UTP
Perak, Malaysia
UTP
Perak, Malaysia

Time filter

Source Type

News Article | January 27, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. Bovine Pol II was prepared as described11 with modifications. Unless otherwise noted, all steps were completed at 4 °C. Protease inhibitors included 1 mM PMSF, 1 mM benzamidine, 60 μM leupeptin, and 200 μM pepstatin. Calf thymus was homogenized for 3 min in buffer A (50 mM Tris, pH 7.9 at 4 °C, 1 mM EDTA, 10 μM ZnCl , 10% glycerol, 1 mM DTT, protease inhibitors) using a 2 l blender (Waring). The homogenized material was centrifuged and the supernatant filtered through two layers of Miracloth. A 5% solution of polyethyleneimine, pH 7.9 at 25 °C, was added to a final concentration of 0.02%, and the material was stirred for 10 min then centrifuged. The resulting pellets were washed with buffer A before resuspension in buffer A (0.15 M ammonium sulfate). After centrifugation, the conductivity of the supernatant was adjusted to that of buffer A (0.2 M ammonium sulfate), and the resulting material was loaded on a 225-ml MacroPrepQ column equilibrated in buffer A (0.2 M ammonium sulfate). The column was washed with two column volumes of buffer A (0.2 M ammonium sulfate), followed by Pol II elution with buffer A (0.4 M ammonium sulfate). The eluate was precipitated by addition of finely ground ammonium sulfate added to 50% saturation, and pellets were collected by centrifugation. The pellets were resuspended in buffer A, and the conductivity was adjusted to that of buffer A (0.15 M ammonium sulfate). The material was clarified by centrifugation, and further purified using a 5-ml gravity flow column of 8WG16 (αRPB1 CTD) antibody-coupled sepharose equilibrated in buffer A (0.15 M ammonium sulfate). After application of the input material, the antibody column was washed with five column volumes of buffer A (0.5 M ammonium sulfate), sealed, and allowed to equilibrate to room temperature (20–25 °C) for 15 min. Pol II was eluted using buffer A (0.5 M ammonium sulfate, 50% (v/v) glycerol), and Pol-II-containing fractions were immediately mixed with buffer A (2 mM DTT, lacking glycerol and protease inhibitors). The diluted material was centrifuged and subjected to anion exchange chromatography using a UNO-Q column equilibrated in buffer A (0.1 M ammonium sulfate, 2 mM DTT, lacking protease inhibitors). Pol II was eluted using a linear gradient from 0.1 M to 0.5 M ammonium sulfate in buffer A (2 mM DTT, lacking protease inhibitors). For the purification of 12-subunit bovine Pol II, the Gdown1-free Pol II fraction was applied to a Sephacryl S-300 HiLoad sizing column equilibrated in buffer B (150 mM NaCl, 5 mM HEPES pH 7.25 at 25 °C, 10 μM ZnCl , 10 mM DTT). For the purification of bovine Pol II containing Gdown1, the Gdown1-free Pol II fraction was incubated with a 3× molar excess of human Gdown1 for 1 h at 4 °C before application to the Sephacryl S-300 HiLoad sizing column. Pol-II-containing fractions were concentrated using a 100-kDa cutoff Amicon concentrator to a final concentration of 2–4 mg ml−1. Gene-optimized human Gdown1 (Life Technologies) was cloned into pOPINB (N-terminal His tag and 3C protease site). After transformation, Escherichia coli BL21(DE3)RIL cells were grown at 37 °C in Lysogeny broth (LB) medium to an absorbance at 600 nm, A , of 0.5 before protein expression with 0.5 mM IPTG for 3–4 h at 37 °C. Subsequent steps were completed at 4 °C unless otherwise noted. Cells were lysed by sonication in buffer C (50 mM HEPES pH 7.5 (25 °C), 300 mM NaCl, 1 mM CaCl , 10% glycerol) supplemented with 10 mM imidazole, 1 mM PMSF, 1 mM benzamidine, 1 mM sodium metabisulfite, 1 mM DTT, and 2 μg ml−1 DNase I. Cleared lysate was subjected to affinity chromatography using Ni-NTA agarose (Qiagen), and excess chaperone was removed by washing the resin with a 5 mM ATP and 2 mg ml−1 denatured E. coli protein wash at room temperature in buffer C supplemented as above containing 30 mM imizdazole. Protein was eluted with buffer C supplemented as above, but lacking DNase I and containing 250 mM imidazole. Elutions were exchanged into buffer C supplemented with 10 mM imidazole and 1 mM DTT via a PD10 desalting column, followed by 3C protease cleavage at 4 °C overnight. Cleaved Gdown1 was subjected to reverse chromatography (Ni-NTA agarose) followed by dilution with buffer D (50 mM HEPES pH 7.5 (25 °C), 1 mM CaCl , 10% glycerol, 2 mM DTT) to a conductivity of buffer D containing 0.05 M NaCl. Diluted protein was subjected to cation exchange chromatography (MonoS 5/50) to remove additional chaperone, and eluted with a linear gradient from 0.05 M to 0.5 M NaCl in buffer D. The conductivity of the Gdown1-containing fractions was again adjusted to that of buffer D containing 0.05 M NaCl, and applied to a MonoQ 5/50 anion exchange column. Gdown1 was eluted using a linear gradient from 0.05 M to 0.5 M NaCl in buffer D. Fractions containing purified Gdown1 were pooled, resulting in a final concentration of 1–1.5 mg ml−1. Yield was approximately 2.5 mg per 2 l of E. coli culture. Purification of human SPT4 and SPT5 was as described31, with adaptations. Gene-optimized human SPT5 (pMK vector, no tag) and SPT4 were purchased from Life Technologies, and SPT4 was recloned into pOPINJ (N-terminal HIS6 and GST tags followed by a 3C protease cleavage site). SPT4 and SPT5 vectors were co-transformed into E. coli BL21(DE3)RIL cells, which were then grown at 37 °C in LB medium supplemented with 10 μM ZnCl to A  = 0.6. Expression was induced with 1 mM IPTG for 18 h at 18 °C. Cells were lysed by sonication in buffer E (25 mM Tris pH 7.4 (4 °C), 500 mM NaCl, 10 μM ZnCl , 5 mM DTT) supplemented with 5 mM imidazole and protease inhibitors (1 mM PMSF, 1 mM benzamidine, 60 μM leupeptin, and 200 μM pepstatin). Soluble material was passed over a Ni-NTA agarose column and washed with ten column volumes each of buffer E supplemented with 20 mM or 40 mM imidazole before elution in buffer E supplemented with 300 mM imidazole. Eluted protein was cleaved with 3C protease during overnight dialysis (4 °C) against buffer E, then subjected to reverse chromatography. Protein was passed over a HiTrap Q HP anion exchange column to remove DNA, and the flow-through fraction containing SPT4/5 was concentrated using a 50-kDa cutoff Amicon concentrator to 1–4 mg ml−1. The nucleic-acid scaffold (Metabion) was only slightly modified from what was used for a yeast Pol II EC crystal structure20 by mutation of the DNA templating base from C to A to generate a fully mismatched open bubble and by removing the upstream and downstream CC overhangs. A 1.5× molar excess of pre-annealed template DNA (sequence 5′-AAGCTCAAGTACTTAAGCCTGGTCATTACTAGTACTGCC-3′), non-template DNA (sequence 5′-GGCAGTACTAGTAAACTAGTATTGAAAGTACTTGAGCTT-3′), and RNA (sequence 5′-UAUAUGCAUAAAGACCAGGC-3′) were incubated with Pol II–Gdown1 at 4 °C for 10 min, then 20 °C for 15 min. To increase the randomness of Pol II EC particle orientations, the resulting complex (0.85 μM) was crosslinked with 3 mM BS3 (Thermo) for 30 min at 30 °C, then quenched with 50 mM ammonium bicarbonate. Crosslinked complex was applied to a Superdex 200 increase 10/300 GL column equilibrated in buffer B (150 mM NaCl, 5 mM HEPES pH 7.25 at 25 °C, 10 μM ZnCl , 10 mM DTT). The nucleic-acid-containing peak was concentrated to ~0.3 mg ml−1 as described above and used immediately for cryo-EM grid preparation. Four microlitres of sample were applied to glow-discharged Quantifoil R 3.5/1 holey carbon grids, which were then blotted and plunge-frozen in liquid ethane using a Vitrobot (FEI). Data were acquired using an FEI Titan Krios operated in energy-filtered transmission electron microscopy (EFTEM) mode at 300 kV equipped with a Gatan K2 Summit direct detector. Automated data collection was performed using the TOM toolbox32. Movie images were collected at a nominal magnification of ×37,000 (1.35 Å per pixel) in ‘super-resolution mode’ (0.675 Å per pixel) at a dose rate of about nine electrons per pixel per second. Two movies were acquired per hole, and each movie encompassed a total dose of ~43 electrons per square ångström over 8 s fractionated into 40 frames (0.2 s each). Defocus values ranged from −0.6 μm to −3.1 μm. Movies were aligned and binned as previously described15, 33, except that images were not partitioned into quadrants. Unless otherwise noted, processing was performed using RELION 1.3 (ref. 34). Contrast transfer function (CTF) parameters were estimated using CTFFIND4 (ref. 35). Initial 2D classes were generated after semi-automated picking of ~10,000 particles (box size 204) using e2boxer.py (EMAN2)36. Sixteen distinct classes were low-pass filtered to 25 Å resolution and used as templates for autopicking37, resulting in 476,100 particles selected from 1,172 micrographs. The autopicked particles were subjected to manual screening followed by screening by 2D classification, yielding an input data set of 409,401 particles. A previously published 22-Å-resolution cryo-negative stain reconstruction of human Pol II (EMD-1282)4 filtered to 50 Å was used as an initial reference for 3D refinement. Before any 3D classification, data were subjected to the particle polishing movie-processing algorithm of RELION 1.3 (ref. 38), resulting in an improvement in resolution from 3.7 Å to 3.4 Å. Three-dimensional classification was performed without image alignment as outlined in Extended Data Fig. 2. Masks were chosen to include either the entire Pol II EC or a smaller region of interest. The full data set was used as input for the classification of heterogeneity in the region of upstream DNA density. Only classes displaying strong clamp density were used as input for classification of conformations of the RPB4–RPB7 stalk. After classification, data were again subjected to 3D refinement with a 50 Å filtered reference volume. B-factors were automatically estimated in RELION39 and resolutions were reported on the basis of the gold-standard Fourier shell correlation (FSC) (0.143 criterion)40 as described41. The Pol II EC1 reconstruction was calculated from 264,134 particles to 3.4 Å resolution and sharpened with a B-factor of −137 Å2. The Pol II EC2 (improved RPB4–RPB7 stalk density) reconstruction was calculated from 219,265 particles to 3.6 Å and sharpened with a B-factor of −128 Å2. The Pol II EC3 (improved upstream DNA density) reconstruction was calculated from 184,122 particles to 3.7 Å and sharpened with a B-factor of −123 Å2. Focused refinements were achieved by continuing a refinement of the full data set from the iteration at which local searches began, but replacing the mask encompassing the entire Pol II EC density with a soft mask around the region of interest and allowing the refinement to continue to convergence. Local resolution was calculated using a sliding window method as described15, 42, except that a single pair of half maps was used per estimation and local resolution was not capped at the nominal value. Figures were generated using UCSF Chimera43. Alignments for each Pol II subunit were generated using the Homo sapiens, Bos taurus, Drosophila melanogaster, Schizosaccharomyces pombe, and S. cerevisiae sequences followed by alignment using Clustal Omega44. The Pol II crystal structure PDB 4BBS45 was chosen as a reference, as it displayed good stereochemistry and included the most complete model of the RPB2 protrusion domain. A starting model of ten-subunit Pol II was generated using the CCP4 (ref. 46) program chainsaw47 along with the alignment of the B. taurus and S. cerevisiae sequences. Conserved amino acids were retained, and non-conserved amino acids were pruned back to the gamma atom. The starting model was placed in the Pol II EC density by fitting in UCSF Chimera43, followed by fitting of rigid body groups in COOT48. Groups for rigid body refinement were chosen on the basis of observations from Pol II X-ray studies and visual inspection of the initial fit to the density. In regions of sufficient density quality, the model was manually adjusted to include complete side chains, and missing or divergent regions were built in COOT using B-factor sharpened maps. Multiple maps were used during model building, including the densities for the refinement using all data, Pol II EC1, Pol II EC2, Pol II EC3, and focused refinements. To generate a complete EC model, one molecule (chains A and B) of the crystal structure of human RPB4–RPB7 (PDB 2C35)49 was docked into the Pol II EC2 map. Regions near the ten-subunit core were adjusted manually to fit the density. Amino-acid side chains (previously stubbed) were added to the model if side chain density was visible. Ideal B-form DNA was manually fitted into the Pol II EC3 upstream DNA density. To improve backbone geometry, the EC model was subjected to PHENIX real space refinement (global minimization and ADP refinement) into one of the three unsharpened EC maps using Ramachandran, rotamer, and nucleic-acid restraints50. EC3 was used for refinement of the upstream DNA (chain N residues 1–13 and chain T residues 27–39). Because of the lower local resolution of the distal end of the upstream DNA, residues 1–10 of the non-template strand and residues 29–39 of the template strand were replaced with ideal B-form DNA that had been aligned to the refined upstream nucleic acids. EC2 was used for refinement of RPB4 and RPB7, and EC1 was used for the remaining model (EC body). The EC body was additionally refined as described above using the sharpened EC1 map to better position well-resolved side chains and nucleic acids within the density50. The final model was validated using Molprobity51, EMRinger52, and the FSC of the final model versus the EC1 map (Extended Data Fig. 3b). For model versus map FSC calculations, the EC1 map was masked using the RELION-generated soft automask used in postprocessing. Nucleic-acid scaffold used to assemble Pol II EC complexes was modified to include a 50 nucleotide RNA (sequence 5′-GAACGAGAUCAUAACAUUUGAACAAGAAUAUAUAUACAUAAAGACCAGGC-3′), as previous data have shown that DSIF affinity for ECs is increased as RNA length increases53. RNA was produced and purified as previously described54. A twofold molar excess of pre-annealed RNA and template DNA was incubated with Pol II for 20 min at 25 °C, followed by incubation with fourfold excess of non-template DNA for an additional 20 min at 25 °C. A fivefold molar excess of DSIF was incubated with the resulting Pol II EC for 20 min at 25 °C. Pol II–DSIF EC sample was applied to two consecutive Superdex 200 10/300 size-exclusion columns equilibrated in buffer B (150 mM NaCl, 5 mM HEPES pH 7.25 at 25 °C, 10 μM ZnCl , 10 mM DTT). Purified Pol II–DSIF EC was concentrated to ~0.5 mg ml−1 (~0.74 μM) and crosslinked with 3 mM BS3 (BS3-d0/d12, Creative Molecules) as described above. Crosslinked sample was again applied to two Superdex 200 10/300 columns, resulting in ~ 25 μg material. Sample was digested with trypsin, and analysed as previously described15, 55. Pol II–DSIF EC complexes were prepared as described above. Sample (~30 μg ml−1) was applied to glow-discharged 400 mesh copper grids coated with continuous carbon (Plano EM) for 1 min, washed on 500 μl water for 30 s, floated for 20 s on three consecutive 20-μl drops of 2% uranyl formate stain, and blotted to remove excess stain. Data were collected using an FEI Tecnai Spirit operated at 120 kV and a magnification of ×90,600. Micrographs were collected using a defocus range from −1.0 to −1.5 μm with an FEI Eagle CCD (charge-coupled device) camera binned 2× (image dimensions 2,048 pixels × 2,048 pixels) at a pixel size of 3.31 Å. Semi-automatic picking using e2boxer.py (EMAN2) yielded 11,531 particles from 120 micrographs. Data were subjected to 3D classification in RELION (eight classes, no CTF correction) using the cryo-negative stain reconstruction of human Pol II (EMD-1282)4 low-pass filtered to 60 Å as an initial reference. The two highest populated classes (comprising 85% of the data) were further classified into two classes each, for a total of four classes in which Pol II features beyond 60 Å were recognizable. Two classes did not have discernible additional density compared with Pol II (42% of data). A third class (28% of the data) displayed additional density near the RPB4–RPB7 stalk. A final class (15% of the data) showed additional density over the Pol II DNA binding cleft, as well as additional density near the RPB4–RPB7 stalk. Refinement of this subset of data (1,630 particles) resulted in a 3D reconstruction at 26 Å resolution, revealing extra density consistent with results from crosslinking coupled to mass spectrometry, previous DSIF–RNA crosslinking56, and the published interaction between SPT5 and the Pol II clamp coiled-coil motif26. Activity assays were performed as described57, with modifications. For reactions using fully complementary template and non-template DNA sequences, Pol II ECs were assembled stepwise beginning with either 12-subunit bovine Pol II or 12-subunit bovine Pol II in complex with human Gdown1, as indicated. Per reaction, Pol II was pre-assembled for 20 min at 28 °C with a 0.5 molar ratio of 5′ 6-FAM-labelled 20-nucleotide RNA annealed to template DNA, followed by incubation with a 1.0 molar ratio of fully complementary non-template DNA. The RNA and DNA sequences were the same as for the Pol II EC, except for an additional 46 nucleotides of downstream DNA. The template DNA sequence was 5′-ACAAATTACTGGGAAGTCGACTATGCAATACAGGCATCATTTGATCAAGCTCAAGTACTTAAGCCTGGTCATTACTAGTACTGCC-3′; the non-template DNA sequence was 5′-GGCAGTACTAGTAATGACCAGGCTTAAGTACTTGAGCTTGATCAAATGATGCCTGTATTGCATAGTCGACTTCCCAGTAATTTGT-3′, and RNA sequence was 5′-UAUAUGCAUAAAGACCAGGC-3′. Transcription was allowed to proceed for 10 min at 30 °C in the presence of 1–100 μM nucleoside triphosphates (NTPs) as indicated, and 0.2 pmol product per reaction was visualized on a 15% denaturing urea polyacrylamide gel. Transcription assays were also performed on the bubble scaffold used for structural studies. Pol II–EC complexes were prepared as described for cryo-EM, except that the samples were not crosslinked and the 20-nucleotide RNA used for assembly was 5′-labelled with 6-FAM. Assembled complex was incubated with 10–1,000 μM UTP at 30 °C for 10 min, allowing the extension of the RNA by two additional nucleotides. Product was visualized on a 20% denaturing urea polyacrylamide gel and imaged using a Typhoon FLA 9500.


News Article | November 2, 2016
Site: globenewswire.com

Geneva, Switzerland, Nov. 02, 2016 (GLOBE NEWSWIRE) -- HDBaseT Automotive technology enables simultaneous transmissions of up to 6Gbps of high-definition video & audio, USB, data, and power over a single twisted-pair cable Hod Hasharon, Israel; Geneva, Switzerland - November 2, 2016 - Valens and STMicroelectronics announced today their collaboration to bring HDBaseT Automotive into the next-generation of connected cars. The highly efficient technology optimizes in-vehicle connectivity by enabling the transmission of reliable 6Gbps high-throughput infotainment, road safety, and automotive-control content over a low-cost infrastructure with near-zero latency. Valens, as the inventor of HDBaseT and founder of the HDBaseT Alliance, brings the technology and expertise to accomplish the goal of commercializing HDBaseT-enabled vehicles. STMicroelectronics will contribute its extensive design and manufacturing experience and know-how in compliance with the strict automotive quality and reliability requirements. "As Valens meets significant milestones in our vision to optimize in-vehicle connectivity, we are excited to welcome ST as our major partner in pursuing this goal. ST will help us accelerate the introduction of HDBaseT Automotive to the market," said Dror Jerushalmi, CEO, Valens. "With long leadership in serving the Automotive industry and Smart Driving as one of our key focus areas, we can see the potential of HDBaseT Automotive as a high-throughput, low-latency, low-cost technology. That's why we are excited to be part of this project to help Valens bring the HDBaseT Automotive technology and devices to the market, with the highest levels of quality and reliability expected," said Fabio Marchio, Vice President and General Manager, Automotive Digital Division, STMicroelectronics. Learn more about HDBaseT Automotive at the Electronica 2016 show in Munich, on November 8th-11th, at the HDBaseT Alliance booth (Hall A6, Booth 264). To schedule an appointment, contact us at info-auto@valens.com. HDBaseT Automotive is the only technology today that enables the tunneling of up to 6Gbps of video, audio, data, USB and more, with native networking capabilities over a single unshielded twisted-pair (UTP) cable for up to 15m (50ft).  HDBaseT Automotive also allows for daisy-chaining and multistreaming, to simplify and optimize in-vehicle connectivity. For more information about Valens' HDBaseT Automotive solution, click here. About Valens  Established in 2006, Valens provides semiconductor products for the distribution of uncompressed ultra-high-definition (HD) multimedia content. The company's HDBaseT technology enables long-reach connectivity of devices over a single cable and is a global standard for advanced digital media distribution. Valens is a private company headquartered in Israel. For more information, visit www.valens.com. About STMicroelectronics ST is a global semiconductor leader delivering intelligent and energy-efficient products and solutions that power the electronics at the heart of everyday life. ST's products are found everywhere today, and together with our customers, we are enabling smarter driving and smarter factories, cities and homes, along with the next generation of mobile and Internet of Things devices. By getting more from technology to get more from life, ST stands for life.augmented. In 2015, the Company's net revenues were $6.9 billion, serving more than 100,000 customers worldwide. Further information can be found at www.st.com. A photo accompanying this announcement is available at http://www.globenewswire.com/NewsRoom/AttachmentNg/67933ea3-2204-491d-b1cc-5d113757aa51


No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. All yeast strains used in this study are listed in Extended Data Table 1, oligonucleotides in Extended Data Table 2 and plasmids in Extended Data Table 3. Plasmids and yeast strains were generated by conventional methods. The experiments were essentially performed as published previously7. All yeast strains were grown to log phase (2–3 × 107 cells/ml). For the experiment shown in Fig. 1b, the cells were split into three portions: one served as an unstressed control and the cells of the two other portions were either incubated for 15 min at 42 °C to apply heat stress or treated with 1 M NaCl for 1 h at 25 °C for salt stress. Cells for the precipitation shown in Fig. 2d were not shifted. For co-IP analyses shown in Fig. 3b, c, cells were split into two portions: one served as an unstressed control (25 °C) and the other was incubated for 15 min at 42 °C. Afterwards, the cells were collected immediately and lysed in immunoprecipitation buffer (1× PBS, 3 mM KCl, 2.5 mM MgCl , 0.5% Triton X-100, 200 μg/ml RNase A, vanadyl phosphatase inhibitors and protease inhibitors from Roche). The supernatant was incubated for 3–4 h at 4 °C (Figs 1b, 2d) or for 20 min, at either 25 °C (for the unstressed cell lysate) or 37 °C (for the heat-stressed lysate) (Fig. 3b, c) with protein G sepharose beads (Amersham Biosciences) bound to Myc (9E10)-antibody (Santa Cruz), HA-antibody (Santa Cruz) or Mex67 antiserum (own) or with GFP-Trap_A beads (Chromotek). The matrix was washed six times with immunoprecipitation buffer and proteins were detected by western blot analyses with the indicated antibodies (GFP (Pierce) 1:5,000; Myc (9E10) (Santa Cruz) 1:1,000; Tdh1 (Pierce) 1:5,000; Hem15 (R. Lill) 1:7,000; Mex67 (C. Dargemont) 1:2,000; Mex67 (rabbit, serum) 1:50,000; HA (Santa Cruz) 1:1,000), Rps3 (rabbit, own serum) 1:750). Signals were detected with the Fusion SL system (PeqLab). Intensities were quantified using the Bio1D software. The experiments were essentially carried out as described previously17. All yeast strains were grown to mid-log phase (2–3 × 107 cells/ml). For the experiment shown in Fig. 1a and Extended Data Fig. 1c, cells were split into three portions: one cell portion served as an unstressed control, one portion was incubated for 15 min (7 min for Gbp2) at 42 °C to apply heat stress and the final portion was treated with 1 M NaCl for 1 h at 25 °C for salt stress. Afterwards the cells were immediately collected and lysed in RIP buffer (25 mM Tris HCl pH 7.5, 100 mM KCl, 0.2% (v/v) Triton X-100, 0.2 mM PMSF, 5 mM DTT, 10 U RiboLock RNase Inhibitor (Thermo Scientific) and protease inhibitor (Roche)). The supernatant was incubated for 3–4 h at 4 °C with protein G sepharose beads (Amersham Biosciences) bound to Myc (9E10)-antibody (Santa Cruz) or with GFP-Trap_A beads (Chromotek). The matrix was washed six times with RIP buffer and split into two portions after the last washing step. Proteins were detected by western blot. RNA was extracted using phenol/chloroform and further purified using an RNA purification kit (Macherey & Nagel). All of the purified RNA was used for subsequent dot-blot experiments. For Fig. 1c and Extended Data Figs 2, 3 (microarray and RNA-seq) yeast cells were grown at 25 °C in yeast extract peptone dextrose (YPD) medium to log phase. The cells were collected and resuspended in 50 ml YPD medium and incubated at either 25 °C or 42 °C in a Petri dish for 30 min. Subsequently, cells were irradiated with UV (254 nm, 120,000 MJ/cm2) to induce cross-linking. After centrifugation, cell pellets were washed in 1 ml RIP buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.2% (v/v) Triton X-100, 2 mM DTT, 10 U RiboLock RNase Inhibitor (Thermo Scientific)). One volume of the pellet was mixed with 1.5 volumes of RIP buffer, containing EDTA-free protease inhibitor cocktail (Roche) and 1 volume of glass beads. Cells were lysed by vigorous mixing for 30 s at 4 m/s using the FastPrep-24 machine (MP Biomedicals). Co-IP experiments were performed at 4 °C for 4 h by incubating the lysates with protein G sepharose beads bound to monoclonal Myc (9E10) or GFP-Trap_A beads. Afterwards beads were washed five times with RIP buffer and treated with 20 μg proteinase K at 55 °C for 20 min to remove RNA-bound proteins. Subsequently, eluates were purified via trizol–chloroform (Ambion RNA, Life Technologies) extraction. Contaminating DNA was removed with the TURBO DNA-free kit (Ambion RNA by Life technologies). The purified RNA was reverse transcribed with Maxima reverse transcriptase (Thermo Scientific) for subsequent qRT–PCR analyses. For dot blot experiments (Fig. 1a and Extended Data Fig. 1a, c) RNA was spotted onto a Hybond N+ nylon membrane (GE Healthcare) and UV cross-linked (254 nm, 120,000 μJ/cm2). The membrane was incubated at 80 °C for 2 h, pre-hybridized for 1 h in hybridization buffer (0.5 M sodium phosphate buffer, pH 7.5, 7% SDS, 1 mM EDTA) and hybridized overnight at 42 °C in hybridization buffer with a digoxygenin (DIG)-labelled oligo d(T) probe. The membrane was washed once with 2× SSC buffer, 0.1% (w/v) SDS; once with 1× SSC buffer, 0.1% (w/v) SDS for 15 min at room temperature; and twice with 0.5× SSC buffer, 0.1% (w/v) SDS for 15 min at 42 °C. For detection of the signal, the manufacturer’s instructions (Roche) were followed. Signal intensities were quantified using the Fusion camera (Peqlab) and Fiji software, and compared to the signal of the unstressed samples, always in relation to the precipitated protein. The experiments were essentially carried out as described previously17. RNA probes were synthesized by in vitro transcription, using the T7 RNA polymerase (Thermo Scientific) and labelled with DIG–UTP using an RNA labelling mix (Roche) or with Cy3-labelled oligonucleotides (Sigma), which are listed in Extended Data Table 2. To detect poly(A)+ RNA a Cy3- or Atto488-labelled oligo d(T) probe (Sigma) was used. Cells were grown to log phase before being subjected to heat stress at 42 °C for 30 min or 1 h. For leakage analyses, cells were shifted to 30 °C (Fig. 4a and Extended Data Fig. 5a, f, h) or to 37 °C (Extended Data Fig. 5c, j) for 3 h. For visualization of mRNAs under control of the GPM1 promoter, cells were grown in 1% glucose (in the respective medium). Glucose concentration was adjusted to 4% at 15 min before heat stress. Samples were fixed by adding formaldehyde, giving a final concentration of 4%. Cells were spheroplasted by adding zymoylase, permeabilized in 0.1 M potassium phosphate buffer pH 6.5 with 1.2 M sorbitol and 0.5% Triton X-100, pre-hybridized with Hybmix (50% deionized formamide, 5× SSC buffer, 1× Denhardts, 500 μg/ml tRNA, 500 μg/ml salmon sperm DNA, 50 μg/ml heparin, 2.5 mM EDTA pH 8.0, 0.1% Tween 20, 10% dextran sulfate) for 1 h on a polylysine coated slide at 37 °C and hybridized in Hybmix with the specific probe overnight at 37 °C. After hybridization, cells were washed with 2× SSC buffer and 1× SSC buffer at room temperature, each for 1 h and with 0.5× SSC buffer at 37 °C and room temperature, each for 30 min. For detection of DIG probes, the cells were treated with blocking buffer containing 5% heat-inactivated FBS for 1 h and incubated with sheep anti-digoxigenin Fab-FITC antibody (Roche) overnight at 4 °C or at room temperature for 4 h. DNA was stained with Hoechst 33342 (Sigma). Microscopy studies were performed with a Leica AF6000 microscope and pictures were obtained using the LEICA DFC360FX camera and the LAS AF 2.7.3.9 software (Leica) and quantified using Fiji software. A detailed description is given in the Supplementary Information. To purify yeast RNAs bound to recombinant Mex67 and Mtr2, Escherichia coli BL21 DE3 cells carrying pET8c-His -MTR2 (pHK1279) and either pGEX4T-1-GST-MEX67 (pHK442) or pGEX4T-1-GST-NPL3 (pHK1276), or, as a negative control, pGEX4T-1-GST (pHK439). pET8c-His -MTR2 (pHK1279) cells were grown for two days at 16 °C with 2 mM isopropyl-β-d-thiogalactopyranosid (IPTG). Cells were collected and sonicated in binding buffer (5% (v/v) glycerin, 100 mM NaCl, 2 mM MgCl , 20 mM HEPES, 0.14% (v/v) 2-β-mercaptoethanol and protease inhibitor from Roche). Protein complexes were purified via affinity purification with Gluthatione Sepharose 4B (GE Healthcare). The sepharose (20 μl of 50% slurry) was incubated with bacterial lysate containing the respective recombinant proteins and purified total yeast RNA from stressed and unstressed cells (50 μg/sample) for 1 h at 4 °C. The sepharose was washed six times with binding buffer and split into two portions, one of which contained 10% of the beads to control the pull-down efficiency of the western blot analysis. The other fraction was treated with proteinase K at 37 °C for 30 min. RNA was extracted with phenol/chloroform and further purified with an RNA purification kit (Macherey & Nagel). cDNA was prepared with Maxima Reverse Transcriptase (Thermo Scientific) with random hexamer primers according to the manufacturer’s instructions. Abundance of mRNA was determined by qRT–PCR using GoTaq 2× master mix (Promega) and primers specific for each transcript (Extended Data Table 2). The mRNA levels were compared to the negative control (Fig. 2a). To investigate whether the mutations in the loop domain of Mex67 (ref. 9) would affect mRNA binding (Fig. 2b), recombinant His -tagged Mtr2 and untagged Mex67 pHK1372 (HIS:TEV:MTR2:MEX67), pHK1373 (HIS:TEV:MTR2:MEX67loopKR > AA) and pHK1374 (HIS:TEV:MTR2:MEX67-409-435aaK343E) (constructs described in ref. 9) were co-expressed and purified from E. coli Rosetta 2 cells by affinity chromatography using Ni-NTA agarose (Macherey & Nagel). As the negative control, pET8c-His -MTR2 (pHK1279) was expressed and purified as described above. The purified proteins were diluted in washing buffer (30 mM HEPES pH 7.5, 100 mM NaCl, 10% (v/v) glycerin, and protease inhibitors (Roche) to a final concentration of 0.45 mg/ml. Samples were incubated with purified total yeast RNA (100 μg per sample) extracted from heat-stressed cells (30 min at 42 °C) and Ni-NTA agarose (Qiagen) for 60 min at 4 °C. The matrix was treated and divided as described above. Pull down of proteins was analysed using western blot, RNA was analysed as described above. The mRNA levels were compared to the negative control and set into relation with wild type. GST–Npl3 was recombinantly expressed in E. coli Rosetta 2 cells carrying a pGEX4T-1-GST-NPL3 (pHK1276) plasmid. Cells were collected and bacterial lysate with app. 1 μg/μl GST–Npl3 in lysis buffer (20 mM HEPES pH 7.5, 100 mM NaCl, 4 mM MgCl 10% (v/v) glycerin, 1 mM DTT, 0.1% NP-40 and protease inhibitors (Roche) was prepared. Purification of recombinant Mex67, mex67∆loop409–435 and mex67–loopKR > AA (constructs described in ref. 9) proteins in complex with Mtr2 has already been described in the section on in vitro binding studies. For the co-IP experiments 50 μg of the respective Mex67 protein, 250 μl GST–Npl3 bacterial lysate, 100 μg RNase A, 550 μl lysis buffer with protein G sepharose beads (Amersham Biosciences) loaded with anti-Mex67 antibody (rabbit, own serum) were mixed and incubated at 4 °C for 1.5 h. The matrix was washed six times with lysis buffer and proteins were detected by western blot with the indicated antibodies (anti-Mex67 (rabbit, serum) 1:50,000); anti-GST (mouse, Santa Cruz) 1:2,000). The anti-Mex67 (and not the anti-GST or anti-His) antibodies were used preferentially after generation of a highly specific antibody against Mex67. For RNA/DNA competition analysis, co-IP was performed as above, but the matrix was washed only three times. Following this, 1 ml lysis buffer, 1 μl Ribolock (Thermo Scientific) and the indicated amount of total yeast RNA (prepared from cells that were shifted to 42 °C for 30 min) or DNA (a 7.3-kb plasmid was digested with BanI, resulting in 6 fragments from 94 bp to 3.1 kb) were added and incubated for 1 h at 4 °C. The beads were washed four times with lysis buffer and proteins were detected as described above. Signal intensities were quantified using the Bio1D software. For ChIP experiments, cells were grown at 25 °C to OD of 0.8. Cultures were split into two equal parts and either shifted to 42 °C or further incubated at 25 °C for 20 min, crosslinked with 1% formaldehyde for 20 min and quenched with 250 mM glycine for 5 min. Cells were collected and washed three times with TBS (20 mM Tris-HCl, pH 7.5, 150 mM NaCl). Pellets were lysed with 1× pellet volume of glass beads and 3× pellet volume of ChIP lysis buffer (50 mM HEPES pH 7.5, 140 mM NaCl, 1% Triton X-100, 0.1% sodium-deoxycholate, 1 mM EDTA, 0.1% SDS, 1 mM PMSF) for 30 s at 5.5 m/s two times using the FastPrep machine. The lysates were sonicated in a water bath sonicator at 100% duty for 2.5 min to obtain a ~350-bp DNA fragment size. A total of 10% of the lysate was collected and used as an immunoprecipitation input control. Immunoprecipitation with cleared lysate was performed using anti-Myc (Santa Cruz) and anti-HA antibodies (Santa Cruz) and G-Sepharose beads (GE) or with GFP trap beads (Chromotek) for 3 h at 4 °C. Beads were washed twice with lysis buffer, one time with high-salt buffer (50 mM HEPES pH 7.5, 500 mM NaCl, 1% TritonX-100, 0.1% sodium deoxycholate, 1 mM EDTA), deoxycholate wash buffer (10 mM Tris pH 8.0, 250 mM LiCl, 0.5% NP-40, 0.5% sodium deoxycholate, 1 mM EDTA) and twice with TE buffer pH 8.0 (10 mM Tris, 1 mM EDTA). Immunoprecipitation eluates and input samples were treated with proteinase K for 1 h at 42 °C and crosslinks were reversed by overnight incubation at 65 °C. DNA was purified via phenol/chloroform extraction. qRT–PCR analyses with input and immunoprecipitation samples were performed on a Rotor-Gene Q cycler to analyse binding at the 5′-regions of the housekeeping gene HEM15 and the stress-regulated HSP12 gene. As a control, primers for a non-transcribed region (NTR) of chromosome V were used and ΔC values were calculated from respective input and immunoprecipitation samples. Standard curves were used to determine primer efficiencies. Occupancies were calculated relative to the NTR control, according to (E^(ΔC Pos. − ΔC No tag)NTR/ E^(ΔC Pos. − ΔC No tag)GOI (Pos., tagged strains; GOI, gene of interest). For detection of unspliced mRNAs in the cytoplasm (Fig. 4c), cells were grown to log phase in selective medium. After collection, cells were washed once with 1 ml YPD/1 M sorbitol/2 mM DTT and resuspended in YPD/1 M sorbitol/1 mM DTT. Cells were spheroblasted using Zymolyase and diluted in 50 ml YPD/1 M sorbitol to recover for 30 min before shift to 42 °C for 30 min. Cells were put on ice, centrifuged at 900g for 5 min and resuspended in 500 μl Ficoll buffer (18% Ficoll 400, 10 mM HEPES pH 6.0). Cells were lysed by addition of 1 ml buffer A (50 mM NaCl, 1 mM MgCl , 10 mM HEPES pH 6.0). The suspension was mixed and centrifuged at 1,500g for 15 min. The supernatant was used for cytoplasmic analyses. To verify correct fractionation of the cytoplasmic lysates, samples were analysed by western blot for the presence of the cytoplasmic Zwf1 and nucleolar Nop1. RNA was purified using a purification kit (Macherey & Nagel). Equal amounts were separated on a 1% agarose gel (1× MOPS, 2% formaldehyde) and blotted overnight on a Hybond–Nylon membrane. The membrane was processed as described for the dot blot experiments. For detection of the GFP-containing mRNA a DIG-labelled probe was prepared as described for FISH analyses. All experiments shown in this work were performed at least three times independently as biological replicates, with the exception of the genome-wide analyses. Error bars represent the standard deviation. P values shown in Figs 1a, 2a, b, e and Extended Data Figs 3c, 4h, j were calculated using a two-tailed, two-sample unequal variance t-test. P values shown in Fig. 3a and Extended Data Fig. 5b c were calculated by a two-tailed, two-sample equal variance test. P values are indicated as follows: ***P < 0.001, **P < 0.01, *P < 0.05. For quantification of cells with displayed phenotypes (Figs 2c, 4b and Extended Data Figs 5b, c, 6a and 7d), a minimum of 20 cells was counted for each experiment. Fluorescent signal intensities were analysed using the Fiji software. The Hoechst signal indicated the nuclear area. Increased nuclear signal for Cy3 indicated nuclear accumulation of the analysed RNA and was counted as such. For intensity analyses, this area was measured for all RNA-probes on a single plane to get the intensity of the nuclear signal and this signal was set into relation with the whole-cell signal to determine the cytoplasmic signal. All datasets generated and analysed during the current study are available in Supplementary Information Fig. 1 and from the corresponding author upon reasonable request. All microarray and RIP-seq data that support the findings of the study have been deposited at the NCBI gene expression omnibus (GEO; www.ncbi.nlm.nih.gov/geo/) with the GEO accession numbers GSE83267 (Microarray) and GSE81542 (RNA-seq.).


No statistical methods were used to predetermine sample size for biochemical or cell-based assays, or for pharmacokinetic studies. Investigators were not blinded to outcome assessment during these investigations. For GS-5734 efficacy assessments in nonhuman primates, statistical power analysis was used to predetermine sample size, and subjects were randomly assigned to experimental group, stratified by sex and balanced by body weight. Study personnel responsible for assessing animal health (including euthanasia assessment) and administering treatments were experimentally blinded to group assignment of animals and outcome. GS-5734, Nuc, and NTP were synthesized at Gilead Sciences, Inc., and chemical identity and sample purity were established using NMR, HRMS, and HPLC analysis (Supplementary Information). The radiolabelled analogue [14C]GS-5734 (specific activity, 58.0 mCi mmol−1) was obtained from Moravek Biochemicals (Brea, California) and was prepared in a similar manner described for GS-5734 using [14C]trimethylsilylcyanide (Supplementary Information). Small molecule X-ray crystallographic coordinates and structure factor files have been deposited in the Cambridge Structural Database (http://www.ccdc.cam.ac.uk/) and accession numbers are supplied in the Supplementary Information. RSV A2 was purchased from Advanced Biotechnologies, Inc. EBOV (Kikwit and Makona variants), Sudan virus (SUDV, Gulu), Marburg virus (MARV, Ci67), Junín virus (JUNV, Romero), Lassa virus (LASV, Josiah), Middle East respiratory syndrome virus (MERS, Jordan N3), Chikungunya virus (CHIV, AF 15561), and Venezuelan equine encephalitis virus (VEEV, SH3) were all prepared and characterized at the United States Army Medical Research Institute for infectious diseases (USAMRIID). EBOV containing a GFP reporter gene (EBOV–GFP), EBOV Makona (Liberia, 2014), and MARV containing a GFP reporter gene (MARV–GFP) were prepared and characterized at the Centers for Disease Control and Prevention26, 27. HEp-2 (CCL-23), PC-3 (CCL-1435), HeLa (CCL-2), U2OS (HTB-96), Vero (CCL-81), HFF-1 (SCRC-1041), and HepG2 (HB-8065) cell lines were purchased from the American Type Culture Collection. Cell lines were not authenticated and were not tested for mycoplasma as part of routine use in assays. HEp-2 cells were cultured in Eagle’s Minimum Essential Media (MEM) with GlutaMAX supplemented with 10% fetal bovine serum (FBS) and 100 U ml−1 penicillin and streptomycin. PC-3 cells were cultured in Kaighn’s F12 media supplemented with 10% FBS and 100 U ml−1 penicillin and streptomycin. HeLa, U2OS, and Vero cells were cultured in MEM supplemented with 10% FBS, 1% l-glutamine, 10 mM HEPES, 1% non-essential amino acids, and 1% penicillin/streptomycin. HFF-1 cells were cultured in MEM supplemented with 10% FBS and 0.5 mM sodium pyruvate. HepG2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) with GlutaMAX supplemented with 10% FBS, 100 U ml−1 penicillin and streptomycin, and 0.1 mM non-essential amino acids. The MT-4 cell line was obtained from the NIH AIDS Research and Reference Reagent Program and cultured in RPMI-1640 medium supplemented with 10% FBS, 100 U ml−1 penicillin and streptomycin, and 2 mM l-glutamine. The Huh-7 cell line was obtained from C. M. Rice (Rockefeller University) and cultured in DMEM supplemented with 10% FBS, 100 U ml−1 penicillin and streptomycin, and non-essential amino acids. Primary human hepatocytes were purchased from Invitrogen and cultured in William’s Medium E medium containing cell maintenance supplement. Donor profiles were limited to 18- to 65-year-old nonsmokers with limited alcohol consumption. Upon delivery, the cells were allowed to recover for 24 h in complete medium with supplement provided by the vendor at 37 °C. Human PBMCs were isolated from human buffy coats obtained from healthy volunteers (Stanford Medical School Blood Center, Palo Alto, California) and maintained in RPMI-1640 with GlutaMAX supplemented with 10% FBS, 100 U ml−1 penicillin and streptomycin. Rhesus fresh whole blood was obtained from Valley Biosystems. PBMCs were isolated from whole blood by Ficoll-Hypaque density gradient centrifugation. Briefly, blood was overlaid on 15 ml Ficoll-Paque (GE Healthcare Bio-Sciences AB), and centrifuged at 500g for 20 min. The top layer containing platelets and plasma was removed, and the middle layer containing PBMCs was transferred to a fresh tube, diluted with Tris buffered saline up to 50 ml, and centrifuged at 500g for 5 min. The supernatant was removed and the cell pellet was resuspended in 5 ml red blood cell lysis buffer (155 mM ammonium chloride, 10 mM potassium bicarbonate, 0.1 mM EDTA, pH 7.5). To generate stimulated PBMCs, freshly isolated quiescent PBMCs were seeded into a T-150 (150 cm2) tissue culture flask containing fresh medium supplemented with 10 U ml−1 of recombinant human interleukin-2 (IL-2) and 1 μg ml−1 phytohaemagglutinin-P at a density of 2 × 106 cells ml−1 and incubated for 72 h at 37 °C. Human macrophage cultures were isolated from PBMCs that were purified by Ficoll gradient centrifugation from 50 ml of blood from healthy human volunteers. PBMCs were cultured for 7 to 8 days in in RPMI cell culture media supplemented with 10% FBS, 5 to 50 ng ml−1 granulocyte-macrophage colony-stimulating factor and 50 μM β-mercaptoethanol to induce macrophage differentiation. The cryopreserved human primary renal proximal tubule epithelial cells were obtained from LifeLine Cell Technology and isolated from the tissue of human kidney. The cells were cultured at 90% confluency with RenaLife complete medium in a T-75 flask for 3 to 4 days before seeding into 96-well assay plates. Immortalized human microvascular endothelial cells (HMVEC-TERT) were obtained from R. Shao at the Pioneer Valley Life Sciences Institute28. HMVEC-TERT cells were cultured in endothelial basal media supplemented with 10% FBS, 5 μg of epithelial growth factor, 0.5 mg hydrocortisone, and gentamycin/amphotericin-B. RNA POLII was purchased as part of the HeLaScribe Nuclear Extract in vitro Transcription System kit from Promega. The recombinant human POLRMT and transcription factors mitochondrial transcription factors A (mtTFA or TFAM) and B2 (mtTFB2 or TFB2M) were purchased from Enzymax. RSV ribonucleoprotein (RNP) complexes were prepared according to a method modified from ref. 29. The intracellular metabolism of GS-5734 was assessed in different cell types (HMVEC and HeLa cell lines, and primary human and rhesus PBMCs, monocytes and monocyte-derived macrophages) following 2-h pulse or 72-h continuous incubations with 10 μM GS-5734. For comparison, intracellular metabolism during a 72-h incubation with 10 μM of Nuc was completed in human monocyte-derived macrophages. For pulse incubations, monocyte-derived macrophages isolated from rhesus monkeys or humans were incubated for 2 h in compound-containing media followed by removal, washing with 37 °C drug-free media, and incubated for an additional 22 h in media which did not contain GS-5734. Human monocyte-derived macrophages, HeLa and HMVEC were grown to confluence (approximately 0.5, 0.2, and 1.2 × 106 cells per well, respectively) in 500 μl of media in 12-well tissue culture plates. Monocyte and PBMCs were incubated in suspension (approximately 1 × 106 cells ml−1) in 1 ml of media in micro centrifuge tubes. For adherent cells (HMVEC, HeLa, and monocyte-derived macrophages), media was removed at select time points from duplicate wells, cells washed twice with 2 ml of ice-cold 0.9% normal saline. For non-adherent cells (monocytes and PBMCs), duplicate incubations were centrifuged at 2,500g for 30 s to remove media. The cell pellets were re-suspended with 500 μl cell culture media (RPMI with 10% FBS) and layered on top of a 500 μl oil layer (Nyosil M25; Nye Lubricants) in a microcentrifuge tube. Samples were then centrifuged at room temperature at 13,000 r.p.m. for 45 s. The media layer was removed and the oil layer was washed twice with 500 μl water. The oil layer was then carefully removed using a Pasteur pipet attached to vacuum. A volume of 0.5 ml of 70% methanol containing 100 nM of the analytical internal standard 2-chloro-adenosine-5′-triphosphate (Sigma-Aldrich) was added to isolated cells. Samples were stored overnight at −20 °C to facilitate extraction, centrifuged at 15,000g for 15 min and then supernatant was transferred to clean tubes for drying in a MiVac Duo concentrator (Genevac). Dried samples were then reconstituted in mobile phase A containing 3 mM ammonium formate (pH 5.0) with 10 mM dimethylhexylamine (DMH) in water for analysis by liquid chromatography coupled to triple quadrupole mass spectrometry (LC-MS/MS). LC-MS/MS was performed using low-flow ion-pairing chromatography, similar to methods described previously30. Briefly, analytes were separated using a 50 × 2 mm × 2.5 μm Luna C18(2) HST column (Phenomenex) connected to a LC-20ADXR (Shimadzu) ternary pump system and HTS PAL autosampler (LEAP Technologies). A multi-stage linear gradient from 10% to 50% acetonitrile in a mobile phase containing 3 mM ammonium formate (pH 5.0) with 10 mM dimethylhexylamine over 8 min at a flow rate of 150 μl min−1 was used to separate analytes. Detection was performed on an API 4000 (Applied Biosystems) MS/MS operating in positive ion and multiple reaction monitoring modes. Intracellular metabolites alanine metabolite, Nuc, nucleoside monophosphate, nucleoside diphosphate, and nucleoside triphosphate were quantified using 7-point standard curves ranging from 0.274 to 200 pmol (approximately 0.5 to 400 μM) prepared in cell extract from untreated cells. Levels of adenosine nucleotides were also quantified to assure dephosphorylation had not taken place during sample collection and preparation. In order to calculate intracellular concentration of metabolites, the total number of cells per sample were counted using a Countess automated cell counter (Invitrogen). Antiviral assays were conducted in biosafety level 4 containment (BSL-4) at the Centers for Disease Control and Prevention. EBOV antiviral assays were conducted in primary HMVEC-TERT and in Huh-7 cells. Huh-7 cells were not authenticated and were not tested for mycoplasma. Ten concentrations of compound were diluted in fourfold serial dilution increments in media, and 100 μl per well of each dilution was transferred in duplicate (Huh-7) or quadruplicate (HMVEC-TERT) onto 96-well assay plates containing cell monolayers. The plates were transferred to BSL-4 containment, and the appropriate dilution of virus stock was added to test plates containing cells and serially diluted compounds. Each plate included four wells of infected untreated cells and four wells of uninfected cells that served as 0% and 100% virus inhibition controls, respectively. After the infection, assay plates were incubated for 3 days (Huh-7) or 5 days (HMVEC-TERT) in a tissue culture incubator. Virus replication was measured by direct fluorescence using a Biotek HTSynergy plate reader. For virus yield assays, Huh-7 cells were infected with wild-type EBOV for 1 h at 0.1 plaque-forming units (PFU) per cell. The virus inoculum was removed and replaced with 100 μl per well of media containing the appropriate dilution of compound. At 3 days post-infection, supernatants were collected, and the amount of virus was quantified by endpoint dilution assay. The endpoint dilution assay was conducted by preparing serial dilutions of the assay media and adding these dilutions to fresh Vero cell monolayers in 96-well plates to determine the tissue culture infectious dose that caused 50% cytopathic effects (TCID ). To measure levels of viral RNA from infected cells, total RNA was extracted using the MagMAX-96 Total RNA Isolation Kit and quantified using a quantitative reverse transcription polymerase chain reaction (qRT–PCR) assay with primers and probes specific for the EBOV nucleoprotein gene. Antiviral assays were conducted in BSL-4 at USAMRIID. HeLa or HFF-1 cells were seeded at 2,000 cells per well in 384-well plates. Ten serial dilutions of compound in triplicate were added directly to the cell cultures using the HP D300 digital dispenser (Hewlett Packard) in twofold dilution increments starting at 10 μM at 2 h before infection. The DMSO concentration in each well was normalized to 1% using an HP D300 digital dispenser. The assay plates were transferred to the BSL-4 suite and infected with EBOV Kikwit at a multiplicity of infection of 0.5 PFU per cell for HeLa cells and with EBOV Makona at a multiplicity of infection of 5 PFU per cell for HFF-1 cells. The assay plates were incubated in a tissue culture incubator for 48 h. Infection was terminated by fixing the samples in 10% formalin solution for an additional 48 h before immune-staining, as described in Supplementary Table 1. Antiviral assays were conducted in BSL-4 at USAMRIID. Primary human macrophage cells were seeded in a 96-well plate at 40,000 cells per well. Eight to ten serial dilutions of compound in triplicate were added directly to the cell cultures using an HP D300 digital dispenser in threefold dilution increments 2 h before infection. The concentration of DMSO was normalized to 1% in all wells. The plates were transferred into the BSL-4 suite, and the cells were infected with 1 PFU per cell of EBOV in 100 μl of media and incubated for 1 h. The inoculum was removed, and the media was replaced with fresh media containing diluted compounds. At 48 h post-infection, virus replication was quantified by immuno-staining as described in Supplementary Table 1. For antiviral tests, compounds were threefold serially diluted in source plates from which 100 nl of diluted compound was transferred to a 384-well cell culture plate using an Echo acoustic transfer apparatus. HEp-2 cells were added at a density of 5 × 105 cells per ml, then infected by adding RSV A2 at a titer of 1 × 104.5 tissue culture infectious doses (TCID ) per ml. Immediately following virus addition, 20 μl of the virus and cells mixture was added to the 384-well cell culture plates using a μFlow liquid dispenser and cultured for 4 days at 37 °C. After incubation, the cells were allowed to equilibrate to 25 °C for 30 min. The RSV-induced cytopathic effect was determined by adding 20 μl of CellTiter-Glo Viability Reagent. After a 10-min incubation at 25 °C, cell viability was determined by measuring luminescence using an Envision plate reader. Antiviral assays were conducted in 384-or 96-well plates in BSL-4 at USAMRIID using a high-content imaging system to quantify virus antigen production as a measure of virus infection. A ‘no virus’ control and a ‘1% DMSO’ control were included to determine the 0% and 100% virus infection, respectively. The primary and secondary antibodies and dyes used for nuclear and cytoplasmic staining are listed in Supplementary Table 1. The primary antibody specific for a particular viral protein was diluted 1,000-fold in blocking buffer (1 × PBS with 3% BSA) and added to each well of the assay plate. The assay plates were incubated for 60 min at room temperature. The primary antibody was removed, and the cells were washed three times with 1 × PBS. The secondary detection antibody was an anti-mouse (or rabbit) IgG conjugated with Dylight488 (Thermo Fisher Scientific, catalogue number 405310). The secondary antibody was diluted 1,000-fold in blocking buffer and was added to each well in the assay plate. Assay plates were incubated for 60 min at room temperature. Nuclei were stained using Draq5 (Biostatus) or 33342 Hoechst (ThermoFisher Scientific) for Vero and HFF-1 cell lines. Both dyes were diluted in 1× PBS. The cytoplasm of HFF-1 (EBOV assay) and Vero E6 (MERS assay) cells were counter-stained with CellMask Deep Red (Thermo Fisher Scientific). Cell images were acquired using a Perkin Elmer Opera confocal plate reader (Perkin Elmer) using a ×10 air objective to collect five images per well. Virus-specific antigen was quantified by measuring fluorescence emission at a 488 nm wavelength and the stained nuclei were quantified by measuring fluorescence emission at a 640 nm wavelength. Acquired images were analysed using Harmony and Acapella PE software. The Draq5 signal was used to generate a nuclei mask to define each nuclei in the image for quantification of cell number. The CellMask Deep Red dye was used to demarcate the Vero and HFF-1 cell borders for cell-number quantitation. The viral-antigen signal was compartmentalized within the cell mask. Cells that exhibited antigen signal higher than the selected threshold were counted as positive for viral infection. The ratio of virus-positive cells to total number of analysed cells was used to determine the percentage of infection for each well on the assay plates. The effect of compounds on the viral infection was assessed as percentage of inhibition of infection in comparison to control wells. The resultant cell number and percentage of infection were normalized for each assay plate. Analysis of dose–response curve was performed using GeneData Screener software applying Levenberg–Marquardt algorithm for curve-fitting strategy. The curve-fitting process, including individual data point exclusion, was pre-specified by default software settings. R2 value quantified goodness of fit and fitting strategy was considered acceptable at R2 > 0.8. All virus infections were quantified by immuno-staining using antibodies that recognized the relevant viral glycoproteins, as described in Supplementary Table 1. HeLa cells were seeded at 2,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 1 PFU per cell MARV, which resulted in 50% to 70% of the cells expressing virus antigen in a 48-h period. HeLa cells were seeded at 2,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.08 PFU SUDV per cell, which resulted in 50% to 70% of the cells expressing virus antigen in a 48-h period. HeLa cells were seeded at 2,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.3 PFU per cell JUNV, which resulted in ~50% of the cells expressing virus antigen in a 48-h period. HeLa cells were seeded at 2,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.1 PFU per cell LASV, which resulted in >60% of the cells expressing virus antigen in a 48-h period. African green monkey (Chlorocebus sp.) kidney epithelial cells (Vero E6) were seeded at 4,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.5 PFU per cell of MERS virus, which resulted in >70% of the cells expressing virus antigen in a 48-h period. U2OS cells were seeded at 3,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.5 PFU per cell of CHIK, which resulted in >80% of the cells expressing virus antigen in a 48-h period. HeLa cells were seeded at 4,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.1 PFU per cell VEEV, which resulted in >60% of the cells expressing virus antigen in a 20-h period. HEp-2 (1.5 × 103 cells per well) and MT-4 (2 × 103 cells per well) cells were plated in 384-well plates and incubated with the appropriate medium containing threefold serially diluted compound ranging from 15 nM to 100,000 nM. PC-3 cells (2.5 × 103 cells per well), HepG2 cells (4 × 103 cells per well), hepatocytes (1 × 106 cells per well), quiescent PBMCs (1 × 106 cells per well), stimulated PBMCs (2 × 105 cells per well), and RPTEC cells (1 × 103 cells per well) were plated in 96-well plates and incubated with the appropriate medium containing threefold serially diluted compound ranging from 15 nM to 100,000 nM. Cells were cultured for 4–5 days at 37 °C. Following the incubation, the cells were allowed to equilibrate to 25 °C, and cell viability was determined by adding Cell-Titer Glo viability reagent. The mixture was incubated for 10 min, and the luminescence signal was quantified using an Envision plate reader. Cell lines were not authenticated and were not tested for mycoplasma as part of routine use in cytotoxicity assays. RNA synthesis by the RSV polymerase was reconstituted in vitro using purified RSV L/P complexes and an RNA oligonucleotide template (Dharmacon), representing nucleotides 1–14 of the RSV leader promoter31, 32, 33 (3′-UGCGCUUUUUUACG-5′). RNA synthesis reactions were performed as described previously, except that the reaction mixture contained 250 μM guanosine triphosphate (GTP), 10 μM uridine triphosphate (UTP), 10 μM cytidine triphosphate (CTP), supplemented with 10 μCi [α-32P]CTP, and either included 10 μM adenosine triphosphate (ATP) or no ATP. Under these conditions, the polymerase is able to initiate synthesis from the position 3 site of the promoter, but not the position 1 site. The NTP metabolite of GS-5734 was serially diluted in DMSO and included in each reaction mixture at concentrations of 10, 30, or 100 μM as specified in Fig. 1f. RNA products were analysed by electrophoresis on a 25% polyacrylamide gel, containing 7 M urea, in Tris–taurine–EDTA buffer, and radiolabelled RNA products were detected by autoradiography. Transcription reactions contained 25 μg of crude RSV RNP complexes in 30 μL of reaction buffer (50 mM Tris-acetate (pH 8.0), 120 mM potassium acetate, 5% glycerol, 4.5 mM MgCl , 3 mM DTT, 2 mM EGTA, 50 μg ml−1 BSA, 2.5 U RNasin, 20 μM ATP, 100 μM GTP, 100 μM UTP, 100 μM CTP, and 1.5 μCi [α-32P]ATP (3,000 Ci mmol−1)). The radiolabelled nucleotide used in the transcription assay was selected to match the nucleotide analogue being evaluated for inhibition of RSV RNP transcription. To determine whether nucleotide analogues inhibited RSV RNP transcription, compounds were added using a six-step serial dilution in fivefold increments. After a 90-min incubation at 30 °C, the RNP reactions were stopped with 350 μl of Qiagen RLT lysis buffer, and the RNA was purified using a Qiagen RNeasy 96 kit. Purified RNA was denatured in RNA sample loading buffer at 65 °C for 10 min and run on a 1.2% agarose/MOPS gel containing 2 M formaldehyde. The agarose gel was dried, exposed to a Storm phosphorimaging screen, and developed using a Storm phosphorimager. For a 25 μl reaction mixture, 7.5 μl 1 × transcription buffer (20 mM HEPES (pH 7.2–7.5), 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, 20% glycerol), 3 mM MgCl , 100 ng CMV positive or negative control DNA, and a mixture of ATP, GTP, CTP and UTP was pre-incubated with various concentrations (0–500 μM) of the inhibitor at 30 °C for 5 min. The mixture contained 5–25 μM (equal to K ) of the competing 33P-labelled ATP and 400 μM of GTP, UTP, and CTP. The reaction was started by addition of 3.5 μl of HeLa and extract. After 1 h of incubation at 30 °C, the polymerase reaction was stopped by addition of 10.6 μl proteinase K mixture that contained final concentrations of 2.5 μg μl−1 proteinase K, 5% SDS, and 25 mM EDTA. After incubation at 37 °C for 3–12 h, 10 μl of the reaction mixture was mixed with 10 μl of the loading dye (98% formamide, 0.1% xylene cyanol and 0.1% bromophenol blue), heated at 75 °C for 5 min, and loaded onto a 6% polyacrylamide gel (8 M urea). The gel was dried for 45 min at 70 °C and exposed to a phosphorimager screen. The full length product, 363 nucleotide runoff RNA, was quantified using a Typhoon Trio Imager and Image Quant TL Software. Twenty nanomolar POLRMT was incubated with 20 nM template plasmid (pUC18-LSP) containing POLRMT light-strand promoter region and mitochondrial (mt) transcription factors TFA (100 nM) and mtTFB2 (20 nM) in buffer containing 10 mM HEPES (pH 7.5), 20 mM NaCl, 10 mM DTT, 0.1 mg ml−1 BSA, and 10 mM MgCl 34. The reaction mixture was pre-incubated to 32 °C, and the reactions were initiated by addition of 2.5 μM of each of the natural NTPs and 1.5 μCi of [32P]GTP. After incubation for 30 min at 32 °C, reactions were spotted on DE81 paper and quantified. A homology model of RSV A2 and EBOV polymerases were built using the HIV reverse transcriptase X-ray crystal structure (PDB:1RTD). Schrödinger Release 2015-1: Prime, version 3.9 (Schrödinger, LLC), default settings with subsequent rigid body minimization and side-chain optimization. Loop insertions not in 1RTD of greater than 10 amino acids were not built. For quantitative assessment of viral RNA nonhuman primate plasma samples, whole blood was collected using a K3 EDTA Greiner Vacuette tube (or equivalent) and sample centrifuged at 2500 (± 200) relative centrifugal force for 10 ± 2 min. To inactivate virus, plasma was treated with 3 parts (300 μl) TriReagent LS and samples were transferred to frozen storage (−60 °C to −90 °C), until removal for RNA extraction. Carrier RNA and QuantiFast High Concentration Internal Control (Qiagen) were spiked into the sample before extraction, conducted according to manufacturer’s instructions. The viral RNA was eluted in AVE buffer. Each extracted RNA sample was tested with the QuantiFast Internal Control RT–PCR RNA Assay (Qiagen) to evaluate the yield of the spiked-in QuantiFast High Concentration Internal Control. If the internal control amplified within manufacturer-designated ranges, further quantitative analysis of the viral target was performed. RT–PCR was conducted using an ABI 7500 Fast Dx using primers specific to EBOV glycoprotein. Samples were run in triplicate using a 5 μl template volume. For quantitative assessments, the average of the triplicate genomic equivalents (GE) per reaction were determined and multiplied by 800 to obtain GE ml−1 plasma. Standard curves were generated using synthetic RNA. The limits of quantification for this assay are 8.0 × 104 − 8.0 × 1010 GE ml−1 of plasma. Acceptance criteria for positive template control (PTC), negative template control (NTC), negative extraction control (NEC), and positive extraction control (PEC) are specified by standard operating procedure. For qualitative assessments, the limit of detection (LOD) was defined as C 38.07, based on method validation testing. An animal was considered to have tested positive for detection of EBOV RNA when a minimum of 2 of 3 replicates were designated as ‘positive’ and PTC, NTC, and NEC controls met specified method-acceptance criteria. A sample was designated as ‘positive’ when the C value was


No statistical methods were used to predetermine sample size. For calibrating the duration of the dark housing period before light exposure, C57Bl6 wild-type mice were housed in a standard light cycle until they were placed in constant darkness for varying amounts of time before analysis at postnatal day 56. At P56, all mice were either sacrificed in the dark (dark-housed condition) or light-exposed for 1, 3, or 7.5 h before being sacrificed. The eyes of all animals were enucleated (for the dark-housed condition, enucleation was performed in the dark) before dissection of the visual cortex in the light. For RiboTag-experiments, mice were reared in a standard light cycle and then housed in constant darkness for two weeks starting from P42; at P56, all mice were either sacrificed in the dark (dark-housed condition) or light-exposed for 1, 3, or 7.5 h before being sacrificed. Additional cohorts of mice for the ‘standard’ condition were housed in a standard light cycle until P56 when they were euthanized. The eyes of all animals were enucleated (for the dark-housed condition, enucleation was performed in the dark) before dissection of the visual cortex in the light. Total RNA was extracted with TRIzol reagent (Sigma) according to the manufacturer’s instructions, and RNA quality was assessed on a 2100 BioAnalyzer (Agilent); all RNAs were treated with DNaseI (Invitrogen) before reverse transcription. For the cloning of riboprobes, total RNA was extracted from whole adult C57Bl6 wild-type mouse brains and cDNA was prepared using SuperScript II kit (Life Technologies). For real-time quantitative PCR experiments aimed at calibrating the duration of the dark housing period, total RNA was extracted for each sample from the visual cortices of one animal. For real-time quantitative PCR experiments aimed at testing the efficacy of shRNA constructs directed against Igf1, total RNA was isolated from two pooled 24 wells of cultured cortical neurons for each condition. For qPCR experiments, RNA was reverse-transcribed with the High Capacity cDNA Reverse Transcription kit (Life Technologies). Real-time quantitative PCR reactions were performed on the LightCycler 480 system (Roche) with LightCycler 480 SYBR Green I Master. Reactions were run in duplicates, triplicates or quadruplicates, and β-actin (Actb) or β3-tubulin (Tubb3) levels were used as an endogenous control for normalization using the ΔΔC method24. Real-time PCR primers were designed using the Universal ProbeLibrary (Roche) as exon-spanning whenever possible and answered the following criteria: linear amplification over three orders of magnitude of target concentration, no amplification product in control samples that were not reverse-transcribed (that is, control for contamination with genomic DNA), no amplification product in control samples where no template was added (that is, control for primer dimers), amplification of one singular product as determined by melt-curve analysis and analysis of the product in agarose gel electrophoresis and sequencing of the PCR product. The qPCR primers used in this study are listed in Supplementary Table 6. For analysis of light-induced gene expression in wild-type mice, the gene expression levels were analysed in four mice (two males and two females) at each time point. The data were calculated as fold change relative to the average of the overnight dark-housed condition and normalized to the average of the maximally induced time point. Data in figures represent the mean and s.e.m. of four mice. For assessing Igf1 levels in cortical cultures infected with shRNA-expressing lentiviral constructs, qPCRs were performed in quadruplicates for each condition and fold changes were calculated relative to the non-infected non-stimulated cultures. Data were normalized to the maximally induced condition in each biological replicate, and data in figures represent the mean and s.e.m. of three biological replicates. Immunoprecipitation and purification of ribosome associated RNA was performed essentially as described6, 8, with minor modifications: lysis of the samples was performed in the presence 10 mM Ribonucleoside Vanadyl Complex (NEB, Ipswich, MA), and immunoprecipitation was performed with a different anti-HA antibody (HA-7, 12 μg per immunoprecipitation, Sigma). In brief, the visual cortices were dissected, flash frozen in liquid nitrogen and then kept at −80 °C until further processing. Visual cortices from three individual animals (each sample contained both male and female animals) were pooled for each biological replicate, and three biological replicates were performed. After lysis of the tissues and before immunopurification, a small fraction of lysate of each sample (that is, ‘input’) was set aside and total RNA was extracted with TRIzol reagent followed by the RNEasy Micro Kit’s procedure (Qiagen, Valencia, California). After immunopurification of the ribosome-associated RNAs, RNA quality was assessed on a 2100 BioAnalyzer (Agilent, Palo Alto, California) and RNA amounts were quantified using the Qubit 2.0 Fluorometer (Life Technologies). Only samples with RIN numbers above 8.0 were considered for analysis by qPCR and RNA-seq. For all RNA samples of sufficient integrity, 5–10 ng of RNA were SPIA-amplified with the Ovation RNA Amplification System V2 (NuGEN, San Carlos, California), yielding typically 5–8 μg of cDNA per sample. Quantitative RT–PCR was performed as described above and relative expression levels were determined in every experiment by normalizing the Ct-values to those of beta-Actin (ActB) from the 0 h input using the ΔΔC method24. To determine the fold-enrichment (IP/Input), the actin-normalized expression levels for every time point of every biological replicate were averaged, and the grand averages from the IP and Input were divided to find the IP/Input ratio. To calculate fold-induction for each biological replicate, each time point was divided by the maximal value occurring in that biological replicate, such that the maximal value was set to 1 in each biological replicate. The mean and standard error were calculated at each time point from these normalized values. All samples were analysed by qPCR for purity and light-induced gene expression before analysis by high throughput sequencing. SPIA-amplified samples from RiboTag-immunoprecipitated fractions for each of the five stimulus conditions and each of the five Cre lines were prepared as described above and processed in triplicate (75 samples total). For preparing sequencing libraries, 2 μg of each amplified cDNA were fragmented to a length of 200–400 bp using a Covaris S2 sonicator (Acoustic Wave Instruments) using the following parameters: duty cycle: 10%, intensity: 5, cycles per burst: 200, time: 60 s, total time: 5 min. After validating the fragment length of the sonicated cDNA using a 2100 BioAnalyzer (Agilent, Palo Alto, California), 2 μg of the fragmented cDNA were used for sequencing library preparation using the PrepX DNA kit on an Apollo 324 robot (IntegenX). The quality of completed sequencing libraries was assessed using a 2100 BioAnalyzer (Agilent, Palo Alto, California) and the completed libraries were sequenced on an Illumina HiSeq 2000 instrument, following the manufacturer’s standard protocols for single-end 50 bp sequencing with single index reads. Sequencing typically yielded 30–80 million usable non-strand-specific reads per IP sample. Reads were mapped to the mm9 genome using TopHat (v.2.0.13) and Bowtie (2.1.0.0)25. On average, ~70% of mapped IP reads were uniquely mapped to the mm9 genome allowing for 0 mismatches and were therefore assignable to genic features (one RiboTag-seq library (Sst-cre, standard-housing, biological replicate 2) was excluded from analysis due to low mappability). Values from all IP libraries were normalized using Cufform (v.2.2.1), and values from the Cuffnorm output file ‘genes-Count_Table’ (normalized reads) were taken as a proxy for gene expression. P values were generated for each Cre line for each dark–light conditions using Cuffdiff (v.2.2.1) using the time series (-T) flag based on three biological replicates. To identify transcripts regulated by visual experience, for each biological replicate of each Cre line, the fold change in normalized reads was calculated for each gene at every time point (dark-housed/standard-housed, 1 h light/dark-housed, 3 h light/dark-housed; 7.5 h light/dark-housed). Genes were flagged as experience-regulated in a given Cre line if they met the following conditions in at least one sample: (1) P value <0.005, (2) mean fold change of twofold or greater, (3) fold changes of 2 or higher in 2 of 3 biological replicates, (4) the mean expression value in at least one sample must be above absolute expression threshold (set at the 40th percentile of all observed values). To determine in which Cre lines genes were regulated by experience, genes were simply classified according to the above criteria. However, for this analysis we excluded the Gad2-cre line, since Pv-, Sst- and Vip-cre all label subsets of the neurons labelled by Gad2-cre. However, we did detect genes regulated solely in Gad2-cre, but no other Cre lines; we reasoned that these genes are probably regulated by experience in a population of 5HT3aR+/VIP− neurons that are contained in Gad2-cre but none of the other Cre lines. We classified the set of experience-regulated genes into categories ‘early’, ‘late’, and ‘long-term’ based on the fastest kinetics observed. When genes were found to be elevated and/or suppressed at multiple time points, we assigned them to the categories based on the most rapid observed change. For example, while Fos levels are elevated over dark housing at 1, 3 and 7.5 h of light exposure and suppressed after two weeks of dark housing, Fos is classified as ‘early-up’ because it is elevated at 1 h after light exposure. All linkage analysis was performed using the ‘single’ method and ‘Cityblock’ metric using Matlab’s linkage function. To determine the branch-order significance of the cladogram resulting from clustering of the 602 experience-regulated genes, we generated 1,000 cladograms from 602 sets of random expressed genes (including experience-regulated genes, with replacement) and asked how often we generated a cladogram with an identical branch order at the level of the Cre lines. Only 11 sets of 1,000 random genes sets generated an identical tree. For the purposes of this analysis, we only compared the branches above the level of the individual Cre line. To identify cell-type-enriched transcripts, an enrichment score was calculated for every transcript in every Cre line for each biological replicate. This enrichment score was calculated by dividing the maximum expression value observed in a given Cre line by the maximum expression value observed across all conditions for all other Cre lines (GABAergic subtypes were not required to be enriched above Gad2-cre). The enrichment scores for a set of known cell-type-specific genes were evaluated (Vglut1, Tbr1, Pvalb, Sst, Vip), and our threshold was set at the enrichment score of the cell-type-specific gene with the lowest score (Slc17a7/Vglut1, at 5.5-fold-enriched in Emx1-cre). Transcripts were considered to be expressed in a cell-type-specific manner (or ‘highly enriched’) in a given Cre line if their mean enrichment score was above this threshold and if the enrichment score exceeded this threshold in 2 out of 3 biological replicates. Cloning of all constructs was done using standard cloning techniques, and the integrity of all cloned constructs was validated by DNA sequencing. Templates for the riboprobes for Igf1, Gad1, Pvalb, Sst and Vip were prepared by PCR-amplification of cDNA fragments generated from total RNA isolated from adult C57Bl6 mouse brains (see Supplementary Table 7 for primer sequences) and cloning of the respective PCR fragments into the pBlueScript II vector (Agilent Technologies). Lentiviral shRNA constructs were generated by cloning shRNA stem loop sequences against Igf1 (Igf1 shRNA 1: GGTGGATGCTCTTCAGTTC; Igf1 shRNA 2: TGAGGAGACTGGAGATGTA) and Luciferase (Luc, control: ACTTACGCTGAGTACTTCG) into a modified version of pLentiLox3.726 in which the CMV promoter driving the expression of eGFP was replaced with an hUbc promoter and in which the loxP sites surrounding the hUbc-eGFP cassette were removed. The loop sequence used in these shRNA constructs is based on miR-25 (CCTCTCAACACTGG)27. shRNA-expressing AAV-constructs (pAAV-U6-shRNA-hUbc-Flex-eGFP) were made by first replacing the Flex-GFP-Gephyrin cassette in pAAV-Flex-GFP-Gephyrin22 with a Flex-eGFP cassette (resulting in pAAV-hUbc-Flex-eGFP) and then transferring the U6-shRNA cassettes from the pLentiLox constructs to pAAV-hUbc-Flex-eGFP. AAV constructs for the Cre-conditional co-expression of epitope-tagged IGF1.4 and eGFP or of eGFP alone were cloned by synthesizing the gBlocks (Integrated DNA Technologies) and using the gBlocks as templates for PCR amplification; the respective PCR products were then cloned into the pAAV-hUbc-Flex-eGFP (see above) by replacing the EGFP with the respective insert. This strategy yielded plasmids termed pAAV-hUbc-Flex-SSHA-IGF1.4-Myc-F2A-eGFP and pAAV-hUbc-Flex-F2A-eGFP, whereby the Cre-dependent inserts were driven by a human ubiquitin promoter (hUbc). The sequence for Igf1.4 was based on NM_001111275 (base pairs 277–752) and was modified in the following way: an HA epitope (TATCCtTATGATGTTCCAGATTATGCT) was inserted in frame between the Igf1.4 signal sequence and the beginning of the coding sequencing (cds) of Igf1.4, Igf1.4 was rendered resistant to the shRNA against Igf1 by introducing silent mutations into the target sequences specified above (sh1: TGTTGACGCGCTCCAATTT; sh2: TACGCCGGTTAGAAATGTA) and the followings tags were inserted in frame 3′ to the Igf1.4 coding sequencing: Myc epitope (GAACAAAAACTCATCTCAGAAGAGGATCTG), Furin cleavage site (CGGGCCAAGCGG) and a 2A peptide (GGCAGTGGAGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT). The sequence for eGFP was based of the published sequence of eGFP. For pAAV-hUbc-Flex-F2A-eGFP a gBlock was synthesized containing the Furin cleavage site followed by the 2A site and eGFP. Detailed sequences are available upon request. For double-fluorescent in situ hybridization (FISH), wild-type C57Bl6 mice were dark-housed and light-exposed for 7.5 h as described above. After light exposure, the brains were dissected and fresh frozen in Tissue-Tek Cryo-OCT compound (Fisher Scientific) on dry ice and stored at −80 °C until use. FISH for Igf1 was essentially done as described28, 29: riboprobes were prepared by in vitro transcription of linearized plasmids containing the template of the respective probe. Riboprobes for Igf1 were labelled with UTP-11-Digoxigenin, while the riboprobes for the subtype markers (Gad1, Pvalb, Sst, Vip) were labelled with UTP-12-Fluorescein (Roche); all riboprobes were hydrolyzed to lengths of 200–400 bp after synthesis and validated for labelling with Dioxigenin or Fluorescein. For in situ hybridization, coronal sections (20 μm thick) of the visual cortex were cut on a cryostat and fixed in 4% paraformaldehyde for 10 min. Endogenous peroxidases were inactivated by treating the sections for 15 min in 0.3% H O in PBS, and acetylation was performed as described. Pre-hybridization was done overnight at room temperature, and hybridization was performed under stringent conditions at 71.5 °C. Following hybridization, stringency washes in SSC were performed as described at 65 °C. For immunological detection of the first probe (Igf1), the tissue was first treated with a blocking step for 1 h in blocking buffer (B2) at room temperature before the anti-Digoxigenin-POD antibody (Roche) was applied at a concentration of 1:1000 in blocking buffer for 1 h at room temperature. Following three washes in buffer B1 and an additional wash in buffer TNT (0.1 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.05% Tween20), the Igf1 probe was detected by exposing the sections at room temperature in the dark for 20 min to TSA Plus Cy3 reagent (Perkin Elmer) diluted 1:100 in TSA working solution, after which the sections were washed three times in TNT buffer. Before the immunological detection of the second probe, the peroxidases for detecting the first probe were inactivated by treating the sections for 30 min with 3% H O , followed by three washes in PBS. After an additional blocking step in blocking buffer for 1 h at room temperature, the anti-fluorescein-POD antibody (Roche) was applied at a concentration of 1:1000 in blocking buffer overnight at 4 °C. Following three washes in buffer B1 and an additional wash in buffer TNT, the probes of the subtype markers were detected by exposing the sections at room temperature in the dark for 15 min to TSA Plus Cy5 reagent (Perkin Elmer) diluted 1:100 in TSA working solution, after which the sections were washed three times in TNT buffer. Finally, the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole, Molecular Probes) and mounted using Fluoromount-G (Southern Biotech). In each experiment, controls for hybridization specificity were included (sense probe for Igf1) as well as controls for ensuring the specificity of the immunological detection of the digoxigenin- and fluorescein-labelled riboprobes. FISH for Crh, Prok2 and Fbln2 was done using the RNAscope system (Advanced Cell Diagnostic); this was necessary since no reliable signal could be detected with the method described above for Igf1 FISH using DIG-labelled riboprobes. RNAscope probes for all genes were synthesized by ACD and all experiments were done according to the ACD’s protocol for fresh frozen brain sections. For quantifying of the expression pattern of all genes of interest (GOI, that is, Igf1, Crh and Prok2; Fbln2 could not be detected reliably), the visual cortices in each section were imaged on a Zeiss Axio Imager microscope with a 10× objective and 3 × 5 fields-of-view were ‘stitched’ into one compound image; in all cases, image exposures were kept constant throughout a given experiment for each channel. Compound images of each visual cortex were then imported to Photoshop, and additional layers were created for each probe (that is, one layer for the GOI and one layer for the subtype marker in each compound image). The cells positive for each probe were then marked with a dot in the new respective layer by two independent investigators in a blinded manner (one investigator marking GOI-positive cells and the other investigator marking subtype-marker-positive cells). Finally, the layers containing the dots of the identified positive cells were compiled into a separate image file together with the DAPI-layer and imported into ImageJ. In ImageJ, the images were analysed in a blinded manner by defining the visual cortex and its layers as regions of interest (ROI) based on the DAPI staining and quantifying the number of cells positive for either one or both markers per ROI. For each combination of probes (GOI together with each of the subtype markers), two visual cortices from four animals were analysed (a total of eight visual cortices for each combination). Concentrated lentiviral stocks were prepared and titrated essentially as described30. AAV stocks were prepared at the University of North Carolina (UNC) Vector Core and at the Children’s Hospital Boston Vector Core; see also Supplementary Table 8 for further details on AAV stocks. Primary cultures of cortical neurons were prepared from E16.5 mouse embryos as described6. In brief, 3 × 105 neurons per well were plated in 24-well dishes coated with poly-d-lysine (20 μg ml−1) and laminin (3.4 μg ml−1). Cultures were maintained in neurobasal medium supplemented with B27 (Invitrogen), 1 mM l-glutamine, and 100 U ml−1 penicillin/streptomycin, and one-third of the media in each well was replaced every other day. For testing of viral shRNA constructs, the cultures were infected at DIV 3 with concentrated viral stocks for 5 h at an MOI of 6. After infection, the cultures were washed twice in plain neurobasal medium after which the conditioned medium was returned to the dish and the cultures were continued to be maintained as described. At DIV 7, neuronal cultures were treated overnight with 1 μM TTX and 100 μM AP-5 to silence spontaneous activity before the cultures were depolarized at DIV 8 with 55 mM extracellular KCl as described6 and lysed in TRIzol after 6 h of stimulation. HEK293T cells were used for testing the expression and the biological activity of the epitope-tagged IGF1.4 constructs. HEK293T cells were cultured in DMEM (Life Sciences) containing 10% FCS and penicillin/streptomycin. Cells were transfected using lipofectamine (Life Technologies) and 18 h post transfection, the medium was replaced with DMEM containing 0.1% FCS; 42 h post transfection, the conditioned media were collected, spun down to remove cell debris and used immediately for stimulating non-transfected HEK293T that were serum starved for 3 days in DMEM containing 0.1% FCS. The conditioned media were applied to the serum starved cells for 15 min at 37 °C after which the cells were lysed in boiling SDS sample buffer and subjected to Western blot analysis essentially as described6, 31. For detecting the (phosphorylated) IGF1-receptor, the following antibodies were used: anti-IGF1-receptor-β (D23H3) XP Rabbit mAb (#9750, Cell Signaling, 1:1000) and anti-phospho-IGF1-receptor-β (Tyr1135/1136)/Insulin Receptor β (Tyr1150/1151) (19H7) Rabbit mAb (#3024, Cell Signaling, 1:1000). For determining serum IGF1 levels, we used the IGF1 Quantikine ELISA kit (R&D Systems), following the manufacturer’s instructions (P3 Vip-cre heterozygous pups were injected intracortically with the respective AAV and bled at P20). Mice were anaesthetized with 10% ketamine and 1% xylazine in PBS by intraperitoneal injection. When fully anaesthetized, the animals were transcardially perfused with ice-cold PBS for 5 minutes followed by 15 minutes of cold 4% PFA in PBS. Brains were dissected and post-fixed for one hour at 4 °C in 4% PFA, followed by three washes (each for 30 min) in cold PBS, and cryoprotection overnight in 20% sucrose in PBS at 4 °C. The following day, brains were placed in Tissue-Tek Cryo-OCT compound (Fisher Scientific), frozen on dry ice and stored at −80 °C. Coronal sections (20 μm thick) of the visual cortices were subsequently cut using a Leica CM1950 cryostat and used for subsequent experiments. For immunolabelling, the slides were blocked for 1 h with PBS containing 5% normal goat serum and 0.1% Triton X-100 (blocking solution). The samples were incubated overnight with different primary antibodies diluted in blocking solution, washed three times with PBS and then incubated for 45 min at room temperature with secondary antibodies and/or Hoechst stain (ThermoFisher Scientific). Slides were mounted in FluoromountG (Southern Biotech) and imaged on a Zeiss Axio Imager microscope. The following antibodies were used: mouse anti-HA (HA-7, Sigma; 1:1000), chicken anti-GFP (GFP-1020, Aves labs ; 1:1500), goat anti-mouse IgG (H+L) Alexa Fluor 488 (Highly Cross-Adsorbed, Life Technologies; 1:1,000), goat anti-chicken IgY (H+L) Alexa Fluor 488 (Life Technologies; 1:1,000). For analysing the brains of Igf1 Vip-cre WT and cKO mice, brains of three-week-old WT and cKO littermates were placed on the same slide to minimize variation. After cryosectioning, the slides were either counterstained immediately or stored at −20 °C before they were counterstained and imaged. Counterstaining was done with DAPI (4′,6-diamidino-2-phenylindole, Molecular Probes) in PBS for 15–30 min at room temperature, after which the sections were washed once in PBS and mounted in Fluoromount-G (SouthernBiotech). For cell counting experiments, coronal visual cortex sections were imaged using a Zeiss Axio Imager microscope with a 10× objective and typically, 3 × 5 fields-of-view were ‘stitched’ into one compound image. In all cases, image exposures were kept constant throughout a given experiment for each channel. Custom ImageJ and MATLAB macros were used to quantify the area of each cortical layer, the number tdTomato-positive cells per layer, and the size of tdTomato-postive cells. Briefly, regions of interest (ROI) encompassing the visual cortex and its layers were defined based on the DAPI counterstaining. While the width of these ROIs was kept constant throughout the analysis of all sections, the height of the ROIs was adjusted in each image according to the DAPI counterstaining in each section and the areas of each layer in each section were recorded. For analysing the number and soma size of tdTomato-postive cells in each layer, a threshold for each channel was determined based on multiple user-defined negative regions. Channels were thresholded and binarized, and a mask of each channel was created. The number of tdTomato- positive cells was determined by taking the logical AND of the DAPI and tdTomato channel masks and counting the number of components greater than 4 pixels in size in the double overlap of the masks of the two channels in each layer ROI. The soma size was calculated as the area of these double-overlapping components. Three animals per genotype and 4–6 visual cortex sections per animal were analysed, and these data were used to determine the mean and s.e.m. of the values reported for each genotype. All surgeries were performed according to protocols approved by the Harvard University Standing Committee on Animal Care and were in accordance with federal guidelines. Surgeries were performed on mice between P14 and P15. Animals were deeply anaesthetized by inhalation of isoflurane (initially 3–5% in O , maintained with 1–2%) and secured in the stereotaxic apparatus (Kopf). Animal temperature was maintained at 37 °C. The fur was shaved and scalp cleaned with betadine and 100% ethanol three times before an incision was made to expose the skull. Injections into the visual cortex were made by drilling a ~0.5 mm burr hole (approximately 2.7 mm lateral, 0.5 mm anterior to lambda) through the skull, inserting a glass pipette to a depth of 200–400 μm and injecting 250 nl of the respective AAV construct at a rate of 100 nl min−1. Five minutes post-injection, the glass pipette was retracted, the scalp sutured and the mouse returned to its home cage. All animals were monitored for at least one hour post-surgery and at 12 h intervals for the next 5 days. Post-operatively, analgesic (flunixin, 2.5 mg per kg) was administered at 12 h intervals for 72 h. For neonatal injections, pups post-natal day 3–5 were anaesthetized on ice for 2–3 min, and secured to a stage where their head was supported using a clay mould using standard lab tape. A bevelled glass pipette was lowered into visual cortex (approximately 2 mm lateral, 0.2 mm anterior to lambda), and 50 nl of the respective AAV virus was injected at a rate of 23 nl sec−1. Injections were made into eight sites (four on each hemisphere), and the mouse was then allowed to recover on a 37 °C warm plate before being returned to the home cage. For bilateral stereotaxic intra-cortical injections of AAV constructs for visual plasticity experiments, surgeries were performed on mice between P18 and P20. Animals were anaesthetized with isofluorane gas (1–2% in O ), and body temperature was maintained at around 37 °C with a heating pad during surgery. The head was held in place by standard mouse stereotaxic frame. The fur was shaved and scalp cleaned with betadine and 100% ethanol three times before an incision was made to expose the skull. Burr holes were drilled into the skull at the point of injection guided by stereotaxic coordinates and blood vessel patterns (approximately 2 mm and 2.7 mm lateral, 0.5 mm anterior to lamba) on both hemispheres. A 28-gauge Hamilton syringe (701RN) was inserted to a depth of 200–300 μm and 250 nl of the respective AAV construct was injected at the rate of 50 ml min−1. Five minutes post-injection, the Hamilton syringe was retracted, the scalp sutured and the mouse returned to its home cage. All animals were monitored for at least one hour post-surgery. Post-operatively, analgesic (meloxicam, 5–10 mg kg−1) was administered every 24 h for 2 days. Coronal sections (300 μm thick) containing the primary visual cortex were cut from P19-P21 mice using a Leica VT1000S vibratome in ice-cold choline dissection media (25 mM NaHCO , 1.25 mM NaH PO , 2.5 mM KCl, 7 mM MgCl , 25 mM glucose, 0.5 mM CaCl , 110 mM choline chloride, 11.6 mM ascorbic acid, 3.1 mM pyruvic acid). Slices were incubated in artificial cerebral spinal fluid (ACSF, contains 127 mM NaCl, 25 mM NaHCO , 1.25 mM NaH PO , 2.5 mM KCl, 2.5 mM CaCl , 1 mM MgCl , 25 mM glucose) at 32 °C for 30 min immediately after cutting, and subsequently at room temperature. All solutions were saturated with 95% O /5% CO , and slices were used within 6 h of preparation. Whole-cell voltage-clamp recordings were performed in ACSF at room temperature from neurons in primary visual cortex that were identified under fluorescent and DIC optics. Recording pipettes were pulled from borosilicate glass capillary tubing with filaments using a P-1000 micropipette puller (Sutter Instruments) and yielded tips of 2–5.5 MΩ resistance. All experiments were recorded with pipettes filled with 135 mM caesium methanesulfonate, 15 mM HEPES, 0.5 mM EGTA, 5 mM TEA-Cl, 1 mM MgCl , 0.16 mM CaCl , 2 mM Mg-ATP, 0.3 mM Na-GTP, 10 mM phosphocreatine (Tris), and 2 mM QX-314-Cl. Osmolarity and pH were adjusted to 310 mOsm and 7.3 with Millipore water and CsOH, respectively. Recordings were sampled at 20 kHz and filtered at 2 kHz. mEPSCs were isolated by holding neurons at −70 mV and exposing them to 0.5 μM tetrodotoxin, 50 μM picrotoxin and 25 μM cyclothiazide and were blocked by application of 25 μM NBQX and 50 μM CPP. mIPSCs were isolated by holding neurons at 0 mV and exposing them to 0.5 μM tetrodotoxin, 25 μM NBQX, and 50 μM CPP and were blocked by 50 μM picrotoxin. Data were acquired using either Clampex10 or custom MATLAB software, using either an Axopatch 200B or Multiclamp 700B amplifier, and digitized with a DigiData 1440 data acquisition board (Axon Instruments) or a PCIe-6323 (National Instruments). For measuring miniature postsynaptic currents (minis), cells were allowed to stabilize for at least two minutes. For paired pulse experiments, no drugs were used in the ACSF. A stimulating electrode (ISO-Flex, A.M.P.I.) was positioned approximately 100 μm below the cell, and 0.1 ms electrical pulses were given while adjusting the stimulus intensity and electrode position until the first pulse was between 100 and 500 pA. Inter-stimulus interval was varied and 10 s elapsed between each sweep. Pulse amplitudes were obtained from average sweeps of at least ten trials. Cells were held at 0 mV to record IPSCs and −70 mV to record EPSCs. For evoked IPSCs, no drugs were used in the ACSF. Simultaneous paired whole-cell recordings were obtained from an eGFP-expressing VIP neuron and a morphologically identified pyramidal neuron located not more than five cell bodies away from the VIP neuron. Both cells were held at 0 mV, and a 5 ms light pulse from a blue LED (Thorlabs) was used to evoke IPSCs. Light intensity and the objective position were varied until the VIP neuron IPSC amplitude was between 200 and 500 pA. Average light power at 470 nm varied from between 0.3 and 0.7 mW over the course of the experiment. Reported ratios were obtained by dividing IPSC amplitudes obtained from an average trace of at least ten trials. For electrophysiology experiments, n was set to min n = 10 to detect 20% effect size with power 0.95. For experiments to determine average firing rate of VIP neurons, a modified ACSF that promotes increased action potential firing was used containing, 3.5 mM KCl and 0.8 mM CaCl . Cell-attached patch recordings were obtained from eGFP-positive cells. Cells that did not fire an action potential in the first 30 s of recording were discarded, and recordings were maintained for at least 30 ten-second sweeps. Average firing rate was determined from the first sweep to the last recorded sweep in which an action potential occurred. Miniature IPSC and EPSC data were analysed using Axograph X. Events were identified using a variable amplitude template-based strategy. Templates for each event type were defined as follows: mEPSC: 0.25 ms rise time, 3 ms decay τ, amplitude threshold of −3 × s.d. local noise; mIPSC: 1 ms rise time, 50 ms decay τ, amplitude threshold of 2.5 × s.d. local noise. Local noise was determined by calculating the standard deviation of the current in a 5 ms window before event rise onset. Templates lengths extended 25 ms after rise onset in the case of mEPSCs and 50 ms after rise onset in the case of mIPSCs. Events were discarded if they had a rise time outside the range of 0–3 ms. Statistical significance for all recorded parameters between genotypes was evaluated using a Mann–Whitney U-test on the mean values from individual neurons in a given experiment. Minis were additionally evaluated for significance using both a Kolmogorov–Smirnov test (KS test) and Monte Carlo test. For these tests, 50 random minis were sampled from each neuron in each condition to obtain a continuous distribution for each condition that equally weighted each cell in that condition: these distributions are the data shown in the cumulative distribution graphs. One hundred random events were randomly sampled from these distributions for a KS test; and for Monte Carlo tests, 100 random events were randomly sampled from each distribution 1,000 times (with replacement), and the means were compared. All significant differences in mini amplitude and frequency were found to be significant by Monte Carlo test, KS test, and Mann–Whitney U-test of cell means. Since the Mann–Whitney test was found to be the most stringent test, the P values from Mann–Whitney tests are reported. All data was analysed blind to genotype or experimental condition. In all conditions, series resistance, holding potential, cell capacitance, and input resistance were recorded and were not found to be significantly different except where noted. Statistical tests were performed using Graphpad Prism and MATLAB. VIP neurons were filled with a patch pipette containing 1% Alexa 647 Hydrazide and the internal solution was allowed to dialyze for at least 30 min before slices were fixed in 4% paraformaldehyde for 1 h at room temperature. Slices were then washed three times for 30 min in PBS before slices were mounted in Fluormount-G (Southern Biotech). Images were acquired using a Zeiss Axio Imager microscope with a 20× objective with the use of an Apotome (Zeiss). Neurons were reconstructed using NeuronJ (ImageJ), and Sholl analysis was performed using a custom script in MATLAB. Eyelids were trimmed and sutured under isoflurane anaesthesia (1–2% in O ) as previously described31. The integrity of the suture was checked daily and mice were used only if the eyelids remained closed throughout the duration of the deprivation period. One eye was closed for 4 days starting between P26 to P28. The eyelids were reopened immediately before recording, and the pupil was checked for clarity. VEPs were recorded from anaesthetized mice (50 mg kg−1 Nembutal and 0.12 mg chlorprothixene) using standard techniques described previously32. The contra- and the ipsilateral eye of the mouse were presented with horizontal black and white sinusoidal bars that alternated contrast (100%) at 2 Hz. A tungsten electrode was inserted into the binocular visual cortex at 2.8 mm from the midline where the visual receptive field was approximately 20° from the vertical meridian. VEPs were recorded by filtering the signal from 0.1–100 Hz and amplifying 10,000 times. VEPs were measured at the cortical depth where the largest amplitude signal was obtained in response to a 0.05 c.p.d. stimulus (400–600 μm); 3–4 repetitions of 20 trials each were averaged in synchrony with the abrupt contrast reversal. The signal was baseline corrected to the mean voltage of the first 50 ms post-stimulus-onset. VEP amplitude was calculated by finding the minimum voltage (negative peak) within a 50–150 ms post-stimulus-onset time window. Acuity was calculated only from the deprived eye. For each different spatial frequency, 3–4 repetitions of 20 trials each were averaged in synchrony with the abrupt contrast reversal. VEP amplitude was plotted against the log of the different spatial frequency, and the threshold of visual acuity was determined by linear extrapolation to 0 μV. Igf1 conditional knockout mice15, Ai9 tdTomato reporter mice33, Emx1-cre34, Pv-cre35, Gad2-cre, Sst-cre, Vip-cre36 and RiboTag mice8 are available from The Jackson Laboratory. For routine experimentation, animals were genotyped using a PCR-based strategy; PCR primer sequences are available at the The Jackson Laboratory’s website. For RiboTag experiments, mice homozygous for the RiboTag allele were crossed to mice homozygous for the cre allele and all experiments were performed with mice double heterozygous for both the RiboTag and the cre alleles. For Igf1 cKO experiments, mice heterozygous for the Igf1 conditional allele (Igf1fl/WT) and homozygous for the Vip-cre allele were crossed to mice heterozygous for the Igf1 conditional allele and homozygous for the tdTomato reporter allele. Resulting littermates all had one copy of the Vip-cre transgene and the tdTomato Cre reporter and yielded Igf1WT/WT and Igf1fl/fl littermates for experimentation. For injections of AAV constructs in the visual cortices of Cre mice (Vip-, Pv-, Sst-, or Emx1-cre), mice homozygous for the cre allele were crossed to wild-type C57Bl6 mice and offspring heterozygous for the cre allele were used for experiments. The use of animals was approved by the Animal Care and Use Committee of Harvard Medical School and/or the University of California Berkeley.


News Article | February 15, 2017
Site: www.businesswire.com

Today Euronext (Paris:ENX) (Amsterdam:ENX) (Brussels:ENX) announced its results for the full year 2016. “The Euronext team is proud of the results we announce today for 2016. In a year marked by lower volumes on our markets that induced, as guided with our Q3 2016 results, a 4.3% decrease in revenue, we have managed to maintain our EBITDA in absolute terms stable compared to last year. Our cost base has been significantly reduced, and is now fully covered by our non-volume related revenue only. As a result, our profitability and EPS increased significantly and we are in a position to propose for the approval of our Annual General Meeting on 19 May 2017, based on our consistent dividend policy, the payment of a dividend of €1.42 per share, increased by 14.5% compared to last year. These results demonstrate Euronext’s continuous capability to service our shareholders and customers, and to deliver value against a tough trading environment. 2017 will be a critical year for our industry landscape. We will remain focused on executing our Agility for Growth strategy and maximizing opportunities that may arise, as we did with the agreement to potentially acquire LCH.Clearnet S.A.,” said Stéphane Boujnah, Chairman and CEO of the Managing Board of Euronext NV. The year 2016 was marked by a down-trend in volatility, both for cash and derivatives markets, with some volatility spikes around the UK referendum in June and the US elections in November. Ongoing uncertainty also resulted in low activity on primary markets. As a result, revenue for the full-year decreased by -4.3% to €496.4 million (2015: €518.5 million). As a reminder, 2015 was the strongest year since 2008, both in terms of trading volumes and in terms of primary markets activity. This performance results from the strict execution of our strategic plan with €15.6 million of cost savings since Q2 2016. The level of operational expenses has been reduced by some reversal of accruals for a total amount of €3.3 million. The onboarding of costs, linked to the execution of the growth initiatives, ramped up after the summer break, impacting the cost base of the Company by €2.1 million for the full year 2016 and generating €0.8 million of revenue. The relocation of our IT operations from Belfast to Porto is nearly complete, with 88 people hired in Porto, while the closure of the Belfast office will be effective at the end of Q1 2017. This strong focus on costs has allowed us to contain the impact of the reduced revenue on EBITDA, which remained stable in 2016, to €283.9 million, representing a margin of 57.2% (2015: 54.7% or €283.8 million). Depreciation and Amortization decreased by -11.6% in 2016, to €15.1 million (2015: €17.1 million). The impact of the end of the accelerated depreciation of assets, resulting from relocations of our offices in Belgium and France, and of the roll-out of a portion of UTP amortization were partially offset by the start of Interbolsa T2S project depreciation in Q3 2016. Operating profit before exceptional items was €268.8 million, an increase of +0.8% compared to 2015 (€266.8 million). €10.0 million of exceptional items were booked in 2016 compared to €28.7 million in 2015. These costs consisted mainly of M&A related costs, for €3.3 million, and of restructuring costs for €7.1 million in 2016. In 2015 some reversal of provision related to Cannon Bridge House premises for €14.4 million had partially compensated the €35.0 million of restructuring costs. Results from equity investment increased by 29.8% in 2016, to €6.0 million (2015: €4.6 million), due to the increase in dividends paid by Euroclear (both direct and indirect stakes), and to €0.7 million of dividend paid this year by LCH Group (2015: zero). Income tax for the full year 2016 was €67.0 million, representing an effective tax rate for the year of 25.4% (2015: 27.6%), both years being impacted by the release of tax provisions (€16.3 million in 2016 and €13.9 million in 2015). As a result, the net profit for 2016 increased by 14.1%, to €197.0 million (2015: €172.7 million). This represents an EPS (basic) of € 2.83 (€2.82 fully diluted) in 2016 compared to €2.47 (€2.46 fully diluted) in 2015. The number of shares used for the basic calculation was 69,526,615 for 2016, compared to 69,851,603 in 2015. As of 31 December 2016, the Company had cash and cash equivalents of €174.5 million, and total debt of €69.1 million, after the partial debt repayment of €40 million in Q3 2016 and the €86.2 million dividend payment in Q2 2016. Revenue was €68.7 million in 2016, a decrease of -2.6% compared to the €70.5 million achieved in 2015. This decrease was driven by the fall in IPO fees and reduced listing fees for ETPs in comparison with 2015. In 2015, large transactions such as Lafarge-Holcim, Altice, Amundi and ABN Amro were key contributors to the listing revenue performance. In 2016 much uncertainty and volatility induced low activity on primary markets even though two benchmark transactions took place on our market (Coca Cola European Partners and AB Inbev). 28 new listings took place in 2016, raising €3.7 billion, compared to 52 listings for €12.4 billion during 2015, due to the uncertainty created by various global factors throughout the year (UK referendum in June, US elections in November, etc.). Euronext continued to be the venue of choice for Tech SMEs. Although the number of new SME listings decreased from 36 in 2015 to 23 in 2016, these companies raised €1,430 million in 2016 compared to €1,337 million in 2015. Amongst these listings, Euronext markets registered interesting small and mid cap deals in 2016, confirming the relevance of its strategy and its willingness to develop specific offers for these kinds of companies: Maisons du Monde (a regional based mid-cap furniture company), Nextstage (the first listing of a private equity fund on Euronext Paris) as well as Geneuro and Noxxon Pharma (listing of a Swiss and a German Biotech). In 2016, Euronext saw an all time high on secondary issues, to €56.4 billion, up 72% compared to €32.9 billion in 2015. Debt capital markets issuance also increased in 2016, with €80.6 billion raised by corporates on our markets in 2016 vs €66.4 billion in 2015. In total €140.7 billion in equity and debt was raised on our markets in 2016, compared to €111.7 billion in 2015. Full-year 2016 volumes in Cash Trading were down due to the macro factors mentioned above, translating into reduced investor confidence post Brexit and lower volatility, particularly in Q3. Average daily volumes were € 7.0 billion (-15.3% compared to 2015). However, efficient yield management enabled us to partially de-correlate revenue from volumes, thus minimising the impact on our top line. Yield averaged 0.50 bps in 2016, compared to 0.47 bps in 2015, a +7.8% increase. Revenue for the full-year is down by -8.4% to €180.7 million (2015: €197.2 million). Average market share for the year was 61.0%. The year ended strongly with December market share at 65.2%, following lows in October at 58.6% as a result of the launch of several initiatives (notably new fee scheme for non-member proprietary flow and a new best execution service for retail investors). Average market share in 2015 was 63.5%, in a context of buoyant market activity. Activity on ETFs followed a similar trend, with an average daily transaction value at €554 million, down 9.7% compared to €613 million in 2015. However, we recorded a record number of new ETFs listed on our markets, at 137, bringing the total number of ETFs listed on our markets at 790 by year end (up +13.5% versus end of 2015: 696). Our client alignment is demonstrated by Euronext winning four awards during 2016, being consistently recognised as the Best ETF Exchange in Europe. A new issuer, UBS AG has been onboarded in January 2016. Derivatives trading revenue decreased by -9.8% in 2016 compared to 2015, amounting to €40.1 million (2015: €44.5 million) as a result of the lower volatility . Index product trading volumes declined by -9.8% in 2016 compared to 2015 (average daily volumes of 214,520 lots in 2016 vs 237,881 in 2015). Trading activity on our individual equity options franchise decreased by -5.2% during 2016 compared to 2015 as market volatility was higher last year (average daily volumes was 222,942 lots in 2016 vs 235,135 in 2015). A materially sub-standard 2016 French wheat harvest have impacted volumes in commodity products that declined by -4.1% in 2016 compared to 2015 (average daily volumes of 53,536 lots in 2016 vs 55,843 lots in 2015). Market data and indices revenue delivered a strong performance in 2016 with revenue up + 6.0% compared to 2015, to €105.7 million (2015: €99.8 million), benefiting from the positive impact of the new products and services launched during the course of 2015 as well as from some fee adjustments. Consistent with the trend in derivatives trading mentioned above, clearing revenue decreased by -7.6%, from €51.9 million in 2015 to €48.0 million in 2016. Revenue from Interbolsa in Portugal in 2016 was €19.6 million; stable compared to the €19.7 million achieved in 2015. Revenue from market solutions decreased by -3.3% in 2016, to €33.0 million (2015: €34.1 million). The decrease in software solution revenue during transition to Optiq platform was partially offset by the introduction of a new Market Abuse Regulation compliance service in July. For comparative purposes, the company provides unaudited non-IFRS measures including: We define the non-IFRS measures as follows: Non-IFRS financial measures are not meant to be considered in isolation or as a substitute for comparable IFRS measures and should be read only in conjunction with the consolidated financial statements. Update on the Agility for Growth plan Since the publication of its strategic plan in May 2016, Euronext has started the deployment of the Agility for Growth plan and has achieved a number of significant milestones. 2016 has been a year of intense focus on our technology capabilities. The relocation of IT operations from Belfast to Porto is being delivered on time and within budget. As of 31 December 2016, 88 people had been onboarded in Porto and the Belfast office will be closed, as planned, at the end of Q1 2017. Over time this will enable us to operate more efficiently at lower cost. The development of Optiq, our new trading platform, is taking shape. The customer test platform opened as scheduled in November 2016 for market data. The launch of the new market data infrastructure for cash and derivatives products is scheduled for May 2017. The migration to Optiq for the cash businesses will be completed in October 2017 and will include MiFID II compliance. By the end of 2016, Euronext already achieved 70% of the gross cost reduction programme (based on 2016 cost base that was also reduced by €3.3 million of non-recurring reversals of accruals), thanks to strong cost discipline and due to fact that the onboarding of costs related to the growth initiatives started only after the summer break. Euronext has begun enhancing its agility, demonstrated by a number of product launches leveraging the regulatory environment, to help clients comply with major changes implied by MiFID II or MAR. Thanks to reinforced client centricity, Euronext also identified selected opportunities that translate into innovative projects such as the involvement in a Blockchain consortium and new areas of business, evidenced by the expansion of our fixed income offering. In addition Euronext announced several milestones that will strengthen its core business: The Agility for Growth strategic plan is already bearing its first fruits and delivering enhanced shareholder value. If approved during the Annual General Meeting on 19 May 2017, the dividend paid of €1.42 per share will represent an increase of 14.5% compared to the dividend paid last year. Stronger profitability combined with consistent dividend policy translates into increased shareholder remuneration while Euronext maintains significant flexibility to deploy capital. 2016 has been the first year of capital deployment since IPO; Euronext will pursue the implementation of its strategy in 2017 where organic milestones and various products and services launches will be combined with additional acquisitions and partnerships. Euronext is the leading pan-European exchange in the Eurozone with more than 1,300 listed issuers worth close to €3.3 trillion in market capitalisation as of end December 2016, an unmatched blue chip franchise consisting of 25 issuers in the EURO STOXX 50® benchmark and a strong diverse domestic and international client base. Euronext operates regulated and transparent equity and derivatives markets. Its total product offering includes Equities, Exchange Traded Funds, Warrants & Certificates, Bonds, Derivatives, Commodities and Indices. Euronext also leverages its expertise in running markets by providing technology and managed services to third parties. Euronext operates regulated markets, Alternext and the Free Market; in addition it offers EnterNext, which facilitates SMEs’ access to capital markets. For the latest news, find us on Twitter (twitter.com/euronext) and LinkedIn (linkedin.com/euronext). This press release is for information purposes only and is not a recommendation to engage in investment activities. This press release is provided “as is” without representation or warranty of any kind. While all reasonable care has been taken to ensure the accuracy of the content, Euronext does not guarantee its accuracy or completeness. Euronext will not be held liable for any loss or damages of any nature ensuing from using, trusting or acting on information provided. No information set out or referred to in this publication may be regarded as creating any right or obligation. The creation of rights and obligations in respect of financial products that are traded on the exchanges operated by Euronext’s subsidiaries shall depend solely on the applicable rules of the market operator. All proprietary rights and interest in or connected with this publication shall vest in Euronext. This press release speaks only as of this date. Euronext refers to Euronext N.V. and its affiliates. Information regarding trademarks and intellectual property rights of Euronext is located at www.euronext.com/terms-use.


Research and Markets has announced the addition of the "Global Automotive Connectors Market 2016-2020" report to their offering. The global automotive connectors market to grow at a CAGR of 8.12% during the period 2016-2020. The report covers the present scenario and the growth prospects of the global automotive connectors market for 2016-2020. To calculate the market size, the report considers the revenue generated from the sale of automotive connectors. The report covers the market landscape and its growth prospects over the coming years. The report also includes a discussion of the key vendors operating in this market. One of latest trends in the market is induction of high-end optical fibers into automobile sector. Traditional cars used the crimp and poke connector system owing to its simplified architecture for wiring harnesses. However, as the demand for driver support systems such as ADAS and ESC increased, traditional connector system could no longer provide the bandwidth. This gave rise to the development of other complex architecture for wiring harnesses such as UTP and STP. According to the report, one of the primary drivers in the market is rising demand for high-speed connectivity solutions in automobiles. Earlier, automobiles consisted of more mechanical components than electronic components. However, in the recent years, the electronic content per vehicle has increased to more than 50% in some vehicles. This is due to the increased adoption of advanced safety features and powertrain electrification. Modern-day vehicles have an array of sensors installed in them. This has led to the development of more complex safety systems. Further, the report states that one major challenge in the market is rising labor cost in low-cost manufacturing countries. One such means to optimize cost was to outsource manufacturing activities to countries, such as China, Taiwan, South Korea, and India, which have low-cost labor. These countries are among the largest manufacturers of automotive connectors in the world. The primary reason for the high concentration of automotive connectors manufacturers in these countries is attributed to the drastic shift of electronic manufacturing units to these countries from developed countries such as the US and the UK. For more information about this report visit http://www.researchandmarkets.com/research/6fr9kr/global_automotive


News Article | February 23, 2017
Site: www.businesswire.com

NAPERVILLE, Ill.--(BUSINESS WIRE)--Coriant, a global supplier of SDN-enabled end-to-end packet optical networking and DCI solutions, today announced that PT Telekomunikasi Indonesia, Tbk (Telkom) has deployed Coriant’s best-in-class coherent optical transport and universal switching technology as part of a nationwide upgrade to its fiber-based backbone network. Completed at the end of 2016, the network modernization initiative will improve the performance and increase the capacity of Telkom’s terrestrial and subsea optical transport infrastructure to meet growing demand for high-bandwidth mobile and fixed line services and applications. “We continue to transform our network infrastructure with cutting-edge technologies to provide the best digital experience for our customers,” said Agus Subandrio, Deputy EGM of Backbone and Core Network Planning and Deployment, Telkom. “With growing demand for data in Indonesia and across the Southeast Asia region, Coriant’s advanced traffic grooming, switching, and transport solution will play a key role in our ability to cost-efficiently scale backbone capacity and deliver an uninterrupted quality of service under any network condition.” The Coriant solution enables Telkom to seamlessly scale its DWDM infrastructure to 100G per channel without replacing existing transmission systems. In addition to terrestrial 100G backbone upgrades, the combination of the industry-leading Coriant® hiT 7300 Multi-Haul Transport Platform and Coriant CloudWave™ Optics coherent interface technology enables Telkom to further boost capacity on its JASUKA undersea cable, which provides high-speed connectivity amongst Java, Sumatera, and Kalimantan islands. Initial implementation includes operational deployment of sixteen 100G optical channels across an unrepeatered and DCM-free subsea transmission distance of over 350 kilometers between Dumai and Dangas. The Telkom nationwide upgrade project includes expanded deployment of the Coriant® mTera® Universal Transport Platform to optimize service traffic and maximize utilization of fiber assets as the network scales. The mTera® UTP is an extremely flexible multi-service transport solution that supports software-defined Universal Switching, including OTN, Carrier Ethernet, MPLS-TP and SONET/SDH in a single, power-efficient system architecture. To simplify capacity provisioning and efficiently manage service traffic across the multi-domain Coriant optical transport network, Telkom is using the Coriant® Transport Network Management System (TNMS), a robust management platform that helps service providers reduce OpEx and CapEx expenses through sophisticated end-to-end network control, automated provisioning features, and advanced planning capabilities. “Telkom remains a premier provider of fixed and mobile network services in the region, and we are pleased to help them address the challenges of backbone traffic growth with the latest innovations in our end-to-end packet optical transport solutions portfolio,” said Tarcisio Ribeiro, Executive Vice President and Chief Commercial and Marketing Officer, Coriant. Coriant will showcase the new 7300 OLS and its complete portfolio of SDN-enabled Smart Router and Packet Optical Transport Solutions at Mobile World Congress 2017 in Barcelona from February 27 – March 2 (Hall 2, Stand 2I30). From performance-based multi-layer network optimization to purpose-built metro and long haul DCI, Coriant will demonstrate a broad range of networking solutions that help operators realize the business value of intelligent, open, and highly-programmable networks optimized for the hyperscale generation. Coriant delivers innovative and dynamic networking solutions for a fast-changing and cloud-centric business world. The Coriant portfolio of SDN-enabled, edge-to-core packet optical networking and DCI solutions enables network operators to cost-efficiently scale network capacity, reduce operational complexity, and create the resilient foundation for a new generation of mobile, video, and cloud services. Coriant serves leading network operators around the world, including mobile and fixed line service providers, cloud and data center operators, Web 2.0 content providers, cable MSOs, government agencies, and large enterprises. With a distinguished heritage of technology innovation and service excellence, Coriant is helping its global customers maximize the value of their network infrastructure as demand for bandwidth explodes and the communications needs of businesses and consumers continue to evolve. Learn more at www.coriant.com and follow us on Twitter for the latest @Coriant news and information.


News Article | August 31, 2016
Site: www.nature.com

In every living cell, a large macromolecular complex called the ribosome is responsible for translating messenger RNA into amino-acid chains in the cytoplasm. A mature ribosome contains about 80 ribosomal proteins (r-proteins) and four ribosomal RNAs (rRNAs). Yet the construction of a ribosome is mediated by many more proteins and RNA molecules within large dynamic pre-ribosomal complexes. Writing in Cell, Kornprobst et al.1 report that they have exploited advances in cryo-electron microscopy2 to resolve the structure of the earliest pre-ribosome, the 90S, to a near-atomic resolution of between 4 and 7 ångströms. The structure reveals, for the first time and in stunning detail, the arrangement of and interactions between many proteins that have been implicated in ribosome assembly, shedding light on a crucial step in early ribosome formation. In 1967, it was discovered3 that, in eukaryotic organisms (those whose cells carry a nucleus), a long RNA transcript called the pre-rRNA undergoes processing in a nuclear compartment, the nucleolus, to produce three of the four rRNAs found in the mature ribosome. An analysis4 later that year of ribosomes isolated from human nuclei, and a comparison5 of cytoplasmic and nuclear ribosomes in 1972, revealed that nuclear ribosomes contain many more proteins than do their cytoplasmic counterparts. These extra proteins were hypothesized to help process the pre-rRNA. Since then, the steps of pre-rRNA processing have been established and most of the extra proteins (now called ribosome biogenesis factors) have been identified, thanks to advances in biochemistry and mass spectrometry. During its transcription, the long pre-rRNA is assembled with r-proteins, ribosome biogenesis factors and small nucleolar RNAs to form a large 90S pre-ribosome. Following the first stage of pre-rRNA processing, the complex splits into two pre-ribosomes, dubbed pre-40S and pre-60S, which are eventually exported to the cytoplasm where they undergo further maturation steps and then join as 40S and 60S subunits to form the mature ribosome. Along with the identities of the biogenesis factors came the realization that they numbered a vast 200 to 300 in eukaryotes6, 7. In the yeast Saccharomyces cerevisiae, the 90S pre-ribosome alone contains about 70 ribosome biogenesis factors — almost as many as the number of proteins in a mature ribosome6. Hence, a recurring question in the field is: why does ribosome production require so many accessory proteins? By resolving the structure of the 90S pre-ribosome in the yeast Chaetomium thermophilum, Kornprobst et al. provide an answer to this question. The authors identified features in their structure by fitting data from previous biochemical and genetic studies (including X-ray structures of several proteins, predicted protein-domain structures and known protein–protein and protein–pre-rRNA interactions) to determine where different proteins and RNAs are located in the 90S complex. The requirement for so many extra proteins is explained by the authors' observation that many accessory proteins are arranged around the folded pre-rRNA molecule in previously defined8 multi-protein complexes called UTP-A, UTP-B and UTP-C. Of these, UTP-A and UTP-B form a scaffold, within which the newly transcribed pre-rRNA is encased and so can be securely processed, modified and assembled with r-proteins (Fig. 1). The role of this scaffold is reminiscent of the way in which chaperone proteins aid folding of other proteins — a common process that prevents aggregation of proteins into non-functional structures. But although chaperone-mediated protein folding has been long established9, the idea of chaperone moulds is new to RNA biology. The 90S chaperone mould also includes the small nucleolar ribonucleoprotein complex U3 — an RNA–protein complex that has known roles in pre-rRNA processing and folding10, 11. Kornprobst et al. showed that one half of U3 spans the outer body of the 90S complex in a scaffold-like arrangement, whereas the other half is buried deep within the 90S, presumably interacting with the pre-rRNA. This part of U3 is associated with a region at the end of the pre-rRNA called the 5′ external transcribed spacer (5′-ETS), and the authors demonstrated that cleavage of this spacer from the pre-rRNA is crucial for the separation of the processed 90S pre-rRNAs into pre-40S and pre-60S complexes, and the progression of ribosome production. Kornprobst and colleagues also identified the position of the pre-18S rRNA (which will become the rRNA component of the 40S subunit) in their structure. When comparing the pre-18S structure with that of the mature 18S rRNA, the authors observed that the molecule underwent progressive folding, beginning in the domains closest to the site where transcription began. In the 90S, these regions were folded to resemble the mature 18S, whereas domains farther from the transcriptional start site were seemingly still in transitory states. This observation fits well with a previous model6 of hierarchical rRNA assembly. Kornprobst and colleagues have visualized in detail what, until now, has been seen through electron microscopy only as small black balls on strings of pre-rRNA. Holding a magnifying glass to the early steps of ribosome biogenesis, the authors have finally revealed a role for the multitude of ribosome biogenesis factors as a chaperone mould that provides a secure environment for the processing and folding of pre-rRNA. The 90S pre-ribosome contains the entire rRNA precursor, which includes several transcribed spacer sequences that will be cleaved away, and sequences that will give rise to the rRNAs of the 60S ribosomal subunit. However, Kornprobst et al. focused on only the rRNA region and the proteins that give rise to the 40S subunit. As such, many questions about 60S formation remain unanswered — for instance, whether a separate chaperone-like mould encases these other regions of the pre-rRNA. There are several structures visible in 90S that have not yet been identified. In years to come, it will be interesting to index these features and further unravel the role of the UTP-C complex and other proteins in 90S pre-rRNA maturation. Using the technical advances highlighted in the current study, we can hope to shed more light on the dynamic and multi-tiered process that is ribosome formation.


Hod Hasharon (Israel) et Genève (Suisse), le 2 novembre 2016 -  Valens et STMicroelectronics annoncent leur collaboration en vue d'intégrer la technologie HDBaseT Automotive dans la prochaine génération de véhicules automobiles connectés. Cette technologie à haut rendement optimise la connectivité à bord des véhicules en transmettant des informations à haut débit d'infotainment, de sécurité routière et de contrôle automobile au débit de 6 Gbits/s sur une infrastructure à faible coût et avec un temps de latence quasiment nul. Valens, inventeur du HDBaseT et fondateur de l'Alliance HDBaseT, apporte sa technologie et son expertise pour atteindre la commercialisation de véhicules dotés de la technologie HDBaseT. STMicroelectronics apporte son savoir-faire et sa vaste expérience de la conception et de la fabrication conformément aux très strictes exigences de qualité et de fiabilité de l'industrie automobile. « Notre longue expérience au service de l'industrie automobile et notre stratégie en faveur du Smart Driving nous ont  convaincus du potentiel du HDBaseT Automotive, une technologie à haut débit et faible temps de latence dotée pour un coût peu élevé. C'est pourquoi nous sommes heureux de nous associer à ce projet et d'aider Valens à lancer la technologie et les produits HDBaseT Automotive sur le marché avec les plus hauts niveaux de qualité et de fiabilité possibles », a déclaré Fabio Marchio, Directeur Général de la division Automotive Digital de STMicroelectronics. La technologie HDBaseT Automotive est actuellement la seule technologie capable d'acheminer des signaux vidéo, audio, données, USB, etc. à un débit pouvant atteindre 6 Gbits/s avec des capacités de connexion natives via un unique câble à paires torsadées non blindé (UTP) sur une distance pouvant atteindre 15 mètres. Cette technologie autorise également la connexion en cascade (daisy chaining) et la lecture en multistreaming, ce qui simplifie et optimise la connectivité à bord des véhicules. Pour de plus amples informations sur la solution HDBaseT Automotive de Valens, cliquez ici. Créée en 2006, la société Valens fournit des circuits intégrés conçus pour diffuser des contenus multimédias ultra-haute définition (HD) non compressés. Sa technologie HDBaseT permet de connecter des produits sur une longue distance via un unique câble et représente un standard mondial pour la distribution avancée de médias numériques. Valens est une entreprise privée dont le siège est situé en Israël. Pour plus d'informations, visitez le site www.valens.com. ST, un leader mondial sur le marché des semiconducteurs, fournit des produits et des solutions intelligents qui consomment peu d'énergie et sont au coeur de l'électronique que chacun utilise au quotidien. Les produits de ST sont présents partout, et avec nos clients, nous contribuons à rendre la conduite automobile, les usines, les villes et les habitations plus intelligentes et à développer les nouvelles générations d'appareils mobiles et de l'Internet des objets.

Loading UTP collaborators
Loading UTP collaborators