Morgantown, WV, United States
Morgantown, WV, United States

West Virginia University is a public land grant research university in Morgantown, West Virginia, United States. Its other campuses include the West Virginia University Institute of Technology in Montgomery and Potomac State College of West Virginia University in Keyser; and a second clinical campus for the University's medical and dental schools at Charleston Area Medical Center in Charleston. WVU Extension Service provides outreach with offices in all of West Virginia's 55 counties. Since 2001, WVU has been governed by the West Virginia University Board of Governors.Enrollment for the fall 2013 semester was 29,466 for the main campus, while enrollment across all campuses totaled 32,348. WVU offers 191 bachelor's, master's, doctoral, and professional degree programs in 15 colleges.WVU has produced 24 Rhodes Scholars, including former WVU president David C. Hardesty, Jr. The University also has produced 36 Goldwater Scholars, 22 Truman Scholars, and 5 members of USA Today '​s "All‑USA College Academic First Team." Wikipedia.


Time filter

Source Type

The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.


Patent
West Virginia University | Date: 2015-07-31

One embodiment includes forming surface-modifying phases on a surface of a functional electrode via atomic layer deposition and controlling the chemistry of constituent phases, the crystalline nature of the constituent phases and the thickness of the surface-modifying phase via the atomic layer deposition such that the thickness is between about 2 nm to about 200 nm. The surface-modifying phases enhances the performance of electrocatalytic activity of the functional electrode and the device.


Patent
West Virginia University | Date: 2016-12-06

An apparatus and method for igniting combustible materials in a combustion chamber of a combustion engine using corona discharge plasma from a quarter wave coaxial cavity resonator. A tapered quarter wave coaxial cavity resonator is adapted to mate with the combustion chamber. The quarter wave coaxial cavity resonator is coupled with an energy shaping means, or waveform generator, that develops the appropriate waveform for triggering radio frequency oscillations in the quarter wave coaxial cavity resonator. A loop coupling is angularly positioned within the quarter wave coaxial cavity resonator to match impedances between the quarter wave coaxial cavity resonator and the energy shaping means, or waveform generator. Radio frequency oscillations produce a standing wave in the quarter wave coaxial cavity resonator and a corona discharge plasma develops near the center conductor. The corona discharge plasma developed near the center conductor ignites the combustible materials in the combustion chamber of the combustion engine.


Provided herein are devices, systems, and methods of CTD mass spectrometry analysis of biomolecules.


Grant
Agency: NSF | Branch: Standard Grant | Program: | Phase: Dimensions of Biodiversity | Award Amount: 542.12K | Year: 2016

Although most flowering plants (angiosperms) have flowers that combine male and female organs, an estimated seven percent of flowering plant species are dioecious, meaning male and female flowers are on separate plants. All poplars and willows are dioecious and these two genera are the most abundant trees and shrubs in many parts of the United States and China. This research aims to understand the genetic basis for the evolution of unisexual flowers in poplars and willows, how defense and volatile chemical compounds differ between male and female individuals, and how different chemical profiles within these plants affects insect biodiversity. Moreover, poplars and willows are also important components of the timber and biofuels industries, so results from this research may lead to new insights into how growth and yield may be improved in the two genera. The collaboration between United States and Chinese researchers will provide extensive cross-disciplinary and cross-cultural training opportunities for over fifteen graduate students and five postdoctoral scholars, and the data generated from the research will be incorporated into teaching materials for courses to be taught in both Chinese and US institutions. Dozens of undergraduates from diverse backgrounds will be trained in plant genomics and functional ecology through direct contributions to data collection and analysis, or through access to the data for research immersion experiences. Finally, researchers will lead K-12 teacher training workshops targeted at under-represented groups in rural Texas to encourage teaching of the foundational theories of biodiversity.

This research will address functional biodiversity with a comprehensive survey of gender dimorphism for defense and volatile chemistry in Populus and Salix, and determine how gender dimorphism influences pollinator attraction, herbivore feeding preferences, and overall arthropod community structure. Genetic aspects of biodiversity will be investigated by population genomic characterization of the allosomes in comparison to autosomes. Researchers will map the chromosomal locations of sex determination regions (SDRs) in a suite of sixteen Salix and Populus species, determine whether these genomic regions contain defense and volatile chemistry loci consistent with their theoretical influence on movement of the SDR, and investigate predicted population genomic patterns of allosome divergence caused by interactions between sexually antagonistic loci with the SDR. The phylogenetic component of this research will place gender dimorphism and allosome evolution in a historical context by developing and integrating robust phylogenies of Populus, Salix, and closely related genera within the Salicaceae in order to understand how many times the SDR has moved during evolution of the family, how the SDR has changed in size and composition, and whether movement of the SDR correlates with barriers to interspecific hybridization.


Grant
Agency: NSF | Branch: Standard Grant | Program: | Phase: COMBUSTION, FIRE, & PLASMA SYS | Award Amount: 500.91K | Year: 2016

1554254 - Akkerman

The issues with flame acceleration from subsonic (deflagration) to supersonic (detonation) are extremely important in terms of combustion applications and fire safety. This phenomenon is the so-called deflagration-to-detonation transition (DDT). From the practical consideration, the DDT influences countless disasters such as explosions in power plants and mining accidents that claim hundreds of lives every year. On the other hand, the DDT can be employed, in the energetically cheapest manner, in advanced technologies such as micro-combustors and pulse-detonation engines of the next-generation hypersonic aircrafts. From the fundamental viewpoint, the DDT is an intriguing phenomenon with applications ranging from combustion and inertial confined fusion to Thermonuclear Supernovae. This project will characterize the mechanisms promoting, controlling or preventing the DDT process. Specifically, a possibility to replace a hazardous detonation in energy-efficient manufacturing with a safer alternative combustion regime will be verified. Additionally, a novel predictive tool for fire safety and DDT risk assessment will be developed. The latter is exceptionally important for West Virginia, the Principal Investigators region where the state economy is significantly based on the coal and shale gas mining industry. The research component of this project will be integrated with an extensive educational module promoting awareness of advanced combustion research in schools and colleges. In particular, the educational module will include an on-campus annual training program organized in a partnership with the NASA-sponsored West Virginia Space Grant Consortium. The educational module will be also translated into the Concept Warehouse - an NSF-sponsored web-based instructional tool.

The research component will include computational endeavors and analytical efforts. It will be devoted to the interplay between several factors influencing the processes of flame acceleration and detonation triggering such as mechanistic and thermal boundary conditions of a burner, combustion instabilities, turbulence, and combustible or inert dust impurities. Specifically, the influence of the local variations of the fuel properties on the global flame propagation scenario will be scrutinized, and the properties of a newly-found, near-sonic quasi-steady deflagration regime will be identified. It will be determined if this regime is controlled by viscous effects, and if it can be an alternative to a detonation. Finally, the evolution of a methane-air-dusty fire in a coal mine will be quantified. It will be identified how the fire evolution depends on the type, size, concentration and distribution of the combustible or inert dust, the fuel parameters and the geometry of a mining passage. This will provide the knowledgebase for the novel preventive fire safety strategies.


Grant
Agency: NSF | Branch: Standard Grant | Program: | Phase: RES EXP FOR TEACHERS(RET)-SITE | Award Amount: 577.82K | Year: 2017

This Research Experiences for Teachers (RET) in Engineering and Computer Science Site, entitled Digital Signal Processing in Radio Astronomy (DSPIRA) at West Virginia University (WVU) Lane Department of Computer Sciences and Electrical Engineering, the WVU Center for Gravitational Waves and Cosmology, and the National Radio Astronomy Observatory, (NRAO) in Green Bank, WV, will expose high school STEM teachers from West Virginia school districts, to hands-on research experiences in the engineering method, via involvement in the research, design, development, and prototyping of digital signal processing (DSP) techniques and applications targeted for the next generation of radio telescopes. Radio Astronomy is undergoing a revolution as major new telescopes come on line. This next generation of telescopes requires exceptionally sophisticated signal processing algorithms running in high throughput, heterogeneous computing environments. Implementation of these algorithms and hardware is pushing the state of the art of current DSP techniques. Advanced DSP algorithms running in commodity devices are a fundamental part of modern life. The signal processing techniques being developed here are also becoming vital across a wide range of areas, including vision-based navigation, remote sensing, robotics, mechatronics, computerized tomography, biomedical engineering, radar and sonar, and signal processing for security. The experiences gained by the teachers will give them, and through them their own students, insight into the design, development, and implementation of such devices. DSPIRA addresses a confluence of three needs: an industry need for greater public understanding of a widely used technology; science and industrys need to have cross-curricular problem solvers; and the K-12 worlds need to integrate engineering principles into their new science standards.

Over a three-year period this RET Site will offer an intensive six week summer research program and academic year follow-up to a total of 30 STEM high school teachers who will join research teams led by engineers at WVU and NRAO who will provide the RET teachers the opportunity to make meaningful contributions, with authentic involvement, in these engineering research areas. With the recent advances in open source Software Defined Radio (SDR) tools, teachers will be able to learn core concepts and explore implementation strategies in an extremely accessible software/hardware environment (a laptop and RTL-SDR device running GNU Radio software) and take these back to their institutions. The research experience will also include RET teachers working with project staff to develop classroom projects that involve an entire classroom of students in DSP activities. in addition to dissemination of the results of RET participants research projects, through poster sessions and national conferences such as NSTA and ASEE, the PIs will share all educational and research material developed over the period of this project both in state and nationally through the Teach Engineering Digital Library.


Grant
Agency: NSF | Branch: Standard Grant | Program: | Phase: S-STEM:SCHLR SCI TECH ENG&MATH | Award Amount: 954.04K | Year: 2016

The focus of this program is to increase the number of students from traditionally underrepresented groups who pursue undergraduate degrees in engineering in the Statler College of Engineering and Mineral Resources at West Virginia University. The program will provide merit scholarships to academically talented, low-income students with a focus on first-generation college students, females, African-Americans and Hispanics. Recipients of the scholarships will participate in a pre-fall bridge program, specialized first-year courses, and a variety of co-curricular activities designed to provide support and increase retention in engineering degrees. The major goals of the program are to increase the annual enrollment of underrepresented students in the engineering programs, to enhance curricular and co-curricular support services for these students, to develop and utilize partnerships with local and regional engineering companies and to assess the impact of these activities on student motivation and success.

Plans for project implementation include facilitating student participation in activities designed to increase retention including enrollment in common courses, participation in live-learn communities, academic advising and tutoring, and multi-tier mentoring from academia and industry with opportunities for internships and undergraduate research. Program activities will be assessed to determine the relationship between program participation and academic success, what elements of the program most significantly impact success, how practical and logistical challenges are overcome, and what the longitudinal impact of the program is on motivation, perceptions, feelings of inclusion, and overall outcome. Data from the project will be used to identify successful program elements that can be disseminated to other institutions to foster persistence and perseverance of under-represented and low socioeconomic status students in engineering programs.


Grant
Agency: NSF | Branch: Standard Grant | Program: | Phase: ENVIRONMENTAL ENGINEERING | Award Amount: 500.00K | Year: 2016

1552353
Weidhaas

This research will improve environmental stewardship efforts and public health protection by developing and optimizing a rapid method for tracking hundreds of waterborne pathogens and developing statistical tools for identifying the source of water impairment. Several basic research questions surrounding the interface of molecular biology, environmental microbiology, and environmental engineering are proposed. Additionally, this research and education program is expected to show that student understanding and retention of microbiology concepts for environmental engineers can be measurably improved using technology-enabled, interactive learning modules.

The objective of this integrated research and education program is to develop and validate quantitative microarrays for simultaneously detecting hundreds of pathogens, fecal indicator bacteria, and microbial source tracking markers in environmental samples. The combination of the comprehensive microarray data with statistical methods for fecal source apportionment will advance the science of water protection. Rapid, multi-target tools for water quality monitoring that can simultaneously indicate fecal contamination sources can enhance our ability to provide high quality water supplies and water for reuse. In developing and testing this tool the transformative research proposed will: 1) refocus water microbiological safety monitoring on pathogens, 2) develop rigorous methods to overcome whole genome amplification bias, 3) develop quantitative microarrays, and, 4) develop statistical methods for fecal contamination source apportionment in water. The proposed quantitative microarray will facilitate rapid and sensitive determination of the presence of infectious agents in a variety of media (e.g., water, treated wastewater, and food). The research agenda proposed herein will: 1) establish upstream environmental sample processing for reproducible and unbiased concentration, extraction and amplification of nucleic acids, 2) develop quantitative microarrays and rigorous quality control methods for detection of nucleic acids from environmental samples, and 3) develop statistical methods for identification of the source of fecal pollution in environmental samples. The educational agenda proposed herein will develop, test, and disseminate technology-enabled, active-learning modules of fundamental microbiology concepts for environmental engineers. The development of tech-enabled, student-active learning modules allows for broad dissemination of these new tools and the concepts behind them to practicing engineers, educators, and students at multiple levels. The principal investigator has a plan to assess the effectiveness of the teaching modules and pipelines in place, especially for underrepresented groups. With the NSF-REU in place and departmental funds available, the feasibility of the educational components is high.


Grant
Agency: NSF | Branch: Standard Grant | Program: | Phase: LINGUISTICS | Award Amount: 275.55K | Year: 2017

The projects research questions focus on how traditional dialects have changed and how Appalachian teens alter them to build their own identities in the 21st century. Since World War II, rural America has changed dramatically, and sociolinguistic patterns in these communities have morphed over the last three generations. With these changes, English in Appalachia will be markedly different by the middle of the 21st century, and these transitions are socially and linguistically complex. This sociolinguistic confluence of change provides an excellent opportunity to examine why Appalachian teens propagate certain dialect features at the expense of others. This proposal provides worthwhile community benefits because it integrates research and education by advancing discovery and understanding of what language patterns hamper students from obtaining their fullest educational potential. The outcomes from the project will provide teachers across Appalachia with the content and pedagogical knowledge needed for addressing linguistic diversity in a culturally sustainable manner. The long-term objective is to boost students comfort in the classroom by reducing stereotype threat and fostering positive learning environments for students.

The proposed study brings together the previous examination of 14 variables and divergent West Virginia vowel systems to document emerging trends in language variation. The researchers will conduct interviews with Appalachian students to compare dialect patterns. The interviews will be in four schools in West Virginia: two northern, secondary schools (rural and nonrural) and two southern, secondary schools (rural and nonrural). The most socially marked variables from the previous studies provide lexical, morphological, and phonological variation for quantitative investigation. To probe deeper into teens local understanding of sociolinguistic patterns, we will also conduct classroom observations and focus group discussions. The project design is well-suited to explore how teens use linguistic patterns to create social meanings that drive transmission and diffusion of Appalachian language variation patterns.

Loading West Virginia University collaborators
Loading West Virginia University collaborators