Morgantown, WV, United States

West Virginia University
Morgantown, WV, United States

West Virginia University is a public land grant research university in Morgantown, West Virginia, United States. Its other campuses include the West Virginia University Institute of Technology in Montgomery and Potomac State College of West Virginia University in Keyser; and a second clinical campus for the University's medical and dental schools at Charleston Area Medical Center in Charleston. WVU Extension Service provides outreach with offices in all of West Virginia's 55 counties. Since 2001, WVU has been governed by the West Virginia University Board of Governors.Enrollment for the fall 2013 semester was 29,466 for the main campus, while enrollment across all campuses totaled 32,348. WVU offers 191 bachelor's, master's, doctoral, and professional degree programs in 15 colleges.WVU has produced 24 Rhodes Scholars, including former WVU president David C. Hardesty, Jr. The University also has produced 36 Goldwater Scholars, 22 Truman Scholars, and 5 members of USA Today '​s "All‑USA College Academic First Team." Wikipedia.

Time filter
Source Type

West Virginia University | Date: 2016-03-01

Various methods and apparatuses are provided for calibrating a three-axis IMU sensor package using a single-axis rate table. In one embodiment, a method includes adjusting an x-axis position of a sensor by rotating an inner assembly along the circumference of the inner surface of the circular frame, adjusting a y-axis position of the sensor by rotating a portion of the inner assembly, spinning the single-axis rate table to generate z-axis rotation of the apparatus which results in simultaneous stimulation of all three axes of the sensor assembly, and obtaining measurements from the sensor corresponding to the x-axis position, the y-axis position, and the z-axis rotation of the apparatus.

A method for producing elemental carbon and hydrogen gas directly from a hydrocarbon (for example, natural gas or methane) using a chemical reaction or series of reactions. In an aspect, other materials involved such as, for example, elemental magnesium, remain unchanged and function as a catalyst.

West Virginia University | Date: 2016-12-06

An apparatus and method for igniting combustible materials in a combustion chamber of a combustion engine using corona discharge plasma from a quarter wave coaxial cavity resonator. A tapered quarter wave coaxial cavity resonator is adapted to mate with the combustion chamber. The quarter wave coaxial cavity resonator is coupled with an energy shaping means, or waveform generator, that develops the appropriate waveform for triggering radio frequency oscillations in the quarter wave coaxial cavity resonator. A loop coupling is angularly positioned within the quarter wave coaxial cavity resonator to match impedances between the quarter wave coaxial cavity resonator and the energy shaping means, or waveform generator. Radio frequency oscillations produce a standing wave in the quarter wave coaxial cavity resonator and a corona discharge plasma develops near the center conductor. The corona discharge plasma developed near the center conductor ignites the combustible materials in the combustion chamber of the combustion engine.

The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.

Provided herein are devices, systems, and methods of CTD mass spectrometry analysis of biomolecules.

West Virginia University | Date: 2017-03-09

A quarter wave coaxial cavity resonator for producing corona discharge plasma from is presented. The quarter wave coaxial cavity resonator has a folded cavity made of opposing concentric cavity members that are nested together to form a continuous cavity ending in a aperture. A center conductor with a tip is positioned in the cavity. The folded cavity advantageously permits the coaxial cavity resonator to resonate at a lower operating frequency than an unfolded quarter wave coaxial cavity resonator of the same length. Embodiments of the quarter wave coaxial cavity resonator use narrower apertures to reduce radiative losses, and include center conductors that are reactive load elements, such as helical coils. When a radio frequency (RF) oscillation is produced in the quarter wave coaxial cavity resonator, corona discharge plasma is formed at the tip of the center conductor. The corona discharge plasma can be used to ignite combustible materials in combustion chambers of combustion engines.

West Virginia University | Date: 2017-03-09

A quarter wave coaxial cavity resonator for producing corona discharge plasma from is presented. The quarter wave coaxial cavity resonator has a folded cavity made of opposing concentric cavity members that are nested together to form a continuous cavity ending in a aperture. A center conductor with a tip is positioned in the cavity. The folded cavity advantageously permits the coaxial cavity resonator to resonate at a lower operating frequency than an unfolded quarter wave coaxial cavity resonator of the same length. Embodiments of the quarter wave coaxial cavity resonator use narrower apertures to reduce radiative losses, and include center conductors that are reactive load elements, such as helical coils. When a radio frequency (RF) oscillation is produced in the quarter wave coaxial cavity resonator, corona discharge plasma is formed at the tip of the center conductor. The corona discharge plasma can be used to ignite combustible materials in combustion chambers of combustion engines.

West Virginia University | Date: 2015-07-31

One embodiment includes forming surface-modifying phases on a surface of a functional electrode via atomic layer deposition and controlling the chemistry of constituent phases, the crystalline nature of the constituent phases and the thickness of the surface-modifying phase via the atomic layer deposition such that the thickness is between about 2 nm to about 200 nm. The surface-modifying phases enhances the performance of electrocatalytic activity of the functional electrode and the device.

This invention provides a compound that is 4,4-(4-Carboxy)-4-nonyloxy-[1,1-biphenyl]-3,5-diyl)dibutanoic acid (CNBDA), derivative compounds of CNBDA, and pharmaceutical compositions thereof. The derivative compounds of CNBDA have one or more of the following substitutions (a) replacement of one or both of the carboxylic acid groups of the CNBDA compound with an organic acid group having 1-3, or 5-30, or more carbon atoms in chain length, wherein the carbon atom chains are either saturated, partially saturated, or unsaturated with respect to the carbon to carbon bonding, (b) replacement of the carboxylic groups of (a) with a phosphate, a sulphate, an amide, a hydroxyl, an aldehyde, or a halide group, and (c) replacement of the nonane group with an alkane having a carbon chain length of 1-8 or 10-30, or more carbon atoms. A method of treating a patient having cancer is provided.

West Virginia University | Date: 2017-04-19

The present invention provides a method of producing lysergic acid and other ergot alkaloids by genetic modification of a fungus. A strain of fungus comprising Aspergillus fumigatus (A. fumigatus) and expressing one or more genes of the ergot alkaloid biosynthesis pathway from one or more fungus selected from the group consisting of Epichlo festucae var. lolii x Epichlo typhina isolate Lpl (E. sp. Lpl); Claviceps species; Claviceps africana (C. africana); Claviceps gigantea (C. gigantea); Epichlo coenophiala and Periglandula species, wherein gene easA or gene easM is inactivated in said A. fumigatus, is provided.

Loading West Virginia University collaborators
Loading West Virginia University collaborators