Entity

Time filter

Source Type

Bremen, Germany

Krug O.,German Sport University Cologne | Krug O.,European Monitoring Center for Emerging Doping Agents | Kutscher D.,ThermoFisher | Piper T.,German Sport University Cologne | And 4 more authors.
Drug Testing and Analysis | Year: 2014

Since first reports on the impact of metals such as manganese and cobalt on erythropoiesis were published in the late 1920s, cobaltous chloride became a viable though not widespread means for the treatment of anaemic conditions. Today, its use is de facto eliminated from clinical practice; however, its (mis)use in human as well as animal sport as an erythropoiesis-stimulating agent has been discussed frequently. In order to assess possible analytical options and to provide relevant information on the prevalence of cobalt use/misuse among athletes, urinary cobalt concentrations were determined by inductively coupled plasma-mass spectrometry (ICP-MS) from four groups of subjects. The cohorts consisted of (1) a reference population with specimens of 100 non-elite athletes (not being part of the doping control system), (2) a total of 96 doping control samples from endurance sport athletes, (3) elimination study urine samples collected from six individuals having ingested cobaltous chloride (500μg/day) through dietary supplements, and (4) samples from people supplementing vitamin B12 (cobalamin) at 500μg/day, accounting for approximately 22μg of cobalt. The obtained results demonstrated that urinary cobalt concentrations of the reference population as well as the group of elite athletes were within normal ranges (0.1-2.2ng/mL). A modest but significant difference between these two groups was observed (Wilcoxon rank sum test, p<0.01) with the athletes' samples presenting slightly higher urinary cobalt levels. The elimination study urine specimens yielded cobalt concentrations between 40 and 318ng/mL during the first 6h post-administration, and levels remained elevated (>22ng/mL) up to 33h. Oral supplementation of 500μg of cobalamin did not result in urinary cobalt concentrations>2ng/mL. Based on these pilot study data it is concluded that measuring the urinary concentration of cobalt can provide information indicating the use of cobaltous chloride by athletes. Additional studies are however required to elucidate further factors potentially influencing urinary cobalt levels. © 2014 John Wiley & Sons, Ltd. Source


News Article
Site: http://www.nature.com/nature/current_issue/

The complementary DNA of PALB2 was obtained from the Mammalian Gene Collection (MGC). Full-length PALB2 and BRCA1 were amplified by PCR, subcloned into pDONR221 and delivered into the pDEST-GFP, pDEST-Flag and the mCherry-LacR vectors using Gateway cloning technology (Invitrogen). Similarly, the coiled-coil domain of BRCA1 (residues 1363–1437) was amplified by PCR, subcloned into the pDONR221 vector and delivered into both mCherryLacR and pDEST-GFP vectors. The N-terminal domain of PALB2 was amplified by PCR and introduced into the GST expression vector pET30-2-His-GST-TEV29 using the EcoRI/XhoI sites. The coiled-coil domain of BRCA1 was cloned into pMAL-c2 using the BamHI/SalI sites. Truncated forms of PALB2 were obtained by introducing stop codons or deletions through site-directed mutagenesis. Full-length CtIP was amplified by PCR, subcloned into the pDONR221 and delivered into the lentiviral construct pCW57.1 (a gift from D. Root; Addgene plasmid #41393) using Gateway cloning technology (Invitrogen). The USP11 cDNA was a gift from D. Cortez and was amplified by PCR and cloned into the pDsRed2-C1 vector using the EcoRI/SalI sites. The bacterial codon-optimized coding sequence of pig USP11 was subcloned into the 6×His–GST vector pETM-30-Htb using the BamHI/EcoRI sites. siRNA-resistant versions of PALB2, BRCA1 and USP11 constructs were generated as previously described11. Full-length CUL3 and RBX1 were amplified by PCR from a human pancreas cDNA library (Invitrogen) as previously described30 and cloned into the dual expression pFBDM vector using NheI/XmaI and BssHII/NotI respectively. The NEDD8 cDNA was a gift from D. Xirodimas and was fused to a double StrepII tag at its C terminus in the pET17b vector (Millipore). Human DEN1 was amplified from a vector supplied by A. Echalier and fused to a non-cleavable N-terminal StrepII2× tag by PCR and inserted into a pET17b vector. The pCOOL-mKEAP1 plasmid was a gift from F. Shao. The pcDNA3-HA2-KEAP1 and pcDNA3-HA2-KEAP1ΔBTB were gifts from Y. Xiong (Addgene plasmids #21556 and 21593). gRNAs were synthesized and processed as described previously31. Annealed gRNAs were cloned into the Cas9-expressing vectors pSpCas9(BB)-2A-Puro (PX459) or pX330-U6-Chimeric_BB-CBh-hSpCas9, a gift from F. Zhang (Addgene plasmids #48139 and 42230). The gRNAs targeting the LMNA or the PML locus and the mClover-tagged LMNA or PML are described previously28. The lentiviral packaging vector psPAX2 and the envelope vector VSV-G were a gift from D. Trono (Addgene plasmids #12260 and 12259). His -Ub was cloned into the pcDNA5-FRT/TO backbone using the XhoI/HindIII sites. All mutations were introduced by site-directed mutagenesis using QuikChange (Stratagene) and all plasmids were sequence-verified. All culture media were supplemented with 10% fetal bovine serum (FBS). U-2-OS (U2OS) cells were cultured in McCoy’s medium (Gibco). 293T cells were cultured in DMEM (Gibco). Parental cells were tested for mycoplasma contamination and authenticated by STR DNA profiling. Plasmid transfections were carried out using Lipofectamine 2000 Transfection Reagent (Invitrogen) following the manufacturer’s protocol. Lentiviral infection was carried out as previously described15. U2OS and 293T cells were purchased from ATCC. U2OS 256 cells were a gift from R. Greenberg. We employed the following antibodies: rabbit anti-53BP1 (A300-273A, Bethyl), rabbit anti-53BP1 (sc-22760, Santa Cruz), mouse anti-53BP1 (#612523, BD Biosciences), mouse anti-γ-H2AX (clone JBW301, Millipore), rabbit anti-γ-H2AX (#2577, Cell Signaling Technologies), rabbit anti-KEAP1 (ab66620, Abcam), rabbit anti-NRF2 (ab62352, Abcam), mouse anti-Flag (clone M2, Sigma), mouse anti-tubulin (CP06, Calbiochem), mouse anti-GFP (#11814460001, Roche), mouse anti-CCNA (MONX10262, Monosan), rabbit anti-BRCA2 (ab9143, Abcam), mouse anti-BRCA2 (OP95, Calbiochem), rabbit anti-BRCA1 (#07–434, Millipore), rabbit anti-USP11 (ab109232, Abcam), rabbit anti-USP11 (A301-613A, Bethyl), rabbit anti-RAD51 (#70-001, Bioacademia), mouse anti-BrdU (RPN202, GE Healthcare), mouse anti-FK2 (BML-PW8810, Enzo), rabbit anti-PALB2 (ref. 32), rabbit anti-GST (sc-459, Santa Cruz), rabbit anti-CUL3 (A301-108A, Bethyl), mouse anti-MBP (E8032, NEB), mouse anti-HA (clone 12CA5, a gift from M. Tyers), rabbit anti-ubiquitin (Z0458, Dako) and mouse anti-actin (CP01, Calbiochem). The following antibodies were used as secondary antibodies in immunofluorescence microscopy: Alexa Fluor 488 donkey anti-rabbit IgG, Alexa Fluor 488 donkey anti-goat IgG, Alexa Fluor 555 donkey anti-mouse IgG, Alexa Fluor 555 donkey anti-rabbit IgG, Alexa Fluor 647 donkey anti-mouse IgG, Alexa Fluor 647 donkey anti-human IgG, Alexa Fluor 647 donkey anti-goat IgG (Molecular Probes). All siRNAs employed in this study were single duplex siRNAs purchased from ThermoFisher. RNA interference (RNAi) transfections were performed using Lipofectamine RNAiMax (Invitrogen) in a forward transfection mode. The individual siRNA duplexes used were: BRCA1 (D-003461-05), PALB2 (D-012928-04), USP11 (D-006063-01), CUL1 (M-004086-01), CUL2 (M-007277-00), CUL3 (M-010224-02), CUL4A (M-012610-01), CUL4B (M-017965-01), CUL5 (M-019553-01), KEAP1 (D-12453-02), RAD51 (M-003530-04), CtIP/RBBP8 (M-001376-00), BRCA2 (D-003462-04), 53BP1 (D-003549-01) and non-targeting control siRNA (D-001210-02). Except when stated otherwise, siRNAs were transfected 48 h before cell processing. We employed the following drugs at the indicated concentrations: cycloheximide (CHX; Sigma) at 100 ng ml−1, camptothecin (CPT; Sigma) at 0.2 μM, ATM inhibitor (KU55933; Selleck Chemicals) at 10 μM, ATR inhibitor (VE-821; a gift from P. Reaper) at 10 μM, DNA-PKcs inhibitor (NU7441; Genetex) at 10 μM, proteasome inhibitor MG132 (Sigma) at 2 μM, lovastatin (S2061; Selleck Chemicals) at 40 μM, doxycycline (#8634-1; Clontech), Nedd8-activating enzyme inhibitor (MLN4929; Active Biochem) at 5 μM and olaparib (Selleck) at the indicated concentrations. In most cases, cells were grown on glass coverslips, fixed with 2% (w/v) paraformaldehyde in PBS for 20 min at room temperature, permeabilized with 0.3% (v/v) Triton X-100 for 20 min at room temperature and blocked with 5% BSA in PBS for 30 min at room temperature. Alternatively, cells were fixed with 100% cold methanol for 10 min at −20 °C and subsequently washed with PBS for 5 min at room temperature before PBS-BSA blocking. Cells were then incubated with the primary antibody diluted in PBS-BSA for 2 h at room temperature. Cells were next washed with PBS and then incubated with secondary antibodies diluted in PBS-BSA supplemented with 0.8 μg ml−1 of DAPI to stain DNA for 1 h at room temperature. The coverslips were mounted onto glass slides with Prolong Gold mounting agent (Invitrogen). Confocal images were taken using a Zeiss LSM780 laser-scanning microscope. For G1 versus S/G2 analysis of the BRCA1–PALB2–BRCA2 axis, cells were first synchronized with a double-thymidine block, released to allow entry into S phase and exposed to 2 or 20 Gy of X-irradiation at 5 h and 12 h post-release and fixed at 1 to 5 h post-treatment (where indicated). For the examination of DNA replication, cells were pre-incubated with 30 μM BrdU for 30 min before irradiation and processed as previously described. 293T and U2OS cells were transiently transfected with three distinct sgRNAs targeting either 53BP1, USP11 or KEAP1 and expressed from the pX459 vector containing Cas9 followed by the 2A-Puromycin cassette. The next day, cells were selected with puromycin for 2 days and subcloned to form single colonies or subpopulations. Clones were screened by immunoblot and/or immunofluorescence to verify the loss of 53BP1, USP11 or KEAP1 expression and subsequently characterized by PCR and sequencing. The genomic region targeted by the CRISPR–Cas9 was amplified by PCR using Turbo Pfu polymerase (Agilent) and the PCR product was cloned into the pCR2.1 TOPO vector (Invitrogen) before sequencing. 293T cells were incubated with the indicated doses of olaparib (Selleck Chemicals) for 24 h, washed once with PBS and counted by trypan blue staining. Five-hundred cells were then plated in duplicate for each condition. The cell survival assay was performed as previously described33. GST and MBP fusions proteins were produced as previously described34, 35. Briefly, MBP proteins expressed in Escherichia coli were purified on amylose resin (New England Biolabs) according to the batch method described by the manufacturer and stored in 1× PBS, 5% glycerol. GST proteins expressed in E. coli were purified on glutathione sepharose 4B (GE Healthcare) resin in 50 mM Tris HCl pH 7.5, 300 mM NaCl, 2 mM dithiothreitol (DTT), 1 mM EDTA, 15 μg ml−1 AEBSF and 1× complete protease inhibitor cocktail (Roche). Upon elution from the resin using 50 mM glutathione in 50 mM Tris HCl pH 8, 2 mM DTT, the His –GST tag was cleaved off using His-tagged TEV protease (provided by F. Sicheri) in 50 mM Tris HCl pH 7.5, 150 mM NaCl, 10 mM glutathione, 10% glycerol, 2 mM sodium citrate and 2 mM β-mercaptoethanol. His -tagged proteins were depleted using Ni-NTA-agarose beads (Qiagen) in 50 mM Tris HCl pH 7.5, 300 mM NaCl, 20 mM imidazole, 5 mM glutathione, 10% glycerol, 1 mM sodium citrate and 2 mM β-mercaptoethanol followed by centrifugal concentration (Amicon centrifugal filters, Millipore). GST–mKEAP1 was purified as described previously36, with an additional anion exchange step on a HiTrap Q HP column (GE Healthcare). The GST tag was left on the protein for in vitro experiments. Purification of CUL3 and RBX1 was performed as previously described30. NEDD8 (gift from D. Xirodimas) and DEN1 were expressed in E. coli BL21 grown in Terrific broth media and induced overnight with 0.5 mM isopropyl-β-D-thiogalactoside (IPTG) at 16 °C. Cells were harvested and resuspended in wash buffer (400 mM NaCl, 50 mM Tris-HCl, pH 8, 5% glycerol, 2 mM DTT), supplemented with lysozyme, universal nuclease (Pierce), benzamidine, leupeptin, pepstatin, PMSF and complete protease inhibitor cocktail (Roche), except for DEN1-expressing cells where the protease inhibitors were omitted. Cells were lysed by sonication and the lysate was cleared by centrifugation at 20,000 r.p.m. for 50 min. The soluble supernatant was bound to a 5 ml Strep-Tactin Superflow Cartridge with a flow rate of 3 ml min−1 using a peristaltic pump. The column was washed with 20 column volumes (CV) of washing buffer and eluted with 5 CV washing buffer, diluted 1:2 in water to reduce the final salt concentration, and supplemented with 2.5 mM desthiobiotin. The elution fractions were pooled and concentrated to a total volume of 4 ml using a 3 kDa cut-off Amicon concentrator. DEN1 was further purified over a Superdex 75 size-exclusion column, buffer exchanged into 150 mM NaCl, HEPES, pH 7.6, 2% glycerol and 1 mM DTT. The C-terminal pro-peptide and StrepII2×-tag were removed by incubation with StrepII2×–DEN1 in a 1:20 molar ratio for 1 h at room temperature. The DEN1 cleavage reaction was buffer exchanged on a Zeba MWCO desalting column (Pierce), to remove the desthiobiotin, and passed through a Strep-Tactin Cartridge, which retains the C-terminal pro-peptide and DEN1. The GST-tagged Sus scrofa (pig) USP11 proteins were expressed in E. coli as described37. Cells were lysed by lysozyme treatment and sonication in 50 mM Tris pH 7.5, 300 mM NaCl, 1 mM EDTA, 1 mM AEBSF, 1× Protease Inhibitor mix (284 ng ml−1 leupeptin, 1.37 μg ml−1 pepstatin A, 170 μg ml−1 PMSF and 330 μg ml−1 benzamidine) and 5% glycerol. Cleared lysate was applied to a column packed with glutathione sepharose 4B (GE Healthcare), washed extensively with lysis buffer before elution in 50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol and 25 mM reduced glutathione. DUB activity was assayed on fluorogenic ubiquitin-AMC (Enzo life sciences), measured using a Synergy Neo microplate reader (Biotek). His -TEV-ubiquitin-G76C was purified on chelating HiTrap resin, following the manufacturer’s instructions, followed by size-exclusion chromatography on a S-75 column (GE healthcare). The protein was extensively dialysed in 1 mM acetic acid and lyophilized. HA-tagged N-terminal fragments of PALB2 (1–103) (1 μM) were in vitro ubiquitylated using 50 μM wild-type (Ubi WT, Boston Biochem) or a lysine-less ubiquitin (Ub-K0, Boston Biochem), 100 nM human UBA1 (E1), 500 nM CDC34 (provided by F. Sicheri and D. Ceccarelli), 250 nM neddylated CUL3/RBX1, 375 nM GST–mKEAP1 and 1.5 mM ATP in a buffer containing 50 mM Tris HCl pH 7.5, 20 mM NaCl, 10 mM MgCl and 0.5 mM DTT. Ubiquitylation reactions were carried out at 37 °C for 1 h, unless stated otherwise. For USP11-mediated deubiquitylation assays, HA–PALB2 (1–103) was first ubiquitylated using lysine-less ubiquitin with enzyme concentrations as described earlier in 50 μl reactions in a buffer containing 25 mM HEPES pH 8, 150 mM NaCl, 10 mM MgCl , 0.5 mM DTT and 1.5 mM ATP for 1.5 h at 37 °C. Reactions were stopped by the addition of 1 unit Apyrase (New England Biolabs). Reaction products were mixed at a 1:1 ratio with wild-type or catalytically inactive (C270S) USP11, or USP2 (provided by F. Sicheri and E. Zeqiraj) using final concentrations of 100 nM, 500 nM and 2,500 nM (USP11) and 500 nM (USP2) and incubated for 2 h at 30 °C in a buffer containing 25 mM HEPES pH 8, 150 mM NaCl, 2 mM DTT, 0.1 mg ml−1 BSA, 0.03% Brij-35, 5 mM MgCl , 0.375 mM ATP. PALB2 in vitro ubiquitylation reaction products were diluted in a buffer at final concentration of 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl , 0.25 mM DTT and 0.1% NP-40. Twenty micrograms MBP or MBP–BRCA1-CC was coupled to amylose resin (New England Biolabs) in the above buffer supplemented with 0.1% BSA before addition of the ubiquitylation products. Pulldown reactions were performed at 4 °C for 2 h, followed by extensive washing. Cells were collected by trypsinization, washed once with PBS and lysed in 500 μl of lysis buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10% glycerol, 2 mM EDTA, 1% NP-40, complete protease inhibitor cocktail (Roche), cocktail of phosphatase inhibitors (Sigma) and N-ethylmaleimide to inhibit deubiquitylation) on ice. Lysates were centrifuged at 15,000g for 10 min at 4 °C and protein concentration was evaluated using absorbance at 280 nm. Equivalent amounts of proteins (∼0.5–1 mg) were incubated with 2 μg of rabbit anti-PALB2, rabbit anti-USP11 antibody, rabbit anti-GFP antibody or normal rabbit IgG for 5 h at 4 °C. A mix of protein A/protein G-Sepharose beads (Thermo Scientific) was added for an additional hour. Beads were collected by centrifugation, washed twice with lysis buffer and once with PBS, and eluted by boiling in 2× Laemmli buffer before analysis by SDS–PAGE and immunoblotting. For mass spectrometry analysis of Flag–PALB2, 150 × 106 transiently transfected HEK293T cells were lysed in high-salt lysis buffer (50 mM Tris-HCl pH 7.5, 300 mM NaCl, 1 mM EDTA, 1% Triton X-100, 3 mM MgCl , 3 mM CaCl ), supplemented with complete protease inhibitor cocktail (Roche), 4 mM 1,10-Phenantroline, 50 U benzonase and 50 U micrococcal nuclease. Cleared lysates were incubated with Flag-M2 agarose (Sigma), followed by extensive washing in lysis buffer and 50 mM ammoniumbicarbonate. After immunoprecipitation of transiently transfected Flag–PALB2 from siCTRL-transfected or USP11 siRNA-depleted 293T cells, cysteine residues were reduced and alkylated on beads using 10 mM DTT (30 min at 56 °C) and 15 mM 2-chloroacetamide (1 h at room temperature), respectively. Proteins were digested using limited trypsin digestion on beads (1 μg trypsin; Worthington) per sample, 20 min at 37 °C), and dried to completeness. For LC-MS/MS analysis, peptides were reconstituted in 5% formic acid and loaded onto a 12 cm fused silica column with pulled tip packed in-house with 3.5 μm Zorbax C18 (Agilent Technologies). Samples were analysed using an Orbitrap Velos (Thermo Scientific) coupled to an Eksigent nanoLC ultra (AB SCIEX). Peptides were eluted from the column using a 90 min linear gradient from 2% to 35% acetonitrile in 0.1% formic acid. Tandem MS spectra were acquired in a data-dependent mode for the top two most abundant multiply charged peptides and included targeted scans for five specific N-terminal PALB2 tryptic digest peptides (charge state 1+, 2+, 3+), either in non-modified form or including a diGly-ubiquitin trypsin digestion remnant. Tandem MS spectra were acquired using collision-induced dissociation. Spectra were searched against the human Refseq_V53 database using Mascot, allowing up to four missed cleavages and including carbamidomethyl (C), deamidation (NQ), oxidation (M), GlyGly (K) and LeuArgGlyGly (K) as variable modifications. In vitro ubiquitylated HA–PALB2 (1–103) (50 μl total reaction mix) was run briefly onto an SDS–PAGE gel, followed by total lane excision, in-gel reduction using 10 mM DTT (30 min at 56 °C), alkylation using 50 mM 2-chloroacetamide and trypsin digestion for 16 h at 37 °C. Digested peptides were mixed with 20 μl of a mix of 10 unique heavy isotope-labelled N-terminal PALB2 (AQUA) peptides (covering full or partial tryptic digests of regions surrounding Lys 16, 25, 30 or 43, either in non-modified or diG-modified form; 80–1,200 fmol μl−1 per peptide, based on individual peptide sensitivity testing) before loading 6 μl onto a 12 cm fused silica column with pulled tip packed in-house with 3.5 μm Zorbax C18. Samples were measured on an Orbitrap ELITE (Thermo Scientific) coupled to an Eksigent nanoLC ultra (AB SCIEX). Peptides were eluted from the column using a 180 min linear gradient from 2% to 35% acetonitrile in 0.1% formic acid. Tandem MS spectra were acquired in a data-dependent mode for the top two most abundant multiply charged ions and included targeted scans for the ten specific N-terminal PALB2 tryptic digest peptides (charge states 1+, 2+, 3+), either in light or heavy isotope-labelled form. Tandem MS spectra were acquired using collision induced dissociation. Spectra were searched against the human Refseq_V53 database using Mascot, allowing up to two missed cleavages and including carbamidomethyl (C), deamidation (NQ), oxidation (M), GlyGly (K) and LeuArgGlyGly (K) as variable modifications, after which spectra were manually validated. 293 FLIP-IN cells stably expressing His –Ub were transfected with the indicated siRNA and treated with doxycycline (DOX) for 24 h to induce His –Ub expression. Cells were pre-treated with 10 mM N-ethylmaleimide for 30 min and lysed in denaturating lysis buffer (6 M guanidinium-HCl, 0.1 M Na HPO /NaH PO , 10 mM Tris-HCl, 5 mM imidazole, 0.01 M β-mercaptoethanol, complete protease inhibitor cocktail). Lysates were sonicated on ice twice for 10 s with 1 min break and centrifuged at 15,000g for 10 min at 4 °C. The supernatant was incubated with Ni-NTA-agarose beads (Qiagen) for 4 h at 4 °C. Beads were collected by centrifugation, washed once with denaturating lysis buffer, once with wash buffer (8 M urea, 0.1 M Na HPO /NaH PO , 10 mM Tris-HCl, 5 mM imidazole, 0.01 M β-mercaptoethanol, complete protease inhibitor cocktail), and twice with wash buffer supplemented with 0.1% Triton X-100, and eluted in elution buffer (0.2 M imidazole, 0.15 M Tris-HCl, 30% glycerol, 0.72 M β-mercaptoethanol, 5% SDS) before analysis by SDS–PAGE and immunoblotting. Parental U2OS cells and U2OS cells stably expressing wild-type CtIP or CtIP(T847E) mutant were transfected with the indicated siRNA and the PALB2-KR construct, synchronized with a single thymidine block, treated with doxycycline to induce CtIP expression and subsequently blocked in G1 phase by adding 40 μM lovastatin. Cells were collected by trypsinization, washed once with PBS and electroporated with 2.5 μg of sgRNA plasmid and 2.5 μg of donor template using the Nucleofector technology (Lonza; protocol X-001). Cells were plated in medium supplemented with 40 μM lovastatin and grown for 24 h before flow cytometry analysis. PALB2 (1–103) polypeptides, engineered with only one cross-linkable cysteine, were ubiquitylated by cross-linking alkylation, as previously described38, 39, with the following modifications. Purified PALB2 cysteine mutant (final concentration of 600 μM) was mixed with His -TEV-ubiquitin G76C (350 μM) in 300 mM Tris pH 8.8, 120 mM NaCl and 5% glycerol. Tris(2-carboxyethyl)phosphine (TCEP) (Sigma-Aldrich) reducing agent was added to a final concentration of 6 mM to the mixture and incubated for 30 min at room temperature. The bi-reactive cysteine cross-linker, 1,3-dichloroacetone (Sigma-Aldrich), was dissolved in dimethylformamide and added to the protein mix to a final concentration of 5.25 mM. The reaction was allowed to proceed on ice for 1 h, before being quenched by the addition of 5 mM β-mercaptoethanol. His -TEV-ubiquitin-conjugated PALB2 was enriched by passing over Ni-NTA-agarose beads (Qiagen). No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.


News Article
Site: http://www.nature.com/nature/current_issue/

Recovery and culture. All animal work was performed in the animal facility at the European Molecular Biology Laboratory, with permission from the institutional veterinarian overseeing the operation (ARC number TH11 00 11). The animal facilities are operated according to international animal welfare rules (Federation for Laboratory Animal Science Associations guidelines and recommendations). Embryos are isolated from superovulated female mice mated with male mice. Superovulation of female mice is induced by intraperitoneal injection of 5 international units (IU) of pregnant mare’s serum gonadotropin (PMSG; Intervet Intergonan), followed by intraperitoneal injection of 5 IU human chorionic gonadotropin (hCG; Intervet Ovogest 1500) 44–48 h later. Two-cell-stage (embryonic day 1.5 (E1.5)) embryos are recovered by flushing oviducts from plugged females with 37 °C FHM (Millipore, MR-024-D) using a custom-made syringe (Acufirm, 1400 LL 23). Embryos are handled using an aspirator tube (Sigma, A5177-5EA) equipped with a glass pipette pulled from glass micropipettes (Blaubrand intraMark). Embryos are placed in KSOM (Millipore, MR-121-D) or FHM supplemented with 0.1% BSA (Sigma, A3311) in 10 μl droplets covered in mineral oil (Sigma, M8410 or Acros Organics). Embryos are cultured in an incubator with a humidified atmosphere supplemented with 5% CO at 37 °C. For imaging, embryos are placed in 5 cm glass-bottom dishes (MatTek). Mouse lines. (C57BL/6xC3H) F1 hybrid strain is used for wild type (WT). To visualize filamentous actin, LifeAct–GFP mice (Tg(CAG-EGFP)#Rows) are used29. To visualize plasma membranes, mTmG mice (Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo) are used30. To visualize nuclei, H2B–GFP mice are used31. Genes are deleted maternally using Zp3-cre (Tg(Zp3-cre)93Knw) mice32. To generate mMyh9 embryos, Myh9tm5RSad mice are used24 to breed Myh9tm5RSad/tm5RSad ; Zp3Cre/+ mothers with WT fathers. To generate mzMyh10 embryos, Myh10tm7Rsad mice were used33 to breed Myh10tm7Rsad/tm7Rsad ; Zp3Cre/+ mothers with Myh10+/− fathers. To generate aPKC-knockout embryos, Prkcitm1Kido (ref. 10) and Prkcztm1.1Cda (ref. 4) mice are used to breed Prkci−/− ; Prkcz+/− fathers with Prkci−/− ; Prkcztm1.1Cda/+; Zp3Cre/+ mothers. Mice were used from 6 weeks old onwards. Chemical reagents. Blebbistatin(+), an inactive enantiomere of the inhibitor, or (−), the selective inhibitor of myosin II ATPase activity (Tocris, 1853 and 1852), and 50 mM DMSO stocks are diluted to 5, 12.5 or 25 μM in KSOM. Isolation of blastomeres at the 8- and 16-cell stage. Embryos are dissected out of their zona pellucida (ZP) at the 2- to 4-cells stage. ZP-free 8- or 16-cell stage embryos are placed into Ca2+-free KSOM for 5–10 min before being aspirated multiple times (typically between 3 and 5 times) through a narrow glass pipette (with a radius between that of an 8- or 16-cell-stage blastomere and of the whole embryo) until dissociation of cells. To form doublets of polarized and unpolarized 16-cell-stage blastomeres, an 8-cell-stage blastomere is cultured until asymmetric division. To form chimaeras, 16-cell-stage blastomeres are grafted onto a complete embryo using a mouth pipette. Immunostaining. Primary antibody targeting the double phosphorylated form (Thr18/Ser19) of the myosin regulatory light-chain (Cell Signaling, 3674), PKC-ζ (Santa Cruz, sc-17781), Yap (Abnova, M01, clone 2F12) or its Ser127 phosphorylated form (Cell Signaling, 4911) are used at 1:100. The primary antibody targeting Cdx2 (Biogenex, MU392A-UC) or phosphorylated form (Ser1943) of the non-muscle myosin heavy chain Myh9 (Cell Signaling, 5026) are used at 1:200. Secondary antibody targeting mouse or rabbit IgG coupled to Alexa Fluor 488 or 546 (Life Technologies) are used at 1:250. Alexa Fluor 633-coupled (ThermoFisher, A22284) phalloidin is used at 1:250. Micropipette aspiration. As described previously12, a microforged micropipette coupled to a microfluidic pump (Fluigent, MFCS) is used to measure the surface tension of cells. In brief, micropipettes of radii 7–8 μm for 8-cell-stage embryos and 2.5–3.5 μm for 16-cell-stage embryos are used to apply step-wise increasing pressures on blastomeres until reaching a deformation which has the radius of the micropipette (R ). At steady state, the surface tension γ of the blastomere is calculated based on Young–Laplace’s law: γ  = P /2(1/R  − 1/R ), where P is the pressure used to deform the cell of radius R . Asymmetric division tracing. To measure the tension of sister cells at the 16-cell stage, time-lapse images of mTmG and H2B–GFP expressing embryos were taken every 30 min from the 8-cell stage onwards. The 8- to 16-cell-stage divisions are tracked, the time lapse is paused to measure the surface tension of both sister cells. After resuming the time lapse, the measured cells are tracked until blastocyst stage. When both sister cells remain at the surface of the embryo, the division is considered symmetric, whereas when one sister cell internalizes during the 16-cell stage and becomes part of the ICM, the division is considered asymmetric. Microscopy. Tension measurements are performed on a Zeiss Axio Observer microscope with a dry × 20/0.8 PL Apo DICII objective. The microscope is equipped with an incubation chamber to keep the sample at 37 °C. Tension measurements and confocal images are taken using an inverted Zeiss Observer Z1 microscope with a CSU-X1M 5000 spinning disc unit. Excitation is achieved using 488 nm, 561 nm and 633 nm laser lines through a × 63/1.2 C Apo W DIC III water immersion objective. Emission is collected through 525/50 nm, 605/40 nm, 629/62 nm band pass or 640 nm low pass filters onto an EMCCD Evolve 512 camera. The microscope is equipped with an incubation chamber to keep the sample at 37 °C and supply the atmosphere with 5% CO . Shape analysis. Using FIJI, we manually fit a circle onto the cell-medium interface to measure the radius of curvature of the cell R . We use the angle tool to measure the contact angles θ , θ and θ . We draw a line perpendicular to the micropipette tip and use the linescan function to measure the diameter of the micropipette and calculate R . Intensity ratio measurements. Using FIJI, we pick confocal slices cutting through the equatorial plane of the apical domain or of two contacting cells. We draw a ~1 μm thick line along the cell-medium interface of the apical and non-apical regions or of each cell and measure the mean intensity. The apical region is defined by visually observing aPKC or mTmG enrichment in the central region of the cell-medium interface. For aPKC-knockout embryos, the actin-rich region at the centre of the cell-medium interface is selected. The transition zones between apical and non-apical or close to cell–cell contacts between polarized and unpolarized cells are excluded to calculate intensity ratios (~5 μm). Using FIJI, we pick confocal slices cutting through the equatorial plane of the nucleus of a cell. We draw a 2.5 μm radius circle and measure the average intensity in the nucleus and, next to it, in the cytoplasm. We then calculate the nucleus-to-cytoplasm intensity ratio. For whole embryos, the closest distance of the nucleus to the surface of the embryo, marked by phalloidin staining, is measured using the line tool. Periodic contractions analysis. To analyse periodic contractions, we used a previously described pipeline12. In brief, mTmG images are used to segments the cells outlines into 100 equidistant nodes for 8-cell-stage blastomeres and 150 for 16-cell-stage blastomeres doublets. From those nodes, three nodes spaced by 10 or 7 nodes (respectively for 8-cell-stage blastomeres and 16-cell-stage blastomeres doublets) are then taken to fit a circle and compute the local curvature from the inverse radius of this circle. Taking the local curvatures along the cell perimeter over time, a kymograph of local curvature is created. Applying a Fourier transform on the curvature changes over time at each node, we obtain the amplitude of nodes that are classified either as apical or non-apical, based on the mTmG signal that is enriched on the apical domain excluding about 10 nodes around the transition between apical to non-apical domains. For doublets, nodes are classified either as inner or outer cell, based on, when applicable, the asymmetry of the internal contact angles (the cell with the largest internal contact angle being designated as the inner cell for ratio calculation) and/or, when applicable, by the asymmetry in cell size (the smallest cell being designated as the inner cell for ratio calculation). About 10 nodes near the contact edges are excluded from the analysis. Codes are available upon request. Mean, standard deviation, correlation coefficient, two-tailed Student’s t-test and single-tailed Mann–Whitney U-test P values are calculated using Excel (Microsoft). Statistical significance of correlation coefficients is obtained from the Pearson correlation table. The sample size was not predetermined and simply results from the repetition of experiments. No sample was excluded. No randomization method was used. The investigators were not blinded during experiments.


News Article
Site: http://www.nature.com/nature/current_issue/

All mice were bred and maintained under pathogen-free conditions at an American Association for the Accreditation of Laboratory Animal Care accredited animal facility at the University of Pennsylvania or Yale University. Mice were housed in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals under an animal study proposal approved by an institutional Animal Care and Use Committee. Male and female mice between 4 and 12 weeks of age were used for all experiments. Littermate controls were used whenever possible. C57BL/6 (wild type) and B6.SJL-Ptprca Pepcb/Boy (B6.SJL) mice were purchased from The Jackson Laboratory. We generated Morrbid-deficient mice and the in cis and in trans double heterozygous mice (Morrbid+/−, Bcl2l11+/−) mice using the CRISPR/Cas9 system as previously described26. In brief, to generate Morrbid-deficient mice, single guide RNAs (sgRNAs) were designed against regions flanking the first and last exon of the Morrbid locus (Extended Data Fig. 1g). Cas9-mediated double-stranded DNA breaks resolved by non-homologous end joining (NHEJ) ablated the intervening sequences containing Morrbid in C57BL/6N one-cell embryos. The resulting founder mice were Morrbid−/+, which were then bred to wild-type C57BL/6N and then intercrossed to obtain homozygous Morrbid-/- mice. One Morrbid-deficient line was generated. To control for potential off-target effects, mice were crossed for at least 5 generations to wild-type mice and then intercrossed to obtain homozygosity. Littermate controls were used when possible throughout all experiments. To generate the in cis and in trans double heterozygous mice (Morrbid+/−, Bcl2l11+/−) mice, we first obtained mouse one-cell embryos from a mating between Morrbid−/− female mice and wild-type male mice. As such, the resulting one-cell embryos were heterozygous for Morrbid (Morrbid+/−). We then micro-injected sgRNAs designed against intronic sequences flanking the second exon of Bcl2l11, which contains the translational start site/codon, into Morrbid−/+ one-cell embryos (Extended Data Fig. 9). Cas9-mediated double-stranded DNA breaks resolved by NHEJ ablated the intervening sequences containing the second exon of Bcl2l11 in Morrbid+/− (C57BL/6N) one-cell embryos, generating founder mice that were heterozygous for both Bcl2l11 and Morrbid (Bcl2l11+/−; Morrbid−/+). Founder heterozygous mice were then bred to wild-type C57BL/6N to interrogate for the segregation of the Morrbid-deficient and Bcl2l11-defient alleles (Extended Data Fig. 9). Pups that segregated such alleles were named in trans and pups that did not segregate were labelled in cis. One line of in cis and in trans double heterozygous mice (Bcl2l11+/−; Morrbid−/+) lines were generated. To control for potential off-target effects, mice were crossed for at least 5 generations to wild-type (C57BL/6N) mice (for in cis) and to Morrbid−/− mice (for in trans) to maintain heterozygosity. To determine genetic rescue, samples from mice containing different permutations of Morrbid and Bcl2l11 alleles (Fig. 4g–j) were analysed in a blinded manner by a single investigator not involved in the breeding or coding of these samples. Cells were isolated from the indicated tissues (blood, spleen, bone marrow, peritoneal exudate, adipose tissue). Red blood cells were lysed with ACK. Single-cell suspensions were stained with CD16/32 and with indicated fluorochrome-conjugated antibodies. If run live, cells were stained with 7-AAD (7-amino-actinomycin D) to exclude non-viable cells. Otherwise, before fixation, Live/Dead Fixable Violet Cell Stain Kit (Invitrogen) was used to exclude non-viable cells. Active caspase staining using Z-VAD-FMK (CaspGLOW, eBiosciences) was performed according to the manufacturer's specifications. Apoptosis staining by annexin V+ (Annexin V Apoptosis Detection kit) was performed according to the manufacturer’s recommendations. BrdU staining was performed using BrdU Staining Kit (eBioscience) according to the manufacturer’s recommendations. For BCL2L11 staining, cells were fixed for 15 min in 2% formaldehyde solution, and permeabilized with flow cytometry buffer supplemented with 0.1% Triton X-100. All flow cytometry analysis and cell-sorting procedures were done at the University of Pennsylvania Flow Cytometry and Cell Sorting Facility using BD LSRII cell analysers and a BD FACSAria II sorter running FACSDiva software (BD Biosciences). FlowJo software (version 10 TreeStar) was used for data analysis and graphic rendering. All fluorochrome-conjugated antibodies used are listed in Supplementary Table 2. 1 × 106 wild-type and Morrbid-deficient neutrophils sorted from mouse bone marrow were assayed for BCL2L11 protein expression by western blotting (Bim C34C5 rabbit monoclonal antibody, Cell Signaling), as previously described. 2 × 106 wild-type and Morrbid-deficient neutrophils sorted from mouse bone marrow were cross-linked in a 1% formaldehyde solution for 5 min at room temperature while rotating. Crosslinking was stopped by adding glycine (0.2 M in 1 × PBS (phosphate buffered saline)) and incubating on ice for 2 min. Samples were spun at 2500g for 5 min at 4 °C and washed 4 times with 1 × PBS. The pellets were flash frozen and stored at −80 °C. Cells were lysed, and nuclei were isolated and sonicated for 8 min using a Covaris S220 (105 Watts, 2% duty cycle, 200 cycles per burst) to obtain approximately 200–500 bp chromatin fragments. Chromatin fragments were pre-cleared with protein G magnetic beads (New England BioLabs) and incubated with pre-bound anti-H3K27me3 (Qiagen), anti-EZH2 (eBiosciences), or mouse IgG1 (Santa Cruz Biotechnology) antibody-protein G magnetic beads overnight at 4 °C. Beads were washed once in low-salt buffer (20 mM Tris, pH 8.1, 2 mM EDTA, 50 mM NaCl, 1% Triton X-100, 0.1% SDS), twice in high-salt buffer (20 mM Tris, pH 8.1, 2 mM EDTA, 500 mM NaCl, 1% Triton X-100, 0.1% SDS), once in LiCl buffer (10 mM Tris, pH 8.1, 1 mM EDTA, 0.25 mM LiCl, 1% NP-40, 1% deoxycholic acid) and twice in TE buffer (10 mM Tris-HCl, pH 8. 0, 1 mM EDTA). Washed beads were eluted twice with 100 μl of elution buffer (1% SDS, 0.1 M NaHCO ) and de-crosslinked (0.1 mg ml−1 RNase, 0.3 M NaCl and 0.3 mg ml−1 Proteinase K) overnight at 65 °C. The DNA samples were purified with Qiaquick PCR columns (Qiagen). qPCR was carried out on a ViiA7 Real-Time PCR System (ThermoFisher) using the SYBR Green detection system and indicated primers. Expression values of target loci were directly normalized to the indicated positive control loci, such as MyoD1 for H3K27me3 and EZH2 ChIP analysis, and Actb for Pol II ChIP analysis. ChIP–qPCR primer sequences are listed in Supplementary Table 1. 50,000 wild-type and knockout cells, in triplicate, were spun at 500g for 5 min at 4 °C, washed once with 50 μl of cold 1× PBS and centrifuged in the same conditions. Cells were resuspended in 50 μl of ice-cold lysis buffer (10 mM Tris-HCl, pH7.4, 10 mM NaCl, 3 mM MgCl , 0.1% IGEPAL CA-630). Cells were immediately spun at 500g for 10 min at 4 °C. Lysis buffer was carefully pipetted away from the pellet, which was then resuspended in 50 μl of the transposition reaction mix (25 μl 2× TD buffer, 2.5 μl Tn5 Transposase (Illumina), 22.5 μl nuclease-free water) and then incubated at 37 °C for 30 min. DNA purification was performed using a Qiagen MinElute kit and eluted in 12 μl of Elution buffer (10 mM Tris buffer, pH 8.0). To amplify library fragments, 6 μl of the eluted DNA was mixed with NEBnext High-Fidelity 2× PCR Master Mix, 25 μM of customized Nextera PCR primers 1 and 2 (Supplementary Table 1), 100x SYBR Green I and used in PCR as follow: 72 °C for 5 min; 98 °C for 30 s; and thermocycling 4 times at 98 °C for 10 s; 63 °C for 30 s; 72 °C for 1 min. 5 μl of the 5 cycles PCR amplified DNA was used in a qPCR reaction to estimate the additional number of amplification cycles. Libraries were amplified for a total of 10–11 cycles and were then purified using a Qiagen PCR Cleanup kit and eluted in 30 μl of Elution buffer. The libraries were quantified using qPCR and bioanalyser data, and then normalized and pooled to 2 nM. Each 2 nM pool was then denatured with a 0.1 N NaOH solution in equal parts then further diluted to form a 20 pM denatured pool. This pool was then further diluted down to 1.8 pM for sequencing using the NextSeq500 machine on V2 chemistry and sequenced on a 1 × 75 bp Illumina NextSeq flow cell. ATAC sequencing cells was done on Illumina NextSeq at a sequencing depth of ~40–60 million reads per sample. Libraries were prepared in triplicates. Raw reads were deposited under GSE85073. 2 × 75 bp paired-end reads were mapped to the mouse mm9 genome using ‘bwa’ algorithm with ‘mem’ option. Only reads that uniquely mapped to the genome were used in subsequent analysis. Duplicate reads were eliminated to avoid potential PCR amplification artifacts and to eliminate the high numbers of mtDNA duplicates observed in ATAC–seq libraries. Post-alignment filtering resulted in ~26–40 million uniquely aligned singleton reads per library and the technical replicates were merged into one alignment BAM file to increase the power of open chromatin signal in downstream analysis. Depicted tracks were normalized to total read depth. ATAC–seq enriched regions (peaks) in each sample was identified using MACS2 using the below settings: 10 × 106 wild-type and knockout mice neutrophils were cross-linked in a 1% formaldehyde solution for 10 min at room temperature while rotating. Crosslinking was stopped by adding glycine (0.2 M in 1 × PBS) and incubating on ice for 2 min. Samples were spun at 2500g for 5 min at 4 °C and washed 4 times with 1× PBS. The pellets were flash frozen and stored at −80 °C. Cells were lysed and sonicated (Branson Sonifier 250) for 9 cycles (30% amplitude; time, 20 s on, 1 min off). Lysates were spun at 18,400g for 10 min at 4 °C and resuspended in 3 ml of lysis buffer. A sample of 100 μl was kept aside as input and the rest of the samples were divided by the number of antibodies to test. Chromatin immunoprecipitation was performed with 10 μg of antibody-bound beads (anti-H3K27ac, H3K4me3, H3K4me1, H3K36me3 (Abcam) and anti-rabbit IgG (Santa Cruz), Dynal Protein G magnetic beads (Invitrogen)) and incubated overnight at 4 °C. Bead-bound DNA was washed, reverse cross-linked and eluted overnight at 65 °C, shaking at 950 r.p.m. Beads were removed using a magnetic stand and eluted DNA was treated with RNase A (0.2 μg μl−1) for 1 h at 37 °C shaking at 950 r.p.m., then with proteinase K (0.2 μg μl−1) for 2 h at 55 °C. 30 μg of glycogen (Roche) and 5 M of NaCl were adding to the samples. DNA was extracted with 1 volume of phenol:chlorofrom:isoamyl alcohol and washed out with 100% ethanol. Dried DNA pellets were resuspended in 30 μl of 10 mM Tris HCl, pH 8.0, and DNA concentrations were quantified using Qubit. Starting with 10 ng of DNA, ChIP–seq libraries were prepared using the KAPA Hyper Prep Kit (Kapa Biosystems, Inc.) with 10 cycles of PCR. The libraries were quantified using qPCR and bioanalyser data then normalized and pooled to 2 nM. Each 2 nM pool was then denatured with a 0.1 N NaOH solution in equal parts then further diluted to form a 20 pM denatured pool. This pool was then further diluted down to 1.8 pM for sequencing using the NextSeq500 machine on V2 chemistry and sequenced on a 1 × 75 bp Illumina NextSeq flow cell. ChIP sequencing was done on an Illumina NextSeq at a sequencing depth of ~30–40 million reads per sample. Raw reads were deposited under GSE85073. 75 bp single-end reads were mapped to the mouse mm9 genome using ‘bowtie2’ algorithm. Duplicate reads were eliminated to avoid potential PCR amplification artifacts and only reads that uniquely mapped to the genome were used in subsequent analysis. Depicted tracks were normalized to control IgG input sample. ChIP–seq-enriched regions (peaks) in each sample was identified using MACS2 using the below settings: 107 immortalized BMDMs were collected by trypsinization and resuspended in 2 ml PBS, 2 ml nuclear isolation buffer (1.28 M sucrose; 40 mM Tris-HCl, pH 7.5; 20 mM MgCl ; 4% Triton X-100), and 6 ml water on ice for 20 min (with frequent mixing). Nuclei were pelleted by centrifugation at 2,500g for 15 min. Nuclear pellets were resuspended in 1 ml RNA immunoprecipitation (RIP) buffer (150 mM KCl, 25 mM Tris, pH 7.4, 5 mM EDTA, 0.5 mM DTT, 0.5% NP40; 100 U ml−1 SUPERaseIn, Ambion; complete EDTA-free protease inhibitor, Sigma). Resuspended nuclei were split into two fractions of 500 μl each (for mock and immunoprecipitation) and were mechanically sheared using a dounce homogenizer. Nuclear membrane and debris were pelleted by centrifugation at 15,800g. for 10 min. Antibody to EZH2 (Cell Signaling 4905S; 1:30) or normal rabbit IgG (mock immunoprecipitation, SantaCruz; 10 μg) were added to supernatant and incubated for 2 hours at 4 °C with gentle rotation. 25 μl of protein G beads (New England BioLabs S1430S) were added and incubated for 1 hour at 4 °C with gentle rotation. Beads were pelleted by magnetic field, the supernatant was removed, and beads were resuspended in 500 μl RIP buffer and repeated for a total of three RIP buffer washes, followed by one wash in PBS. Beads were resuspended in 1 ml of Trizol. Co-precipitated RNAs were isolated, reverse-transcribed to cDNA, and assayed by qPCR for the Hprt and Morrbid-isoform1. Primer sequences are listed in Supplementary Table 1. EZH2 PAR–CLIP dataset (GSE49435) was analysed as previously described22. Adapter sequences were removed from total reads and those longer than 17 bp were kept. The Fastx toolkit was used to remove duplicate sequences, and the resulting reads were mapped using BOWTIE allowing for two mismatches. The four independent replicates were pooled and analysed using PARalyzer, requiring at least two T→C conversions per RNA–protein contact site. lncRNAs were annotated according to Ensemble release 67. 13 × 106 wild-type bone marrow derived mouse eosinophils were fixed with 1% formaldehyde for 10 minutes at room temperature, and quenched with 0.2 M glycine on ice. Eosinophils were lysed for 3–4 hours at 4 °C (50 mM Tris, pH 7.4, 150 mM NaCl, 0.5% NP-40, 1% Triton X-100, 1× Roche complete protease inhibitor) and dounce-homogenized. Lysis was monitored by Methyl-green pyronin staining (Sigma). Nuclei were pelleted and resuspended in 500 μl 1.4× NEB3.1 buffer, treated with 0.3% SDS for one hour at 37 °C, and 2% Triton X-100 for another hour at 37 °C. Nuclei were digested with 800 units BglII (NEB) for 22 hours at 37 °C, and treated with 1.6% SDS for 25 minutes at 65 °C to inactivate the enzyme. Digested nuclei were suspended in 6.125 ml of 1.25× ligation buffer (NEB), and were treated with 1% Triton X-100 for one hour at 37 °C. Ligation was performed with 1,000 units T4 DNA ligase (NEB) for 18 hours at 16 °C, and crosslinks were reversed by proteinase K digestion (300 μg) overnight at 65 °C. The 3C template was treated with RNase A (300 μg), and purified by phenol-chloroform extraction. Digested and undigested DNA were run on a 0.8% agarose gel to confirm digestion. To control for PCR efficiency, two bacterial artificial chromosomes (BACs) spanning the region of interest were combined in equimolar quantities and digested with 500 units BglII at 37 °C overnight. Digested BACs were ligated with 100 units T4 Ligase HC (Promega) in 60 μl overnight at 16 °C. Both BAC and 3C ligation products were amplified by qPCR (Applied Biosystems ViiA7) using SYBR fast master mix (KAPA biosystems). Products were run side by side on a 2% gel, and images were quantified using ImageJ. Intensity of 3C ligation products was normalized to intensity of respective BAC PCR product. Mice were infected with 30,000 CFUs of Listeria monocytogenes (strain 10403s, obtained as a gift from E. J. Wherry) intravenously (i.v.). Mice were weighed and inspected daily. Mice were analysed at day 4 of infection to determine the CFUs of L. monocytogenes present in the spleen and liver. Papain was purchased from Sigma Aldrich and resuspended in at 1 mg ml−1 in PBS. Mice were intranasally challenged with 5 doses of 20 μg papain in 20 μl of PBS or PBS alone every 24 hours. Mice were killed 12 hours after the last challenge. Bronchoalveolar lavage was collected in two 1 ml lavages of PBS. Cellular lung infiltrates were collected after 1 hour digestion in RPMI supplemented with 5% FCS, 1 mg ml−1 collagenase D (Roche) and 10 μg ml−1 DNase I (Invitrogen) at 37 °C. Homogenates were passed through a cell strainer and infiltrates separated with a 27.5%, Optiprep gradient (Axis-Shield) by centrifugation at 1,175g for 20 min. Cells were removed from the interface and treated with ACK lysis buffer. Congenic C57BL/6 (wild-type) bone marrow expressing CD45.1 and CD45.2 and Morrbid-deficient bone marrow expression CD45.2 was mixed in a 1:1 ratio and injected into C57BL/6 hosts irradiated twice with 5 Gy 3 hours apart that express CD45.1 (B6.SJL-Ptprca Pepcb/BoyJ). Mice were analysed between 4–9 weeks after injection. Bone marrow was isolated and cultured as previously described9. Briefly, unfractionated bone marrow cells were cultured with 100 ng ml−1 stem cell factor (SCF) and 100 ng ml−1 FLT3-ligand (FLT3-L). At day 4, the media was replaced with media containing 10 ng ml−1 interleukin (IL-5). Mature bone-marrow-derived eosinophils were analysed between day 10–14. Bone marrow cells were isolated and cultured in media containing recombinant mouse M-CSF (10 ng ml−1) for 7–8 days. On day 7–8, cells were re-plated for use in experimental assays. Bone-marrow-derived macrophages were stimulated with LPS (250 ng ml−1) for the indicated periods of time. Briefly, 40 × 107 Immortalized bone-marrow-derived macrophages were fixed with 40 ml of 1% glutaraldehyde for 10 min at room temperature. Crosslinking was quenched with 0.125 M glycine for 5 min. Cells were rinsed with PBS, pelleted for 4 min at 2,000g, snap-frozen in liquid nitrogen, and stored at −80 °C. Cell pellets were thawed at room temperature and resuspended in 800 μl of lysis buffer (50 mM Tris-HCl, pH 7.0, 10 mM EDTA, 1% SDS, 1 mM PMSF, complete protease inhibitor (Roche), 0.1 U ml−1 Superase In (Life Technologies)). Cell suspension was sonicated using a Covaris S220 machine (Covaris; 100 W, duty factor 20%, 200 cycles per burst) for 60 minutes until DNA was in the size range of 100–500 bp. After centrifugation for 5 min at 16100 g at 4 °C, the supernatant was aliquoted, snap-frozen in liquid nitrogen, and stored at −80 °C. 1 ml of chromatin was diluted in 2 ml hybridization buffer (750 mM NaCl, 1% SDS, 50 mM Tris HCl, pH 7.0, 1 mM EDTA, 15% formamide) and input RNA and DNA aliquots were removed. 100 pmoles of probes (Supplementary Table 1) were added and mixed by rotation at 37 °C for 4 h. Streptavidin paramagnetic C1 beads (Invitrogen) were equilibrated with lysis buffer. 100 μl washed C1 beads were added, and the entire reaction was mixed for 30 min at 37 °C. Samples were washed five times with 1 ml of washing buffer (SSC 2×, 0.5% SDS and fresh PMSF). 10% of each sample was removed from the last wash for RNA isolation. RNA aliquots were added to 85 μl RNA PK buffer, pH 7.0, (100 mM NaCl, 10 mM TrisCl, pH 7.0, 1 mM EDTA, 0.5% SDS, 0.2 U μl−1 proteinase K) and incubated for 45 min with end-to-end shaking. Samples were spun down, and boiled for 10 min at 95 °C. Samples were chilled on ice, added to 500 μl TRizol, and RNA was extracted according to the manufacturer’s recommendations. Equal volume of RNA was reverse-transcribed and assayed by qPCR using Hprt and Morrbid-exon1-1 primer sets (Supplementary Table 1). DNA was eluted from remaining bead fraction twice using 150 μl DNA elution buffer (50 mM NaHCO , 1%SDS, 200 mM NaCl, 100 μg ml−1 RNase A, 100 U ml−1 RNase H) incubated for 30 min at 37 °C. DNA elutions were combined and treated with 15 μl (20 mg ml−1) Proteinase K for 45 min at 50 °C. DNA was purified using phenol:chloroform:isoamyl and assayed by qPCR using the indicated primer sequences (Supplementary Table 1). shRNAs of indicated sequences (Supplementary Table 1) were cloned into pGreen shRNA cloning and expression lentivector. Psuedotyped lentivirus was generated as previously described, and 293T cells were transfected with a packaging plasmid, envelop plasmid, and the generated shRNA vector plasmid using Lipofectamine 2000. Virus was collected 14–16 h and 48 h after transfection, combined, 0.4-μm filtered, and stored at −80 °C. For generation of in vivo BM chimaeras, virus was concentrated 6 times by ultracentrifugation using an Optiprep gradient (Axis-Shield). For transduced BM-derived eosinophils, cultured BM cells on day 3 of previously described culture conditions were mixed 1:1 with indicated lentivirus and spinfected for 2 h at 260g at 25 °C with 5 μg ml−1 polybrene. Cultures were incubated overnight at 37 °C, and media was exchanged for IL-5 containing media at day 4 of culture as previously described9. Cells were sorted for GFP+ cells on day 5 of culture, and then cultured as previously described for eosinophil generation. Cells were assayed on day 11 of culture. For transduced in vivo BM chimaeras, BM cells were cultured at 2.5 × 106 cells per ml in mIL-3 (10 ng ml−1), mIL-6 (5 ng ml−1) and mSCF (100 ng ml−1) overnight at 37 °C. Culture was readjusted to 2 ml at 2.5 × 106 cells per ml in a 6-well plate, and spinfected for 2 h at 260g at 25 °C with 5 μg ml−1 polybrene. Cells were incubated overnight at 37 °C. On the day before transfer, recipient hosts were irradiated twice with 5 Gy 3 hours apart. Mice were analysed between 4 and 5 weeks following transfer. Bone marrow-derived macrophages (BMDMs) were transfected with pooled Morrbid or scrambled locked nucleic acid (LNA) antisense oligonucleotides of equivalent total concentrations using Lipofectamine 2000. Morrbid LNA pools contained Morrbid LNA 1-4 sequences at a total of 50 or 100 nM (Supplementary Table 1). After 24 h, the transfection media was replaced. The BMDMs were incubated for an additional 24 h and subsequently stimulated with LPS (250 ng ml−1) for 8−12 h. Eosinophils were derived from mouse BM as previously described. On day 12 of culture, 1 × 106 to 2 × 106 eosinophils were transfected with 50 nm of Morrbid LNA 3 or scrambled LNA (Supplementary Table 1) using TransIT-oligo according to manufacturer’s protocol. RNA was extracted 48 h after transfection. Guide RNAs (gRNAs) targeting the 5’ and 3’ flanking regions of the Morrbid promoter were cloned into Cas9 vectors pSPCas9(BB)-2A-GFP(PX458) (Addgene plasmid 48138) and pSPCas9(BB)-2A-mCherry (a gift from the Stitzel lab, JAX-GM) respectively. gRNA sequences are listed in Supplementary Table 1. The cloned Cas9 plasmids were then transfected into RAW 264.7, a mouse macrophage cell line using Lipofectamine 2000, according to manufacturer’s protocol. Forty–eight hours post transfection the double positive cells expressing GFP and mcherry, and the double negative cells lacking GFP and mcherry were sorted. The bulk sorted cells were grown in a complete media containing 20% FBS, assayed for deletion by PCR, as well as for Morrbid and Bcl2l11 transcript expression by qPCR. BM-derived eosinophils, or neutrophils or Ly6Chi monocytes sorted from mouse BM, were rested for 4–6 hours at 37 °C in complete media. Cells were subsequently stimulated with IL-3 (10 ng ml−1, Biolegend), IL-5 (10 ng ml−1, Biolegend), GM-CSF (10 ng ml−1, Biolegend), or G-CSF (10 ng ml−1, Biolegend) for 4–6 h. RNA was collected at each time-point using TRIzol (Life Technologies). Wild-type and Bcl2l11−/− BM-derived eosinophils were generated as previously described9. On day 8 of culture, the previously described IL-5 media was supplemented with the indicated concentrations of the EZH2-specific inhibitor GSK126 (Toronto Research Chemicals). Media was exchanged for fresh IL-5 GSK126 containing media every other day. Cells were assayed for numbers and cell death by flow cytometry every day for 6 days following GSK126 treatment. Total RNA was extracted from TRIzol (Life Technologies) according to the manufacturer’s instructions. Gycogen (ThermoFisher Scientific) was used as a carrier. Isolated RNA was quantified by spectophotemetry, and RNA concentrations were normalized. cDNA was synthesized using SuperScript II Reverse Transcriptase (ThermoFisher Scientific) according to the manufacturer’s instructions. Resulting cDNA was analysed by SYBR Green (KAPA SYBR Fast, KAPABiosystems) or Taqman-based (KAPA Probe Fast, KAPABiosystems) using indicated primers. Primer sequences are listed in Supplementary Table 1. All reactions were performed in duplicate using a CFX96 Touch instrument (BioRad) or ViiA7 Real-Time PCR instrument (ThermoFischer Scientific). Reads generated from mouse (Gr1+) granulocytes (previously published GSE53928), human neutrophils (previously published GSE70068), and bovine peripheral blood leukocytes (previously published GSE60265) were filtered, normalized, and aligned to the corresponding host genome. Reads mapping around the Morrbid locus were visualized. For visualization of the high level of Morrbid expression in short-lived myeloid cells, reads from sorted mouse eosinophils (previously published GSE69707), were filtered, aligned to mm9, normalized using RPKM, and gene expression was plotted in descending order. For each human sample corresponding to the indicated stimulation conditions, the number of reads mapping to the human MORRBID locus per total mapped reads was determined. For conservation across species, the genomic loci and surrounding genomic regions for the species analysed were aligned with mVista and visualized using the rankVista display generated with mouse as the reference sequence. Green highlights annotated mouse exonic regions and corresponding regions in other indicated species. Single molecule RNA fluorescence in situ hybridization (FISH) was performed as previously described. A pool of 44 oligonucleotides (Biosearch Technologies) were labelled with Atto647N (Atto-Tec). For validation purposes, we also labelled subsets consisting of odd and even numbered oligonucleotides with Atto647N and Atto700, respectively, and looked for colocalization of signal. We designed the oligonucleotides using the online Stellaris probe design software. Probe oligonucleotide sequences are listed in Supplementary Table 1. Thirty Z-sections with a 0.3-μm spacing were taken for each field of view. We acquired all images using a Nikon Ti-E widefield microscope with a 100× 1.4NA objective and a Pixis 1024BR cooled CCD camera. We counted the mRNA in each cell by using custom image processing scripts written in MATLAB. For nuclear and cytoplasmic fractionation, 5 × 106 BMDMs were stimulated with 250 ng ml−1 LPS for 4 hours. Cells were collected and washed once with cold PBS. Cells were pelleted, resuspended in 100 μl cold NAR A buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1× complete EDTA-free protease inhibitor, Sigma; 1 mM DTT, 20 mM β-glycerophasphate, 0.1 U μl−1 SUPERaseIn, Life Technologies), and incubated at 4 °C for 20 min. 10 μl 1% NP-40 was added, and cells were incubated for 3 min at room temperature. Cells were vortexed for 30 seconds, and centrifuged at 3,400g. for 1.5 min at 4 °C. Supernatant was removed, centrifuged at full speed for 90 min at 4 °C, and remaining supernatant was added to 500 μl Trizol as the cytoplasmic fraction. The original pellet was washed 4 times in 100 μl NAR A with short spins of 6,800g. for 1 min. The pellet was resuspended in 50 μl NAR C (20 mM HEPES, pH 7.9, 400 mM NaCl, 1 mM EDTA, 1× complete EDTA-free protease inhibitor, Sigma, 1 mM DTT, 20mM β-glycerophasphate, 0.1 U μl−1 SUPERaseIn, Life Technologies). Cells were vortexed every 3 min for 10 s for a total of 20 min at 4 °C. The sample was centrifuged at maximum speed for 20 min at room temperature. Remaining supernatant was added to 500 μl Trizol as the nuclear fraction. Equivalent volumes of cytoplasmic and nuclear RNA were converted to cDNA using gene specific primers and Super Script II RT (Life Technologies). Fraction was assessed by qPCR for Morrbid-exon1-1 and other known cytoplasmic and nuclear transcripts. Primer sequences are listed in Supplementary Table 1. For cytoplasmic, nuclear, and chromatin fractionation, cell fractions 5 × 106 to 10 × 106 immortalized macrophages were activated with 250 ng ml−1 LPS (Sigma) for 6 hours at 37 °C. Cells were washed 2× with PBS, and then resuspended in 380 μl ice-cold HLB (50 mM Tris-HCl, pH7.4, 50 mM NaCl, 3 mM MgCl , 0.5% NP-40, 10% glycerol), supplemented with 100 U SUPERase In RNase Inhibitor (Life Technologies). Cells were vortexed 30 s and incubated on ice for 30 min, followed by a final 30 s vortex and centrifugation at 4 °C for 5 min × 1000g. Supernatant was collected as the cytoplasmic fraction. Nuclear pellets were resuspended by vortexing in 380 μl ice-cold MWS (50 mM Tris-HCl, pH7.4, 4 mM EDTA, 0.3 M NaCl, 1 M urea, 1% NP-40) supplemented with 100 U SUPERase in RNase Inhibitor. Nuclei were lysed on ice for 10 min, vortexed for 30 s, and incubated on ice for 10 more min to complete lysis. Chromatin was pelleted by centrifugation at 4 °C for 5 min × 1000g. Supernatant was collected as the nucleoplasmic fraction. RNA was collected as described previously and cleaned up using the RNeasy kit (Qiagen). Equivalent volumes of cytoplasmic, nucleoplasmic, and chromatin-associated RNA were converted to cDNA using random hexamers and Super Script III RT (Life Technologies). Fraction was assessed by qPCR for Morrbid-exon1-2 and other known cytoplasmic and nuclear transcripts. Primer sequences are listed in Supplementary Table 1. Morrbid cDNA was cloned into reference plasmid (pCDNA3.1) containing a T7 promoter. The plasmid was linearized and Morrbid RNA was in vitro transcribed using the MEGAshortscript T7 kit (Life Technologies), according to the manufacturer’s recommendations, and purified using the MEGAclear kit (Life Technologies). RNA was quantified using spectrophotometry and serial dilutions of Morrbid RNA of calculated copy number were spiked into Morrbid-deficient RNA isolated from Morrbid-deficient mouse spleen. Samples were reverse transcribed in parallel with wild-type-sorted neutrophil RNA and B-cell RNA isolated from known cell number using gene-specific Morrbid primers, and the Morrbid standard curve and wild-type neutrophils and B cells were assayed using qPCR with Morrbid-exon 1 primer sets (Supplementary Table 1) Cohorts of mice were given a total of 4 mg bromodeoxyuridine (BrdU; Sigma Aldrich) in 2 separate intraperitoneal (i.p.) injections 3 h apart and monitored over the subsequent 5 days, unless otherwise noted. For analysis cells were stained according to manufacturer protocol (BrdU Staining Kit, ebioscience; anti-BrdU, Biolgend). A one-phase exponential curve was fitted from the peak labelling frequency to 36 h after peak labelling within each genetic background, and the half-life was determined from this curve. Study subjects were recruited and consented in accordance with the University of Pennsylvania Institutional Review Board. Peripheral blood was separated by Ficoll–Paque density gradient centrifugation, and the mononuclear cell layer and erythrocyte/granulocyte pellet were isolated and stained for fluorescence-associated cell sorting as previously described. Neutrophils (live, CD16+F4/80intCD3−CD14−CD19−), eosinophils (live, CD16−F4/80hiCD3−CD14−CD19−), T cells (live, CD3+CD16−), monocytes (live, CD14+CD3−CD16−CD56−), natural killer (NK) cells (live, CD56+CD3−CD16−CD14−), B cells (live, CD19+CD3−CD16−CD14−CD56−). Samples from human subjects were collected on NIAID IRB-approved research protocols to study eosinophilic disorders (NCT00001406) or to provide controls for in vitro research (NCT00090662). All participants gave written informed consent. Eosinophils were purified from peripheral blood by negative selection and frozen at –80 oC in TRIzol (Life Technologies). Purity was >97% as assessed by cytospin. RNA was purified according to the manufacturer’s instructions. Expression analysis by qPCR was performed in a blinded manner by an individual not involved in sample collection or coding of these of these samples. Plasma IL-5 levels were measured by suspension array in multiplex (Millipore). The minimum detectable concentration was 0.1 pg ml−1. RAW 264.7 cells were obtained from ATCC and were not authenticated, but were tested for mycoplasma contamination biannually. Immortalized C57/B6 macrophages were obtained as a generous gift from I. Brodsky. These cells were not authenticated, but were tested for mycoplasma contamination biannually. Samples sizes were estimated based on our preliminary phenotyping of Morrbid-deficient mice. Preliminary cell number analysis of eosinophils, neutrophils, and Ly6Chi monocytes suggested that there were very large differences between wild-type and Morrbid-deficient samples, which would allow statistical interpretation with relatively small numbers and no statistical methods were used to predetermine sample size. No animals were excluded from analysis. All experimental and control mice and human samples were run in parallel to control for experimental variability. The experiments were not randomized. Experiments corresponding to Fig. 3g–i and Fig. 4g–j were performed and analysed in a single-blinded manner. All other experiments were not blinded to allocation during experiments and outcome assessment. Correlation was determined by calculating the Spearman correlation coefficient. Half-life was estimated by calculating the one-phase exponential decay constant from the peak of labelling frequency to 36 h after peak labelling. P values were calculated using a two-way t-test, Mann–Whitney U-test, one-way ANOVA with Tukey post-hoc analysis, Kaplan–Meier Mantel–Cox test, and false discovery rate (FDR) as indicated. FDR was calculated using trimmed mean of M-values (TMM)-normalized read counts and the DiffBind R package as described in Extended Data Fig. 7c, d. All error bars indicate mean plus and minus the standard error of mean (s.e.m.).


News Article
Site: http://www.nature.com/nature/current_issue/

The cell lines 8988T, MiaPaCa2, Tu8902, Panc1, MPanc96 and IMR90 were obtained from ATCC or the DSMZ. hPSCs (hPSC#1) have been previously described16. hPSC#2 was isolated from an untreated human PDAC resection and considered de-identified ‘surgical waste’ tissue under IRB approved protocols 03-189 and 11-104. Patients gave informed consent for tissue collection. Stromal cells that outgrew the cancer cells in culture were isolated by differential trypsinization and immortalized by infection with hTERT and SV40gp6 (Addgene plasmids #22396 and #10891, respectively) retro-viruses. These cells were kept in DMEM (Life Technologies 11965) supplemented with 10% FBS and 1% Pen/Strep (Life Technologies 15140). Primary human pancreatic cancer-associated fibroblasts were isolated from tumour resections in a similar manner as above, under IRB approved protocol STU 102010-051, but were not immortalized. Cells were kept in DMEM supplemented with 10% CCS (Thermo Scientific) and 1% Pen/Strep. PSCs were verified by measuring Desmin and SMA expression. HPDE have been previously described and grown as indicated26. All cells were routinely tested for mycoplasma by PCR and PDAC lines were typically authenticated by fingerprinting as well as visual inspection and carefully maintained in a centralized cell bank. mPSCs were isolated from normal mice pancreata and purified by centrifugation using a Nycodenz gradient and activated by in vitro culture, as described25. Black 6 (B6) mPSCs were generated from B6 females (Taconic, B6NTac) harbouring mouse PDAC. These animals were pre-treated with doxycycline diet and kept in doxycycline regimen for the duration of the experiment and were injected with 5 × 105 iKRAS mPDAC cells15 into the pancreas. Pancreatic tumours were resected at 2 weeks, digested in collagenase and dispase and mechanically minced. Cells were plated in cell culture dishes in DMEM (Gibco) with 15% FBS in the absence of doxycycline to limit the growth of iKRAS mouse PDAC cells. mPSCs were immortalized by infection with hTERT and SV40gp6 (Adgene plasmids #22396 and #10891, respectively) retro-viruses. Cells were kept in DMEM (Gibco) with 10% FBS and 1% Pen/strep. mCherry-hPSCs are hPSC#1 labelled with mCherry through infection with a lentivirus expressing mCherry. Conditioned medium was generated by adding fresh medium to cells at >50% confluence. Medium was harvested 48 h later and passed through 0.45-μm filters. For size cut-off experiments conditioned medium was filtered through 3-kDa cutoff columns (EMD Millipore, UFC900308). Concentrated (>3 kDa) medium was resuspended in a DMEM volume matching the initial medium volume. Boiled medium experiments were performed by heating conditioned medium at 100 °C for 15 min followed by filtration at 0.45 μm to remove precipitate. Freeze-thaw medium was treated by 3 consecutive cycles of 15 min at −80 °C followed by 15 min at 60 °C and then filtered to remove precipitate. The tandem fluorescence LC3-reporter stable hPSC cells were generated by retroviral infection of hPSCs with pBABE-puro mCherry-EGFP-LC3B (Addgene plasmid #22418). For autophagic flux quantification experiments, 7.5 × 104 hPSC-LC3 cells were plated in 12-well plates with cover slips and 3 × 105 PDAC or hPSC cells were added 4 h later. Cover slips were fixed in 4% paraformaldehyde (ThermoFisher, 28908) after cells had been in contact for 24 h. Coverslips were mounted in DAPI containing mounting solution (Life Technologies P36931). Cells were imaged on a Yokogawa Spinning Disk Confocal in FITC, RFP and DAPI channels. The ratio of red:yellow puncta was determined by counting puncta using the Cell Counter imageJ plugin. Oil-red O staining was performed on cells plated on glass cover slips and fixed 24 h after plating in 4% paraformaldehyde (Thermo-Fisher, 28908) for 15 min. Cells were rinsed with PBS followed by a rinse with 60% isopropanol and stained with freshly prepared Oil Red O working solution comprised of 3 ml of 0.5% solution (Sigma, O1391) and 2 ml of H O for 15 min, rinsed with 60% isopropanol and counterstained with Heamatoxylin. Cover slips were then washed in H O, mounted in Vectashield and imaged using a Leica DM2000 bright-field microscope. Growth curves were obtained as previously described19. Cell growth over 48 h was assessed in clear bottom 96-well plates (Costar 3603, Corning Incorporated) by CellTiter-Glo (Promega G7572) analysis 48 h post treatment with conditioned medium or metabolites and determined by the mean of at least three wells per condition. Luminescence was measured on a POLARstar Omega plate reader. OCR and ECAR experiments were performed using the XF-96 apparatus from Seahorse Bioscience. Cells were plated (16,000 cells per well for 8988T; 20,000 cells for Tu8902 or Panc-1; 50,000 cells for HPDE) in at least quadruplicate for each condition the day before the experiment. The next day, medium was completely replaced with conditioned medium (75 μl of conditioned medium and 25 μl of fresh medium) or fresh medium containing either 1 mM l-alanine (Sigma A7469), 1 mM of NEAAs (Gibco 11140), 1 mM glycine (Sigma G8790), 1 mM aspartate (Sigma A4534) or 1 mM cysteine (Sigma A9165). 20 h later, medium was replaced by reconstituted DMEM with 25 mM glucose and 2 mM glutamine (no sodium bicarbonate) adjusted to pH~7.4 and incubated for 30 min at 37% in a CO -free incubator. For the mitochondrial stress test (Seahorse 101706-100), oligomycin, FCCP and rotenone were injected to a final concentration of 2 μM, 0.5 μM and 4 μM, respectively. For the glycolysis stress test (Seahorse 102194-100), glucose, oligomycin and 2-deoxyglucose were injected to a final concentration of 10 mM, 2 μM and 100 mM, respectively. OCR and ECAR were normalized to cell number as determined by CellTiter-Glo analysis at the end of the experiments. Steady-state metabolomics experiments were performed as previously described14. Briefly, PDAC cell lines were grown to ~80% confluence in growth medium (DMEM, 2 mM glutamine, 10 mM glucose, 10% CCS) on 6 cm dishes in biological triplicate. A complete medium change was performed two hours before metabolite collection. To trace the effect of alanine on glutamine and glucose metabolism, PDAC cell lines were grown as above and then transferred into glutamine-free (with 10 mM glucose) or glucose-free (with 2 mM glutamine) DMEM containing 10% dialysed FBS and supplemented with either 2 mM U-13C-glutamine (± 1 mM alanine) or 10 mM U-13C-glucose (± 1 mM alanine), respectively, overnight. To trace alanine metabolism, PDAC cell lines were grown as above and then transferred into DMEM (with 10 mM glucose, 2 mM glutamine, 10% dialysed FBS) and supplemented with 1 mM U-13C-alanine overnight. Additionally, fresh medium containing the labelled metabolite was exchanged 2 h before metabolite extraction for steady-state analyses. To trace glucose metabolism in low-glucose conditions, cells were grown in 0.5 mM of glucose and medium was refreshed every 8 h for the 24 h labelling period to achieve steady-state labelling. For all metabolomics experiments, the quantity of the metabolite fraction analysed was adjusted to the corresponding protein concentration calculated upon processing a parallel well in a 6-cm dish. To collect labelled conditioned medium, hPSC or 8988T cells were grown for three passages in DMEM containing 10 mM U-13C-glucose, 2 mM U-13C-Gln and 10% dialysed FBS. This medium was then replaced by DMEM with unlabelled glucose, glutamine and 10% dialysed FBS, and incubated for 48 h, filtered and processed for metabolite extraction. Metabolite extraction of medium was performed by adding 200 μl of filtered fresh conditioned medium to 800 μl of cold (–80 °C) methanol, incubated at −80 °C for 30 min followed by centrifugation at 10,000g for 10 min at 4 °C. The resultant supernatant was lyophilized by speedvac and stored at −80 °C until analysis. Dried metabolite pellets were re-suspended in 20 μl LC–MS grade water, 5 μl were injected onto a Prominence UFLC and separated using a 4.6 mm i.d. × 100 mm Amide XBridge HILIC column at 360 μl per minute starting from 85% buffer B (100% ACN) to 0% B over 16 min. Buffer A: 20 mM NH OH/20 mM CH COONH (pH = 9.0) in 95:5 water/ACN. 287 selected reaction monitoring (SRM) transitions were captured using positive/negative polarity switching by targeted LC-MS/MS using a 5500 QTRAP hybrid triple quadrupole mass spectrometer. For kinetics of metabolite secretion by hPSCs, triplicate samples of subconfluent hPSCs cultured under normal conditions were changed to fresh DMEM with 10% dialysed FBS, which was allowed to condition for 2, 4, 8, 24, 48, or 72 h. Fresh DMEM with 10% dialysed FBS was used as a blank control. Metabolites were then extracted from conditioned medium by adding ice cold 100% MeOH to a final concentration of 80% MeOH. For PDAC metabolite uptake kinetics, conditioned DMEM with 10% dialysed FBS from subconfluent hPSCs was collected after 48 h of culture, and then filtered through a 0.45 μm filter. 8988T PDAC cells were plated in triplicate and treated with the PSC-conditioned medium or fresh DMEM with 10% dialysed FBS for 1, 2, 4, 8, or 24 h. The medium was removed and the cell lysate harvested with ice cold 80% MeOH. The soluble metabolite fractions were cleared by centrifugation, dried under nitrogen, then resuspended in 50:50 MeOH:H O mixture for LC–MS analysis. For the kinetic analyses, a Shimadzu Nexera X2 UHPLC combined with a Sciex 5600 Triple TOFMS was used, which was controlled by Sciex Analyst 1.7.1 instrument acquiring software. A Supelco Ascentis Express HILIC (7.5 cm × 3 mm, 2.7 μm) column was used with mobile phase (A) consisting of 5 mM NH OAc and 0.1% formic acid; mobile phase (B) consisting of 98% CAN, 2% 5 mM NH OAc and 0.1% formic acid. Gradient program: mobile phase (A) was held at 10% for 0.5 min and then increased to 50% in 3 min; then to 99% in 4.1 min and held for 1.4 min before returning initial condition. The column was held at 40 °C and 5 μl of sample was injected into the LC–MS with a flow rate of 0.4 ml/min. Calibrations of TOFMS were achieved through reference APCI source with average mass accuracy of less than 5 ppm except for alanine, which was 20 ppm. Key MS parameters were the collision energy and spread of 25 eV and 10 eV for positive product ion acquisition and −35 eV and 15 eV for negative acquisition. 100 MRM transitions were set on the MS method. Data Processing Software included Sciex PeakView 2.2, MasterView 1.1, LibraryView (64 bit) and MultiQuant 3.0.2. For analysis of palmitate and stearate, PDAC cells in log growth were labelled in biological quadruplicate with either 5.5 mM U-13C-glucose or 1 mM U-13C-Ala in DMEM containing 2 mM glutamine and 10% dialysed FBS for 3 days. Unlabelled species were used at equivalent concentrations, where relevant. Labelled medium was refreshed every day. At 72 h, medium was refreshed for 2 h, and samples were collected by quick rinse in ddH O followed by liquid nitrogen quenching directly on cells. Plates were then stored at −80 °C before extraction. Polar metabolites and fatty acids were extracted using methanol/water/chloroform, as described27. Samples were placed on ice and 10 μl of 1.2 mM D27 myristic acid as internal standard was introduced to each cell plate. 400 μl of cold water and 400 μl of methanol were added to each sample. Cells were collected in a centrifuge tube and 400 μl of ice-cold chloroform was added to each tube. Extracts were vortexed at 4 °C for 30 min and centrifuged at 14,000xG for 20 min at 4 °C. The lower (organic) phase was recovered, and samples were nitrogen dried before reconstitution in 50 μl of Methyl-8 reagent (Thermo) at 60 °C for 1 h to generate fatty acid methyl esters (FAMEs). GC–MS analysis was performed using an Agilent 7890A GC equipped with a 30 m DB-5MS+DG capillary column and a Leap CTC PAL ALS as the sample injector. The GC was connected to an Agilent 5975C quadrupole MS operating under positive electron impact ionization at 70 eV. Tunings and data acquisition were done with ChemStation E.02.01, PAL Loader 1.1.1, Agilent Pal Control Software Rev A and Pal Object Manager updated firmware. MS tuning parameters were optimized so that PFTBA tuning ion abundance ratios of 69:219:512 were 100:114:12, increasing high ion abundance. Agilent Fiehn retention time locking (RLT) GC method was used and calibrated with standard FAMEs (Agilent) and confirmed with Agilent G1677AA Fiehn GC/MS metabolomics RTL Library. For measurement of FAMEs, the GC injection port was set at 250 °C and GC oven temperature was held at 60 °C for 1 min and increased to 320 °C at a rate of 10 °C/minute, then held for 10 min under constant flow with initial pressure of 10.91 psi. The MS source and quadrupole were held at 230 °C and 159 °C, respectively, and the detector was run in scanning mode, recording ion abundance in the range of 35–600 m/z with solvent delay time of 5.9 min. Data extraction was done with Agilent MassHunter WorkStation Software GCMS Quantitative Analysis Version B.07. Additional isotope correction was performed using an in-house software tool from MATLab28. All 13C isotopic reagents were purchased from Cambridge Isotope Laboratories. Total RNA was extracted using TRIzol (Invitrogen) and reverse transcription was performed from 2 μg of total RNA using oligo-dT and MMLV HP reverse transcriptase (Epicentre), according to the manufacturer’s instructions. Quantitative RT–PCR was performed with SYBR Green dye using an Mx3000PTM instrument (Stratagene). PCR reactions were performed in triplicate and the relative amount of cDNA was calculated by the comparative CT method using the 18S ribosomal or actin RNA sequences as a control. LC3B (Novus Biologicals NB100-2220) was used for IF at a 1:200 dilution. Secondary anti-rabbit–GFP antibody (Invitrogen A21206) was used at 1:200. For western blot ATG5 (Novus Biologicals NB110-53818), ATG7 (Sigma A2856), β-actin (Sigma A5441), LC3B (Novus Biologicals NB600-1384), RFP (Rockland 600-401-379), and secondary HRP conjugated anti-rabbit (Thermo-Fisher, 31460) and anti-mouse (Thermo-Fisher 31430) antibodies were used, as described14. For IHC analysis, αSMA (Dako M0851) was used at 1:500 followed by anti-mouse–HRP secondary antibody (Vector labs PK6101). shRNA vectors were obtained from the RNA Interference Screening Facility of Dana-Farber Cancer Institute. The sequences and/or RNAi Consortium clone IDs for each shRNA are as follows: shGFP: GCAAGCTGACCCTGAAGTTCAT (Addgene plasmid #30323); shATG5 #1: TRCN0000150645 (sequence: GATTCATGGAATTGAGCCAAT); shATG5 #2: TRCN0000150940 (sequence: GCAGAACCATACTATTTGCTT); shATG7 #1: TRCN0000007584 (sequence: GCCTGCTGAGGAGCTCTCCAT); shATG7 #2: TRCN0000007587 (sequence: CCCAGCTATTGGAACACTGTA); shGPT1 #1: TRCN0000034979 (sequence: GCAGTTCCACTCATTCAAGAA); shGPT1 #2: TRCN0000034983 (sequence: CTCATTCAAGAAGGTGCTCAT); shGPT2 #1: TRCN0000035024 (sequence: CGGCATTTCTACGATCCTGAA); shGPT2 #2: TRCN0000035025 (sequence: CCATCAAATGGCTCCAGACAT). Mouse shATG5: TRCN0000099430 (sequence: GCCAAGTATCTGTCTATGATA); mouse shATG7 TRCN0000092163 (sequence: CCAGCTCTGAACTCAATAATA). Sequences for qPCR primers are as follows: αSMA_Fw, GTGTTGCCCCTGAAGAGCAT, αSMA_Rv: GCTGGGACATTGAAAGTCTCA, Desmin_Fw: TCGGCTCTAAGGGCTCCTC, Desmin_Rv: CGTGGTCAGAAACTCCTGGTT, GPT1_Fw: GTGCGGAGAGTGGAGTACG, GPT1_Rv: GATGACCTCGGTGAAAGGCT, GPT2_Fw: CATGGACATTGTCGTGAACC, GPT2_Rv: TTACCCAGGACCGACTCCTT. Mitochondrial stress test (Seahorse 101706-100) and glycolysis stress test (Seahorse 102194-100) kits were purchased from Seahorse Bioscience. NAD+/NADH kit was purchased from Biovision (Biovision K337-100) and used according to the manufacturer’s instructions. Statistical analysis was done using GraphPad PRISM software. No statistical methods were used to predetermine sample size. When comparing multiple groups with more than one changing variable (for example, experiments where cells were treated with different shRNAs and with different conditioned media) a two-way ANOVA test was performed. For experiments where we analysed one variable for multiple conditions, a one-way ANOVA was performed. In both cases, ANOVA analyses were followed by Tukey’s post hoc tests to allow multiple group comparisons. Survival curve statistical analysis was performed using the log-rank (Mantel–Cox) test. When comparing two groups to each other, a Student’s t-test (unpaired, 2-tailed) was performed. Groups were considered significantly different when P < 0.05. The relevant calculated P values are reported in Supplementary Information, where detailed statistical information for each experiment can also be found. Tumours were identified and dimensions and volume were measured as previously described using high-resolution ultrasound (Vevo 770)29. Briefly, mice were anaesthetized using 3% isoflurane, and abdominal fur was removed using fine clippers and depilatory cream. Pre-warmed sterile saline (100–200 μl) was administered via intraperitoneal injection. Ultrasound gel was applied over the abdominal area and the ultrasound transducer was used to identify abdominal landmark organs (liver/spleen) followed by the pancreas and the tumour. Once identified, the transducer was transferred to the 3D motor stage and a 3D scan was performed for measurement of tumour dimensions and volume. Tumour volumes were contoured as described29. To determine cell viability in starved conditions, cells were plated in complete medium at 50% confluency. Once the cells were attached, medium was replaced with serum-free DMEM. 48 h later, cells were trypsinized, re-suspended in their own medium, diluted in trypan blue (Thermo-scientific 15250061) and counted using a haematocytometer. The percentage of dead cells was determined by trypan blue incorporation. Xenograft studies were performed as described previously14. Briefly, 2 × 105 8988T or MiaPaCa2 cells were either injected alone or co-injected into the flanks of nude female mice at 6 weeks of age (Taconic ncrnu-f) with 1 × 106 hPSCs previously infected with shGFP, shATG5 or shATG7 shRNAs under protocol 10-055. Tumour take was monitored visually and by palpation bi-weekly. Tumour diameter and volume were calculated based on caliper measurements of tumour length and height using the formula tumour volume = (length × width2)/2. Animals were considered to have a tumour when the maximal tumour diameter was over 2 mm. For syngeneic orthotopic injections, black6 female mice at 12 weeks of age (Taconic B6NTac), pre-conditioned with doxycycline diet and kept in doxycycline regimen for the duration of the experiment, were injected in the pancreas with 1 × 105 iKRAS mPDAC cells isolated from a pure black6 PDAC GEMM (KrasG12D, P53 L/+)15 either alone or co-injected with 5 × 105 mPSCs that were previously infected with shGFP, shATG5 or shATG7 shRNAs (or mPSC–shGFP was used alone as a negative control). Briefly, an incision was made on the flank, above the spleen. The spleen was identified and gently pulled out through the incision to expose the pancreas. 10 μl of cell suspension containing 20% of Matrigel (BD-Biosciences 354234) was injected in the tail of the pancreas using a Hamilton syringe that was held in place for 30 s to allow Matrigel polymerization. The spleen and pancreas were carefully re-introduced in the animal and the peritoneum sutured. The wound was clipped with surgical staples and the animals were allowed to recover for 1 week until the beginning of weekly ultra-sound monitoring of tumour take and progression. Human PDAC orthotopic injections were performed in a similar way, by injecting 5 × 105 MiaPaCa2 and/or 1 × 106 hPSC #1 infected with shGFP, shATG5 or shATG7 shRNAs into the tail of the pancreas of nude female mice (Taconic ncrnu-f) at 8 weeks of age. Animals were considered as tumour-positive when a mass detected in the pancreas reached a volume of at least 1 mm3 as calculated by 3D ultrasound. All animal studies were not blinded or randomized. Studies were performed under DFCI IACUC protocol # 10-055, where the maximal tumour size allowed is less than 2 cm.

Discover hidden collaborations