Supelco

Bellefonte, PA, United States
Bellefonte, PA, United States
SEARCH FILTERS
Time filter
Source Type

Wang P.,Northeastern University | Gao J.,Armstrong Pharmaceuticals | Li G.,Novartis | Shimelis O.,Supelco | Giese R.W.,Northeastern University
Chemical Research in Toxicology | Year: 2012

Using a method in which DNA adducts are discovered based on their conversion in a nucleotide form to phosphorimidazolides with isotopologue benzoylhistamines (or p-bromobenzoylhistamine) prior to detection by MALDI-TOF-MS, we have profiled the adducts that form when calf thymus DNA is reacted in vitro with p-benzoquinone (BQ). We find, as relative values normalized to 100% of adducts observed, 79% BQ-dCMP, 21% BQ-methyl-dCMP (a new DNA adduct), and trace amounts of BQ-dAMP and BQ-dGMP. Because mC is 5% of C in this DNA, the reaction of BQ with DNA in vitro is about five times faster at methyl-C than C. When equal amounts of dCMP and methyl-dCMP are reacted with BQ, equal amounts of the corresponding adducts are observed. Thus, the microenvironment of methyl-C in DNA enhances its reactivity relative to C with BQ. In a prior, similar study, but based on analysis by 32P- postlabeling, the second most abundant adduct was assigned to BQ-A, apparently because of comigration of the BQ-A and BQ-methyl-C adducts (as bisphosphates) in the chromatographic step. Because the calf thymus DNA (used as received) was contaminated with RNA, we also detected the ribonucleotide adduct, BQ-CMP. © 2012 American Chemical Society.


Bell D.S.,Supelco | Wang X.,Agilent Technologies
LC-GC North America | Year: 2015

The 42nd International Symposium of High Performance Liquid Phase Separations and Related Techniques, or HPLC 2015, convened in Geneva, Switzerland, on June 21-25, 2015. The conference was held at the International Conference Center Geneva (CICG) in the very country that the conference began in 1973 (Interlaken). This conference, which has grown into the premier event bringing together leading scientists in the field of liquid separations, attracted about 1100 delegates from 50 countries. This was a considerable increase compared to HPLC 2014 in New Orleans, Louisiana, but similar in numbers to previous European events. HPLC 2015 was chaired by Professor Gérard Hopfgartner of the University of Geneva and emphasized fundamental aspects of separations sciences, sample preparation, novel developments and applications as well as hyphenation with mass spectrometry (MS). © 2015, UBM Medica Periodical Publication. All rights reserved.


Bianchi F.,University of Parma | Bedini A.,University of Parma | Riboni N.,University of Parma | Pinalli R.,University of Parma | And 4 more authors.
Analytical Chemistry | Year: 2014

A selective cavitand-based solid-phase microextraction coating was synthesized for the determination of nitroaromatic explosives and explosive taggants at trace levels in air and soil. A quinoxaline cavitand functionalized with a carboxylic group at the upper rim was used to enhance selectivity toward analytes containing nitro groups. The fibers were characterized in terms of film thickness, morphology, thermal stability, and pH resistance. An average coating thickness of 50 (±4) μm, a thermal stability until 400 °C, and an excellent fiber-to-fiber and batch to batch repeatability with RSD lower than 4% were obtained. The capabilities of the developed coating for the selective sampling of nitroaromatic explosives were proved achieving LOD values in the low ppbv and ng kg-1 range, respectively, for air and soil samples. © 2014 American Chemical Society.


News Article | November 16, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Gas-rich hydrothermally-heated sediments covered with dense mats of Beggiatoa were obtained in the Guaymas Basin vent area (27° 00.437′ N, 11° 24.548′ W; 2,000 m water depth). Samples were collected by push coring using the submersible Alvin (dive 4570) on RV Atlantis during November/December 2009. The sediments were stored anaerobically in butyl rubber stopper-sealed glass vials. In the laboratory sediments were 1:4 diluted with anoxic artificial seawater (ASW) medium49, initially provided with methane as a substrate, and incubated at 50 °C. These incubations showed immediate methane-dependent sulfate reduction. After 3 months a subsample was incubated with butane (0.2 MPa). Initially, we did not detect butane-dependent sulfide production. However, after 2 months of incubation sulfide production set in. When sulfide concentrations exceeded 15 mM the culture was diluted (1:5) in fresh ASW medium (semi-continuous cultivation) and resupplied with butane. This procedure was repeated several times and resulted in a virtually sediment-free culture after 2 years of cultivation. For quantitative growth experiments, cultures were set up in 150 ml serum bottles containing 80 ml ASW medium, and inoculated with a 20 ml aliquot of a grown culture. Parallel cultures with different starting amounts of butane (5 and 7.5 ml butane in the culture headspace) were prepared. As controls, we used sterile cultures receiving butane, and inoculated cultures lacking butane. All cultures were incubated at 50 °C without shaking. Measurements of sulfide production and butane were performed in triplicate. Sulfide concentrations were determined by transferring 0.1 ml culture into 4 ml acidified copper sulfate (5 mM) solution. The formation of colloidal copper sulfide was determined photometrically at 480 nm (ref. 50). To quantify butane concentration, volumes of 0.1 ml headspace gas were withdrawn using N -flushed, gas-tight syringes. The gas samples were injected without a split into a Shimadzu GC-14B gas chromatograph, equipped with a Supel-Q PLOT column (30 m × 0.53 mm, 30 μm film thickness; Supelco, Bellefonte, USA) and a flame ionization detector. The oven temperature was maintained at 140 °C, and the injection and detection temperatures were maintained at 150 °C and 280 °C, respectively. The carrier phase was N at a flow rate of 3 ml min−1. Samples were analysed in triplicates. Butane concentrations were calculated based on an external calibration curve. Consortia from the Butane50 culture were visualized by Confocal Laser Scanning Microscopy (LSM 780, Zeiss, Germany) with an excitation light of 405 nm and an emission filter >463 nm, and by recording the maximum autofluorescence at 470 nm wavelength. Total DNA was extracted from 10 ml of the Butane50 culture pelleted via centrifugation (4,000 r.p.m. for 15 min; Eppendorf Centrifuge 5810R) using the FastDNA Spin Kit for Soil (MP Biomedicals) following the manufacturer’s protocols. Bacterial and archaeal 16S rRNA gene fragments were amplified using the primer pairs GM3/GM451 and Arch20F52/1492R53. Furthermore genes encoding canonical anaerobic hydrocarbon-activating enzymes including assA/masD (primer pairs 7757F-1, 7757F-2/8543R54) and bssA (primer pair 1213F/1987R55) were targeted for amplification. For amplification of assA, a mixture of forward primers was applied to improve diversity coverage54. Polymerase chain reactions (PCR) were performed in 20-μl volumes containing 0.5 μM of each primer solution, 7.5/6 μg bovine serum albumin solution, 250 μM deoxynucleoside triphosphate (dNTP) mixture, 1 × PCR reaction buffer (5Prime, Germany), 0.25U Taq DNA polymerase (5Prime) and 1 μl DNA template (25–50 ng). PCR reactions (Mastercycler; Eppendorf) included an initial denaturation step of 95 °C for 5 min followed by 34 cycles of denaturation (95 °C for 1 min.), annealing (1.5 min at 44 °C for bacterial 16S primers, or at 58 °C for archaeal 16S primers), and extension (72 °C for 3 min) and a final 72 °C step for 10 min. For amplification of genes encoding canonical hydrocarbon-activating enzymes, the protocol consisted of an initial denaturation step (95 °C for 5 min) followed by 34 cycles of denaturation (96 °C for 1 min), annealing (58 °C for assA primers and 55 °C for bssA primers, both for 1 min) and extension (72 °C for 2 min) ending with a final extension (72 °C for 10 min). All products were checked on 1% agarose gels, stained with ethidium bromide and visualized with UV light. Amplicons (archaeal and bacterial 16S rRNA gene) were purified (QIAquick PCR Purification Kit; Qiagen) and cloned in Escherichia coli (TOPO TA cloning Kit for sequencing; Invitrogen). Clones were screened by standard PCR procedure and positive inserts were sequenced using Taq cycle sequencing with ABI BigDye Terminator chemistry and an ABI377 sequencer (Applied Biosystems, Foster City, CA, USA). Representative full-length sequences were used for phylogenetic analysis using the ARB software package56 and the SSURef_NR99_115 SILVA database57. Phylogenetic trees of 16S rRNA genes were constructed with RAxML (version 7.7.2) using a 50% similarity filter and the GTRGAMMA model. An extended phylogenetic tree is provided as Supplementary Fig. 3. Branch support values were determined using 100 bootstrap replicates. From the Butane50 culture no masD/assA and bssA genes could be amplified. Cell aliquots were fixed for 2 h in 2% formaldehyde, washed and stored in phosphate buffered saline (PBS; pH = 7.4): ethanol 1:1. Samples were sonicated (30 s; Sonoplus HD70; Bandelin) and incubated in 0.1 M HCl (1 min) to remove potential carbonate precipitates. Aliquots were filtered on GTTP polycarbonate filters (0.2 μm pore size; Millipore, Darmstadt, Germany). CARD-FISH was performed according to Pernthaler et al.58 including the following modifications: cells were permeabilized with a lysozyme solution (0.5 M EDTA pH 8.0, 1 M Tris-HCl pH 8.0, 10 mg ml−1 lysozyme; Sigma-Aldrich) at 37 °C for 30 min and with a proteinase K solution (0.5 M EDTA, 1 M Tris/HCl, 5 M NaCl, 7.5 μM of proteinase K; Merck, Darmstadt, Germany) for 5 min at room temperature; endogenous peroxidases were inactivated by incubation in a solution of 0.15% H O in methanol for 30 min at room temperature. Specific 16S rRNA-targeting oligonucleotide probes used were SYNA-407 and HotSeep-1-145626, both applied at 20% formamide concentration. SYNA-407 was developed during this project using the probe design tool within the ARB software package to specifically detect Ca. Syntrophoarchaeum. The probe is highly specific for Ca. Syntrophoarchaeum and has at least one mismatch to non-target group sequences in the current database. The stringency of probe SYNA-407 was experimentally tested on the Butane50 culture using 10% to 40% formamide in the hybridization buffer. The sequence of the probe is: 5′-AGTCGACACAGGTGCCGA-3′. Three helpers were necessary: hSYNA-388 (5′-ACTCGGAGTCCCCTTATC-3′), hSYNA-369 (5′-CACTTGCGTGCATTGTAA-3′) and hSYNA-426 (5′-TATCCGGACAGTCGACAC-3′). Probes were purchased from Biomers (Ulm, Germany). In case of double hybridization, the peroxidases from the first hybridization were inactivated by incubating the filters in 0.30% H O in methanol for 30 min at room temperature. The hybridized archaeal and bacterial cells were stained by addition of the fluorochromes Alexa Fluor 594 and Alexa Fluor 488 for the two target organisms. Finally the filters were stained with DAPI (4′,6′-diamino-2-phenylindole) and analysed by epifluorescence microscopy (Axiophot II Imaging, Zeiss, Germany). Selected filters were analysed by confocal laser scanning microscopy (LSM 780, Zeiss, Germany). Genomic DNA was extracted from 15 ml of the Butane50 culture using the FastDNA Spin Kit for Soil (MP Biomedicals, Illkirch, France). For paired-end library preparation the TruSeq DNA PCR-Free Sample Prep Kit (Illumina) was used including the following modifications of the manufacturer’s guidelines. A total amount of 700 ng DNA (in 50 μl volume) was fragmented in 500 μl nebulization buffer (50% glycerol v/v, 35 mM Tris-HCl, 5 mM EDTA), using a Nebulizer (Roche), with a fragmentation time of 3 min, and applied pressure of 32 p.s.i. The fragmented DNA was purified via a MinElute purification column (Qiagen). Following end repair, the first size-selection step (removal of large DNA fragments) was done with a sample purification bead/H O mixture of 6/5 (v/v). For mate-pair library construction, genomic DNA was extracted from 35 ml Butane50 culture following the protocol after Zhou et al.59 with the following modifications: cells were collected by centrifugation of the culture aliquot (3,000g for 5 min). The pellet was resuspended in 450 μl of extraction buffer, homogenized in a tissue grinder and the mixture was freeze–thawed three times. Subsequently 1,350 μl of fresh extraction buffer and 60 μl of Proteinase K were added. In total, 1,370 ng of DNA were obtained and used for mate-pair library construction with the Illumina Nextera Mate Pair Sample Preparation Kit following the manufacturer’s guidelines with the following modifications: a total amount of 1.3 μg DNA was used and the fragmentation time was reduced to 15 min. Fragments of lengths between 4 kb and 9 kb were obtained on an agarose gel which were then used for further library preparation. Sequencing of both libraries was performed on a MiSeq 2500 instrument (Illumina; 2 × 300 cycles) using v3 sequencing chemistry. In total 4,460,548 and 21,182,518 reads were obtained for the paired-end and mate-pair library respectively. The paired-end Illumina reads were quality-trimmed after adaptor and contaminant removal using the bbduk tool in BBMap (version 34; http://sourceforge.net/projects/bbmap; minimum quality value of 20; minimum read length ≥50 bp). Overlapping paired-end reads were merged using bbmerge when overlap exceeded 20 bases without mismatches for reads ≥150 bp. The 16S rRNA based phylogenetic composition of the paired-end library was estimated using the software phyloFlash (https://github.com/HRGV/phyloFlash), which classifies reads taxonomically by mapping reads against the SSU SILVA 119 database using bbmap. For quantification, only unambiguously mapped reads were counted. For the mate-pair library, junctions, contaminants and external adaptors were removed using bbduk. Afterwards, the reads were quality trimmed (quality value ≥20 and minimum sequence length 50 bp). Bulk assembly of processed libraries was done with SPAdes (version 3.5.0 (ref. 60)) including the BayesHammer error correction step and using default k-mer size recommended for the read length (21, 33, 55, 77, 99, 127). The resulting scaffolds were analysed and binned using the Metawatt software (version 2.1 (ref. 61)), which analyses the GC content, coverage, open reading frames (ORF) and tetranucleotide pattern for each scaffold. The subsequent binning of the scaffolds was based on three different criteria: highly similar tetranucleotide frequency (98% confidence level), coherent taxonomic classification according to BlastP search of the translated ORFs and similar GC content and read coverage in the metagenome. Using the software RNAmmer62, the 16S rRNAs present in the bulk assembly were extracted to classify the different bins of the bulk assembly phylogenetically. Bins corresponding to the GoM-Arch87 group were selected and refined. The refinement started with a mapping of the raw reads (from complete libraries) to the selected bins (with a minimum identity of 90% the first time and 97% the next ones) using the bbmap tool from the BBMap package. The mapped reads were reassembled using SPAdes (same settings as for the bulk assembly), followed by binning in Metawatt. Contigs smaller than 1 kb were removed from the bin. The mate-pair read mapping information of the bin was used to create connectivity graphs using Cytoscape63, 64 and to remove poorly connected contigs. After bin refinement, its completeness was checked using AMPHORA265, which screens for 104 archaeal single copy genes; CheckM66, which analyses completeness and contamination based on lineage-specific marker sets, in our case Euryarchaeota and tRNAscan67, which screens for the different tRNA sequences. The final bins were used as draft genome of Ca. S. butanivorans and Ca. S. caldarius for automated gene annotation in RAST68 and genDB69 after gene prediction using Glimmer3.02 (ref. 70). After selecting the best annotation for each ORF using the automated annotation tool MicHanThi71, the GenDB results were visualized using the JCoast frontend72. All presented genes were manually curated afterwards. A HotSeep-1 bin was retrieved and annotated as described above for Ca. Syntrophoarchaeum. To compare our HotSeep-1 bin and the published draft genome of Ca. D. auxilii (CP013015), JSpecies1.2.1 (ref. 73) was used, which analyses the average nucleotide identity and the tetranucleotide frequency between two genomes. This method was also used to compare the two genome bins of Ca. Syntrophoarchaeum. Furthermore, the two HotSeep-1 strains were compared by checking the identity of the following genes: 16S rRNA, 23S rRNA, sulfate adenylyltransferase (sat), adenylylsulfate reductase subunit alpha (apr alpha), adenylylsulfate reductase subunit beta (apr beta) and dissimilatory sulfite reductase subunit alpha (dsr alpha) and of the internal transcribed spacer (ITS) region. To study genes encoding pili and cytochromes of HotSeep-1, genes of interest were identified. This selection was manually curated using Blastp and Pfam search. The subcellular localization of cytochromes was predicted using PSORTb (version 3.0.2 (ref. 74)). To search for canonical genes of hydrocarbon oxidation in the metagenome and the bins of Ca. S. butanivorans and Ca. S. caldarius, a protein database of anaerobic hydrocarbon oxidation genes was constructed. Full-length sequences from hydrocarbon degrading enzymes present in the Uniprot database were combined with recently published masD sequences47. These enzymes were AssA, BssA, MasD, the alpha subunit from naphtylmethylsuccinate synthase (Nms), the alpha subunit from a ring cleaving hydrolase (BamA), and pyruvate formate lyase (Pfl). The bulk assembly and the Ca. Syntrophoarchaeum draft genomes were searched against this database using Blastx with an E-value of 10−5. Triplicate Butane50 cultures and duplicates of Ca. D. auxilii cultures were grown on their respective substrates (butane or hydrogen). Two active Butane50 cultures were incubated with bromoethanesulfonate (BES, 5 mM final concentration) and as growth control, one culture remained untreated. To check the effect of BES on the bacterial partner alone, hydrogenotrophic grown Ca. D. auxilii cultures were also treated with 5 mM of BES. Sulfate-reducing activity was determined by sulfide measurements as described above. The McrA amino acid sequences in the genomes of Ca. S. butanivorans and Ca. S. caldarius were extracted from the genomic data, and used for a phylogenetic reconstruction. 124 reference McrA protein sequences longer than 450 amino acids from public databases were aligned with Muscle3.7 (ref. 75), accession numbers of these sequences are provided in the Supplementary Table 4. After manual refinement of the alignment a masking filter accounting the alignment ambiguity of each column was designed using the ZORRO software65. Phylogenetic trees were calculated using maximum likelihood algorithm RAxML (version 8.2.6 (ref. 76)) with the masking filter and the PROTGAMMA model with LG as amino acid substitution model and empirical base frequencies. These were the best-fitting conditions according to RAxML using both Akaian and Bayesian information criterion. To find the optimal tree topology 149 bootstraps were calculated according to the bootstrap convergence criterion of RAxML. To verify results of the presented phylogenetic affiliation, the phylogenetic analyses were repeated using IQ-TREE77 with LG+I+F+C20 as substitution model on the same alignment (Supplementary Fig. 1a). To avoid the possibility of long branch attraction, further partial McrA sequences of Bathyarchaeota (Supplementary Table 4) were included and only the McrA sequence regions common between the partial McrAs of Bathyarchaeota and our previous set of full-length sequences (>300 residues) was considered for phylogenetic analysis. First, it was confirmed that using these regions for phylogenetic analysis resulted in similar tree topology as using the full-length sequences by calculating a phylogenetic tree using RAxML (PROTGAMMALG+I+F) with the respective parts of all full-length sequences (the data set used in the previous phylogenetic analysis; Supplementary Fig. 1b). Then the partial sequences of Bathyarchaeota were included into the set to perform phylogenetic analysis of the common McrA sequence parts using both RAxML (PROTGAMMALG+I+F, Supplementary Fig. 1c) and IQ-tree (LG+I+F+C20, Supplementary Fig. 1d). Finally, to check if the overall tree topology was influenced by the deeply-branching SCAL_000352 sequence, a tree using RAxML (PROTGAMMALG+I+F) with only full-length sequences but excluding the SCAL_000352 sequence was constructed (Supplementary Fig. 1e). All resulting trees were plotted using the iTol webserver78. To test the correct genome assembly and to confirm the presence of four mcrA genes per bin, an mcrA clone library was constructed. For each of the eight mcrA genes found in the two Ca. Syntrophoarchaeum bins primer sets were developed, which were used for PCR amplification from Butane50 culture DNA (Supplementary Table 5). PCR reactions (20 μl volume) were performed containing 1 μM primer each, 200 μM dNTPs, 1 × PCR buffer, and 0.5 U DNA polymerase (TaKaRa Taq, TaKaRa Bio Europe, France) under the following conditions: initial denaturation at 95 °C for 5 min, followed by 39 cycles of denaturation (96 °C, 1 min), annealing for 1 min, elongation (72 °C, 2 min), and a final elongation step (72 °C, 10 min). For two primer sets, amplification was done with Phusion High-Fidelity DNA Polymerase (Thermo Fischer Scientific, Germany) using 50 μl reactions containing 1.5 mM MgCl , 3% (v/v) DMSO, 0.4 μM primer each, 50 μM dNTPs, 1 × PCR buffer, and 1 U DNA polymerase under the following conditions: initial denaturation at 98 °C for 30 s, followed by 39 cycles of denaturation (98 °C, 10 s), annealing for 30 s, elongation (72 °C, 50 s), and a final elongation step (72 °C, 10 min). For annealing temperatures for the individual primer sets see Supplementary Table 5. PCR resulted in multiple bands, therefore amplicons of expected size were excised from an 1% agarose gel and purified using the MinElute Gel extraction kit (Qiagen, Germany). DNA was ligated in a pGEM T-Easy vector (Promega, Madison, WI) and transformed into E. coli TOP10 cells (Invitrogen, Carlsbad, CA) according to the manufacturer’s recommendations. Sequencing was performed by Taq cycle sequencing using a vector-specific primer (M13F or M13R) with a model ABI377 sequencer (Applied Biosystems). Sequence data were analysed with the ARB software package56. Total RNA was extracted from 100 ml of an active Butane50 culture, which was kept at 50 °C during the whole procedure: first most medium (>90%) was replaced by butane gas, whereas the biomass remained at the bottom of the bottle. Then RNA was preserved by adding 90 ml preheated RNAlater (Sigma-Aldrich; 10:1 RNAlater vs sample) for 1 h. Subsequently this mixture was filtered through an RNA-free cellulose nitrate filter (pore size 0.45 μm; Sartorius; Göttingen, Germany). The filter was extracted in an RNase-free tube with glass beads and 600 μl of RNA Lysis Buffer (Quick-RNA MiniPrep, Zymoresearch, USA) applying bead beating (2 cycles of 6 m s−1 for 20 s). The lysate was cleared by centrifugation (10,000g; 1 min) and the supernatant was used for RNA extraction with the Quick-RNA MiniPrep Kit (Zymoresearch, Irvine, CA, USA) according to the manufacturer’s guidelines but omitting the on-column DNase treatment step. The RNA extract was cleaned from DNA by incubating it at 37 °C for 40 min with 10 μl of DNase I (DNase I recombinant, RNA-free; Roche Diagnostics, Mannheim, Germany), 7 μl of 10 × incubation buffer (Roche) and 2 μl of RNase-Inhibitor (Protector RNase Inhibitor, Roche Diagnostics, Mannheim, Germany). DNases were inactivated by heating for 10 min to 56 °C. Subsequently the RNA was purified with the RNeasy MinElute Cleanup Kit (QIAGEN, Hilden, Germany). In total, 450 ng of high-quality RNA was obtained. The TruSeq Stranded Total RNA Kit (Illumina) was used for RNA library preparation. The rRNA depletion step was omitted. Of the total RNA, 80 ng (in 5 μl volume) was combined with 13 μl of ‘Fragment, Prime and Finish mix’, for the RNA fragmentation step according to the Illumina TruSeq stranded mRNA sample preparation guide. Subsequent steps were performed as described in the sample preparation guide. The library was sequenced on a MiSeq instrument; with v3 sequencing chemistry in 2 × 75 cycles paired-end runs. The resulting reads were pre-processed including removal of adaptors and contaminants and quality trimming to Q10 using bbduk v34 from the BBMAP package. Trimmed reads were used to quantify the 16S rRNA gene based phylogenetic composition of the library by phyloFlash as described above for the DNA paired-end library. Trimmed reads were also mapped to the bins of interest (Ca. S. butanivorans, HotSeep-1) using bbmap with a minimum identity of 97%. The expression level of each gene was quantified by counting the number of unambiguously mapped reads per gene using featureCount79 with the –p option to count fragments instead of reads. To compare expression levels between genes, absolute fragment counts per genes were converted into fragments per kilobase of transcript per million mapped reads (FPKM80) as follows: where i denotes any specific gene, j denotes the sum of all the transcribed genes, C denotes counts and L denotes length (bp). For total protein analysis, the cells from 50 ml of grown (approximately 10 mM sulfide) Butane50 enrichment culture were harvested by centrifugation, frozen in liquid nitrogen and stored at −20 °C until analysis. The cell pellets were suspended in 30 μl of 50 mM ammonium bicarbonate buffer, and lysed by three 60 s freeze–thaw cycles between liquid nitrogen and +40 °C (thermal shaker, 1,400 r.p.m.). The cell lysate was incubated with 50 mM dithiothreitol at 30 °C for 1 h, followed by alkylation with 200 mM iodacetamide for 1 h at room temperature, in the dark, and trypsin digestion (0.6 μg trypsin, Promega) overnight at 37 °C. Peptides were desalted using C18 Zip Tip columns (Millipore), and analysed by nLC–MS/MS using an LTQ-Orbitrap mass spectrometer (Thermo Fisher Scientific) equipped with a nanoUPLC system (nanoAquity, Waters) as described previously81. Peptide identification was conducted by Proteome Discoverer (version 1.4.1.14, Thermo Fisher Scientific) using the Mascot search engine with the annotated metagenome of Ca. Syntrophoarchaeum as a database81. Peptides were considered to be identified by Mascot when a probability of 0.05 (probability-based ion score threshold of 40) was achieved. emPAI values calculated by Mascot for identified proteins were used as semi-quantitative measure to estimate the abundance of proteins in the analysed sample82. The mass spectrometry proteomics data have been deposited to the ProteomeXchange Consortium83 via the PRIDE partner repository84. To synthesize 1-butyl-CoM and 2-butyl-CoM, 5 g of coenzyme M (Na 2-mercaptoethanesulfonate, purity 98%; Sigma Aldrich) were dissolved in 40 ml of a 30% (v/v) ammonium hydroxide solution, in serum vials. Twice the molar amount of 1-bromobutane (purity 99%; Sigma Aldrich) or 2-bromobutane (purity 98%; Sigma Aldrich) were added, the serum bottles were closed with butyl rubber septa and incubated at room temperature with vigorous shaking (500 r.p.m.) for 4 h. The aqueous phase was separated from the excess hydrophobic 1- or 2-bromobutane via separatory funnels. Residual, dissolved 1- or 2-bromobutane was removed by bubbling with nitrogen. The solutions were analysed for the presence of 1-butyl-CoM or 2-butyl-CoM by FT-ICR-MS analysis without further purification. Both solutions contained a major m/z peak at 197.0311; no m/z peaks were indicative of free CoM, CoM dimers, 1- or 2-bromobutane being detected. Both standards were stable and no interconversion of isomers was observed. For preparation of cell extracts, volumes of 20 ml were collected from grown Butane50 cultures (sulfide concentrations of 14–15 mM) under anoxic conditions. The cells were harvested by centrifugation (10 min, 10,000 r.p.m., 4 °C), washed twice with a 100 mM ammonium bicarbonate solution, and finally suspended in 1 ml of acetonitrile/methanol/water solution (40:40:20 v/v). Glass beads (0.1 mm diameter, Roth) were added (0.3 g per tube), and the cells were lysed with a PowerLyzer 24 bench top bead-based homogenizer (MO BIO Laboratories, Carlsbad, CA) using 5 cycles of 2,000 r.p.m. for 50 s, with a 15 s pause between cycles. Prior to use, the glass beads were treated with 1N HCl solution and washed twice with deionized water. Glass beads and cell debris were removed by centrifugation, and the aqueous cell extracts were stored in glass vials at 4 °C until analysis. Authentic standards and cell extract samples were measured with ultra-high-resolution mass spectrometry (SolariX XR 12T Fourier transform ion cyclotron resonance mass spectrometer, Bruker Daltonics Inc., Billerica, MA) with negative electrospray ionization (capillary voltage: 4.5 kV) in direct infusion mode (4 μl min−1 and 0.1 s accumulation time). Spectra were recorded with a 2 MWord time domain (0.42 s transient length) between m/z 74 and 3,000 resulting in a mass resolution of approximately 250,000 at m/z 200. Instrument mass accuracy was linearly calibrated with low-molecular mass fatty acids (C4–C12) between 88 and 199 Da, resulting in an average root-mean square error of the calibration masses of 39 p.p.b. (n = 7). For each measurement, 64 (Butane50 samples), or 128 (controls) spectra were co-added (lock mass: 143.10775 m/z) and internally recalibrated with naturally present fatty acids. Collision induced fragmentation of m/z 197 was carried out after quadrupole isolation (10 Da window) with 12 V collision energy and 128 scans per measurement (lock mass: 199.17035 m/z). The 1-butyl-CoM and 2-butyl-CoM standards were diluted to approximately 10 μg ml−1 and checked for appropriate collision energy and fragment pattern. Fragment masses 89.0430 (C H S−) and 80.9652 (HSO −) were then used as indicative fragment for butyl-CoM in the cell extracts. The formation of an even-electron fragment HSO − from bisulfite is favoured when a beta H atom is present85. However, SO −• (m/z = 79.9674) was also produced upon fragmentation of the standards. Fragmentation information of the butyl-CoM standards was used to implement a UPLC–MS/MS method to validate the isomeric form of m/z 197.031 in the samples. A triple quadrupole mass spectrometer (Xevo TQ-S, Waters Cooperation, Manchester, UK) in negative electrospray ionization mode was used in multiple reaction monitoring (MRM) mode. Indicative butyl-CoM transitions (m/z 197 > 89 and m/z 197 > 81) were initially optimized (cone voltage and collision energy) by direct infusion of standard solutions into the mass spectrometer. The mass spectrometer was coupled to a UPLC (ACQUITY I-Class, Waters Cooperation Milford, MA, USA) equipped with a reversed phase column (HSS T3, 25 cm, Waters) and run with a binary gradient (1% methanol in water to 90% methanol) at a flow rate of 0.3 ml min−1. For each analysis, 10 μl were injected into the UPLC. Retention time, presence of both MRM transitions and relative ion ratios as compared to the standards were used as quality criteria. Hydrogen production in the Butane50 culture was measured by analysing the headspace of replicate incubations which were constantly agitated on a shaking table in a 50 °C incubator. The butane-dependent sulfide production (and therefore potential hydrogen production) was determined by tracking the sulfide production (as above) for 4 weeks. Gas phase (1 ml) was sampled with a gas-tight syringe to determine hydrogen concentrations (i) before changing the headspace, (ii) after exchanging the headspace in 30 min intervals for 6 h (iii) the next day, before and after addition of sodium molybdate solution (10 mM final concentration) to the culture to stop potential hydrogen-dependent sulfate reduction. Gas phase was immediately injected into a Peak Performer 1 gas chromatograph (Peak Laboratories, Palo Alto, CA) equipped with a reducing compound photometer. Development of hydrogen concentrations were converted into hydrogen production rates and compared with potential hydrogen production rates according to a stoichiometry of 4:1 (H production vs sulfate reduction). A 100 ml grown Butane50 culture was concentrated by centrifugation at 2,000 r.p.m. using a Stat Spin Microprep 2 table-top centrifuge. Aliquots were placed in aluminium platelets of 150 μm depth containing 1-hexadecen86. The platelets were frozen using a Leica EM HPM100 high-pressure freezer (Leica Mikrosysteme, Wetzlar, Germany). The frozen samples were transferred to an Automatic Freeze Substitution Unit (Leica EM AFS2) and substituted at −90 °C in a solution containing anhydrous acetone, 0.1% tannic acid for 24 h and in anhydrous acetone, 2% OsO , 0.5% anhydrous glutaraldehyde (Electron Microscopy Sciences, Ft. Washington, USA) for additional 8 h. After a further incubation over 20 h at −20 °C samples were warmed up to +4 °C and washed with anhydrous acetone subsequently. The samples were embedded at room temperature in Agar 100 (Epon 812 equivalent) at 60 °C over 24 h. Thin sections (80 nm) were examined using a Philips CM 120 BioTwin transmission electron microscope (Philips Inc. Eindhoven, The Netherlands). Images were recorded with a TemCam F416 CMOS camera (TVIPS, Gauting, Germany), for additional images see Supplementary Fig. 4. All sequence data are archived in NCBI database under the BioSample number SAMN05004607. Representative full-length 16S rRNA gene sequences of the clone library of the Butane50 culture have been submitted to NCBI under accession numbers KX812780– KX812802. Draft genomes of the Ca. Syntrophoarchaeum organisms can be found under the BioProject accession numbers PRJNA318983 (Ca. S. butanivorans) and PRJNA319143 (Ca. S. caldarius). Metagenomic and metatranscriptomic reads have been submitted to the short read archive under accession number SRS1505411. The mass spectra of the proteomic data set have been deposited to the ProteomeXchange Consortium with the data set identifier PXD005038.


The cell lines 8988T, MiaPaCa2, Tu8902, Panc1, MPanc96 and IMR90 were obtained from ATCC or the DSMZ. hPSCs (hPSC#1) have been previously described16. hPSC#2 was isolated from an untreated human PDAC resection and considered de-identified ‘surgical waste’ tissue under IRB approved protocols 03-189 and 11-104. Patients gave informed consent for tissue collection. Stromal cells that outgrew the cancer cells in culture were isolated by differential trypsinization and immortalized by infection with hTERT and SV40gp6 (Addgene plasmids #22396 and #10891, respectively) retro-viruses. These cells were kept in DMEM (Life Technologies 11965) supplemented with 10% FBS and 1% Pen/Strep (Life Technologies 15140). Primary human pancreatic cancer-associated fibroblasts were isolated from tumour resections in a similar manner as above, under IRB approved protocol STU 102010-051, but were not immortalized. Cells were kept in DMEM supplemented with 10% CCS (Thermo Scientific) and 1% Pen/Strep. PSCs were verified by measuring Desmin and SMA expression. HPDE have been previously described and grown as indicated26. All cells were routinely tested for mycoplasma by PCR and PDAC lines were typically authenticated by fingerprinting as well as visual inspection and carefully maintained in a centralized cell bank. mPSCs were isolated from normal mice pancreata and purified by centrifugation using a Nycodenz gradient and activated by in vitro culture, as described25. Black 6 (B6) mPSCs were generated from B6 females (Taconic, B6NTac) harbouring mouse PDAC. These animals were pre-treated with doxycycline diet and kept in doxycycline regimen for the duration of the experiment and were injected with 5 × 105 iKRAS mPDAC cells15 into the pancreas. Pancreatic tumours were resected at 2 weeks, digested in collagenase and dispase and mechanically minced. Cells were plated in cell culture dishes in DMEM (Gibco) with 15% FBS in the absence of doxycycline to limit the growth of iKRAS mouse PDAC cells. mPSCs were immortalized by infection with hTERT and SV40gp6 (Adgene plasmids #22396 and #10891, respectively) retro-viruses. Cells were kept in DMEM (Gibco) with 10% FBS and 1% Pen/strep. mCherry-hPSCs are hPSC#1 labelled with mCherry through infection with a lentivirus expressing mCherry. Conditioned medium was generated by adding fresh medium to cells at >50% confluence. Medium was harvested 48 h later and passed through 0.45-μm filters. For size cut-off experiments conditioned medium was filtered through 3-kDa cutoff columns (EMD Millipore, UFC900308). Concentrated (>3 kDa) medium was resuspended in a DMEM volume matching the initial medium volume. Boiled medium experiments were performed by heating conditioned medium at 100 °C for 15 min followed by filtration at 0.45 μm to remove precipitate. Freeze-thaw medium was treated by 3 consecutive cycles of 15 min at −80 °C followed by 15 min at 60 °C and then filtered to remove precipitate. The tandem fluorescence LC3-reporter stable hPSC cells were generated by retroviral infection of hPSCs with pBABE-puro mCherry-EGFP-LC3B (Addgene plasmid #22418). For autophagic flux quantification experiments, 7.5 × 104 hPSC-LC3 cells were plated in 12-well plates with cover slips and 3 × 105 PDAC or hPSC cells were added 4 h later. Cover slips were fixed in 4% paraformaldehyde (ThermoFisher, 28908) after cells had been in contact for 24 h. Coverslips were mounted in DAPI containing mounting solution (Life Technologies P36931). Cells were imaged on a Yokogawa Spinning Disk Confocal in FITC, RFP and DAPI channels. The ratio of red:yellow puncta was determined by counting puncta using the Cell Counter imageJ plugin. Oil-red O staining was performed on cells plated on glass cover slips and fixed 24 h after plating in 4% paraformaldehyde (Thermo-Fisher, 28908) for 15 min. Cells were rinsed with PBS followed by a rinse with 60% isopropanol and stained with freshly prepared Oil Red O working solution comprised of 3 ml of 0.5% solution (Sigma, O1391) and 2 ml of H O for 15 min, rinsed with 60% isopropanol and counterstained with Heamatoxylin. Cover slips were then washed in H O, mounted in Vectashield and imaged using a Leica DM2000 bright-field microscope. Growth curves were obtained as previously described19. Cell growth over 48 h was assessed in clear bottom 96-well plates (Costar 3603, Corning Incorporated) by CellTiter-Glo (Promega G7572) analysis 48 h post treatment with conditioned medium or metabolites and determined by the mean of at least three wells per condition. Luminescence was measured on a POLARstar Omega plate reader. OCR and ECAR experiments were performed using the XF-96 apparatus from Seahorse Bioscience. Cells were plated (16,000 cells per well for 8988T; 20,000 cells for Tu8902 or Panc-1; 50,000 cells for HPDE) in at least quadruplicate for each condition the day before the experiment. The next day, medium was completely replaced with conditioned medium (75 μl of conditioned medium and 25 μl of fresh medium) or fresh medium containing either 1 mM l-alanine (Sigma A7469), 1 mM of NEAAs (Gibco 11140), 1 mM glycine (Sigma G8790), 1 mM aspartate (Sigma A4534) or 1 mM cysteine (Sigma A9165). 20 h later, medium was replaced by reconstituted DMEM with 25 mM glucose and 2 mM glutamine (no sodium bicarbonate) adjusted to pH~7.4 and incubated for 30 min at 37% in a CO -free incubator. For the mitochondrial stress test (Seahorse 101706-100), oligomycin, FCCP and rotenone were injected to a final concentration of 2 μM, 0.5 μM and 4 μM, respectively. For the glycolysis stress test (Seahorse 102194-100), glucose, oligomycin and 2-deoxyglucose were injected to a final concentration of 10 mM, 2 μM and 100 mM, respectively. OCR and ECAR were normalized to cell number as determined by CellTiter-Glo analysis at the end of the experiments. Steady-state metabolomics experiments were performed as previously described14. Briefly, PDAC cell lines were grown to ~80% confluence in growth medium (DMEM, 2 mM glutamine, 10 mM glucose, 10% CCS) on 6 cm dishes in biological triplicate. A complete medium change was performed two hours before metabolite collection. To trace the effect of alanine on glutamine and glucose metabolism, PDAC cell lines were grown as above and then transferred into glutamine-free (with 10 mM glucose) or glucose-free (with 2 mM glutamine) DMEM containing 10% dialysed FBS and supplemented with either 2 mM U-13C-glutamine (± 1 mM alanine) or 10 mM U-13C-glucose (± 1 mM alanine), respectively, overnight. To trace alanine metabolism, PDAC cell lines were grown as above and then transferred into DMEM (with 10 mM glucose, 2 mM glutamine, 10% dialysed FBS) and supplemented with 1 mM U-13C-alanine overnight. Additionally, fresh medium containing the labelled metabolite was exchanged 2 h before metabolite extraction for steady-state analyses. To trace glucose metabolism in low-glucose conditions, cells were grown in 0.5 mM of glucose and medium was refreshed every 8 h for the 24 h labelling period to achieve steady-state labelling. For all metabolomics experiments, the quantity of the metabolite fraction analysed was adjusted to the corresponding protein concentration calculated upon processing a parallel well in a 6-cm dish. To collect labelled conditioned medium, hPSC or 8988T cells were grown for three passages in DMEM containing 10 mM U-13C-glucose, 2 mM U-13C-Gln and 10% dialysed FBS. This medium was then replaced by DMEM with unlabelled glucose, glutamine and 10% dialysed FBS, and incubated for 48 h, filtered and processed for metabolite extraction. Metabolite extraction of medium was performed by adding 200 μl of filtered fresh conditioned medium to 800 μl of cold (–80 °C) methanol, incubated at −80 °C for 30 min followed by centrifugation at 10,000g for 10 min at 4 °C. The resultant supernatant was lyophilized by speedvac and stored at −80 °C until analysis. Dried metabolite pellets were re-suspended in 20 μl LC–MS grade water, 5 μl were injected onto a Prominence UFLC and separated using a 4.6 mm i.d. × 100 mm Amide XBridge HILIC column at 360 μl per minute starting from 85% buffer B (100% ACN) to 0% B over 16 min. Buffer A: 20 mM NH OH/20 mM CH COONH (pH = 9.0) in 95:5 water/ACN. 287 selected reaction monitoring (SRM) transitions were captured using positive/negative polarity switching by targeted LC-MS/MS using a 5500 QTRAP hybrid triple quadrupole mass spectrometer. For kinetics of metabolite secretion by hPSCs, triplicate samples of subconfluent hPSCs cultured under normal conditions were changed to fresh DMEM with 10% dialysed FBS, which was allowed to condition for 2, 4, 8, 24, 48, or 72 h. Fresh DMEM with 10% dialysed FBS was used as a blank control. Metabolites were then extracted from conditioned medium by adding ice cold 100% MeOH to a final concentration of 80% MeOH. For PDAC metabolite uptake kinetics, conditioned DMEM with 10% dialysed FBS from subconfluent hPSCs was collected after 48 h of culture, and then filtered through a 0.45 μm filter. 8988T PDAC cells were plated in triplicate and treated with the PSC-conditioned medium or fresh DMEM with 10% dialysed FBS for 1, 2, 4, 8, or 24 h. The medium was removed and the cell lysate harvested with ice cold 80% MeOH. The soluble metabolite fractions were cleared by centrifugation, dried under nitrogen, then resuspended in 50:50 MeOH:H O mixture for LC–MS analysis. For the kinetic analyses, a Shimadzu Nexera X2 UHPLC combined with a Sciex 5600 Triple TOFMS was used, which was controlled by Sciex Analyst 1.7.1 instrument acquiring software. A Supelco Ascentis Express HILIC (7.5 cm × 3 mm, 2.7 μm) column was used with mobile phase (A) consisting of 5 mM NH OAc and 0.1% formic acid; mobile phase (B) consisting of 98% CAN, 2% 5 mM NH OAc and 0.1% formic acid. Gradient program: mobile phase (A) was held at 10% for 0.5 min and then increased to 50% in 3 min; then to 99% in 4.1 min and held for 1.4 min before returning initial condition. The column was held at 40 °C and 5 μl of sample was injected into the LC–MS with a flow rate of 0.4 ml/min. Calibrations of TOFMS were achieved through reference APCI source with average mass accuracy of less than 5 ppm except for alanine, which was 20 ppm. Key MS parameters were the collision energy and spread of 25 eV and 10 eV for positive product ion acquisition and −35 eV and 15 eV for negative acquisition. 100 MRM transitions were set on the MS method. Data Processing Software included Sciex PeakView 2.2, MasterView 1.1, LibraryView (64 bit) and MultiQuant 3.0.2. For analysis of palmitate and stearate, PDAC cells in log growth were labelled in biological quadruplicate with either 5.5 mM U-13C-glucose or 1 mM U-13C-Ala in DMEM containing 2 mM glutamine and 10% dialysed FBS for 3 days. Unlabelled species were used at equivalent concentrations, where relevant. Labelled medium was refreshed every day. At 72 h, medium was refreshed for 2 h, and samples were collected by quick rinse in ddH O followed by liquid nitrogen quenching directly on cells. Plates were then stored at −80 °C before extraction. Polar metabolites and fatty acids were extracted using methanol/water/chloroform, as described27. Samples were placed on ice and 10 μl of 1.2 mM D27 myristic acid as internal standard was introduced to each cell plate. 400 μl of cold water and 400 μl of methanol were added to each sample. Cells were collected in a centrifuge tube and 400 μl of ice-cold chloroform was added to each tube. Extracts were vortexed at 4 °C for 30 min and centrifuged at 14,000xG for 20 min at 4 °C. The lower (organic) phase was recovered, and samples were nitrogen dried before reconstitution in 50 μl of Methyl-8 reagent (Thermo) at 60 °C for 1 h to generate fatty acid methyl esters (FAMEs). GC–MS analysis was performed using an Agilent 7890A GC equipped with a 30 m DB-5MS+DG capillary column and a Leap CTC PAL ALS as the sample injector. The GC was connected to an Agilent 5975C quadrupole MS operating under positive electron impact ionization at 70 eV. Tunings and data acquisition were done with ChemStation E.02.01, PAL Loader 1.1.1, Agilent Pal Control Software Rev A and Pal Object Manager updated firmware. MS tuning parameters were optimized so that PFTBA tuning ion abundance ratios of 69:219:512 were 100:114:12, increasing high ion abundance. Agilent Fiehn retention time locking (RLT) GC method was used and calibrated with standard FAMEs (Agilent) and confirmed with Agilent G1677AA Fiehn GC/MS metabolomics RTL Library. For measurement of FAMEs, the GC injection port was set at 250 °C and GC oven temperature was held at 60 °C for 1 min and increased to 320 °C at a rate of 10 °C/minute, then held for 10 min under constant flow with initial pressure of 10.91 psi. The MS source and quadrupole were held at 230 °C and 159 °C, respectively, and the detector was run in scanning mode, recording ion abundance in the range of 35–600 m/z with solvent delay time of 5.9 min. Data extraction was done with Agilent MassHunter WorkStation Software GCMS Quantitative Analysis Version B.07. Additional isotope correction was performed using an in-house software tool from MATLab28. All 13C isotopic reagents were purchased from Cambridge Isotope Laboratories. Total RNA was extracted using TRIzol (Invitrogen) and reverse transcription was performed from 2 μg of total RNA using oligo-dT and MMLV HP reverse transcriptase (Epicentre), according to the manufacturer’s instructions. Quantitative RT–PCR was performed with SYBR Green dye using an Mx3000PTM instrument (Stratagene). PCR reactions were performed in triplicate and the relative amount of cDNA was calculated by the comparative CT method using the 18S ribosomal or actin RNA sequences as a control. LC3B (Novus Biologicals NB100-2220) was used for IF at a 1:200 dilution. Secondary anti-rabbit–GFP antibody (Invitrogen A21206) was used at 1:200. For western blot ATG5 (Novus Biologicals NB110-53818), ATG7 (Sigma A2856), β-actin (Sigma A5441), LC3B (Novus Biologicals NB600-1384), RFP (Rockland 600-401-379), and secondary HRP conjugated anti-rabbit (Thermo-Fisher, 31460) and anti-mouse (Thermo-Fisher 31430) antibodies were used, as described14. For IHC analysis, αSMA (Dako M0851) was used at 1:500 followed by anti-mouse–HRP secondary antibody (Vector labs PK6101). shRNA vectors were obtained from the RNA Interference Screening Facility of Dana-Farber Cancer Institute. The sequences and/or RNAi Consortium clone IDs for each shRNA are as follows: shGFP: GCAAGCTGACCCTGAAGTTCAT (Addgene plasmid #30323); shATG5 #1: TRCN0000150645 (sequence: GATTCATGGAATTGAGCCAAT); shATG5 #2: TRCN0000150940 (sequence: GCAGAACCATACTATTTGCTT); shATG7 #1: TRCN0000007584 (sequence: GCCTGCTGAGGAGCTCTCCAT); shATG7 #2: TRCN0000007587 (sequence: CCCAGCTATTGGAACACTGTA); shGPT1 #1: TRCN0000034979 (sequence: GCAGTTCCACTCATTCAAGAA); shGPT1 #2: TRCN0000034983 (sequence: CTCATTCAAGAAGGTGCTCAT); shGPT2 #1: TRCN0000035024 (sequence: CGGCATTTCTACGATCCTGAA); shGPT2 #2: TRCN0000035025 (sequence: CCATCAAATGGCTCCAGACAT). Mouse shATG5: TRCN0000099430 (sequence: GCCAAGTATCTGTCTATGATA); mouse shATG7 TRCN0000092163 (sequence: CCAGCTCTGAACTCAATAATA). Sequences for qPCR primers are as follows: αSMA_Fw, GTGTTGCCCCTGAAGAGCAT, αSMA_Rv: GCTGGGACATTGAAAGTCTCA, Desmin_Fw: TCGGCTCTAAGGGCTCCTC, Desmin_Rv: CGTGGTCAGAAACTCCTGGTT, GPT1_Fw: GTGCGGAGAGTGGAGTACG, GPT1_Rv: GATGACCTCGGTGAAAGGCT, GPT2_Fw: CATGGACATTGTCGTGAACC, GPT2_Rv: TTACCCAGGACCGACTCCTT. Mitochondrial stress test (Seahorse 101706-100) and glycolysis stress test (Seahorse 102194-100) kits were purchased from Seahorse Bioscience. NAD+/NADH kit was purchased from Biovision (Biovision K337-100) and used according to the manufacturer’s instructions. Statistical analysis was done using GraphPad PRISM software. No statistical methods were used to predetermine sample size. When comparing multiple groups with more than one changing variable (for example, experiments where cells were treated with different shRNAs and with different conditioned media) a two-way ANOVA test was performed. For experiments where we analysed one variable for multiple conditions, a one-way ANOVA was performed. In both cases, ANOVA analyses were followed by Tukey’s post hoc tests to allow multiple group comparisons. Survival curve statistical analysis was performed using the log-rank (Mantel–Cox) test. When comparing two groups to each other, a Student’s t-test (unpaired, 2-tailed) was performed. Groups were considered significantly different when P < 0.05. The relevant calculated P values are reported in Supplementary Information, where detailed statistical information for each experiment can also be found. Tumours were identified and dimensions and volume were measured as previously described using high-resolution ultrasound (Vevo 770)29. Briefly, mice were anaesthetized using 3% isoflurane, and abdominal fur was removed using fine clippers and depilatory cream. Pre-warmed sterile saline (100–200 μl) was administered via intraperitoneal injection. Ultrasound gel was applied over the abdominal area and the ultrasound transducer was used to identify abdominal landmark organs (liver/spleen) followed by the pancreas and the tumour. Once identified, the transducer was transferred to the 3D motor stage and a 3D scan was performed for measurement of tumour dimensions and volume. Tumour volumes were contoured as described29. To determine cell viability in starved conditions, cells were plated in complete medium at 50% confluency. Once the cells were attached, medium was replaced with serum-free DMEM. 48 h later, cells were trypsinized, re-suspended in their own medium, diluted in trypan blue (Thermo-scientific 15250061) and counted using a haematocytometer. The percentage of dead cells was determined by trypan blue incorporation. Xenograft studies were performed as described previously14. Briefly, 2 × 105 8988T or MiaPaCa2 cells were either injected alone or co-injected into the flanks of nude female mice at 6 weeks of age (Taconic ncrnu-f) with 1 × 106 hPSCs previously infected with shGFP, shATG5 or shATG7 shRNAs under protocol 10-055. Tumour take was monitored visually and by palpation bi-weekly. Tumour diameter and volume were calculated based on caliper measurements of tumour length and height using the formula tumour volume = (length × width2)/2. Animals were considered to have a tumour when the maximal tumour diameter was over 2 mm. For syngeneic orthotopic injections, black6 female mice at 12 weeks of age (Taconic B6NTac), pre-conditioned with doxycycline diet and kept in doxycycline regimen for the duration of the experiment, were injected in the pancreas with 1 × 105 iKRAS mPDAC cells isolated from a pure black6 PDAC GEMM (KrasG12D, P53 L/+)15 either alone or co-injected with 5 × 105 mPSCs that were previously infected with shGFP, shATG5 or shATG7 shRNAs (or mPSC–shGFP was used alone as a negative control). Briefly, an incision was made on the flank, above the spleen. The spleen was identified and gently pulled out through the incision to expose the pancreas. 10 μl of cell suspension containing 20% of Matrigel (BD-Biosciences 354234) was injected in the tail of the pancreas using a Hamilton syringe that was held in place for 30 s to allow Matrigel polymerization. The spleen and pancreas were carefully re-introduced in the animal and the peritoneum sutured. The wound was clipped with surgical staples and the animals were allowed to recover for 1 week until the beginning of weekly ultra-sound monitoring of tumour take and progression. Human PDAC orthotopic injections were performed in a similar way, by injecting 5 × 105 MiaPaCa2 and/or 1 × 106 hPSC #1 infected with shGFP, shATG5 or shATG7 shRNAs into the tail of the pancreas of nude female mice (Taconic ncrnu-f) at 8 weeks of age. Animals were considered as tumour-positive when a mass detected in the pancreas reached a volume of at least 1 mm3 as calculated by 3D ultrasound. All animal studies were not blinded or randomized. Studies were performed under DFCI IACUC protocol # 10-055, where the maximal tumour size allowed is less than 2 cm.


Risticevic S.,University of Waterloo | Chen Y.,Supelco | Kudlejova L.,University of Waterloo | Vatinno R.,University of Waterloo | And 4 more authors.
Nature Protocols | Year: 2010

Ever since the invention of gas chromatography (GC), numerous efforts within the chromatographic community have been directed toward the development of fast GC methods. However, the developments in high-speed GC technologies have simultaneously created demand for the availability of compatible detection and sample preparation methods, so that the speed of the overall analytical process is increased. Solid phase micro extraction (SPME) is a sample preparation technique developed to address the need for rapid sample preparation. Therefore, the objective of this protocol is to outline recent developments in SPME technology that can be applied toward high-throughput automated qualitative and quantitative analyses of volatile and semivolatile compounds in wine samples. The use of this protocol facilitates routine high-throughput determinations of 200-500 analytes of different physicochemical properties with SPME step requiring only 10-15 min per sample. © 2009 Nature Publishing Group.


Chen Y.,Supelco | Sidisky L.M.,Supelco
Analytica Chimica Acta | Year: 2014

A modified Rheodyne 7520 microsample injector was used as a new solid phase microextraction (SPME)-liquid chromatography (LC) interface. The modification was focused on the construction of a new sample rotor, which was built by gluing two sample rotors together. The new sample rotor was further reinforced with 3 pieces of stainless steel tubing. The enlarged central flow passage in the new sample rotor was used as a desorption chamber. SPME fiber desorption occurred in static mode. But all desorption solvent in the desorption chamber was injected into LC system with the interface. The analytical performance of the interface was evaluated by SPME-LC analysis of PAHs in water. At least 90% polycyclic aromatic hydrocarbons (PAHs) were desorbed from a polyacrylonitrile (PAN)/C18 bonded fuse silica fiber in 30s. And injection was completed in 20s. About 10-20% total carryovers were found on the fiber and in the interface. The carryover in the interface was eliminated by flushing the desorption chamber with acetonitrile at 1mLmin-1 for 2min. The repeatability of the method was from 2% to 8%. The limit of detection (LOD) was in the mid pgmL-1 range. The linear ranges were from 0.1 to 100ngmL-1. The new SPME-LC interface was reliable for coupling SPME with LC for both qualitative and quantitative analysis. © 2014 Elsevier B.V.


Chen Y.,Supelco | Shirey R.E.,Supelco | Sidisky L.M.,Supelco
Chromatographia | Year: 2010

A solid phase microextraction-gas chromatography-mass spectrometry method was developed to determine diacetyl in butter samples. The extraction was performed for 5 min at 37 °C using a polydimethylsiloxane/divinyl benzene fiber. The method had a linear range of 0.024-11.2 ppm with limit of detection of 0.0078 ppm. Air sampling of diacetyl using solid phase microextraction was also developed to estimate diacetyl concentration in air. The extraction was performed by exposure of a polydimethylsiloxane fiber to air for 2 min. This method had linear range of 0.2-22 ppm (v/v) with limit of detection of 0.05 ppm. © 2010 Vieweg+Teubner Verlag | Springer Fachmedien Wiesbaden GmbH.


Chen Y.,Supelco | Sidisky L.M.,Supelco
Analytica Chimica Acta | Year: 2012

Modifications were made on commercial SPME fiber assembly and SPME-LC interface to improve the applicability of SPME for LC. Polyacrylonitrile (PAN)/C18 bonded fuse silica was used as the fiber coating for LC applications because the fiber coating was not swollen in common LC solvents at room temperature. The inner tubing of SPME fiber assembly was replaced with a 457 μm outside diameter (o.d.) solid nitinol rod. And the coated fiber (o.d. 290 μm) was installed onto the nitinol rod. The inner diameter (i.d.) of the through hole of the ferrule in the SPME-LC interface was enlarged to 508 μm to accommodate the nitinol rod. The much larger inner rod protected the fiber coating from being stripped when the fiber was withdrawn from the SPME-LC interface. The system was evaluated in term of pressure test, desorption optimization, peak shape, carryovers, linear range, precision, and limit of detection (LOD) with polycyclic aromatic hydrocarbons (PAHs) as the test analytes. The results demonstrated that the improved system was robust and reliable. It overcame the drawbacks, such as leak of solvents and damage of fiber coatings, associated with current SPME fibers and SPME-LC interface. Another sealing mechanism was proposed by sealing the nitinol rod with a specially designed poly(ether ether ketone) (PEEK) fitting. The device was fabricated and tested for manual use. © 2012 Elsevier B.V.


Furaneol is an important aroma compound. It is very difficult to extract furaneol from food matrices and separate it on a gas chromatography column due to its high polarity and instability. A new quantitative method was developed to quantify furaneol in aqueous samples by the use of derivatization/solid phase microextraction (SPME) coupled with gas chromatography/mass spectrometry (GC/MS). The derivatization was carried out by reacting pentafluorobenzyl bromide with furaneol in basic solutions at elevated temperatures. The derivative was stable and less polar so that SPME-GC/MS could be applied for extraction, separation and detection. The automated analytical method had a limit of detection (LOD) of 0.5ngmL-1, a limit of quantification (LOQ) of 2ngmL-1, a repeatability of 9.5%, and a linear range from 2 to 500ngmL-1. The method was applied to analyze fruit samples. And it was found that the concentrations of furaneol in tomato ranged from 95 to 173μgkg-1, in strawberries ranged from 1663 to 4852μgkg-1. The results were verified with a LC procedure. To facilitate analytical method development, some physico-chemical parameters for furaneol were determined in this work. Its solubility in water was determined as 0.315gmL-1 (25°C). Its LogD in water and LogP in 0.1M phosphate buffer were -0.133 and 0.95 (20°C), respectively. Its pKa was 8.56 (20°C). © 2011 Elsevier B.V.

Loading Supelco collaborators
Loading Supelco collaborators