Göttingen, Germany
Göttingen, Germany

Time filter

Source Type

Hammer C.,Max Planck Institute for Experimental Medicine | Stepniak B.,Max Planck Institute for Experimental Medicine | Schneider A.,University of Gottingen | Schneider A.,Research Center Nanoscale Microscopy and Molecular Physiology of the Brain | And 26 more authors.
Molecular Psychiatry | Year: 2013

In 2007, a multifaceted syndrome, associated with anti-NMDA receptor autoantibodies (NMDAR-AB) of immunoglobulin-G isotype, has been described, which variably consists of psychosis, epilepsy, cognitive decline and extrapyramidal symptoms. Prevalence and significance of NMDAR-AB in complex neuropsychiatric disease versus health, however, have remained unclear. We tested sera of 2817 subjects (1325 healthy, 1081 schizophrenic, 263 Parkinson and 148 affective-disorder subjects) for presence of NMDAR-AB, conducted a genome-wide genetic association study, comparing AB carriers versus non-carriers, and assessed their influenza AB status. For mechanistic insight and documentation of AB functionality, in vivo experiments involving mice with deficient blood-brain barrier (ApoE-/-) and in vitro endocytosis assays in primary cortical neurons were performed. In 10.5% of subjects, NMDAR-AB (NR1 subunit) of any immunoglobulin isotype were detected, with no difference in seroprevalence, titer or in vitro functionality between patients and healthy controls. Administration of extracted human serum to mice influenced basal and MK-801-induced activity in the open field only in ApoE-/- mice injected with NMDAR-AB-positive serum but not in respective controls. Seropositive schizophrenic patients with a history of neurotrauma or birth complications, indicating an at least temporarily compromised blood-brain barrier, had more neurological abnormalities than seronegative patients with comparable history. A common genetic variant (rs524991, P=6.15E-08) as well as past influenza A (P=0.024) or B (P=0.006) infection were identified as predisposing factors for NMDAR-AB seropositivity. The >10% overall seroprevalence of NMDAR-AB of both healthy individuals and patients is unexpectedly high. Clinical significance, however, apparently depends on association with past or present perturbations of blood-brain barrier function.Molecular Psychiatry advance online publication, 3 September 2013; doi:10.1038/mp.2013.110.


Hammer C.,Max Planck Institute for Experimental Medicine | Stepniak B.,Max Planck Institute for Experimental Medicine | Schneider A.,German Center for Neurodegenerative Diseases | Papiol S.,Max Planck Institute for Experimental Medicine | And 20 more authors.
Molecular psychiatry | Year: 2014

In 2007, a multifaceted syndrome, associated with anti-NMDA receptor autoantibodies (NMDAR-AB) of immunoglobulin-G isotype, has been described, which variably consists of psychosis, epilepsy, cognitive decline and extrapyramidal symptoms. Prevalence and significance of NMDAR-AB in complex neuropsychiatric disease versus health, however, have remained unclear. We tested sera of 2817 subjects (1325 healthy, 1081 schizophrenic, 263 Parkinson and 148 affective-disorder subjects) for presence of NMDAR-AB, conducted a genome-wide genetic association study, comparing AB carriers versus non-carriers, and assessed their influenza AB status. For mechanistic insight and documentation of AB functionality, in vivo experiments involving mice with deficient blood-brain barrier (ApoE(-/-)) and in vitro endocytosis assays in primary cortical neurons were performed. In 10.5% of subjects, NMDAR-AB (NR1 subunit) of any immunoglobulin isotype were detected, with no difference in seroprevalence, titer or in vitro functionality between patients and healthy controls. Administration of extracted human serum to mice influenced basal and MK-801-induced activity in the open field only in ApoE(-/-) mice injected with NMDAR-AB-positive serum but not in respective controls. Seropositive schizophrenic patients with a history of neurotrauma or birth complications, indicating an at least temporarily compromised blood-brain barrier, had more neurological abnormalities than seronegative patients with comparable history. A common genetic variant (rs524991, P=6.15E-08) as well as past influenza A (P=0.024) or B (P=0.006) infection were identified as predisposing factors for NMDAR-AB seropositivity. The >10% overall seroprevalence of NMDAR-AB of both healthy individuals and patients is unexpectedly high. Clinical significance, however, apparently depends on association with past or present perturbations of blood-brain barrier function.


Hahn P.,Helmholtz Center for Infection Research | Wegener I.,Helmholtz Center for Infection Research | Burrells A.,Roslin Institute | Bose J.,Helmholtz Center for Infection Research | And 7 more authors.
PLoS ONE | Year: 2010

Background: Methylation of residues in histone tails is part of a network that regulates gene expression. JmjC domain containing proteins catalyze the oxidative removal of methyl groups on histone lysine residues. Here, we report studies to test the involvement of Jumonji domain-containing protein 6 (Jmjd6) in histone lysine demethylation. Jmjd6 has recently been shown to hydroxylate RNA splicing factors and is known to be essential for the differentiation of multiple tissues and cells during embryogenesis. However, there have been conflicting reports as to whether Jmjd6 is a histone-modifying enzyme. Methodology/Principal Findings: Immunolocalization studies reveal that Jmjd6 is distributed throughout the nucleoplasm outside of regions containing heterochromatic DNA, with occasional localization in nucleoli. During mitosis, Jmjd6 is excluded from the nucleus and reappears in the telophase of the cell cycle. Western blot analyses confirmed that Jmjd6 forms homo-multimers of different molecular weights in the nucleus and cytoplasm. A comparison of mono-, di-, and tri-methylation states of H3K4, H3K9, H3K27, H3K36, and H4K20 histone residues in wildtype and Jmjd6-knockout cells indicate that Jmjd6 is not involved in the demethylation of these histone lysine residues. This is further supported by overexpression of enzymatically active and inactive forms of Jmjd6 and subsequent analysis of histone methylation patterns by immunocytochemistry and western blot analysis. Finally, treatment of cells with RNase A and DNase I indicate that Jmjd6 may preferentially associate with RNA/RNA complexes and less likely with chromatin. Conclusions/Significance: Taken together, our results provide further evidence that Jmjd6 is unlikely to be involved in histone lysine demethylation. We confirmed that Jmjd6 forms multimers and showed that nuclear localization of the protein involves association with a nucleic acid matrix.


PubMed | Karolinska Institutet, Hungarian Academy of Sciences, University of Calgary, Stanford University and 9 more.
Type: | Journal: Nature neuroscience | Year: 2016

The hypothalamus contains the highest diversity of neurons in the brain. Many of these neurons can co-release neurotransmitters and neuropeptides in a use-dependent manner. Investigators have hitherto relied on candidate protein-based tools to correlate behavioral, endocrine and gender traits with hypothalamic neuron identity. Here we map neuronal identities in the hypothalamus by single-cell RNA sequencing. We distinguished 62 neuronal subtypes producing glutamatergic, dopaminergic or GABAergic markers for synaptic neurotransmission and harboring the ability to engage in task-dependent neurotransmitter switching. We identified dopamine neurons that uniquely coexpress the Onecut3 and Nmur2 genes, and placed these in the periventricular nucleus with many synaptic afferents arising from neuromedin S


No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Yeast strains are all based on the BY4741 laboratory strain28. Manipulations were performed using a standard PEG/LiAC transformation protocol29. All deletions were verified using primers from within the endogenous open reading frame. Primers for all genetic manipulations were planned either manually or using the Primers-4-Yeast web tool30. All strains, primers and plasmids used in this study28, 31, 32, 33, 34 are listed in Supplementary Table 4. SGA and microscopic screening were performed using an automated microscopy set-up as previously described11, 15, using the RoToR bench-top colony arrayer (Singer Instruments) and automated inverted fluorescent microscopic ScanR system (Olympus). Images were acquired using a 60× air lens with excitation at 490/20 nm and emission at 535/50 nm (GFP) or excitation at 575/35 nm and emission at 632/60 nm (RFP). After acquisition, images were manually reviewed using the ScanR analysis program. Manual microscopy was performed using by one of two apparatuses. (I) Olympus IX71 microscope controlled by the Delta Vision SoftWoRx 3.5.1 software. Images were acquired using a 60× oil lens and captured by PhoetometricsCoolsnap HQ camera with excitation at 490/20 nm and emission at 528/38 nm (GFP/YFP) or excitation at 555/28 nm and emission at 617/73 nm (mCherry/RFP). (II) VisiScope Confocal Cell Explorer system, composed of a Zeiss Yokogawa spinning disk scanning unit (CSU-W1) coupled with an inverted Olympus IX83 microscope. Images were acquired using a 60× oil lens and captured by a connected PCO-Edge sCMOS camera, controlled by VisView software, with wavelength of 488 nm (GFP) or 561 nm (mCherry/RFP). Images were transferred to Adobe Photoshop CS6 for slight adjustments to contrast and brightness. Lysates for immunoprecipitation were prepared from indicated strains in mid-logarithmic growth grown in YPD reach medium. Cells were harvested, washed in distilled water, and resuspended in lysis buffer (50 mM Tris HCl pH 7, 150 mM NaCl) supplemented with protease inhibitors (complete EDTA-free cocktail; Roche) and frozen in a drop-by-drop fashion in liquid nitrogen. Frozen cells were then pulverized in a ball mill (1 min at 30 Hz; Retsch) and thawed with nutation. Samples were thawed in 1 ml lysis buffer supplemented with protease inhibitors and 1% CHAPS (Sigma Aldrich) at 4 °C for 1 h. All samples were then clarified by centrifugation at 14,000g at 4 °C for 15 min. The remaining supernatant was added to GFP-trap (Chromotek) for 1 h followed by centrifugation at 1,000g at 4 °C for 3 min, and the supernatant was set aside as the flow through. Beads were washed three times with lysis buffer supplemented with protease inhibitors, and bound proteins were released from the beads by a 5-min incubation at 95 °C in sample buffer. The total protein lysate, the flow through and the immunoprecipitation (IP) fraction were analysed by western blotting. Yeast proteins were extracted by either NaOH or TCA protocol as previously described9, 35 and resolved on polyacrylamide gels, transferred to nitrocellulose membrane blots, and probed with primary rabbit/mouse antibodies against HA (BioLegend, 901502), GFP (Abcam ab290), RFP (Abcam ab62341), histone H3 (Abcam ab1791), actin (Abcam ab8224), Sec65 (kindly provided by P. Walter) or Sec61 (kindly provided by M. Seedorf). The membranes were then probed with a secondary goat-anti-rabbit/mouse antibody conjugated to IRDye800 or to IRDye680 (LI-COR Biosciences). Membranes were scanned for infrared signal using the Odyssey Imaging System. Images were transferred to Adobe Photoshop CS6 for slight adjustments to contrast and brightness. Newly synthesized yeast proteins were radioactively labelled in vivo by a 7–10 min pulse with [35S]methionine at either 30 °C or 37 °C. Labelling was stopped by adding to the cells ice-cold TCA to a final concentration of 10%. Cells were then lysed and proteins were immunoprecipitated as previously described36 with antibodies against RFP (Abcam, ab62341), HA (BioLegend, 901502), Kar2 (kindly provided by P. Walter) or CPY (Abcam, ab113685). Protease inhibitors (complete EDTA-free cocktail; Roche) were used throughout the extraction and immunoprecipitation process. Immunoprecipitated samples were resolved on polyacrylamide gels, which were then exposed to Phosphor Screen (GE Life Sciences) and scanned by phosphorimager. Translocation efficiency was calculated as . The statistical significance of differences was measured using two-tailed student t-test with unequal variance, as indicated in the figure legends. For the Tetp-repression experiments, doxycycline (Sigma-Aldrich) was added to the overnight culture and to the back-dilution medium at a final concentration of 15 μg/ml. The ribosomal subunits RPL16a/b were conjugated to AVI-tag (biotin acceptor peptide), and Sec63 was conjugated to BirA (biotin ligase), allowing the specific biotinylation and streptavidin pull-down of ribosomes in close physical proximity to the ER membrane. By comparing the ribosomal footprints obtained from the total ribosome fraction and the streptavidin-pulled fraction, we measured ER-localized translation enrichment. Biotin induction was carried out at mid-logarithmic growth phase in the presence of cycloheximide, which was added to the medium 2 min before the addition of biotin, at a final concentration of 100 μg/ml. To induce biotinylation, d-biotin was added to the medium to a final concentration of 10 nM and biotinylation was allowed to proceed for 2 min at the same temperature as growth. Cells were harvested by filtration onto 0.45 μm pore size nitrocellulose filters (Whatman), scraped from the membrane, and immediately submerged in liquid nitrogen. The following steps of monosome isolation, streptavidin pulldown of biotinylated ribosomes, and library generation were done as previously described25. Sequencing reads were demultiplexed and stripped of 3′ cloning adapters using in-house scripts. Reads were mapped sequentially to Bowtie indices composed of rRNAs, tRNAs, and finally all chromosomes using Bowtie 1.1.0. Only uniquely-mapped, zero-mismatch reads from the final genomic alignment were used for subsequent analyses. These alignments were assigned a specific P-site nucleotide using a 15-nt offset from the 3′ end of reads. Gene-level enrichments were computed by taking the log ratio of biotinylated footprint density (reads per million) within a gene coding sequence (CDS) over the corresponding density of matched input ribosome-profiling experiment. Yeast genes were excluded from all analysis if they met any of the following criteria: had fewer than 100 CDS-mapping footprints in the input sample of a particular experiment; were annotated as ‘dubious’ in the SGD database; mapped to the mitochondrial chromosome. Additionally, regions in which a CDS overlapped another same-strand CDS were excluded from enrichment calculations. TMD positions were predicted using the Phobius algorithm. TMD classification was divided based on the start site of the first predicted TMD: N-terminal TMDs start in the first 95 amino acids of the protein; downstream TMDs start after the first 95 amino acids of the protein. Genes that were dependent on SND components were identified by comparing the Sec63-BirA ER enrichment in a wild-type strain (yJW1784) with that in a Δsnd strain (yJW1811, yJW1812, or yJW1813) as previously described25. Briefly, log enrichments were separately normalized by subtracting the mean enrichment and dividing by the standard deviation of enrichments for the corresponding experiment. Genes were then binned by the minimum number of sequencing counts in either wild-type or Δsnd input sample, and the difference between normalized enrichments was compared within each bin. Enriched genes were defined as those genes whose Δsnd log enrichments were greater than 0.3 and whose enrichments increased in the Δsnd sample by at least two standard deviations compared to other genes in that bin. Depleted genes were defined as those genes whose wild type log enrichments were greater than 0.3 and whose enrichments decreased in the Δsnd sample by at least two standard deviations compared to other genes in that bin. Significant depletion of 10–23%, 9–42% and 14–45% was observed in Δsnd1, Δsnd2 and Δsnd3, respectively. Including or excluding SS-bearing proteins had no effect on this trend. Mitochondrial proteins were excluded from the analysis. Lysates for immunoprecipitations were prepared from yeast that expressed GFP-tagged SND genes or a constitutively expressed GFP-negative control, in mid-logarithmic growth grown in YPD reach medium. Cells were harvested, washed in distilled water, and resuspended in lysis buffer (50 mM Tris HCl pH 7, 150 mM NaCl) supplemented with protease inhibitors (complete EDTA-free cocktail; Roche) and frozen in a drop-by-drop fashion in liquid nitrogen. Frozen cells were then pulverized in a ball mill (1 min at 30 Hz; Retsch) and thawed with nutation. Samples were thawed in 1 ml lysis buffer supplemented with protease inhibitors and 1% digitonin (Sigma Aldrich) at 4 °C for 1 h. All samples were then clarified by centrifugation at 14,000g at 4 °C for 15 min. The remaining supernatant was added to GFP-trap (Chromotek) for 1 h followed by three washes with lysis buffer supplemented with protease inhibitors and 1% digitonin. Bound proteins were released from the beads by a 5-min acidic treatment (0.2 M glycine pH 2.5), which was neutralized with 1 M Tris pH 9.4. The eluted proteins were digested with 0.4 μg sequencing grade trypsin for 2 h in the presence of 100 μl of 2 M urea, 50 mM Tris HCl pH 7.5 and 1 mM DTT. The resulting peptides were acidified with trifluoroacetic acid (TFA) and purified on C18 StageTips. LC–MS/MS analysis was performed on an EASY-nLC1000 UHPLC (Thermo Scientific) coupled to a Q-Exactive mass spectrometer (Thermo Scientific). Peptides were loaded onto the column with buffer A (0.5% acetic acid) and separated on a 50-cm PepMap column (75 μm i.d., 2 μm beads; Dionex) using a 4-h gradient of 5–30% buffer B (80% acetonitrile, 0.5% acetic acid). Interactors were extracted by comparing the protein intensities to a GFP control. Yeast microsomes were extracted from the ADHp-SND2–GFP/SND3–HA strain as described37. In brief, spheroplasts of yeast were lysed by dounce homogenization (25 strokes) in lysis buffer (0.1 M sorbitol, 20 mM HEPES pH 7.4, 50 mM potassium acetate, 2 mM EDTA, 1 mM DTT, 1 mM PMSF) at 4 °C. The lysates were centrifuged at 1,000g and the resulting supernatant at 27,000g for 10 min at 4 °C. The crude membrane pellet was re-suspended in lysis buffer and layered onto a discontinuous sucrose density gradient consisting of 1.2 and 1.5 M sucrose. Following centrifugation at 100,000g for 60 min at 4 °C, the membranes at the 1.2–1.5 M sucrose interface were collected and washed twice in lysis buffer. The membrane pellets were re-suspended in membrane storage buffer (50 mM NaCl, 0.32 M sucrose, 20 mM HEPES pH 7.4, 2 mM EDTA containing protease inhibitors) and the protein concentration determined by a standard Bradford assay. Microsomes were solubilized in ComplexioLyte 48 buffer (1 mg/ml, Logopharm) for 30 min at 4 °C38. Solubilized extracts were centrifuged at 100,000g for 30 min at 4 °C, supplemented with glycerol (5%) and coomassie G-250 (0.3%) and loaded on a 3.5–15% linear native polyacrylamide gel. The BN-PAGE gel was prepared as described39. The gel buffer contained 25 mM imidazole and 500 mM 6-aminohexanoic acid. The cathode chamber was first filled with cathode buffer B (50 mM Tricine, 7.5 mM imidazole and 0.02% coomassie) and subsequently replaced by cathode buffer B/10 (containing 0.002% coomassie) after the gel running front had covered a third of the desired distance of electrophoresis. The anode chamber was filled with 25 mM imidazole pH 7.0. A high-molecular-weight calibration kit for native electrophoresis from GE Healthcare was used as a standard. For 2D BN-PAGE, the excised lanes were equilibrated in 2D-dissociation buffer (60 mM Tris/HCl pH 6.8, 10% glycerol, 2% SDS, 5% v/v β-mercaptoethanol, 6 M urea) before separation on the second dimension by SDS–PAGE. After electro-blotting, the nitrocellulose membrane was detected with the indicated antibodies. The HEK293 cell line used was obtained from DSMZ (no. ACC 305). DSMZ supplied verification of authentication of the cells, tested by DSMZ via short tandem repeat loci (STR profile). The cell line is routinely tested for mycoplasma contamination. This cell line was chosen as it is routinely used for fractionation experiments. Rough microsomes from human cells were prepared as described40. Briefly, 30 × 106 HEK293 cells were harvested and washed once with PBS and twice with buffer 1 (50 mM HEPES/KOH pH 7.5; 0.25 M sucrose; 50 mM KOAc; 6 mM MgOAc; 4 mM PMSF; 1 mM EDTA; 1 mM DTT; 0.1 mg/ml cycloheximide; 0.3 U/ml RNAsin (Promega); protease inhibitor cocktail). After homogenization in buffer 1 using a glass/Teflon homogenizer, the suspension was centrifuged at 1,000g for 10 min. The supernatant was centrifuged at 10,000g for 10 min. The new supernatant was layered onto 0.6 M sucrose in buffer 2 (50 mM HEPES/KOH pH 7.5, 0.6 M sucrose, 100 mM KOAc, 5 mM MgOAc, 4 mM DTT, 0.1 mg/ml cycloheximide, 40 U/ml RNAsin) and centrifuged at 230,000g for 90 min. The resulting membrane pellet was previously shown to comprise rough ER. Here, it was resuspended in buffer 2 and adjusted to 2.3 M sucrose, which was overlaid with 1.9 and 0 M sucrose, respectively, in buffer 2. After flotation at 100,000g for 18 h, the interphase between 0 and 1.9 M sucrose, two fractions of the remaining supernatant, and the pellet were collected. After centrifugation of the interphase at 100,000g for 1 h, the membrane pellet corresponded to purified rough ER. All steps after the first washing step were carried out on ice. Western blot analyses employed antibodies against β-actin (Sigma), CAML (Synaptic Systems SA7679), or rabbit antibodies that were raised against the depicted proteins: the C-terminal peptide of hSnd2 (KRQRRQERRQMKRL) plus an N-terminal cysteine; or an internal peptide of SRα (KKFEDSEKAKKPVR) plus a C-terminal cysteine, cross-linked to KLH. The SRα and β-actin antibodies were visualized using ECL Plex goat-anti-rabbit IgG-Cy5-conjugate or ECL Plex goat-anti-mouse IgG-Cy3-conjugate (GE Healthcare) and the Typhoon-Trio imaging system (GE Healthcare) in combination with Image Quant TL software 7.0 (GE Healthcare). The hSnd2 and CAML antibodies were visualized using secondary peroxidase (POD)-coupled anti-rabbit antibody (Sigma) plus ECL (GE Healthcare) and the Fusion SL luminescence-imaging system (Peqlab) in combination with Image Quant TL software 7.0. Ribosome-profiling data have been deposited in Gene Expression Omnibus (GEO) under accession number GSE85686. Gel source images can be found in Supplementary Fig. 1. Other data that support the findings of this study are available from the authors on reasonable request.


No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Male heterozygous ythdf2+/− fish in the *AB background were custom made by ZGeneBio. TALEN mutagenesis was performed to mutate ythdf2 (Ensembl ENSDART00000127043) with L1 recognition sequence 5′-GGACCTGGCCAATCCCC-3′, R1 recognition sequence 5′-GGCACAGTAATGCCACC-3′, and spacer sequence 5′-TCCCAATTCAGGAATG-3′. Purchased fish were outcrossed to in-house wild-type *AB fish. Embryos were obtained from natural crosses, were raised under standard conditions, and were staged according to literature26. Embryos were reared at 28.5 °C and all experiments and observations were performed as close to this temperature as possible. Fish lines were maintained in accordance with AAALAC research guidelines, under a protocol approved by the University of Chicago IACUC (Institutional Animal Care & Use Committee). The open reading frame of zebrafish ythdf2 was purchased from Open Biosystems (clone 5601005) and subcloned into a pCS2+ vector using restriction enzyme sites of BamHI and XhoI. The resulting vector was linearized by HindIII and used as a template for ythdf2 probe preparation. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription using standard reagents and methods. In situ hybridization protocol was followed essentially as previously reported27. All experiments were repeated at least once from biological samples. Control and ythdf2 morpholinos (5′-TGGCTGACATTTCTCACTCCCCGGT-3′) were obtained from Gene Tools (Oregon). 3 ng of either control or gene-specific morpholino was injected into *AB wild-type embryos at the one-cell stage. GFP and mCherry were subcloned into pCS2+ vectors and linearized by NotI. GFP-m6A, GFP-A, and mCherry-capped and polyadenylated mRNA was generated by in vitro transcription using mMessage mMachine SP6 kit (Thermo Fisher) and Poly(A) tailing kit (Thermo Fisher) according to the manufacturer’s protocol. Products were purified with the MEGAclear transcription clean-up kit (Thermo Fisher) and used for injections directly. For GFP-m6A, we spiked 6 nmol m6ATP into the 100 nmol ATP supplied in the transcription reaction, in order to ensure that less than 0.3% of GFP mRNAs are without m6A on average. (GFP mRNA is 942 nt; each mRNA has 1.89 m6A on average.) 35 pg of either GFP reporter mRNA and 10 pg of mCherry mRNA were injected together in 1.25 nl into embryos at the one-cell stage. ythdf2 mRNA containing the ythdf2 5′ UTR and a 3′ Flag tag, which was used to rescue the mutant phenotype and validate the knockdown efficiency of ythdf2 MO, was constructed in pCS2+ vector (forward primer: 5′-CGTACGGATCCTGTCTGATCTGCAGCTGTAG-3′; reverse primer: 5′-CGATGCTCGAGTTACTTGTCATCGTCGTCCTTGTAATCTATTCCAGATGGAGCAAGGC-3′) and prepared in the same way as mCherry mRNAs. Antibodies used in this study are listed below in the format of name (application; catalogue number; supplier): mouse anti-Flag HRP conjugate (Western; A5892; Sigma), rabbit anti-m6A (m6A-seq and m6A-CLIP-seq; 202003; Synaptic Systems), rabbit anti-histone H3 (IF; ab5176; Abcam), and anti-rabbit Alexa Fluor 488 (IF; ab150077; Abcam). All images were observed with a Leica MZFLIII microscope and captured with a Nikon D5000 digital camera using Camera Control Pro (Nikon) software. For fluorescent microscopy, standard ET-GFP and TXR LP filters (Leica) were used. For bright field imaging of live embryos, only saturation was adjusted and was adjusted identically for all images. For fluorescent imaging of live embryos, no image processing was performed. For fluorescent imaging of fixed embryos, contrast and exposure were adjusted for all to obtain the lowest amount of background while preserving the morphology of all visible nuclei. All experiments were repeated at least once from biological samples. To compare the total amount of DNA in wild-type and mutant embryos at different time points during the MZT, 10 embryos per time point per condition were dechorionated and pipetted into standard DNA lysis buffer. The number of embryos in each tube was counted twice to ensure uniformity. Proteinase K was added to 100 μg ml−1 and the embryos were incubated for 4 h at ~55 °C with occasional mixing. Proteinase K was inactivated by a 10-min incubation at 95 °C and the DNA was then phenol-chloroform-extracted, ethanol-precipitated, and resuspended in 100 μl Tris (pH 8.5) and 1 mM EDTA using standard procedures. Double-stranded DNA content was measured with NanoDrop. Three biological replicates (comprised of the offspring of three different fish mating pairs of the appropriate genotype) were measured for each time point for both the control and experimental samples. Biological replicates were averaged together to determine the average DNA amount per time point per genotype and to compute standard errors of the mean. All DNA values were normalized to that of wild-type embryos at 2.5 h.p.f. Embryos were collected into standard 2× protein sample buffer with added β-mercaptoethanol and protease inhibitors and immediately put on ice for a few minutes. The embryo mixtures were carefully but thoroughly pipetted up and down to dissolve and homogenize the embryos, and then samples were heated at 95 °C for 5 min and frozen at −80 °C. Before use, samples were again heated for 5 min and then centrifuged at 12,000 r.p.m. to remove debris. Supernatants were loaded into a 10-well, 1.5 mm Novex 4–20% Tris-Glycine Mini Protein Gel (Thermo Fisher) with 6 embryos per well. The gel was transferred onto a nitrocellulose membrane using iBlot2 gel transfer system (Thermo Fisher) set to P3 for 7 min with iBlot2 mini gel transfer stacks (Thermo Fisher). Membranes were blocked in 5% BSA, 0.05% Tween-20 in PBS for 1 h, and then incubated overnight at 4 °C with anti-Flag–HRP conjugate (Sigma) diluted 1:10,000 in 3% BSA. Proteins were visualized using the SuperSignal West Pico Luminol/Enhancer solution (Thermo Fisher) in FluorChem M system (ProteinSimple). mRNA isolation for LC-MS/MS: total RNA was isolated from zebrafish embryos with TRIzol reagent (Invitrogen) and Direct-zol RNA MiniPrep kit (Zymo). mRNA was extracted by removal of contaminating rRNA using RiboMinus Eukaryote Kit v2 (Thermo Fisher) for two rounds. Total RNA isolation for RT–qPCR: we followed the instruction of Direct-zol RNA MiniPrep kit (Zymo) with DNase I digestion step. Total RNA was eluted with RNase-free water and used for RT–qPCR directly. 100–200 ng of mRNA was digested by nuclease P1 (2 U) in 25 μl of buffer containing 10 mM of NH OAc (pH 5.3) at 42 °C for 2 h, followed by the addition of NH HCO (1 M, 3 μl, freshly made) and alkaline phosphatase (0.5 U). After an additional incubation at 37 °C for 2 h, the sample was diluted to 50 μl and filtered (0.22 μm pore size, 4 mm diameter, Millipore), and 5 μl of the solution was injected into LC-MS/MS. Nucleosides were separated by reverse-phase ultra-performance liquid chromatography on a C18 column with on-line mass spectrometry detection using an Agilent 6410 QQQ triple-quadrupole LC mass spectrometer in positive electrospray ionization mode. The nucleosides were quantified by using the nucleoside to base ion mass transitions of 282 to 150 (m6A), and 268 to 136 (A). Quantification was performed in comparison with the standard curve obtained from pure nucleoside standards running on the same batch of samples. The ratio of m6A to A was calculated on the basis of the calibrated concentrations9. Total RNA was isolated from fish embryos collected at different time points with TRIzol reagent and Direct-zol RNA MiniPrep kit. For each time point, ~200 embryos were collected to ensure RNA yield and that samples were representative. mRNA was further purified using RiboMinus Eukaryote Kit v2. RNA fragmentation was performed by sonication at 10 ng μl−1 in 100 μl RNase-free water using Bioruptor Pico (Diagenode) with 30 s on/off for 30 cycles. m6A-immunoprecipitation (IP) and library preparation were performed according to the previous protocol17. Sequencing was carried out on Illumina HiSeq 2000 according to the manufacturer’s instructions. Additional high-throughput sequencing of zebrafish methylome was carried out using a modified m6A-seq method, which is similar to previously reported methods19, 20. Briefly, total RNA and mRNA were purified as previously described for m6A-seq. Purified mRNA (1 μg) was mixed with 2.5 μg of affinity purified anti-m6A polyclonal antibody (Synaptic Systems) in IPP buffer (150 mM NaCl, 0.1% NP-40, 10 mM Tris-HCl (pH 7.4)) and incubated for 2 h at 4 °C. The mixture was subjected to UV-crosslinking in a clear flat-bottom 96-well plate (Nalgene) on ice at 254 nm with 0.15 J for 3 times. The mixture was then digested with 1 U μl−1 RNase T1 at 22 °C for 6 min followed by quenching on ice. Next, the mixture was immunoprecipitated by incubation with protein-A beads (Invitrogen) at 4 °C for 1 h. After extensive washing, the mixture was digested again with 10 U μl−1 RNase T1 at 22 °C for 6 min followed by quenching on ice. After additional washing and on-bead end-repair, the bound RNA fragments were eluted from the beads by proteinase K digestion twice at 55 °C for 20 and 10 min, respectively. The eluate was further purified using RNA clean and concentrator kit (Zymo Research). RNA was used for library generation with NEBNext multiplex small RNA library prep kit (NEB). Sequencing was carried out on Illumina HiSeq 2000 according to the manufacturer’s instructions. Total RNA was isolated from wild-type and mutant fish embryos collected at different time points with TRIzol reagent and Direct-zol RNA MiniPrep kit. For each time points, ~20 embryos were collected to ensure RNA yield and that samples were representative. mRNA was further purified using RiboMinus Eukaryote Kit v2. RNA fragmentation was performed using Bioruptor Pico as described previously. Fragmented mRNA was used for library construction using TruSeq stranded mRNA library prep kit (Illumina) according to manufacturer’s protocol. Sequencing was carried out on Illumina HiSeq 2000 according to the manufacturer’s instructions. All samples were sequenced by Illumina Hiseq 2000 with single-end 50-bp read length. The deep-sequencing data were mapped to zebrafish genome version 10 (GRCz10). (1) For m6A-seq, reads were aligned to the reference genome (danRer10) using Tophat v2.0.14 (ref. 28) with parameter -g 1–library-type = fr-firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene had multiple isoforms. Aligned reads were extended to 150 bp (average fragments size) and converted from genome-based coordinates to isoform-based coordinates, in order to eliminate the interference from introns in peak calling. The peak-calling method was modified from published work18. To call m6A peaks, the longest isoform of each gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform, windows with read counts less than 1 out of 20 of the top window in both m6A-IP and input sample were excluded. For each gene, the read counts in each window were normalized by the median count of all windows of that gene. A Fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the FDR < 0.01 and log (enrichment score) ≥ 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak (or window): (a) reads count of the IP samples in the current peak or window, (b) median read counts of the IP sample in all 100 bp windows on the current mRNA, (c) reads count of the input sample in the current peak/window, and (d) median read counts of the input sample in all 100 bp windows on the current mRNA. The enrichment score of each window was calculated as (a × d)/(b × c). (2) For m6A-CLIP-seq, after removing the adaptor sequence, the reads were mapped to the reference genome (danRer10) using Bowtie2. Peak calling method was similar to the previous study19. Briefly, mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation was used to identify the binding regions. The motif analysis was performed using HOMER29 to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. (3) For mRNA-seq, reads were mapped with Tophat and Cufflink (v2.2.1) was used to calculate the FPKM of each gene to represent their mRNA expression level30. (4) For fish gene group categorization, we used the input mRNA-seq data from m6A-seq. FPKM of all genes were first normalized to the highest value of five time points, with only genes with FPKM >1 analysed. Then Cluster3.0 (ref. 31) was used to divide all genes into six clusters, with the parameters: adjust data – normalize genes; k-means cluster – organize genes, 6 clusters, 100 number; k-means – Euclidean distance. The result clustered file with clustered number was merged with original FPKM values, imported and processed in R, and plotted in Excel. (5) For GO analysis, the list of target genes was first uploaded into DAVID32, 33 and analysed with functional annotation clustering. The resulting file was downloaded and extracted with GO terms and corresponding P values. The new list (contains GO terms with P < 0.01) was imported into REVIGO34 and visualized with the interactive graph, which was used as the final output figures. Methylated genes (at each time point) were defined as overlapped gene targets between m6A-seq and m6A-CLIP-seq. Ythdf2-regulated genes were defined as overlapped gene targets between the lists of the top 20% upregulated genes in both ythdf2 knockout and MO-injected samples. The most stringent Ythdf2 target genes at 4 h.p.f. (135) were defined in the main text, as overlapped genes of methylated genes at 4 h.p.f. (3,237) and Ythdf2-regulated genes at 4 h.p.f. (876). All the raw data and processed files have been deposited in the Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) and accessible under GSE79213. A summary of sequenced samples and processed FPKM data are included as Supplementary Data 2. One set of representative experiment results from at least two independent experiments were shown where applicable. Quantitative reverse-transcription PCR (RT–qPCR) was performed to assess the relative abundance of mRNA. All RNA templates used for RT–qPCR were pre-treated with on-column DNase I digestion in the purification step. RT–qPCR primers were designed to span exon-exon junctions to only detect mature mRNA. RT–qPCR was performed by using SuperScript III one-step RT–PCR system (Thermo Fisher) with 50–100 ng total RNA template. Actb1 was used as an internal control as it showed relative invariant expression during the studied time period according to pilot RT–qPCR data. P values were determined using two-sided Student’s t-test for two samples with equal variance. *P < 0.05; **P < 0.01; ***P < 0.001. The sequences of primers used in this study are listed below: actb1: forward 5′-CGAGCAGGAGATGGGAACC-3′, reverse 5′-CAACGGAAACGCTCATTGC-3′; buc: forward 5′-CAAGTTACTGGACCTCAGGATC-3′, reverse 5′-GGCAGTAGGTAAATTCGGTCTC-3′; zgc:162879: forward 5′-TCCTGAATGTCCGTGAATGG-3′, reverse 5′-CCCTCAGATCCACCTTGTTC-3′; mylipa: forward 5′-CCAAACCAGACAACCATCAAC-3′, reverse 5′-CACTCCACCCCATAATGCTC-3′; vps26a: forward 5′-AAATGACAGGAATAGGGCCG-3′, reverse 5′-CAGCCAGGAAAAGTCGGATAG-3′; tdrd1: forward 5′-TACTTCAACACCCGACACTG-3′, reverse 5′-TCACAAGCAGGAGAACCAAC-3′; setdb1a: forward 5′-CTTCTCAACCCAAAACACTGC-3′, reverse 5′-CTATCTGAAGAGACGGGTGAAAC-3′; mtus1a: forward 5′-TGGAGTATTACAAGGCTCAGTG-3′, reverse 5′-TTATGACCACAGCGACAGC-3′; GFP: forward 5′-TGACATTCTCACCACCGTGT-3′, reverse 5′-AGTCGTCCACACCCTTCATC-3′. High-throughput sequencing data that support the findings of this study have been deposited at GEO under the accession number GSE79213. All the other data generated or analysed during this study are included in the article and Supplementary Information.


No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. The deletion allele Ime4∆22-3 was obtained from imprecise excision of the transposon P{SUPor-P}KrT95D and mapped by primers 5933 F1 (CTCGCTCTATTTCTCTTCAGCACTCG) and 5933 R9 (CCTCCGCAACGATCACATCGCAATCGAG). To obtain a viable line of Ime4null, the genetic background was cleaned by out-crossing to Df(3R)Exel6197. Flight ability was scored as the number of flies capable of flying out of a Petri dish within 30 s for groups of 15–20 flies for indicated genotypes. Viability was calculated from the numbers of females compared to males of the correct genotype and statistical significance was determined by a χ2 test (GraphPad Prism). Unfertilized eggs were generated by expressing sex-peptide in virgin females as described30. The genomic rescue construct was retrieved by recombineering (Genebridges) from BAC clone CH321-79E18 by first cloning homology arms with SpeI and Acc65I into pUC3GLA separated by an EcoRV site for linearization (CTCCGCCGCCGGAACCGCCGCCTCCTCCGCCACTTTGCAGGTTGAGCGGACCGCCTCCA GGGCCGCTGCCGCCGGTGCCGCTGATATCCCAGCATGGTAGCTGCGGCCACTCCTAGTC CCGCCTTTAACCACAGCTTGGGGTCCTCCGTCATCAGGCCGAATTGCCTCGAG). An HA-tag was then fused to the end of the ORF using two PCR amplicons and SacI and XhoI restriction sites. This construct was the inserted into PBac{y+-attB-3B}VK00002 at 76A as described31. The Ime4 UAS construct was generated by cloning the ORF from fly cDNA into a modified pUAST with primers Adh dMT-A70 F1 EI (GCAGAATTCGAGATCtAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCATGGCAGATGC GTGGGACATAAAATCAC) and dMT-A70 HA R1 Spe (GGTAACTAGTCTTTTGTATTCCATTGATCGACGCCGCATTGG) by adding a translation initiation site from the Adh gene and two copies of an HA tag to the end of the ORF. This construct was then also inserted into PBac{y+-attB-3B}VK00002 at 76A. For transient transfection in S2 cells, YT52B-1 and CG6422 ORFs were amplified from fly cDNA by a combination of nested and fusion PCR incorporating a translation initiation site from the Adh gene using primers CG6422 Adh F1 (GCCTGCTAAAGCAAAAAAGAAGTCACCACATGTCAGGCGTGGATCAGATGAAAATACCAG), pACT Adh CG6422 F1 (CCAGAGACCCCGGATCCAGATATCAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCAC), CG6422 Adh R1, (GATTCCTGCGAACAGGTCCCGTGGGCGAAAC) and CG6422 3′ F1 (CCCACGGGACCTGTTCGCAGGAATCTAG), CG6422 3′ R1 (CATTGCTTCGCATTTTATCCTTGTCCGTGTCCTTAAAGCGCACGCCGATTTTAATTTG), pACT CG6422 3×HA R1 (GTGGAGATCCATGGTGGCGGAGCTCGAGGAATATTCATTGCTTCGCATTTTATCCTTGTC) for CG6422 and primers YT521 Adh F1, (AAGCAAAAAAGAAGTCACATGCCAAGAGCAGCCCGTAAACAAACGCTGCCGATGCGCGAG), pACT Adh YT521 F1 (CCAGAGACCCCGGATCCAGATATCAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACATGCC), YT521 Adh R1 (TGCCATCCGGGCGAATCCTGCAAATTTACCACTCTCGTTGACCGAGAAAATGAGCAGGAC) and YT521 3′ F1(GCAGGATTCGCCCGGATGGCAGCCCCCTCAC), pact YT521 R1 (GGTGGAGATCCATGGTGGCGGAGCTCGAGCGCCTGTTGTCCCGATAGCTTCGCTG) for YT521-B, and cloned into a modified pACT using Gibson Assembly (NEB) also incorporating HA epitope tags at the C terminus. Constructs were verified by Sanger sequencing. The Sxl-HA expression vector was a gift from N. Perrimon32. The YT521-B UAS construct was generated by sub-cloning the ORF from the pACT vector into a modified pUAST with primers YT521 Adh F1 (AAGCAAAAAAGAAGTCACATGCCAAGAGCAGCCCGTAAACAAACGCTGCCGATGCGCGAG), YT521 Adh F2 (TAGGGAATTGGGAATTCGAGATCTAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACATGCC) and YT521 3′ R1 (GGGCACGTCGTAGGGGTACAGACTAGTCTCGAGGCGCCTGTTGTCCCGATAGCTTCGCTG) by adding a translation initiation site from the Adh gene and two copies of an HA tag to the end of the ORF. This construct was then also inserted into PBac{y+-attB-3B}VK00002 at 76A. Essential parts of all DNA constructs were sequence-verified. S2 cells (ATCC) were cultured in Insect Express medium (Lonza) with 10% heat-inactivated FBS and 1% penicillin/streptomycin. The Drosophila S2 cell line was verified to be male by analysing Sxl alternative splicing using species-specific primers Sxl F2 (ATGTACGGCAACAATAATCCGGGTAG) and Sxl R2 (CATTGTAACCACGACGCGACGATG) to confirm species and gender (Extended Data Fig. 8). Transient transfections were done with Mirus Reagent (Bioline) according to the manufacturer’s instruction and cells were assayed 48 h after transfection for protein expression or RNA binding of expressed proteins. To adhere S2 cells to a solid support, Concanavalin A (Sigma) coated glass slides (in 0.5 mg ml−1) were added 1 day before transfection, and cells were stained 48 h after transfection with antibodies as described. Transfections and follow up experiments were repeated at least once. Total RNA was extracted using Tri-reagent (SIGMA) and reverse transcription was done with Superscript II (Invitrogen) according to the manufacturer’s instructions using an oligodT17V primer. PCR for Sxl, tra, msl2 and ewg was done for 30 cycles with 1 μl of cDNA with primers Sxl F2, Sxl R2 or Sxl NP R3 (GAGAATGGGACATCCCAAATCCACG), Sxl M F1 (GCCCAGAAAGAAGCAGCCACCATTATCAC), Sxl M R1 (GCGTTTCGTTGGCGAGGAGACCATGGG), Tra FOR (GGATGCCGACAGCAGTGGAAC), Tra REV (GATCTGGAGCGAGTGCGTCTG), Msl-2 F1 (CACTGCGGTCACACTGGCTTCGCTCAG), Msl-2 R1 (CTCCTGGGCTAGTTACCTGCAATTCCTC), Ewg 4F and Ewg 5R and quantified with ImageQuant (BioRad)22. Experiments included at least three biological replicates. For qPCR, reverse transcription was carried out on input and pull-down samples spiked with yeast RNA using ProtoScript II reverse transcriptase and random nanomers (NEB). Quantitative PCR was carried out using 2× SensiMix Plus SYBR Low ROX master mix (Quantace) using normalizer primers ACT1 F1 (TTACGTCGCCTTGGACTTCG) and ACT1 R1 (TACCGGCAGATTCCAAACCC) and for Sxl, Sxl ZB F1 (CACCACAATGGCAGCAGTAG) and Sxl ZB R1 (GGGGTTGCTGTTTGTTGAGT). Samples were run in triplicate for technical repeats and duplicate for biological repeats. Relative enrichment levels were determined by comparison with yeast ACT1, using the method33. For immunoprecipitations of Sxl RNA bound to Sxl or YTH proteins, S2 cells were fixed in PBS containing 1% formaldehyde for 15 min, quenched in 100 mM glycine and disrupted in IP-Buffer (150 mM NaCl, 50 mM Tris–HCL, pH 7.5, 1% NP-40, 5% glycerol). After IP with anti-HA beads (Sigma) for 2 h in the presence of Complete Protein Inhibitor (Roche) and 40 U RNase inhibitors (Roche), IP precipitates were processed for Sxl RT–PCR using gene-specifc RT primer SP NP2 (CATTCCGGATGGCAGAGAATGGGAC) and PCR primers Sxl NP intF (GAGGGTCAGTCTAAGTTATATTCG) and Sxl NP R3 as described31. Western blots were done as described using rat anti-HA (1:50, clone 3F10, Roche) and HRP-coupled secondary goat anti-rat antibodies (Molecular Probes)34. All experiments were repeated at least once from biological samples. Poly(A) mRNA from at least two rounds of oligo dT selection was prepared according to the manufacturer (Promega). For each sample, 10–50 ng of mRNA was digested with 1 μl of Ribonuclease T1 (1,000 U μl−1; Fermentas) in a final volume of 10 μl in polynucleotide kinase buffer (PNK, NEB) for 1 h at 37 °C. The 5′ end of the T1-digested mRNA fragments were then labelled using 10 U T4 PNK (NEB) and 1 μl [γ-32P]-ATP (6,000 Ci mmol−1; Perkin-Elmer). The labelled RNA was precipitated, resuspended in 10 μl of 50 mM sodium acetate buffer (pH 5.5), and digested with P1 nuclease (Sigma-Aldrich) for 1 h at 37 °C. Two microlitres of each sample was loaded on cellulose TLC plates (20 × 20 cm; Fluka) and run in a solvent system of isobutyric acid: 0.5 M NH OH (5:3, v/v), as the first dimension, and isopropanol:HCl:water (70:15:15, v/v/v), as the second dimension. TLCs were repeated from biological replicates. The identification of the nucleotide spots was carried out using m6A-containing synthetic RNA. Quantification of 32P was done by scintillation counting (Packard Tri-Carb 2300TR). For the quantification of spot intensities on TLCs or gels, a storage phosphor screen (K-Screen; Kodak) and Molecular Imager FX in combination with QuantityOne software (BioRad) were used. For immunoprecipitation of m6A mRNA, poly(A) mRNA was digested with RNase T1 and 5′ labelled. The volume was then increased to 500 μl with IP buffer (150 mM NaCl, 50 mM Tris–HCL, pH 7.5, 0.05% NP-40). IPs were then done with 2 μl of affinity-purified polyclonal rabbit m6A antibody (Synaptic Systems) and protein A/G beads (SantaCruz). Whole-fly extracts were prepared from 20–30 adult Drosophila previously frozen in liquid N and ground into fine powder in liquid N . Cells were then lysed in 0.5 ml lysis buffer (0.3 M NaCl, 15 mM MgCl , 15 mM Tris-HCl pH 7.5, cycloheximide 100 μg ml−1, heparin (sodium salt) 1 mg ml−1, 1% Triton X-100). Lysates were loaded on 12 ml sucrose gradients and spun for 2 h at 38,000 r.p.m. at 4 °C. After the gradient centrifugation 1-ml fractions were collected and precipitated in equal volume of isopropanol. After several washes with 80% ethanol the samples were resuspended in water and processed. Experiments were done in duplicate. Drosophila nuclear extracts were prepared from Kc cells as described35. Templates for in vitro transcripts were amplified from genomic DNA using the primers listed below and in vitro transcribed with T7 polymerase in the presence of [α-32P]-ATP. DNA templates and free nucleotides were removed by DNase I digestion and Probequant G-50 spin columns (GE Healthcare), respectively. Markers were generated by using in vitro transcripts with or without m6ATP (Jena Bioscience), which were then digested with RNase T1, kinased with PNK in the presence of [γ-32P]-ATP. After phenol extraction and ethanol precipitation, transcripts were digested to single nucleotides with P1 nuclease as above. For in vitro methylation, transcripts (0.5–1 × 106 c.p.m.) were incubated for 45 min at 27 °C in 10 μl containing 20 mM potassium glutamate, 2 mM MgCl , 1 mM DTT, 1 mM ATP, 0.5 mM S-adenosylmethionine disulfate tosylate (Abcam), 7.5% PEG 8000, 20 U RNase protector (Roche) and 40% nuclear extract. After phenol extraction and ethanol precipitation, transcripts were digested to single nucleotides with P1 nuclease as above, and then separated on cellulose F TLC plates (Merck) in 70% ethanol, previously soaked in 0.4 M MgSO and dried36. In vitro methylation assays were done from biological replicates at least in duplicates. Primers to amplify parts of the Sxl alternatively spliced intron from genomic DNA for in vitro transcription with T7 polymerase were Sxl A T7 F (GGAGCTAATACGACTCACTATAGGGAGAGGATATGTACGGCAACAATAATCCGGGTAG) and Sxl A R (CGCAGACGACGATCAGCTGATTCAAAGTGAAAG), Sxl B T7 F (GGAGCTAATACGACTCACTATAGGGAGAGCGCTCGCATTTATCCCACAGTCGCAC) and Sxl B R (GGGTGCCCTCTGTGGCTGCTCTGTTTAC), Sxl C T7 F (GGAGCTAATACGACTCACTATAGGGGTCGTATAATTTATGGCACATTATTCAG) and Sxl C R (GGGAGTTTTGGTTCTTGTTTATGAGTTGGGTG), Sxl D T7 F (GGAGCTAATACGACTCACTATAGGGAGAAAACTTCCAGCCCACACAACACACAC) and Sxl D R (GCATATCATATTCGGTTCATACATTTAGGTCTAAG), Sxl E T7 F (GGAGCTAATACGACTCACTATAGGGAGAGGGGAAGCAGCTCGTTGTAAAATAC) and Sxl E R (GATGTGACGATTTTGCAGTTTCTCGACG), Sxl F T7 F (GGAGCTAATACGACTCACTATAGGGAGAGGGGGATCGTTTTGAGGGTCAGTCTAAG) and Sxl NP2, Sxl C T7 F and Sxl C1 R (GTAGTTTTGCTCGGCATTTTATGACCTTGAGC), Sxl C2 F (GGAGCTAATACGACTCACTATAGGGAGACTCTCATTCTCTATATCCCTGTGCTGACC) and Sxl C2 R (CTAATTTCGTGAGCTTGATTTCATTTTGCACAG), Sxl C3 F (GGAGCTAATACGACTCACTATAGGGAGACTGTGCAAAATGAAATCAAGCTCACGAAATTAG) and Sxl C R, Sxl E T7 F and Sxl E1 R (AAAAAAATCAAAAAAATAATCACTTTTGGCACTTTTTCATCAC), Sxl E2 F (GGAGCTAATACGACTCACTATAGGGAGATGAAAAAGTGCCAAAAGTGATTATTTTTTTG), Sxl E2 R (AAAAGCATGATGTATTTTTTTTTTTTTGTACTTTCGAATCACCG), Sxl E3 F (GGAGCTAATACGACTCACTATAGGGAGACGGTGATTCGAAAGTACAAAAAAAAAAAAATAC) and Sxl E R, Sxl C4 F (GAGCTAATACGACTCACTATAGGGAGAAATACTAAAACATCAAACCGCAAGCAGAGCAGC) and Sxl C4 R (GAGTGCCACTTCAAAATCTCAGATATGC), Sxl C5 F (CTAATACGACTCACTATAGGGAGACTCTTTTTTTTTTTCTTTTTTTTACTGTGCAAAATG) and Sxl C5 R (AAAAAAATATGCAAAAAAAAAAAGGTAGGGCACAAAGTTCTCAATTAC), Sxl C6 F (GAGCTAATACGACTCACTATAGGGAGACTGTGCAAAATGAAATCAAGCTCACGAAATTAG) and Sxl C6 R (CAATTTCACTATATGTACGAAAACAAAAGTGAG), Sxl E4 F (GGAGCTAATACGACTCACTATAGGGAGAACCAAAATTCGACGTGGGAAGAAAC) and Sxl E4 R (TAATCACTTTTGGCACTTTTTCATCACATTAAC), Sxl E5 F (GGCTAATACGACTCACTATAGGGAGATTTTTTTGATTTTTTTAAAGTGAAAATGTGCTCC) and Sxl E5 R (CACCGAAAAAAAATAAAAAAAAATAATCATGGGACTATACTAG), Sxl E6 F (GGCTAATACGACTCACTATAGGGAGACTTAAGTGCCAATATTTAAAGTGAAACCAATTG) and Sxl E6 R (CCCCCAGTTATATTCAACCGTGAAATTCTGC). Total RNA was extracted from 15 pulverized head/thoraces previously flash-frozen in liquid nitrogen, using TRIzol reagent from white (w) control and w;Ime4∆22-3 females that have been outcrossed for several generations to w;Df(3R)Exel6197 to equilibrate genetic background. Total RNA was treated with DNase I (Ambion) and stranded libraries for Illumina sequencing were prepared after poly(A) selection from total RNA (1 μg) with the TruSeq stranded mRNA kit (Illumina) using random primers for reverse transcription according to the manufacturer’s instructions. Pooled indexed libraries were sequenced on an Illumina HiSeq2500 to yield 40–46 million paired-end 100 bp reads, and in a second experiment 14–19 million single-end 125-bp reads for three controls and mutants each. After demultiplexing, sequence reads were aligned to the Drosophila genome (dmel-r6.02) using Tophat2.0.6 (ref. 37). Differential gene expression was determined by Cufflinks-Cuffdiff and the FDR-correction for multiple tests to raw P values with q < 0.05 considered significant38. alternative splicing was analysed by SPANKI39 and validated for selected genes based on length differences detectable on agarose gels. Illumina sequencing, differential gene expression and alternative splicing analysis was done by Fasteris (Switzerland). For dosage compensation analysis, differential expression analysis of X-linked genes versus autosomal genes in Ime4null mutant was done by filtering Cuffdiff data by a P value expression difference significance of P < 0.05, which corresponds to a false discovery rate of 0.167 to detect subtle differences in expression consistent with dosage compensation. Visualization of sequence reads on gene models and splice junctions reads in Sashimi plots was done using Integrated Genome Viewer40. For validation of alternative splicing by RT–PCR as described above, the following primers were used: Gprk2 F1 (CCAACCAGCCGAAACTCACAGTGAAGC) and Gprk2 R1 (CAGGGTCTCGGTTTCAGACACAGGCGTC), fl(2)d F1 (GCAGCAAACGAGAAATCAGCTCGCAGCGCAG) and fl(2)d R1 (CACATAGTCCTGGAATTCTTGCTCCTTG), A2bp1 F3 (CTGTGGGGCTCAGGGGCATTTTTCCTTCCTC) and A2bp1 R1 (CTCCTCTCCCGTGTGTCTTGCCACTCAAC), cv.-c F1 (GGGTTTCCACCTCGACCGGGAAAAGTCG) and cv.-c R1 (GCGTTTGCGGTTGCTGCTCGCGAAGAGAG), CG8312 F1 (GCGCGTGGCCTCCTTCTTATCGGCAGTC) and CG8312 R1 (GCGTGGCCACTATAAAGTCCACCTCATC), Chas F2 (CCGATTCGATTCGATTCGATCCTCTCTTC) and Chas R1 (GTCGGTGTCCTCGGTGGTGTTGGTGGAG). GO enrichment analysis was done with FlyMine. For the analysis of uATGs, an R script was used to count the uATGs in 5′ UTRs in all ENSEMBL isoforms of those genes which are differentially spliced in Ime4 mutants, that were then compared to the mean number of ATGs in all Drosophila ENSEMBL 5′ UTRs using a t-test. Gene expression data were obtained from flybase. >pattern <-”atg” # the pattern to look for >dict <-PDict(pattern, max.mismatch = 0)#make a dictionary of the pattern to look for >seq <- DNAStringSet(unlist(fasta_file)[1:638])#make the DNAstringset from the DNAsequences that is, all 638 UTRs related to the 156 genes identified in spanki >result <-vcountPDict(dict,seq)#count the pattern in each of the sequences >pattern <-”atg” # the pattern to look for >dict <-PDict(pattern, max.mismatch = 0)#make a dictionary of the pattern to look for >seq <- DNAStringSet(unlist(fasta_file)[1:29822])#make the DNAstringset from the DNAsequences that is, all UTRs >result <-vcountPDict(dict,seq)#count the pattern in each of the sequences Ime4 or YT521-B were expressed in salivary glands with C155-GAL4 from a UAS transgene. Larvae were grown at 18 °C under non-crowded conditions. Salivary glands were dissected in PBS containing 4% formaldehyde and 1% Triton X-100, and fixed for 5 min, and then for another 2 min in 50% acetic acid containing 4% formaldehyde, before placing them in lactoacetic acid (lactic acid:water:acetic acid, 1:2:3). Chromosomes were then spread under a siliconized cover slip and the cover slip removed after freezing. Chromosome were blocked in PBT containing 0.2% BSA and 5% goat serum and sequentially incubated with primary antibodies (mouse anti-PolII H5, 1:1000, Abcam, or rabbit anti-histone H4, 1:200, Santa-Cruz, and rat anti-HA monoclonal antibody 3F10, 1:50, Roche) followed by incubation with Alexa488- and/or Alexa647-coupled secondary antibodies (Molecular Probes) including DAPI (1 μg ml−1, Sigma). RNase A treatment (4 and 200 μg ml−1) was done before fixation for 5 min. Ovaries were analysed as previously described41. The YTH domain (amino acids 207–423) was PCR-amplified with oligos YTHdom F1 (CAGGGGCCCCTGTCGACTAGTCCCGGGAATGGTGGCGGCAACGGCCG) and R1 (CACGATGAATTGCGGCCGCTCTAGATTACTTGTAGATCACGTGTATACCTTTTTCTCGC) and cloned with Gibson assembly (NEB) into a modified pGEX expression vector to express a GST-tagged fusion protein. The YTH domain was cleaved while GST was bound to beads using Precession protease. Electrophoretic mobility shift assays and UV cross-linking assays were performed as described35, 42. Quantification was done using ImageQuant (BioRad) by measuring free RNA substrate to calculate bound RNA from input. All binding assays were done at least in triplicates. RNA-seq data that support the findings of this study have been deposited at GEO under the accession number GSE79000, combining the single-end (GSE78999) and paired-end (GSE78992) experiments. All other data generated or analysed during this study are included in this published article and its Supplementary Information.


News Article | April 20, 2016
Site: www.nature.com

Mouse TT2 ES cells were cultured on gelatin coating plates with recombinant LIF. ES cells were grown in DMEM supplemented with 15% fetal bovine serum, 1% non-essential amino acids, 2 mM l-glutamine, 1,000 units of mLIF (EMD Millipore), 0.1 mM β-mercaptoethanol (Sigma) and antibiotics. A doxycycline (Dox)-inducible Cas9–eGFP ES cell line was established with TT2 ESC. Guide RNA oligos (5′-accgAGTGCCTCTGGCATCCCGGG-3′, 5′-aaacCCCGGGATGCCAGAGGCACT-3′) were annealed and cloned into a pLKO.1-based construct (Addgene: 52628). Guide RNA virus was made in 293FT cells and infected inducible Cas9 ES cells. ES cells were first selected with Puromycin (1 μg ml−1) for two days, and Dox (0.5 μg ml−1) was added to induce Cas9–eGFP expression for 24 h. ES cells were then seeded at low density to obtain single-derived colonies. Then, 72 ES cell colonies were randomly picked up and screened by PCR-enzyme digestion that is illustrated in Extended Data Fig. 3a. PCR screening primers flanking guide RNA sequence were designed as following: 5′-AGGCAGATTTCTGAGTTCAAGG-3′ and 5′-TTTAGTCATGTGCTTGTCCAGG-3′. PCR products were digested by XmaI overnight at 37 degrees and separated on 2% agarose gel. A total of 8 mutants from which PCR products show resistance to XmaI digestion were subjected to DNA sequencing. Clones that harbour deletion and coding frame shift (premature termination mutation) were expanded and used in this study. Human Alkbh–Flag DNA sequence was inserted into pCW lenti-virus based vector (puromycin or hygromycin resistance). The amino acid of D233 was mutated to A by QuickChange Site-Directed Mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, number 200521, Agilent) according to the manual. For Alkbh1 rescue experiment, wild-type and D233A mutated Alkbh1 constructs were introduced to Alkbh1 knockout ES cells, pCW-Hygromycin was chosen as control. After infections, the cells were selected with hygromycin at 200 μg ml−1 for 4 days, and then the cells were expanded to isolate genomic DNA for N6-mA dot blotting or other tests. The 293FT cells were transfected with pCW-hAlkbh1 and pCW-hAlkbh1-D233A mutant plasmids along with package plasmids of pMD2.G and pSPAX2. Culture medium was changed 10 h after transfection. The viruses were collected and concentrated 24 and 48 h after transfecction according to manufacturer’s instructions (Lenti-X Concentrator, Clontech). To establish stable expression of hAlkbh1 and hAlkbh1-D233A cell lines, 293FT cells were infected the corresponding virus, and then select with puromycin at 1 μg ml−1 for 4 days. The stable cell lines of hAlkbh1-293FT and D233A-293FT were expanded to purify the proteins according to the previous reported method with some modifications34. Briefly, M2 Flag antibody was added to the nuclear extract and incubated overnight, and then Dynabeads M-280 (sheep anti-mouse IgG, from Life Technology) was added to the above solution and incubated for 3–4 h. Subsequently, the beads were separated from the solution and washed clean with washing buffer34. Finally, the beads were eluted with 3× Flag peptides, followed by standard chromatography purification to 95% purity. Proteins were analysed by mass spectrometry. Demethylation assays were performed in 50 μl volume, which contained 50 pmol of DNA oligos and 500 ng recombinant ALKBH1 (or D233A mutant) protein. The reaction mixture also consisted of 50  μM KCl, 1mM MgCl , 50 μM HEPES (pH = 7.0), 2 mM ascorbic acid, 1 mM-KG, and 1 mM (NH ) Fe(SO ) .6H O. Reactions were performed at 37 degrees for 1 h and then stopped with EDTA followed by heating at 95 degrees for 5 min. Then the reaction product was subjected to dot blotting. Substrate sequences are listed in Supplementary Table 2. First, DNA samples were denatured at 95 degrees for 5 min, cooled down on ice, neutralized with 10% vol of 6.6 M ammonium acetate. Samples were spotted on the membrane (Amersham Hybond-N+, GE) and air dry for 5 min, then UV-crosslink (2× auto-crosslink, 1800 UV Stratalinker, STRATAGENE). Membranes were blocked in blocking buffer (5% milk, 1% BSA, PBST) for 2 h at room temperature, incubated with 6mA antibodies (202-003, Synaptic Systems, 1:1000) overnight at 4 degrees. After 5 washes, membranes were incubated with HRP linked secondary anti-rabbit IgG antibody (1:5,000, Cell Signaling 7074S) for 30 min at room temperature. Signals were detected with ECL Plus Western Blotting Reagent Pack (GE Healthcare). DNA samples were purified by standard N-ChIP protocol. 5 μg anti-H2A.X antibodies were used per 10 million cells. DNA (250 ng) from ChIP pull-down were converted to SMRTbell templates using the PacBio RS DNA Template Preparation Kit 1.0 (PacBio catalogue number 100-259-100) following manufacturer’s instructions. Control samples were amplified by PCR (18 cycles). In brief, samples were end-repaired and ligated to blunt adaptors. Exonuclease incubation was carried out in order to remove all unligated adapters. Samples were extracted twice (0.6× AMPure beads) and the final ‘SMRTbells’ were eluted in 10 μl embryoid bodies. Final quantification was carried out on an Agilent 2100 Bioanalyzer with 1 μl of library. The amount of primer and polymerase required for the binding reaction was determined using the SMRTbell concentration (ng μl−1) and insert size previously determined using the manufacturer-provided calculator. Primers were annealed and polymerase was bound using the DNA/Polymerase Binding Kit P4 (PacBio catalogue number 100-236-500) and sequenced using DNA sequencing reagent 2.0 (PacBio catalogue number 100-216-400). Sequencing was performed on PacBio RS II sequencer using SMRT Cell 8Pac V3 (PacBio catalogue number 100-171-800). In all sequencing runs, a 240 min movie was captured for each SMRT Cell loaded with a single binding complex. Base modification was detected using SMRT Analysis 2.3.0 (Pacific Biosciences), which uses previously published methods for identifying modified bases based on inter-pulse duration ratios in the sequencing data35. All calculations used the Mus musculus mm10 genome as a reference. For the detection of modified bases in individual samples, the RS_Modification_Detection.1 protocol was used with the default parameters. Modifications were only called if the computed modification QV was better than 20, corresponding to P < 0.01 (versus in silico model, Welch’s t-test). The in silico model considers the IPDs from the eight nucleotides 5′ through the three nucleotides 3′ of the site in question. Only the sites with a sequencing coverage higher than 25 fold were used for subsequent analyses. To assess the significance of the overlap between N6-mA sites by SMRT-ChIP and peaks from DIP-seq, intersection with DIP-seq peaks was analysed for each of the N6-mA site called by SMRT-ChIP. To assess if the overlap is higher than expected by random chance, a permutation based approach was used, in which we randomly shuffle the original mapping between “As” that meet coverage cutoff and their corresponding QV scores, and estimated the expected overlap by random chance. As preparation for PacBio RS II sequencing, these relatively short DNA fragments (200–1,000 base pairs on average) were made topologically circular, allowing each base to be read many times by a single sequencing polymerase. Thus, the coverage requirement for modification detection was achieved both by sequencing different fragments pulled down from the same genomic regions and by sequencing the same fragment with many passes. Of note, the SMRT-ChIP approach did not identify more N6-mA sites in Alkbh1 knockout cells than wild-type cells. Although the exact reason remain to be identified, our analysis showed that much fewer adenines are sequenced at a comparable coverage in Alkbh1 knockout cells than wild-type cells (Extended Data Fig. 5c and Extended Data Fig. 1b), presumably due to the difficulty of using native ChIP approach to isolate H2A.X-deposition regions from Alkbh1 knockout cells because of heterochromatinization. Genomic DNA from wild-type or knockout ES cells was purified with DNeasy kit (QIAGEN, 69504). For each sample, 5 μg DNA was sonicated to 200–500 bp with Bioruptor. Then, adaptors were ligated to genomic DNA fragments following the Illumina protocol. The ligated DNA fragments were denatured at 95 degree for 5 min. Then, the single-stranded DNA fragments were immunoprecipitated with 6 mA antibodies (5 μg for each reaction, 202-003, Synaptic Systems) overnight at 4 degrees. N6-Me-dA enriched DNA fragments were purified according to the Active Motif hMeDIP protocol. IP DNA and input DNA were PCR amplified with Illumina indexing primers. The same volume WT and KO DNA samples were subjected to multiplexed library construction and sequencing with Illumina HiSeq2000. After sequencing and filter, high quality raw reads were aligned to the mouse genome (UCSC, mm10) with bowtie (2.2.4, default)36. By default, bowtie searches for multiple alignments and only reports the best match; for repeat sequences, such as transposons, bowtie reports the best matched locus or random one from the best-matched loci. After alignment, N6-mA enriched regions were called with SICER (version 1.1, FDR <1.0 × 10−15, input DNA as control)37. Higher FDR cut-off could not further reduce N6-mA peak number. MACS2 was also used for peak calling, which generated similar results as SICER. Part of the data analysis was done by in-house customized scripts in R, Python or Perl. Genomic DNA samples from mouse fibroblast cells (where the endogenous N6-mA level is undetectable) were spiked with increasing amount of N6-mA-containing, or unmodified (control), oligonucleotides, and the N6-mA levels were determined by qPCR approach after DIP and library construction. Followed manufacture’s protocol (Active Motif 5mC MeDIP kit). The 5 mC data processed with MEDIPS in Bioconductor, and in-house scripts in R, Python or Perl. Native chromatin immunoprecipitation (N-ChIP) assay was performed as previously described. 10 million ES cells were used for each ChIP and massive parallel sequencing (ChIP-seq) experiment. Cell fractionation and chromatin pellet isolation were performed as described. Chromatin pellets were briefly digested with micrococcal nuclease (New England BioLabs) and the mononucleosomes were monitored by electrophoresis. Co-purified DNA molecules were isolated and quantified (100–200 ng for sequencing). Co-purified DNA and whole cell extraction (WCE) input genomic DNA were subject to library construction, cluster generation and next-generation sequencing (Illumina HiSeq 2000). The output sequencing reads were filtered and pre-analyzed with Illumina standard workflow. After filtration, the qualified tags (in fastq format) were aligned to the mouse genome (UCSC, mm10) with bowtie (2.2.4, default)36. Then, these aligned reads were used for peak calling with the SICER algorithm (input control was used as control in peak calling). H3K4Me1 and H3K27Ac ChIP-seq data were aligned to mouse genome (mm10) and peaks were called with SICER. H3K4Me1 and H3K27Ac enriched regions were defined as enhancers. Then, RSEG38 (mode 3) was to call the H3K27Ac differentiated regions. Decommissioned enhancers in KO cells are determined by H3K27Ac downregulation (compared to wild-type cells). Native ChIP-qPCR assay was used to validate H4K4Me3 at levels on gene promoters (Extended Data Fig. 8). All procedures were similar to what has been described in ChIP-seq experiments, except that the co-purified DNA molecules were diluted and subject to qPCR (histone H3K4Me3 antibodies: Abcam Ab8580). Real-time PCR was performed with SybrGreen Reagent (Qiagen, QuantiTect SYBR Green PCR Kit, Cat: 204143) and quantified by a CFX96 system (BioRAD, Inc.). RNA was extracted with miRNeasy kit (QIAGEN, 217004) and standard RNA protocol. The quality of RNA samples was measured using the Agilent Bioanalyzer. Then, RNA was prepared for sequencing using standard Illumina ‘TruSeq’ single-end stranded or ‘Pair-End’ mRNA-seq library preparation protocols. 50 bp of single-end and 100 bp of pair-end sequencing were performed on an Illumina HiSeq 2000 instrument at Yale Stem Cell Center Genomics Core. RNA-seq reads were aligned to mm9 with splicing sites library with Tophat39 (2.0.4, default parameters). The gene model and FPKM were obtained from Cufflink2. The differentially expressed genes were identified by Cuffdiff40 (2.0.0, default parameters). To make sure the normalization is appropriate, the data were also analysed with DESeq2 (default parameters), which generated similar results (Extended Data Fig. 4b). For transposons analysis, unique best alignment reads were used (alignment with bowtie (0.12.9), -m 1; or BWA) and calculated RPKM for each subfamily. For qPCR, the cDNA libraries were generated with First-strand synthesis kit (Invitrogen). Real-time PCR was performed with SybrGreen Reagent (Qiagen, QuantiTect SYBR Green PCR Kit, Cat: 204143) and quantified by a CFX96 system (BioRAD, Inc.). For Fig. 3d, the specific loci L1Md elements primers were designed and optimized based on ref. 27. For embryoid body differentiation experiment, feeder-free cultured ES cells were treated with 0.5% trypsin-EDTA free solution and resuspended with culture medium and counted. Then, cells were seeded at 200,000 cells per ml to Petri dishes with embryoid body differentiation medium (ESC medium without LIF and beta-ME). Medium was changed every 2 days. Histones were isolated in biological triplicate from wild-type and Alkbh1 knockout cells by acid-extraction and resolved/visualized by SDS–PAGE/Coomassie staining. The low molecular weight region of the gel corresponding to core histones was excised and de-stained. The excised gel region containing the histones was treated with d6-acetic anhydride to convert unmodified lysine resides to heavy acetylated lysines (45 Da mass addition) as reported in ref. 41. Following d6-acetic anhydride treatment, the gel region was subjected to in-gel trypsin digestion. Histone peptides were analysed with a Thermo Velos Orbitrap mass spectrometer coupled to a Waters nanoACQUITY LC system as detailed in ref. 42. Tandem mass spectrometric data was searched with Mascot for the following possible modifications: heavy lysine acetylation, lysine acetylation, lysine monomethylation, lysine dimethylation and lysine trimethylation. For each biological replicate, histone H2A was identified with 100% sequence coverage across K118/119 that revealed predominately no detectable lysine methylation DNA was digested with DNA Degradase Plus (Zymo Research) by following the manufacturer’s instructions with small modification. Briefly, the digestion reaction was carried out at 37 °C for 70 min in a 25 μl final volume containing 5 units of DNA Degradase Plus and 5 fMol of internal standard. Following digestion, reaction mixture was diluted to 110 μl and the digested DNA solution was filtered with a Pall NanoSep 3kDa filter (Port Washington, NY) at 8,000 r.p.m. for 15 min. After centrifugal filtration, the digested DNA solution was injected onto an Agilent 1200 HPLC fraction collection system equipped with a diode-array detector (Agilent Technologies, Santa Clara, CA). Analytes were separated by reversed-phase liquid chromatography using an Atlantis C T3 (150 × 4.6 mm, 3 μm) column. The column temperature was kept at 30 °C. For the purification of N6-mA, the mobile phases were water with 0.1% acetic acid (A) and acetonitrile with 0.1% acetic acid (B). The flow rate was 1.0 ml min−1 with a starting condition of 2% B, which was held for 5 min, followed by a linear gradient of 4% B at 20 min, 10% B at 30 min, followed by 6 min at 80% B, then re-equilibration at the starting conditions for 20 min. dA and 6-Me-dA eluted with retention times of 14.7 and 27.0 min, respectively. The amount of dA in samples was quantitated by the UV peak area (λ = 254 nm) at the corresponding retention time using a calibration curve ranging from 0.2 to 5 nMol dA on column. For the simultaneous purification of N3-Me-dC, N1-Me-dA, N3-Me-dA, N6-Me-dA and dA, the mobile phases were water with 5 mM ammonium acetate (A) and acetonitrile (B). The flow rate was 0.45 ml min−1 and the gradient elution program was set at following conditions: 0 min, 1% B; 2 min, 1% B; 40 min, 4% B; 60 min, 30% B; 65 min, 30% B; 65.5 min, 1% B, and 75 min, 1% B. N3-Me-dC, N1-Me-dA, N3-Me-dA, N6-Me-dA and dA eluted with retention times of 24.8, 25.0, 22.0, 60.2 and 54.2 min, respectively. The amount of dA in samples was quantitated by the UV peak area (λ = 254 nm) at the corresponding retention time using a calibration curve ranging from 0.9 to 7.2 nMol dA on the column. HPLC fractions containing target analyte were dried in a SpeedVac and reconstituted in 22 μl of D.I. water before LC-MS/MS analysis. LC-MS-MS analysis of N3-Me-dC, N1-Me-dA, N3-Me-dA and N6-Me-dA was performed on Ultra Performance Liquid Chromatography system from Waters Corporation (Milford, MA) coupled to TSQ Quantum Ultra triple-stage quadrupole mass spectrometer (Thermo Scientific, San Jose, CA). 20 μl of sample was introduced into mass spectrometry through a 100 mm × 2.1 mm HSS T3 column (Waters) at flow rate of 0.15 ml/min. Mobile phases were comprised of water with 0.1% formic acid (A) or acetonitrile (B). Elution gradient condition was set as following: 0 min, 1%B; 3 min, 1%B; 15 min, 7.5%B; 15.5 min, 1%B; 20 min, 1%B. Ionization was operated in positive mode and analytes were detected in selected reaction monitoring (SRM) mode. Specifically, 6-Me-dA and its internal standard were detected by monitoring transition ions of m/z = 266.1 to m/z = 150.1 and m/z = 271.1 to m/z = 155.1, respectively. Similarly, N3-Me-dC, N1-Me-dA and N3-Me-dA was detected by monitoring transition ions of m/z = 242.1 to m/z = 126.1, m/z = 266.1 to m/z = 150.1 and m/z = 266.1 to m/z = 150.1, respectively. Mass spectrometry conditions were set as following: source voltage, 3,000 V; temperature of ion transfer tube, 280 °C; skimmer offset, 0; scan speed, 75 ms; scan width, 0.7 m/z; Q1 and Q3 peak width, 0.7 m/z; collision energy, 17 eV; collision gas (argon), 1.5 arbitrary units. For quantification of N6-Me-dA, the linear calibration curves ranging from 1.5 to 750 fMol, were obtained using the ratio of integrated peak area of the analytical standard over that of the internal standard. The linear calibration curves for analysis of N3-Me-dC, N1-Me-dA and N3-Me-dA were obtained using integrated peak area of the analytical standard. N3-Me-dA is not commercial available and was prepared from the reaction between 3-methyladenine and deoxythymidine in the presence of nucleoside deoxyribosyltransferase II. The chemical identity of purified N3-Me-dA was confirmed by using an Agilent 1200 series Diode Array Detector (DAD) HPLC system coupled with Agilent quadrupole-time-of-flight (QTOF)-MS (Agilent Technologies, Santa Clara, CA). Electrospray ionization (ESI)-MS-MS spectrum of N3-Me-dA was obtained by in source fragmentation. One product ion was observed from MS/MS spectra of the protonated precursor ion of N3-Me-dA, resulting from the loss of the deoxyribosyl group. The accurate masses for parent and fragment ion are m/z = 266.1253 and m/z = 150.0774, with mass error 0.4 p.p.m. and 3.8 p.p.m., respectively. The method sensitivity for N3-Me-dC, N1-Me-dA, N3-Me-dA and N6-Me-dA was detected at 1.0 fmol, 1.6 fmol, 1.0 fmol and 1.6 fmol, respectively. In order to confirm the chemical identity of the N6-Me-dA isolated from HLPC purification, HPLC fractions containing N6-Me-dA was analysed by HPLC-QTOF-MS/MS. The chemical identity of N6-Me-dA in HPLC fractions was characterized on an Agilent 1200 series Diode Array Detector (DAD) HPLC system coupled with Agilent quadrupole-time-of-flight (QTOF)-MS (Agilent Technologies, Santa Clara, CA). HPLC separation was carried out on a C18 reverse phase column (Waters Atlantis T3, 3  μM, 150 mm × 2.1 mm) with a flow rate at 0.15 ml min−1 and mobile phase A (0.05% acetic acid in water) and B (acetonitrile). The gradient elution program was set at following conditions: 0 min, 1% B; 2 min, 1% B; 15 min, 30% B; 15.5 min, 1% B; and 25 min, 1% B. N6-Me-dA was eluted with retention times of 12.7 min. The electrospray ion source in positive mode with the following conditions were used: gas temperature, 200 °C; drying gas flow, 12 litres per min; nebulizer, 35 psi; Vcap, 4000 V; fragmentor, 175 V; skimmer, 67 V. Electrospray ionization (ESI)-MS-MS spectrum of N6-Me-dA isolated from genomic DNA was obtained by in source fragmentation. One product ion was observed from MS/MS spectra of the protonated precursor ion of N6-Me-dA, resulting from the loss of the deoxyribosyl group. The accurate masses for parent and fragment ion are m/z = 266.1245 and m/z = 150.0775, with mass error 3.0 p.p.m. and 3.1 p.p.m., respectively. The same MS/MS fragmentation spectra was obtained from analytical standard of N6-Me-dA. For in vitro demethylation assay, sample was treated with EDTA to remove Fe2+. The mixture was transferred to Amicon Ultra Centrifugal Filter (EMD Millipore Corporation, 10K MWCO), followed by spin at 11,000 r.p.m. and 4 °C for 14 min. The concentrated sample was wash three times by adding 500 μl DI-H2O, followed spin at 11,000 r.p.m. and 4 °C for 14 min. The washed sample was digested with DNA Degradase Plus (Zymo Research) by following manufacturer’s instruction with small modification. Briefly, the digestion reaction was carried out at 37 °C for 60 min in 60 μl final volume containing 0.17 units per μl of DNA Degradase Plus and 50 fmol of Internal Standard of N6-Me-dA. Following digestion, reaction mixture was filtered with a Pall NanoSep 3kDa filter (Port Washington, NY) at 10000g and room temperature for 10 min to remove enzyme. The LC-MS/MS conditions for the quantification of dA and N6-Me-dA were set the same as those for quantification of N6-Me-dA in in vivo samples. The linear calibration curves for quantification of dA and N6-Me-dA was obtained using the ratio of integrated peak area of the analytical standard over that of the internal standard of N6-Me-dA.


News Article | August 22, 2016
Site: www.nature.com

The study protocols were approved by University of California San Diego and Salk Institute IRB/ESCRO committees (protocols 141223ZF and 95-0001, respectively). Four TD individuals (ages 8–19 years) and five individuals with WS (ages 8–14 years; Extended Data Fig. 1a) were included in the analysis: four of the latter group had typical WS gene deletions and one (pWS88) had a partial deletion in the WS region. Informed consents were obtained from all participants or their parents as appropriate. Genetic diagnosis of WS was established using fluorescent in situ hybridization probes for elastin (ELN), a gene consistently associated with the deletion in the typical WS region1, 9. All of the participants with WS having confirmed genetic deletion exhibited the medical and clinical characteristics of the WS phenotype, including previously established cognitive, behavioural and physical features associated with the syndrome4. A diagnosis of WS was confirmed on the basis of the Diagnostic Score Sheet (DSS) for WS (American Academy of Paediatrics Committee on Genetics, 2001), with a particular focus on the cardiovascular abnormalities and the characteristic facial features associated with the ELN deletion. The scores for the participants were at the mean for WS (9) or higher, with the individual with partial deletion in the WS chromosomal region (pWS88) scoring lower than the individuals with typical WS deletion. Similarly, pWS88 reported fewer symptoms with connective tissue and growth, his cognitive scores were slightly higher than the typical individuals with WS, and he did not demonstrate the disparity between verbal and visual–spatial abilities typical of WS. However, pWS88 did display behavioural and developmental features consistent with WS, including developmental delay, over-friendliness and anxiousness. The participants were administered standard tests to quantify their non-verbal and verbal abilities, as well as versions of the WS cognitive and social profiles to capture the distinct pattern of strengths and weaknesses both within and across domains associated with the WS cognitive and social phenotype. Details of the tests and the measures tapping into the two profiles are presented in Extended Data Fig. 1. The WS cognitive profiles for the five participants with WS were constructed by calculating the log of predictive likelihood ratios under assumed normality for age-appropriate TD versus WS classifications on the basis of verbal and performance IQ (VIQ and PIQ), Beery Developmental Test of Visual-Motor Integration (VMI) and Peabody Picture Vocabulary Test (PPVT) standard scores, subject to availability. Predictive distributions were based on the published normative mean and s.d. for each of the tests employed, whereas for the WS classification the predictive distributions26 were determined using data from n = 81 (VIQ and PIQ), n = 56 (VMI) and n = 97 (PPVT) participants in a broader WS sample (described in Extended Data Fig. 1d). A tobit model was used to estimate parameters for individuals with WS on the VMI owing to the presence of floor effects. The WS social profiles for the five participants with WS were constructed using measures of social approach behaviour, emotionality/empathy and language use. Quantitative PCR was used to define the breakpoints of deleted regions in DNA isolated from iPSCs, or lymphoblast cell lines for participants with WS, with probes spanning from CALN1 to WBSCR16 and template DNA. Taqman expression assay probes detecting the WS region genes were designed and synthesized with sequences shown in Supplementary Table 11. RNase P (VIC) was used as control. Quantitative PCR was performed on the ABI PRISM 7900HT system and the results were analysed using SDS 3.2. We avoided invasive sample collection methods such as skin biopsy or blood withdrawal by taking advantage of the natural loss of deciduous teeth as a source of somatic cells. We chose to reprogram dental pulp cells (DPCs) because these cells develop from the same set of early progenitors that generate neurons. Furthermore, the neurons derived from iPSCs generated from DPCs express higher levels of forebrain genes compared with those generated from skin fibroblast-derived iPSCs27, serving the purpose of this study. Deciduous teeth were collected when they fell out and were shipped to our laboratory in DMEM 1× (Mediatech) with 4% Pen/Strep (Mediatech). Dental pulp was pulled out, washed in PBS with 4% Pen/Strep and incubated in 5% TrypLE (Gibco) for 15 min. Pulp was partly dissociated using needles and plated in culture medium (DMEM/F12 50:50, 15% FBS, 1%NEAA, 1% fungizone and 2% Pen/Strep). In 1–4 weeks, DPCs migrated out of the pulp and could be passaged and frozen as stock. DPCs in early passage (two to three) were reprogrammed using pMXs retroviruses expressing Yamanaka transcription factors (obtained from Addgene, Cambridge, Massachusetts)12. After 4 days, transduced DPCs were trypsinized, plated on mouse embryonic fibroblasts and cultured using human embryonic stem cell (hESC) medium. After manually picked and clonally expanded, feeder-free iPSCs were grown on matrigel-coated dishes (BD Bioscience, San Jose, California) with mTeSR1 (StemCell Technologies) or iDEAL28. All G-banding karyotyping analyses were performed by Molecular Diagnostics Service (San Diego, California) and Children’s Hospital Los Angeles (Los Angeles, California). Two hundred nanograms of DNA were processed and hybridized to the Illumina Infinium Human Core Exome BeadChip following manufacturer’s instructions. Illumina GenomeStudio V2011.1 with the Genotyping Module version 1.9.4 was used to normalize data and call genotypes using reference data provided by Illumina. Illumina’s cnv Partition and gada R packages were used to automatically detect aberrant copy number region. In addition, the B Allele Frequency (BAF) and Log R Ratio (LRR) distributions were manually checked to determine additional CNVs not detected by the software. Sample identification/relatedness was assessed by comparing called genotypes for each sample. The absolute number of different genotypes was counted and the Euclidean distances were calculated to identify relatedness of the samples. Dissociated iPSC colonies were centrifuged and resuspended in 1:1 matrigel and phosphate buffer saline solution. The cells were injected subcutaneously in nude mice. After 1–2 months, teratomas were dissected, fixed and sliced. Sections were stained with haematoxylin and eosin for further analysis. Protocols were previously approved by the University of California San Diego Institutional Animal Care and Use Committee. iPSCs were cultured on matrigel-coated dishes and fed daily with mTeSR for 7 days. On the next day, mTeSR was substituted by N2 medium (DMEM/F12 supplemented with 0.5× N2-Supplement (Life Technologies), 1 μM dorsomorphin (Tocris) and 1 μM SB431542 (Stemgent)) for 1–2 days. iPSC colonies were lifted off, cultured in suspension on the shaker (95 r.p.m. at 37 °C) for 8 days to form embryoid bodies and fed with N2 media. Embryoid bodies then were mechanically dissociated, plated on a matrigel-coated dish and fed with N2B27 medium (DMEM/F12 supplemented with 0.5× N2-Supplement, 0.5× B27-Supplement (Life Technologies), 1% penicillin/streptomycin and 20 ng/mL FGF-2). The emerging rosettes were picked manually, dissociated completely using accutase and plated on a poly-ornithine/laminin-coated plate. NPCs were expanded in N2B27 medium and fed every other day. To differentiate NPCs into neurons, FGF-2 was withdrawn from the N2B27 medium. NPCs and neurons were characterized for stage-specific markers by immunostaining and flow cytometry (NPCs only), expression profile by single-cell RT–PCR and RNA sequencing and electrophysiological property (neurons). Total RNA of DPCs, iPSCs, NPCs and neurons was extracted using TRIzol reagent (Life Technologies) according to the manufacturer’s protocols. Contaminating DNA in RNA samples was removed using TURBO DNase (Life Technologies) according to the manufacturer’s protocols. Quality and quantity of DNase-treated RNA were assessed using NanoDrop 1000 (Thermo Scientific). RNA was extracted from iPSCs as previously described using Trizol reagent (Life Technologies). cDNA was generated from the RNA using SuperScript III protocol according to the manufacturer’s instructions. PCR was performed using primers listed below at the following cycles: 94 °C for 10 min; 35 repeats of 94 °C for 30 s, 62 °C for 30 s and 72 °C for 1 min; and finally, 72 °C for 7 min. As a positive control, the pMX plasmid of the four vectors used on the reprogramming of the cells was placed along the samples as well as water as a negative template control for amplification. As an additional positive control for the endogenous genes, two hESC lines were used along with our iPSCs: H1 and HUES6 cells. Primers used were as follows. Endo-cMyc: forward, TTG AGG GGC ATC GTC GCG GGA; reverse, GCG TCC TGG GAA GGG AGA TCC. Endo-Klf4: forward, GAA ATT CGC CCG CTC CGA TGA; reverse, CTG TGT GTT TGC GGT AGT GCC. Endo-OCT3/4: forward, TCT TTC CAC CAG GCC CCC GGC TC; reverse, TGC GGG CGG ACA TGG GGA GAT CC. Endo-SOX2: forward, GCC GAG TGG AAA CTT TTG TCG; reverse, GGC AGC GTG TAC TTA TCC TTC T. Exo transgenes pMXs-TgUS: forward, GTG GTG GTA CGG GAA ATC AC. Exo-Oct4 pMXs-Oct3/4-TgDS: reverse, TAG CCA GGT TCG AGA ATC CA. Exo-Sox2 pMXs-Sox2-TgDS: reverse, GGT TCT CCT GGG CCA TCT TA. Exo-Klf4 pMXs-Klf4-TgDS: reverse, GGG AAG TCG CTT CAT GTG AG. Exo-c-Myc pMXs-c-Myc-TgDS: reverse, AGC AGC TCG AAT TTC TTC CA. Partly dissociated iPSCs were re-suspended in embryoid body medium (DMEM/F12 medium, 1× N2 supplement and 1% FBS) and cultured on shaker (95 r.p.m.) at 37 °C. Medium was changed every 3–4 days. After 20 days, total RNA of embryoid bodies was extracted for further gene expression analyses by qPCR. All tissue culture samples were routinely tested for mycoplasma by PCR. One millilitre of media supernatants (with no antibiotics or fungizone) was collected for all cell lines, spun down and resuspended in TE buffer. Ten microlitres of each sample were used in PCR reaction with the following primers: forward, GGC GAA TGG GTG AGT AAC; reverse, CGG ATA ACG CTT GCG ACC T. Any positive sample was immediately discarded. Three hundred nanograms of total extracted RNA from each sample were subjected to microarray by using the Affymatrix GeneChip one-cycle target labelling kit (Affymatrix, Santa Clara, California) according to the manufacturer’s recommended protocols. The resultant biotinylated cRNA was fragmented and then hybridized to the GeneChip Human 1.0 ST Array (764,885 probes, 28,869 genes, 19,734 gene-level probe sets with putative full-length transcript support (GenBank and RefSeq)) on the basis of human genome, Hg18. Arrays were prepared at the University of California DNA Core Facility. Arrays were analysed by the Affy (Affymetrix pre-processing)29 Bioconductor software package for microarray data. Data were then normalized by the RMA (robust multichip averaging) method to background-corrected and normalized probe levels to obtain a summary expression of normalized values for each probe set. Normalized microarray samples were then clustered by a hierarchical approach based on a matrix of distances. Normalized expression data were used to create a distance matrix that was calculated on the basis of Euclidean distance between the transcripts over a pair of samples representing a variation between two samples. Having the distances for all pairs of samples, a linkage method is used to cluster samples in a dendrogram by using calculated distances (sample expression similarities). This method also creates a heat map to graphically show the expression correlation between the samples. RNA samples were reverse transcribed into cDNA using the Super Script III First Strand Synthesis System (Invitrogen, California) according to the manufacturer’s instructions. Reactions were run on the Bio-Rad detection system using Sybr-green master mix (Bio-Rad). Primers were selected from Primerbank; validated database (http://pga.mgh.harvard.edu/primerbank/) and specificities were confirmed by melting curve analysis through a Bio-Rad detection system. Sequences of the primers are described in Supplementary Table 12. Quantitative analysis used the comparative threshold cycle method30. GAPDH was used as housekeeping gene. Each sample was run in triplicate. The RNA-seq analyses were previously described by our group31. Briefly, RNAs were isolated using the RNeasy Mini kit (Qiagen). A total of 1,000 ng of RNA was used for library preparation using the Illumina TruSeq RNA Sample Preparation Kit. The RNAs were sequenced on Illumina HiSeq2000 with 50 bp paired-end reads, generating 50 million high-quality sequencing fragments per sample on average. For validation purposes of biological samples subjected to RNA-seq, hESC and iPSC data available from the literature were downloaded and used to compare with our sequenced cell lines. The two hESC lines used are available (HUES-6, referred as ES(HUES), SRR873630, http://www.ncbi.nlm.nih.gov/sra/SRX290739; and H1, referred to here as ES(H1), SRR873631, http://www.ncbi.nlm.nih.gov/sra/SRX290740). The two human iPSC lines used are available under accession codes SRR873619 (referred to here as iPS(TD,1)) and SRR873620 (referred to here as iPS(TD,2)). RNA-seq enrichment used WebGestalt32 and Cytoscape33 software plugins, considering only categories having statistical significance (P < 0.05). Genes tested for differential expression were used as the background for GO annotation and enrichment analysis. NPCs were seeded onto poly-ornithine/laminin-coated six-well plates at a total number of 105 cells per well on day 0. Medium change was done on day 2. Cells were collected and counted on day 4. NPCs were resuspended, dissociated with accutase and fixed using fixation buffer (BioLegend) for 15 min followed by three PBS washes. The cell pellet was incubated and kept in Perm III buffer (BD Biosciences) at −20 °C until needed for the experiment. A total of 106 cells were incubated with antibodies Sox1 (PE), Sox2 (APC) or Nestin (PE) and Pax6 (APC) (Bd Biosciences) for 30 min and then washed three times before being resuspended for cell analyses. Cells were analysed in a plate reader mode using FACS Canto II machine (BD Biosciences). Cells were fixed in 4% paraformaldehyde for 10–20 min, washed with PBS three times (5 min each), permeabilized with 0.1% Triton X-100 for 15 min, incubated in blocking solution (2% BSA) for 1 h at room temperature and then in primary antibodies (goat anti-Nanog, Abcam ab77095, 1:500; rabbit anti-Lin28, Abcam ab46020, 1:500; rabbit anti-Oct4, Abcam ab19857, 1:500; mouse anti-SSEA4, Abcam ab16287, 1:200; mouse anti-Nestin, Abcam ab22035, 1:200; rabbit anti-Musashi1, Abcam ab52865, 1:250; rat anti-CTIP2, Abcam ab18465, 1:250; rabbit anti-SATB2, Abcam ab34735, 1:200; chicken anti-MAP2, Abcam ab5392, 1:1,000; rabbit anti-FZD9, Origene TA314730, 1:150; chicken anti-EGFP, Abcam ab13970, 1:1,000; rabbit anti-Synapsin1, EMD-Millipore AB1543P, 1:500; mouse anti-Vglut1, Synaptic Systems 135311, 1:500; rabbit anti-Homer1, Synaptic Systems 160003, 1:500) overnight at 4 °C. The next day, cells were washed with PBS three times (5 min each), incubated with secondary antibodies (Alexa Fluor 488, 555 and 647, Life Technologies, 1:1,000) for 1 h at room temperature and washed with PBS three times (5 min each). Nuclei were stained using DAPI (1:10,000). Slides or coverslips were mounted using ProLong Gold antifade mountant (Life Technologies). One million NPCs were harvested to single-cell suspension in 1mL PBS, then fixed by addition of 3 mL of 100% ethanol and stored at 4 °C for at least 2 h. NPC pellets were washed once with 5 mL PBS. After removal of PBS, cells were resuspended in 1 mL of propidium iodide (PI) staining solution (0.1% (v/v) Triton X-100, 10 μg/mL PI and 100 μg/mL RNase A in 1× PBS). WS and TD NPC samples were analysed by FACS on a Becton Dickinson LSRI, and gating of subG1 population (cells with fragmented DNA) was examined using FlowJo flow cytometry analysis software. Caspase activity was measured using a Green FLICA Caspases 3 & 7 Assay Kit (ImmunoChemistry Technologies). Briefly, NPCs were harvested, washed and stained with 1× carboxyfluorescein Fluorochrome Inhibitor of Caspase Assay (FAM-FLICA) reagent, 10 μg/mL Hoechst and 10 μg/mL propidium iodide (PI). Samples were analysed on the NC-3000 using the pre-optimized Caspase Assay. The population with caspase activity was used to analyse for apoptosis. NPC proliferation was assessed using BD Pharmingen BrdU Flow Kits (BD Biosciences) according to the manufacturer’s protocol. Briefly, NPCs were incubated with 1 μM BrdU for 45 min at 37 °C and harvested to single-cell suspension. NPCs were then fixed and permeabilized using BD Cytofix/Cytoperm Buffer and stained using FITC-conjugated anti-BrdU antibody and 7-aminoactinomycin D (7-AAD), a fluorescent dye for labelling DNA. Fluorescence-activated cell sorting (FACS) was done on LSRFortessa (BD Biosciences) and, to obtain the percentage of the BrdU-positive population, the cell-cycle profiles were analysed using FlowJo flow cytometry analysis software. Commercially available lentiviral vectors (pLKO.1) expressing short hairpin RNAs (shRNAs) against FZD9 under the control of the U6 promoter (Thermo Scientific) were engineered to express the Discosoma sp. red fluorescent protein (RFP) mCherry under the control of the hPGK (human phosphoglycerate kinase) promoter. The following shRNAs against FZD9 and a non-silencing scrambled control shRNA were selected (Thermo Scientific): shRNA-control, 5′-TTC TCC GAA CGT GTC ACG T-3′; shRNA-FZD9, 5′-ATC TTG CGG ATG TGG AAG AGG-3′. For rescue experiments, FZD9 cDNA was amplified from TD NPC cDNA as template by the following primer pair: 5′-CCG AGA TCT TCG AGG TGT GTG GGG TTC TCC AAA G-3′; 5′-TCT AGA GCC ACC ATG GCC GTA GCG CCT CTG-3′. The reaction was performed using Phusion High-Fidelity DNA polymerase (New England Biolabs) according to the manufacturer’s protocol. The FZD9 cDNA was cloned into a lentiviral vector driven by the ubiquitin promoter followed by a self-clevage peptide and GFP sequence. The specificity and efficiency of shRNA-control, shRNA-FZD9, and the FZD9-WT constructs were verified by co-transfection into HEK-293 cells. Cell lysates were collected and analysed by western blot analysis with anti-FZD9 antibodies (Aviva OAEC02415, 1:1,000). CHIR-98014 (Selleckchem) was resuspended according to manufacturer’s instructions into 10 mM stock using DMSO and then diluted to 100 μM. Final concentration used in cells was 100 nM of CHIR-98014, whereas the vehicle cells received only DMSO. For qPCR experiments, NPCs were propagated in six-well plates until 70% confluency and then treated with CHIR-98014 for 6 h to have their RNA collected using Trizol as previously described. For the NPC counting experiment, cells were seeded in six-well plates as described in the presence of CHIR-98014 or DMSO, in triplicates (TD and WS). After 48 h, the culture medium was changed and treatment was repeated. Cells were collected and counted after 96 h of incubation. The TD NPCs were lifted into suspension and maintained on a shaker (95 r.p.m.) to form neurospheres for 3 weeks. For the first week, the spheres were grown with N2B27 medium. The neurospheres were overlaid with the astrocyte medium (Lonza) for the remaining 2 weeks. The neurospheres were plated onto poly-ornithine- and laminin-coated plates and expanded for two to three passages before experimentation. Co-cultures of neurons and astrocytes were prepared for morphometric and functional analyses. NPCs were lysed in RIPA buffer with protease inhibitor. Rabbit anti-FZD9 antibody (Aviva OAEC02415, 1:1,000) and mouse anti-β-actin (Abcam ab8226, 1:3,000) were used as primary antibodies. IRDye 800CW goat anti-rabbit and IRDye 680RD goat anti-mouse (1:10,000) were used as secondary antibodies. The Odyssey system was used for signal detection. Signal intensities were measured using the Odyssey Image Studio and semi- quantitative analysis of FZD9 signal intensity was corrected with respect to β-actin relative quantification. A paired t-test analysis with P < 0.05 was used in the comparison of TD and WS FZD9 signal intensity normalized data. Co-localized Vglut (presynaptic) and Homer1 (postsynaptic) puncta were quantified after three-dimensional reconstruction of z-stack random images for all individuals and from two different experiments. Slides were analysed under a fluorescence microscope (Z1 Axio Observer Apotome, Zeiss). Only puncta in proximity of MAP2-positive processes were scored. Specific target amplification was performed in individual dissociated NPCs or 6-week-old neurons using C1 Single-Cell and BioMark HD Systems (Fluidigm), according to the manufacturer’s protocol and as described previously34, 35, 36. Briefly, single cells were captured on a C1 chip (10- to 17-μm cells) and cell viability was checked using a LIVE/DEAD Cell Viability/Cytotoxicity kit (Life Technologies). After lysis, RNA was reverse transcribed into cDNA with validated amplicon-specific DELTAgene Assays (Supplementary Table 13) using SuperScript III RT Platinum Taq Mix. Specific target amplification was performed by 18 cycles of 95 °C denaturation for 15 s and 60 °C annealing and amplification for 4 min. Each preamplified cDNA was mixed with 2× SsoFast EvaGreen Supermix with Low ROX (Bio-Rad) and then pipetted into an individual sample inlet in a 96.96 Dynamic Array IFC chip (Fluidigm). DELTAgene primer pairs (Supplementary Table 13) were diluted and pipetted into individual assay inlets in the same 96.96 Dynamic Array IFC chip. Quantitative PCR results were analysed using Fluidigm’s Real-time PCR Analysis software using the linear (derivative) baseline correction method and the automatic (gene) C threshold method with 0.65 curve quality threshold. Hierarchical clustering heat map, PCA analyses, violin plots of log (expression of C values) (limit of detection = 24) and ANOVA statistical analysis were performed using Singular Analysis Toolset 3.0 (Fluidigm). Neuronal networks derived from human iPSCs were transduced with lentivirus carrying the Syn::RFP reporter construct. Cell cultures were washed with Krebs HEPES buffer (KHB) (10 mM HEPES, 4.2 mM NaHCO , 10 mM dextrose, 1.18 mM MgSO , 1.18 mM KH PO 4.69 mM KCl, 118 mM NaCl, 1.29 mM NaCl ; pH 7.3) and incubated with 2–5 μM Fluo-4AM (Molecular Probes/Invitrogen, Carlsbad, California) in KHB for 40 min. Five thousand frames were acquired at 28 Hz with a region of 256 pixels × 256 pixels (×100 magnification), using a Hamamatsu ORCA-ER digital camera (Hamamatsu Photonics K.K., Japan) with a 488 nm (FITC) filter on an Olympus IX81 inverted fluorescence confocal microscope (Olympus Optical, Japan). Images were acquired with MetaMorph 7.7 (MDS Analytical Technologies, Sunnyvale, California), processed and analysed using individual circular regions of interest (ROI) on ImageJ and Matlab 7.2 (Mathworks, Natick, Massachusetts). Syn::RFP+ neurons were selected after confirmation that calcium transients were blocked with 1 mM of tetrodotoxin (TTX). The amplitude of signals was presented as relative fluorescence changes (ΔF/F) after background subtraction. The threshold for calcium spikes was set at the 95th percentile of the amplitude of all detected events. For whole-cell patch-clamp recordings, individual coverslips containing live 1-month-old neurons were transferred into a heated recording chamber and continuously perfused (1 mL/min) with artificial cerebrospinal fluid bubbled with a mixture of CO (5%) and O (95%) and maintained at 25 °C. Artificial cerebrospinal fluid contained (in mM) 121 NaCl, 4.2 KCl, 1.1 CaCl2, 1 MgSO , 29 NaHCO , 0.45 NaH PO -H O, 0.5 Na HPO and 20 glucose (all chemicals from Sigma). Whole-cell recordings were performed using a digidata 1440A/ Multiclamp 700B and Clampex 10.3 (Molecular devices). Patch electrodes were filled with internal solutions containing 130 mM K-gluconate, 6 mM KCl, 4 mM NaCl, 10 mM Na-HEPES, 0.2 mM K-EGTA; 0.3 mM GTP, 2 mM Mg-ATP, 0.2 mM cAMP, 10 mM d-glucose, 0.15% biocytin and 0.06% rhodamine. The pH and osmolarity were adjusted for physiological conditions. Data were all corrected for liquid junction potentials, electrode capacitances were compensated on-line in cell-attached mode and a low-pass filter at 2 kHz was used. The access resistance of the cells in our sample was around 37 MΩ with resistance of the patch pipettes 3–5 MΩ. Spontaneous synaptic AMPA events were recorded at the reversal potential of Cl− and could be reversibly blocked by AMPA receptor antagonist (10 μM NBQX, Sigma). Spontaneous synaptic GABA events were recorded at the reversal potential of Na+ and could be reversibly blocked with GABA receptor antagonist (10 μM SR95531, Sigma). Using 12-well MEA plates from Axion Biosystems, we plated the same density of NPCs from TD and WS individuals in triplicate. Each well was seeded with 10,000 NPCs that were induced into neuronal differentiation as previously described. Each well was coated with poly-l-ornithine and laminin before cell seeding. Cells were fed once a week and measurements were taken before the medium was changed. Recordings were performed using a Maestro MEA system and AxIS software (Axion Biosystems), using a band-pass filter with 10 Hz and 2.5 kHz cutoff frequencies. Spike detection was performed using an adaptive threshold set to 5.5 times the standard deviation of the estimated noise on each electrode. Each plate first rested for 5 min in the Maestro, and then 5–10 min of data were recorded to calculate the spike rate per well. MEA analysis was performed using the Axion Biosystems Neural Metrics Tool, wherein electrodes that detected at least five spikes per minute were classified as active electrodes. Bursts were identified in the data recorded from each individual electrode using an adaptive Poisson surprise algorithm. Network bursts were identified for each well, using a non-adaptive algorithm requiring a minimum of ten spikes with a maximum inter-spike interval of 100 ms. Only channels that exhibited bursting activity (more than ten spikes in 5 min interval) were included in this analysis. After measurement, neurons were immunostained to check morphology and density. We used six post-mortem brains (two WS and four TD) that were gender-, age- and hemisphere-matched. All brain specimens were harvested within a post-mortem interval of 18–30 h and had been immersed and fixed in 10% formalin for up to 20 years. For the purpose of the present experiments, samples were obtained from anatomically well-identified cortical areas in a consistent manner across specimens. Tissue blocks approximately 5 mm3 were removed from primary somatosensory cortex (Brodmann area 3) and primary motor cortex (Brodmann area 4) in the arm/hand knob region of the pre- and postcentral gyri, respectively, and from the secondary visual area (Brodmann area 18) from approximately 1.4 cm dorsally to the occipital pole and 2 cm from the midline37, 38. We focused specifically on these parts of the cortex because pathologies in dendritic morphology in these areas have been reported in other neurodevelopmental disorders39, 40, 41. In addition, pyramidal neurons in the selected areas reach their mature-like morphology early in development and start displaying dendritic pathologies sooner than high integration areas, such as the prefrontal cortex, allowing comparison of post-mortem findings with iPSC-derived neurons in early stages of development42, 43. Sampled tissue blocks were processed using an adaptation of the Golgi–Kopsch method44, which has been shown to give good results with tissue that has been fixed for long periods45. Briefly, blocks were immersed in a solution of 3% potassium dichromate, 0.5% formalin for 8 days, followed by immersion into 0.75% silver nitrate for 2 days. Blocks were then sectioned on a vibratome, perpendicular to the pial surface, at a thickness of 120 μm. Golgi sections were cut into 100% ethyl alcohol and transferred briefly into methyl salicylate followed by toluene, mounted onto glass slides and coverslipped. Adjacent blocks from each region were sectioned at 60 μm and stained with thionin for visualization of cell bodies and laminar organization, which enabled identification of the position of each neuron within a specific cortical layer. Cytoarchitectonic analysis of histological sections from each block confirmed that tissue was sampled from the ROI and that the Golgi-impregnated pyramidal neurons were located in cortical layers V/VI. Cortical neurons from all six post-mortem brains were used in the study. Neurons included in the morphological analysis did not display degenerative changes46. Only neurons with fully impregnated soma, apical dendrites with present oblique branches and at least two basal dendrites with third-order segments were chosen for the analysis47. To minimize the effects of cutting on dendritic measurements, we included neurons with cell bodies located near the centre of 120-μm-thick histological sections, with natural terminations of higher-order dendritic branches present where possible37, 47. Inclusion of the neurons completely contained within 120-μm sections biases the sample towards smaller neurons, leading to the underestimation of dendritic length48; therefore, we applied the same criteria blinded across all WS and TD specimens, and we thus included the neurons with incomplete endings if they were judged to otherwise fulfil the criteria for successful Golgi impregnation. All neurons were oriented with apical dendrite perpendicular to the pial surface; inverted pyramidal cells as well as magnopyramidal neurons were excluded from the analysis. Neuronal morphology was quantified along x-, y-, and z-coordinates using Neurolucida version 10 software (MBF Bioscience, Williston, Vermont) connected to a Nikon Eclipse 80i microscope, with a ×40 (0.75 numerical aperture) Plan Fluor dry objective. Tracings were conducted on both apical and basal dendrites, and the results reflect summed values for both types of dendrite per neuron. Following the recommendation that the applications of Sholl’s concentric spheres or Eayrs’ concentric circles for the analysis of neuronal morphology are not adequate when neuronal morphology is analysed in three dimensions48, we conducted dendritic tree analysis with the following measurements37, 47: (1) soma area—cross sectional surface area of the cell body; (2) dendritic length—summed total length of all dendrites per neuron; (3) dendrite number—number of dendritic trees emerging directly from the soma per neuron; (4) dendritic segment number—total number of segments per neuron; (5) dendritic spine/protrusion number—total number of dendritic spines per neuron; (6) dendritic spine/protrusion density—average number of spines per 20 μm of dendritic length; and (7) branching point number—number of nodes (points at the dendrite where a dendrite branches into two or more) per neuron. Dendritic segments were defined as parts of the dendrites between two branching points—between the soma and the first branching point in the case of first-order dendritic segments, and between the last branching point and the termination of the dendrite in the case of terminal dendritic segments. Since the long formalin-fixation time could have resulted in degradation of dendritic spines, spine values might be underestimated and are thus reported here with caution. All of the tracings were accomplished blind to brain region and diagnostic status. The iPSC-derived sample consisted of EGFP-positive 8-week-old neurons with pyramidal- or ovoid-shaped soma and at least two branched neurites (dendrites) with visible spines/protrusions. Protrusions from dendritic shaft, which morphologically resembled dendritic spines in post-mortem specimens, were considered and quantified as dendritic spines in iPSC-derived neurons. The neurites were considered dendrites on the basis of the criteria applied in post-mortem studies: (1) thickness that decreased with the distance from the cell body; (2) branches emerging under acute angle; and (3) presence of dendritic spines. In addition, only enhanced-GFP-positive neurons with nuclei co-stained with CTIP2, indicative of layer V/VI neurons, and with the dendrites displaying evenly distributed fluorescent stain along their entire length, were included in the analysis. The morphology of the neurons was quantified along x-, y-, and z-coordinates using Neurolucida version 9 software (MBF Bioscience, Williston, VT) connected to a Nikon Eclipse E600 microscope with a ×40 oil objective. No distinction was made between apical and basal dendrites, and the results reflect summed length values of all neurites/dendrites per neuron, consistent with what was done for the post-mortem neurons. The same set of measurements used in the analysis of Golgi-impregnated neurons was applied to the analysis of iPSC-derived neurons, and all of the tracings were accomplished blind to the diagnostic status and were conducted by the same rater (B.H.-M.). Intra-rater reliability was assessed by having the rater trace the same neuron after a period of time. The average coefficient of variation between the results of retraced neurons was 2% for soma area (SA), total dendritic length (TDL), dendritic segment number (DSN) and branching point number (BPN), and 3% for dendritic spine/protrusion number (DPN); there was no variation in tree/dendrite number (TN) in different tracings of the same neuron. The accuracy was further checked by having three individuals (B.H.-M., B.J. and L.S.) trace the same neuron. MRI scanning was completed in 19 participants with WS (aged 19–43 years; mean 29.0, s.d. 8.8; 11 males, 8 females) and 19 TD comparison participants (aged 16–43 years; mean 26.2, s.d. 7.3; 8 males, 11 females). There was no significant difference between the groups in age (t = 1.0, P < 0.30) or in gender ratio (Pearson’s χ2 = 0.95, P < 0.33). A standardized multiple modality high-resolution structural MRI protocol was implemented, involving three-dimensional T - and T -weighted volumes and a set of diffusion-weighted scans. Imaging data were obtained at the University of California San Diego Radiology Imaging Laboratory on a 1.5 T GE Signa HDx 14.0M5 TwinSpeed system (GE Healthcare, Waukesha, Wisconsin) using an eight-channel phased array head coil. A three-dimensional inversion recovery spoiled gradient echo (IR-SPGR) T -weighted volume was acquired with pulse sequence parameters optimized for maximum grey/white matter contrast (echo time = 3.9 ms, repetition time = 8.7 ms, inversion time = 270 ms, flip angle = 8°, difference in echo times = 750 ms, bandwidth = ± 15.63 kHz, field of view = 24 cm, matrix = 192 × 192, voxel size = 1.25 mm × 1.25 mm × 1.2 mm). All MRI data were collected using prospective motion (PROMO) correction for non-diffusion imaging49. This method has been shown to improve image quality, reduce motion-related artefacts, increase the reliability of quantitative measures and improve the clinical diagnostic utility of MRI data obtained in children and clinical groups50, 51. Standardized quality control procedures were followed for both raw and processed data, including visual inspection ratings by a trained imaging technician and computer algorithms testing general image characteristics as well as aspects specific to each imaging modality, such as contrast properties, registrations and artefacts from motion and other sources. Participants included in the current analyses were only those who passed all raw and processed quality control measures. Image post-processing and analysis were performed using FreeSurfer software suite (http://surfer.nmr.mgh.harvard.edu/). Surface-based cortical reconstruction and subcortical volumetric segmentation procedures have been shown elsewhere52, 53, 54, 55, 56, 57, 58. Briefly, a three-dimensional model of the cortical surface was generated using MRI scans with four attributes: white matter segmentation; tessellation of the grey/white matter boundary; inflation of the folded, tessellated surface; and correction of topological defects53, 54. Cortical thickness was measured using the distances from each point on the white matter surface to the pial surface57. Cortical surface area was measured at the pial surface for the entire cerebrum and for each parcel of the Desikan and Destrieux atlases53, 54, 58, 59. Means ± s.e.m. for each parameter were obtained from samples described in Supplementary Table 1. There were no statistical methods used to predetermine sample size. The experiments were not randomized. All of the tracings were accomplished blind to brain region and diagnostic status. All statistical analyses were done using Prism (Graphpad). Before statistical analysis comparing means between three to five unmatched groups of data, normal distribution was tested using D’Agostino and Pearson omnibus normality test and variance similarity was tested using Bartlett’s test for equal variances. Means of three to five unmatched groups, where normal distribution and equal variances between groups were confirmed, were statistically compared using one-way ANOVA and Tukey’s post hoc test. Otherwise, a Kruskal–Wallis test and Dunn’s multiple comparison test were used. Before statistical analysis comparing means between two unmatched groups of data, normal distribution was tested using D’Agostino and Pearson omnibus normality test and variance similarity was tested using an F test to compare variances. To compare the means of two groups where normal distribution and similar variance between groups were confirmed, Student’s t test was used. Otherwise, a Mann–Whitney test was used. Significance was defined as *P < 0.05, **P < 0.01, ***P < 0.001 or ****P < 0.0001.


News Article | December 7, 2016
Site: www.nature.com

Drosophila melanogaster w1118, Canton-S and Oregon-R were used as wild-type controls. Other fly stocks used were tub-GAL4, elavC155-GAL4, how24B-GAL4, Df(3R)Exel6197, Df(2L)BSC200/Cyo, Df(3L)Exel6094 (Bloomington Drosophila Stock Center). UAS-Ime4-HA/Cyo flies were generated by injection of UAS Ime4–HA vector at Bestgene. Mutant alleles for Ime4, dMettl14, fl(2)d and YT521-B were generated using the CRISPR–Cas9 system following the previously described procedure41. Two independent guide RNAs (gRNAs) per gene were designed using the gRNA design tool: http://www.crisprflydesign.org/ (Supplementary Table 9). Oligonucleotides were annealed and cloned into pBFv-U6.2 vector (National Institute of Genetics, Japan). Vectors were injected into embryos of y2 cho2 v1; attP40(U6.2-w-ex3-2) flies. Positive recombinant males were further crossed with y2 cho2 v1; attP40(nos-Cas9)/CyO females. Males carrying nos-Cas9 and U6-gRNA transgenes were screened for the expected deletion and further crossed with the balancer strain AptXa/CyoGFP-TM6c. Ime4∆cat allele was obtained using gRNA sequences (GGACTCTTTCCGCGCTACAG and GGCTCACACGGACGAATCTC). A deletion of 569 bp (607–1,175 bp in the genome region chr3R:24032157..24034257, genome assembly BDGP release 6) was produced. Ime4null allele was obtained using gRNA sequences (GGCCCTTTTAACGTTCTTGA and GGCTCACACGGACGAATCTC) and produced a deletion of 1,291 bp (1,876–3,166 bp in the genome region chr3R:24030157..24034257). dMettl14fs allele was obtained using gRNA sequences (GGTTCCCTTCAGGAAGGTCG and GGACCAACATTAACAAGCCC) and produced a 2-nucleotide frame shift at position 227 of the coding sequence, leading to a premature stop codon at amino acid position 89. YT521-BΔN allele was obtained using gRNA sequences (GGCATTAATTGTGTGGACAC and GGCTGTCGATCCTCGGTATC) and produced a deletion of 602 bp (133–734 bp in the genome region chr3L:3370451..3374170 (reverse complemented)). The phylogenetic trees were constructed with ClustalX42 from multiple sequence alignments generated with MUSCLE43 of the Drosophila sequences with homologues from representative species. Drosophila S2R+ are embryonic-derived cells obtained from Drosophila Genomics Resource Center (DGRC; FlyBase accession FBtc0000150). The presence of Mycoplasma contamination was not tested. The plasmids used for immunohistochemistry and co-immunoprecipitation assays in Drosophila S2R+ cells were constructed by cloning the corresponding cDNA in the pPAC vector44 with N-terminal Myc tag and the Gateway-based vectors with N-terminal Flag–Myc tag (pPFMW) as well as C-terminal HA tag (pPWH) (obtained from Drosophila Genomics Resource Center at Indiana University). Two-to-three-day-old flies were gender-separated and placed into measuring cylinders to assess their locomotion using the climbing assay reported previously45. Flies were tapped to the bottom and the number of flies that climb over the 10 cm threshold in 10 s interval were counted. Ten female flies were used per experiment and six independent measurements were performed. Staging experiment was performed using Drosophila melanogaster w1118 flies that were kept in a small fly cage at 25 °C. Flies laid embryos on big apple juice plates that were exchanged every 2 h. Before each start of collection, 1 h pre-laid embryos were discarded to remove all retained eggs and embryos from the collection. All the resultant plates with embryos of 1 h or 2 h lay were further incubated at 25 °C between 0 h and 20 h, with 2 h increments, to get all embryonic stages. For the collection of larval stages, L1 larvae (~30 larvae/stage) were transferred onto a new apple juice plate and were further incubated at 25 °C till they reached a defined age (24 to 110 h, 2 h intervals). Similarly, pupal stages were obtained by the transfer of L3 larvae (~30/stage) in a fresh vial, that were kept at 25 °C and left to develop into defined stage between 144 and 192 h in 2 h increments. One-to-three-day-old adults were collected and gender separated. Heads and ovaries from 50 females were also collected. A total of three independent samples were collected for each Drosophila stage as well as for heads and ovaries. Samples from the staging experiment were used for RNA extraction to analyse m6A abundance in mRNA and expression levels of different transcripts during Drosophila development. Total RNA from S2R+ cells was isolated using Trizol reagent (Invitrogen) and DNA was removed with DNase-I treatment (NEB). mRNA was purified with Oligotex mRNA Kit (Qiagen) or by using two rounds of purification with Dynabeads Oligo (dT)25 (Invitrogen). cDNA for RT–qPCR was prepared using M-MLV Reverse Transcriptase (Promega) and transcript levels were quantified using Power SYBR Green PCR Master Mix (Invitrogen) and the oligonucleotides indicated in Supplementary Table 9. For RNA isolation from fly heads, 20 female flies were collected in 1.5 ml Eppendorf tubes and flash frozen in liquid nitrogen. Heads were first removed from the body by spinning the flies on vortex and then collected via the 0.63 mm sieve at 4 °C. Fly heads were homogenized using a pestle and total RNA was isolated with Trizol reagent. DNA was removed by DNase-I treatment and RNA was further purified using RNeasy Kit (Qiagen). RNA from adult flies and dissected ovaries was prepared as described earlier by skipping the head separation step. Two-to-three-day-old flies were collected and their RNA isolated as described earlier. Following cDNA synthesis PCR was performed using the oligonucleotides described in Supplementary Table 9 to analyse Sxl, tra and msl-2 splicing. For in situ hybridization Drosophila melanogaster w1118 flies were kept at 25 °C in conical flasks with apple juice agar plates and embryos were collected every 24 h. Embryos were transferred in a sieve and dechorionated for 2 min in 50% sodium hypochloride. After 5 min wash in water, embryos were permeabilized with PBST (0.1% Tween X-100 in PBS) for 5 min. Embryos were transferred in 1:1 mixture of heptane (Sigma) and 8% formaldehyde (Sigma) and fixed for 20 min with constant shaking at room temperature. After fixation the lower organic phase was removed and 1 volume of MeOH was added to the aqueous phase containing fixed embryos. Following 5 min of extensive shaking all liquid was removed and embryos were washed 3 times with 100% MeOH. At this point embryos were stored at −20 °C or used for further analysis. For in situ hybridization MeOH was gradually replaced with PBST with 10 min washes and with three final washes in PBST. Embryos were further washed for 10 min at room temperature with 50% HB4 solution (50% formamide, 5× SSC, 50 μg/ml heparin, 0,1% Tween, 5 mg/ml torula yeast extract) diluted in PBST. Blocking was performed with HB4 solution, first for 1 h at room temperature and next for 1 h at 65 °C. In situ probes were prepared with DIG RNA labelling Kit (Roche) following the manufacturer’s protocol. Two microlitres of the probe were diluted in 200 μl of HB4 solution, heated up to 65 °C to denature the RNA secondary structure and added to blocked embryos for further overnight incubation at 65 °C. The next day, embryos were washed 2 times for 30 min at 65 °C with formamide solution (50% formamide, 1× SSC in PBST) and further 3 times for 20 min at room temperature with PBST. Embryos were then incubated with anti-DIG primary antibody (Roche) diluted in PBST (1:2,000) for 2 h at room temperature and later washed 5 times for 30 min with PBST. In order to develop the staining, embryos were rinsed with AP buffer (100 mM Tris pH 9.5, 50 mM MgCl , 100 mM NaCl, 0.1% Tween) and incubated with NBT/BCIP solution in AP buffer (1:100 dilution) until the intense staining was observed. Reaction was stopped with several 15 min PBST washes. Prior to mounting, embryos were incubated in 20% glycerol and later visualized on Leica M205-FA stereomicroscope. S2R+ cells were depleted for the indicated proteins with two treatments of double-stranded RNA (dsRNA). Four days after treatment Myc-tagged YT521-B was transfected along with the control Myc construct. Seventy-two hours after transfection, cells were fixed with 1% formaldehyde at room temperature for 10 min and harvested as described previously46. Extracted nuclei were subjected to 13 cycles of sonication on a bioruptor (Diagnode), with 30 s “ON”/“OFF” at high settings. Nuclear extracts were incubated overnight with 4 μg of anti-Myc 9E10 antibody (Enzo Life Sciences). Immunoprecipitation was performed as described previously46 except that samples were DNase-treated (NEB) instead of RNase-treated and subjected to proteinase K treatment for reversal of crosslinks, 1 h at 65 °C. RNase inhibitors (Murine RNase Inhibitor, NEB) were used in all steps of the protocol at a concentration of 40 U/ml. Antibodies against Ime4 and dMettl14 were generated at Eurogentec. For anti-Ime4 sera guinea pig was immunized with a 14 amino-acid-long peptide (163–177 amino acids (AA)); for anti-dMettl14 sera rabbit was immunized with a 14 amino acid-long peptide (240–254 AA). Both serums were affinity-purified using peptide antigens crosslinked to sepharose columns. For ovary immunostaining, ovaries from 3–5-day-old females were dissected in ice-cold PBS and fixed in 5% formaldehyde for 20 min at room temperature. After a 10 min wash in PBT1% (1% Triton X-100 in PBS), ovaries were further incubated in PBT1% for 1 h at room temperature. Ovaries were then blocked with PBTB (0.2% Triton, 1% BSA in PBS) for 1 h at room temperature and later incubated with the primary antibodies in PBTB overnight at 4 °C: rabbit anti-Vasa, 1:250 (gift from Lehmann laboratory), mouse anti-ORB 1:30 (#6H4 DSHB). The following day, ovaries were washed 2 times for 30 min in PBTB and blocked with PBTB containing 5% donkey serum (Abcam) for 1 h at room temperature. Secondary antibody was added later in PBTB with donkey serum and ovaries were incubated for 2 h at room temperature. Five washing steps of 30 min were performed with 0.2% Triton in PBT and ovaries were mounted onto slides in Vectashield (Vector Labs). For NMJ staining, third instar larvae were dissected in calcium free HL-3 saline and fixed in 4% paraformaldehyde in PBT (PBS + 0.05% Triton X-100). Larvae were then washed briefly in 0.05% PBT for 30 min and incubated overnight at 4 °C with the following primary antibodies: rabbit anti-synaptotagmin, 1:2,000 (ref. 47); mouse anti-DLG, 1:100 (#4F3, DSHB); TRITC-conjugated anti-HRP, 1:200 (Jackson ImmunoResearch). Secondary antibodies conjugated to Alexa-488 (goat anti-rabbit, Jackson ImmunoResearch) and Alexa-647 (goat anti-mouse, Jackson ImmunoResearch) were used at a concentration of 1:200 and incubated at room temperature for 2 h. Larvae were finally mounted in Vectashield. For staining of Drosophila S2R+ cells, cells were transferred to the poly-lysine pre-treated 8-well chambers (Ibidi) at the density of 2 × 105 cells/well. After 30 min, cells were washed with 1× DPBS (Gibco), fixed with 4% formaldehyde for 10 min and permeabilized with PBST (0.2% Triton X-100 in PBS) for 15 min. Cells were incubated with mouse anti-Myc (1:2000; #9E10, Enzo) in PBST supplemented with 10% of donkey serum at 4 °C, overnight. Cells were washed 3× for 15 min in PBST and then incubated with secondary antibody and 1× DAPI solution in PBST supplemented with 10% of donkey serum for 2 h at 4 °C. After three 15 min washes in PBST, cells were imaged with Leica SP5 confocal microscope using ×63 oil immersion objective. Images from muscles 6–7 (segment A3) were acquired with a Leica Confocal Microscope SP5. Serial optical sections at 512 × 512 or 1,024 × 1,024 pixels were obtained at 0.38 μm with the ×63 objective. Different genotypes were processed simultaneously and imaged using identical confocal acquisition parameters for comparison. Bouton number was quantified in larval abdominal segment A3, muscles 6 and 7, of wandering third instar larvae. ImageJ software (version 1.49) was used to measure the area of the synaptotagmin-positive area. Drosophila S2R+ cells were grown in Schneider`s medium (Gibco) supplemented with 10% FBS (Sigma) and 1% penicillin–streptomycin (Sigma). For RNA interference (RNAi) experiments, PCR templates for the dsRNA were prepared using T7 megascript Kit (NEB). dsRNA against bacterial β-galactosidase gene (lacZ) was used as a control for all RNA interference (RNAi) experiments. S2R+ cells were seeded at the density of 106 cells/ml in serum-free medium and 7.5 μg of dsRNA was added to 106 cells. After 6 h of cell starvation, serum supplemented medium was added to the cells. dsRNA treatment was repeated after 48 and 96 h and cells were collected 24 h after the last treatment. Effectene (Qiagen) was used to transfect vector constructs in all overexpression experiments following the manufacturer`s protocol. For the co-immunoprecipitation assay, different combinations of vectors with indicated tags were co-transfected in S2R+ cells seeded in a 10 cm cell culture dish as described earlier. Forty-eight hours after transfection cells were collected, washed with DPBS and pelleted by 10 min centrifugation at 400g. The cell pellet was lysed in 1 ml of lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% NP-40) supplemented with protease inhibitors (1 μg/ml leupeptin, 1 μg/ml pepstatin, 1 μg/ml aprotinin and 1 mM PMSF) and rotated head-over-tail for 30 min at 4 °C. Nuclei were collected by 10 min centrifugation at 1,000g at 4 °C re-suspended in 300 μl of lysis buffer and sonicated with 5 cycles of 30 s ON, 30 s OFF low power setting. Cytoplasmic and nuclear fractions were joined and centrifuged at 18,000g for 10 min at 4 °C to remove the remaining cell debris. Protein concentrations were determined using Bradford reagent (BioRad). For immunoprecipitation, 2 mg of proteins were incubated with 7 μl of anti-Myc antibody coupled to magnetic beads (Cell Signaling) in lysis buffer and rotated head-over-tail overnight at 4 °C. The beads were washed 3 times for 15 min with lysis buffer and immunoprecipitated proteins were eluted by incubation in 1× NuPAGE LDS buffer (ThermoFischer) at 70 °C for 10 min. Eluted immunoprecipitated proteins were removed from the beads and DTT was added to 10% final volume. Immunoprecipitated proteins and input samples were analysed by western blot after incubation at 70 °C for additional 10 min. For western blot analysis, proteins were separated on 7% SDS–PAGE gel and transferred on Nitrocellulose membrane (BioRad). After blocking with 5% milk in PBST (0.05% Tween in PBS) for 1 h at room temperature, the membrane was incubated with primary antibody in blocking solution overnight at 4 °C. Primary antibodies used were: mouse anti-Myc 1:2,000 (#9E10, Enzo); mouse anti-HA 1:1,000 (#16B12, COVANCE); mouse anti-Tubulin 1:2,000 (#903401, Biolegend); guinea pig anti-Ime4 1:500 and rabbit anti-dMettl14 1:250. The membrane was washed 3 times in PBST for 15 min and incubated 1 h at room temperature with secondary antibody in blocking solution. Protein bands were detected using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). S2R+ cells were transfected with either Myc–YT521-B of Myc–GFP constructs. Forty-eight hours after transfection cells were collected, washed with PBS and pelleted by centrifugation at 400g for 10 min. The cell pellet was lysed and processed in 1 ml of pull-down lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.5% Triton-X100, 0.5 mM DTT). For individual pull-down, 1.5 mg of protein were incubated with either 3 μg of biotinylated RNA probe of bPRL containing m6A or not, or without probe, as a control in 0.5 ml of pull-down buffer supplemented with protease inhibitor mix and 10 U of Murine RNase Inhibitor (NEB) and incubated for 2 h at 4 °C. Five microlitres of Streptavidin beads (M-280, Invitrogen) were added and pull-down samples were incubated for an additional 1 h at 4 °C. After 3 washes of 15 min with pull-down buffer, beads were re-suspended in 400 μl of pull-down buffer. One-hundred microlitres was were used for RNA isolation and dot blot analysis of recovered RNA probes with anti Strep-HRP. The remaining 300 μl of the beads was collected on the magnetic rack and immunoprecipitated proteins were eluted by incubation in 1× SDS buffer (ThermoFischer) at 95 °C for 10 min. Immunoprecipitated proteins as well as input samples were analysed by western blot. Serial dilutions of biotinylated RNA probe of bPRL containing m6A or A were spotted and crosslinked on nitrocellulose membrane (Biorad) with ultraviolet 245 light (3 × 150 mJ/cm2). RNA loading was validated with methylene blue staining. Membranes were blocked with 5% milk in PBST for 1 h at room temperature and washed in PBST before incubation with the proteins of interest. S2R+ cells were transfected with either Myc–YT521-B or Myc–GFP constructs. Forty-eight hours after transfection cells were collected, washed with PBS and pelleted by centrifugation at 400g for 10 min. The cell pellet was lysed in 1 ml of lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% NP-40). Three milligrams of the protein lysate were mixed with 2% BSA in lysis buffer and incubated with the membrane overnight at 4 °C. For control dot-blot rabbit anti-m6A antibody (Synaptic Systems) was used. The next day membranes were washed 3 times in lysis buffer. Membranes with bound proteins were further crosslinked with ultraviolet 245 light (3 × 150 mJ/cm2) and analysed using anti-Myc antibody. For SILAC experiments, S2R+ cells were grown in Schneider medium (Dundee Cell) supplemented with either heavy (Arg8, Lys8) or light amino acids (Arg0, Lys0) (Sigma). For the forward experiment, Myc–YT521-B was transfected in heavy-labelled cells and Myc-alone in light-labelled cells. The reverse experiment was performed vice versa. The co-immunoprecipitation experiment was done as described earlier. Before elution, beads of the heavy and light lysates were combined in 1:1 ratio and eluted with 1× NuPAGE LDS buffer that was subject to MS analysis as described previously48. Raw files were processed with MaxQuant (version 1.5.2.8) and searched against the Uniprot database of annotated Drosophila proteins (Drosophila melanogaster: 41,850 entries, downloaded 8 January 2015). mRNA samples from S2R+ cells depleted for the indicated proteins or from Drosophila staging experiments were prepared following the aforementioned procedure. Three-hundred nanograms of purified mRNA was further digested using 0.3 U Nuclease P1 from Penicillum citrinum (Sigma-Aldrich, Steinheim, Germany) and 0.1 U Snake venom phosphodiesterase from Crotalus adamanteus (Worthington, Lakewood, USA). RNA and enzymes were incubated in 25 mM ammonium acetate, pH 5, supplemented with 20 μM zinc chloride for 2 h at 37 °C. Remaining phosphates were removed by 1 U FastAP (Thermo Scientific, St Leon-Roth, Germany) in a 1 h incubation at 37 °C in the manufacturer supplied buffer. The resulting nucleoside mix was then spiked with 13C stable isotope labelled nucleoside mix from Escherichia coli RNA as an internal standard (SIL-IS) to a final concentration of 6 ng/μl for the sample RNA and 10 ng/μl for the SIL-IS. For analysis, 10 μl of the before mentioned mixture were injected into the LC–MS/MS machine. Generation of technical triplicates was obligatory. All mRNA samples were analysed in biological triplicates, except for the ctr, nito, vir, hrb27C and qkr58E-1 knockdown samples, which were measured as biological duplicates. LC separation was performed on an Agilent 1200 series instrument, using 5 mM ammonium acetate buffer as solvent A and acetonitrile as buffer B. Each run started with 100% buffer A, which was decreased to 92% within 10 min. Solvent A was further reduced to 60% within another 10 min. Until minute 23 of the run, solvent A was increased to 100% again and kept at 100% for 7 min to re-equilibrate the column (Synergi Fusion, 4 μM particle size, 80 Å pore size, 250 × 2.0 mm, Phenomenex, Aschaffenburg, Germany). The ultraviolet signal at 254 nm was recorded via a DAD detector to monitor the main nucleosides. MS/MS was then conducted on the coupled Agilent 6460 Triple Quadrupole (QQQ) mass spectrometer equipped with an Agilent JetStream ESI source which was set to the following parameters: gas temperature, 350 °C; gas flow, 8 l/min; nebulizer pressure, 50 psi; sheath gas temperature, 350 °C; sheath gas flow, 12 l/min; and capillary voltage, 3,000 V. To analyse the mass transitions of the unlabelled m6A and all 13C m6A simultaneously, we used the dynamic multiple reaction monitoring mode. Mass transitions, retention times and QQQ parameters are listed in Supplementary Table 10. The quantification was conducted as described previously49. Briefly, the amount of adenosine was evaluated by the external linear calibration of the area under the curve (AUC) of the ultraviolet signal. The amount of modification was calculated by linear calibration of the SIL-IS in relation to m6A nucleoside. The R2 of both calibrations was at least 0.998 (see Extended Data Fig. 1a, b). Knowing both amounts, the percentage of m6A/A could be determined. MeRIP was performed using the previously described protocol50 with the following modifications. Eight micrograms of purified mRNA from Drosophila S2R+ cells was incubated with 5 μg of anti-m6A antibody (Synaptic Systems) in MeRIP buffer (150 mM NaCl, 10 mM Tris-HCl pH 7.4, 0.1% NP-40) supplemented with 5 U/ml of Murine RNase inhibitor (NEB) for 2 h at 4 °C. In control MeRIP experiment, no antibody was used in the reaction mixture. Five microlitres of A+G magnetic beads were added to all MeRIP samples for 1 h at 4 °C. On bead digestion with RNase T1 (Thermo Fisher) at final concentration 0.1 U/ml was performed for 15 min at room temperature. Beads with captured RNA fragments were then immediately washed 3 times with 500 μl of ice-cold MeRIP buffer and further eluted with 100 μl of elution buffer (0.02 M DTT, 150 mM NaCl, 50 mM Tris-HCl pH 7.4, 1 mM EDTA, 0.1% SDS, 5 U/ml Proteinase K) at 42 °C for 5 min. Elution step was repeated 4 times and 500 μl of acidic phenol/chloroform pH 4.5 (Ambion) was added to 400 μl of the combined eluate per sample to extract captured RNA fragments. Samples were mixed and transferred to Phase Lock Gel Heavy tubes (5Prime) and centrifuged for 5 min at 12,000g. Aqueous phase was precipitated overnight, −80 °C. On the following day, samples were centrifuged, washed twice with 80% EtOH and re-suspended in 10 μl of RNase-free H O (Ambion). Recovered RNA was analysed on RNA Pico Chip (Agilent) and concentrations were determined with RNA HS Qubit reagents. Since no RNA was recovered in the MeRIP control samples, libraries were prepared with 30 ng of duplicate MeRIPs and duplicate input mRNA samples. MeRIP-qPCR was performed on the fraction of eluted immunoprecipitated RNA and an equal amount of input mRNA. cDNA for RT–qPCR was prepared using M-MLV Reverse Transcriptase (Promega) and transcript levels were quantified using Power SYBR Green PCR Master Mix (Invitrogen) using oligonucleotides indicated in Supplementary Table 9. For lifespan assay, 2–3-day-old flies were gender-separated and kept at 25 °C in flasks with apple juice medium (<20 flies/tube). Number of flies tested: females (37, Ime4Δcat/Ime4Δcat; 57, Tubulin-GAL4/UAS-Ime4); males (33, Ime4Δcat/Ime4Δcat; 41, Tubulin-GAL4/UAS-Ime4). To monitor their survival rate over time, flies were counted and transferred into a new tube every 2 days. Behavioural tests were performed on 2–5-day-old females with Canton-S as wild-type control. Wings were cut under cold anaesthesia to one-third of their length on the evening before the experiment. Walking and orientation behaviour was analysed using Buridan’s paradigm as described36. Dark vertical stripes of 12° horizontal viewing angle were shown on opposite sides of an 85-mm diameter platform surrounded by water. The following parameters were extracted by a video-tracking system (5 Hz sampling rate): total fraction of time spent walking (activity), mean walking speed taken from all transitions of a fly between the visual objects, and number of transitions between the two stripes. The visual orientation capacity (mean angular deviation) of the flies was assessed by comparing all 0.2-s path increments per fly (4,500 values in 15 min) to the respective direct path towards the angular-wise closer of the two dark stripes. All statistical groups were tested for normal distribution with the Shapiro–Wilk test. Multiple comparisons were performed using the Kruskal–Wallis ANOVA or one-way ANOVA with a post-hoc Bonferroni correction. n = 15 for all genotypes. The sample size was chosen based on a previous study51 and its power was validated with result analysis. Blinding was applied during the experiment. For samples from S2R+ cells and for full fly RNA samples, Ilumina TruSeq Sequencing Kit (Illumina) was used. For Drosophila head samples, NEBNext Ultra Directional RNA Kit (NEB) was used. Libraries were prepared following the manufacturer`s protocol and sequenced on Illumina HiSeq 2500. The read-length was 71 bp paired end. For MeRIP, NEBNext Ultra Directional Kit was used omitting the RNA fragmentation step for recovered MeRIP samples and following the manufacturer’s protocol for input samples. Libraries were sequenced on an Illumina MiSeq as 68 bp single read in one pool on two flow cells. The RNA-seq data was mapped against the Drosophila genome assembly BDGP6 (Ensembl release 79) using STAR52 (version 2.4.0). After mapping, the bam files were filtered for secondary alignments using samtools (version 1.2). Reads on genes were counted using htseq-count (version 0.6.1p1). After read counting, differential expression analysis was done between conditions using DESeq2 (version 1.6.3) and filtered for a false discovery rate (FDR) < 5%. Differential splicing analysis was performed using rMATS (3.0.9) and filtered for FDR < 10%. The data from fly heads were treated as above but cleaned for mitochondrial and rRNA reads after mapping before further processing. The sample Ime4hom_3 was excluded as an outlier from differential expression analysis. The MeRIP-seq data were processed following the same protocol as the RNA samples for mapping and filtering of the mapped reads. After mapping, peaks were called using MACS (version 1.4.1)53. The genome size used for the MACS was adjusted to reflect the mappable transcriptome size based on Ensembl-annotated genes (Ensembl release 79). After peak calling, peaks were split into subpeaks using PeakSplitter (version 1.0, http://www.ebi.ac.uk/research/bertone/software). Consensus peaks were obtained by intersecting subpeaks of both replicates (using BEDTools, version 2.25.0). For each consensus peak, the coverage was calculated as counts per million (CPM) for each of the samples and averaged for input and MeRIP samples. Fold changes for MeRIP over input were calculated based on these. Peaks were filtered for a minimal fold change of 1.3 and a minimal coverage of 3 CPM in at least one of the samples. Peaks were annotated using the ChIPseeker and the GenomicFeatures package (based on R/Bioconductor)54. In the Buridan paradigm, normality was tested for every dataset; different tests were used depending on the outcome. For not normally distributed data, Kruskal–Wallis test and Wilcoxon test were used. For normally distributed data, Bartlett test was applied to check for homogeneity of variances. ANOVA and t-test were used. Bonferroni corrections were applied. For climbing assays, normality was tested for every dataset. Homogeneity of variances were analysed with Levene’s test. One-way ANOVA test with Tukey’s post-hoc test was performed for multiple comparisons and Student’s t-test when two data sets were compared. For m6A level measurement, normality was tested for every dataset. Homogeneity of variances were analysed with Levene’s test. One-way ANOVA test with Tukey’s post-hoc test was performed for multiple comparisons. Randomization was used for selection of female flies of chosen genotype for climbing tests, Buridan paradigm and RNA sequencing experiments. Randomized complete block design was applied to ensure the equal number of flies per test group. Complete randomization was applied for selection of larvae or flies of the chosen genotype for lifespan assay and NMJ staining experiment. The data that support the findings of this study have been deposited in the NCBI Gene Expression Omnibus (GEO) under accession number GSE79297. All other relevant data are available from the corresponding author.

Loading Synaptic Systems GmbH collaborators
Loading Synaptic Systems GmbH collaborators