Entity

Time filter

Source Type

Royston, United Kingdom

No statistical methods were used to predetermine sample size. The experiments were not randomized. MB5746 is an antibiotic-sensitized E. coli strain harbouring an envA1 mutation and tolC deletion42. Consequently, MB5746 is outer membrane hyper-permeable and efflux deficient. The primary screen was performed in 1,536-well plate format. MB5746 (1:10,000 dilution of an overnight culture 2–4 × 109 CFU ml−1) was grown in cation-adjusted Mueller Hinton broth (CAMHB; BD BBL, cat. no. 212322), with or without 10 μM riboflavin (riboflavin; Sigma, cat. no. 4500-100G) supplementation. The final medium volume in each well was 5 μl, to which 50 nl DMSO containing twofold-titrated compound was transferred. Hit compounds whose activity was suppressed by riboflavin were retested with CAMH agar containing MB5746 (1:1,000 dilution of overnight culture). MICs were determined by the broth microdilution method as recommended by the Clinical and Laboratory Standards Institute with one exception: bacterial strains were tested in M9 broth. MB5746 was grown to late-exponential phase in CAMHB and spread on CAMH agar plates (BD BBL cat. no. 211438) containing twofold escalating agar MIC levels of ribocil. To establish the number of viable cells in the starting inoculum, the culture was serially diluted and plated on CAMH agar plates lacking ribocil. Resistant isolates were re-streaked on plates containing the same ribocil concentration. The frequency of resistance (FOR) was determined, dividing the number of resistant isolates by the viable CFU in the late-exponential inoculum. ribA and ribB were knocked out in strain MB5746 by λ-Red recombineering using the linear PCR product generated by amplification from pKD4 (ref. 2) with the primer pairs P1/P2 or P3/P4, respectively. Transformation and selection on kanamycin were performed as described previously43, except that 500 µg ml−1 riboflavin was added to the selection plate to maintain the auxotrophic mutants. Upon obtaining strains MB5746ΔribA::kan and MB5746 ΔribB::kan, riboflavin growth assays were performed to determine the minimal concentration of riboflavin required to maintain growth of the auxotrophic mutant. Liquid cultures of CAMHB inoculated with 1 × 105 CFU ml−1 of the mutants grown overnight on solid media were supplemented with a twofold dilution series of riboflavin ranging from 250 µg ml−1 to 0.25 µg ml−1. After 24 h of incubation at 37 °C growth was scored visually and it was determined that as little as 0.5 µg ml−1 was sufficient to maintain some growth of the auxotrophic mutants, but optimal growth was observed with a minimum of 4 µg ml−1 riboflavin. DNA templates for in vitro transcription of aptamer RNA were prepared by PCR from the pCDF-EcFMN–GFP reporter plasmid using a forward primer ApT7 (TAATACGACTCATTATAGGgcttattctcagggcg) incorporating the T7 promoter and a reverse primer ApRev (cgttactctctcccatccg). Uppercase represents additional sequences added in the primer including the T7 promoter, lowercase represents the riboswitch sequence. In vitro RNA aptamer transcription was carried out using the RiboMAX large scale RNA production system kit (P1300, Promega) using the protocols provided by the manufacturer. After extraction with phenol/cholorform the RNA aptamers were further purified by column chromatography on NAP-10 sephadex columns (GE Healthcare) and isopropanol precipitation. E. coli MB5746 and deletion mutants (ΔribA, ΔribB) were reconstituted in 10 ml trypticase soy broth (TSB, Corning, cat. no. 46-060-CI). The mutant strains were supplemented with 2.5 µg ml−1 riboflavin (Sigma, cat. no. R4500-100G) and incubated at 35 °C for 6 h with shaking at 250 r.p.m. The respective 6-h cultures were used to seed, at a ratio of 1:50 ml, TSB either with or without 2.5 µg ml−1 riboflavin in a 250 ml flask and were incubated at 35 °C for 16 h with shaking at 250 r.p.m. Overnight cultures were centrifuged at 5,000 r.p.m. for 12 min at 5 °C. Supernatant was decanted and pellets were re-suspended in 50 ml fresh TSB to remove excess riboflavin. Six tenfold serial dilutions were made in TSB from these stock cultures (1.2 × 1010 CFU ml−1 for wild type, 5.7 × 109 CFU ml−1 for ΔribA, 3.6 × 109 CFU ml−1 for ΔribB). Select serial dilutions were further diluted 1:10 into 3% gastric hog mucin for intra-peritoneal (i.p.) injection into mice. The initial dilutions without mucin were plated for quantification on TSA II (5% sheep’s blood) agar plates (BD BBL, cat. no. 221261) for the wild-type strain or 10 µg ml−1 riboflavin-infused Muller Hinton II Agar (BD BBL, cat. no. 211438) plates for mutant strains. Eleven-week-old female DBA2/J mice (Jackson Labs) were chosen for this study based on weight (~20 g) and combined into one pool. Animals were then randomly selected from this pool and placed in groups of five in separate boxes. Subjects were treated with 150 mg kg−1 i.p. cyclophosphamide (Baxter, NDC# 10019-955-50) on day −4 and 100 mg kg−1 on day −1. On day 0, five mice per group were injected i.p. with 0.5 ml of a respective dilution of bacteria in 3% mucin (6.0 × 106, 105, 104 CFU ml−1 for wild type, 2.85 × 107, 106, 105 CFU ml−1 for ΔribA, 1.8 × 107, 106, 105 CFU ml−1 for ΔribB). On day 1, subjects were euthanized via CO asphyxiation and spleens were aseptically removed, weighed and homogenized in 1.5 ml of sterile saline (Hyclone, cat. no. SH30028.03) with 10% glycerol (Fisher Scientific, cat. no. BP229-1). Tissue homogenates were serially diluted tenfold in sterile saline and selected concentrations were plated on either TSA II (5% sheep’s blood) agar plates for the wild type or MH riboflavin infused agar plates for ΔribA and ΔribB mutants. Plates were incubated at 35 °C for 24 h and CFU per g of spleen tissue were determined. No data was excluded from this study and investigator blinding was not implemented during this study. This study was approved and was in compliance with the ethical regulations set forth by the Institutional Animal Care and Use Committee (IACUC) at Merck Research Laboratories, Kenilworth, New Jersey. E. coli MB5746 was reconstituted in 10 ml trypticase soy broth (TSB, Corning, cat. no. 46-060-CI) and incubated at 35 °C for 6 h with shaking at 250 r.p.m. The 6 h culture was used to seed, at a ratio of 1:50 ml, TSB in a 250 ml flask and were incubated at 35 °C for 16 h with shaking at 250 r.p.m. The overnight culture was centrifuged at 5,000 r.p.m. for 12 min at 5 °C. Supernatant was decanted and the pellet was re-suspended in 50 ml fresh TSB to remove excess riboflavin. Nine tenfold serial dilutions were made in TSB from the culture (1.0 × 1010 CFU ml−1). The third dilution (1.0 × 107 CFU ml−1) was further diluted into 3% gastric hog mucin for i.p. injection into mice. The initial dilutions without mucin were plated for quantification on TSA II (5% sheep’s blood) agar plates (BD BBL, cat. no. 221261). Twelve-week-old female DBA2/J mice (Charles River Laboratory) were chosen for this study based on weight (~20 g) and combined into one pool. Animals were then randomly selected from this pool and placed in groups of five in separate boxes. Subjects were treated by intraperitoneal (i.p.) injection with 150 mg kg−1 of cyclophosphamide (Baxter, NDC# 10019-955-50) on day −4 and 100 mg kg−1 on day −1. On day 0, mice were inoculated i.p. with 0.5 ml of bacteria in 3% mucin (5.0 × 104 CFU ml−1; Fig. 4) or a higher inoculum of 5.0 × 105 CFU ml−1 (Extended Data Figure 8). Thirty minutes post-inoculation, mice (n = 5 per group) were treated by subcutaneous (s.c.) injection three times over 24 h with either ciprofloxacin (0.5 mg kg−1, Sigma Aldrich, cat. no. 17850-5G-F, ribocil-C (at either 120, 60, or 30 mg kg−1)) or 10% DMSO (Sigma Aldrich, cat. no. 276855-1L) sham. On day 1, subjects were euthanized via CO asphyxiation and spleens were aseptically removed, weighed and homogenized in 1.5 ml of sterile saline (Hyclone, cat. no. SH30028.03) with 10% glycerol (Fisher Scientific, cat. no. BP229-1). Tissue homogenates were serially diluted tenfold in sterile saline and selected concentrations were plated on TSA II (5% sheep’s blood) agar plates. Plates were incubated at 35 °C for 24 h and CFU per g of spleen tissue were determined. A normality test was performed to verify normal distribution of data before determining statistical significance via the one-way Bonferroni ANOVA. No data was excluded from these studies and investigator blinding was not implemented during this study. This study was approved and was in compliance with the ethical regulations set forth by the Institutional Animal Care and Use Committee (IACUC) at Merck Research Laboratories, Kenilworth, New Jersey. Overnight cultures of MB5746 or MB5746 RibocilR cells were diluted 1:50 in CAMHB and distributed (1.25 ml) into 10-ml culture tubes containing diluted ribocil (twofold dilution series) or DMSO (1%) as mock control. The treated cultures were incubated with shaking at 37 °C for about 20 h, after which the OD of the culture was determined and 500 μl was moved to a 96-well deep-well plate. After centrifugation (4,000 r.p.m.) for 10 min, the bacterial cell pellets were rinsed with lysozyme dilution buffer (10 mM Tris HCl (pH 8.0), 25 mM NaCl, 1 mM EDTA) and centrifuged again. Cell pellets were then re-suspended in 100 μl of lysozyme solution (10 mg ml−1 lysozyme (Sigma) in lysozyme dilution buffer), incubated at 37 °C for 30 min, and then frozen at −20 °C. Riboflavin, FMN and FAD concentrations in the bacterial lysates were determined using the Vitamin B2 HPLC detection kit (ImmuChrom, GmbH) and Vitamin B2 column (IC2300rp, ImmuChrom GmbH) following the procedure recommended by the manufacturer scaled for a 50 μl sample (bacterial lysate). A Shimadzu HPLC system with fluorescence detector was used at a flow rate of 1.0 ml min−1 and flavin detection was carried out at 450 nm. Flavin levels were determined for an equivalent number of cells by correcting raw AUCs using the OD ratio of the treated versus the untreated cultures. P1:tatggcaaaataagccaatacagaaccagcattatctggagaatttcatggtgcaggctggagctgcttc; P2:aagcaaatgaattacacaatgcaagagggttatttgttcagcaaatggcccatatgaatatcctccttag; P3:gactgccctgattctggtaaccataattttagtgaggtttttttaccatggtgcaggctggagctgcttc; P4:gattaaggcagtaaattaagcagcggttttcagctggctttacgctcatgcatatgaatatcctccttag; P5:CTCAAATGCCTGAGGTTTCAGcaggacttgcgtttggacgtc; P6:GAAAAGTTCTTCTCCTTTACTCATggtaaaaaaacctcactaaaattatg; P7:GACGTCCAAACGCAAGTCCTGctgaaacctcaggcatttgag; P8:CATGGATGAGCTCTACAAATAAgcgcaacgcaattaatgtaag; P9:CATAATTTTAGTGAGGTTTTTTTACCatgagtaaaggagaagaacttttc; P10:CTTACATTAATTGCGTTGCGCttatttgtagagctcatccatg; P11:CATTAGCGTTATAGTGAATCCGCtaacgttctcagggcggggtg; P12:GAAAAGTTCTTCTCCTTTACTCATgcgacctcccgtttttccgcc; P13:CATTAGCGTTATAGTGAATCCGCtaaaacccatcgcttcagggc; P14:GAAAAGTTCTTCTCCTTTACTCATaatgaaacgctctcgtaagaatac; P15:CACCCCGCCCTGAGAACGTTAgcggattcactataacgctaatg; P16:GGCGGAAAAACGGGAGGTCGCatgagtaaaggagaagaacttttc; P17:GCCCTGAAGCGATGGGTTTTAgcggattcactataacgctaatg; P18:GTATTCTTACGAGAGCGTTTCATTatgagtaaaggagaagaacttttc; AbRFN-ribB_RED forward: ttgcatcagtcctgaaatgttcaaccgtattcttacgagagcgtttcattatgaatcagacgctactttc; PaRFN-ribB_RED forward: gtcgcgccggccatgctgcgcgcctgtgcggcggaaaaacgggaggtcgcatgaatcagacgctactttc, Ab/Pa RFN-ribB_RED reverse: agatcccggtgcctaatgagtgagctaacttacattaattgcgttgcgcgctggctttacgctcatgtg; yqiC_RED forward: caggacttgcgtttggacgtcgaactcttcacggcttacaaggtcgaggcgcgtcagctgcgcttgtagg; ribB_RED reverse: gattaaggcagtaaattaagcagcggttttcagctggctttacgctcatgtgcctgacggtatgccacca; yqiC seq. reverse: agttcgctgattctttgttc; ribB seq. reverse 1: agcggaattaacatcttgc; ribB seq. reverse 2: gcttcaatggtcacggtaa. Transition from capital to lowercase letters for P5–P18 denotes boundaries of fragments that facilitate in-fusion cloning. EcFMN–GFP reporter plasmids were constructed by fusing the EcFMN region, inclusive of 550 bp upstream of ribB through the start codon, to gfpuv and cloning into a vector with the low copy CloDF13 origin of replication. Primers P5 and P6 were used to amplify the EcFMN region from wild-type and resistant mutants by colony PCR, primers P7 and P8 were used to amplify the CloDF13 origin and SmR cassette from pCDF-1b (EMD Millipore), and primers P9 and P10 were used to amplify gfpuv from pGFPuv (Clontech). Upon purification, all three linear PCR products were combined using the in-fusion HD cloning system (Clontech) and transformed into TOP10 cells (Life Technologies) with selection on spectinomycin (MP biomedicals) to yield pCDF-EcFMN–GFP reporter plasmids. Plasmids were subsequently transformed into the MB5746 ribocilR mutant M5 background for compound testing. Initial attempts to create Pseudomonas aeruginosa and Acinetobacter baumannii FMN–GFP reporters in a similar fashion to the EcFMN–GFP reporters by using the PaFMN or AbFMN region, inclusive of 550 bp upstream of ParibE or AbribB through the start codon, did not yield constructs with sufficient baseline fluorescence (data not shown). In order to optimize fluorescence, hybrid constructs were made in which the E. coli promoter region was placed upstream of the PaFMN or AbFMN elements. Primer combinations P11/P12 or P13/P14 were used to amplify the PaFMN or AbFMN elements, respectively, from wild-type cells by colony PCR, and primer pairs P15/P16 and P17/P18 were used to amplify the E. coli promoter, gfpuv, and vector backbone from the previously constructed pCDF-EcFMN–GFP plasmid for combination with PaFMN and AbFMN, respectively. Purified linear PCR products were combined and transformed as described above to yield pCDF-EcPro-PaFMN–GFP and pCDF-EcPro-AbFMN–GFP reporter plasmids. Again, plasmids were transformed into the MB5746 ribocilR mutant M5 background for compound testing. The native, chromosomal E. coli ribB riboswitch was replaced with that of either A. baumannii or P. aeruginosa using a two-step λ-RED recombineering process44. In the first recombineering event, the GFPuv coding sequence from either the pCDF-EcPro-AbFMN–GFP or pCDF-EcPro-PaFMN–GFP plasmid was replaced with the E. coli ribB coding sequence (EcribB). To this end, MB5746 ribB::kan cells were grown in CAMH broth supplemented with 4 μg ml−1 riboflavin (reconstituted in 1:1 dH2O:ethanol) and transformed (as described below) with the temperature-sensitive plasmid pKD4644. Reactions were plated onto CAMH agar +50 μg ml−1 ampicillin at 30 °C. Next, either the pCDF-EcPro-AbFMN–GFP or pCDF-EcPro-PaFMN–GFP plasmid was transformed into MB5746 ribB::kan/pKD46 and plated onto CAMH + 4 μg ml−1 riboflavin + 50 μg ml−1 spectinomycin + 50 μg ml−1 ampicillin at 30 °C to maintain double plasmid selection. The resulting strains were recombineered with EcribB PCR product containing flanking regions homologous to the cognate pCDF plasmid. Substrate PCR products were obtained through colony PCR of the wild-type ribB locus of MB5746 and either the AbFMN-ribB_RED forward or PaFMN-ribB_RED forward primer in combination with the Ab/Pa FMN-ribB_RED reverse primer. Cells were recovered in CAMH broth for 1 h and Rib+ colonies were selected on CAMH agar +50 μg ml−1 spectinomycin and incubated at 37 °C to remove pKD46. The resulting strains, MB5746 ribB::kan (pCDF-EcPro-AbFMN-EcribB) or (pCDF-EcPro-PaFMN-EcribB) carry a plasmid-borne EcribB gene downstream of the native E. coli ribB promoter fused to either AbFMN or PaFMN. In the second recombineering event, the plasmid-borne AbFMN- or PaFMN-EcribB fusions engineered above were introduced into the E. coli chromosome in single-copy at the native ribB locus. MB5746 ribB::kan/pKD46 cells were grown to exponential phase in CAMH broth + 4 μg ml−1 riboflavin + 50 μg ml−1 ampicillin and electroporated with either AbFMN-EcribB or PaFMN-EcribB PCR product containing flanking regions homologous to the native ribB locus. These PCR products were amplified from pCDF-EcPro-AbFMN-EcribB or pCDF-EcPro-PaFMN-EcribB using the yqiC_RED forward and ribB_RED reverse primers. Unlike strains carrying the plasmid-borne hybrid EcribB constructs, the chromosomal hybrid fusion constructs do not yield enough riboflavin for optimal growth on CAMH in single copy. Therefore, reactions were recovered in CAMH broth containing very low levels of riboflavin (0.4 μg ml−1, a concentration that does not permit growth of the ribB deletion mutant), plated onto CAMH agar + 0.4 μg ml−1 riboflavin, and incubated at 37 °C to remove the pKD46 plasmid. The E. coli ribB promoter, hybrid riboswitch, and EcribB coding regions were sequenced in resulting Rib+ cells and additionally sequenced at joint sequences using yqiC seq. reverse, ribB seq. reverse 1, and ribB seq. reverse 2 primers. All transformations were electroporation reactions performed as suggested2 with some modifications. Around 30–50 ml of cells were grown in CAMH to exponential phase. For recombineering reactions, strains harbouring pKD46 were induced for 1 h with 1% arabinose before harvesting of cells. Cells were washed with 30 ml of ice-cold ddH O and pelleted at 4 °C, 3,000g for 10 min, followed by two additional washes with 1 ml ice-cold ddH O and pelleted each time at 8,000g at 4 °C for 2 min. Pellets were re-suspended in 300 μl ddH O and 100 μl cells were incubated with 1–2 μl PCR product for 5 min before electroporation. Electroporation reactions were performed using 0.1-cm gap cuvettes and a GenePulser II (BioRad) with settings at 200 Ω, 25 μF, and 1.8 kV. Cells were recovered at the appropriate temperature in 1 ml CAMH broth as described above and plated on CAMH agar containing the appropriate supplements. All PCR reactions were performed using GoTaq Green Master Mix (Promega Corporation) according to manufacturer’s instructions. DNA sequencing was performed by Genewiz, Inc. Crystals of the F. nucleatum FMN riboswitch in presence of the ligand were obtained following published protocols13, 45 with minor modifications. The RNA was synthesized in two strands: GGAUCUUCGGGGCAGGGUGAAAUUCCCGACCGGUGGUAUAGUCCACGAAAGCUU and GCUUUGAUUUGGUGAAAUUCCAAAACCGACAGUAGAGUCUGGAUGAGAGAAGAUUC. The oligonucleotides were purchased from Sigma-Aldrich. After reception each strand was dissolved in water, aliquoted so that each aliquot would contain the material necessary to make a 25 μl solution at 0.4 mM concentration. The aliquots were lyophylized using a Centrivap concentrator (Labconco) and kept at −20 °C for long-term storage. Prior to annealing the nucleic acids were re-suspended in 25 μl annealing buffer (10 mM cacodylic acid, 100 mM acetate, 4 mM MgCl adjusted to pH 6.8 using KOH). The oligomers were mixed together, along with 1.0 μl of an inhibitor stock solution at 50 mM in 100% deuterated DMSO, and annealed in a thermocycler by incubation at 37 °C for 30 min followed by cooling from 37 °C to 4 °C at a rate of 3 °C per min. The crystals were grown by vapour diffusion using a 15-well EasyXtal DropGuard X-Seal tool (Qiagen) after mixing 3 μl of riboswitch–ligand solution with 3 μl precipitant (0.1 M Na acetate, pH 5.0, 0.2 M MgCl , and 7 to 11% v/v PEG 4K). Small nuclei appear after a few days, and are made to grow larger for diffraction studies by controlled drying. Drying is achieved by substitution once a day of the adequate volume of well solution with a 50% v/v PEG 4K stock solution. The volume is calculated to achieve a ~2% increase in precipitant concentration per step. The crystals after growth are harvested and dipped for 1 to 2 min in a cryoprotectant solution (0.1 M Na MES, pH 6.5, 0.2 M MgCl , 10% v/v PEG 4K, 20% v/v glycerol, and ligand diluted to 1 mM concentration). Crystals were harvested with a mesh Litholoop (Molecular Dimensions Ltd) and flash-frozen in liquid nitrogen. X-ray diffraction data (Extended Data Table 2) were collected at the Advanced Photon Source (APS) sector 17 (IMCA) at 1.0 Å wavelength using a Pilatus 6M (Dectris) pixel array detector. 720 frames with an oscillation of 0.25° each were collected. The data were processed using the automated pipeline autoPROC46, with calls to the programs XDS47 for integration and AIMLESS48 for scaling. The structure was determined using PDB entry 3F4E as a starting point after removing all heterogeneous atoms including the FMN. The structure was refined without inclusion of the ligand coordinates at any step before and until an omit map difference map is generated to fit the compound. The steps include refinement using the program autoBUSTER49, corrections of the model and inclusions of several cations with Coot, and Cartesian simulated annealing using the program Phenix50 to further eliminate the potential of bias against FMN which was present in the PDB 3F4E entry. The set of ‘free’ reflections was taken from the same PDB entry 3F4E and completed as required. All refinement calculations after adding the ligand were performed using the program autoBUSTER49. Model visualization and rebuilding was performed using the program Coot51. All figures in the manuscript generated with PyMol52. Co-crystallization of the heptamer with ribocil was performed using a racemic mixture of the ligand. In spite of its limited resolution, 2.9 Å, the (R) isomer fits distinctly better than the (S) isomer in the initial electron density. Consistent with this observation, crystallographic refinement of a model which starts with the wrong (R) isomer ends up with a structure with the chiral centre inversed and nearly planar, an impossible stereochemistry. By contrast, the chiral volume remains unchanged in the course of refinement when starting from the (S) isomer. Notwithstanding the electron density map, due to the constrained nature of the binding site it is not possible to fit the (R) isomer while maintaining reasonable ligand stereochemistry and parallelism of the pyrimidynonyl and the methylaminopyrimidynyl between the bases of A48 and A85, and against the base of G62. Altogether, crystallographic and stereochemical considerations strongly support the conclusion that only the (S) form binds to the FMN aptamer. Further observations made later when the isomers were separated agree with this interpretation: only one of them is active against the riboswitch, and the ligand with the correct chirality is more active than the racemic mixture (Extended Data Fig. 3 and Extended Data Table 1). A homology model of the E. coli FMN aptamer was constructed using program mutate_bases53 of the 3DNA package using the F. nucleatum impX riboswitch aptamer X-ray structure as the template and the FMN aptamer alignment of E. coli, F. nucleatum, P. aeruginosa and A. baumannii (Extended Data Fig. 5). All nucleotide insertions in the E. coli sequence were removed in the model (Extended Data Fig. 5). There are 34 base changes among the 111 nucleotides modelled. Base pairing when present remains consistent. Energy minimization at A92 was performed to avoid VDW clashes using Macromodel (Schrodinger, LLC). Reporter strains were diluted to ~5 × 106 CFU ml−1 in CAMHB supplemented with 30 µg ml−1 spectinomycin. Compounds to be tested were serially diluted twofold through 11 points in 100% DMSO. A BioMek FX liquid handler was used to deliver 49 μl of diluted culture into a 384-well, black/clear-bottom assay plate followed by 1 μl of titrated compound. DMSO and antibiotic controls were added manually to appropriate wells and the plates were shaken for 1 min before incubating at 37 °C. After overnight growth, fluorescence, using 405 nm excitation and 510 nm emission, and absorbance at 600 nm, was assessed on an EnVision multiplate reader (Perkin Elmer). Fluorescence response (RFU), relative to full growth and fully inhibited (50 μM ribocil) controls and absorbance response (OD ), relative to full growth and sterile controls, were fitted to four parameter (variable slope) curves. The concentration of compound which decreased the specific fluorescence signal by 50% is reported as the GFP EC . Aptamers were first re-annealed at a 20 μM concentration in 4 mM KH PO , 16 mM K HPO , 64 mM KCl and 0.1 mM EDTA, pH 7.4 buffer by heating at 95 °C for 5 min followed by incubation at room temperature for 15 min. Only one re-annealing cycle was performed per aptamer sample. A 1.25-fold serial dilution of the re-annealed aptamer was prepared to have a final concentration ranging from 6.6 to 150 nM in 50 mM Tris-HCl, 100 mM KCl and 2 mM MgCl assay buffer, pH 7.4. This was mixed with FMN ligand (30–240 nM final concentration). Fluorescence signal was read using the Spectramax M5 at an excitation wavelength of 455 nm and emission wavelength at 525 nm with cut-off filter at 515 nm. The instrument was set up in kinetic mode to acquire data every 20 s. The steady-state K and the binding-competent fraction of aptamer were determined from fluorescence data obtained at 120 min of the reaction by fitting to a quadratic equation fully describing the binding equilibrium under tight-binding conditions. A twofold serial dilution of compounds was prepared to have a final assay concentration range from 1.22 to 10,000 nM. This was prepared in 50 mM Tris-HCl, 100 mM KCl and 2 mM MgCl assay buffer, pH 7.4, with 0.2% DMSO. FMN ligand concentration was 60 nM and the E. coli FMN aptamer concentration was 48 nM or, for ribocil, 150 nM. The fluorescence signal was read on the Spectramax M5 as described above. The steady-state binding competition data at 120 min was fitted to a cubic equation fully describing the competition binding equilibria to derive the K value for the compound, while fixing K to the value obtained earlier for FMN binding. The binding kinetics data was fitted by KinTek Explorer-based numerical integration with K constrained to derive the dissociation rate constant (k ). The association (k ) rate constant is then calculated from K and k . The Click-iT EdU Alexa Fluor 488 HCS assay kit (Life Technologies, C10351) was used to assess the potential cytoxicity of ribocil in mammalian cell cultures using a modified version of the manufacturer’s protocol. For the assay, mycoplasma-tested HeLa cells (ATTC) were seeded at 4,000 cells per well in 384-well poly-d-lysine-coated plates (Greiner, 781946) in 25 μl of culture medium (Optimem I, Life Technologies) and treated with a 20-point twofold dilution series of ribocil. After addition of EdU (5 μM) and incubation (37 °C) for 24 h, images were captured and analysed using an Acumen eXC3 (TTP Labtech Ltd) laser scanning cytometer. Total cell numbers were determined using Hoechst 33342 (Life Tech, H3530). Ribocil displayed no HeLa cell cytoxicity as detected by cell count (EC ≥ 100 μm, activity at 100 μM = 17%) or EdU measurement (EC ≥ 100 μM, activity at 100 μM = 11%).

Discover hidden collaborations