UCD

Davis, CA, United States
Davis, CA, United States
SEARCH FILTERS
Time filter
Source Type

News Article | May 8, 2017
Site: www.eurekalert.org

The digging, stirring and overturning of soil by conventional ploughing in tillage farming is severely damaging earthworm populations around the world, say scientists. The findings published in the scientific journal Global Change Biology show a systematic decline in earthworm populations in soils that are ploughed every year. The deeper the soil is disturbed the more harmful it is for the earthworms. The scientists from the University of Vigo, Spain, and University College Dublin, Ireland, analysed 215 field studies from across 40 countries dating back as far as 1950. Each of the studies investigated earthworm populations under conventional tillage and other forms of reduced tillage. "What we see is a systematic decline in the earthworm population in the soil after continued ploughing and a significant increase in the abundance of earthworms in less disturbed soil, although some soils would need more than 10 years to show good signs of recovery" says Associate Professor Olaf Schmidt, from the UCD School of Agriculture and Food Science, University College Dublin. According to the findings, the earthworm populations most vulnerable to tillage are larger earthworms that move between layers of soil and create permanent burrows between them (anecic earthworms). Small earthworms that live in the top layers of soil and convert debris to topsoil (epigeic earthworms) were also found to be highly susceptible. Farming practices that involve no-tillage, Conservation Agriculture and shallow non-inversion tillage were shown to significantly increase earthworm populations. The scientists note that these reduced tillage practices are increasingly being adopted world-wide due to their environmental benefits in terms of erosion control and soil protection. "Our study also identifies the conditions under which earthworms respond most to a reduction in tillage intensity. These findings can be translated into advice for farmers in different parts of the world", explains Professor Maria Briones from the University of Vigo. "For example, strong results are achieved in soils with higher clay contents (>35%) and low pH ( Earthworms are critical to the maintenance of soil functions and the ecosystem services we expect from them. The great evolutionary biologist, Charles Darwin called earthworms "nature's plough" because they continually consume and defecate soil enhancing its fertility in the process. In his experiments in England in the late 1800s, Darwin found about 54,000 earthworms inhabited each acre of land and that each of these populations turn over tens of tons of topsoil every year. Recognizing the critical ecological value of earthworms, Darwin wrote: "It may be doubted whether there are any other animals which have played so important a part in the history of the world as have these lowly, organized creatures." Professor Maria Briones concludes "Switching to reduced tillage practices is a win-win situation for farmers because they save costs and in return larger earthworm populations help in soil structure maintenance and nutrient cycling."


News Article | May 16, 2017
Site: www.businesswire.com

CAMBRIDGE, Mass. & AUSTIN, Texas--(BUSINESS WIRE)--Privately held Synlogic, Inc., has entered into a definitive merger agreement with Mirna Therapeutics, Inc. (NASDAQ:MIRN) under which Synlogic will merge with a wholly owned subsidiary of Mirna in an all-stock transaction. The merged company will continue under the Synlogic name and will focus on advancing Synlogic’s drug discovery and development platform for Synthetic Biotic medicines, which are designed using synthetic biology to genetically reprogram beneficial microbes to treat metabolic and inflammatory diseases and cancer. Synlogic also recently closed a $42 million Series C preferred stock financing from leading biotechnology investors, including Aju IB Investment, Ally Bridge Group, Arctic Aurora LifeScience, CLI Ventures, Perceptive Advisors, Rock Springs Capital, and other undisclosed new investors. Existing investors, Atlas Venture, Deerfield, New Enterprise Associates (NEA), and OrbiMed also participated in the financing. “We believe that our Synthetic Biotic medicines are efficient and targeted biologic engines with the potential to have a transformative impact on the treatment of human diseases. While many conventional medicines address one molecular dysfunction, these living medicines have the potential to uniquely and effectively compensate for entire processes or pathways to treat patients with significant unmet medical need,” said Jose Carlos Gutierrez-Ramos, Ph.D., Chief Executive Officer of Synlogic. “This merger and our recently completed Series C financing are projected to provide the capital to progress our two lead metabolic disease programs through patient proof-of-concept studies as well as advance the development of our earlier product candidates.” By mid-2017, Synlogic plans to initiate a Phase 1 healthy volunteers study for its lead candidate, SYNB1020, which is for the potential treatment of Urea Cycle Disorders (UCD) and hepatic encephalopathy (HE), both diseases where patients experience elevated ammonia levels. Following success in the first study, the company plans to open two parallel studies in symptomatic patients with UCD and HE. The company’s second development candidate SYNB1618 will be studied in Phenylketonuria (PKU), which is caused by defective metabolism of the amino acid phenylalanine. “Following a thorough review of strategic alternatives, we are delighted to announce this transaction with Synlogic, which we believe is in the best interest of Mirna’s stockholders,” said Paul Lammers, M.D., M.Sc., President and Chief Executive Officer of Mirna. “Synlogic is advancing an exciting potential new class of medicines supported by a strong drug discovery and development platform, an experienced management team and a strong set of investors.” Following the merger, current Synlogic shareholders are expected to own approximately 83 percent of the combined company and the current Mirna stockholders will own approximately 17 percent of the combined company. The exchange ratio is based on Mirna’s expected cash at the time of the close, and the actual allocation will be subject to adjustment based on Mirna’s net cash balance at closing. The transaction has been approved by the board of directors of both companies. The merger is currently expected to close in the third quarter of 2017, subject to the approval of the stockholders of each company and the satisfaction or waiver of other customary conditions. Wedbush PacGrow acted as exclusive strategic advisor to Mirna for the reverse merger transaction and Latham & Watkins LLP served as legal counsel to Mirna. Leerink Partners LLC acted as exclusive financial advisor to Synlogic for the reverse merger and as exclusive placement agent for the Series C financing, and Mintz, Levin, Cohn, Ferris, Glovsky and Popeo, P.C. served as legal counsel to Synlogic. Following the merger, Jose Carlos Gutierrez-Ramos, Ph.D., Synlogic’s Chief Executive Officer will become the chief executive officer of the merged company. The board of directors will be comprised of seven directors, including two directors currently serving on Mirna’s board. Upon closing of the transaction, the merged company will operate under the Synlogic name and the company’s common stock will trade on the NASDAQ global market under a ticker symbol to be announced at a later date. The corporate headquarters will be located in Cambridge, Massachusetts. The companies will host a conference call to discuss the proposed transaction as well as Synlogic’s platform and pipeline assets on May 16, 2017 at 8:30 AM ET. The live webcast can be accessed on the Events & Presentations page of Mirna’s website or by dialing +1-844-815-2882 (U.S.) or + 1-213-660-0926 using the conference ID number 24465241. The conference call will be archived on both the Mirna and Synlogic websites for at least 30 days. Synlogic’s innovative new class of Synthetic Biotic medicines leverages the tools and principles of synthetic biology to genetically reengineer beneficial, probiotic microbes to perform critical functions missing or damaged due to disease. The company’s two lead programs target a group of rare metabolic diseases – inborn errors of metabolism (IEM). Patients with these diseases are born with a faulty gene, inhibiting the body’s ability to breakdown commonly occurring by-products of digestion that then accumulate to toxic levels and cause serious health consequences. When delivered orally, these medicines can act from the gut to compensate for the dysfunctional metabolic pathway and have a systemic effect. Synthetic Biotic medicines are designed to clear toxic metabolites associated with specific metabolic diseases and promise to significantly improve the quality of life for affected patients. Synlogic™ is pioneering the development of a novel class of living medicines, Synthetic Biotics™, based on its proprietary drug discovery and development platform. Synlogic’s initial pipeline includes Synthetic Biotic medicines for the treatment of rare genetic diseases, such as Urea Cycle Disorder (UCD) and Phenylketonuria (PKU). In addition, the company is leveraging the broad potential of its platform to create Synthetic Biotic medicines for the treatment of more common diseases, including liver disease, inflammatory and immune disorders, and cancer. Synlogic is collaborating with AbbVie to develop Synthetic Biotic-based treatments for inflammatory bowel disease (IBD). For more information, please visit synlogictx.com. Mirna is a biopharmaceutical company that has focused on the development of microRNA-based oncology therapeutics. Mirna's first product candidate, MRX34, the first microRNA mimic to enter clinical development in oncology, was studied as a single agent in a multicenter Phase 1 clinical trial. In September 2016, Mirna voluntarily halted enrollment and dosing in the clinical study following multiple immune-related serious adverse events (SAEs) observed in patients dosed with MRX34 over the course of the trial. Subsequently, the U.S. Food and Drug Administration (FDA) notified the Company that the Investigational New Drug (IND) Application for MRX34 was placed on full clinical hold. The Company has since closed the IND and focused on evaluating strategic alternatives, including the possibility of a merger or sale of the Company. This communication shall not constitute an offer to sell or the solicitation of an offer to sell or the solicitation of an offer to buy any securities, nor shall there be any sale of securities in any jurisdiction in which such offer, solicitation or sale would be unlawful prior to registration or qualification under the securities laws of any such jurisdiction. No public offer of securities shall be made except by means of a prospectus meeting the requirements of Section 10 of the Securities Act of 1933, as amended. Mirna, Synlogic and their respective directors and executive officers may be deemed to be participants in the solicitation of proxies from the holders of Mirna common stock in connection with the proposed transaction. Information about Mirna’s directors and executive officers is set forth in Mirna’s Annual Report on Form 10-K for the period ended December 31, 2016, which was filed with the SEC on March 15, 2017. Other information regarding the interests of such individuals, as well as information regarding Synlogic’s directors and executive officers and other persons who may be deemed participants in the proposed transaction, will be set forth in the proxy statement/prospectus, which will be included in Mirna’s registration statement when it is filed with the SEC. You may obtain free copies of these documents as described in the paragraph below. Important Additional Information Will be Filed with the SEC: In connection with the proposed transaction between Mirna and Synlogic, Mirna intends to file relevant materials with the SEC, including a registration statement that will contain a proxy statement and prospectus. Mirna urges investors and stockholders to read these materials carefully and in their entirety when they become available because they will contain important information about Mirna, the proposed transaction, and related matters. Investors and stockholders will be able to obtain free copies of the proxy statement/prospectus and other documents filed by Mirna with the SEC (when they become available) through the website maintained by the SEC at www.sec.gov. In addition, investors and shareholders will be able to obtain free copies of the proxy statement/prospectus and other documents filed by Mirna with the SEC by contacting investor relations by mail at Attn: Investor Relations PO Box 163387 Austin, TX 78716 USA. Investors and stockholders are urged to read the proxy statement/prospectus and the other relevant materials when they become available before making any voting or investment decision with respect to the proposed transaction. This press release contains “forward-looking statements” that involve substantial risks and uncertainties for purposes of the safe harbor provided by the Private Securities Litigation Reform Act of 1995. All statements, other than statements of historical facts, included in this press release regarding strategy, future operations, future financial position, future revenue, projected expenses, prospects, plans and objectives of management are forward-looking statements. In addition, when or if used in this press release, the words “may,” “could,” “should,” “anticipate,” “believe,” “estimate,” “expect,” “intend,” “plan,” “predict” and similar expressions and their variants, as they relate to Mirna, Synlogic or the management of either company, before or after the aforementioned merger, may identify forward-looking statements. Examples of forward-looking statements, include, but are not limited to, statements relating to the timing and completion of the proposed merger; Mirna’s continued listing on the NASDAQ Global Market until closing of the proposed merger; the combined company’s listing on the NASDAQ Global Market after closing of the proposed merger; expectations regarding the capitalization, resources and ownership structure of the combined company; the approach Synlogic is taking to discover and develop novel therapeutics using synthetic biology; the adequacy of the combined company’s capital to support its future operations and its ability to successfully initiate and complete clinical trials; the nature, strategy and focus of the combined company; the difficulty in predicting the time and cost of development of Synlogic’s product candidates; the executive and board structure of the combined company; and expectations regarding voting by Mirna’s and Synlogic’s stockholders. Actual results could differ materially from those contained in any forward-looking statement as a result of various factors, including, without limitation: the risk that the conditions to the closing of the transaction are not satisfied, including the failure to timely or at all obtain stockholder approval for the transaction; uncertainties as to the timing of the consummation of the transaction and the ability of each of Mirna and Synlogic to consummate the transaction; risks related to Mirna’s ability to correctly estimate its operating expenses and its expenses associated with the transaction; the ability of Mirna or Synlogic to protect their respective intellectual property rights; unexpected costs, charges or expenses resulting from the transaction; potential adverse reactions or changes to business relationships resulting from the announcement or completion of the transaction; and legislative, regulatory, political and economic developments. The foregoing review of important factors that could cause actual events to differ from expectations should not be construed as exhaustive and should be read in conjunction with statements that are included herein and elsewhere, including the risk factors included in Mirna’s Quarterly Report on Form 10-Q filed with the SEC on May 9, 2017. Mirna can give no assurance that the conditions to the transaction will be satisfied. Except as required by applicable law, Mirna undertakes no obligation to revise or update any forward-looking statement, or to make any other forward-looking statements, whether as a result of new information, future events or otherwise.


News Article | May 17, 2017
Site: marketersmedia.com

LONDON, UK / ACCESSWIRE / May 17, 2017 / Active Wall St. blog coverage looks at the headline from Mirna Therapeutics Inc. (NASDAQ: MIRN) as the biopharmaceutical Company announced on May 16, 2017, that it has entered into a reverse merger agreement with privately held Synlogic, Inc., under which Synlogic will merge with a wholly owned subsidiary of Mirna in an all-stock transaction. Register with us now for your free membership and blog access at: One of Mirna Therapeutics' competitors within the Biotechnology space, Array BioPharma Inc. (NASDAQ: ARRY), reported on May 10, 2017, its results for Q3 FY17 and provided an update on the progress of its key clinical development programs. AWS will be initiating a research report on Array BioPharma in the coming days. Today, AWS is promoting its blog coverage on MIRN; touching on ARRY. Get all of our free blog coverage and more by clicking on the link below: Following the merger, current Synlogic's shareholders are expected to own approximately 83% of the merged business, while current Mirna's stockholders will own the rest of the merged organization. The exchange ratio is based on Mirna's expected cash at the time of the close, and the actual allocation will be subject to adjustment based on Mirna's net cash balance at closing. The merged entity will continue under the Synlogic name and will focus on advancing Synlogic drug discovery and development platform for Synthetic Biotic medicines, which are designed using synthetic biology to genetically reprogram beneficial microbes to treat metabolic and inflammatory diseases and cancer. Mirna brings cash, cash equivalents, and marketable securities that were worth $57.5 million in the merged unit, while Synlogic recently closed a $42 million Series C preferred stock financing from leading biotechnology investors. The transaction has been approved by the Boards of Directors of both companies. The merger is currently expected to close in Q3 2017, subject to the approval of the stockholders of each Company and the satisfaction or waiver of other customary conditions. Synlogic plans to initiate a Phase-1 healthy volunteers study for its lead candidate, SYNB1020, which is for the potential treatment of Urea Cycle Disorders (UCD) and hepatic encephalopathy (HE), both diseases where patients experience elevated ammonia levels by mid-2017. Following success in the first study, the Company plans to open two parallel studies in symptomatic patients with UCD and HE. The Company's second development candidate SYNB1618 will be studied in Phenylketonuria (PKU), which is caused by defective metabolism of the amino acid phenylalanine. Mirna's first product candidate, MRX34, the first microRNA mimic to enter clinical development in oncology, was studied as a single agent in a multicenter Phase 1 clinical trial. In September 2016, Mirna voluntarily halted enrollment and dosing in the clinical study following multiple immune-related serious adverse events (SAEs) observed in patients dosed with MRX34 over the course of the trial. Subsequently, the US Food and Drug Administration (FDA) placed a full clinical hold on the Company's Investigational New Drug (IND) Application for MRX34. The Company has since ceased the IND and focused on evaluating strategic alternatives, including the possibility of a merger or sale of the Company. “Following a thorough review of strategic alternatives, we are delighted to announce this transaction with Synlogic, which we believe is in the best interest of Mirna's stockholders,” said Paul Lammers, M.D., M.Sc., President and Chief Executive Officer of Mirna, “Synlogic is advancing an exciting potential new class of medicines supported by a strong drug discovery and development platform, an experienced management team and a strong set of investors.” Following the merger, Jose Carlos Gutierrez-Ramos, Ph.D., Synlogic's Chief Executive Officer will become the CEO of the merged entity. The new Company's Board of Directors will be comprised of seven directors, including two directors currently serving on Mirna's Board. Upon closing of the transaction, the merged Company's common stock will trade on the NASDAQ global market under a ticker symbol to be announced at a later date. At the close of trading session on Tuesday, May 16, 2017, following the announcement, Mirna Therapeutics' stock price plunged 27.59% to end the day at $1.47. A total volume of 403.69 thousand shares were exchanged during the session, which was above the 3-month average volume of 33.40 thousand shares. The Company's share price has surged 13.08% in the past six months. The stock currently has a market cap of $30.80 million. Active Wall Street (AWS) produces regular sponsored and non-sponsored reports, articles, stock market blogs, and popular investment newsletters covering equities listed on NYSE and NASDAQ and micro-cap stocks. AWS has two distinct and independent departments. One department produces non-sponsored analyst certified content generally in the form of press releases, articles and reports covering equities listed on NYSE and NASDAQ and the other produces sponsored content (in most cases not reviewed by a registered analyst), which typically consists of compensated investment newsletters, articles and reports covering listed stocks and micro-caps. Such sponsored content is outside the scope of procedures detailed below. AWS has not been compensated; directly or indirectly; for producing or publishing this document. The non-sponsored content contained herein has been prepared by a writer (the "Author") and is fact checked and reviewed by a third party research service company (the "Reviewer") represented by a credentialed financial analyst, for further information on analyst credentials, please email info@activewallst.com. Rohit Tuli, a CFA® charterholder (the "Sponsor"), provides necessary guidance in preparing the document templates. The Reviewer has reviewed and revised the content, as necessary, based on publicly available information which is believed to be reliable. Content is researched, written and reviewed on a reasonable-effort basis. The Reviewer has not performed any independent investigations or forensic audits to validate the information herein. The Reviewer has only independently reviewed the information provided by the Author according to the procedures outlined by AWS. AWS is not entitled to veto or interfere in the application of such procedures by the third-party research service company to the articles, documents or reports, as the case may be. Unless otherwise noted, any content outside of this document has no association with the Author or the Reviewer in any way. AWS, the Author, and the Reviewer are not responsible for any error which may be occasioned at the time of printing of this document or any error, mistake or shortcoming. No liability is accepted whatsoever for any direct, indirect or consequential loss arising from the use of this document. AWS, the Author, and the Reviewer expressly disclaim any fiduciary responsibility or liability for any consequences, financial or otherwise arising from any reliance placed on the information in this document. Additionally, AWS, the Author, and the Reviewer do not (1) guarantee the accuracy, timeliness, completeness or correct sequencing of the information, or (2) warrant any results from use of the information. The included information is subject to change without notice. This document is not intended as an offering, recommendation, or a solicitation of an offer to buy or sell the securities mentioned or discussed, and is to be used for informational purposes only. Please read all associated disclosures and disclaimers in full before investing. Neither AWS nor any party affiliated with us is a registered investment adviser or broker-dealer with any agency or in any jurisdiction whatsoever. To download our report(s), read our disclosures, or for more information, visit http://www.activewallst.com/disclaimer/. For any questions, inquiries, or comments reach out to us directly. If you're a company we are covering and wish to no longer feature on our coverage list contact us via email and/or phone between 09:30 EDT to 16:00 EDT from Monday to Friday at: CFA® and Chartered Financial Analyst® are registered trademarks owned by CFA Institute. LONDON, UK / ACCESSWIRE / May 17, 2017 / Active Wall St. blog coverage looks at the headline from Mirna Therapeutics Inc. (NASDAQ: MIRN) as the biopharmaceutical Company announced on May 16, 2017, that it has entered into a reverse merger agreement with privately held Synlogic, Inc., under which Synlogic will merge with a wholly owned subsidiary of Mirna in an all-stock transaction. Register with us now for your free membership and blog access at: One of Mirna Therapeutics' competitors within the Biotechnology space, Array BioPharma Inc. (NASDAQ: ARRY), reported on May 10, 2017, its results for Q3 FY17 and provided an update on the progress of its key clinical development programs. AWS will be initiating a research report on Array BioPharma in the coming days. Today, AWS is promoting its blog coverage on MIRN; touching on ARRY. Get all of our free blog coverage and more by clicking on the link below: Following the merger, current Synlogic's shareholders are expected to own approximately 83% of the merged business, while current Mirna's stockholders will own the rest of the merged organization. The exchange ratio is based on Mirna's expected cash at the time of the close, and the actual allocation will be subject to adjustment based on Mirna's net cash balance at closing. The merged entity will continue under the Synlogic name and will focus on advancing Synlogic drug discovery and development platform for Synthetic Biotic medicines, which are designed using synthetic biology to genetically reprogram beneficial microbes to treat metabolic and inflammatory diseases and cancer. Mirna brings cash, cash equivalents, and marketable securities that were worth $57.5 million in the merged unit, while Synlogic recently closed a $42 million Series C preferred stock financing from leading biotechnology investors. The transaction has been approved by the Boards of Directors of both companies. The merger is currently expected to close in Q3 2017, subject to the approval of the stockholders of each Company and the satisfaction or waiver of other customary conditions. Synlogic plans to initiate a Phase-1 healthy volunteers study for its lead candidate, SYNB1020, which is for the potential treatment of Urea Cycle Disorders (UCD) and hepatic encephalopathy (HE), both diseases where patients experience elevated ammonia levels by mid-2017. Following success in the first study, the Company plans to open two parallel studies in symptomatic patients with UCD and HE. The Company's second development candidate SYNB1618 will be studied in Phenylketonuria (PKU), which is caused by defective metabolism of the amino acid phenylalanine. Mirna's first product candidate, MRX34, the first microRNA mimic to enter clinical development in oncology, was studied as a single agent in a multicenter Phase 1 clinical trial. In September 2016, Mirna voluntarily halted enrollment and dosing in the clinical study following multiple immune-related serious adverse events (SAEs) observed in patients dosed with MRX34 over the course of the trial. Subsequently, the US Food and Drug Administration (FDA) placed a full clinical hold on the Company's Investigational New Drug (IND) Application for MRX34. The Company has since ceased the IND and focused on evaluating strategic alternatives, including the possibility of a merger or sale of the Company. “Following a thorough review of strategic alternatives, we are delighted to announce this transaction with Synlogic, which we believe is in the best interest of Mirna's stockholders,” said Paul Lammers, M.D., M.Sc., President and Chief Executive Officer of Mirna, “Synlogic is advancing an exciting potential new class of medicines supported by a strong drug discovery and development platform, an experienced management team and a strong set of investors.” Following the merger, Jose Carlos Gutierrez-Ramos, Ph.D., Synlogic's Chief Executive Officer will become the CEO of the merged entity. The new Company's Board of Directors will be comprised of seven directors, including two directors currently serving on Mirna's Board. Upon closing of the transaction, the merged Company's common stock will trade on the NASDAQ global market under a ticker symbol to be announced at a later date. At the close of trading session on Tuesday, May 16, 2017, following the announcement, Mirna Therapeutics' stock price plunged 27.59% to end the day at $1.47. A total volume of 403.69 thousand shares were exchanged during the session, which was above the 3-month average volume of 33.40 thousand shares. The Company's share price has surged 13.08% in the past six months. The stock currently has a market cap of $30.80 million. Active Wall Street (AWS) produces regular sponsored and non-sponsored reports, articles, stock market blogs, and popular investment newsletters covering equities listed on NYSE and NASDAQ and micro-cap stocks. AWS has two distinct and independent departments. One department produces non-sponsored analyst certified content generally in the form of press releases, articles and reports covering equities listed on NYSE and NASDAQ and the other produces sponsored content (in most cases not reviewed by a registered analyst), which typically consists of compensated investment newsletters, articles and reports covering listed stocks and micro-caps. Such sponsored content is outside the scope of procedures detailed below. AWS has not been compensated; directly or indirectly; for producing or publishing this document. The non-sponsored content contained herein has been prepared by a writer (the "Author") and is fact checked and reviewed by a third party research service company (the "Reviewer") represented by a credentialed financial analyst, for further information on analyst credentials, please email info@activewallst.com. Rohit Tuli, a CFA® charterholder (the "Sponsor"), provides necessary guidance in preparing the document templates. The Reviewer has reviewed and revised the content, as necessary, based on publicly available information which is believed to be reliable. Content is researched, written and reviewed on a reasonable-effort basis. The Reviewer has not performed any independent investigations or forensic audits to validate the information herein. The Reviewer has only independently reviewed the information provided by the Author according to the procedures outlined by AWS. AWS is not entitled to veto or interfere in the application of such procedures by the third-party research service company to the articles, documents or reports, as the case may be. Unless otherwise noted, any content outside of this document has no association with the Author or the Reviewer in any way. AWS, the Author, and the Reviewer are not responsible for any error which may be occasioned at the time of printing of this document or any error, mistake or shortcoming. No liability is accepted whatsoever for any direct, indirect or consequential loss arising from the use of this document. AWS, the Author, and the Reviewer expressly disclaim any fiduciary responsibility or liability for any consequences, financial or otherwise arising from any reliance placed on the information in this document. Additionally, AWS, the Author, and the Reviewer do not (1) guarantee the accuracy, timeliness, completeness or correct sequencing of the information, or (2) warrant any results from use of the information. The included information is subject to change without notice. This document is not intended as an offering, recommendation, or a solicitation of an offer to buy or sell the securities mentioned or discussed, and is to be used for informational purposes only. Please read all associated disclosures and disclaimers in full before investing. Neither AWS nor any party affiliated with us is a registered investment adviser or broker-dealer with any agency or in any jurisdiction whatsoever. To download our report(s), read our disclosures, or for more information, visit http://www.activewallst.com/disclaimer/. For any questions, inquiries, or comments reach out to us directly. If you're a company we are covering and wish to no longer feature on our coverage list contact us via email and/or phone between 09:30 EDT to 16:00 EDT from Monday to Friday at: CFA® and Chartered Financial Analyst® are registered trademarks owned by CFA Institute.


News Article | May 23, 2017
Site: www.gizmag.com

Researchers at Harvard and the University of California, Davis (UCD) have come up with a new type of planetary object they've called a "synestia". The proposed object would take the form of a giant, donut-shaped mass of hot, vaporized rock spinning around a molten mass left over from a planetary collision. It's not only a new word to remember, but may provide insights into the formation of the Earth and Moon. Conceived by Simon Lock at Harvard University and Sarah Stewart at UCD, a synestia is what you get when two planet-sized objects bash into one another. This may not seem like the sort of thing we have to worry about today, but five billion years ago it was a painfully common occurrence as the Solar System formed from the giant disc of dust, gas, and debris that orbited the young Sun. According to current ideas about planetary formation, the planets and moons of our system were created as the debris disc about the Sun coalesced into larger and larger objects. At first, this was basically clumping, but as these objects became big enough, they started to collide with one another to shatter and reform into new bodies. The basic idea is that if the colliding body was small enough, the bits left over from the impact would rain down on the protoplanet like meteorites do on present day Earth. If the object was big enough, it would shatter and form a disc that would orbit for a time around the planet like the rings of Saturn, before spiraling in and increasing the planet's mass. However, if the two planetary objects are more or less the same size, the collision would be cataclysmic, with both destroyed to form a new molten core surrounded by a huge, thick disc of molten and even vaporized rock and debris – the synestia. The name is a portmanteau of "syn", meaning "together", and "Hestia", for the Greek goddess of architecture and structures. To find out how a synestia would form, Lock and Stewart looked at the role conservation of angular momentum plays in the collision. This is a basic law of physics that states that the energy that rotates an object remains the same regardless of how an object is altered. In a classic analogy, the scientists compare this to a figure skater spinning in place with her arms extended. As she pulls her arms in, she spins faster, and as she extends them, her spin slows, thanks to this law. Taking this a step further, if two spinning skaters garb hold of one another, their respective angular momenta are combined. The same thing goes with planets. If they expand, the rotate slower, if they contract, they rotate faster, and if they collide, the angular momenta of the two planets is combined. Therefore, high-impact collisions between planet-sized objects with high angular momentum would result in what Stewart refers to as a completely new structure. The team says that in these high-energy impacts, some of the gas and debris would fly off so fast as to go into orbit. There, the expansion of the spinning mass would form a thick indented lozenge-like mass a bit like a red blood cell or a donut because each point in the mass would be spinning at the same rate around the core. According to Stewart, the early Earth is likely to have suffered such an impact and formed a synestia that lasted about a hundred years, though such bodies would be longer lived around larger planets. If this did occur, then it could explain how the Moon formed and why it is so similar in composition to the Earth. Perhaps at some point in the distant past, two bodies collided to form a synestia out of which came the Earth from the molten core and the Moon from the orbiting mass. The research was published in the Journal of Geophysical Research: Planets.


GAD2-IRES-Cre, VGLUT2-IRES-Cre, VGAT-IRES-Cre, GAD1-eGFP, CCK-IRES-Cre, CRH-IRES-Cre, TAC1-IRES-Cre, and HDC-IRES-Cre mice (Jackson stock numbers 010802, 016963, 016962, 007677, 012706, 012704, 021877, and 021198, respectively) were obtained from Jackson Laboratory19, 32, 33 and VGLUT2-eGFP mice were from MMRRC (MMRRC 011835-UCD). PDYN-IRES-Cre mice were obtained from Bradford Lowell34. GAL-Cre mice were obtained from GENSAT (stock number KI87). Mice were housed in 12 h light–dark cycle (lights on 7:00 and off at 19:00) with free access to food and water. Experiments were performed in adult male or female mice (6–12 weeks old). All procedures were approved by Institutional Animal Care and Use Committees of the University of California, Berkeley, University of California, San Francisco, Allen Institute for Brain Science, and Stanford University and were done in accordance with federal regulations and guidelines on animal experimentation. Note that, in different experiments, GAD1, GAD2, and VGAT were used to identify GABAergic neurons. To examine the relationship between GAD1, GAD2, and VGAT in the POA, we quantified the overlap between GAD1 and VGAT on the basis of the double in situ hybridization data from the Allen Mouse Brain Atlas (http://connectivity.brain-map.org/transgenic/experiment/100142488) and found that 95% (327 out of 345) of VGAT-positive neurons also contained GAD1. Comparison between GAD1 and GAD2 expression in the POA (http://connectivity.brain-map.org/transgenic/experiment/100142491) showed that 99% (246 out of 248) of GAD1 neurons also contained GAD2. Together, these data indicate a very high degree of overlap between GAD1, GAD2, and VGAT in the POA. AAV -EF1α-DIO-ChR2–eYFP and AAV -hSyn-FLEX-hM4D(Gi)–mCherry were obtained from the University of North Carolina vector core. The final titre was estimated to be ~1012 genome copies per millilitre. AAV -EF1α-DIO-ChR2–eYFP, AAV -EF1α-DIO–eYFP, AAV -EF1α-DIO-iC++–eYFP, and AAV -EF1α-DIO-iC++–eYFP were obtained from Stanford University virus core. Lentivirus rEIAV-DIO-TLoop-ChR2–eYFP, rEIAV-DIO-TLoop-iC++–eYFP, and rEIAV-DIO-TLoop-nls–eYFP were obtained from Salk virus core and Allen Institute for Brain Science13. Rabies-tracing reagents (AAV-CAG-FLExloxP-TVA–mCherry, AAV-CAG-FLExloxP-RG (RG, rabies glycoprotein) and EnvA-pseudotyped, rabies-glycoprotein-deleted, and GFP-expressing rabies viral particles (RVdG)), cTRIO reagents (CAV-FLExloxP-Flp, AAV-FLExFRT-TVA–mCherry, AAV-FLExFRT-RG, and EnvA-pseudotyped, rabies-glycoprotein-deleted, and GFP-expressing rabies viral particles (RVdG)) and axon arborization analysis reagents (CAV-FLExloxP-Flp and AAV-hSyn1-FLExFRT–mGFP–2A-synaptophysin–mRuby) were obtained from Stanford University15. HSV-LoxSTOPLox-FlagHA-L10a was obtained from the University of California, San Francisco. Mice of a specific genotype were randomly assigned to experimental and control groups. Experimental and control animals were subjected to exactly the same surgical and behavioural manipulations. Data from animals used in experiments were excluded on the basis of histological criteria that included injection sites, virus expression, and optical fibre placement. Only animals with injection sites and optic fibre placement in the region of interest were included. To implant EEG and EMG recording electrodes, adult mice (6–12 weeks old) were anaesthetized with 1.5–2% isoflurane and placed on a stereotaxic frame. Two stainless steel screws were inserted into the skull 1.5 mm from midline and 1.5 mm anterior to the bregma, and two others were inserted 3 mm from midline and 3.5 mm posterior to the bregma. Two EMG electrodes were inserted into the neck musculature. Insulated leads from the EEG and EMG electrodes were soldered to a 2 × 3-pin header, which was secured to the skull using dental cement. For optogenetic activation/inhibition experiments, a craniotomy was made on top of the target region for optogenetic manipulation in the same surgery as for EEG and EMG implant, and 0.1–0.5 μl virus was injected into the target region using Nanoject II (Drummond Scientific) via a micropipette. We then implanted optic fibres bilaterally into the target region. Dental cement was applied to cover the exposed skull completely and to secure the implants for EEG and EMG recordings to the screws. After surgery, mice were allowed to recover for at least 2–3 weeks before experiments. For anti-histamine experiments (Extended Data Fig. 4), triprolidine (Tocris) was administered intraperitoneally at 20 mg per kg (body weight) and brain states were recorded for 3 h. For retrograde tracing in Extended Data Fig. 1a, 0.2–0.3 μl red or green RetroBeads (Lumafluor) was injected into each target region. For optrode recording experiments, the optrode assembly was inserted into the POA at a depth of 4.9 mm. Screws were attached to the skull for EEG recordings, and an EMG electrode was inserted into the neck musculature. The optrode assembly, screws, and EEG/EMG electrodes were secured to the skull using dental cement. These procedures are related to the results in Fig. 3 and Extended Data Fig. 6. For rabies tracing, AAV-CAG-FLExloxP-TVA–mCherry and AAV-CAG-FLExloxP-RG were injected into the TMN of HDC-Cre mice. Two to three weeks later, EnvA-pseudotyped, glycoprotein-deleted, and GFP-expressing rabies viral particles (RVdG) were injected into the TMN, and mice were euthanized 1 week later. These procedures are related to the results in Extended Data Fig. 2. For cTRIO experiments, a retrograde virus CAV-FLExloxP-Flp (5.0 × 1012 genome copies per millilitre) was injected into either the TMN or the PFC of GAD2-Cre mice to express Flp recombinase specifically in GABAPOA→TMN or GABAPOA→PFC neurons, and AAV-FLExFRT-TVA–mCherry (2.6 × 1012 genome copies per millilitre) and AAV-FLExFRT-RG (1.3 × 1012 genome copies per millilitre) were injected into the POA to express TVA (the receptor for the EnvA envelope glycoprotein)–mCherry and rabies glycoprotein in the Flp-expressing neurons. Two to three weeks later, EnvA-pseudotyped, glycoprotein-deleted, and GFP-expressing rabies viral particles (RVdG) (5.0 × 108 colony forming units per millilitre) were injected into the POA, and mice were euthanized 1 week later for histology. These procedures are related to the results in Extended Data Fig. 7. For axon arborization experiments, CAV-FLExloxP-Flp was injected into TMN, and AAV-hSyn1-FLExFRT–mGFP–2A-synaptophysin–mRuby was injected into the POA of GAD2-Cre mice. Mice were euthanized 4–7 weeks later for histology. These procedures are related to the results in Extended Data Fig. 7. For pharmacogenetic experiments, AAV -hSyn-FLEX-hM4D(Gi)–mCherry was injected bilaterally into the POA. These procedures are related to the results in Extended Data Fig. 10. For TRAP experiments, we injected Cre-inducible HSV expressing the large ribosomal subunit protein Rpl10a fused with Flag/haemagglutinin tag (HSV-LoxSTOPLox-FlagHA-L10a) into the TMN of VGAT-Cre mice. After 30–45 days of expression, the POA was dissected, and ribosome immunoprecipitation was performed to pull down the messenger RNAs (mRNAs) attached to Rpl10a. These procedures are related to the results in Fig. 4 and Extended Data Fig. 8. For single-cell RNA-seq experiments, rEIAV-DIO-TLoop-nls–eYFP was injected into the TMN of GAD2-Cre and VGAT-Cre mice. Four weeks later, we dissociated eYFP-labelled POA neurons for single-cell RNA-seq. These procedures are related to the results in Fig. 4 and Extended Data Fig. 8. For immunohistochemistry-detecting peptides, mice received a single intraventricular injection of colchicine (12 μg) 1–2 days before killing. These procedures are related to the results in Fig. 4. The stereotaxic coordinates were as follows. TMN: anteroposterior (AP) −2.45 mm, mediolateral (ML) 1 mm, dorsoventral (DV) 5–5.2 mm from the cortical surface; POA: AP 0 mm, ML 0.7 mm, DV 5.2 mm; PFC: AP +2.0 mm, ML 0.4 mm, DV 2 mm; vlPAG: AP −4.7 mm, ML 0.7 mm, DV 2.3 mm; dorsomedial hypothalamus: AP −1.8 mm, ML 0.4 mm, DV 5.2 mm; habenula: AP −1.8 mm, ML 0.5 mm, DV 2.2 mm. Sleep deprivation started at the beginning of the light period (7:00) and lasted till 13:00. Mice were kept awake by a combination of cage tapping, introduction of foreign objects such as paper towels, cage rotation, and fur stroking with a paintbrush35, gentle handling procedures that have been used extensively to induce sleep deprivation36. EEG and EMG were not recorded during sleep deprivation and recovery. After 6 h of deprivation, sleep-deprived mice were allowed rebound sleep for 4 h before being euthanized by cervical dislocation and decapitation. c-Fos immunohistochemistry was performed as described below. These procedures are related to the results in Extended Data Figs 1 and 2. Behavioural experiments were performed in home cages placed in sound-attenuating boxes. Sleep recordings were performed between 12:00 and 19:00 (light on at 7:00 and off at 19:00). EEG and EMG electrodes were connected to flexible recording cables via a mini-connector. EEG and EMG signals were recorded and amplified using AM Systems, digitally filtered (0.1–1,000 Hz and 10–1,000 Hz for EEG and EMG recordings respectively), and digitized at 600 Hz using LabView. Spectral analysis was performed using fast Fourier transform, and brain states were classified into NREM, REM, and wake states (wake: desynchronized EEG and high EMG activity; NREM: synchronized EEG with high-amplitude, low-frequency (0.5–4 Hz) activity and low EMG activity; REM: high power at theta frequencies (6–9 Hz) and low EMG activity). Brain states were classified into NREM sleep, REM sleep, and wakefulness using custom-written MATLAB software, and the classification was performed without any information about the identity of the animal or laser stimulation timing as previously described25. Each optic fibre (200 μm diameter; ThorLabs) was attached through an FC/PC adaptor to a 473-nm blue laser diode (Shanghai laser), and light pulses were generated using a Master 8 (A.M.P.I.). All photostimulation/inhibition experiments were conducted bilaterally and fibre optic cables were connected at least 2 h before the experiments for habituation. For photostimulation/inhibition experiments in ChR2-, iC++-, or eYFP-expressing mice, light pulses (10 ms per pulse, 10 Hz, 4–8 mW) or step pulses (60 s) were triggered using Master 8 that provided simultaneous input into two blue lasers. In each optogenetic manipulation experiment, inter-stimulation interval for optogenetic manipulation was chosen randomly from a uniform distribution between 15 and 25 min. Custom-made optrodes37 consisted of an optic fibre (200 μm in diameter) glued together with six pairs of stereotrodes. Two FeNiCr wires (Stablohm 675, California Fine Wire) were twisted together and electroplated to an impedance of ~ 600 kΩ using a custom-built plating device. The optrode was attached to a driver to allow vertical movement of the optrode assembly. The optrode was slowly lowered to search for light-responsive neurons. Wires to record cortical EEG and EMG from neck musculatures were also attached for simultaneous recordings. A TDT RZ5 amplifier was used for all the recordings, signals were filtered (0.3–8 kHz) and digitized at 25 kHz. At the end of the experiment, an electrolytic lesion was made by passing a current (100 μA, 10 s) through one or two electrodes to identify the end of the recording tract. Spikes were sorted offline on the basis of the waveform energy and the first three principal components of the spike waveform on each stereotrode channel. For single unit isolation, all channels were separated into groups and spike waveforms were identified either manually using Klusters (http://neurosuite.sourceforge.net/) or automatically using the software klustakwik (http://klustakwik.sourceforge.net/). The quality of each unit was assessed by the presence of a refractory period and quantified using isolation distance and L . Units with an isolation distance <20 and L >0.1 were discarded38. To identify ChR2-tagged neurons, laser pulse trains (10 and/or 20 Hz) were delivered intermittently every minute. A unit was identified as ChR2-expressing if spikes were evoked by laser pulses with short first-spike latency (<6 ms for all units in our sample) and the waveforms of the laser-evoked and spontaneous spikes were highly similar (correlation coefficient >0.9). Mean latency of all identified units was 3.05 ms. Mean correlation coefficient of all identified units was 0.99. To calculate the average firing rate of each unit in each brain state, spikes during the laser pulse trains were excluded. These procedures are related to the results in Fig. 3 and Extended Data Fig. 6. Mice were deeply anaesthetized and transcardially perfused using PBS buffer followed by 4% paraformaldehyde in PBS. Brains were post-fixed in fixative and stored in 30% sucrose in PBS overnight for cryoprotection. Brains were embedded and mounted with Tissue-Tek OCT compound (Sakura Finetek) and 20 μm sections were cut using a cryostat (Leica). Brain slices were washed using PBS, permeabilized using PBST (0.3% Triton X-100 in PBS) for 30 min and then incubated with blocking solution (5% normal goat serum or normal donkey serum in PBST) for 1 h followed by primary antibody incubation overnight at 4 °C using the following antibodies: anti–GFP antibody (A-11122 or A-11120, Life technologies, 1:1,000); anti-cFos antibody (sc-52-G and sc-52, Santa Cruz Biotech, 1:1,000); anti-CCK-8 antibody (20078, Immunostar, 1:500); anti-CRH antibody (sc-1759, Santa Cruz Biotech, 1:500); anti-haemagglutinin antibody (C29F4, Cell Signaling tech, 1:1,000); and anti-HDC antibody (16045, Progen, 1:1,000). The next day, slices were washed with PBS and incubated with appropriate secondary antibodies for 2 h (1:500, all from Invitrogen): A-11008, Alexa Fluor 488 goat anti-rabbit IgG; A-21206, Alexa Fluor 488 donkey anti-rabbit IgG; A-11055, Alexa Fluor 488 donkey anti-goat IgG; A-21202, Alexa Fluor 488 donkey anti-mouse IgG; A-11012, Alexa Fluor 594 goat anti-rabbit IgG; A-21207, Alexa Fluor 594 donkey anti-rabbit IgG; A-11058, Alexa Fluor 594 donkey anti-goat IgG; A-21245, Alexa Fluor 647 goat anti-rabbit IgG. The slices were washed with PBS followed by counterstaining with DAPI or Hoechst and coverslipped. Fluorescence images were taken using a confocal microscope (LSM 710 AxioObserver Inverted 34-Channel Confocal, Zeiss) or Nanozoomer (Hamamatsu). FISH was performed with two methods. First, FISH for CCK, CRH, TAC1, and GAD1 was done using RNAscope assays according to the manufacturer’s instructions (Advanced Cell Diagnostics). Second, to make TAC1, GAD1, and GAD2 FISH probes, DNA fragments containing the coding or untranslated sequences were amplified using PCR from mouse whole brain complementary DNA (cDNA) (Zyagen). A T7 RNA polymerase recognition site was added to the 3′ end of the PCR product. The PCR product was purified using a PCR purification kit (Qiagen). One microgram of DNA was used for in vitro transcription by using digoxigenin (DIG) RNA labelling mix (Roche) and T7 RNA polymerase. After DNase I treatment for 30 min at 37 °C, the RNA probe was purified using probeQuant G-50 Columns (GE Healthcare). Sections (20 μm) were pre-treated with proteinase K (0.1 μg ml−1), acetylated, dehydrated through ethanol (50, 70, 95, and 100%), and air dried. Pre-treated sections were then incubated for 16–20 h at 60 °C, in a hybridization buffer containing sense or anti-sense riboprobes. After the sections were hybridized, they were treated with RNase A (20 μg ml−1) for 30 min at 37 °C and then washed four times in decreasing salinity (from 2× to 0.1× standard saline citrate buffer) and a 30 min wash at 68 °C. Sections were incubated with 3% hydrogen peroxide in PBS for 1 h and washed using PBS. After incubation in the blocking buffer for 1 h (TNB buffer, Perkin Elmer), sections were incubated with anti-DIG-POD antibody (1:500, Roche) in TNB buffer for 2 h. TSA-plus-Fluorescein reagent was used to visualize the signal. For GAD-FISH, anti-DIG-AP antibody (1:500, Roche) and Fast Red TR/Naphthol AS-MX (F4523, Sigma-Aldrich) were used to visualize the signal. After washing the sections in PBS, they were incubated with blocking buffer for 2 h followed by incubation with anti–GFP antibody overnight, and finally incubated with a secondary antibody as described above. To examine the overlap between each peptide marker and GAD, we used CCK-, CRH-, TAC1-, and PDYN-Cre mice injected with AAV-EF1α-DIO-ChR2–eYFP or AAV-EF1α-DIO–eYFP. These procedures are related to the results in Extended Data Figs 2 and 8. For analysis of rabies-tracing data, consecutive 60 μm coronal sections were collected and stained using Hoechst. Slides were scanned using Nanozoomer (Hamamatsu). GFP+ input neurons were counted from the forebrain to the posterior brainstem except sections adjacent to the injection sites (1 mm from the injection site), and grouped into ten regions based on Allen Mouse Brain Atlas (http://mouse.brain-map.org/static/atlas) using anatomical landmarks in the sections visualized by Hoechst staining and autofluorescence. We normalized the number of neurons in each region by the total number of input neurons in the entire brain. These procedures are related to the results in Extended Data Fig. 7. Consecutive 60 μm coronal sections were collected and stained using Hoechst. Slides were scanned using a Nanozoomer (Hamamatsu). All images were acquired using identical settings and were analysed using ImageJ as previously described15. Images were background subtracted (rolling ball radius of 50 pixels), thresholded, and pixels above this threshold were interpreted as positive signals. The mGFP- or eYFP-labelled axon arborization signal was measured for each region and averaged across the five sections. These procedures are related to the results in Extended Data Fig. 7. We adapted a previously described procedure to perform TRAP experiment39. Mice were euthanized at 12:00 to 14:00 and the POA was rapidly dissected on ice with a dissection buffer (1× HBSS, 2.5 mM HEPES (pH 7.4), 4 mM NaHCO , 35 mM glucose, 100 μg ml−1 cycloheximide). Brains from six mice were then pooled, homogenized in the homogenization buffer (10 mM HEPES (pH 7.4), 150 mM KCl, 5 mM MgCl , 100 nM calyculin A, 2 mM DTT, 100 U ml−1 RNasin, 100 μg ml−1 cycloheximide and protease). Homogenates were transferred to a microcentrifuge tube and clarified at 2,000g for 10 min at 4 °C. The supernatant was transferred to a new tube, and 70 μl of 10% NP40 and 70 μl of 1,2-diheptanoyl-sn-glycero-3-phosphocholine (DHPC, 300 mM) per millilitre of supernatant were added. This solution was mixed and then clarified at 17,000g for 10 min at 4 °C. The resulting high-speed supernatant was transferred to a new tube. This supernatant served as the input. A small amount (25 μl) was added to a new tube containing 350 μl of buffer RLT for future input RNA purification. Immunoprecipitation was performed with an anti-Flag antibody loaded beads. The beads were washed four times using 0.15 M KCl Wash buffer (10 mM HEPES (pH 7.4), 350 mM KCl, 5 mM MgCl , 2 mM DTT, 1% NP40, 100 U ml−1 RNasin, and 100 μg ml−1 cycloheximide). After the final wash, the RNA was eluted by addition of buffer RLT (350 μl) to the beads on ice, the beads removed by a magnet, and the RNA purified using the RNeasy Micro Kit (Qiagen) and analysed using an Agilent 2100 Bioanalyzer. cDNA libraries for RNA-seq were prepared with Ovation RNA-Seq System V2 and Ovation Ultralow Library Systems (NuGen), and analysed on an Illumina HiSeq 2500. Gene classification shown in Supplementary Table 1 was performed using PANTHER (http://pantherdb.org/)40. These procedures are related to the results in Fig. 4 and Extended Data Fig. 8. We adapted a previously described procedure to isolate fluorescently labelled neurons from the mouse brain41, 42, 43. Individual adult male mice (postnatal day 56 ± 3) were anaesthetized in an isoflurane chamber, decapitated, and the brain was immediately removed and submerged in fresh ice-cold artificial cerebrospinal fluid (ACSF) containing 126 mM NaCl, 20 mM NaHCO , 20 mM dextrose, 3 mM KCl, 1.25 mM NaH PO , 2 mM CaCl , 2 mM MgCl , 50 μM DL-AP5 sodium salt, 20 μM DNQX, and 0.1 μM tetrodotoxin, bubbled with a carbogen gas (95% O and 5% CO ). The brain was sectioned on a vibratome (Leica VT1000S) on ice, and each slice (300–400 μm) was immediately transferred to an ACSF bath at room temperature. After the brain slicing was complete (not more than 15 min), individual slices of interest were transferred to a small Petri dish containing bubbled ACSF at room temperature. The POA was microdissected under a fluorescence dissecting microscope, and the slices before and after dissection were imaged to examine the location of the microdissected tissue and confirm its location. The dissected tissue pieces were transferred to a microcentrifuge tube and treated with 1 mg ml−1 pronase (Sigma, P6911-1G) in carbogen-bubbled ACSF for 70 min at room temperature without mixing in a closed tube. After incubation, with the tissue pieces sitting at the bottom of the tube, the pronase solution was pipetted out of the tube and exchanged with cold ACSF containing 1% fetal bovine serum. The tissue pieces were dissociated into single cells by gentle trituration through Pasteur pipettes with polished tips of 600, 300, and 150 μm diameter. Single cells were isolated by fluorescence-activated cell sorting into individual wells of 96-well plates or 8-well PCR strips containing 2.275 μl of Dilution Buffer (SMARTer Ultra Low RNA Kit for Illumina Sequencing, Clontech 634936), 0.125 μl RNase inhibitor (SMARTer kit), and 0.1 μl of 1:1,000,000 diluted RNA spike-in RNAs (ERCC RNA Spike-In Mix 1, Life Technologies 4456740). Sorting was performed on a BD FACSAriaII SORP using a 130 μm nozzle, a sheath pressure of 10 p.s.i., and in the single-cell sorting mode. To exclude dead cells, DAPI (DAPI*2HCl, Life Technologies D1306) was added to the single-cell suspension to the final concentration of 2 ng ml−1. Sorted cells were frozen immediately on dry ice and stored at −80 °C. We used the SMARTer kit described above to reverse transcribe single-cell RNA and amplify the cDNA for 19 PCR cycles. To stabilize the RNA after quickly thawing the cells on ice, we immediately added to each sample an additional 0.125 μl of RNase inhibitor mixed with SMART CDS Primer II A. All steps downstream were performed according to the manufacturer’s instructions. cDNA concentration was quantified using Agilent Bioanalyzer High Sensitivity DNA chips. For most samples, 1 ng of amplified cDNA was used as input to make sequencing libraries with a Nextera XT DNA kit (Illumina FC-131-1096). Individual libraries were quantified using Agilent Bioanalyzer DNA 7500 chips. To assess sample quality and adjust the concentrations of libraries for multiplexing on HiSeq, all libraries were sequenced first on Illumina MiSeq to obtain approximately 100,000 reads per library, and then on Illumina HiSeq 2000 or 2500 to generate 100 base pair reads. These procedures are related to the results in Fig. 4 and Extended Data Fig. 8. Since both TRAP and single-cell RNA-seq have technical limitations and are prone to false-positive and false-negative errors, we used the following strategy for identifying markers for POA sleep neurons. (1) To eliminate false-positive errors, the candidate markers with existing Cre lines were tested in optogenetic experiments, and cell types that did not promote sleep were eliminated (for example, GAL, which was found to be enriched in the TRAP experiment). (2) To reduce false-negative errors, we included markers identified by either method in our candidate list, rather than only those identified by both methods. This should have enhanced our chance of finding a useful marker, even if it were missed by one of the methods because of false-negative errors. Of course, this strategy could increase the probability for false-positive errors in our candidate list, but these errors were eliminated by the functional test in (1). To inhibit CCK, CRH, or TAC1 neurons, we injected CNO dissolved in 0.1 ml vehicle solution (PBS with 0.5% dimethyl sulfoxide (DMSO)) into CCK-, CRH- or TAC1-Cre mice expressing hM4Di in the POA, 20 min before the recording session. CNO was administered intraperitoneally at 2.5 mg per kg (body weight). Vehicle solution was injected for the control experiment. These procedures are related to the results in Extended Data Fig. 10. Slice recordings were made at postnatal days 42–50. AAV -EF1α-DIO-ChR2–eYFP (500 nl) was injected into the POA of GAD2-Cre mice, and recording was made 2–3 weeks after injection. Slice preparation was according to procedures described previously44. A mouse was deeply anaesthetized with 5% isoflurane. After decapitation, the brain was dissected rapidly and placed in ice-cold oxygenated HEPES-buffered ACSF (in mM: NaCl 92, KCl 2.5, NaH PO 1.2, NaHCO 30, HEPES 20, glucose 25, sodium ascorbate 5, thiourea 2, sodium pyruvate 3, MgSO ·7H O 10, CaCl ·2H O 0.5, and NAC 12, at pH 7.4, adjusted with 10 M NaOH), and coronal sections of the TMN were made with a vibratome (Leica). Slices (300 μm thick) were recovered in oxygenated NMDG–HEPES solution (in mM: NMDG 93, KCl 2.5, NaH PO 1.2, NaHCO 30, HEPES 20, glucose 25, sodium ascorbate 5, thiourea 2, sodium pyruvate 3, MgSO ·7H O 10, CaCl ·2H O 0.5, and NAC 12, at pH 7.4, adjusted with HCl) at 32 °C for 10 min and then maintained in an incubation chamber with oxygenated standard ACSF (in mM: NaCl 125, KCl 3, CaCl 2, MgSO 2, NaH PO 1.25, sodium ascorbate 1.3, sodium pyruvate 0.6, NaHCO 26, glucose 10, and NAC 10, at pH 7.4, adjusted by 10 M NaOH) at 25 °C for 1–4 h before recording. All chemicals were from Sigma. Whole-cell recordings were made at 30 °C in oxygenated solution (in mM: NaCl 125, KCl 4, CaCl 2, MgSO 1, NaH PO 1.25, sodium ascorbate 1.3, sodium pyruvate 0.6, NaHCO 26, and glucose 10, at pH 7.4). Inhibitory postsynaptic currents were recorded using a caesium-based internal solution (in mM: CsMeSO 125, CsCl 2, HEPES 10, EGTA 0.5, MgATP 4, Na GTP 0.3, sodium phosphocreatine 10, TEACl 5, QX-314 3.5, at pH 7.3, adjusted with CsOH, 290–300 mOsm) and isolated by clamping the membrane potential of the recorded neuron at the reversal potential of the excitatory synaptic currents. The resistance of the patch pipette was 3–5 MΩ. The cells were excluded if the series resistance exceeded 40 MΩ or varied by more than 20% during the recording period. To activate ChR2, we used a mercury arc lamp (Olympus) coupled to the epifluorescence light path and bandpass filtered at 450–490 nm (Semrock), gated by an electromagnetic shutter (Uniblitz). A blue light pulse (5 ms) was delivered through a 40 × 0.8 numerical aperture water immersion lens (Olympus) at a power of 1–2 mW. Data were recorded with a Multiclamp 700B amplifier (Axon instruments) filtered at 2 kHz and digitized with a Digidata 1440A (Axon instruments) at 4 kHz. Recordings were analysed using Clampfit (Axon instruments). These procedures are related to the results in Extended Data Fig. 2. At the end of each recording, cytoplasm was aspirated into the patch pipette, expelled into a PCR tube as described previously45. The single-cell reverse-transcription PCR (RT–PCR) protocol was designed to detect the presence of mRNAs coding for GAPDH, GAD1, VGLUT2, and HDC. First, reverse transcription and the first round of PCR amplification were performed with gene-specific multiplex primer using the SuperScript III One-Step RT–PCR kit (12574-018, Invitrogen) according to the manufacturer’s protocol. Second, nested PCR was performed using GoTaq Green Master Mix (M7121, Promega) with nested primers for each gene. Amplification products were visualized via electrophoresis using 2% agarose gel. Primers (5′>3′) for single-cell RT–PCR were as follows. GAPDH (sense/anti-sense): multiplex, ACTCCACTCACGGCAAATTC/CACATTGGGGGTAG GAACAC; nested, AGCTTGTCATCAACGGGAAG/GTCATGAGCCCTTC CACAAT; Final product 331 base pairs (bp). GAD1 (sense/anti-sense): multiplex, CACAGGTCACCCTCGATTTT/TCTATGCCGCTGAGTTTGTG; nested, TAGCTGGTGAATGGCTGACA/CTTGTAACGAGCAGCCATGA; final product 200 bp. VGLUT2 (sense/anti-sense): multiplex, GCCGCTACATCATAGCCATC/GCTCTCTCCAATGCTCTCCTC; nested, ACATGGTCAACAACAGCACTATC/ATAAGACACCAGAAGCCAGAACA; final product 506 bp. HDC (sense/anti-sense): multiplex, GGAGCCCTGTGAATACCGTG/TCCACTGAAGAGTGAGCCTGA; nested, CGTGAATACTACCGAGCTAGAGG/ACTCGTTCAATGTCCCCAAAG; final product 182 bp. These procedures are related to the results in Extended Data Fig. 2. Statistical analysis was performed using MATLAB, GraphPad Prism, or Python. The selection of statistical tests was based on reported previous studies. All statistical tests were two-sided. The 95% confidence intervals for brain state probabilities were calculated using a bootstrap procedure: for an experimental group of n mice, with mouse i comprising m trials, we repeatedly resampled the data by randomly drawing for each mouse m trials (random sampling with replacement). For each of the 10,000 iterations, we recalculated the mean probabilities for each brain state across the n mice. The lower and upper confidence intervals were then extracted from the distribution of the resampled mean values. To test whether a given brain state was significantly modulated by laser stimulation, we calculated for each bootstrap iteration the difference between the mean probabilities during laser stimulation and the preceding period of identical duration. The investigators were not blinded to allocation during experiments and outcome assessment. To determine the sample size for optogenetic and pharmacogenetic experiments, we first performed pilot experiments with two or three mice. Given the strength of the effect and the variance across this group, we then predicted the number of animals required to reach sufficient statistical power. To determine the sample size (number of units) for optrode recordings, we first recorded from two animals. Given the success rate of finding identified units and the homogeneity of units in the initial data set, we set a target sample size. For rabies-mediated retrograde tracing, histology, and slice recording experiments, the selection of the sample size was based on numbers reported in previous studies. For gene profiling experiments, sample size was not calculated a priori, and the selection of the sample size was based on previous studies. Otherwise, no statistical methods were used to predetermine sample size. The single-cell RNA-seq data have been deposited in the Gene Expression Omnibus under accession number GSE79108. All other data are available from the corresponding author upon reasonable request.


DUBLIN, Ireland, March 02, 2017 (GLOBE NEWSWIRE) -- Horizon Pharma plc (NASDAQ:HZNP), a biopharmaceutical company focused on improving patients’ lives by identifying, developing, acquiring and commercializing differentiated and accessible medicines that address unmet medical needs, today announced support of a program developed by the National Organization for Rare Disorders (NORD) to help people with Urea Cycle Disorders (UCDs) seeking assistance with high out-of-pocket costs associated with the purchase of medical foods and supplements for their low-protein dietary needs.   “Patients' health care needs extend beyond medications and we commend Horizon for being willing to support programs that are aimed at overcoming obstacles to other important treatments,” said Catherine Blansfield, RN, vice president of patient services at NORD.  “This donation provides financial support for products, which are essential for good health but, unfortunately, are not commonly covered by health insurance benefits.” The program is independently administered by NORD and available to all people living with UCDs in the United States who meet the NORD eligibility criteria.  Horizon provided a charitable grant to help fund the program and has no involvement or input on its administration. “I have to significantly limit the amount of protein I consume to avoid elevated ammonia levels, but the flipside is that too little protein can deprive my body of core amino acids, and that can also lead to high ammonia levels,” said Denise Z., who lives with a type of UCD called Citrullinemia Type 1.  “Medical foods and supplements that provide these core nutrients are vital to my health, and that is why this program is so important to those of us in the UCD community who struggle with the day-to-day challenges of living with a UCD.” UCDs are rare genetic disorders that affect approximately 1 in 35,000 people in the United States.  It is caused by an enzyme deficiency in the urea cycle, a process that is responsible for converting excess ammonia from the bloodstream and ultimately removing it from the body.  Because of this, people with a UCD experience hyperammonemia, or elevated ammonia levels in their blood that can then reach the brain where it can cause irreversible brain damage, coma or death.  UCD symptoms may first occur at any age depending on the severity of the disorder, with more severe defects presenting earlier in life.  Those with UCDs adhere to a low-protein diet to decrease the nitrogen load of the urea cycle, and receive essential nutrient supplementation to help achieve normal growth and metabolic stability.1 “At Horizon, we are always looking for ways to be supportive, beyond our therapies, for people with rare diseases,” said Robert Metz, senior vice president, business operations and external affairs, Horizon Pharma plc.  “We’ve received feedback directly from people living with UCDs, their caregivers and health care professionals about the financial burden that those who require medical foods and supplements face, and are thrilled to support NORD’s UCDs Medical Foods and Supplements Financial Assistance Program.” To learn more about the UCDs Medical Foods and Supplements Financial Assistance Program, patients or their caregivers should contact NORD at 877-333-1860 or UCD@rarediseases.org. About Horizon Pharma plc Horizon Pharma plc is a biopharmaceutical company focused on improving patients' lives by identifying, developing, acquiring and commercializing differentiated and accessible medicines that address unmet medical needs.  The Company markets 11 medicines through its orphan, rheumatology and primary care business units.  For more information, please visit www.horizonpharma.com.  Follow @HZNPplc on Twitter or view careers on our LinkedIn page.


News Article | February 21, 2017
Site: techcrunch.com

City officials worldwide are bursting blood vessels trying to figure out how to create their own version of Silicon Valley. From the Silicon Hills in Austin, Texas to Silicon Alley in NYC, the Silicon Docks in Ireland’s capital city to Silicon “Wadi” in Israel, potential new global tech hubs are popping up everywhere. Having the right ingredients for innovation to flourish on a scale similar to Silicon Valley will take more than stealing the moniker. The formal elements — an open economy, regulation that supports enterprise, a creative culture and easy access to capital — are the parts of the puzzle that could be implemented anywhere. However, the key ingredient underpinning Silicon Valley’s success, many believe, has been the steady flow of skilled engineers — with an entrepreneurial mindset — coming out of Stanford University. “SV was largely driven by Stanford University — it has become a magnet for attracting the best talent in tech,” says Dr. Damien McLoughlin, professor of marketing and associate dean at University College Dublin (UCD) Michael Smurfit Graduate Business School in Ireland. “As an educator, it does make me wonder what universities elsewhere should be doing differently. Just a few decades ago, all the smartest people worked for universities. Today they’re all in startups.” For tech hubs to thrive, a city or region needs a nearby university, with a strong research and engineering tradition, providing a constant supply of skilled graduates. However, that isn’t enough. “There must also be a culture of tech commercialization within any nearby university,” says Chuck Eesley, assistant professor at Stanford’s Department of Management Science & Engineering and affiliated faculty member at the Stanford Technology Ventures Program. “There’s no place for the Ivory Tower academic mindset, or the idea that commercialization somehow gets your hands dirty.” University incubators are already responsible for the commercialization of academic research output. But, in most cases, their influence is minor and peripheral. “Perhaps the university of tomorrow should be more like one big incubator,” suggests McLoughlin. By fostering an environment where tech startups and tech entrepreneurs can engage with university academics and students openly, and ideas can be shared more fluidly by industry and academia, one can achieve greater levels of innovation. Universities used to be where the smartest people in the world went to exchange ideas. Some spent their whole lives there as faculty and helped steer the brightest and best young students who passed through during their tenure. The role of the 21st century educational institution has changed. “In the past, the most important academic questions focused around the meaning of life and why we exist,” says McLoughlin. “Today the questions have changed, with one of the most important being: how do we engage with tech to make society better? If you ask me where the ideal place would be to try and answer fundamental questions like this in a truly independent way, the university is the obvious location. Is Stanford an already existing example of one such great, big incubator? “There’s definitely a special set of ingredients that came together here for the kind of high-tech entrepreneurship to emerge in SV,” says Eesley. “There are other institutions with great engineering programs, like Caltech and Carnegie Mellon University, but they haven’t been able to achieve the same level of commercialization. They have great breakthroughs, but something is missing.” It’s also critical that university policy makes it simple for faculty members and/or students to commercialize research. If institution authorities are overly concerned with royalties and ensuring they negotiate the biggest piece of the IP pie for the alma mater, they’re unlikely to encourage entrepreneurship from within. “I have experience in this area at both MIT and Stanford,” says Eesley. “MIT used to focus on negotiating as good a deal as possible for the university in every situation. Now their focus is on maximizing the number of deals getting done on campus. That is key to enabling true entrepreneurship in an academic setting.” Bringing in former alumni who became entrepreneurs to mentor also has an impact. “We did studies of mentorship where we randomized which students were matched with entrepreneurs or with VCs, and various other alumni who may have had successful careers but who never actually started a business,” says Eesley. “The ones with entrepreneurs for mentors were far more likely to start an early-stage startup upon graduation.” Eesley isn’t suggesting what’s happened (and continues to happen) in the southern Bay Area isn’t possible elsewhere. “Tech hubs can emerge in almost any location,” he says. “We know this because the centers of innovation of the past in the U.S. were places like Detroit and Cleveland. Just a few short decades ago, if you were a young, talented engineer, these were the cities you were drawn to.” With little to ostensibly offer in an educational system driven even more by commercial interests, the arts and humanities would presumably suffer most, and be considered to have even less value than they already do. McLoughlin disagrees. “In this context, engaging more with tech startups only appears as a prioritization of business and commerce above all else on a superficial level. The arts give us access to our cultural life and the culture of society,” he says. “If the incubator model were to be adopted in an overall university setting, the arts would thrive. The social sciences, in particular, would be put to the fore in the development of new tech and people would think more about the consequences of new innovations. Many of the negative aspects of life in the digital age could be avoided or minimized if there were more independent input during the design stages of new tech. If innovation was driven as much by universities as it is by startups, we would all benefit.”


News Article | February 27, 2017
Site: phys.org

Located some 116 million light years away, NGC 5044 is an early-type massive elliptical galaxy residing at the center of an X-ray bright group also named NGC 5044. This group contains about 150 members, most of which are dwarf galaxies. Although the group's center galaxy has been the subject of several past studies, its globular cluster and UCD system remain unexplored. UCDs are very compact galaxies with high stellar populations, containing about 100 million stars. They display masses, colors, and metallicities between those of globular clusters and early-type dwarf galaxies. These ultra-compact stellar systems could provide important insights on the formation and evolution of galaxies in the universe. That is why Faifer's team observed the NGC 5044 with the Gemini Multi-Object Spectrograph (GMOS) at the Gemini South telescope in Chile. They obtained deep images of several fields around NGC 5044, which allowed them to detect the presence of a UCD. "From the photometric and spectroscopic analysis of a deep field taken with Gemini+GMOS, we have been able to detect and confirm the first UCD in the NGC 5044 group," the researchers wrote in the paper. The radial velocity and angular proximity (2.83 arcmin) of this UCD indicate that this object is associated with galaxy NGC 5044. The newly discovered UCD was designated NGC 5044-UCD1. The researchers found that the metallicity of NGC 5044-UCD1 is within the range displayed by other UCD detected in constellations Virgo and Fornax, but considerably lower than that of the confirmed stripped nuclei described in previous studies. They also studied the star formation history of this UCD and found that this object is approximately 11.7 billion years old. Although the origin of UCDs is still widely debated, the most plausible hypotheses suggest that they are massive star clusters or the nuclei of tidally stripped dwarf galaxies. The scientists assume that NGC 5044-UCD1 could be such an unusually massive globular cluster. They note that the object's luminosity is well above the usual upper cut for "classical" globular clusters. Furthermore, NGC 5044-UCD1 presents a supersolar α-element abundance of [α/Fe] = 0.30, suggesting rapid star formation, typical for most globular clusters. "All the lines of evidence would point toward NGC 5044-UCD1 being an unusually massive globular cluster of the NGC 5044 system," the paper reads. Further spectroscopic observations could reveal more insights on the true nature of NGC 5044-UCD1. Currently, the team prepares an analysis of the complete photometric dataset, what will be presented in a forthcoming paper. More information: First confirmed ultra-compact dwarf galaxy in the NGC 5044 group, arXiv:1702.06472 [astro-ph.GA] arxiv.org/abs/1702.06472 Abstract Context. Ultra-compact dwarfs (UCDs) are stellar systems displaying colours and metallicities between those of globular clusters (GCs) and early-type dwarf galaxies, as well as sizes of Reff


News Article | February 28, 2017
Site: www.businesswire.com

NEW YORK--(BUSINESS WIRE)--Kroll Bond Rating Agency (KBRA) announced today the appointment of Stephen Kemmy to the role of Director within KBRA’s European RMBS group. Stephen previously worked as a Director at Fitch Ratings in London, within the Structured Finance group and covered bonds. He was primarily responsible for newly issued and existing ratings from the UK, Netherlands, Ireland and the Nordic countries. In addition, he worked on developing criteria for assessing Irish, Danish and Norwegian rating methodologies. Prior to working in structured finance, Stephen spent nearly 3 years working in KBC Bank Ireland plc as an Executive within the Credit Risk team and Treasury. Stephen holds an MBS in Finance from UCD Michael Smurfit School of Business and a BS in Accounting and Finance from Dublin Institute of Technology. “Stephen brings reputable knowledge in the market as KBRA continues to expand its footprint globally and to grow its business lines. Stephen will be focused on mortgage and housing finance across Europe helping us execute our existing pipeline and develop new ratings and research,” said Mauricio Noé, who is leading KBRA’s expansion into Europe. Please visit www.kbra.com for more details. KBRA is registered with the U.S. Securities and Exchange Commission as a Nationally Recognized Statistical Rating Organization (NRSRO). In addition, KBRA is recognized by the National Association of Insurance Commissioners (NAIC) as a Credit Rating Provider (CRP).


News Article | February 23, 2017
Site: phys.org

Asian Horned frogs account for approximately half of the ancient family of frogs called Megophryidae. This group was previously estimated to have originated 100-126 million years ago (mya). Frogs of this family hopped alongside the famed Velociraptors and other dinosaurs during the Cretaceous period (145-66 mya). Despite the fact that these animals have been around for a long time, little is known about their evolutionary history. Furthermore, unlike their dinosaur contemporaries, these frogs did not leave behind any known fossils. Methods using information from DNA sequences exist for estimating the age of origin for such groups of animals but these methods rely heavily on fossils of related animal groups, which could prove unreliable for these species. New research recently published in the scientific journal, Molecular Biology and Evolution, by a team of scientists from Ireland and India resolved a 195-year old confusion regarding relationships between the species of Asian Horned Frogs, an enigmatic group of frogs often with horn-like projections over their eyes. Using DNA sequences, they discovered many potentially new species in this group previously unknown to science. They also estimated the ages of species and groups of species using a method that had previously not been tried on amphibians and inadvertently discovered that until now scientists may have been overestimating the age of many frog families. Their discovery may open a new chapter on how scientists interpret the evolutionary history of many animals that currently have no known fossil record. "While this research particularly focused on frogs, many other animal groups also lack a fossil record, and so its very difficult to decipher their evolutionary histories. Our hope is that methods used here will prove beneficial for understanding how the distant ancestors of living animals may have coexisted in prehistoric times," explains lead author Dr. Stephen Mahony. The research team was led by Ireland's leading herpetologist, Dr. Stephen Mahony (previously of University College Dublin [UCD], Ireland and University of Delhi [DU], India), and a prominent mammal molecular evolutionary biologist, Prof. Emma Teeling (UCD). A PhD student of Prof. Teeling, Nicole Foley (UCD), and the "Frogman of India", Prof. SD Biju (DU) were co-authors on this research publication. The scientists demonstrated that a recently developed method called RelTime, that does not require fossil information, provided comparatively better age estimates for frogs. Their results correlate well with current knowledge on prehistoric biogeography—distribution of animals in space and time, considering tectonic plate movements, the rise of mountain ranges and palaeoclimatic changes—that may have influenced the evolutionary history of Asian Horned Frogs. This research project was envisaged by Dr. Mahony in 2006 after he discovered that one widely distributed 'species' appeared to represent several similar but scientifically 'new' distinct species. Six of these species from Thailand, Cambodia and India, were formally described as new to science between 2009 and 2013 from his (and his colleagues) previous research. Since then, Stephen embarked on the most extensive research to have ever been carried out on this group of frogs. He did so by examining and measuring hundreds of specimens from museums in Asia, Europe and the US, and used DNA gene sequences to determine how these species are related. These new results indicate that the Asian Horned Frogs family may have originated as recently as 77 million years ago in contrast to 100-126 mya as previously estimated, and suggest that scientists might have been also overestimating the age of many other families of frogs by up to 35%. The results have completely changed our understanding of how the different Asian Horned Frog species and their species groups are related. Many of the species that look similar, and so were considered to be closely related, were found to be distant relatives of each other, and those that look different were found to be closely related. Finally, the results of this research have identified numerous species in India, Vietnam and Laos that are very likely new to science, several of which may be restricted to small distributions in vulnerable habitats. This raises concerns for their continued survival as "having a name" is the bedrock for conservation. "It is well known that Amphibians are one of the most endangered animal groups. Our research further demonstrates that many species remain undiscovered. Sadly, with climate change and continuing habitat destruction, we are losing many species before we can learn anything about them, but the use of molecular techniques is dramatically speeding up the learning process." says Mahony. Explore further: Seven new species of night frogs from India including four miniature forms More information: Stephen Mahony et al, Evolutionary History of the Asian Horned Frogs (Megophryinae): Integrative Approaches to Timetree Dating in the Absence of a Fossil Record, Molecular Biology and Evolution (2017). DOI: 10.1093/molbev/msw267

Loading UCD collaborators
Loading UCD collaborators