ThermoFisher

Bremen, Germany

ThermoFisher

Bremen, Germany
SEARCH FILTERS
Time filter
Source Type

No statistical methods were used to predetermine sample sizes. All behaviour data were collected in a random manner. No blinding method was used in assessing experimental outcomes. The following flies were obtained from Bloomington Stock Center: isogenized w1118 (BL5905), norpAP24 (BL9048), ninaE-norpA (rh1>norpA; this is a direct fusion of the ninaE promoter to the norpA coding region; BL52276), ninaE–Gal4 (rh1–Gal4; BL8691), trpMB (BL23636), trplMB (BL29314), UAS–mcherry-NLS (BL38425), gl60j (BL 509), pdf–Gal4 (BL6900), and two UAS–plc21C RNAi lines (01210, BL 31269 and 01211, BL31270). GMR–hid31 was obtained from the Drosophila Genetic Resource Center, Kyoto (108419). We used w1118 as the control strain. The UAS–rh7 RNAi line (v1478) was from VDRC Stock Center. The tim–Gal4 transgene32 was provided by A. Sehgal. The cry–Gal4.E13 transgene2 was from M. Rosbash. The cryb and cry01 flies2, 33 were provided by M. Wu and the rh502, rh601, UAS-rh3, UAS-rh4 and UAS-rh5 lines34, 35 were provided by C. Desplan. We also used ninaEI17 flies36. To clone the rh7 coding region, we prepared mRNA from w1118 heads, performed reverse transcription (RT)-PCR using the following primers, and cloned the cDNA into the TOPO vector (pCR2.1-TOPO, Invitrogen). Primers: rh7 forward, GCGGCCGCCACCATGGAGGCCATCATCATGACG; rh7 reverse, GCGGCCGCTCAGAACTTACTCTGTTCCATGAC. To generate the UAS–rh7 transgene, we subcloned the rh7 open reading frame into the NotI site of the pUAST vector. To construct the plasmid for expression of Rh7 in HEK293T cells, we subcloned the rh7 open reading frame between the BamH1 and Xba1 sites of the pCS2+MT vector using the following primers: rh7 forward, ATCAGATCTCACCATGGAGGCCATCATCATGACG; rh7 reverse, ATCTCTAGATCAGAACTTACTCTGTTCCATGAC. To generate transgenic flies expressing an Rh7–FLAG fusion protein, we first constructed the pUAST–FLAG vector using the following two oligonucleotides, which we annealed and cloned into the XhoI and XbaI sites of the pUAST vector: FLAG 5′-XbaI, TCGAGGGGATTACAAGGATGACGACGATAAGTAAT and FLAG 3′-XhoI, CTAGATTACTTATCGTCGTCATCCTTGTAATCCCC. We amplified the rh7 coding region using the same forward primer as above, in conjunction with the following reverse primer to eliminate the stop codon: rh7 reverseno-stop, GCGGCCGCGAACTTACTCTGTTCCATGAC. Both the UAS–rh7 and UAS–rh7–FLAG transgenic flies were obtained by germline transformation using w1118 embryos (Bestgene Inc.). To generate flies expressing an rh7+ genomic transgene (P[rh7+]), a BAC genomic DNA clone (CH322180G19) was obtained from the P[acman] collection37. The germline transformation took advantage of site-specific integration using the Φ31-attB/attP system (Bestgene Inc.). We produced the plasmid for knocking out rh7 by ends-out homologous recombination38 as follows. We PCR amplified two homologous arms (left, 3.2 kb and right, 3.3 kb) using the following primers: left arm forward, AATTGCTGGGATCCCTCAATTGGCCTAATCGGTTTCTG; left arm reverse, AATTGCTGGGTACCGACTGACTTGGCCAAATATTTACG; right arm forward, AATGCTGGCGGCCGCTTAAAATGCTGCCCGAGACT; right arm reverse, AATTGCTGGCGGCCGCTGGCTTATGAAGTTGCAAAAAG. We cloned the two arms into the targeting vector, pw35loxp–Gal4. This construct was designed to delete 540 base pairs (bp) 3′ to the rh7 translational start site, and was replaced with a cassette containing the mini-white marker and Gal4 flanked by two loxP sites. The upstream loxP sequence contained a translational start site that rendered the Gal4 coding region out of frame. Consequently, the Gal4 was not functional. To obtain the donor lines for generating the rh7 knockout (rh71 allele), the targeting vector was injected into w1118 embryos (Bestgene Inc.). We mobilized the donor insertion by crossing the donor line to y,w;P[70FLP]11 P[70I-SceI]2B nocSco/CyO flies (Bloomington Stock Center, BL6934). The progeny were screened for gene targeting in the rh7 locus by PCR using two pairs of primers. The first pair (P1 and P2) were the following two primers that annealed to the first and second coding exons, and produced a DNA product (885 bp) only in the wild-type (Extended Data Fig. 2g): P1, CTCTCGCTCTCCGAGATGTT and P2, ACCACCGAAATCAGGCAATA. The following second pair of primers (P3 and P4) annealed to the mini-white gene and to a sequence 3′ to rh7, and therefore only generated a product in the rh71 mutant (4.4 kb; Extended Data Fig. 2g): P3, TGTACATAAAAGCGAACCGAACCT and P4, ACTGTGCGACAGAGTGAGAGAGCAATAGTA. After generating rh71, we outcrossed the flies to the control stain (w1118) for five generations. To determine whether the key fly lines used in this study harboured the perSLIH, timls or jetc mutations in the genetic background, we performed DNA sequencing. We extracted genomic DNA from adult flies, and amplified the relevant regions in the per, tim and jet genes by PCR (Phusion High-Fidelity DNA Polymerase, NEB) using the following primers: per: forward, GTCCACACACAACACCAAGG; reverse, TTGATGATCATGTCGCTGCT. tim: forward, TGGCTGGGGATTGAAAATAA; reverse, TTACAGATACCGCGCAAATG. jet: forward, AGCCGATCATAGTGGAGTGC; reverse, AAGGCACGCACAGGTTTACT. We purified the PCR products and subjected them to DNA sequencing (DNA Sequencing Facility at the University of California, Berkeley). The perSLIH allele has a C to A transversion at nucleotide 2688438. The control (per+) sequence encompassing this region (2688436–2688448, Drosophila genome release r6.14) is CTCCGGCAGCAGT. The perSLIH sequence is CTACGGCAGCAGT. All of the fly lines checked had sequences that matched per+. These include: (1) rh71, (2) rh71 cryb, (3) rh71 cry01, (4) pdf–Gal4 and (5) rh7-RNAi. The timls allele has a single nucleotide insertion (C) after nucleotide 3504474 relative to tims. The sequence spanning this region in the control (timls) is ATCAAAGTTCTGAT (3504473–3504486, Drosophila genome release r6.14) and in tims is ATAAAGTTCTGAT. We sequenced the following lines, all which had sequences that matched the control (tims): (1) cry01, (2) rh71 and (3) P[rh7+]; rh71. The jetc allele has a T-to-A transversion at nucleotide 4949048. The control (jet+) sequence spanning this region (4949059–4949047, Drosophila genome release r6.14) is CTTGATTATCTTC, while the jetc sequence is CTTGATTATCTAC. We sequenced the following lines, all of which had sequences that matched the control (jet+): (1) cry01, (2) rh71 and (3) P[rh7+];rh71. To quantify expression of opsin genes (Fig. 1b), we isolated total RNA from ~50 fly heads from each of the indicated fly stocks, and used 1 μg total RNA from each sample as a template for reverse transcription using SuperScript III Reverse Transcriptase (ThermoFisher, cat. 18080093). Oligo dT primers were used for cDNA synthesis. cDNA preparation was subjected to real-time quantitative PCR (Roche, LightCycler 480 system) according to the LightCycler 480 SYBR Green 1 Master Mix (cat. 04707516001) protocol. The primers used for real-time quantitative PCR were: rh1: forward CGCTACCAAGTGATCGTCAA, reverse GTATGAGCGTGGGTTCCAGT. rh2: forward TCCGTGCTGGACAATGTG, reverse AATCATGCACATGGACCAGA. rh3: forward CGAGCAAAAGAACAGGAAGC, reverse TCGATACGCGACTCTTTGTG. rh4: forward GTAGCCCTCTGGCACGAAT, reverse TCTTCAGCACATCCAAGTCG. rh5: forward TCCTGACCACCTGCTCCTTC, reverse GCTCCAGCTCCAGACGATAC. rh6: forward CAAGGACTGGTGGAACAGGT, reverse GTACTTCGGGTGGCTCAATC. rh7: forward GTTTCCACGGGTCTGACAAT, reverse GCTGTAGCACCAGATCAGCA. rp49: forward GACGCTTCAAGGGACAGTATCTG, reverse AAACGCGGTTCTGCATGAG. We also analysed opsin gene expression using an RNA-seq dataset (Fig. 1c). For each genotype, three independent RNA libraries were prepared from ~50 heads using the TruSeq Stranded mRNA Library Prep Kit. Pair-end sequencing was performed using the TruSeq platform (Illumina). Details of the RNA-seq experiments and data analysis will be presented elsewhere (J.D.N., I. Tekin and C.M., in preparation). Opsin RNA-seq mRNA levels were quantified as RPKM. RPKMs for each opsin were calculated independently and the average RPKMs are plotted. To knock-down plc21C expression, we combined each UAS–plc21C RNAi transgene (01210 and 01211) with UAS–Dicer2;;actin–Gal4. To quantify the efficacy of the RNAi, we extracted total RNA from ten adult flies (five male and five female), and used 1 μg total RNA from each sample as a template for reverse transcription using SuperScript III Reverse Transcriptase (ThermoFisher, cat. 18080093). Oligo dT primers were used for cDNA synthesis. cDNA preparation was subjected to quantitative PCR (Roche, LightCycler 480 system) according to the LightCycler 480 SYBR Green 1 Master Mix (cat. 04707516001) protocol. The plc21C primers used were: forward, GGATCTCTCCAAGTCGTTCG; reverse, TAGCCGCTTCACCAGCTTAT. The rp49 primers were: forward, GACGCTTCAAGGGACAGTATCTG; reverse, AAACGCGGTTCTGCATGAG. In each reaction, we normalized expression of plc21C transcripts to rp49. To obtain Rh7 antibodies, we generated a GST–Rh7 fusion protein by subcloning the region encoding the N-terminal 80 amino acids into the pGEX6P-1 vector (GE Healthcare Life Science). We expressed the fusion protein in Escherichia coli (BL21), purified the recombinant protein using glutathione sepharose beads (GE Healthcare Life Science) and generated antiserum in a rabbit (Covance). We affinity purified the antibodies by conjugating the antigen to Affi-Gel 10 (Bio-Rad). We performed immunohistochemistry using whole-mounted fly brains as described previously39. Briefly, we fixed dissected brains for 15–20 min at 4 °C in 4% paraformaldehyde in phosphate buffer (0.1 M Na PO , pH 7.4) with 0.3% Triton-X100 (Sigma), hereafter referred to as PBT. The brains were blocked with 5% normal goat serum (Sigma) in phosphate buffer for 1 h at 4 °C. We then incubated the tissue with primary antibodies at 4 °C for ≥24 h. After three washes in PBT, the brains were incubated overnight at 4 °C with the following secondary antibodies from Life Technologies: anti-mouse Alexa Fluor 488 or 568 Dyes, anti-rabbit Alexa Fluor 488 or 568 Dyes or Alexa dyes. The brains were washed three times with PBT and mounted in VECTASHIELD mounting medium (Vector Labs) for imaging. For Rh7 and PDF co-staining (Fig. 2d–i), four brains were examined. To analyse light-mediated degradation of Tim (Fig. 3c–f), we entrained the flies for 3 days under 12 h light–12 h dark cycles (~600 lx LED white light). The flies were then exposed to a 5-min LED light stimulation (~600 lx) at ZT22, kept in the dark for 55 min, fixed at ZT23 under a red photographic safety light (for 45 min), and dissected for whole-mount immunostaining. Flies that were not exposed to the nocturnal light treatment were fixed and stained at the same time. To examine Per staining at different ZT points (Extended Data Fig. 9), flies were entrained for 4 days under 12 h light (~400 lx)–12 h dark cycles, and were collected at the indicated ZTs. For nighttime samples, we handled the flies under a red photographic safety light. We prefixed whole flies at 4 °C with 4% paraformaldehyde in PBT for 45 min before dissecting out the brains. After the dissections, the brains were fixed again for 15–20 min at 4 °C in 4% paraformaldehyde in PBT. We used the following primary antibodies: anti-Rh7 (1:250, rabbit), anti-Per (1:1,000, guinea pig), anti-Tim (1:1,000, rat)40, anti-PDF (1:1,000, c7 mouse monoclonal antibody from the Developmental Studies Hybridoma Bank), anti-dsRed (1:500, mouse, Clontech Catalog #632392). The Per and Tim antibodies were contributed by A. Sehgal. The secondary antibodies (Thermo Fisher Scientific) were anti-rat Alexa Fluor 568 Dye and anti-guinea pig Alexa Fluor 555 Dye. We acquired the images using a Zeiss LSM 700 confocal microscope. To perform whole-mount staining of the retina, we dissected the retina (within the eye cup) and fixed the tissue at 4 °C in 4% paraformaldehyde in PBT for 20 min. After washing briefly in PBT, we blocked the retina for 1 h in PBT plus with 5% normal goat serum. We used the following primary antibodies: anti-Rh7 (1:250, rabbit), anti-Rh3 (1:200, mouse, gift from S. Britt, University of Colorado, Denver) and anti-Rh5 (1:200, mouse, gift from S. Britt, University of Colorado, Denver). The secondary antibodies were: anti-rabbit Alexa Fluor 568 Dye (1:1000) and anti-mouse Alexa Fluor 488 Dye (1:1000). Circadian experiments were performed at 25 °C using the Drosophila Activity Monitoring (DAM) System (Trikinetics). Individual 3–7-day-old male flies were loaded into monitoring tubes, which contained 1% agarose (Invitrogen) and 5% sucrose (Sigma) as the food source. The flies were entrained to 12 h light–12 h dark cycles for 4 days and released to constant darkness or constant light (10 lx for dim light conditions and 400 lx for bright light conditions, unless indicated otherwise) for at least six days to measure periodicity. Data collection and analyses were performed using Clocklab (Actimetrics). Activity data for each fly were binned every 30 min for the circadian analyses. To obtain the periodicities, data from constant darkness were subjected to χ2 periodograms and fast Fourier transfer analysis using Clocklab software. The rhythm strength of a fly was measured as the power minus the significance (p − s). Flies were considered arrhythmic based on either p − s < 10 or FFT < 0.03. Actograms of weakly rhythmic flies were visually inspected to confirm rhythmicity. To investigate the effects on activity of 5-min light pulses at night (Fig. 3a, b; Extended Data Figs 4, 10), we first entrained the flies for 3 days under 12 h light–12 h dark cycles (~600 lx LED white light). During the night of the fourth L–D cycle (at ZT14, ZT16, ZT18, ZT20 or ZT22), we exposed the flies to a single 5-min light pulse (LED white light, ~600 lx), and then maintained the flies under constant darkness. The phase shift was calculated as the phase difference of the evening peaks before and after the light pulse. Negative and positive phase changes indicate phase delays and phase advances, respectively. To conduct the phase delay experiments (Fig. 3g–l), we first entrained the flies for 4 days under 12 h light–12 h dark cycles (~400 lx LED white light). To obtain a phase delay of 8 h, on day 5 we extended the light phase to 20 h, and then returned the flies to normal 12 h dark–12 h light cycles. The phase shift magnitude was calculated as the phase difference between the evening peak of the day before the phase shift and the indicated day after the phase shift. To assess light-dependent arousal, we entrained the flies for 4 days under 12 h light–12 h dark cycles and then exposed the flies to a 5-min white light pulse (~600 lx LED lights) at ZT22. We binned the activity data for each fly every minute. ‘Light-coincident arousal’ is the increase in locomotion activity (bin-crosses) during the 5-min stimulation compared to the previous 5 min. ‘Arousal delay’ is the time between lights on and maximum activity. The HEK293T cells were obtained from the ATCC, which authenticates their lines. This line has not been tested for mycoplasma contamination. The HEK293T cells were cultured to 70% confluency and transfected with 2 μg pCS2+MT-rh7 plasmid per 10-cm dish. We used the FuGENE HD Transfection Reagent (Cat.E2311) to perform the transfections. Cells were harvested 24–36 h after transfection and stored at −80 °C. For reconstitution of Rh7 with the chromophore, the HEK293T cells were resuspended in cold PBS (pH 7.4, Quality Biological Inc.) supplemented with a protease inhibitor cocktail (Sigma P8340) and incubated with 40 μM 11-cis-retinal in the dark for 4 h. We prepared membrane protein extracts by resuspending membrane pellets in 0.1% CHAPs in PBS, rotating for 2 h at 4 °C, then centrifuging (14,000g) for 20 min at 4 °C. The supernatants were removed and analysed with a UV3600 UV-Nir-NIR Spectrometer (Shimadzu). To obtain the spectral absorption for Rh7, we used membrane extracts from untransfected cells as the blank. ERG recordings were performed by filling two glass electrodes with Drosophila Ringer’s solution (3 mM CaCl , 182 mM KCl, 46 mM NaCl, 10 mM Tris pH 7.2) and placing small droplets of electrode cream on the surface of the compound eye and the thorax to increase conductance. We inserted the recording electrode into the cream on the surface of the compound eye and the reference electrode into the cream on the thorax. Flies were dark adapted for 1 min before stimulating with a 2-s pulse using a halogen light (~30 mV/cm2 unless indicated otherwise). The ERG signals were amplified with a Warner electrometer and recorded with a Powerlab 4/30 analogue-to-digital converter (AD Instruments). Data were collected and analysed with the Laboratory Chart version 6.1 program (AD Instruments). Patch-clamp measurements were performed on acutely dissected adult fly brains as described previously18, 19. Briefly, all patch-clamp recordings were performed during the daytime to avoid clock-dependent variance in firing rate. All l-LNvs were recorded within a relatively narrow daytime window, and recordings for each genotype were normally distributed for the time of day and did not vary significantly among all three genotypes. l-LNv recordings were made in whole-cell current clamp mode. After allowing the membrane properties to stabilize after whole cell break-in, we recorded for 30–60 s in the current clamp configuration (unless otherwise stated) under nearly dark conditions (~0.05 mW/cm2) before the lights were turned on. Lights-on data were collected for 5–20 s and this was followed by 60–120 s of darkness. Multiple light sources were used for these studies. We used a standard halogen light source on an Olympus BX51 WI microscope (Olympus USA) for all experiments with white light (400–1,000 nm, 4 mW/cm2). Orange light (550–1,000 nm; 4 mW/cm2) for electrophysiological recordings was achieved by placing appropriate combinations of 25 mm long- and short-pass filters (Edmund Industrial Optics) over the halogen light source directly beneath the recording chamber. We changed the filters during the recordings to internally match the neuronal responses to different wavelengths of light. Recordings using 405 nm violet light (0.8 mW/cm2) were obtained using LEDs obtained from Prizmatix 405 LED (UHP-Mic-LED-405), which provide >2 W collimated purple light (405 nm peak, 15 nm spectrum half width). Light was measured for all sources using a Newport 818-UV sensor and the Optical Power/Energy Meter (842-PE, Newport Corporation) and expressed as mW/cm2. The control genotype for the electrophysiological recordings was w;pdf-Gal4-dORK-NC1-GFP. The cry01 and rh71 recordings were performed using w;pdf-Gal4-dORK-NC1-GFP;cry01 and w;pdf-Gal4-dORK-NC1-GFP; rh71, respectively. To analyse two sets of data, we used the unpaired Student’s t-test. To compare multiple sets of behavioural data, we used a one-away ANOVA (Kruskal–Wallis test) followed by Dunn’s test. Data are presented as mean ± s.e.m. We used Fisher’s exact test to analyse the percentages of rhythmic flies. For the patch-clamp recordings, the data are presented as mean ± s.e.m. Values of n refer to the number of measured light on–off cycles. In all cases the n values were obtained from at least 5 separate recordings (see legends). ANOVAs were performed using SigmaPlot 11 (Systat Software Inc.) or Prism 6 (Graphpad Software). The data were first tested for normal distribution. If the data were not normally distributed, we performed Kruskal–Wallis one way analysis of variance on ranks, followed by Dunn’s test. ANOVAs on normally distributed data were followed by Tukey’s test to determine significant differences between genotypes. All data are available from the corresponding author upon reasonable request.


Patients who were included in the study all had Goodpasture disease and fulfilled the following key diagnostic criteria: (1) serum anti-α3(IV)NC1 IgG by enzyme-linked immunosorbent assay (ELISA), (2) linear IgG staining of the GBM and (3) necrotizing and crescentic glomerulonephritis. HLA-DR15 typing of patients was done by monoclonal antibody staining (BIH0596, One Lambda) and flow cytometry. Blood from HLA-typed healthy humans was collected via the Australian Bone Marrow Donor Registry. HLA-DR15, HLA-DR1 and HLA-DR15/DR1 donors were molecularly typed and were excluded if they expressed DQB1*03:02, which is potentially weakly associated with susceptibility to anti-GBM disease2. Studies were approved by the Australian Bone Marrow Donor Registry and Monash Health Research Ethics Committees, and informed consent was obtained from each individual. Mouse MHCII deficient, DR15 transgenic mice and mouse MHCII deficient, DR1 transgenic mice were derived from existing HLA transgenic colonies and intercrossed so that they were on the same background as previously described4. The background was as follows: 50% C57BL/10, 43.8% C57BL/6, 6.2% DBA/2; or with an Fcgr2b−/− background: 72% C57BL/6, 25% C57BL/10 and 3% DBA/2. To generate mice transgenic for both HLA-DR15 and HLA-DR1, mice transgenic for either HLA-DR15 or HLA-DR1 were intercrossed. FcγRIIb intact HLA transgenic mice and cells were used for all experiments, except those in experimental Goodpasture disease, where Fcgr2b−/− HLA transgenic strains were used. While DR15+ mice readily break tolerance to α3(IV)NC1 when immunized with human α3 or mouse α3 , renal disease is mild4. As genetic changes in fragment crystallizable (Fc) receptors have been implicated in the development of nephritis in rodents and in humans18, Fcgr2b−/− HLA transgenic strains were used when end organ injury was an important endpoint. For in vitro experiments, cells from either male or female mice were used. For in vivo experiments both male and female mice were used, for immunization aged 8–12 weeks and for the induction of experimental Goodpasture disease aged 8–10 weeks. Experiments were approved by the Monash University Animal Ethics Committee (MMCB2011/05 and MMCB2013/21). HLA-DR15-α3 and HLA-DR1-α3 were produced in High Five insect cells (Trichoplusia ni BTI-Tn-5B1-4 cells, Invitrogen) using the baculovirus expression system essentially as described previously for HLA-DQ2/DQ8 proteins19, 20. Briefly, synthetic DNA (Integrated DNA Technologies, Iowa, USA) encoding the α- and β-chain extracellular domains of HLA-DR15 (HLA-DR1A*0101, HLA-DRB1*15:01), HLA-DR1 (HLA-DR1A*0101, HLA-DRB1*01:01) and the α3 peptide were cloned into the pZIP3 baculovirus vector19, 20. To promote correct pairing, the carboxy (C) termini of the HLA-DR15 and HLA-DR1 α- and β-chain encoded enterokinase cleavable Fos and Jun leucine zippers, respectively. The β-chains also encoded a C-terminal BirA ligase recognition sequence for biotinylation and a poly-histidine tag for purification. HLA-DR15-α3 and HLA-DR1-α3 were purified from baculovirus-infected High Five insect cell supernatants through successive steps of immobilized metal ion affinity (Ni Sepharose 6 Fast-Flow, GE Healthcare), size exclusion (S200 Superdex 16/600, GE Healthcare) and anion exchange (HiTrap Q HP, GE Healthcare) chromatography. For crystallization, the leucine zipper and associated tags were removed by enterokinase digestion (Genscript, New Jersey, USA) further purified by anion exchange chromatography, buffer exchanged into 10 mM Tris, pH 8.0, 150 mM NaCl and concentrated to 7 mg ml−1. Purified HLA-DR15-α3 and HLA-DR1-α3 proteins were buffer exchanged into 10 mM Tris pH 8.0, biotinylated using BirA ligase and tetramers assembled by addition of Streptavidin-PE (BD Biosciences) as previously described19. In mice, 107 splenocytes or cells from kidneys were digested with 5 mg ml−1 collagenase D (Roche Diagnostics, Indianapolis, Indiana, USA) and 100 mg ml−1 DNase I (Roche Diagnostics) in HBBS (Sigma-Aldrich) for 30 min at 37 °C, then filtered, erythrocytes lysed and the CD45+ leukocyte population isolated by MACS using mouse CD45 microbeads (Miltenyi Biotec); they were then surface stained with Pacific Blue-labelled anti-mouse CD4 (BD), antigen-presenting cell (APC)-Cy7-labelled anti-mouse CD8 (BioLegend) and 10 nM PE-labelled tetramer. Cells were then incubated with a Live/Dead fixable Near IR Dead Cell Stain (Thermo Scientific), permeabilized using a Foxp3 Fix/Perm Buffer Set (BioLegend) and stained with Alexa Fluor 647-labelled anti-mouse Foxp3 antibody (FJK16 s). To determine Vα2 and Vβ6 usage, cells were stained with PerCP/Cy5.5 anti-mouse Vα2 (B20.1, Biolegend) and antigen-presenting cell labelled anti-mouse Vβ6 (RR4-7, Biolegend). For each mouse a minimum of 100 cells were analysed. The tetramer+ gate was set on the basis of the CD8+ population. In humans, 3 × 107 white blood cells were surface stained with BV510-labelled anti-human CD3 (BioLegend), Pacific Blue-labelled anti-human CD4 (BioLegend), PE-Cy7-labelled anti-human CD127 (BioLegend), FITC-labelled anti-human CD25 (BioLegend) and 10 nM PE-labelled tetramer. Then, cells were incubated with a Live/Dead fixable Near IR Dead Cell Stain (Life Technologies), permeabilized using a Foxp3 Fix/Perm Buffer Set (BioLegend) and stained with Alexa Fluor 647-labelled anti-human Foxp3 antibody (150D). The tetramer+ gate was set on the basis of the CD3+CD4− population. As validation controls, we found that HLA-DR1-α3 tetramer+ cells did not bind to HLA-DR1-CLIP tetramers (data not shown). The human α3 peptide (GWISLWKGFSF), the mouse α3 peptide (DWVSLWKGFSF) and control OVA peptide (ISQAVHAAHAEINEAGR) were synthesized at >95% purity, confirmed by high-performance liquid chromatography (Mimotopes). Recombinant murine α3(IV)NC1 was generated using a baculovirus system21 and recombinant human α3(IV)NC1 expressed in HEK 293 cells22. The murine α3(IV)NC1 peptide library, which consists of 28 20-amino-acid long peptides overlapping by 12 amino acids, was synthesized as a PepSet (Mimotopes). To measure peptide specific recall responses, IFN-γ and IL-17A ELISPOTs and [3H]thymidine proliferation assays were used (Mabtech for human ELISPOTs and BD Biosciences for mouse ELISPOTs). To measure pro-inflammatory responses of HLA-DR15-α3 tetramer+ CD4+ T cells in patients with Goodpasture disease, HLA-DR15-α3 tetramer+ CD4+ T cells were enumerated then isolated from peripheral blood mononuclear cells of patients with Goodpasture disease (frozen at the time of presentation) by magnetic bead separation (Miltenyi Biotec) then co-cultured at a frequency of 400 HLA-DR15-α3 tetramer+ CD4+ T cells per well with 2 × 106 HLA-DR15-α3 tetramer-depleted mitomycin C-treated white blood cells and stimulated with either no antigens, α3 (10 μg ml−1) or whole recombinant human α3(IV)NC1 (10 μg ml−1) in supplemented RPMI media (10% male AB serum, 2 mM l-glutamine, 50 μM 2-ME, 100 U ml−1 penicillin and 0.1 mg ml−1 streptomycin) (Sigma-Aldrich). Cells were cultured for 18 h at 37 °C, 5% CO and the data expressed as numbers of IFN-γ or IL-17A spots per well. To measure pro-inflammatory responses of HLA-DR15-α3 tetramer+ CD4+ T cells in DR15+ transgenic mice, HLA-DR15-α3 tetramer+ CD4+ T cells were enumerated then isolated from pooled spleen and lymph node cells of DR15+ transgenic mice, immunized with mouse α3 10 days previously by magnetic bead separation. They were then co-cultured at a frequency of 400 HLA-DR15-α3 tetramer+ CD4+ T cells per well with 106 HLA-DR15-α3 tetramer-depleted mitomycin C-treated white blood cells and stimulated with either no antigens, mouse α3 (10 μg ml−1), human α3 (10 μg ml−1), whole recombinant mα3(IV)NC1 (10 μg ml−1) or whole recombinant hα3(IV)NC1 (10 μg ml−1) in supplemented RPMI media (10% FCS, 2 mM l-glutamine, 50 μM 2-ME, 100 U ml−1 penicillin and 0.1 mg ml−1 streptomycin). Cells were cultured for 18 h at 37 °C, 5% CO and the data expressed as numbers of IFN-γ or IL-17A spots per well. To determine the immunogenic portions of α3(IV)NC1, mice were immunized subcutaneously with peptide pools (containing α3 amino acids 1–92, 81–164, or 153–233; 10 μg per peptide per mouse), the individual peptide or in some experiments mα3 at 10 μg per mouse in Freund’s complete adjuvant (Sigma-Aldrich). Draining lymph node cells were harvested 10 days after immunization and stimulated in vitro (5 × 105 cells per well) with no antigen, peptide (10 μg ml−1) or whole α3(IV)NC1 (10 μg ml−1) in supplemented RPMI media (10% FCS, 2 mM l-glutamine, 50 μM 2-ME, 100 U ml−1 penicillin and 0.1 mg ml streptomycin). For [3H]thymidine proliferation assays, cells were cultured in triplicate for 72 h with [3H]thymidine added to culture for the last 16 h. To measure human α3 - or mouse α3 -specific responses in CD4+ T cells from naive transgenic mice or blood of healthy humans, we used a modification of a previously published protocol23. One million CD4+ T cells were cultured with 106 mitomycin-treated CD4-depleted splenocytes for 8 days in 96-well plates with or without 100 μg ml−1 of human α3 or mouse α3 . T cells were depleted from mouse cultures by sorting out CD4+CD25+ and in humans by sorting out CD4+CD25hiCD127lo cells using antibodies and a cell sorter. Cytokine secretion was detected in the cultured supernatants by cytometric bead array (BD Biosciences) or ELISA (R&D Systems). To determine proliferation, magnetically separated CD4+ T cells were labelled with CellTrace Violet (CTV; Thermo Scientific) before culture. To measure the expansion of T cells, mice were immunized with 100 μg of α3 emulsified in Freund’s complete adjuvant, then boosted 7 days later in Freund’s incomplete adjuvant. Draining lymph node cells were stained with the HLA-DR15-α3 tetramer, CD3, CD4, CXCR5, PD-1, CD8 and Live/Dead Viability dye. To determine the potency of HLA-DR1-α3 tetramer+ T cells, 106 cells per well of CD4+CD25− T effectors isolated by CD4+ magnetic beads and CD25− cell sorting from naive DR15+DR1+ mice were co-cultured with CD4+CD25+ T cells with or without depletion of HLA-DR1-α3 tetramer+ T cells from DR1+ mice at different concentrations: 0, 12.5 × 103, 25 × 103, 50 × 103 and 100 × 103 cells per well in the presence of 106 CD4-depleted mitomycin C-treated spleen and lymph node cells from DR15+DR1+mice in supplemented RPMI media (10% FCS, 2 mM l-glutamine, 50 μM 2-ME, 100 U ml−1 penicillin and 0.1 mg ml−1 streptomycin) containing 100 μg ml−1 of mouse α3 . To determine proliferation, the CD4+CD25− T effector cells were labelled with CTV before culture. Cells were cultured in triplicate for 8 days in 96-well plates. HLA transgenic mice, on an Fcgr2b−/− background, were immunized with 100 μg of α3 or mα3 subcutaneously on days 0, 7 and 14, first in Freund’s complete, and then in Freund’s incomplete, adjuvant. Mice were killed on day 42. Albuminuria was assessed in urine collected during the last 24 h by ELISA (Bethyl Laboratories) and expressed as milligrams per micromole of urine creatinine. Blood urea nitrogen and urine creatinine were measured using an autoanalyser at Monash Health. Glomerular necrosis and crescent formation were assessed on periodic acid-Schiff (PAS)-stained sections; fibrin deposition using anti-murine fibrinogen antibody (R-4025) and DAB (Sigma); CD4+ T cells, macrophages and neutrophils were detected using anti-CD4 (GK1.5), anti-CD68 (FA/11) and anti-Gr-1 (RB6-8C5) antibodies. The investigators were not blinded to allocation during experiments and outcome assessment, except in histological and immunohistochemical assessment of kidney sections. To deplete regulatory T cells, mice were injected intraperitoneally with 1 mg of an anti-CD25 monoclonal antibody (clone PC61) or rat IgG (control) 2 days before induction of disease. In these experiments, mice were randomly assigned to receive control or anti-CD25 antibodies. Individual DR15-α3 -specific CD4+ T cells were sorted into wells of a 96-well plate. Multiplex single-cell reverse transcription and PCR amplification of TCR CDR3α and CDR3β regions were performed using a panel of TRBV- and TRAV-specific oligonucleotides, as described24, 25. Briefly, mRNA was reverse transcribed in 2.5 μl using a Superscript III VILO cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA) (containing 1× Vilo reaction mix, 1× superscript RT, 0.1% Triton X-100), and incubated at 25 °C for 10 min, 42 °C for 120 min and 85 °C for 5 min. The entire volume was then used in a 25 μl first-round PCR reaction with 1.5 U Taq DNA polymerase, 1× PCR buffer, 1.5 mM MgCl , 0.25 mM dNTPs and a mix of 25 mouse TRAV or 40 human TRAV external sense primers and a TRAC external antisense primer, along with 19 mouse TRBV or 28 human TRBV external sense primers and a TRBC external antisense primer (each at 5 pmol μl−1), using standard PCR conditions. For the second-round nested PCR, a 2.5 μl aliquot of the first-round PCR product was used in separate TRBV- and TRAV-specific PCRs, using the same reaction mix described above; however, a set of 25 mouse TRAV or 40 human TRAV internal sense primers and a TRAC internal antisense primer, or a set of 19 mouse TRBV or 28 human TRBV internal sense primers and a TRBV internal antisense primer, were used. Second-round PCR products were visualized on a gel and positive reactions were purified with ExoSAP-IT reagent. Purified products were used as template in sequencing reactions with internal TRAC or TRBC antisense primers, as described. TCR gene segments were assigned using the IMGT (International ImMunoGeneTics) database26. In mouse experiments, three mice were pooled per HLA and the number of sequences obtained were as follows. For TRAV: DR15, n = 81; DR1 n = 84; for TRBV: DR15, n = 100; DR1 n = 87; for TRAJ: DR15, n = 81; DR1 n = 84; and for TCR beta joining (TRBJ): DR15, n = 100; DR1 n = 87. Red-blood-cell-lysed splenocytes from DR1+ and DRB15+DR1+ mice were sorted on the basis of surface expression of CD4 and CD25 and being either DR1-α3 tetramer positive or negative into three groups: (1) CD4+CD25−HLA-DR1-α3 tetramer− T cells; (2) CD4+CD25+HLA-DR1-α3 tetramer− T cells; and (3) CD4+CD25+HLA-DR1-α3 tetramer+ T cells. A minimum of 1,000 cells were sorted. Immediately after sorting, the RNA was isolated and complementary DNA (cDNA) generated using a Cells to Ct Kit (Ambion) followed by a preamplification reaction using Taqman Pre Amp Master Mix (Applied Biosystems), which preamplified the following cDNAs: Il2ra, Foxp3, Ctla4, Tnfrsf18, Il7r, Sell, Pdcd1, Entpd1, Cd44, Tgfb3, Itgae, Ccr6, Lag3, Lgals1, Ikzf2, Tnfrsf25, Nrp1, Il10. The preamplified cDNA was used for RT–PCR reactions in duplicate using Taqman probes for the aforementioned genes. Each gene was expressed relative to 18S, logarithmically transformed and presented as a heat map. The Epstein-Barr-virus-transformed human B lymphoblastoid cell lines IHW09013 (SCHU, DR15-DR51-DQ6) and IHW09004 (JESTHOM, DR1-DQ5) were maintained in RPMI (Invitrogen) supplemented with 10% FCS, 50 IU ml−1 penicillin and 50 μg ml−1 streptomycin. Confirmatory tissue typing of these cells was performed by the Victorian Transplantation and Immunogenetics Service. The B-cell hybridoma LB3.1 (anti-DR) was grown in RPMI-1640 with 5% FCS at 37 °C and secreted antibody purified using protein A sepharose (BioRad). HLA-DR-presented peptides were isolated from naive DR15+Fcgr2b+/+ or DR1+Fcgr2b+/+ mice. Spleens and lymph nodes (pooled from five mice in each group) or frozen pellets of human B lymphoblastoid cell lines (triplicate samples of 109 cells) were cryogenically milled and solubilized as previously described12, 27, cleared by ultracentrifugation and MHC peptide complexes purified using LB3.1 coupled to protein A (GE Healthcare). Bound HLA complexes were eluted from each column by acidification with 10% acetic acid. The eluted mixture of peptides and HLA heavy chains was fractionated by reversed-phase high-performance liquid chromatography as previously described10. Peptide-containing fractions were analysed by nano-liquid chromatography–tandem mass spectrometry (nano-LC–MS/MS) using a ThermoFisher Q-Exactive Plus mass spectrometer (ThermoFisher Scientific, Bremen, Germany) operated as described previously10. LC–MS/MS data were searched against mouse or human proteomes (Uniprot/Swissprot v2016_11) using ProteinPilot software (SCIEX) and resulting peptide identities subjected to strict bioinformatic criteria including the use of a decoy database to calculate the false discovery rate28. A 5% false discovery rate cut-off was applied, and the filtered data set was further analysed manually to exclude redundant peptides and known contaminants as previously described29. The mass spectrometry data have been deposited in the ProteomeXchange Consortium via the PRIDE30 partner repository with the data set identifier PXD005935. Minimal core sequences found within nested sets of peptides with either N- or C-terminal extensions were extracted and aligned using MEME (http://meme.nbcr.net/meme/), where motif width was set to 9–15 and motif distribution to ‘one per sequence’31. Graphical representation of the motif was generated using IceLogo32. Crystal trials were set up at 20 °C using the hanging drop vapour diffusion method. Crystals of HLA-DR15-α3 were grown in 25% PEG 3350, 0.2 M KNO and 0.1 M Bis-Tris-propane (pH 7.5), and crystals of HLA-DR1-α3 were grown in 23% PEG 3350, 0.1 M KNO , and 0.1 M Bis-Tris-propane (pH 7.0). Crystals were washed with mother liquor supplemented with 20% ethylene glycol and flash frozen in liquid nitrogen before data collection. Data were collected using the MX1 (ref. 33) and MX2 beamlines at the Australian Synchrotron, and processed with iMosflm and Scala from the CCP4 program suite34. The structures were solved by molecular replacement in PHASER35 and refined by iterative rounds of model building using COOT36 and restrained refinement using Phenix37 (see Extended Data Table 2 for data collection and refinement statistics). No statistical methods were used to predetermine sample size. For normally distributed data, an unpaired two-tailed t-test (when comparing two groups). For non-normally distributed data, non-parametric tests (Mann–Whitney U-test for two groups or a Kruskal–Wallis test with Dunn’s multiple comparison) were used. Statistical analyses, except for TCR usage, was by GraphPad Prism (GraphPad Software). For each TCR type/region (TRAV, TRBV, TRAJ, TRBJ), we compared the TCR distribution (frequencies of different TCRs) between DR15 and DR1 using Fisher’s exact test. This was applied both to mice and to human samples. The P values associated with those TCR distributions are indicated above the pie-charts. To correct for multiple testing for individual TCRs, we used Holm’s method. *P < 0.05, **P < 0.01, ***P < 0.001. The data that support the findings of this study are available from the corresponding authors upon request. Self-peptide repertoires have been deposited in the Proteomics Identifications Database archive with the accession code PXD005935. Structural information has been deposited in the Protein Data Bank under accession numbers 5V4M and 5V4N.


No statistical methods were used to predetermine sample size. The experiments were not randomized, and investigators were not blinded to allocation during experiments and outcome assessment. Recombinant adenoviruses were constructed with the following inserts. Full-length mouse Dkk1 (ref. 6), and mouse Rspo1-Fc16 with full-length Rspo1 fused to a mouse antibody IgG2α Fc fragment at the C terminus have been described. Human RSPO2 and mouse Rnf43 ECD and Znrf3 ECD similarly contained full-length open reading frames with a C-terminal mouse IgG2α Fc fragment. Mouse Fzd8 CRD (residues 25–173) was cloned with an N-terminal haemagglutinin (HA) epitope tag and C-terminal IgG2α Fc fragment. In addition, a recombinant adenovirus was engineered to express human LGR5 ECD with both C-terminal FLAG and histidine tags. The construction of the adenoviruses encoding the scFv–DKK1c Wnt surrogate agonist and scFv–DKK1c–RSPO2 single-chain polypeptide fusion, each with a C-terminal His tag is described in a companion paper by Janda et al.25 On day 2 after intravenous injection, scFv–DKK1c was found to be expressed in vivo at ~10–20 μg ml−1 (280–560 nM) in mouse sera and the serum potently induced TOPflash activity in vitro. Full-length Wnt3a cDNA (a gift from R. Nusse) was cloned without any epitope tags and detected by western blotting with anti-WNT3A (Cell Signaling 2391) against a recombinant WNT3A protein. No detectable WNT3A protein was found in mouse sera after intravenous injection. All adenoviral constructs contained an N-terminal signal peptide sequence to allow for their secretion. These adenoviruses were cloned by homologous recombination into E1− E3− adenovirus strain 5, purified by double CsCl gradient, and titred as previously described33. Recombinant proteins were expressed in serum-free CD293 medium (Invitrogen) of HEK293 cells infected by adenovirus. Recombinant LGR5-ECD protein was purified by nickel-NTA affinity chromatography (Qiagen) from Ad-LGR5-ECD-infected CD293 medium. Likewise, recombinant RNF43 and ZNRF3 ECD-Fc fusion proteins were purified by protein A affinity chromatography (KPL) from Ad-Rnf43-ECD-infected or Ad-Znrf3-ECD-infected CD293 medium, respectively. Protein purity was verified by Coomassie-stained SDS–PAGE. Adult Lgr5-eGFP-IRES-creER mice7 (Jax) or Axin2-LacZ mice (Jax) between 8 and 12 weeks old were injected intravenously with adenoviruses (doses of 5 × 108 to 1 × 109 pfu per mouse). Lgr5-eGFP-IRES-creER mice were crossed with Rosa26-tdTomato mice to generate Lgr5-eGFP-IRES-creER; Rosa26-tdTomato compound heterozygous mice. Similarly, Villin-creER or Actin-creER mice were crossed to Rosa26-Rainbow mice to generate Villin-creER; Rosa26-Rainbow or Actin-creER; Rosa26-Rainbow compound heterozygous mice. Mice were dosed with adenoviruses as above, and serum expression of all ECDs was confirmed by immunoblotting and histological assessment of intestinal crypt hyperplasia for those treated with Ad-Rspo1 and Ad-RSPO2. Adult mice between 8 and 12 weeks of age were administered tamoxifen (Sigma) dosed at 4 mg per 40 g body weight to genetically label for lineage tracing experiments using the various Rosa26 reporter strains. All in vivo experiments used n = 3–5 mice per group and were repeated at least twice except for the RNA-seq studies. Both male and female mice were used. All animal experiments were conducted in accordance with procedures approved by the IACUC at Stanford University. FACS experiments were performed using fresh small intestine epithelial preparations. A standardized 3 cm segment of proximal jejunum was used for quantitative FACS analysis of ISC populations. Intestinal epithelial cells were extracted from en bloc resected small intestine with 10 mM EDTA and manual shaking, followed by enzymatic dissociation with collagenase/dispase (Roche) to generate a single-cell suspension. Singlet discrimination was sequentially performed using plots for forward scatter (FSC-A versus FSC-H) and side scatter (SSC-W versus SSC-H). Dead cells were excluded by scatter characteristics and viability stains. All FACS experiments were performed on an Aria II sorter (BD) or LSRII analyser (BD) at the Stanford University Shared FACS Facility and FACS data were analysed using FlowJo software (TreeStar). Intestinal tissue was collected and fixed in 4% paraformaldehyde. 8-μm OCT frozen sections or 5-μm paraffin-embedded sections were TUNEL-stained using the DeadEnd Fluorometric TUNEL system per manufacturer’s instructions (Promega) or immunostained using the following primary antibodies: anti-Ki67 (ThermoFisher RM-9106), anti-MUC2 (Santa Cruz sc-15334), anti-lysozyme (Dako A0099), anti-chromogranin A (Santa Cruz sc-1488), anti-FABP1 (Novus NBP1-87695), anti-CD44 (BD Pharmingen 550538), anti-cyclin D1 (Abcam ab134175) and anti-CD166 (R&D AF1172). All primary antibodies were used at 1:100 to 1:200 dilutions. Cy3- and Cy5-conjugated secondary antibodies (Santa Cruz and Jackson ImmunoResearch) were used at 1:500 to 1:1,000 dilutions. Alexa Fluor 594-conjugated phalloidin (Invitrogen) was used at 1:500. CD166 immunostained tissue sections34 were analysed and confocal images acquired as 0.5-μm planes using an IX81 Inverted Microscope equipped with Fluoview FV1000-Spinning Disc Confocal scan head and FV10 ASW 1.7 software (Olympus). All other images were captured on a Zeiss Axio-Imager Z1 with ApoTome or Leica SP5 confocal microscope. In situ hybridization for Olfm4 mRNA was performed using the RNAscope kit (Advanced Cell Diagnostics) according to the manufacturer’s instructions. In brief, 5 μm formalin-fixed, paraffin-embedded tissue sections or 8 μm OCT frozen sections were pre-treated with heat and protease before hybridization with a target probe to Olfm4 mRNA. A horseradish peroxidase (HRP)-based signal amplification system was then hybridized to the target probes followed by colorimetric development with DAB. Negative control probes for the bacterial gene DapB were also included for each slide. Adult Lgr5-eGFP-IRES-creER mice (Jax) between 10 and 12 weeks old were treated with intravenous adenovirus. After 48 h, these mice were treated by oral gavage for 4 days with twice daily dosing interval with either 50 mg kg−1 of PORCN inhibitor C59 (Cellagen Technology) or vehicle consisting of 0.5% methylcellulose plus 0.1% Tween80, as previously described35. Mice were euthanized 20 h after the last dose of C59 and the intestine was harvested for FACS and histological analysis. Small intestine tissue samples were fixed with 2.5% glutaraldehyde and post-fixed in 1% osmium tetroxide in 100 mM phosphate buffer. Tissue was dehydrated, embedded in epoxy resin, and visualized by a JEOL transmission electron microscope at 120 kV (model JEM-1210). L cells stably transfected with TOPflash dual reporter plasmid system (a gift from J. Chen) were used in TOPflash dual luciferase assays (Promega Dual Luciferase kit) with WNT3A conditioned medium from a stably transfected WNT3A-expressing cell line (a gift from R. Nusse) from which activation of the TOPflash reporter has been confirmed; mycoplasma contamination was not tested. Recombinant WNT3A (R&D) was alternatively used. Recombinant mouse RSPO1–RSPO4 proteins (R&D) were used at 5 pM concentration each in these assays. Recombinant LGR5, RNF43 and ZNRF3 ECD proteins were expressed and purified as above and their purity and protein concentrations were determined by Coomassie-stained SDS–PAGE and Bradford assays. Assays were visualized with a Tecan M1000 luminometer. Recombinant scFv–DKK1c was expressed and purified as described in the companion paper25. The kinetics and affinity of interactions between RSPO1–RSPO4 and Flag- and histidine-tagged LGR5 ECD, Fc-tagged RNF43 ECD or Fc-tagged ZNRF3 ECD were determined by surface plasmon resonance. Data were collected on the BIAcore T100 instrument (GE Healthcare). Approximately 1,000 resonance units (RU) of recombinant mouse RSPO1, RSPO2, RSPO3 or RSPO4 (R&D) were immobilized on a CM5 sensor chip (GE Healthcare) using standard amine coupling. Increasing concentrations of LGR5 ECD, RNF43 ECD or ZNRF3 ECD were passed over the chip in HBS supplemented with 0.005% surfactant P20 (HBS+P). Binding phases for the LGR5-ECD were performed at 50 μl min−1 for 240 s and dissociation phases were performed at 50 μl min−1 for 1,850 s. The chip was regenerated after each injection with 240-s washes with 0.5 M magnesium chloride. Binding and dissociation phases for RNF43 ECD and ZNRF3 ECD were each performed at 50 μl min−1 for 120 s. The chip was regenerated after each injection with 120-s washes with 1 M magnesium chloride. All curves were reference-subtracted from a flow cell containing 1,000 RU of a negative control protein (hen egg white lysozyme or BSA). Curves were fitted using the BIAcore T100 evaluation software to a 1:1 model to determine the association rate (k ), dissociation rate (k ) and dissociation constant (K ). The kinetics and affinity of anti-RSPO antibody interactions with RSPO1–RSPO4 were determined as described for RNF43 and ZNRF3, except that the regeneration buffer was 25% ethylene glycol and 2.25 M magnesium chloride. The kinetics and affinity of Fc-tagged RNF43 and ZNRF3 ECDs are enhanced by avidity effects due to Fc-dimerization. The furin 1 and 2 repeats of human RSPO2 were cloned into the pCT302 vector as a C-terminal fusion to a c-Myc epitope and the cell-wall protein AGA2. RSPO2 was displayed on the EBY100 strain of Saccharomyces cerevisiae as previously described36. Competent yeast cells were electroporated with the RSPO2 expression plasmid and recovered in SDCAA selection media. The cultures were harvested in log phase, and yeast cells were then pelleted and resuspended in SGCAA induction media. Surface expression of RSPO2 was detected by staining yeast with a 488-labelled antibody to the c-Myc epitope (Cell Signaling 279), and then analysed by flow cytometry. Binding of LGR5, RNF43 and ZNRF3 ECDs was tested by incubating yeast with 200 nM recombinant Flag-tagged LGR5 ECD or with Fc-tagged RNF43 ECD or ZNRF3 ECD in PBS and 0.1% BSA for 2 h, washing twice with PBS and 0.1% BSA and then incubating for 30 min with an Alexa Fluor 647-labelled antibody to the Flag epitope (Cell Signaling 3916S) (for LGR5 binding) or a PE-labelled anti-IgG antibody (eBioscience 12-4998-82). Cells were washed twice with PBS and 0.1% BSA and then analysed by flow cytometry. Sequential staining of yeast was performed by incubating samples with 200 nM LGR5-ECD, 200 nM RNF43 ECD, or 200 nM ZNRF3 ECD alone, washing and then incubating with a mixture of (200 nM LGR5-ECD and 200 nM RNF43-ECD) or (200 nM LGR5-ECD and 200 nM ZNRF3 ECD). Cells double-stained with both LGR5-ECD and either RNF43 or ZNRF3 ECD were then washed and incubated with a mixture of PE-anti-IgG and 647-anti-Flag before a final wash and analysis by flow cytometry. Cells were isolated by flow cytometry into RNEasy lysis buffer (Qiagen) from n = 2–3 mice per condition, 1.5 days after injection of the appropriate adenoviruses. A 1.8× volume of AMPure beads (Beckman Coulter) was added to the thawed cell lysates. After a 30-min incubation at room temperature, the samples were washed twice with 70% ethanol and eluted in 22 μl water. The samples were then digested with 0.6 mAU Proteinase K (Qiagen) in the presence of 1× NEB buffer 1 (NEB) at 50 °C for 20 min, followed by a heat-inactivation step at 65 °C for 10 min. A DNase digestion was performed using the RNase-Free DNase Set (Qiagen) at 37 °C for 30 min. The samples were cleaned with a 1.8× volume of AMPure XP beads (Beckman Coulter). 1 ng of purified total RNA, as determined by Agilent Bioanalyzer (Agilent Technologies), was processed with the mRNA direct micro kit (Life Technologies) to select for poly A RNA. Each entire sample was input into the Ambion WT Expression Kit (Life Technologies) to perform double-stranded cDNA synthesis followed by in vitro transcription to generate amplified cRNA. The cRNA was purified following the manufacturer’s instructions and the concentration was determined with a NanoDrop instrument (ThermoFisher). 1 μg of cRNA was fragmented in 1× fragmentation buffer (mRNA-Seq Sample Prep Kit, Illumina) at 94 °C for 5 min, then placed on ice and the reaction was stopped by the addition of 20 mM EDTA. The fragments were precipitated with 70 mM sodium acetate (Life Technologies), 40 μg glycogen (Life Technologies) and 70% ethanol at −80 °C for 1 h followed by centrifugation and washing with 70% ethanol. 3 μg of random hexamer (Life Technologies) was added to the fragmented, purified cRNA and incubated at 70 °C for 10 min to anneal the primer. The first strand reaction was performed with 200 units of SuperScript II (Life Technologies) with 0.625 mM dNTPs (NEB) and 8U SUPERase RNase Inhibitor (Life Technologies) at 25 °C for 10 min, then 42 °C for 50 min, then 75 °C for 15 min and cooled to 4 °C. In second-strand synthesis, 1× second strand buffer (Illumina) and 0.3 mM dNTPs (Illumina) were added and the samples were incubated at 4 °C for 5 min before adding 50 U of DNA Polymerase (NEB) and 5 U of Rnase H (NEB). The samples were mixed well and incubated at 16 °C for 2.5 h, followed by purification with the MinElute Kit (Qiagen). To perform library prep, the samples were end repaired using a Quick Blunting Kit (NEB) and incubated at 20 °C for 1 h, then 75 °C for 30 min to inactivate the enzyme. To produce overhangs aimed to improve subsequent ligation efficiency, a single A base was added to the 3′ ends of each fragment with 2 mM dATP and 5 units of Klenow fragment 3′-5′ exo- DNA Polymerase (NEB) at 37 °C for 45 min, followed by 75 °C for 30 min to inactivate the enzyme. Using a quick ligase kit (NEB), 0.5 μM of adaptors containing single T base overhangs were ligated to the cDNA fragments at 12 °C for 75 min, then 80 °C for 20 min and cooled to 4 °C. These adaptors contain barcodes to facilitate sample multiplexing during sequencing. The adaptor sequence is preceded by four random nucleotides to add diversity to the pooled library. The samples were pooled by combining 5 μl of each library. After AMPure XP cleanup, one-half of the pooled library was run on the Pippin Size Selection Instrument (Sage Sciences) to select for 200 bp fragments. Library amplification was performed on one-half of the Pippin eluate in 1× Phusion GC buffer with 0.2 mM dNTPs, 0.1 μM forward primer (IDT), 0.1 μM reverse primer, 1 U Phusion Hot Start II Polymerase (Thermo Fisher Scientific). The reaction was run with the following program: 98 °C for 30 s, then 15 cycles of 98 °C for 10 s, 65 °C for 30 s, 72 °C for 30 s, then 72 °C for 4 min and cooled to 4 °C. The amplified library was cleaned using a 1× volume of AMPure XP beads and QC was run with the Agilent Bioanalyzer DNA 1000 kit, followed by concentration determination by qPCR using the KAPA Library Quantification Kit (KAPA Biosystems). To perform sequencing, the library was diluted to 4 nM and denatured with 0.1 N NaOH. Following denaturation, the library was further diluted to 4 pM and run on the Illumina HiSeq 2500 in paired-end, 100 × 100 bp format. Sequenced reads were aligned to the mouse reference genome mm9 (UCSC) using TopHat37 with the transcript annotation supplied. The mapped reads was assigned to gene using the tool htseq-count of the Python package HTseq38, with the default union-counting mode. The output of htseq-count was used as input for DESeq2 (ref. 39) to perform differential expression analysis, with a false discovery rate (FDR) of 10% as the cutoff. In addition, a filtering criterion of mean fragments per kilobase of transcript per million mapped reads (FPKM) of 1 in at least one condition was used to define expressed transcripts in each differential expression analysis. Cufflinks40 was used to calculate gene count and perform FPKM normalization. Gene Ontology term analysis was performed using DAVID functional annotation tool41. A FDR of 10% was applied to evaluate the significance. Lgr5-eGFP-IRES-creER mice were treated with adenovirus in vivo, and then 26 h after treatment the proximal jejunum was harvested to generate a single-cell suspension and FACS isolated using the endogenous GFP signal, as above. The sorted cellular suspensions were loaded on a GemCode Single Cell Instrument (10x Genomics) to generate single-cell gel beads in emulsion (GEMs). Approximately 1,200–2,800 cells were loaded per channel. Two technical replicates were generated per sorted cell suspension. Single-cell RNA-seq libraries were prepared using GemCode Single Cell 3′ Gel Bead and Library Kit (now sold as P/N 120230, 120231, 120232, 10x Genomics) as described previously29. Sequencing libraries were loaded at 2.1 pM on an Illumina Next-Seq500 with 2 × 75 paired-end kits using the following read length: 98 bp read1, 14 bp I7 index, 8 bp I5 index and 5 bp read2. Note that these libraries were generated before the official launch of GemCode Single Cell 3′ Gel Bead and Library Kit. Thus, 5 bp UMI was used (the official GemCode Single Cell 3′ Gel Bead contains 10 bp UMI). The Cell Ranger Single Cell Software Suite was used to perform sample de-multiplexing, barcode processing, and single-cell 3′ gene counting (http://software.10xgenomics.com/single-cell/overview/welcome). 5 bp UMI tags were extracted from read2. We analysed a total of 13,247 single cells, consisting of 11,268 FACS-sorted Lgr5–eGFP+and 1,979 Ad-Fc-treated Lgr5–eGFP− cells. Two technical replicates (the number of cells recovered per channel ranges from around 400 to 1,400 cells) were generated from each treatment condition. The mean raw reads per cell varied from ~45 k to 86 k. Each sample was downsampled to 28,439 confidently mapped reads per cell. Then the gene-cell barcode matrix from each sample was concatenated. The gene-cell barcode matrix was filtered based on number of genes detected per cell (any cells with less than 400 or more than 4,400 genes per cell were filtered) and percentage of mitochondrial UMI counts (any cells with more than 10% of mitochondrial UMI counts were filtered). Altogether, 13,176 cells, and 15,865 genes were kept for analysis by the Seurat R package30. Among these 13,176 cells, 74 did not show any epithelial cell markers so they were removed leaving a final total of 13,102 cells, consisting of 1,925 Ad-Fc-treated Lgr5–eGFP− cells and 11,177 Lgr5–eGFP+ cells across six conditions. 2,289 variable genes were selected based on their expression and dispersion (expression cutoff = 0.0125, and dispersion cutoff = 0.5). The first 11 principal components were used for the t-SNE projection and clustering analysis (resolution = 0.3, k.seed = 100). We applied sSeq from ref. 42 to identify genes that are enriched in a specific cluster (the specific cluster is assigned as group a, and the rest of clusters is assigned as group b). There are a few differences between our implementation and ref. 42. First, we used the ratio of total UMI counts and median of total UMI counts across all cells as the size factors. Second, the quantile rule of thumb was used to estimate the shrinkage target. Third, for genes with large counts, an asymptotic approximation from the edgeR package43 was used instead of the negative binomial exact test to speed up the computation. For the heatmap in Extended Data Fig. 9h, the gene list was furthered filtered requiring minimum UMI counts of 5 in each group, with a positive log fold change of mean expression between the two groups, and an adjusted P < 0.01. The top 10 genes specific to each cluster were picked, and their mean expression was centre scaled before used for the heatmap. Classification of cells was inferred from the annotation of cluster-specific genes. The stem cell clusters (clusters 0 and 1) were marked by enrichment of Lgr5, Olfm4 and Ascl2. Non-cycling and cycling stem cells were distinguished by the enrichment of cell cycle markers such as Mki67 and Tuba1b. Transit amplifying cells (cluster 2) were classified based on the enrichment of cell cycle markers and lack of Lgr5+ stem-cell marker expression. Enterocytes (clusters 3 and 4) were annotated based on the enrichment of markers such as Alpi and Reg1 and prior studies31. Goblet cells (cluster 5) were annotated based on the enrichment of markers such as Muc2 and Guca2a. Paneth cells (cluster 6) were annotated based on the enrichment of Defa genes. Tuft cells (cluster 7) were annotated based on the enrichment of markers such as Dclk1. EE cells (cluster 8) were annotated based on the enrichment of markers such as Chga and Chgb. To compare the global expression difference between samples and the Fc control, we first normalized gene expression by the sum of their UMI counts across all cells in the sample (adding 1 to the numerator and denominator to avoid dividing by 0 for genes that were not detected at all). Then we compared the normalized gene expression between the samples and the Fc control. To generate the heatmap, we furthered filtered the gene list: (1) Only genes with UMI counts >2 in each sample and a log fold change of >1 were considered. (2) The top 15 up- or downregulated genes were picked per sample–Fc comparison, and the union of all genes was used for the heatmap. Data generated during this study are available in the Gene Expression Omnibus (GEO) repository under accession numbers GSE92377 and GSE92865. All other data are available from the corresponding author upon reasonable request.

Loading ThermoFisher collaborators
Loading ThermoFisher collaborators