Seoul, South Korea
Seoul, South Korea

Sungkyunkwan University is a private research university with campuses in Seoul and Suwon. Originally, it was founded in 1398 by the Joseon Dynasty located in the heart of central Seoul. It was authorized as Sungkyunkwan, the foremost educational institution of Joseon, by the great code of the state administration pertaining to the royal assent.Today, the university has two campuses: the Humanities and Social science Campus in Seoul, and the Natural science Campus in Suwon. Eighteen schools and three colleges offer degrees at the bachelor's level, and twelve graduate schools confer various degrees at both the masters and doctoral levels. SKKU offers Korea’s first fully English-taught Global MBA program, which has gained tremendous international recognition. SKKU also has one of the best medical schools in South Korea, which is affiliated with the world-famous Samsung Medical Center. Samsung partnered with SKKU in the period of 1965-1977 and took up its partnership in 1996. Recent years have seen a trend of SKKU rising in university rankings, consistently placing in the top 5 nationally. Wikipedia.


Time filter

Source Type

Patent
Sungkyunkwan University | Date: 2016-08-11

The present disclosure relates to a lung phantom system provided with an elastic film that separates a first chamber and a second chamber having inner space that may be filled with liquid, the elastic film configured to repeat expansion and restoration according to introduction and discharge of liquid, thereby providing an effect of accurately replicating movements of an actual lung during its respiratory movement.


There is provided a novel polymer including a repeating unit expressed as a following formula 1: where each of R_(1 )and R_(2 )independently represents an alkylene group with 2 to 6 carbon atoms, and each of n and m independently represents 10 to 10,000.


The present disclosure relates to a method for producing a sewage sludge-derived bio-heavy oil and the bio-heavy oil produced by the method, the method including breaking organic materials included in the sewage sludge into small molecules and removing oxygen at the same time using a supercritical state alcohol as a solvent and reaction medium, thereby effectively providing a bio-heavy oil with low oxygen content and high energy content.


Patent
Samsung and Sungkyunkwan University | Date: 2016-07-28

A method of manufacturing a MXene nanosheet includes removing an A atomic layer from an inorganic compound having a formula of M_(n+1)AX_(n )to form a nanosheet, the nanosheet having a formula of M_(n+1)X_(n)T_(s), and reducing the nanosheet having a formula of M_(n+1)X_(n)T_(s)to form an MXene nanosheet, the MXene nanosheet having a formula of M_(n+1)X_(n), wherein M is at least one of Group 3 transition metal, Group 4 transition metal, Group 5 transition metal, and Group 6 transition metal, A is at least one of a Group 12 element, Group 13 element, Group 14 element, Group 15 element and Group 16 element, X is one of carbon (C), nitrogen (N) and a combination thereof, T_(s )is one of oxide (O), epoxide, hydroxide (OH), alkoxide having 1-5 carbon atoms, fluoride (F), chloride (Cl), bromide (Br), iodide (I), and a combination thereof, and n is one of 1, 2 and 3.


A method of outputting color code for data communication to a display screen, the method includes determining a plurality of sections having a predetermined order of a display screen, mapping the plurality of sections to different binary numbers each having at least one-bit length, and outputting a predetermined color to consecutive sections including at least a first section among the plurality of sections in a direction of the predetermined order or a reverse direction of the predetermined order. The color output to the consecutive sections represents binary numbers in which 0 or 1 is added to a front or end of designated binary numbers in the direction of the predetermined order or the reverse direction of the predetermined order, the designated binary numbers mapped to a last section among the consecutive sections in the direction of the predetermined order or the reverse direction of the predetermined order.


Patent
Samsung and Sungkyunkwan University | Date: 2016-03-29

A receiver is provided, which includes an antenna configured to receive a plurality of superposition coded signals from a plurality of base stations; and a signal processor configured to perform decoding of a plurality of layer signals included in the superposition coded signals by decoding an uppermost layer signal among the layer signals through applying Gaussian approximation only to remaining layer signals except an upper layer signal which is a next uppermost layer signal among the layer signals.


A method of performing one-time password (OTP) authentication using a color code is provided. The method includes generating, by an OTP terminal and an authentication server, an OTP using a reference time, generating, by the OTP terminal, a color code corresponding to a binary code representing the OTP, displaying, by a display device, the color code, obtaining, by a camera, the displayed color code, decoding, by the authentication server, the obtained color code into the color code and generating a password which refers to the decoded binary code, and performing, by the authentication server, authentication by comparing the generated OTP and the password.


Patent
Sungkyunkwan University | Date: 2016-06-28

Provided are an atomic layer junction oxide, a method of preparing the atomic layer junction oxide, and a photoelectric conversion device including the atomic layer junction oxide.


Patent
Sungkyunkwan University | Date: 2016-08-11

The present disclosure provides an achromatic colorimetric nanosensor, by using a mixture of nanoparticles with complementary colors. The color changes from an achromatic color to a chromatic color enables more clear color-transition and, thus, allows immediate analysis of the presence of a target analyte. Further, the present disclosure provides achromatic colorimetric nanosensor for detection of multiple analytes using plural nanoparticles via color changes from an achromatic to multiple chromatic colors.


Patent
LG Corp and Sungkyunkwan University | Date: 2015-02-10

The present invention relates to the manufacturing of a heteroelement thin film, and particularly to a method for manufacturing a metal chalcogenide thin film and the thin film manufactured thereby. The present invention, which relates to a method for manufacturing a metal chalcogenide thin film, may comprise the steps of: supplying a vaporized metal precursor; supplying a chalcogen-containing gas; and forming a thin film by reacting the metal precursor with the chalcogen-containing gas on a growth substrate at a first temperature condition.


Patent
Sungkyunkwan University | Date: 2016-09-09

The present disclosure relates to a tactile sensor including a first substrate on which a first electrode is formed; a second substrate on which a second electrode and a coupling hole is formed so that the first electrode may be inserted into the coupling hole; and a dielectric covering the first electrode and the second electrode, and thus not only having flexibility and elasticity, but also requiring a reduced number of wires to be used when sending and receiving signals, making it is easier to manufacture and saving costs.


Patent
Samsung and Sungkyunkwan University | Date: 2016-08-31

A condensed cyclic compound and an organic light-emitting device including the same, the condensed cyclic compound being represented by the following Formula 1:


A graphene electronic device includes a gate insulating layer on a conductive substrate, a channel layer on the gate insulating layer, and a source electrode on one end of the channel layer and a drain electrode on another end of the channel layer. The channel layer includes a semiconductor layer and a graphene layer in direct contact with the semiconductor layer, and the graphene layer includes a plurality of graphene islands spaced apart from each other.


A power amplification apparatus includes a multiple output bias voltage generation unit, a dynamic bias modulator, and a power amplifier. The multiple output bias voltage generation unit generates first and second bias voltages using an inductor coupled between an input voltage and a plurality of capacitors. The capacitors are connected to the inductor in a non-overlapping manner. The dynamic bias modulator outputs the first bias voltage or the second bias voltage as a variable bias voltage based on results of comparing voltage of an envelope signal of a radio frequency (RF) signal to an envelope reference voltage. The power amplifier is biased in response to the variable bias voltage, amplifies power of the RF signal, and outputs the amplified RF signal to an antenna.


Patent
Sungkyunkwan University and Global Frontier Center For Multiscale Energy Systems | Date: 2017-03-01

The present disclosure relates to a precursor for producing a Perovskite, a method of preparing the same, a solar cell including the Perovskite prepared by using the precursor for producing a Perovskite, and a method of preparing the solar cell.


Patent
Samsung and Sungkyunkwan University | Date: 2017-04-05

A thermoelectric structure that may be included in a thermoelectric device may include a thin-film structure that may include a plurality of thin-film layers. The thin-film structure may include Tellurium. The thin-film structure may be on a substrate. The substrate may include an oxide, and a buffer layer may be between the substrate and the thin-film structure. The thermoelectric structure may be manufactured via depositing material ablated from a target onto the substrate. Some material may react with the substrate to form the buffer layer, and thin film layers may be formed on the buffer layer. The thin film layers may be removed from the substrate and provided on a separate substrate. Removing the thin-film layers from the substrate may include removing the thin-film layers from the buffer layer.


Patent
Sungkyunkwan University and Global Frontier Center For Multiscale Energy Systems | Date: 2017-03-01

The present disclosure relates to a Perovskite solar cell and a method of preparing the Perovskite solar cell.


Lee K.-T.,Sungkyunkwan University | Mun G.-H.,Sungkyunkwan University
Annals of Surgical Oncology | Year: 2017

Background: Despite an expanding role of adjuvant radiotherapy and the popularity of two-stage prosthesis-based reconstruction in the treatment of breast cancer, there is no consensus on the proper timing of postmastectomy radiotherapy (PMRT) in relation to the two stages of the reconstruction procedure. The present meta-analysis investigated the optimum timing of PMRT by comparing the outcomes of the following two sequences: radiation on tissue expander followed by the exchange, and radiation on the permanent implant after the exchange. Methods: The Medline, Ovid, and Google Scholar databases were searched to identify relevant studies presenting complication rates of the two sequencings. The relative risks of the adverse outcomes between the groups were calculated. Results: A total of eight studies were analyzed, representing 899 cases. There were no prospective randomized controlled trials, and all but one were retrospective cohorts in nature. The risks for reconstruction failure and major complication requiring reoperation tended to be higher in the group with PMRT to tissue expanders compared to that with PMRT to implants; however, the differences were not significant. The group with PMRT to tissue expanders had a significantly lower risk of severe capsular contracture (relative risk, 0.44; P < 0.001). Conclusions: Delivering PMRT to tissue expanders can reduce the risk of severe capsular contracture compared to delivering to implants. No significant differences in the risks of other complications, including reconstruction failure between the two sequencings, were detected; however, as a result of low level of evidence and insufficient sample sizes, further studies are needed to support evidence-based decision making. © 2017, Society of Surgical Oncology.


OBJECTIVE:: To assess the impact of targeted interventions on trends in central line-associated bloodstream infection. DESIGN:: A before-and-after study between January 2013 and September 2014. SETTING:: Tertiary hospital in the Republic of Korea. PATIENTS:: All patients with central-line catheters in the hospital. INTERVENTIONS:: In September 2013, interventions that targeted central line insertion practices were implemented in 10 ICUs, including compliance monitoring with a central line insertion practices bundle and use of an all-inclusive catheter kit. The impact of targeted interventions on trends in central line-associated bloodstream infection was evaluated by segmented autoregression analysis of an interrupted time series. MEASUREMENTS AND MAIN RESULTS:: The average hospital-wide central line-associated bloodstream infection rates in the baseline and intervention periods were 1.84 and 1.56 per 1,000 catheter-days, respectively. During the baseline period, there was an increase of central line-associated bloodstream infection rate of 0.12 per 1,000 catheter-days per month. In the intervention period, there was a decrease of central line-associated bloodstream infection rate of 0.16 per 1,000 catheter-days per month (change in slope, –0.28; 95% CI, –0.37 to –0.19; p < 0.0001). In ICUs, the average central line-associated bloodstream infection rates in the baseline and intervention periods were 1.92 and 1.64 per 1,000 catheter-days, respectively. During the baseline period, there was an increase of central line-associated bloodstream infection rate of 0.18 per 1,000 catheter-days per month in ICUs. After sequential-targeted interventions, there was a decrease of central line-associated bloodstream infection rate of 0.16 per 1,000 catheter-days per month (change in slope, –0.34; 95% CI, –0.50 to –0.18; p= 0.0007). CONCLUSIONS:: Targeted interventions were associated with significant changes in trends in the occurrence rate of central line-associated bloodstream infection in ICUs and the entire hospital. Copyright © by 2017 by the Society of Critical Care Medicine and Wolters Kluwer Health, Inc. All Rights Reserved.


Lee J.,Sungkyunkwan University
The American journal of managed care | Year: 2015

OBJECTIVES: To assess the combined impact of electronic health record (EHR) adoption and hospitalist care on length of stay (LOS).STUDY DESIGN: Retrospective cohort study using data from the Healthcare Information and Management Systems Society and a 5% national sample of Medicare beneficiaries. Patients included 20,862 admissions for respiratory disease cared for by hospitalists, and 28,714 admissions for respiratory disease cared for by nonhospitalists in 2985 general and surgical hospitals in the United States.METHODS: The interaction effect of EHR and hospitalist care on LOS was evaluated using generalized linear models with log-link normal distribution after controlling for patient and hospital characteristics.RESULTS: In multivariable analyses controlling for patient and hospital characteristics, we found that the reduced LOS associated with complete EHR was 0.166 days and was statistically significant in the hospitals in which 50% or less of patients were cared for by hospitalists. Moreover, we found that reductions in LOS associated with hospitalist care were greater in hospitals that had not adopted a complete EHR. LOS was 0.599 days shorter for patients cared for by hospitalists versus nonhospitalists in hospitals with incomplete EHR adoption; in hospitals with complete EHR adoption, the stay was 0.433 days shorter.CONCLUSIONS: The reduced LOS associated with hospitalist care is greater than that associated with EHR adoption. However, the combined reduction in LOS with both EHR adoption and hospitalist care may be substantial.


Choi J.,Sungkyunkwan University
ISOCC 2016 - International SoC Design Conference: Smart SoC for Intelligent Things | Year: 2016

Energy-efficient design approaches for always-on imaging will be reviewed. Circuit design techniques including dynamic voltage scaling (DVS), dynamic current scaling (DCS), and dynamic frequency scaling (DFS) will be described. In addition, energy-efficient architecture for image signal readout will be described. Finally, power reduction techniques by adaptively suppressing spatial and temporal bandwidth of image signals will be introduced. These energy-efficient design approaches will be illustrated with design examples including 1.36 μW/Frame adaptive CIS for wireless sensor node, 3.4 μW/Frame CIS with integrated feature extractor for objectdetection, and 45.5 μW (@ 15fps) always-on CIS for mobile and wearable devices. © 2016 IEEE.


Kim J.S.,Sungkyunkwan University | Oh S.,Texas State University
Journal of Combinatorial Theory. Series A | Year: 2017

The Selberg integral is an important integral first evaluated by Selberg in 1944. Stanley found a combinatorial interpretation of the Selberg integral in terms of permutations. In this paper, new combinatorial objects “Young books” are introduced and shown to have a connection with the Selberg integral. This connection gives an enumeration formula for Young books. It is shown that special cases of Young books become standard Young tableaux of various shapes: shifted staircases, squares, certain skew shapes, and certain truncated shapes. As a consequence, product formulas for the number of standard Young tableaux of these shapes are obtained. © 2016 Elsevier Inc.


Lee J.,Sungkyunkwan University
Information and Management | Year: 2017

This study examines the effects of outsourced information technology (IT) on hospital productivity by using California hospital data from 1997 to 2007. I estimated the parameters of a value-added hospital production function, correcting for endogenous input choices. I found that in comparison to in-house IT, outsourced IT has a more considerable impact on hospital productivity in the short run. However, in the long run, in-house IT has a more substantial impact on productivity than outsourced IT. I also found that hospitals that do not engage in "too much" IT outsourcing have considerable productivity gains from their outsourced IT. Moreover, hospital characteristics play an important role in the effects of outsourced IT on hospital productivity; for example, hospitals with a small number of beds and early adopters experience productivity gains from outsourced IT. © 2017 Elsevier B.V.


Kim Y.,Sungkyunkwan University
72nd World Foundry Congress, WFC 2016 | Year: 2016

The control of the interface phenomena and reactions might lead to a wide range of structures, properties and performances of the castings. This presentation is concerned with the research on the practical utilization of the interface phenomena, occurring between liquid metal and atmosphere, in commercial Al, Mg and Ti cast alloys. Alpha-case formation in Ti castings, which results in surface-related embrittlement, shows interface phenomena between liquid Ti and solid mold. The range of alpha-case layer could be controlled by thorough understanding of formation mechanism and interface behavior. As an example of practical utilization of interface phenomena between liquid metal and gas atmosphere, Eco-Mg development is presented. The application of ultrasound for grain refinement and degassing of Al and Mg alloys may be expected the use of interface phenomena among liquid metal, solid substrate and gas bubble. © 2016, The WFO (The World Foundry Organization Ltd). All rights reserved.


Lee K.I.,Kangwon National University | Yoon S.W.,Sungkyunkwan University
Journal of Biomechanics | Year: 2017

The present study aims to investigate the feasibility of using the time-reversed Lamb wave as a new method for noninvasive characterization of long cortical bones. The group velocity of the time-reversed Lamb wave launched by using the modified time reversal method was measured in 15 bovine tibiae, and their correlations with the bone properties of the tibia were examined. The group velocity of the time-reversed Lamb wave showed significant positive correlations with the bone properties (r = 0.55–0.81). The best univariate predictor of the group velocity of the time-reversed Lamb wave was the cortical thickness, yielding an adjusted squared correlation coefficient (r2) of 0.64. These results imply that the group velocity of the time-reversed Lamb wave, in addition to the velocities of the first arriving signal and the slow guided wave, could potentially be used as a discriminator for osteoporosis. © 2017 Elsevier Ltd


Lee H.-H.,Sungkyunkwan University | Hong K.-S.,Sungkyunkwan University
Image and Vision Computing | Year: 2017

In this study, we propose a method for the recognition and retrieval of a flower species in the natural environment based on a multi-layer technique, and we also suggest novel applications. First, the study suggests how to capture a flower object that is blooming in the natural environment, as well as the corresponding background. Secondly, an experimental analysis is conducted for the purpose of improving the optimal method of feature extraction for color, texture, and shape. Thirdly, the study developed a flower-image automatic-recognition technology that can be utilized in a mobile environment. We performed experiments on 29,463 images of 300 species of blooming flowers that were collected in South Korea between 2011 and 2014. We found image recognition to be 91.26% for the 1st-ranking recognition of the flower image and 97.40% for the 6th-ranking recognition. These results show that the color–texture–shape features of the flower pictures are the most effective; furthermore, the effectiveness and validity of this suggested method for demonstration services are verified in this paper. © 2017 Elsevier B.V.


HCV-related decompensated liver cirrhosis is a life-threatening illness with an average 5-year survival rate of 50%. Because these patients have higher risk of morbidity and mortality including development of hepatocellular carcinoma, the benefits of eradicating the virus may be greater than in those with less-advanced disease. Recently, direct-acting antiviral agents (DAAs) are replacing interferon-based regimens that have serious adverse events and low tolerability in the treatment of HCV infection. Many clinical trials using combination of several DAAs with or without ribavirin are now actively on-going in HCV-related decompensated cirrhosis, and encouraging data are beginning to appear. In this review, recent advances in the treatment of HCV-related decompensated cirrhosis are introduced with special focus on new DAAs.


Nam T.,Sungkyunkwan University
Computers in Human Behavior | Year: 2017

This analysis of U.S.-based survey data from the Pew Research Center profiles and categorizes online daters and gamers to determine the factors predicting whether an individual has experience of online dating or gaming. The profiles of online daters and gamers show sociodemographic differences by user type (both daters and gamers, daters only, gamers only, and neither daters nor gamers). Attitudinal differences are also identified across those user types and sociodemographic categories. The binary logistic regression analysis found that positive and negative attitudes about online dating and gaming exert a significant influence on whether an individual has experience with either. © 2017 Elsevier Ltd


Lee W.-Y.,Sungkyunkwan University
Endocrinology and Metabolism | Year: 2017

It is well known that both insulin resistance and decreased insulin secretory capacity are important factors in the pathogenesis of type 2 diabetes mellitus (T2DM). In addition to genetic factors, obesity and lipotoxicity can increase the risk of T2DM. Glucagon- like peptide 1 (GLP-1) receptor agonists are novel antidiabetic drugs with multiple effects. They can stimulate glucose-dependent insulin secretion, inhibit postprandial glucagon release, delay gastric emptying, and induce pancreatic β-cell proliferation. They can also reduce the weight of patients with T2DM and relieve lipotoxicity at the cellular level. Many intracellular targets of GLP-1 have been found, but more remain to be identified. Elucidating these targets could be a basis for developing new potential drugs. My colleagues and I have investigated new targets of GLP-1, with a particular focus on pancreatic β-cell lines and hepatic cell lines. Herein, I summarize the recent work from my laboratory, with profound gratitude for receiving the prestigious 2016 Namgok Award. © 2017 Korean Endocrine Society.


Kim D.-Y.,Sungkyunkwan University | Kim S.-A.,Sungkyunkwan University
Automation in Construction | Year: 2017

The Smart Building Envelope (SBE) is an interactive system which is adaptive to environmental conditions by transforming its shape and functions. The success of the SBE depends on elaborate interactions among the various building components. The acutely challenging issue is to design the SBE not only to satisfy multidisciplinary requirements but also to orchestrate the technical functions of components. The research objective is to propose an exploratory model on the usability of a prototyping process for SBE design. So the research is related to the conceptualization of the prototyping process model based on complementary use of the Virtual Model (VM) and Smart Physical Model (SPM). The conceptual prototyping process model is appropriate for consideration of the characteristics of the architectural design, the resources of the educational environment and the limitations of the novice designer. Furthermore, the prototyping process model in this research will help in the formulation of guidelines for the educational process, which in turn will help not merely to make intricate engineering products but also to introduce observed results into the architectural design process. © 2017 Elsevier B.V.


Patra A.K.,Sungkyunkwan University | Kim D.,Sungkyunkwan University
ACS Sustainable Chemistry and Engineering | Year: 2017

Self-assembled mesoporous α-FeOOH nanoparticles with high surface area and controlled structure have been synthesized through a simple and environmentally friendly method. The formation mechanism of self-assembled mesoporous structures, as well as the effect of pH on the structure of the materials, is carefully discussed. The selfassembled mesoporous α-FeOOH nanoparticles have been characterized by small-angle X-ray scattering (SAXS) analysis, powder X-ray diffraction (XRD), field-emission scanning electron microscopy (FESEM), high-resolution transmission electron microscopy (HRTEM), N2 sorption, and X-ray photoelectron spectroscopic (XPS) studies. N2 sorption analysis revealed high surface areas (74-152 m2 g-1) and narrow pore size distributions (2.5 nm) for different samples. The XPS analysis revealed that the materials contain a large amount of surface Fe-OH groups which are the active suite for Hg2+ adsorption. The adsorption process has been discussed using Langmuir and Freundlich models. These self-assembled mesoporous α-FeOOH nanoparticles can act as a very efficient and reusable adsorbent for Hg2+ from polluted water. © 2017 American Chemical Society.


Lee J.,Sungkyunkwan University
Korean Journal of Pediatrics | Year: 2017

Malformations of cortical development are rare congenital anomalies of the cerebral cortex, wherein patients present with intractable epilepsy and various degrees of developmental delay. Cases show a spectrum of anomalous cortical formations with diverse anatomic and morphological abnormalities, a variety of genetic causes, and different clinical presentations. Brain magnetic resonance imaging has been of great help in determining the exact morphologies of cortical malformations. The hypothetical mechanisms of malformation include interruptions during the formation of cerebral cortex in the form of viral infection, genetic causes, and vascular events. Recent remarkable developments in genetic analysis methods have improved our understanding of these pathological mechanisms. The present review will discuss normal cortical development, the current proposed malformation classifications, and the diagnostic approach for malformations of cortical development. © 2017 by The Korean Pediatric Society.


Shi H.,Sungkyunkwan University | Lee J.Y.,Sungkyunkwan University
ACS Chemical Neuroscience | Year: 2017

Tautomeric state of histidine is one of the factors that influence the structural and aggregation properties of amyloid β (Aβ)-peptide in neutral state. It is worth it to uncover the monomeric properties of Aβ(1-42) peptide in comparison with Aβ(1-40) peptide. Our replica-exchange molecular dynamics simulations results show that the sheet content of each tautomeric isomer in Aβ(1-42) monomer is slightly higher than that in Aβ(1-40) monomer except His6(δ)-His13(δ)-His14(δ) (δδδ) isomer, implying higher aggregation tendency in Aβ(1-42), which is in agreement with previous experimental and theoretical studies. Further analysis indicates that (εεε), (εδε), (εδδ), and (δδε) isomers prefer sheet conformation although they are in nondominating states. Particularly, it is confirmed that antiparallel β-sheets of (εδδ) were formed at K16-E22 (22.0-43.9%), N27-A30 except G29 (21.9-40.2%), and M35-I41 except G37 (24.1-43.4%). Furthermore, (εδδ) may be the easiest one to overcome structural transformation due to nonobstructing interactions between K16 and/or L17 and histidine residues. The current study will help to understand the tautomeric effect of Aβ(1-42) peptide to overcome Alzheimer’s disease. © 2016 American Chemical Society.


Yun S.-I.,Sungkyunkwan University | Kim K.K.,Sungkyunkwan University
Cellular Signalling | Year: 2017

For myotube formation, proliferation and differentiation of myoblasts must be tightly regulated by various myogenic regulatory factors (MRFs) such as MyoD, myogenic factor 5 (Myf5), myogenin, and muscle-specific regulatory factor 4 (MRF4). However, it is not clear how the expression or activity of these MRFs is controlled during myogenesis. In this study, we identified ubiquitin-specific protease 4 (USP4), one of deubiquitinating enzymes, as a suppressor of MRFs by demonstrating that a knockdown of USP4 enhances myogenesis by controlling MyoD and the level of myogenesis marker proteins in C2C12 cells. However, it was revealed that the effect of USP4 on myogenesis is independent of its deubiquitinase activity because the catalytic-site mutant has the same inhibitory effects as the wild-type USP4 on myogenesis. We observed that the activity and protein levels of both HDAC1 and HDAC4 are decreased when myoblast differentiation is promoted by the USP4 knockdown. We also found that the role of USP4 in muscle differentiation is correlated with two major signaling pathways in myogenesis, AKT and the p38 mitogen-activated protein kinase pathways. According to these results, we propose that USP4 is a key player in myogenic differentiation; it controls myogenic regulatory factors in a catalytic-independent manner. © 2017


Song K.D.,Sungkyunkwan University
Clinical and molecular hepatology | Year: 2016

Local ablation therapy is considered as a conventional treatment option for patients with early stage hepatocellular carcinoma (HCC). Although radiofrequency (RF) ablation is widely used for HCC, the use of cryoablation has been increasing as newer and safer cryoablation systems have developed. The thermodynamic mechanism of freezing and thawing used in cryoablation is the Joule-Thomson effect. Cryoablation destroys tissue via direct tissue destruction and vascular-related injury. A few recent comparative studies have shown that percutaneous cryoablation for HCCs is comparable to percutaneous RF ablation in terms of long term therapeutic outcomes and complications. Cryoablation has several advantages over RF ablation such as well visualization of iceball, no causation of severe pain, and lack of severe damage to great vessels and gallbladder. It is important to know the advantages and disadvantages of cryoablation compared with RF ablation for improvement of therapeutic efficacy and safety.


PURPOSE OF REVIEW: The most common mechanism of resistance to epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) is acquisition of the T790M gatekeeper mutation. Third-generation EGFR TKIs irreversibly inhibit EGFR mutants (EGFRm), especially T790M, while sparing wild-type EGFR. There are several third-generation EGFR TKIs under development, including osimertinib, CO-1686 (rociletinib), HM61713 (olmutinib), ASP8273, and EGF816. These third-generation EGFR TKIs have shown promising efficacy with favorable toxicity profiles in the management of advanced nonsmall cell lung cancer (NSCLC) with an acquired T790M mutation (EGFR). In the present review, we will discuss the evolving treatment landscape of EGFRm NSCLC. RECENT FINDINGS: The LUX-Lung 7 study demonstrated superior progression-free survival, time-to-treatment failure, and objective response rate with afatinib versus gefitinib, but no significant overall survival improvement in TKI-naïve EGFRm NSCLC patients. In EGFRm NSCLC patients harboring T790M after treatment with first-generation or second-generation EGFR TKIs, third-generation EGFR TKIs showed robust efficacy with tolerable toxicity. The updated results of phase I studies have demonstrated encouraging activity of first-line osimertinib in patients with EGFRm NSCLC. SUMMARY: Following progression with first-generation or second-generation EGFR TKIs, osimertinib was recently approved for the treatment of EGFR NSCLC. Encouraging early results with osimertinib have sparked interest in first-line treatment of EGFRm NSCLC, and head-to-head comparison studies of third-generation versus first-generation EGFR TKIs are being developed. Copyright © 2017 Wolters Kluwer Health, Inc. All rights reserved.


Koh W.-J.,Sungkyunkwan University
Microbiology Spectrum | Year: 2017

Nontuberculous mycobacteria (NTM) are emerging pathogens that affect both immunocompromised and immunocompetent patients. The development of molecular methods has allowed the characterization of new species and the identification of NTM to the precise species and subspecies levels. The incidence and prevalence of NTM lung disease are increasing worldwide, and this syndrome accounts for the majority of clinical cases of NTM disease. Common causative organisms of pulmonary infection are the slowly growing mycobacteria Mycobacterium avium complex and Mycobacterium kansasii and the rapidly growing mycobacteria, including Mycobacterium abscessus complex. NTM lung disease often affects elderly people with chronic lung disease and may be a manifestation of a complex genetic disorder determined by interactions among multiple genes, as well as environmental exposures. To be diagnosed with NTM lung disease, patients should meet all clinical and microbiologic criteria, but the decision to start treatment is complex, requiring careful individualized analysis of risks and benefits. Clinicians should be alert to the unique aspects of NTM lung disease, including the need for proper diagnosis, the availability of advanced molecular methods for species and subspecies identification, and the benefits and limitations of recommended treatments. © 2017 American Society for Microbiology. All rights reserved.


Drug resistance to BCR-ABL1 tyrosine kinase inhibitor (TKI) and disease progression to blast crisis (BC) are major clinical problems in chronic myeloid leukemia (CML); however, underlying mechanisms governing this process remain to be elucidated. Here, we report Cordon-bleu protein-like 1 (Cobll1) as a distinct molecular marker associated with drug resistance as well as progression to BC. In detail, Cobll1 increases IKKγ stability, leading to NF-κB activation and reduction of nilotinib-dependent apoptosis, suggesting Cobll1-mediated NF-κB could be involved in drug resistance. Recently, NF-κB signalling has been highlighted as a core mechanism for chronic phase (CP)-BC progression, stem cell survival and tyrosine kinase inhibitor resistance. We also demonstrated that high expression of Cobll1 confers drug resistance to tyrosine kinase inhibitors in CML cell line as well as patient samples. The analysis of large sets of primary CML samples (n=90) shows that Cobll1 expression is dramatically increased in BC but not in CP, which is correlated with a poor survival rate (P=0.002). Moreover, our studies show that Cobll1 is highly expressed in CD34+ primitive stem cell populations, and the zebrafish paralog Cobll1b is important for normal hematopoiesis during embryonic development. Based on these results, we propose that Cobll1 is a novel biomarker and potential therapeutic target for CML-BC.Leukemia advance online publication, 14 March 2017; doi:10.1038/leu.2017.72. © 2017 Macmillan Publishers Limited, part of Springer Nature.


OBJECTIVE:: Hypertensive urgency is defined as a severe elevation of blood pressure (BP) without target organ damage. In emergency room, hypertensive urgency has been conventionally managed by antihypertensive medication. However, there has been increasing concern for the safety of antihypertensive medication in hypertensive urgency. Thus, this study was to compare the clinical efficacy of resting and antihypertensive medication in managing hypertensive urgency. METHODS:: For 138 hypertensive urgency patients admitting in emergency room of Veterans Health Center hospital, a single-center, randomized controlled trial was conducted. Hypertensive urgency patients were randomly allocated into one group out of resting group and antihypertensive medication (telmisartan) group at admission. We serially checked their BP every 30?min for 2?h, and evaluated change levels and decline of BP. Primary end point of the study was mean BP reduction from 10 to 35%. Additionally, change and decline of SBP and DBP were serially compared over 2?h. RESULT:: The rate of individuals approaching primary end point was 68.5% in rest group and 69.1% in medication group (P?=?0.775). The change levels of BP for 2?h had no significant difference in SBP (P?=?0.882) and DBP (P?=?0.411) between resting group and medication group. The decline of BP after 2?h also did not show any statistical difference in both SBP (P?=?0.065) and DBP (P?=?0.032) between both groups. CONCLUSION:: There was no significant difference between resting and antihypertensive medication in reducing BP of hypertensive urgency patients. This finding suggests the clinical efficacy of resting in managing hypertensive urgency. Copyright © 2017 Wolters Kluwer Health, Inc. All rights reserved.


Patent
Samsung and Sungkyunkwan University | Date: 2017-02-01

A method of supporting a login for a web service of a user terminal using a portable device is provided. The method includes registering the portable device through a wireless communication with the portable device, encrypting login information for at least one web service and transmitting the login information to the registered portable device, and transmitting a request message requesting a transmission of the login information of the web service to the portable device. The request message includes a service identification (ID) identifying the web service.


Lee K.S.,Sungkyunkwan University | Park J.H.,Sungkyunkwan University
Nano Letters | Year: 2012

The widespread commercialization of dye-sensitized solar cells (DSSCs) remains limited because of the use of highly volatile liquid electrolytes. Recently, gel-type quasi-solid electrolytes containing a polymer additive or inorganic nanomaterial have shown promising results in terms of the cell efficiency. However, most gel electrolytes have serious obstacles for pore-filling because of their high viscosity. Herein, we report the first observation of the transition from a liquid to a gel electrolyte after filling the cell with the liquid electrolyte using the controlled dissolution of polystyrene nanobeads on the counter electrode, suggesting that the pore-filling problem can be diminished in quasi-solid state DSSCs. The time-resolved solidification allows for the preparation of the gel electrolyte without interfering with the cell performance. The optimal DSSC composed of the gel electrolyte exhibits almost the same power conversion efficiency as the liquid electrolyte based DSSC when measured using an AM1.5G solar simulator at 100 mW/cm 2 light illumination. Moreover, the long-term stability of the DSSC was greatly improved. © 2012 American Chemical Society.


Lee H.M.,Chung - Ang University | Park S.C.,Sungkyunkwan University
European Physical Journal C | Year: 2014

The recently reported X-ray line signal at (Formula Presented.) from a stacked spectrum of various galaxy clusters and the Andromeda galaxy may be originating from a decaying dark matter particle of the mass (Formula Presented.). A light axion-like scalar is suggested as a natural candidate for dark matter and its production mechanisms are closely examined. We show that the right amount of axion relic density with the preferred parameters, (Formula Presented.) and (Formula Presented.), can be naturally obtainable from the decay of inflaton. If the axions were produced from the saxion decay, it could not have constituted the total relic density due to the bound from structure formation. Nonetheless, the saxion decay is an interesting possibility, because the (Formula Presented.) line and dark radiation can be addressed simultaneously, being consistent with the Planck data. Small misalignment angles of the axion, ranging between (Formula Presented.)–(Formula Presented.) depending on the reheating temperature, can also be the source of axion production. The model with axion misalignment can satisfy the constraints for structure formation and iso-curvature perturbation. © 2014, The Author(s).


Patent
Sungkyunkwan University and Center For Integrated Smart Sensors Foundation | Date: 2015-05-28

In accordance with a first exemplary embodiment, there is provided a device for black box. The device includes one or more camera module; a non-volatile memory, in which a program for operating a file system is stored; and a processor that executes the program stored in the non-volatile memory. Wherein according to execution of the program, the processor divides the whole storage area of the non-volatile memory into a plurality of file storage areas, and stores a file generated by the camera module in one of the plurality of the divided file storage areas according to a type of the file.


A method for performing occlusion queries is disclosed. The method includes steps of: (a) a graphics processing unit (GPU) using a first depth buffer of a first frame to thereby predict a second depth buffer of a second frame; and (b) the GPU performing occlusion queries for the second frame by using the predicted second depth buffer, wherein the first frame is a frame predating the second frame. In accordance with the present invention, a configuration for classifying the objects into the occluders and the occludees is not required and the occlusion queries for the predicted second frame are acquired in advance at the last of the first frame or the first of the second frame.


News Article | April 27, 2016
Site: www.nanotech-now.com

Abstract: A Dartmouth College scientist and his collaborators have created an artificial protein that organizes new materials at the nanoscale. "This is a proof-of-principle study demonstrating that proteins can be used as effective vehicles for organizing nano-materials by design," says senior author Gevorg Grigoryan, an assistant professor of computer science at Dartmouth. "If we learn to do this more generally - the programmable self-assembly of precisely organized molecular building blocks -- this will lead to a range of new materials towards a host of applications, from medicine to energy." The study appears in the journal in Nature Communications. A PDF is available on request. According to the U.S. National Nanotechnology Initiative, scientists and engineers are finding a wide variety of ways to deliberately make materials at the nanoscale - or the atomic and molecular level -- to take advantage of their enhanced properties such as higher strength, lighter weight, increased control of light spectrum and greater chemical reactivity than their larger-scale counterparts. Proteins are "smart" molecules, encoded by our genes, which organize and orchestrate essentially all molecular processes in our cells. The goal of the new study was to create an artificial protein that would self-organize into a new material -- an atomically periodic lattice of buckminster fullerene molecules. Buckminster fullerene (buckyball for short) is a sphere-like molecule composed of 60 carbon atoms shaped like a soccer ball. Buckyballs have an array of unusual properties, which have excited scientists for several decades because of their potential applications. Buckyballs are currently used in nanotechology due to their high heat resistance and electrical superconductivity, but the molecule is difficult to organize in desired ways, which hampers its use in the development of novel materials. In their new research, Grigoryan and his colleagues show that their artificial protein does interact with buckyball and indeed does organize it into a lattice. Further, they determined the 3-dimensional structure of this lattice, which represents the first ever atomistic view of a protein/buckyball complex. "Learning to engineer self-assembly would enable the precise organization of molecules by design to create matter with tailored properties," Grigoryan says. "In this research, we demonstrate that proteins can direct the self-assembly of buckminsterfullerene into ordered superstructures. Further, excitingly, we have observed this protein/buckyball lattice conducts electricity, something that the protein-alone lattice does not do. Thus, we are beginning to see emergent material behaviors that can arise from combing the fascinating properties of buckyball and the abilities of proteins to organize matter at the atomic scale. Taken together, our findings suggest a new means of organizing fullerene molecules into a rich variety of lattices to generate new properties by design." ### The study included researchers from Dartmouth College, Sungkyunkwan University, the New Jersey Institute of Technology, the National Institute of Science Education and Research, the University of California-San Francisco, the University of Pennsylvania and the Institute for Basic Science. For more information, please click If you have a comment, please us. Issuers of news releases, not 7th Wave, Inc. or Nanotechnology Now, are solely responsible for the accuracy of the content.


Patients with advanced non-small-cell lung cancer survive four months longer with fewer side effects on an immunotherapy drug called atezolizumab compared to chemotherapy, according to a phase 3 clinical trial published in The Lancet. The trial enrolled 1225 advanced non-small-cell lung cancer patients who have no more treatment options, but this study used an early analysis of the first 850 patients from the trial. Half of the group were given atezolizumab and the other half were given docetaxel chemotherapy, which is the standard treatment for advanced non-small-cell lung cancer. Patients given atezolizumab - a drug that blocks the programmed death ligand 1 (PD-L1) protein - survived for an average of 13.8 months, compared with 9.6 months for those on chemotherapy. As well as the benefits in survival, atezolizumab also had fewer side effects than chemotherapy with 14.8% (90 of 609) of those given the drug having grade three or four side effects compared with 42.7% (247 of 578) of those given chemotherapy. However, 46 (of 609, 7.6%) of the patients given atezolizumab still gave up treatment due to side effects, as well as 108 (of 578 patients, 18.7%) of those on chemotherapy. "Lung cancer is the most common cancer affecting 1.8 million people each year worldwide. It is also the leading cause of cancer death worldwide and survival remains stubbornly low. Recently, important advances in the treatment of the disease have come from immunotherapies that target the PD-L1 and PD-1 pathway," said Dr Achim Rittmeyer, lead author, University Goettingen, Germany. "Atezolizumab reinvigorates patients' immune systems against cancer, and our trial has shown that this has significant results for their survival." [1] In the trial the researchers also studied the amount of PD-L1 protein on the patients' cancer and immune cells and how long patients survived for on each treatment. They found that the drug worked best for patients with the highest levels of the PD-L1 protein on their cells - more than doubling survival compared with those given chemotherapy (20.5 months compared with 8.9 months overall survival) - but still increased survival for those with little to no levels of the protein by three and a half months (12.6 compared with 8.9 months overall survival). "This is the first phase 3 trial of a PD-L1-directed immunotherapy in lung cancer. The fact that it improves survival in patients with all categories of PD-L1 expression is highly encouraging and adds to the already known benefits of immunotherapy in lung cancer." said Dr David Gandara, senior author, UC Davis Comprehensive Cancer Center, USA. [1] Other immunotherapies for non-small-cell lung cancer, such as nivolumab and pembrolizumab, are designed to block PD-L1's counterpart, the programmed cell death protein 1 (PD-1) which is located on the immune cell surface. Normally the PD-L1 and PD-1 proteins signal to one another to activate the immune system to attack tumours. It's thought that the extra PD-L1 protein on some cancer cells' surfaces helps them hide from the immune system, meaning it cannot find and kill cancer cells as usual. But by blocking the extra PD-L1 protein, atezolizumab may unveil the cells to the immune system so they can be attacked and destroyed. The study is the first phase 3 trial of a PD-L1 inhibitor drug and has shown longer survival than trials of PD-1 inhibitors. The authors note that the trial was 'open label', meaning that patients and doctors knew whether or not they were being given immunotherapy. In addition, after the study treatment finished some (17%) of those given chemotherapy on the trial were prescribed another immunotherapy drug (mostly nivolumab) by their own doctor. This could have increased survival in the chemotherapy group, meaning that the difference between two groups may be greater than shown in this study. Writing in a linked Comment, Professor Elisabeth Quoix, Hôpitaux Universitaires de Strasbourg, France, said: "After decades of disappointments with non-specific vaccines or more recently tumor associated antigen specific vaccines, immunotherapy with antibodies that target the PD-L1 and PD-1 pathway have emerged as a major therapeutic breakthrough. This treatment improves the prognosis of patients with non-small-cell lung cancer that cannot benefit from targeted therapies... The time in which chemotherapy will no more be the mainstay of treatment of metastatic non-small-cell lung cancer is perhaps not so far away. Nevertheless... Several points need to be clarified, such as the optimum therapeutic schedule and the optimum duration of treatment, to limit treatment costs. Additionally combinations of different immunotherapies might be of interest." The study was funded by F. Hoffman-La Roche Ltd and Genentech Ltd.. It was conducted by scientists from Lungenfachklinik Immenhausen, Aix Marseille Universite, Sungkyunkwan University School of Medicine, Seconda Università degli Studi di Napoli, Asklepios Fachkliniken München-Gauting, Karmanos Cancer Institute/Wayne State University, Aichi Cancer Center Hospital, Institute M. Sklodowska-Curie, Hospital Regional Universitario Carlos Haya, AOU San Gerardo, Minnesota Oncology, Southern California Permanente Medical Group, PUCRS School of Medicine, University of California, Centro Internacional de Estudios Clinicos, European Institute of Oncology, Istanbul University Cerrahpasa Medical Faculty Hospital, Seoul National University Bundang Hospital, Genentech Inc. and UC Davis Comprehensive Cancer Center. A declaration of interests is available in the Article. [ 1] Quote direct from author and cannot be found in the text of the Article. IF YOU WISH TO PROVIDE A LINK FOR YOUR READERS, PLEASE USE THE FOLLOWING, WHICH WILL GO LIVE AT THE TIME THE EMBARGO LIFTS: http://www.thelancet.com/journals/lancet/article/PIIS0140-6736(16)32517-X/fulltext


News Article | January 13, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment. A constitutively stabilized mutant of HIF2α (HIF2α-TM) was obtained from Christina Warnecke20. The HIF2α-TM (triple mutant) construct harbours the following mutations in the prolyl and asparagyl hydroxylation sites: P405A, P530G and N851A. Polypeptide fragments of DYRK1B were cloned into pcDNA3-HA and include DYRK1B N terminus, N-Ter (amino acids 1–110), DYRK1B kinase domain, KD (amino acids 111–431), and DYRK1B C terminus, C-Ter (amino acids 432–629). cDNAs for RBX1, Elongin B and Elongin C were kindly provided from Michele Pagano (New York University) and cloned into the pcDNA vector by PCR. HA-tagged HIF1α and HIF2α were obtained from Addgene. GFP-tagged DYRK1A and DYRK1B were cloned into pcDNA vector. pcDNA-HA-VHL was provided by Kook Hwan Kim (Sungkyunkwan University School of Medicine, Korea). Site-directed mutagenesis was performed using QuickChange or QuickChange Multi Site-Directed mutagenesis kit (Agilent) and resulting plasmids were sequence verified. Lentivirus was generated by co-transfection of the lentiviral vectors with pCMV-ΔR8.1 and pMD2.G plasmids into HEK293T cells as previously described9, 42. ShRNA sequences are: ID2-1: GCCTACTGAATGCTGTGTATACTCGAGTATACACAGCATTCAGTAGGC; ID2-2: CCCACTATTGTCAGCCTGCATCTCGAGATGCAGGCTGACAATAGTGGG; DYRK1A: CAGGTTGTAAAGGCATATGATCTCGAGATCATATGCCTTTACAACCTG; DYRK1B: GACCTACAAGCACATCAATGACTCGAGTCATTGATGTGCTTGTAGGTC. IMR-32 (ATCC CCL-127), SK-N-SH (ATCC HTB-11), U87 (ATCC HTB-14), NCI-H1299 (ATCC CRL-5803), HRT18 (ATCC CCL-244), and HEK293T (ATCC CRL-11268) cell lines were acquired through American Type Culture Collection. U251 (Sigma, catalogue number 09063001) cell line was obtained through Sigma. Cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (FBS, Sigma). Cells were routinely tested for mycoplasma contamination using Mycoplasma Plus PCR Primer Set (Agilent, Santa Clara, CA) and were found to be negative. Cells were transfected with Lipofectamine 2000 (Invitrogen) or calcium phosphate. Mouse NSCs were grown in Neurocult medium (StemCell Technologies) containing 1× proliferation supplements (StemCell Technologies), and recombinant FGF-2 and EGF (20 ng ml−1 each; Peprotech). GBM-derived glioma stem cells were obtained by de-identified brain tumour specimens from excess material collected for clinical purposes at New York Presbyterian-Columbia University Medical Center. Donors (patients diagnosed with glioblastoma) were anonymous. Progressive numbers were used to label specimens coded in order to preserve the confidentiality of the subjects. Work with these materials was designated as IRB exempt under paragraph 4 and it is covered under IRB protocol #IRB-AAAI7305. GBM-derived GSCs were grown in DMEM:F12 containing 1× N2 and B27 supplements (Invitrogen) and human recombinant FGF-2 and EGF (20 ng ml−1 each; Peprotech). Cells at passage (P) 4 were transduced using lentiviral particle in medium containing 4 μg ml−1 of polybrene (Sigma). Cells were cultured in hypoxic chamber with 1% O (O Control Glove Box, Coy Laboratory Products, MI) for the indicated times or treated with a final concentration of 100–300 μM CoCl (Sigma) as specified in figure legends. Mouse neurosphere assay was performed by plating 2,000 cells in 35 mm dishes in collagen containing NSC medium to ensure that distinct colonies were derived from single cells and therefore clonal in origin43. We determined neurosphere formation over serial clonal passages in limiting dilution semi-solid cultures and the cell expansion rate over passages, which is considered a direct indication of self-renewing symmetric cell divisions44. For serial sub-culturing we mechanically dissociated neurospheres into single cells in bulk and re-cultured them under the same conditions for six passages. The number of spheres was scored after 14 days. Only colonies >100 μm in diameter were counted as spheres. Neurosphere size was determined by measuring the diameters of individual neurospheres under light microscopy. Data are presented as percent of neurospheres obtained at each passage (number of neurospheres scored/number of NSCs plated × 100) in three independent experiments. P value was calculated using a multiple t-test with Holm–Sidak correction for multiple comparisons. To determine the expansion rate, we plated 10,000 cells from 3 independent P1 clonal assays in 35 mm dishes and scored the number of viable cells after 7 days by Trypan Blue exclusion. Expansion rate of NSCs was determined using a linear regression model and difference in the slopes (P value) was determined by the analysis of covariance (ANCOVA) using Prism 6.0 (GraphPad). Limiting dilution assay (LDA) for human GSCs was performed as described previously45. Briefly, spheres were dissociated into single cells and plated into 96-well plates in 0.2 ml of medium containing growth factors at increasing densities (1–100 cells per well) in triplicate. Cultures were left undisturbed for 14 days, and then the percent of wells not containing spheres for each cell dilution was calculated and plotted against the number of cells per well. Linear regression lines were plotted, and we estimated the minimal frequency of glioma cells endowed with stem cell capacity (the number of cells required to generate at least one sphere in every well = the stem cell frequency) based on the Poisson distribution and the intersection at the 37% level using Prism 6.0 software. Data represent the means of three independent experiments performed in different days for the evaluation of the effects of ID2, ID2(T27A) in the presence or in the absence of DYRK1B. LDA for the undegradable HIF2α rescue experiment was performed by using three cultures transduced independently on the same day. To identify the sites of ID2 phosphorylation from IMR32 human neuroblastoma cells, the immunoprecipitated ID2 protein was excised, digested with trypsin, chymotrypsin and Lys-C and the peptides extracted from the polyacrylamide in two 30 μl aliquots of 50% acetonitrile/5% formic acid. These extracts were combined and evaporated to 25 μl for MS analysis. The LC–MS system consisted of a state-of-the-art Finnigan LTQ-FT mass spectrometer system with a Protana nanospray ion source interfaced to a self-packed 8 cm × 75 μm id Phenomenex Jupiter 10 μm C18 reversed-phase capillary column. 0.5–5 μl volumes of the extract were injected and the peptides eluted from the column by an acetonitrile/0.1 M acetic acid gradient at a flow rate of 0.25 μl min−1. The nanospray ion source was operated at 2.8 kV. The digest was analysed using the double play capability of the instrument acquiring full scan mass spectra to determine peptide molecular weights and product ion spectra to determine amino acid sequence in sequential scans. This mode of analysis produces approximately 1200 CAD spectra of ions ranging in abundance over several orders of magnitude. Tandem MS/MS experiments were performed on each candidate phosphopeptide to verify its sequence and locate the phosphorylation site. A signature of a phosphopeptide is the detection of loss of 98 daltons (the mass of phosphoric acid) in the MS/MS spectrum. With this method, three phosphopeptides were found to carry phosphorylations at residues Ser5, Ser14 and Thr27 of the ID2 protein. The anti-phospho-T27-ID2 antibody was generated by immunizing rabbits with a short synthetic peptide containing the phosphorylated T27 (CGISRSK-pT-PVDDPMS) (Yenzym Antibodies, LLC). A two-step purification process was applied. First, antiserum was cross-absorbed against the phospho-peptide matrix to purify antibodies that recognize the phosphorylated peptide. Then, the anti-serum was purified against the un-phosphorylated peptide matrix to remove non-specific antibodies. Cells were lysed in NP40 lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)) or RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 0.5% sodium dexoycholate, 0.1% sodium dodecyl sulphate, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)). Lysates were cleared by centrifugation at 15,000 r.p.m. for 15 min at 4 °C. For immunoprecipitation, cell lysates were incubated with primary antibody (hydroxyproline, Abcam, ab37067; VHL, BD, 556347; DYRK1A, Cell Signaling Technology, 2771; DYRK1B, Cell Signaling Technology, 5672) and protein G/A beads (Santa Cruz, sc-2003) or phospho-Tyrosine (P-Tyr-100) Sepharose beads (Cell Signaling Technology, 9419), HA affinity matrix (Roche, 11815016001), Flag M2 affinity gel (Sigma, F2426) at 4 °C overnight. Beads were washed with lysis buffer four times and eluted in 2× SDS sample buffer. Protein samples were separated by SDS–PAGE and transferred to polyvinyl difluoride (PVDF) or nitrocellulose (NC) membrane. Membranes were blocked in TBS with 5% non-fat milk and 0.1% Tween20, and probed with primary antibodies. Antibodies and working concentrations are: ID2 1:500 (C-20, sc-489), GFP 1:1,000 (B-2, sc-9996), HIF2α/EPAS-1 1:250 (190b, sc-13596), c-MYC (9E10, sc-40), and Elongin B 1:1,000 (FL-118, sc-11447), obtained from Santa Cruz Biotechnology; phospho-Tyrosine 1:1,000 (P-Tyr-100, 9411), HA 1:1,000 (C29F4, 3724), VHL 1:500 (2738), DYRK1A 1:1,000, 2771; DYRK1B 1:1,000, 5672) and RBX1 1:2,000 (D3J5I, 11922), obtained from Cell Signaling Technology; VHL 1:500 (GeneTex, GTX101087); β-actin 1:8000 (A5441), α-tubulin 1:8,000 (T5168), and Flag M2 1:500 (F1804) obtained from Sigma; HIF1α 1:500 (H1alpha67, NB100-105) and Elongin C 1:1,000 (NB100-78353) obtained from Novus Biologicals; HA 1:1000 (3F10, 12158167001) obtained from Roche. Secondary antibodies horseradish-peroxidase-conjugated were purchased from Pierce and ECL solution (Amersham) was used for detection. For in vitro binding assays, HA-tagged RBX1, Elongin B, Elongin C and VHL were in vitro translated using TNT quick coupled transcription/translation system (Promega). Active VHL protein complex was purchased from EMD Millipore. Purified His-VHL protein was purchased from ProteinOne (Rockville, MD). GST, GST–ID2 and Flag–ID2 proteins were bacterial expressed and purified using glutathione sepharose beads (GE healthcare life science). Active DYRK1B (Invitrogen) was used for in vitro phosphorylation of Flag-ID2 proteins. Biotinylated wild-type and modified (pT27 and T27W) ID2 peptides (amino acids 14–34) were synthesized by LifeTein (Somerset, NJ). In vitro binding experiments between ID2 and VCB–Cul2 were performed using 500 ng of Flag-ID2 and 500 ng of VCB–Cul2 complex or 500 ng VHL protein in binding buffer (50 mM Tris-Cl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1.5 mM Na VO , 0.2% NP40, 10% glycerol, 0.1 mg ml−1 BSA and EDTA-free protease inhibitor cocktail (Roche)) at 4 °C for 3 h. In vitro binding between ID2 peptides and purified proteins was performed using 2 μg of ID2 peptides and 200 ng of recombinant VCB–Cul2 complex or 200 ng recombinant VHL in binding buffer (50 mM Tris-Cl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1.5 mM Na VO , 0.4% NP40, 10% glycerol, 0.1 mg ml−1 BSA and EDTA-free protease inhibitor cocktail (Roche)) at 4 °C for 3 h or overnight. Protein complexes were pulled down using glutathione sepharose beads (GE Healthcare Life Science) or streptavidin conjugated beads (Thermo Fisher Scientific) and analysed by immunoblot. Cdk1, Cdk5, DYRK1A, DYRK1B, ERK, GSK3, PKA, CaMKII, Chk1, Chk2, RSK-1, RSK-2, aurora-A, aurora-B, PLK-1, PLK-2, and NEK2 were all purchased from Life Technology and ATM from EMD Millipore. The 18 protein kinases tested in the survey were selected because they are proline-directed S/T kinases (Cdk1, Cdk5, DYRK1A, DYRK1B, ERK) and/or because they were considered to be candidate kinases for Thr27, Ser14 or Ser5 from kinase consensus prediction algorithms (NetPhosK1.0, http://www.cbs.dtu.dk/services/NetPhosK/; GPS Version 3.0 http://gps.biocuckoo.org/#) or visual inspection of the flanking regions and review of the literature for consensus kinase phosphorylation motifs. 1 μg of bacterially purified GST-ID substrates were incubated with 10–20 ng each of the recombinant active kinases. The reaction mixture included 10 μCi of [γ-32P]ATP (PerkinElmer Life Sciences) in 50 μl of kinase buffer (25 mM Tris-HCl, pH 7.5, 5 mM β-glycerophosphate, 2 mM dithiothreitol (DTT), 0.1 mM Na VO , 10 mM MgCl , and 0.2 mM ATP). Reactions were incubated at 30 °C for 30 min. Reactions were terminated by addition of Laemmli SDS sample buffer and boiling on 95 °C for 5 min. Proteins were separated on SDS–PAGE gel and phosphorylation of proteins was visualized by autoradiography. Coomassie staining was used to document the amount of substrates included in the kinase reaction. In vitro phosphorylation of Flag– ID2 proteins by DYRK1B (Invitrogen) was performed using 500 ng of GST–DYRK1B and 200 ng of bacterially expressed purified Flag–ID2 protein. In vivo kinase assay in GSCs and glioma cells was performed using endogenous or exogenously expressed DYRK1A and DYRK1B. Cell lysates were prepared in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)). DYRK1 kinases were immunoprecipitated using DYRK1A and DYRK1B antibodies (for endogenous DYRK1 proteins) or GFP antibody (for exogenous GFP–DYRK1 proteins) from 1 mg cellular lysates at 4 °C. Immunoprecipitates were washed with lysis buffer four times followed by two washes in kinase buffer as described above and incubated with 200 ng purified Flag–ID2 protein in kinase buffer for 30 min at 30 °C. Kinase reactions were separated by SDS–PAGE and analysed by western blot using p-T27-ID2 antibody. HIF2α half-life was quantified using ImageJ processing software (NIH). Densitometry values were analysed by Prism 6.0 using the linear regression function. Stoichiometric quantification of ID2 and VHL in U87 cells was obtained using recombinant Flag–ID2 and His-tagged-VHL as references. The chemiluminescent signal of serial dilutions of the recombinant proteins was quantified using ImageJ, plotted to generate a linear standard curve against which the densitometric signal generated by serial dilutions of cellular lysates (1 × 106 U87 cells) was calculated. Triplicate values ± s.e.m. were used to estimate the ID2:VHL ratio per cell. The stoichiometry of pT27-ID2 phosphorylation was determined as described46. Briefly, SK-N-SH cells were plated at density of 1 × 106 in 100 mm dishes. Forty-eight hours later 1.5 mg of cellular lysates from cells untreated or treated with CoCl during the previous 24 h were prepared in RIPA buffer and immunoprecipitated using 4 μg of pT27-ID2 antibody or rabbit IgG overnight at 4 °C. Immune complexes were collected with TrueBlot anti-rabbit IgG beads (Rockland), washed 5 times in lysis buffer, and eluted in SDS sample buffer. Serial dilutions of cellular lysates, IgG and pT27-ID2 immunoprecipitates were loaded as duplicate series for SDS–PAGE and western blot analysis using ID2 or p-T27-ID2 antibodies. Densitometry quantification of the chemiluminescent signals was used to determine (1) the efficiency of the immunoprecipitation using the antibody against p-ID2-T27 and (2) the ratio between efficiency of the immunoprecipitation evaluated by western blot for p-T27-ID2 and total ID2 antibodies. This represents the percent of phosphorylated Thr27 of ID2 present in the cell preparation. Cellular ID2 complexes were purified from the cell line NCI-H1299 stably engineered to express Flag-HA–ID2. Cellular lysates were prepared in 50 mM Tris-HCl, 250 mM NaCl, 0.2% NP40, 1 mM EDTA, 10% glycerol, protease and phosphatase inhibitors. Flag-HA–ID2 immunoprecipitates were recovered first with anti-Flag antibody-conjugated M2 agarose (Sigma) and washed with lysis buffer containing 300 mM NaCl and 0.3% NP40. Bound polypeptides were eluted with Flag peptide and further affinity purified by anti-HA antibody-conjugated agarose (Roche). The eluates from the HA beads were analysed directly on long gradient reverse phase LC–MS/MS. A specificity score of proteins interacting with ID2 was computed for each polypeptide by comparing the number of peptides identified from mass spectrometry analysis to those reported in the CRAPome database that includes a list of potential contaminants from affinity purification-mass spectrometry experiments (http://www.crapome.org). The specificity score is computed as [(#peptide*#xcorr)/(AveSC*MaxSC* # of Expt.)], #peptide, identified peptide count; #xcorr, the cross-correlation score for all candidate peptides queried from the database; AveSC, averaged spectral counts from CRAPome; MaxSC, maximal spectral counts from CRAPome; and # of Expt., the total found number of experiments from CRAPome. U87 cells were transfected with pcDNA3-HA-HIFα (HIF1α or HIF2α), pcDNA3-Flag–ID2 (WT or T27A), pEGFP-DYRK1B and pcDNA3-Myc-Ubiquitin. 36 h after transfection, cells were treated with 20 μM MG132 (EMD Millipore) for 6 h. After washing with ice-cold PBS twice, cells were lysed in 100 μl of 50 mM Tris-HCl pH 8.0, 150 mM NaCl (TBS) containing 2% SDS and boiled at 100 °C for 10 min. Lysates were diluted with 900 μl of TBS containing 1% NP40. Immunoprecipitation was performed using 1 mg of cellular lysates. Ubiquitylated proteins were immunoprecipitated using anti-Myc antibody and analysed by western blot using HA antibody. A previously described47, highly accurate flexible peptide docking method implemented in ICM software (Molsoft LLC, La Jolla CA) was used to dock ID2 peptides to VCB or components thereof. A series of overlapping peptides of varying lengths were docked to the complex of VHL and Elongin C (EloC), or VHL or EloC alone, from the recent crystallographic structure22 of the VHL-CRL ligase. Briefly, an all-atom model of the peptide was docked into grid potentials derived from the X-ray structure using a stochastic global optimization in internal coordinates with pseudo-Brownian and collective ‘probability-biased’ random moves as implemented in the ICM program. Five types of potentials for the peptide-receptor interaction energy — hydrogen van der Waals, non-hydrogen van der Waals, hydrogen bonding, hydrophobicity and electrostatics — were precomputed on a rectilinear grid with 0.5 Å spacing that fills a 34 Å × 34 Å × 25 Å box containing the VHL-EloC (V-C) complex, to which the peptide was docked by searching its full conformational space within the space of the grid potentials. The preferred docking conformation was identified by the lowest energy conformation in the search. The preferred peptide was identified by its maximal contact surface area with the respective receptor. ab initio folding and analysis of the peptides was performed as previously described48, 49. ab initio folding of the ID2 peptide and its phospho-T27 mutant showed that both strongly prefer an α-helical conformation free (unbound) in solution, with the phospho-T27 mutant having a calculated free energy almost 50 kcal-equivalent units lower than the unmodified peptide. Total RNA was prepared with Trizol reagent (Invitrogen) and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen) as described42, 50. Semi-quantitative RT–PCR was performed using AccuPrime Taq DNA polymerase (Invitrogen) and the following primers: for HIF2A Fw 5′_GTGCTCCCACGGCCTGTA_3′ and Rv 5′_TTGTCACACCTATGGCATATCACA_3′; GAPDH Fw 5′_AGAAGGCTGGGGCTCATTTG_3′ and Rv 5′_AGGGGCCATCCACAGTCTTC_3′. The quantitative RT–PCR was performed with a Roche480 thermal cycler, using SYBR Green PCR Master Mix from Applied Biosystem. Primers used in qRT–PCR are: SOX2 Fw 5′_TTGCTGCCTCTTTAAGACTAGGA_3′ and Rv 5′_CTGGGGCTCAAACTTCTCTC_3′; NANOG Fw 5′_ATGCCTCACACGGAGACTGT_3′ and Rv 5′_AAGTGGGTTGTTTGCCTTTG_3′; POU5F1 Fw 5′_GTGGAGGAAGCTGACAACAA_3′ and Rv 5′_ATTCTCCAGGTTGCCTCTCA_3′; FLT1 Fw 5′_AGCCCATAAATGGTCTTTGC_3′ and Rv 5′_GTGGTTTGCTTGAGCTGTGT_3′; PIK3CA Fw 5′_TGCAAAGAATCAGAACAATGCC_3′ and 5′_CACGGAGGCATTCTAAAGTCA_3′; BMI1 Fw 5′_AATCCCCACCTGATGTGTGT_3′ and Rv 5′_GCTGGTCTCCAGGTAACGAA_3′; GAPDH Fw 5′_GAAGGTGAAGGTCGGAGTCAAC_3′ and Rv 5′_CAGAGTTAAAAGCAGCCCTGGT_3′; 18S Fw 5′_CGCCGCTAGAGGTGAAATTC_3′ and Rv 5′_CTTTCGCTCTGGTCCGTCTT_3′. The relative amount of specific mRNA was normalized to 18S or GAPDH. Results are presented as the mean ± s.d. of three independent experiments each performed in triplicate (n = 9). Statistical significance was determined by Student’s t-test (two-tailed) using GraphPad Prism 6.0 software. Mice were housed in pathogen-free animal facility. All animal studies were approved by the IACUC at Columbia University (numbers AAAE9252; AAAE9956). Mice were 4–6-week-old male athymic nude (Nu/Nu, Charles River Laboratories). No statistical method was used to pre-determine sample size. No method of randomization was used to allocate animals to experimental groups. Mice in the same cage were generally part of the same treatment. The investigators were not blinded during outcome assessment. In none of the experiments did tumours exceed the maximum volume allowed according to our IACUC protocol, specifically 20 mm in the maximum diameter. 2 × 105 U87 cells stably expressing a doxycycline inducible lentiviral vector coding for DYRK1B or the empty vector were injected subcutaneously in the right flank in 100 μl volume of saline solution (7 mice per each group). Mice carrying 150–220 mm3 subcutaneous tumours (21 days after injection) generated by cells transduced with DYRK1B were treated with vehicle or doxycycline by oral gavage (Vibramycin, Pfizer Labs; 8 mg ml−1, 0.2 ml per day)51; mice carrying tumours generated by cells transduced with the empty vector were also fed with doxycycline. Tumour diameters were measured daily with a caliper and tumour volumes estimated using the formula: width2 × length/2 = V (mm3). Mice were euthanized after 5 days of doxycycline treatment. Tumours were dissected and fixed in formalin for immunohistochemical analysis. Data are means ± s.d. of  7 mice in each group. Statistical significance was determined by ANCOVA using GraphPad Prism 6.0 software package (GraphPad). Orthotopic implantation of glioma cells was performed as described previously using 5 × 104 U87 cells transduced with pLOC-vector, pLOC-DYRK1B (WT) or pLOC-DYRK1B-K140R mutant in 2 μl phosphate buffer42. In brief, 5 days after lentiviral infection, cells were injected 2 mm lateral and 0.5 mm anterior to the bregma, 2.5 mm below the skull of 4–6-week-old athymic nude (Nu/Nu, Charles River Laboratories) mice. Mice were monitored daily for abnormal ill effects according to AAALAS guidelines and euthanized when neurological symptoms were observed. Tumours were dissected and fixed in formalin for immunohistochemical analysis and immunofluorescence using V5 antibody (Life technologies, 46-0705) to identify exogenous DYRK1B and an antibody against human vimentin (Sigma, V6630) to identify human glioma cells. A Kaplan–Meier survival curve was generated using the GraphPad Prism 6.0 software package (GraphPad). Points on the curves indicate glioma related deaths (n = 7 animals for each group, p was determined by log rank analysis). We did not observe non-glioma related deaths. Mice injected with U87 cells transduced with pLOC-DYRK1B(WT) that did not show neurological signs on day 70 were euthanized for histological evaluation and shown as tumour-free mice in Fig. 5g. Intracranial injection of H-Ras-V12-IRES-Cre-ER-shp53 lentivirus was performed in 4-week-old Id1Flox/Flox, Id2Flox/Flox, Id3−/− mice (C57Bl6/SV129). Briefly, 1.3 µl of purified lentiviral particles in PBS were injected 1.45 mm lateral and 1.6 mm anterior to the bregma and 2.3 mm below the skull using a stereotaxic frame. Tamoxifen was administered for 5 days at 9 mg per 40 g of mouse weight by oral gavage starting 30 days after surgery. Mice were killed 2 days later and brains dissected and fixed for histological analysis. Tissue preparation and immunohistochemistry on tumour xenografts were performed as previously described42, 50, 52. Antibodies used in immunostaining are: HIF2α, mouse monoclonal, 1:200 (Novus Biological, NB100-132); Olig2, rabbit polyclonal, 1:200 (IBL International, JP18953); human Vimentin 1:50 (Sigma, V6630), Bromodeoxyuridine, mouse monoclonal 1:500 (Roche, 11170376001), V5 1:500 (Life technologies, 46-0705). Sections were permeabilized in 0.2% tritonX-100 for 10 min, blocked with 1% BSA-5% goat serum in PBS for 1 h. Primary antibodies were incubated at 4 °C overnight. Secondary antibodies biotinylated (Vector Laboratories) or conjugated with Alexa594 (1:500, Molecular Probes) were used. Slides were counterstained with haematoxylin for immunohistochemistry and DNA was counterstained with DAPI (Sigma) for immunofluorescence. Images were acquired using an Olympus 1X70 microscope equipped with digital camera and processed using Adobe Photoshop CS6 software. BrdU-positive cells were quantified by scoring the number of positive cells in five 4 × 10−3 mm2 images from 5 different mice from each group. Blinding was applied during histological analysis. Data are presented as means of five different mice ± standard deviation (s.d.) (two-tailed Student’s t-test, unequal variance). To infer if ID2 modulates the interactions between HIF2α and its transcriptional targets we used a modified version of MINDy53 algorithm, called CINDy25. CINDy uses adaptive partitioning method to accurately estimate the full conditional mutual information between a transcription factor and a target gene given the expression or activity of a signalling protein. Briefly, for every pair of transcription factor and target gene of interest, it estimates the mutual information that is, how much information can be inferred about the target gene when the expression of the transcription factor is known, conditioned on the expression/activity of the signalling protein. It estimates this conditional mutual information by estimating the multi-dimensional probability densities after partitioning the sample distribution using adaptive partitioning method. We applied CINDy algorithm on gene expression data for 548 samples obtained from The Cancer Genome Atlas (TCGA). Since the activity level and not the gene expression of ID2 is the determinant of its modulatory function that is, the extent to which it modulates the transcriptional network of HIF2α, we used an algorithm called Virtual Inference of Protein-activity by Enriched Regulon analysis (VIPER) to infer the activity of ID2 protein from its gene expression profile26. VIPER method allows the computational inference of protein activity, on an individual sample basis, from gene expression profile data. It uses the expression of genes that are most directly regulated by a given protein, such as the targets of a transcription factor (TF), as an accurate reporter of its activity. We defined the targets of ID2 by running ARACNe algorithm on 548 gene expression profiles and use the inferred 106 targets to determine its activity (Supplementary Table 3). We applied CINDy on 277 targets of HIF2α represented in Ingenuity pathway analysis (IPA) and for which gene expression data was available (Supplementary Table 4). Of these 277 targets, 77 are significantly modulated by ID2 activity (P value ≤ 0.05). Among the set of target genes whose expression was significantly positively correlated (P value ≤ 0.05) with the expression of HIF2α irrespective of the activity of ID2, that is, correlation was significant for samples with both high and low activity of ID2, the average expression of target genes for a given expression of HIF2α was higher when the activity of ID2 was high. The same set of target gene were more correlated in high ID2 activity samples compared to any set of random genes of same size (Fig. 5a), whereas they were not in ID2 low activity samples (Fig. 5b). We selected 25% of all samples with the highest/lowest ID2 activity to calculate the correlation between HIF2α and its targets. To determine whether regulation of ID2 by hypoxia might impact the correlation between high ID2 activity and HIF2α shown in Fig. 5a, b we compared the effects of ID2 activity versus ID2 expression for the transcriptional connection between HIF2α and its targets. We selected 25% of all patients (n = 548) in TCGA with high ID2 activity and 25% of patients with low ID2 activity and tested the enrichment of significantly positively correlated targets of HIF2α in each of the groups. This resulted in significant enrichment (P value < 0.001) in high ID2 activity but showed no significant enrichment (P value = 0.093) in low ID2 activity samples. Moreover, the difference in the enrichment score (∆ES) in these two groups was statistically significant (P value < 0.05). This significance is calculated by randomly selecting the same number of genes as the positively correlated targets of HIF2α, and calculating the ∆ES for these randomly selected genes, giving ∆ES . We repeated this step 1,000 times to obtain 1,000 ∆ES that are used to build the null distribution (Extended Data Fig. 9b). We used the null distribution to estimate P value calculated as (number of ∆ES > ∆ES )/1,000. Enrichment was observed only when ID2 activity was high but not when ID2 activity was low, thus suggesting that ID2 activity directionally impacts the regulation of targets of HIF2α by HIF2α. Consistently, the significant ∆ES using ID2 activity suggests that ID2 activity is determinant of correlation between HIF2α and its targets. Conversely, when we performed similar analysis using ID2 expression instead of ID2 activity, we found significant enrichment of positively correlated targets of HIF2α both in samples with high expression (P value = 0.025) and low expression of ID2 (P value = 0.048). Given the significant enrichment in both groups, we did not observe any significant difference in the enrichment score in the two groups (P value of ∆ES = 0.338). Thus, while the determination of the ID2 activity and its effects upon the HIF2α-targets connection by VIPER and CINDy allowed us to determine the unidirectional positive link between high ID2 activity and HIF2α transcription, a similar analysis performed using ID2 expression contemplates the dual connection between ID2 and HIF2α. To test if expression of DYRK1A and DYRK1B is a predictor of prognosis, we divided the patients into two cohorts based on their relative expression compared to the mean expression of all patients in GBM. First cohort contained the patients with high expression of both DYRK1A and DYRK1B (n = 101) and the other cohort contained patients with low expression (n = 128). We used average expression for both DYRK1A and DYRK1B, which individually divide the patient cohort into half and half. However, when we use the condition that patients should display higher or lower average expression of both these genes, then we select approximately 19% for high expression and 24% for low expression. Selection of these patients was entirely dependent on the overall expression of these genes in the entire cohort rather than a predefined cutoff. Kaplan–Meier survival analysis showed the significant survival benefit for the patients having the high expression of both DYRK1A and DYRK1B (P value = 0.004) compared to the patients with low expression. When similar analysis was performed using only the expression of DYRK1A or DYRK1B alone, the prediction was either non-significant (DYRK1A) or less significant (DYRK1B, P value = 0.008) when compared to the predictions using the expression of both genes. Results in graphs are expressed as means ± s.d. or means ± s.e.m., as indicated in figure legends, for the indicated number of observations. Statistical significance was determined by the Student’s t-test (two-tailed, unequal variance). P value < 0.05 is considered significant and is indicated in figure legends.


Huh J.W.,Sungkyunkwan University | Kim H.R.,Chonnam National University | Kim Y.J.,Chonnam National University
Diseases of the Colon and Rectum | Year: 2013

BACKGROUND: The clinical pretreatment factors that accurately predict response to chemoradiation in rectal cancer are not currently known. OBJECTIVE: The aim of this study is to evaluate the clinical factors associated with a pathological complete response after preoperative chemoradiotherapy for rectal cancer. DESIGN: This study is a retrospective review of prospectively collected data. SETTING: This study was conducted at a tertiary care hospital/referral center in South Korea. PATIENTS: From December 2000 to September 2011, a total of 391 consecutive patients with rectal cancer who underwent neoadjuvant chemoradiotherapy followed by radical surgery were identified. The treatment consisted of concurrent chemoradiation, which included preoperative 5-fluorouracil-based chemotherapy and pelvic radiation (median, 5040 cGy); this was followed 8 weeks later (median, 57 days) by surgery with curative intent. MAIN OUTCOME MEASURES: The primary outcome measured was the clinicopathological comparison between pathological complete response (n = 57, 14.6%) and non-pathological complete response (n = 334, 85.4%) groups. RESULTS: The pathological complete response groups had a higher percentage of noncircumferential tumors, nonmacroscopic ulceration, well differentiation, small tumor diameter, early clinical T stage, early clinical N stage, or low levels of pretreatment CEA than the non-pathological complete response group. In multivariate regression analysis, independent predictors of a higher pathological complete response rate were noncircumferentiality (p = 0.007; OR, 3.214), nonmacroscopic ulceration (p = 0.002; OR, 6.702), and low pretreatment CEA level (p = 0.004; OR, 2.656). Significant differences in the pathological complete response rate existed among the 4 risk stratification groups (p < 0.001). For the prediction of pathological complete response by the clinical risk score model, the sensitivity was 64.1% and the specificity was 73.7% (area under the curve, 0.706; p < 0.001). LIMITATIONS: This study was limited because it was a single-institution study with a small sample size. CONCLUSIONS: Pretreatment clinical variables, including tumor circumferentiality, macroscopic ulceration, and CEA level, may be important determinants in achieving a pathological complete response. © 2013 The ASCRS.


Lee J.,University of Wollongong | Sakthivel R.,Sungkyunkwan University
Pramana - Journal of Physics | Year: 2013

The two-dimensional nonlinear physical models and coupled nonlinear systems such as Maccari equations, Higgs equations and Schrödinger-KdV equations have been widely applied in many branches of physics. So, finding exact travelling wave solutions of such equations are very helpful in the theories and numerical studies. In this paper, the Kudryashov method is used to seek exact travelling wave solutions of such physical models. Further, three-dimensional plots of some of the solutions are also given to visualize the dynamics of the equations. The results reveal that the method is a very effective and powerful tool for solving nonlinear partial differential equations arising in mathematical physics. © Indian Academy of Sciences.


Kwon Y.-S.,Chonnam National University | Jeong B.-H.,Sungkyunkwan University | Koh W.-J.,Sungkyunkwan University
Current Opinion in Pulmonary Medicine | Year: 2014

PURPOSE OF REVIEW: Recent advances in the development of new drugs and regimens provide hope that well tolerated, effective, and shorter-duration treatments for tuberculosis (TB) will become available. This review covers the recent trials of new TB drugs and regimens. RECENT FINDINGS: Moxifloxacin and levofloxacin have equally good efficacy and safety in the early phase of treatment of multidrug-resistant TB (MDR-TB), and linezolid has the potential to cure refractory cases of MDR-TB. Bedaquiline and delamanid may be the best drug candidates for enhancing treatment options for MDR-TB. New chemicals, such as sutezolid, AZD5847, PA-824, SQ109, and BTZ043, show potent activity against Mycobacterium tuberculosis. Late-generation fluoroquinolones in combination with the first-line and second-line anti-TB drugs have been used to shorten the treatment duration in drug-susceptible and MDR-TB. SUMMARY: New drugs and new combination regimens in clinical trials are expected to increase therapeutic efficacy and shorten treatment duration in both drug-susceptible and drug-resistant TB. © 2014 Wolters Kluwer Health | Lippincott Williams & Wilkins.


Patent
Sungkyunkwan University and Institute For Basic Science | Date: 2016-03-11

The present invention relates to a partial skull replacement consisting of polydimethylsiloxane (PDMS) and a method of monitoring biological tissues within a skull using the partial skull replacement. The method of monitoring using the partial skull replacement of the present invention has a minimal influence on intracranial pressure and cerebrospinal fluid flow as compared to a conventional cranial window technique using glass, and, by way of visualizing biological tissues within a skull with enhanced clarity, is expected to be usefully employed as a method of monitoring biological tissues within the skull.


Huh J.W.,Sungkyunkwan University | Lee J.H.,Chonnam National University | Kim H.R.,Sungkyunkwan University | Kim H.R.,Chonnam National University
Annals of Surgery | Year: 2014

OBJECTIVE:: This study evaluated the predictive value of a number of tissue biomarkers, including proliferating cell nuclear antigen, survivin, thymidine phosphorylase, thymidylate synthase, bax, p53, nuclear factor-kappa B, vascular endothelial growth factor, matrix metalloproteinase-2, matrix metalloproteinase-9, CD133, CD44, and cyclooxygenase-2 with regard to preoperative chemoradiation in rectal cancer. BACKGROUND:: The ability to predict tumor response before treatment may significantly impact the selection of patients for preoperative chemoradiation therapy for rectal cancer. However, no definite predictive marker is known. METHODS:: Pretreatment biopsies from 123 patients who underwent preoperative chemoradiation were included. The mRNA levels of 13 biomarkers were analyzed by reverse transcriptase-polymerase chain reaction, with normalization relative to glyceraldehydes 3-phosphate dehydrogenase. Response to treatment was assessed by a 4-point tumor regression grade scale based on the ratio of fibrosis to residual cancer. RESULTS:: Among the 13 markers, no significant correlations in terms of T downstaging, N downstaging, and tumor-node-metastasis downstaging were observed. On multiple logistic regression analysis, only CD44 expression was found to be significant independent predictive factors for tumor regression grade response [odds ratio, 4.694 (1.155, 17.741), P = 0.030]. CD44 mRNA expression was significantly associated with expressions of the remaining 12 markers (all P < 0.05). Among the 118 patients receiving radical resection, proliferating cell nuclear antigen was the only independent factor to predict pathologic node negative status [odds ratio, 4.328 (1.078, 12.536), P = 0.037]. CONCLUSIONS:: Elevated CD44 mRNA levels in pretreatment biopsies might be predictive of poor tumor regression after preoperative chemoradiation in rectal cancer. Moreover, the proliferating cell nuclear antigen mRNA level might be predictive of nodal regression. © 2013 Lippincott Williams and Wilkins.


Patent
Kyung Hee University, Sungkyunkwan University and Kyungpook National University | Date: 2015-02-18

The present invention relates to a building energy simulation method may include the steps of: inputting building geometry and coded material information into a building information input program to generate a building information file; importing the building information file into a middleware; mapping the imported coded material information with the imported building geometry through the middleware; and converting the mapped building geometry and the mapped coded material information into an energy simulation program file through the middleware. The building geometry, the coded material information, and the coded space type information may be interconnected through the building information input program which supports BIM, and energy-simulated on the energy simulation program (EnergyPlus or program based on ISO 13790).


News Article | September 2, 2016
Site: phys.org

Comparison between the synapse and the two-terminal tunnelling random access memory (TRAM). In the junctions (synapses) between neurons, signals are transmitted from one neuron to the next. TRAM is made by a stack of different layers: A semiconductor molybdenum disulfide (MoS2) layer with two electrodes (drain and source), an insulating hexagonal boron nitride (h-BN) layer and graphene layer. This two-terminal architecture simulates the two neurons that made up to the synaptic structure. When the difference in the voltage of the drain and the source is sufficiently high, electrons from the drain electrode tunnel through the insulating h-BN and reach the graphene layer. Memory is written when electrons are stored in the graphene layer, and it is erased by the introduction of positive charges in the graphene layer. Credit: Institute for Basic Science Last March, the artificial intelligence (AI) program AlphaGo beat Korean Go champion LEE Se-Dol at the Asian board game. "The game was quite tight, but AlphaGo used 1200 CPUs and 56,000 watts per hour, while Lee used only 20 watts. If a hardware that mimics the human brain structure is developed, we can operate artificial intelligence with less power," points out Professor YU Woo Jong. In collaboration with Sungkyunkwan University, researchers from the Center for Integrated Nanostructure Physics within the Institute for Basic Science (IBS), have devised a new memory device inspired by the neuron connections of the human brain. The research, published in Nature Communications, highlights the devise's highly reliable performance, long retention time and endurance. Moreover, its stretchability and flexibility makes it a promising tool for the next-generation soft electronics attached to clothes or body. The brain is able to learn and memorize thanks to a huge number of connections between neurons. The information you memorize is transmitted through synapses from one neuron to the next as an electro-chemical signal. Inspired by these connections, IBS scientists constructed a memory called two-terminal tunnelling random access memory (TRAM), where two electrodes, referred to as drain and source, resemble the two communicating neurons of the synapse. While mainstream mobile electronics, like digital cameras and mobile phones use the so-called three-terminal flash memory, the advantage of two-terminal memories like TRAM is that two-terminal memories do not need a thick and rigid oxide layer. "Flash memory is still more reliable and has better performance, but TRAM is more flexible and can be scalable," explains Professor Yu. TRAM is made up of a stack of one-atom-thick or a few atom-thick 2D crystal layers: One layer of the semiconductor molybdenum disulfide (MoS2) with two electrodes (drain and source), an insulating layer of hexagonal boron nitride (h-BN) and a graphene layer. In simple terms, memory is created (logical-0), read and erased (logical-1) by the flowing of charges through these layers. TRAM stores data by keeping electrons on its graphene layer. By applying different voltages between the electrodes, electrons flow from the drain to the graphene layer tunnelling through the insulating h-BN layer. The graphene layer becomes negatively charged and memory is written and stored and vice versa, when positive charges are introduced in the graphene layer, memory is erased. IBS scientists carefully selected the thickness of the insulating h-BN layer as they found that a thickness of 7.5 nanometers allows the electrons to tunnel from the drain electrode to the graphene layer without leakages and without losing flexibility. Flexibility and stretchability are indeed two key features of TRAM. When TRAM was fabricated on flexible plastic (PET) and stretachable silicone materials (PDMS), it could be strained up to 0.5% and 20%, respectively. In the future, TRAM can be useful to save data from flexible or wearable smartphones, eye cameras, smart surgical gloves, and body-attachable biomedical devices. Last but not least, TRAM has better performance than other types of two-terminal memories known as phase-change random-access memory (PRAM) and resistive random-access memory (RRAM).


Home > Press > Memory for future wearable electronics: Stretchable, flexible, reliable memory device inspired by the brain Abstract: Last March, the artificial intelligence (AI) program AlphaGo beat Korean Go champion LEE Se-Dol at the Asian board game. "The game was quite tight, but AlphaGo used 1200 CPUs and 56,000 watts per hour, while Lee used only 20 watts. If a hardware that mimics the human brain structure is developed, we can operate artificial intelligence with less power," points out Professor YU Woo Jong. In collaboration with Sungkyunkwan University, researchers from the Center for Integrated Nanostructure Physics within the Institute for Basic Science (IBS), have devised a new memory device inspired by the neuron connections of the human brain. The research, published in Nature Communications, highlights the devise's highly reliable performance, long retention time and endurance. Moreover, its stretchability and flexibility makes it a promising tool for the next-generation soft electronics attached to clothes or body. The brain is able to learn and memorize thanks to a huge number of connections between neurons. The information you memorize is transmitted through synapses from one neuron to the next as an electro-chemical signal. Inspired by these connections, IBS scientists constructed a memory called two-terminal tunnelling random access memory (TRAM), where two electrodes, referred to as drain and source, resemble the two communicating neurons of the synapse. While mainstream mobile electronics, like digital cameras and mobile phones use the so-called three-terminal flash memory, the advantage of two-terminal memories like TRAM is that two-terminal memories do not need a thick and rigid oxide layer. "Flash memory is still more reliable and has better performance, but TRAM is more flexible and can be scalable," explains Professor Yu. TRAM is made up of a stack of one-atom-thick or a few atom-thick 2D crystal layers: One layer of the semiconductor molybdenum disulfide (MoS2) with two electrodes (drain and source), an insulating layer of hexagonal boron nitride (h-BN) and a graphene layer. In simple terms, memory is created (logical-0), read and erased (logical-1) by the flowing of charges through these layers. TRAM stores data by keeping electrons on its graphene layer. By applying different voltages between the electrodes, electrons flow from the drain to the graphene layer tunnelling through the insulating h-BN layer. The graphene layer becomes negatively charged and memory is written and stored and vice versa, when positive charges are introduced in the graphene layer, memory is erased. IBS scientists carefully selected the thickness of the insulating h-BN layer as they found that a thickness of 7.5 nanometers allows the electrons to tunnel from the drain electrode to the graphene layer without leakages and without losing flexibility. Flexibility and stretchability are indeed two key features of TRAM. When TRAM was fabricated on flexible plastic (PET) and stretachable silicone materials (PDMS), it could be strained up to 0.5% and 20%, respectively. In the future, TRAM can be useful to save data from flexible or wearable smartphones, eye cameras, smart surgical gloves, and body-attachable biomedical devices. Last but not least, TRAM has better performance than other types of two-terminal memories known as phase-change random-access memory (PRAM) and resistive random-access memory (RRAM). For more information, please click If you have a comment, please us. Issuers of news releases, not 7th Wave, Inc. or Nanotechnology Now, are solely responsible for the accuracy of the content.


News Article | February 15, 2017
Site: www.eurekalert.org

Pain is a signal of actual or potential damage to the body, so it is natural to think of it as a localized sensation: knee pain in the knee, back pain in the back and so on. However, research has demonstrated that pain is an experience constructed in the brain. A knee doesn't "feel" anything. Instead, it sends signals to the brain. Input from the body is important, but a person's pain experience also depends on the brain's interpretation of what the input signal means. Scientists are just beginning to study these complex cerebral processes, and in a promising step forward, University of Colorado Boulder researchers have developed a functional MRI-based model that identifies brain activity patterns involved in varied pain experience, even when the input from the body is held constant. "Pain is more than just a passive response to stimuli. The brain actively contributes to pain, constructing it through various neural systems," said Choong-Wan Woo, lead author and a post-doctoral researcher in CU Boulder's Institute of Cognitive Science when the research was completed. "Thus, we wanted to build a brain-based model to predict pain using variables beyond the painful stimuli." For the study, researchers began by aggregating data from six independent brain imaging studies, deliberately choosing those with differing methodologies. In all of the studies, participants had been exposed to several seconds' worth of a painful stimulus and asked to rate their pain while inside an MRI scanner that recorded brain activity. From the data, the researchers were able to identify common markers in the brain that were predictive of a participant's different pain experiences when external stimuli are matched on intensity, resulting in fine-grained mapping of both positively correlated ("pro-pain") and negatively correlated ("anti-pain") brain sub-regions. Comprising part of the new model, those markers several brain regions that are not classically considered important for pain. However, the regions -- which include the ventromedial prefrontal cortex, nucleus accumbens, and hippocampus -- are involved in the brain's assessment of the meaning of painful and non-painful events alike. The researchers named their telltale brain pattern the Stimulus Intensity Independent Pain Signature-1 (SIIPS1), a preliminary roadmap that can now be tested and refined in future studies. "We now have a model that can be applied to other basic and clinical pain research in the field," said Woo, who is now beginning an Assistant Professorship at Sungkyunkwan University in South Korea. "We deliberately added the number one to the name because we don't think this is the only brain signature related to pain and expect that more will be developed." The SIIPS1 may provide researchers with a new understanding of chronic pain and hypersensitivity to pain, potentially paving the way for the development of clinical applications and more effective treatments. "There is increasing evidence that chronic pain often involves changes in brain areas identified in our model," said Tor Wager, a professor in CU Boulder's Department of Psychology and Neuroscience and the study's senior author. "The SIIPS1 provides a template for systematic evaluation of how these areas are altered in chronic pain. We hope that it will improve our understanding of chronic pain and lead to the development of new options for preventing and treating this complex disease." The study was published today in the journal Nature Communications. In addition to Woo and Wager, co-authors of the new research include Liane Schmidt of Ecole Normale Supérieure (France); Anjali Krishnan of Brooklyn College of the City University of New York; Marieke Jepma of Leiden University (Netherlands); Mathieu Roy of McGill University (Canada); Martin Lindquist of Johns Hopkins University; and Lauren Atlas of the National Center for Complementary and Integrative Health and the National Institute on Drug Abuse.


News Article | February 14, 2017
Site: www.chromatographytechniques.com

Pain is a signal of actual or potential damage to the body, so it is natural to think of it as a localized sensation: knee pain in the knee, back pain in the back and so on. However, research has demonstrated that pain is an experience constructed in the brain. A knee doesn't "feel" anything. Instead, it sends signals to the brain. Input from the body is important, but a person's pain experience also depends on the brain's interpretation of what the input signal means. Scientists are just beginning to study these complex cerebral processes, and in a promising step forward, University of Colorado Boulder researchers have developed a functional MRI-based model that identifies brain activity patterns involved in varied pain experience, even when the input from the body is held constant. "Pain is more than just a passive response to stimuli. The brain actively contributes to pain, constructing it through various neural systems," said Choong-Wan Woo, lead author and a post-doctoral researcher in CU Boulder's Institute of Cognitive Science when the research was completed. "Thus, we wanted to build a brain-based model to predict pain using variables beyond the painful stimuli." For the study, researchers began by aggregating data from six independent brain imaging studies, deliberately choosing those with differing methodologies. In all of the studies, participants had been exposed to several seconds' worth of a painful stimulus and asked to rate their pain while inside an MRI scanner that recorded brain activity. From the data, the researchers were able to identify common markers in the brain that were predictive of a participant's different pain experiences when external stimuli are matched on intensity, resulting in fine-grained mapping of both positively correlated ("pro-pain") and negatively correlated ("anti-pain") brain sub-regions. Comprising part of the new model, those markers several brain regions that are not classically considered important for pain. However, the regions—which include the ventromedial prefrontal cortex, nucleus accumbens, and hippocampus—are involved in the brain's assessment of the meaning of painful and non-painful events alike. The researchers named their telltale brain pattern the Stimulus Intensity Independent Pain Signature-1 (SIIPS1), a preliminary roadmap that can now be tested and refined in future studies. "We now have a model that can be applied to other basic and clinical pain research in the field," said Woo, who is now beginning an assistant professorship at Sungkyunkwan University in South Korea. "We deliberately added the number one to the name because we don't think this is the only brain signature related to pain and expect that more will be developed." The SIIPS1 may provide researchers with a new understanding of chronic pain and hypersensitivity to pain, potentially paving the way for the development of clinical applications and more effective treatments. "There is increasing evidence that chronic pain often involves changes in brain areas identified in our model," said Tor Wager, a professor in CU Boulder's Department of Psychology and Neuroscience and the study's senior author. "The SIIPS1 provides a template for systematic evaluation of how these areas are altered in chronic pain. We hope that it will improve our understanding of chronic pain and lead to the development of new options for preventing and treating this complex disease." The study was published today in the journal Nature Communications.


News Article | February 22, 2017
Site: news.yahoo.com

FILE - In this Feb. 25, 2015 file photo, South Korean students wearing traditional Korean costumes perform during a graduation ceremony at Sungkyunkwan University in Seoul, South Korea. While most people born in rich countries will live longer by 2030, with women in South Korea projected to reach nearly 91, Americans will continue to have one of the lowest life expectancies of any developed country, a new study published online Tuesday, Feb. 21, 2017 predicts. (AP Photo/Ahn Young-joon, File) LONDON (AP) — While most people born in rich countries will live longer by 2030 — with women in South Korea projected to reach nearly 91 — Americans will continue to have one of the lowest life expectancies of any developed country, a new study predicts. Scientists once thought an average life expectancy beyond 90 was impossible but medical advances combined with improved social programs are continuing to break barriers, including in countries where many people already live well into old age, according to the study's lead researcher, Majid Ezzati of Imperial College London. "I can imagine that there is a limit, but we are still very far from it," he said. Ezzati estimated that people would eventually survive on average to at least 110 or 120 years. The longevity of South Korean women estimated in 2030 is due largely to investments in universal health care, he said. South Korea also led the list for men. "It's basically the opposite of what we're doing in the West, where there's a lot of austerity and inequality," he said. Ezzati and his co-authors used death and longevity trends to estimate life expectancy in 35 developed countries. The calculation is for a baby born in 2030. The study was published online Tuesday in the journal Lancet. Women were ahead of men in all countries. Behind South Korea, women in France, Japan, Spain and Switzerland were projected to live until 88. For South Korea men, life expectancy is expected to reach 84. Next were Australia, Switzerland, Canada and the Netherlands at nearly 84. At the bottom of the list: Macedonia for women at nearly 78, and Serbia for men at about 73. While some genetic factors might explain the longevity in certain countries, social and environmental factors were probably more important, Ezzati said. The study estimated that the U.S., which already lags behind other developed countries, will fall even further behind by 2030, when men and women are projected to live to 80 and 83. American women will fall to 27th out of 35 countries, from their current ranking of 25, and men will fall from 23rd to 26th. The researchers note that among rich countries, the U.S. has the highest maternal and child death rates, homicide rate and is the only high-income country without comprehensive health care. The researchers also predicted how much longer 65 year olds in 2030 would live; they guessed that among men, those in Canada would live the longest, surviving another 23 years. Among 65-year-old women in 2030, they estimated that South Koreans would live the longest, another 28 years. In an accompanying commentary, Ailiana Santosa of Umea University in Sweden wrote that the projections raise "crucial issues" about which strategies are needed to tackle worsening inequality problems. "Achieving universal health coverage is worthy, plausible and needs to be continued," she said. The study was paid for by the U.K. Medical Research Council and the U.S. Environmental Protection Agency.


Nam S.-G.,Pohang University of Science and Technology | Hwang E.H.,Sungkyunkwan University | Lee H.-J.,Pohang University of Science and Technology
Physical Review Letters | Year: 2013

We report measurements of heat transport along the edge conducting channels in monolayer graphene in the integer quantum Hall regime. Hot charge carriers are injected to the edge channels, and the thermoelectric voltage is measured at a distance along the edge from the heat injection point. We confirm that heat transport in graphene in the quantum Hall regime is chiral and the thermoelectric signal is correlated with the charge conductance of ballistic transport, following the Mott relation. The thermoelectric signal decays with distance from the heater, indicating that carriers are partially thermalized during edge transmission. © 2013 American Physical Society.


Xu X.-Q.,Sungkyunkwan University | Han J.H.,Sungkyunkwan University | Han J.H.,Pohang University of Science and Technology
Physical Review Letters | Year: 2012

Hydrodynamic theory of the spinor BEC condensate with Rashba spin-orbit coupling is presented. A close mathematical analogy of the Rashba-Bose-Einstein condensate model to the recently developed theory of chiral magnetism is found. Hydrodynamic equations for mass density, superfluid velocity, and the local magnetization are derived. The mass current is shown to contain an extra term proportional to the magnetization direction, as a result of the Rashba coupling. Elementary excitations around the two known ground states of the Rashba-Bose-Einstein condensate Hamiltonian, the plane-wave, and the stripe states, are worked out in the hydrodynamic framework, highlighting the cross coupling of spin and superflow velocity excitations due to the Rashba term. © 2012 American Physical Society.


Ahn J.-H.,Sungkyunkwan University | Je J.H.,Pohang University of Science and Technology
Journal of Physics D: Applied Physics | Year: 2012

Stretchable electronics, i.e. elastic electronics that can be bent and stretched, is a new, emerging class of electronics, based on building electronic circuits or devices on stretchable substrates. The potential applications range from fully conformable, stretchable, skin sensors for robotic devices, wearable electronic devices, to flesh-like biodevices. One of the challenges in the development of stretchable electronics is to retain full functionality under high external strains in stretching. In this paper, we review a few approaches recently developed for stretchable electronics and highlight recent research efforts on multi-directional writing for stretchable, three-dimensional structures. © 2012 IOP Publishing Ltd.


Ansari S.A.,Bhabha Atomic Research Center | Pathak P.,Bhabha Atomic Research Center | Mohapatra P.K.,Bhabha Atomic Research Center | Manchanda V.K.,Bhabha Atomic Research Center | Manchanda V.K.,Sungkyunkwan University
Chemical Reviews | Year: 2012

The historical perspective and recent advances on the fascinating chemistry of diglycolamides, with special emphasis on their proposed applications in radioactive waste management, is presented. Stephan et al. studied the extraction of various metal ions with multidentate amido podands. The open-chain ether dicarboxylic acid diamides (diglycolamides) exhibited very high D values for rare earth ions, viz. La(III) and Yb(III) from picrate and nitrate media at pH 5. Elsewhere, tripodal chelates bearing three DGA units precisely arranged on a triphenoxymethane platform were synthesized to mimic the preferred TTP geometry favored by lanthanides coordinating through oxygen donor atoms. Yaita et al. and Nave et al. reported the presence of N, N,N',N'-tetraoctyl diglycolamide (TODGA) aggregates dispersed in nonpolar diluents. Wilden et al. proposed a 1-cycle SANEX process for the direct selective extraction of trivalent actinides from a simulated PUREX raffinate using a mixture of CyMe4BTBP and TODGA.


Chae D.,Sungkyunkwan University | Constantin P.,University of Chicago | Wu J.,Oklahoma State University
Archive for Rational Mechanics and Analysis | Year: 2011

Any classical solution of the two-dimensional incompressible Euler equation is global in time. However, it remains an outstanding open problem whether classical solutions of the surface quasi-geostrophic (SQG) equation preserve their regularity for all time. This paper studies solutions of a family of active scalar equations in which each component uj of the velocity field u is determined by the scalar θ through uj = RΛ-1 P(Λ)θ, where R is a Riesz transform and Λ = (-Δ)1/2. The two-dimensional Euler vorticity equation corresponds to the special case P(Λ) = I while the SQG equation corresponds to the case P(Λ) = Λ. We develop tools to bound {double pipe}▽u{double pipe}L∞ for a general class of operators P and establish the global regularity for the Loglog-Euler equation for which P(Λ) = (log(I + log(I - Δ)))γ with 0 ≦ γ ≦ 1. In addition, a regularity criterion for the model corresponding to P(Λ) = Λβ with 0 ≦ β ≦ 1 is also obtained. © 2011 Springer-Verlag.


Tchoe Y.,Seoul National University | Han J.H.,Sungkyunkwan University | Han J.H.,Pohang University of Science and Technology
Physical Review B - Condensed Matter and Materials Physics | Year: 2012

Skyrmions, once a hypothesized field-theoretical object believed to describe the nature of elementary particles, became common sightings in recent years among several noncentrosymmetric metallic ferromagnets. For more practical applications of Skyrmionic matter as a carrier of information, thus realizing the prospect of "Skyrmionics," it is necessary to have the means to create and manipulate Skyrmions individually. We show through extensive simulation of the Landau-Lifshitz-Gilbert equation that a circulating current imparted to the metallic chiral ferromagnetic system can create isolated Skyrmionic spin texture without the aid of external magnetic field. © 2012 American Physical Society.


Han T.-H.,Pohang University of Science and Technology | Lee Y.,Sungkyunkwan University | Choi M.-R.,Pohang University of Science and Technology | Woo S.-H.,Pohang University of Science and Technology | And 4 more authors.
Nature Photonics | Year: 2012

Although graphene films have a strong potential to replace indium tin oxide anodes in organic light-emitting diodes (OLEDs), to date, the luminous efficiency of OLEDs with graphene anodes has been limited by a lack of efficient methods to improve the low work function and reduce the sheet resistance of graphene films to the levels required for electrodes1-4. Here, we fabricate flexible OLEDs by modifying the graphene anode to have a high work function and low sheet resistance, and thus achieve extremely high luminous efficiencies (37.2 lm W-1 in fluorescent OLEDs, 102.7 lm W -1 in phosphorescent OLEDs), which are significantly higher than those of optimized devices with an indium tin oxide anode (24.1 lm W -1 in fluorescent OLEDs, 85.6 lm W-1 in phosphorescent OLEDs). We also fabricate flexible white OLED lighting devices using the graphene anode. These results demonstrate the great potential of graphene anodes for use in a wide variety of high-performance flexible organic optoelectronics. © 2012 Macmillan Publishers Limited. All rights reserved.


Jun Y.,Ulsan National Institute of Science and Technology | Park J.H.,Sungkyunkwan University | Kang M.G.,Electronics and Telecommunications Research Institute
Chemical Communications | Year: 2012

The tubular-shaped nanostructure of TiO 2 is very interesting, and highly ordered arrays of TiO 2 nanotubes (TNTs) can be easily fabricated by anodization of the Ti substrate in specific electrolytes. Here in this feature article, we review synthesis methods for various TNTs including normal, alloy, and architectural forms such as bamboos, lace, and flowers. Specific nanosize architectures such as bamboo and lace types can be regulated by alternating voltage and further anodizing. In order to extend light response of TNTs to visible solar spectra, various dopings of specific elements have been discussed. The normal and modified TNTs are suggested for applications such as dye sensitized solar cells, water splitting, photocatalytic degradation of pollutants, CO 2 reduction, sensors, energy storage devices including Li ion batteries and supercapacitors, and other applications such as flexible substrate and biomaterials. © 2012 The Royal Society of Chemistry.


News Article | September 28, 2016
Site: news.yahoo.com

(Reuters) - In the fast-changing world of science and technology, if you're not innovating, you're falling behind. That’s one of the key findings of The Reuters 100: The World’s Most Innovative Universities. Now in its second year, the list ranks the educational institutions doing the most to advance science, invent new technologies and help drive the global economy. Unlike other rankings that often rely entirely or in part on subjective surveys, Reuters relies exclusively on empirical data such as patent filings and research paper citations. Our 2016 results show that big breakthroughs – even just one highly influential paper or patent – can drive a university way up the list, but when that discovery fades into the past, so does its ranking. According to our findings, consistency is key, with truly innovative institutions putting out groundbreaking work year after year. No university does that better than Stanford University, which once again tops the Reuters 100. Decade after decade, Stanford’s students and faculty consistently innovate. Companies founded by Stanford alumni – including Hewlett Packard and Google – have not only become household names, but have upended existing industries and been the cornerstone of entirely new economies. A 2012 study by the university estimated that all the companies formed by Stanford entrepreneurs generate $2.7 trillion in annual revenue, which would be equivalent to the 10th largest economy in the world. Stanford held fast to its first place ranking by consistently producing new patents and papers that influence researchers elsewhere in academia and in private industry. Those are key criteria in the ranking of the world’s most innovative universities, which was compiled with data from the Intellectual Property & Science division of Thomson Reuters. It’s based on a methodology that focuses on academic papers (which indicate basic research performed at a university) and patent filings (which point to an institution's interest in commercializing its discoveries). The three highest-ranked universities on our list share Stanford’s record of consistent innovation. Researchers at the Massachusetts Institute of Technology (ranked #2) were behind some of the most important innovations of the past century, including the development of digital computers and the completion of the Human Genome Project. Harvard University (ranked #3), is the oldest institution of higher education in the United States, and has produced 47 Nobel laureates over the course of its 380-year history. But look further down the list and it’s clear that innovation is a fickle thing. Take the case of Carnegie Mellon University, a private research university in Pittsburgh, Pennsylvania. When Reuters published its inaugural ranking of the world’s most innovative universities in September 2015, CMU ranked #56. But in 2016 the university fell out of the top 100. How did such a big change occur? The high quality of a Carnegie Mellon education hasn’t changed: It’s still regarded as one of the top universities in the United States, and its computer science program is often considered the best in the world. But in 2015 CMU’s ranking got a big boost from a few blockbuster patents that are now more than a decade old. One such patent, which described new biocompatible polymers that can be used in human patients for applications such as wound repair, was frequently cited by outside researchers as “prior art” in their own patent applications. It received 27 citations in 2008, more than any other CMU patent that year. But in subsequent years its influence dropped. Since Reuters’ methodology only considers citations within a recent window of time, the 2016 ranking no longer includes this patent from 2008 and citations to it – and as a result CMU’s big discovery doesn’t have the same effect on its score. The university didn’t do anything wrong to cause it to drop off the list, that’s just the nature of innovation. One discovery can cause a sudden leap forward, and have an outsized impact on the world. Meanwhile, some universities saw significant movement in the other direction, including, most notably, the University of Chicago, which jumped from #71 last year to #47 in 2016. Other list-climbers include the Netherlands' Delft University of Technology (#73 to #44) and South Korea's Sungkyunkwan University (#66 to #46). While individual universities move up and down the ranking, the regional breakdown remains largely the same year over year. The United States continues to dominate the list, with 46 universities in the top 100; Japan is once again the second best performing country, with nine universities. France and South Korea are tied in third, each with eight. Germany has seven ranked universities; the United Kingdom has five; Switzerland, Belgium and Israel have three; Denmark, China and Canada have two; and the Netherlands and Singapore each have one. The highest ranked university outside the U.S. is the Korea Advanced Institute of Science & Technology, or KAIST, ranked #6. (KAIST placed first on Reuters’ recently published list of Asia's Most Innovative Universities. Click here for details: (http://reut.rs/2doAoNP)). Established in 1971 by the Korean government, KAIST was modeled after engineering schools in the United States, and initially funded with a multimillion-dollar loan from the United States Agency for International Development. Most major courses are taught in English, and the university maintains strong links to the U.S. academic community. The most innovative university in Europe is KU Leuven, ranked #9, a Dutch-speaking school based in Belgium's Flanders region. Founded in 1425 by Pope Martin V, it is the world’s oldest Catholic university, but its modern mission is comprehensive and advanced scientific research, and it operates autonomously from the church. To compile its ranking of the world’s most innovative universities, the IP & Science division of Thomson Reuters began by identifying more than 600 global organizations – including educational institutions, nonprofit charities and government-funded labs – that publish the most academic research. Then they evaluated each candidate on 10 different metrics and ranked them based on their performance. (Click here(http://reut.rs/2dphIc7) for the full methodology.) Careful observers might note a few differences between how non-U.S. schools ranked on Reuters’ regional innovation lists, Asia's Most Innovative Universities and Europe's Most Innovative Universities (http://reut.rs/2d6nMc1), and how they rank on the global innovators list. An institution’s relative ranking may change from list to list, since each ranking is dependent on summarizing 10 indicators and comparing that with others in a specific population; when that population changes, individual rankings might change as well. Furthermore, the global list is restricted to institutions that filed 70 or more patents with the World Intellectual Property Organization during the five-year period examined by Thomson Reuters. The cutoff for regional lists is just 50 patents, allowing a more in-depth view of the most active institutions within a limited geographic area. Of course, the relative ranking of any university – or whether it appears on the list at all – does not provide a complete picture of whether its researchers are doing important, innovative work. Since the ranking measures innovation on an institutional level, it may overlook particularly innovative departments or programs: a university might rank low for overall innovation but still operate one of the world’s best medical schools, for instance. And it’s important to remember that whether a university ranks at the top or the bottom of the list, it’s still within the top 100 on the planet. All of these universities produce original research, create useful technology and stimulate the global economy.


Yu W.J.,University of California at Los Angeles | Yu W.J.,Sungkyunkwan University | Liu Y.,University of California at Los Angeles | Zhou H.,University of California at Los Angeles | And 4 more authors.
Nature Nanotechnology | Year: 2013

Layered materials of graphene and MoS 2, for example, have recently emerged as an exciting material system for future electronics and optoelectronics. Vertical integration of layered materials can enable the design of novel electronic and photonic devices. Here, we report highly efficient photocurrent generation from vertical heterostructures of layered materials. We show that vertically stacked graphene-MoS 2 -graphene and graphene-MoS 2 -metal junctions can be created with a broad junction area for efficient photon harvesting. The weak electrostatic screening effect of graphene allows the integration of single or dual gates under and/or above the vertical heterostructure to tune the band slope and photocurrent generation. We demonstrate that the amplitude and polarity of the photocurrent in the gated vertical heterostructures can be readily modulated by the electric field of an external gate to achieve a maximum external quantum efficiency of 55% and internal quantum efficiency up to 85%. Our study establishes a method to control photocarrier generation, separation and transport processes using an external electric field. © 2013 Macmillan Publishers Limited.


Yu W.J.,University of California at Los Angeles | Liao L.,University of California at Los Angeles | Chae S.H.,Sungkyunkwan University | Lee Y.H.,University of California at Los Angeles | Duan X.,University of California at Los Angeles
Nano Letters | Year: 2011

The bilayer graphene has attracted considerable attention for potential applications in future electronics and optoelectronics because of the feasibility to tune its band gap with a vertical displacement field to break the inversion symmetry. Surface chemical doping in bilayer graphene can induce an additional offset voltage to fundamentally affect the vertical displacement field and the band gap opening in bilayer graphene. In this study, we investigate the effect of chemical molecular doping on band gap opening in bilayer graphene devices with single or dual gate modulation. Chemical doping with benzyl viologen molecules modulates the displacement field to allow the opening of a transport band gap and the increase of the on/off ratio in the bilayer graphene transistors. Additionally, Fermi energy level in the opened gap can be rationally controlled by the amount of molecular doping to obtain bilayer graphene transistors with tunable Dirac points, which can be readily configured into functional devices, such as complementary inverters. © 2011 American Chemical Society.


Patent
Sungkyunkwan University and Snu R&Db Foundation | Date: 2014-05-02

A memory storage apparatus interworking with a database management system and a file system includes a flash translation layer (FTL) configured to guarantee atomicity of a transaction for the database management system by utilizing a copy-on-write (CoW) mechanism.


Patent
Qit Co. and Sungkyunkwan University | Date: 2015-08-17

In a method of efficiently managing and extending life of a battery bank, it is identified whether lifespan characteristic value of a battery bank unit reaches a predetermined threshold value of lifespan extension, by monitoring a lifespan characteristic value of an individual battery bank unit. While the other battery bank units normally supply power, a high-frequency electric pulse is applied to an identified battery bank unit through a DC/DC converter. Thus, materials preventing an electrochemical reaction accumulated on an electrode are removed.


Patent
Lsis Co. and Sungkyunkwan University | Date: 2014-11-06

Disclosed are electrical contact materials and a method for preparing the same. The electrical contact material includes (i) one or more kinds of metals selected from the group consisting of silver (Ag), copper (Cu) and gold (Au), and an alloy of nickel (Ni); and (ii) carbon nano tubes (CNTs) coated with Ag nanoparticles, Ag plated CNTs, or Ag nanowires, or (i) one or more kinds of metals selected from the group consisting of Ag, Cu, Ni and Au; (ii) a metal oxide that is cadmium oxide, indium oxide, tin oxide, zinc oxide or mixture thereof; and (iii) CNTs coated with Ag nanoparticles, Ag plated CNTs, or Ag nanowires. Accordingly, it is possible to reduce the content of high-priced Ag and to obtain excellent electrical and mechanical properties.


Patent
LSIS Co. and Sungkyunkwan University | Date: 2016-11-23

The present invention relates to methods for preparing electrical contact materials comprising silver (Ag) plated carbon nanotubes. The invention has an effect of uniformly dispersing carbon nanotubes in the material by including silver (Ag) in the carbon nanotubes to suppress the aggregation of carbon nanotubes when the electrical contacts are prepared.


Patent
Lsis Co. and Sungkyunkwan University | Date: 2016-05-23

In some embodiments, the effect of uniformly dispersing carbon nanotubes in the material is achieved by including Ag in the carbon nanotubes to suppress the aggregation of carbon nanotubes when the electrical contacts are prepared.


Patent
LSIS Co. and Sungkyunkwan University | Date: 2015-06-03

Disclosed are electrical contact materials and a method for preparing the same. The electrical contact material includes (i) one or more kinds of metals selected from the group consisting of silver (Ag), copper (Cu) and gold (Au), and an alloy of nickel (Ni); and (ii) carbon nano tubes (CNTs) coated with Ag nanoparticles, Ag plated CNTs, or Ag nanowires, or (i) one or more kinds of metals selected from the group consisting of Ag, Cu, Ni and Au; (ii) a metal oxide that is cadmium oxide, indium oxide, tin oxide, zinc oxide or mixture thereof; and (iii) CNTs coated with Ag nanoparticles, Ag plated CNTs, or Ag nanowires. Accordingly, it is possible to reduce the content of high-priced Ag and to obtain excellent electrical and mechanical properties.


The present invention relates to a contrast agent for nuclear magnetic resonance imaging, and more particularly, to a contrast agent for nuclear magnetic resonance imaging containing melanin nanoparticles having a uniform shape and size, thereby providing good dispersibility in water, no cell toxicity, and a long retention time in vivo.


Jeon N.J.,Korea Research Institute of Chemical Technology | Lee J.,Korea Research Institute of Chemical Technology | Noh J.H.,Korea Research Institute of Chemical Technology | Nazeeruddin M.K.,Institute of Chemical science and Engineering | And 3 more authors.
Journal of the American Chemical Society | Year: 2013

A set of three N,N-di-p-methoxyphenylamine-substituted pyrene derivatives have successfully been synthesized and characterized by 1H/ 13C NMR spectroscopy, mass spectrometry, and elemental analysis. The optical and electronic structures of the pyrene derivatives were adjusted by controlling the ratio of N,N-di-p-methoxyphenylamine to pyrene, and investigated by UV/vis spectroscopy and cyclic voltammetry. The pyrene derivatives were employed as hole-transporting materials (HTMs) in fabricating mesoporous TiO2/CH3NH3PbI3/HTMs/Au solar cells. The pyrene-based derivative Py-C exhibited a short-circuit current density of 20.2 mA/cm2, an open-circuit voltage (Voc) of 0.886 V, and a fill factor of 69.4% under an illumination of 1 sun (100 mW/cm2), resulting in an overall power conversion efficiency of 12.4%. The performance is comparable to that of the well-studied spiro-OMeTAD, even though the V oc is slightly lower. Thus, this newly synthesized pyrene derivative holds promise as a HTM for highly efficient perovskite-based solar cells. © 2013 American Chemical Society.


Quan W.,Sungkyunkwan University | Jo E.-K.,Chungnam National University | Lee M.-S.,Sungkyunkwan University
Diabetes, Obesity and Metabolism | Year: 2013

Apoptosis of pancreatic β-cells is the final step in the development of type 1 diabetes (T1D), leading to critically diminished β-cell mass and contributing to the onset of hyperglycaemia. The spontaneous apoptosis of pancreatic β-cells during pancreas ontogeny also induces cell death-associated inflammation, stimulates antigen-presenting cells and sensitizes naïve diabetogenic T cells. The role of pancreatic β-cell death in type 2 diabetes (T2D) is less clear. In the preclinical period of T2D, hyperinsulinaemia and β-cell hyperplasia develop to compensate for insulin resistance, which is clearly seen in animal models of T2D. For the development of overt T2D, relative insulin deficiency is critical in addition to insulin resistance. Insulin deficiency could be due to β-cell dysfunction and/or decreased β-cell mass. Pancreatic β-cell apoptosis due to lipid injury (lipoapoptosis), endoplasmic reticulum (ER) stress or JNK activation could contribute to the decreased β-cell mass in T2D. Activation of inflammasomes by lipid injury, ER stress, human islet amyloid polypeptide, hyperglycaemia or autophagy insufficiency could also lead to β-cell death or dysfunction. Thus, β-cell death and cell death-associated inflammation through innate immune receptors could be important in both T1D and T2D. © 2013 John Wiley & Sons Ltd.


Kim H.-S.,Sungkyunkwan University | Mora-Sero I.,Jaume I University | Gonzalez-Pedro V.,Jaume I University | Fabregat-Santiago F.,Jaume I University | And 3 more authors.
Nature Communications | Year: 2013

Photovoltaic conversion requires two successive steps: accumulation of a photogenerated charge and charge separation. Determination of how and where charge accumulation is attained and how this accumulation can be identified is mandatory for understanding the performance of a photovoltaic device and for its further optimization. Here we analyse the mechanism of carrier accumulation in lead halide perovskite, CH3 NH3 PbI 3, thin-absorber solar cells by means of impedance spectroscopy. A fingerprint of the charge accumulation in high density of states of the perovskite absorber material has been observed at the capacitance of the samples. This is, as far as we know, the first observation of charge accumulation in light-absorbing material for nanostructured solar cells, indicating that it constitutes a new kind of photovoltaic device, differentiated from sensitized solar cells, which will require its own methods of study, characterization and optimization. © 2009-2012 IEEE.


Zhang H.,Zhejiang University | Jin M.,Xi'an University of Science and Technology | Xiong Y.,Anhui University of Science and Technology | Lim B.,Sungkyunkwan University | Xia Y.,Georgia Institute of Technology
Accounts of Chemical Research | Year: 2013

Palladium is a marvelous catalyst for a rich variety of reactions in industrial processes and commercial devices. Most Pd-catalyzed reactions exhibit structure sensitivity, meaning that the activity or selectivity depends on the arrangement of atoms on the surface. Previously, such reactions could only be studied in ultrahigh vacuum using Pd single crystals cut with a specific crystallographic plane. However, these model catalysts are far different from real catalytic systems owing to the absence of atoms at corners and edges and the extremely small specific surface areas for the model systems. Indeed, enhancing the performance of a Pd-based catalyst, in part to reduce the amount needed of this precious and rare metal for a given reaction, requires the use of Pd with the highest possible specific surface area. Recent advances in nanocrystal synthesis are offering a great opportunity to investigate and quantify the structural sensitivity of catalysts based on Pd and other metals. For a structure-sensitive reaction, the catalytic properties of Pd nanocrystals are strongly dependent on both the size and shape. The shape plays a more significant role in controlling activity and selectivity, because the shape controls not only the facets but also the proportions of surface atoms at corners, edges, and planes, which affect the outcomes of possible reactions. We expect catalysts based on Pd nanocrystals with optimized shapes to meet the increasing demands of industrial applications at reduced loadings and costs.In this Account, we discuss recent advances in the synthesis of Pd nanocrystals with controlled shapes and their resulting performance as catalysts for a large number of reactions. First, we review various synthetic strategies based on oxidative etching, surface capping, and kinetic control that have been used to direct the shapes of nanocrystals. When crystal growth is under thermodynamic control, the capping agent plays a pivotal role in determining the shape of a product by altering the order of surface energies for different facets through selective adsorption; the resulting product has the lowest possible total surface energy. In contrast, the product of a kinetically controlled synthesis often deviates from the thermodynamically favored structure, with notable examples including nanocrystals enclosed by high-index facets or concave surfaces.We then discuss the key parameters that control the nucleation and growth of Pd nanocrystals to decipher potential growth mechanisms and build a connection between the experimental conditions and the pathways to different shapes. Finally, we present a number of examples to highlight the use of these Pd nanocrystals as catalysts or electrocatalysts for various applications with structure-sensitive properties. We believe that a deep understanding of the shape-dependent catalytic properties, together with an ability to experimentally maneuver the shape of metal nanocrystals, will eventually lead to rational design of advanced catalysts with substantially enhanced performance. © 2012 American Chemical Society.


Jang H.W.,Sungkyunkwan University | Kim K.-J.,Dongguk University
BMC Medical Education | Year: 2014

Background: Multimedia learning has been shown effective in clinical skills training. Yet, use of technology presents both opportunities and challenges to learners. The present study investigated student use and perceptions of online clinical videos for learning clinical skills and in preparing for OSCE (Objective Structured Clinical Examination). This study aims to inform us how to make more effective us of these resources. Methods. A mixed-methods study was conducted for this study. A 30-items questionnaire was administered to investigate student use and perceptions of OSCE videos. Year 3 and 4 students from 34 Korean medical schools who had access to OSCE videos participated in the online survey. Additionally, a semi-structured interview of a group of Year 3 medical students was conducted for an in-depth understanding of student experience with OSCE videos. Results: 411 students from 31 medical schools returned the questionnaires; a majority of them found OSCE videos effective for their learning of clinical skills and in preparing for OSCE. The number of OSCE videos that the students viewed was moderately associated with their self-efficacy and preparedness for OSCE (p < 0.05). One-thirds of those surveyed accessed the video clips using mobile devices; they agreed more with the statement that it was convenient to access the video clips than their peers who accessed the videos using computers (p < 0.05). Still, students reported lack of integration into the curriculum and lack of interaction as barriers to more effective use of OSCE videos. Conclusions: The present study confirms the overall positive impact of OSCE videos on student learning of clinical skills. Having faculty integrate these learning resources into their teaching, integrating interactive tools into this e-learning environment to foster interactions, and using mobile devices for convenient access are recommended to help students make more effective use of these resources. © 2014 Jang and Kim; licensee BioMed Central Ltd.


Yoo E.-H.,Konyang University | Lee S.-Y.,Sungkyunkwan University
Sensors | Year: 2010

Blood glucose monitoring has been established as a valuable tool in the management of diabetes. Since maintaining normal blood glucose levels is recommended, a series of suitable glucose biosensors have been developed. During the last 50 years, glucose biosensor technology including point-of-care devices, continuous glucose monitoring systems and noninvasive glucose monitoring systems has been significantly improved. However, there continues to be several challenges related to the achievement of accurate and reliable glucose monitoring. Further technical improvements in glucose biosensors, standardization of the analytical goals for their performance, and continuously assessing and training lay users are required. This article reviews the brief history, basic principles, analytical performance, and the present status of glucose biosensors in the clinical practice. © 2010 by the authors; licensee MDPI, Basel, Switzerland.


Im J.-H.,Sungkyunkwan University | Jang I.-H.,Sungkyunkwan University | Pellet N.,Institute of Chemical science and Engineering | Pellet N.,Max Planck Institute for Solid State Research | And 2 more authors.
Nature Nanotechnology | Year: 2014

Perovskite solar cells with submicrometre-thick CH3 NH3 PbI3 or CH3 NH 3 PbI 3- x Cl x active layers show a power conversion efficiency as high as 15%. However, compared to the best-performing device, the average efficiency was as low as 12%, with a large standard deviation (s.d.). Here, we report perovskite solar cells with an average efficiency exceeding 16% and best efficiency of 17%. This was enabled by the growth of CH3 NH3 PbI3 cuboids with a controlled size via a two-step spin-coating procedure. Spin-coating of a solution of CH 3 NH 3 I with different concentrations follows the spin-coating of PbI 2, and the cuboid size of CH3 NH3 PbI3 is found to strongly depend on the concentration of CH3 NH3 I. Light-harvesting efficiency and charge-carrier extraction are significantly affected by the cuboid size. Under simulated one-sun illumination, average efficiencies of 16.4% (s.d.±0.35), 16.3% (s.d.±0.44) and 13.5% (s.d.±0.34) are obtained from solutions of CH3 NH3 I with concentrations of 0.038M, 0.050 M and 0.063 M, respectively. By controlling the size of the cuboids of CH3 NH3 PbI3 during their growth, we achieved the best efficiency of 17.01% with a photocurrent density of 21.64mA-2, open-circuit photovoltage of 1.056V and fill factor of 0.741. © 2014 Macmillan Publishers Limited. All rights reserved.


Chun E.J.,Korea Institute for Advanced Study | Park J.-C.,Sungkyunkwan University | Park J.-C.,Chungnam National University
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2015

We update indirect constraints on Electro-Weak Dark Matter (EWDM) considering the Sommerfeld-Ramsauer-Townsend (SRT) effect for its annihilations into a pair of standard model gauge bosons assuming that EWDM accounts for the observed dark matter (DM) relic density for a given DM mass and mass gaps among the multiplet components. For the radiative or smaller mass splitting, the hypercharged triplet and higher multiplet EWDMs are ruled out up to the DM mass ≈10-20 TeV by the combination of the most recent data from AMS-02 (antiproton), Fermi-LAT (gamma-ray), and HESS (gamma-line). The Majorana triplet (wino-like) EWDM can evade all the indirect constraints only around Ramsauer-Townsend dips which can occur for a tiny mass splitting of order 10 MeV or less. In the case of the doublet (Higgsino-like) EWDM, a wide range of its mass ≳500 GeV is allowed except Sommerfeld peak regions. Such a stringent limit on the triplet DM can be evaded by employing a larger mass gap of the order of 10 GeV which allows its mass larger than about 1 TeV. However, the future CTA experiment will be able to cover most of the unconstrained parameter space. © 2015 The Authors.


Home > Press > Visualizing atoms of perovskite crystals: OIST researchers conduct the first atomic resolution study of perovskites used in next generation solar cells Abstract: Organic-inorganic perovskite materials are key components of the new generation of solar cells. Understanding properties of these materials is important for improving lifetime and quality of solar cells. Researchers from the Energy Materials and Surface Sciences (EMSS) Unit, led by Prof. Yabing Qi, at the Okinawa Institute of Science and Technology Graduate University (OIST) in collaboration with Prof. Youyong Li's group from Soochow University (China) and Prof. Nam-Gyu Park's group from Sungkyunkwan University (Korea) report in the Journal of the American Chemical Society the first atomic resolution study of organic-inorganic perovskite. Perovskites are a class of materials with the general chemical formula ABX3. A and B are positive ions bound by negative ions X. Organic-inorganic perovskites used in solar cells are usually methylammonium lead halides (CH3NH3PbX3, where X is bromine, iodine, or chlorine). The OIST scientists used a single crystal of methylammonium lead bromide (CH3NH3PbBr3) to create topographic images of its surface with a scanning tunneling microscope. This microscope uses a conducting tip that moves across the surface in a manner very similar to a finger moving across a Braille sign. While the bumps in Braille signs are a few millimetres apart, the microscope detects bumps that are more than million times smaller -- atoms and molecules. This is achieved by the quantum tunneling effect -- the ability of an electron to pass through a barrier. The probability of an electron passing between the material surface and the tip depends on the distance between the two. The resulting atomic-resolution topographic images reveal positions and orientations of atoms and molecules, and also provide a detailed look at structural defects in the surface. "At room temperature atoms and molecules are quite mobile, so we decided to freeze the crystal to almost absolute zero (-269ºC) to get a good picture of its atomic structure," says Dr Robin Ohmann, a member of the EMSS Unit and the first author of the paper. The crystal was cut and studied in a vacuum to avoid contamination of the surface. Dr Ohmann's colleagues from Soochow University calculated atomic structures using principles of quantum physics and then compared them with scanning tunneling microscopy data. The researchers discovered that methylammonium molecules can rotate and that they favour specific orientations that lead to two types of surface structures with distinctly different properties. Apart from rotation, these molecules affect positions of neighbouring bromine ions, further altering the atomic structure. Since the structure dictates the electronic properties of the material, the geometric positions of atoms are essential for understanding of solar cells. Scanning tunneling microscope images also reveal local imperfections caused by dislocations of molecules and ions and, probably, missing atoms. These imperfections may affect device performance, for example, by changing electrical properties such as conductivity. The structure of perovskite materials is temperature-sensitive and the observed structure of the frozen crystal might not be fully identical to the structure at room temperature. However, the comprehensive description of perovskite crystals at the atomic level paves the way to better understanding of their behaviour under real-life conditions. The current findings shed light on molecule-ion interplay on the surface of an organic-inorganic crystal and should help to improve designs of future solar cells. The next goal of the researchers is to examine interactions between perovskites and other molecules, for example water molecules that are known to interfere with the performance of solar cells. For more information, please click If you have a comment, please us. Issuers of news releases, not 7th Wave, Inc. or Nanotechnology Now, are solely responsible for the accuracy of the content.


Methylammonium molecules (represented by a ball-and-stick model in the centre) in methylammonium lead bromide (CH3NH3PbBr3) can rotate. They favour specific orientations that lead to two types of surface structures with distinctly different properties (left and right images). Organic-inorganic perovskite materials are key components of the new generation of solar cells. Understanding properties of these materials is important for improving lifetime and quality of solar cells. Researchers from the Energy Materials and Surface Sciences (EMSS) Unit, led by Prof. Yabing Qi, at the Okinawa Institute of Science and Technology Graduate University (OIST) in collaboration with Prof. Youyong Li's group from Soochow University (China) and Prof. Nam-Gyu Park's group from Sungkyunkwan University (Korea) report in the Journal of the American Chemical Society the first atomic resolution study of organic-inorganic perovskite. Perovskites are a class of materials with the general chemical formula ABX3. A and B are positive ions bound by negative ions X. Organic-inorganic perovskites used in solar cells are usually methylammonium lead halides (CH3NH3PbX3, where X is bromine, iodine, or chlorine). The OIST scientists used a single crystal of methylammonium lead bromide (CH3NH3PbBr3) to create topographic images of its surface with a scanning tunneling microscope. This microscope uses a conducting tip that moves across the surface in a manner very similar to a finger moving across a Braille sign. While the bumps in Braille signs are a few millimetres apart, the microscope detects bumps that are more than million times smaller—atoms and molecules. This is achieved by the quantum tunneling effect—the ability of an electron to pass through a barrier. The probability of an electron passing between the material surface and the tip depends on the distance between the two. The resulting atomic-resolution topographic images reveal positions and orientations of atoms and molecules, and also provide a detailed look at structural defects in the surface. "At room temperature atoms and molecules are quite mobile, so we decided to freeze the crystal to almost absolute zero (-269ºC) to get a good picture of its atomic structure," says Dr Robin Ohmann, a member of the EMSS Unit and the first author of the paper. The crystal was cut and studied in a vacuum to avoid contamination of the surface. Dr Ohmann's colleagues from Soochow University calculated atomic structures using principles of quantum physics and then compared them with scanning tunneling microscopy data. The researchers discovered that methylammonium molecules can rotate and that they favour specific orientations that lead to two types of surface structures with distinctly different properties. Apart from rotation, these molecules affect positions of neighbouring bromine ions, further altering the atomic structure. Since the structure dictates the electronic properties of the material, the geometric positions of atoms are essential for understanding of solar cells. Scanning tunneling microscope images also reveal local imperfections caused by dislocations of molecules and ions and, probably, missing atoms. These imperfections may affect device performance, for example, by changing electrical properties such as conductivity. The structure of perovskite materials is temperature-sensitive and the observed structure of the frozen crystal might not be fully identical to the structure at room temperature. However, the comprehensive description of perovskite crystals at the atomic level paves the way to better understanding of their behaviour under real-life conditions. The current findings shed light on molecule-ion interplay on the surface of an organic-inorganic crystal and should help to improve designs of future solar cells. The next goal of the researchers is to examine interactions between perovskites and other molecules, for example water molecules that are known to interfere with the performance of solar cells. Inside view of the scanning tunneling microscope. The yellow cylinders are the heat shields, behind which the sample gets cooled. Explore further: Pinholes be gone More information: Robin Ohmann et al. Real-Space Imaging of the Atomic Structure of Organic–Inorganic Perovskite, Journal of the American Chemical Society (2015). DOI: 10.1021/jacs.5b08227


Kim M.Y.,Yonsei University | Jeong W.K.,Sungkyunkwan University | Baik S.K.,Yonsei University
World Journal of Gastroenterology | Year: 2014

With advances in the management and treatment of advanced liver disease, including the use of antiviral therapy, a simple, one stage description for advanced fibrotic liver disease has become inadequate. Although refining the diagnosis of cirrhosis to reflect disease heterogeneity is essential, current diagnostic tests have not kept pace with the progression of this new paradigm. Liver biopsy and hepatic venous pressure gradient measurement are the gold standards for the estimation of hepatic fibrosis and portal hypertension (PHT), respectively, and they have diagnostic and prognostic value. However, they are invasive and, as such, cannot be used repeatedly in clinical practice. The ideal noninvasive test should be safe, easy to perform, inexpensive, reproducible as well as to give numerical and accurate results in real time. It should be predictive of long term outcomes related with fibrosis and PHT to allow prognostic stratification. Recently, many types of noninvasive alternative tests have been developed and are under investigation. In particular, imaging and ultrasound based tests, such as transient elastography, have shown promising results. Although most of these noninvasive tests effectively identify severe fibrosis and PHT, the methods available for diagnosing moderate disease status are still insufficient, and further investigation is essential to predict outcomes and individualize therapy in this field. © 2014 Baishideng Publishing Group Co., Limited. All rights reserved.


Choi Y.A.,Sungkyunkwan University | Kim C.K.,Sungkyunkwan University | Park B.K.,Sungkyunkwan University | Kim B.,Rochester College
Radiology | Year: 2013

Purpose: To retrospectively compare absolute and relative washout of adrenal metastases in patients with renal cell carcinoma (RCC) and hepatocellular carcinoma (HCC) to that of adrenal adenoma. Materials and Between November 1994 and August 2011, in this insti-Methods: tutional review board-approved study (with waiver of informed consent), 16 patients with 19 adrenal metastases (16 in 13 RCC patients, three in three HCC patients) and 20 patients with 21 adrenal adenomas (16 in 15 RCC patients, five in five HCC patients) underwent dedicated adrenal protocol consisting of unenhanced, 1-minute contrast material-enhanced, and 15-minute delayed contrast-enhanced computed tomography (CT). The attenuation values and percentage enhancement washout, including absolute percentage washout (APW) and relative percentage washout (RPW), were calculated. If available, histologic fndings and the change in the size of adrenal lesions were assessed. Statistical analyses were performed by using generalized estimating equation and coefficient of variation. Results: The mean APW of the metastases (observer 1, 67% 6 11 [standard deviation]; observer 2, 63% 6 12) was not significantly different from that of adenomas (observer 1, 73% 6 9; observer 2, 72% 6 12) for observer 1 (P =.143) and was significantly different for observer 2 (P =.029). The mean RPW of the metastases (observer 1, 46% 6 11; observer 2, 43% 6 12) was significantly lower than that of adenomas (observer 1, 62% 6 19; observer 2, 60% 6 17) (all P <.001 for each observer). With a threshold of 60% for APW or 40% for RPW, 95% (18 of 19) and 89% (17 of 19), respectively, of the metastases were falsely diagnosed as lipid-poor adenomas by each observer. All nine metastases that were followed up at CT had a substantial growth in size. Conclusion: In patients with RCC and HCC who undergo dedicated adrenal CT imaging for known adrenal lesions, the percentage enhancement washout of adrenal metastases is similar to that of lipid-poor adrenal adenomas. Careful imaging follow-up or pathologic tissue confrmation is needed. © RSNA, 2012.


Lee M.J.,Sungkyunkwan University | Yi S.D.,Sungkyunkwan University | Kim B.J.,Sungkyunkwan University
Physical Review Letters | Year: 2014

Phase transition in its strict sense can only be observed in an infinite system, for which equilibration takes an infinitely long time at criticality. In numerical simulations, we are often limited both by the finiteness of the system size and by the finiteness of the observation time scale. We propose that one can overcome this barrier by measuring the nonequilibrium temporal relaxation for finite systems and by applying the finite-time-finite-size scaling (FTFSS) which systematically uses two scaling variables, one temporal and the other spatial. The FTFSS method yields a smooth scaling surface, and the conventional finite-size scaling curves can be viewed as proper cross sections of the surface. The validity of our FTFSS method is tested for the synchronization transition of Kuramoto models in the globally coupled structure and in the small-world network structure. Our FTFSS method is also applied to the Monte Carlo dynamics of the globally coupled q-state clock model. © 2014 American Physical Society.


Kim N.H.,Chung - Ang University | Kim B.J.,Sungkyunkwan University | Ko Y.,Chung - Ang University | Cho J.H.,Sungkyunkwan University | Chang S.T.,Chung - Ang University
Advanced Materials | Year: 2013

Fast and reproducible patterning of high-resolution rGO microstructures over a large area directly on various substrates by modulating the surface energy is reported. The pattern formation of rGO thin films is based on the difference in the adhesion strength between the mold/rGO and rGO/substrates interfaces. Such highly defined rGO micropatterns are applied as electrodes for high-performance flexible and transparent OFETs. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.


Xu X.-Q.,Sungkyunkwan University | Han J.H.,Sungkyunkwan University
Physical Review Letters | Year: 2011

We examine the combined effects of Rashba spin-orbit (SO) coupling and rotation on trapped spinor Bose-Einstein condensates. The nature of single particle states is thoroughly examined in the Landau level basis and is shown to support the formation of a half-quantum vortex. In the presence of weak s-wave interactions, the ground state at strong SO coupling develops ringlike structures with domains whose number shows step behavior with increasing rotation. For the fast rotation case, the vortex pattern favors a triangular lattice, accompanied by density depletion in the central region and a weakened Skyrmionic character as the SO coupling is enhanced. Giant vortex formation is facilitated when SO coupling and rotation are both strong. © 2011 American Physical Society.


Kim J.H.,Sungkyunkwan University
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine | Year: 2010

Lymph node (LN) metastasis is one of the most important adverse prognostic factors for pancreatic cancer. The aim of this study was to identify novel lymphatic metastasis-associated markers for pancreatic cancer. DNA microarray analysis was used to determine and compare the expression profiles of 17 pancreatic cancer tissues with LN metastasis and 17 pancreatic cancer tissues without LN metastasis. The microarray results were validated by real-time reverse transcription-polymerase chain reaction and immunohistochemistry. Only 58 genes were differentially expressed between the two groups with a difference in signal intensity ratio greater than a 1.5-fold change. Of these genes, 30 were significantly down-regulated in the LN metastasis group. Among five selected down-regulated genes for validation using real-time PCR, the expression of DST, FosB, RGS16, and CXCL12 was significantly lower in the LN metastasis group. Immunohistochemical analysis confirmed RGS16 and FosB underexpression in pancreatic cancer tissues with LN metastasis. RGS16 and FosB underexpression was associated with poor patient survival. Our findings show that RGS16 and FosB are underexpressed in pancreatic cancer with lymph node metastasis and associated with reduced survival, suggesting that RGS16 and FosB might be prognostic markers for pancreatic cancer.


Chung S.E.,Sungkyunkwan University
Korean journal of ophthalmology : KJO | Year: 2010

To identify the correlation between preoperative optical coherence tomography (OCT) features and postoperative visual outcomes in eyes with idiopathic macular holes (MHs). Data from 55 eyes with idiopathic MHs which had been sealed by vitrectomy were retrospectively reviewed. Correlation analysis was conducted between postoperative visual acuity (V(postop), logarithm of the minimum angle of resolution [logMAR]) and preoperative factors, including four OCT parameters: the anticipated length (A) devoid of photoreceptors after hole closure, MH height (B), MH size (C), and the grading (D) of the viability of detached photoreceptors. Additionally, the formula for the prediction of visual outcome was deduced. V(postop) was determined to be significantly correlated with the preoperative visual acuity (V(preop)) and OCT parameters A, C, and D (p<0.001). Based on the correlation, the formula for the prediction of V(postop) was derived from the most accurate regression analysis: V(postop)=0.248xV(preop)+1.1x10(-6)xA(2)-0.121xD+0.19. The length and viability of detached photoreceptors are significant preoperative OCT features for predicting visual prognosis. This suggests that, regardless of the MH size and symptom duration, active surgical intervention should be encouraged, particularly if the MH exhibits good viability in the detached photoreceptor layer.


Kwon J.-H.,Sungkyunkwan University
Journal of Combinatorial Theory. Series A | Year: 2013

We give a new combinatorial model of the Kirillov-Reshetikhin crystals of type An(1) in terms of non-negative integral matrices based on the classical RSK algorithm, which has a simple description of the affine crystal structure without using the promotion operator. We have a similar description of the Kirillov-Reshetikhin crystals associated to exceptional nodes in the Dynkin diagrams of classical affine or non-exceptional affine type, which are called classically irreducible together with those of type An(1). © 2012 Elsevier Inc.


Kim S.M.,Sungkyunkwan University
Synlett | Year: 2014

(A) List and co-worker reported the first proline-catalyzed enantioselective Mannich reaction of N-Boc imines with acetaldehyde.2 This method is one of the simplest ways to synthesize enantiopure 3-amino acid derivatives. It is noteworthy that unwanted side reactions were successfully suppressed by using an excess of acetaldehyde (5-10 equiv). (B) The direct asymmetric crossed-aldol reaction of acetaldehyde was reported by the group of Hayashi.3 In particular, trifluoromethylsubstituted diarylprolinol 1 was found to be an effective organocatalyst and gave excellent enantioselectivities. Due to its instability, the aldehyde intermediate was transformed into the corresponding alcohol using NaBH4 in methanol. (C) Hayashi, Uchimaru, and co-workers reported that diarylprolinol silyl ether 2 catalyzed the asymmetric Mannich reaction between N-protected imines and acetaldehyde (5 equiv).4 A wide range of aromatic N-benzoyl , N-Boc , and N-Ts imines were investigated. The reaction proceeded smoothly to afford 3-aminoaldehydes with high enantioselectivity. The aldehydes were reduced to the corresponding alcohols using LiAlH4. (D) Maruoka and co-workers designed a new catalyst motif - axially chiral bifunctional amino sulfonamide catalyst 3 - and performed asymmetric Mannich reactions of N-Boc imines with acetaldehyde (36 equiv).5 As a result, the desired products were obtained in good yields and excellent enantioselectivities (up to 99% ee) in most cases. Undesired side reactions were suppressed with this less nucleophilic chiral amino sulfonamide. (E) List and co-workers reported the proline-catalyzed double Mannich reaction of N-Boc imines with acetaldehyde.6 This method provided pseudo-C2-symmetric ß,ß'-diaminoaldehydes with extremely high diastereo- and enantioselectivities (dr 99:1, er 300:1) by reacting one equivalent of acetaldehyde with three equivalents of both aromatic and aliphatic N-Boc imines via stepwise enamine catalytic activation. (F) Greck et al. investigated the one-pot, organocatalytic a,a-bifunctionalization of acetaldehyde with two different electrophiles (N-benzoyl imine and di-tert-butylazodicarboxylate) using diarylprolinol silyl ether catalyst 2.7 This reaction consists of a tandem Mannich reaction-electrophilic amination. syn-Selective 2,3-diaminoalcohols were obtained with moderate yields and high diastereoand enantioselectivities (dr up to 96:4, up to 98% ee). (G) In N-heterocyclic carbene (NHC) catalysis, the chemoselective intermolecular cross-acyloin condensation reaction of two different aldehydes is one of the biggest challenges. Yang and co-workers established an efficient chemoselective catalytic system using acetaldehyde as the acyl anion source.8 The most striking feature is the switch of chemoselectivity by changing the scaffold of the NHC catalyst. (H) Yang and co-workers reported the intermolecular Stetter reaction of various Michael acceptors, including trans-chalcone derivatives, with acetaldehyde as a biomimetic acyl anion source.9 The authors also extended their work to the enantioselective Stetter reaction which resulted in moderate to good enantioselectivities (up to 76% ee) for the corresponding products. © Georg Thieme Verlag Stuttgart · New York.


Bui Q.V.,Sungkyunkwan University | Jung S.B.,Sungkyunkwan University
Journal of Alloys and Compounds | Year: 2013

Sn-1.0Ag-XCe solders were introduced and mechanical evaluation studied. The effects of different Pd thicknesses in electroless nickel/electroless palladium/immersion gold (ENEPIG) and Ce content in solder on low speed shear test reliability were evaluated after high temperature storage process. Different shear speed and shear height were applied for shear strength evaluation. Microstructure observations of solder joints' interfaces and fracture surfaces after shear test were shown. Pd in surface finishes modified the morphologies of intermetallic compounds at interfaces, while Ce in solders blocked the diffusion of Sn to interface. The Ce element made solders stable in joint's strength of low speed shear test during high temperature storage. © 2013 Elsevier B.V. All rights reserved.


Schuetze T.,Sungkyunkwan University
Advanced Materials Research | Year: 2014

Building integrated photovoltaic (BIPV) components can replace conventional components for the construction of building skins and they can produce renewable electricity during their lifetime. BIPV components can have therefore lower life cycle costs than conventional building components, which do not generate any gain during their lifecycle. The detailed calculation of economical profitability of BIPV is dependent on multiple factors, such as the specific case and the specific basic conditions. However, exemplary calculations indicate that it is possible to compensate the cumulative costs of BIPV components, at least to a significant degree, if the gain of the renewable electricity production during a BIPV component’s lifetime is considered in the life cycle cost calculations. Accordingly, BIPV systems are in general economically more profitable than ground-mounted PV power plants in open areas. © (2014) Trans Tech Publications, Switzerland.


Preclinical and clinical studies have shown that the application of CD105(+) mesenchymal stem cells (MSCs) is feasible and may lead to recovery after stroke. In addition, circulating microparticles are reportedly functional in various disease conditions. We tested the levels of circulating CD105(+) microparticles in patients with acute ischemic stroke. The expression of CD105 (a surface marker of MSCs) and CXCR4 (a CXC chemokine receptor for MSC homing) on circulating microparticles was evaluated by flow cytometry of samples from 111 patients and 50 healthy subjects. The percentage of apoptotic CD105 microparticles was determined based on annexin V (AV) expression. The relationship between serum levels of CD105(+)/AV(-) microparticles, stromal cells derived factor-1α (SDF-1α), and the extensiveness of cerebral infarcts was also evaluated. CD105(+)/AV(-) microparticles were higher in stroke patients than control subjects. Correlation analysis showed that the levels of CD105(+)/AV(-) microparticles increased as the baseline stroke severity increased. Multivariate testing showed that the initial severity of stroke was independently associated with circulating CD105(+)/AV(-) microparticles (OR, 1.103 for 1 point increase in the NIHSS score on admission; 95% CI, 1.032-1.178) after adjusting for other variables. The levels of CD105(+)/CXCR4(+)/AV(-) microparticles were also increased in patients with severe disability (r = 0.192, p = 0.046 for NIHSS score on admission), but were decreased with time after stroke onset (r = -0.204, p = 0.036). Risk factor profiles were not associated with the levels of circulating microparticles or SDF-1α. In conclusion, our data showed that stroke triggers the mobilization of MSC-derived microparticles, especially in patients with extensive ischemic stroke.


Cho E.,Hanyang University | Choi M.,Sungkyunkwan University
Journal of Hydrology | Year: 2014

An understanding soil moisture spatio-temporal variability is essential for hydrological and meteorological research. This work aims at evaluating the spatio-temporal variability of near surface soil moisture and assessing dominant meteorological factors that influence spatial variability over the Korean peninsula from May 1 to September 29, 2011. The results of Kolmogorov-Smirnov tests for goodness of fit showed that all applied distributions (normal, log-normal and generalized extreme value: GEV) were appropriate for the datasets and the GEV distribution described best spatial soil moisture patterns. The relationship between the standard deviation and coefficient of variation (CV) of soil moisture with mean soil moisture contents showed an upper convex shape and an exponentially negative pattern, respectively. Skewness exhibited a decreasing pattern with increasing mean soil moisture contents and kurtosis exhibited the U-shaped relationship. In this regional scale (99,720 km2), we found that precipitation indicated temporally stable features through an ANOVA test considering the meteorological (i.e. precipitation, insolation, air temperature, ground temperature and wind speed) and physical (i.e. soil texture, elevation, topography, and land use) factors. Spatial variability of soil moisture affected by the meteorological forcing is shown as result of the relationship between the meteorological factors (precipitation, insolation, air temperature and ground temperature) and the standard deviation of relative difference of soil moisture contents (SDRDt ) which implied the spatial variability of soil moisture. The SDRDt showed a positive relationship with the daily mean precipitation, while a negative relationship with insolation, air temperature and ground temperature. The variation of spatial soil moisture pattern is more sensitive to change in ground temperature rather than air temperature changes. Therefore, spatial variability of soil moisture is greatly affected by meteorological factors and each of the meteorological factors has certain duration of effect on soil moisture spatial variability in regional scale. The results provide an insight into the soil moisture spatio-temporal patterns affected by meteorological and physical factors simultaneously, as well as the design criteria of regional soil moisture monitoring network at regional scale. © 2014 Elsevier B.V. All rights reserved.


Shin D.-H.,Sungkyunkwan University
International Journal of Human-Computer Interaction | Year: 2010

The growing interest in mobile commerce and the high penetration rate of mobile communication service are expected to provide mobile operators with a new and great business opportunity, the mobile payment. This study proposes a research model that examines the factors that determine consumer acceptance of mobile payment system. To achieve this goal, it employed the technology acceptance model (TAM), adding the concepts of security, trust, social influence, and computer-efficacy from Unified Theory of Acceptance and Use of Technology. The model is examined through an empirical study using structural equation modeling techniques. Although the model confirms the classical role of TAM factors, the results also show that users' attitudes and intentions are influenced by perceived risk and trust. Significant support for the model was found in the data collected from a survey of potential mobile payment system users. Based on the findings, this study proposes a conceptual framework of adoption enablers, drivers, and barriers with propositions to guide future research in mobile payment. Implications to practice and means to overcome the barriers are suggested. © Taylor & Francis Group, LLC.


Shin D.-H.,Sungkyunkwan University
Online Information Review | Year: 2010

Purpose The purpose of this study is to investigate users' underlying motivations for engaging in social networking through online social networking services (SNS) compared with their behaviour. It seeks to examine the differences between USA, and Korean users. Design/methodology/approach The study surveyed SNS users in the USA and Korea to determine the key differences between the two countries. Survey questions, developed in English and Korean, were presented in each country to explore the influences of various factors from the modified Technology Acceptance Model on SNS user dimensions. The analytic design methods were based on structural equation modelling and applied to the data gathered. The TAM factors of SNS were analysed, focusing on the differences in motives between the two countries. Findings The results of the online survey of SNS users validated the proposed theoretical model's ability to explain and predict user acceptance of SNS very well. While the results illustrate the importance of both extrinsic and intrinsic motivation, the two countries showed different sets of motivations, providing useful implications for theory and practice. Practical implications Based on the results of the study, practical applications for marketing strategies in online SNS markets and theoretical applications for cross-national studies are recommended. Originality/value Despite the burgeoning interest in SNS, only a few studies have explored the acceptance of SNS in a cross-national manner, leading to a paucity of information on how different cultures influence acceptance of online services. © 2010 Emerald Group Publishing Limited. All rights reserved.


Shin D.-H.,Sungkyunkwan University
International Journal of Human-Computer Interaction | Year: 2010

Massive multiplayer online role-playing games (MMORPGs) have been popular for several years and have spawned a whole subculture. Although studies on online games have received more attention in the literature, MMORPGs have seldom been addressed. This study applies the theory of reasoned action and modifies the technology acceptance model to propose a research model. An empirical study was conducted to test this model. The goal of this study is to examine what perceived factors contribute to an online game user's behaviors. The results of this study indicate that users' attitudes and intentions are influenced by perceived security and perceived enjoyment. Subjective norm and flow are key behavioral antecedents to users' loyalty. © Taylor & Francis Group, LLC.


Social network services (SNS) focus on building online communities of people who share interests and/or activities, or who are interested in exploring the interests and activities of others. This study examines security, trust, and privacy concerns with regard to social networking Websites among consumers using both reliable scales and measures. It proposes an SNS acceptance model by integrating cognitive as well as affective attitudes as primary influencing factors, which are driven by underlying beliefs, perceived security, perceived privacy, trust, attitude, and intention. Results from a survey of SNS users validate that the proposed theoretical model explains and predicts user acceptance of SNS substantially well. The model shows excellent measurement properties and establishes perceived privacy and perceived security of SNS as distinct constructs. The finding also reveals that perceived security moderates the effect of perceived privacy on trust. Based on the results of this study, practical implications for marketing strategies in SNS markets and theoretical implications are recommended accordingly. © 2010 Elsevier B.V.


Bae K.,Sungkyunkwan University
Korean journal of ophthalmology : KJO | Year: 2012

To compare the histopathologic and morphologic findings of encapsulated blebs following Ahmed glaucoma valve implantation and primary standard trabeculectomy with mitomycin-C. We reviewed the records of patients with otherwise uncontrollable glaucoma who had undergone Ahmed glaucoma valve implantation or trabeculectomy with mitomycin-C. Five eyes that underwent Ahmed valve implantation and three eyes that underwent trabeculectomy needed surgical revision of the initial surgery due to encapsulated bleb development with total loss of function. The surgically removed encapsulated blebs were analyzed macroscopically and microscopically. Removal of the encapsulated bleb was performed at a mean follow-up time of 26.6 ± 19.4 weeks in the Ahmed valve implantation group and 12.0 ± 11.4 weeks in the trabeculectomy group. The fibrotic wall of the encapsulated blebs had an overall thickness of 2.48 ± 0.42 mm in the Ahmed valve implantation group and 1.62 ± 0.37 mm in the trabeculectomy group. Macroscopically, the coconut flesh-like smooth surface was split into two layers, and the wall of the capsule was thicker in the Ahmed valve implantation group than in the trabeculectomy group. Histopathologically, the fibrotic capsule was composed of an inner fibrodegenerative layer and an outer fibrovascular layer, and there were no histopathological differences between the two groups. The fibrotic capsule wall was thicker in the Ahmed valve group, but there were no differences in histological findings between the two groups.


Chun C.,Sungkyunkwan University | Sakthivel R.,Sungkyunkwan University
Computer Physics Communications | Year: 2010

The two-point boundary value problems occur in a wide variety of problems in engineering and science. In this paper, we implement the homotopy perturbation method for solving the linear and nonlinear two-point boundary value problems. The main aim of this paper is to compare the performance of the homotopy perturbation method with extended Adomian decomposition method and shooting method. As a result, for the same number of terms, the homotopy perturbation method yields relatively more accurate results with rapid convergence than other methods. The computer symbolic systems such as Maple and Mathematica allow us to perform complicated and tedious calculations. © 2010 Elsevier B.V. All rights reserved.


Lee J.,Sungkyunkwan University | Ou S.-H.I.,University of California at Irvine
Discovery Medicine | Year: 2013

Gastric cancer is the second leading cancer cause of death globally. Apart from the successful targeting of HER2 over-expression in gastric cancer (GC) with trastuzumab, other targeted therapies in GC have fallen short or still in early clinical development. While HER2 over-expression accounts for up to 20% of GC, other potential actionable driver mutations occur a much lower frequency in GC. In this review we describe some of the more interesting genetic aberrations including driver mutations in gastric cancer that have very potent inhibitors against them already in clinical development. Part I of this review will focus on the receptor tyrosine kinase (RTK) gene amplification (HER2, FGFR2, MET, EGFR). Part II will devoted to gene mutations (HER2, KRAS, PIK3CA, BRAF) and gene rearrangement (ROS1, BRAF, HER2). Because of the low frequency of these potential driver mutations, perseverance in screening for these mutations will be needed in order to enroll enough of each uniquely molecularly defined subset of GC in order to demonstrate significant clinical benefit in a unique molecularly targeted therapy trial. This approach has been successfully employed in the clinical approval of crizotinib for the treatment of ALK-rearranged non-small cell lung cancer. © Discovery Medicine.


Lee J.,Sungkyunkwan University
International Journal for Equity in Health | Year: 2015

Introduction: Disparities in the quality of health care and treatment among racial or ethnic groups can result from unequal access to medical care, disparate treatments for similar severities of symptoms, and wide divergence in general health status among individuals. Such disparities may be eliminated through better use of health information technology (IT). Investment in health IT could foster better coordinated care, improve guideline compliance, and reduce the likelihood of redundant testing, thereby encouraging more equitable treatment for underprivileged populations. However, there is little research exploring the impact of health IT investment on disparities of process of care. Methodology: This study examines the impact of health IT investment on waiting times - from admission to the date of first principle procedure - among different racial and ethnic groups, using patient and hospital data for the state of California collected from 2001 to 2007. The final sample includes 14,056,930 patients admitted with medical diseases to 316 unique, acute-care hospitals over a seven-year period. The linear random intercept and slope model was employed to examine the impacts of health IT investment on waiting time, while controlling for patient, disease, and hospital characteristics. Results: Greater health IT investment was associated with shorter waiting times, and the reduction in waiting times was greater for non-White than for White patients. This indicates that minority populations could benefit from health IT investment with regard to process of care. Conclusion: Investments in health IT may reduce disparities in process of care. © 2015 Lee; licensee BioMed Central.


Jeon H.J.,Sungkyunkwan University
Journal of the Korean Medical Association | Year: 2011

Suicide is the fourth leading cause of death in South Korea, which is the highest rate among the Organization for Economic Cooperation and Development member countries. The World Health Organization worldwide initiative for the prevention of suicide reported that there are at least 20 suicide attempts for every suicide committed. The lifetime prevalence of suicidal ideation, planning, and attempts in South Korea was 15.2%, 3.3%, and 3.2% (single 2.1% and multiple 1.1%), respectively. Suicide attempts showed a significant association with mental disorders, especially major depressive disorder in a Korea-based community study. Brain neuroimaging studies showed prefrontal localized hypofunction and impaired serotonergic responsivity in those attempting suicide, which are also typical findings in patients with depression. Postmortem studies have reported that approximately 60% of suicide victims suffered from major depressive disorder and other mood disorders. Family studies have suggested a genetic linkage between suicide and depression. In conclusion, suicide and suicidal behaviors are significantly associated with depression. Suicide is a medical condition which is treatable and preventable, and suicide rates can be reduced through early diagnosis and treatment for depression. Regular surveys for suicide and depression an essential tool for establishing a national policy for suicide prevention. © Korean Medical Association.


Lahaye R.J.W.E.,Sungkyunkwan University
Surface Science | Year: 2010

This is a study into the scattering dynamics of the alkaline ions Cs+, K+, Na+, and Li+ from an ice surface, and the process of abstracting water molecules by the scattered ions to form ion-water clusters as a result of the ion-dipole attraction. In a classical molecular dynamics computer simulation a semi-empirical ion-water interaction potential and a modified version of the TIP3P ice model are employed. The thickness of the ice structure at the surface greatly affects the abstraction efficiency. From a thin ice overlayer all alkaline ions exhibit similar scattering probabilities, but Cs+ abstracts water molecules most efficiently; its lower speed facilitates a mechanism where the Cs+ in its outgoing trajectory pulls water molecules out of the ice structure. From a thick ice structure the scattering probabilities decrease dramatically due to an effective energy transfer to the ice structure. A more grazing angle of incidence reduces the energy transfer and enhances the scattering probabilities for the lighter alkaline ions. The deprived formation of ion-water clusters in the simulations confirms that from thick ice the cluster formation probability is reduced by at least three orders of magnitude. © 2010 Elsevier B.V. All rights reserved.


Park S.,Ewha Womans University | Ko Y.H.,Sungkyunkwan University
Journal of Dermatology | Year: 2014

Primary infection with Epstein-Barr virus (EBV) is usually asymptomatic and, in a normal host, EBV remains latent in B cells after primary infection for the remainder of life. Uncommonly, EBV can infect T or natural killer (NK) cells in a person with a defect in innate immunity, and EBV infection can cause unique systemic lymphoproliferative diseases (LPD) of childhood. Primary infection in young children can be complicated by hemophagocytic lymphohistiocytosis or fulminant systemic T-cell LPD of childhood. Uncommonly, patients can develop chronic active EBV (CAEBV) disease-type T/NK LPD, which includes CAEBV infection of the systemic form, hydroa vacciniforme-like T-cell LPD, and mosquito-bite hypersensitivity. The clinical course of CAEBV disease-type T/NK LPD can be smoldering, persistent or progressive, depending on the balance between viral factors and host immunity. Aggressive NK-cell leukemia, hydroa vacciniforme-like T-cell lymphoma, or uncommonly extranodal NK/T-cell lymphoma can develop in children and young adults with CAEBV disease-type T/NK-cell LPD. Extranodal T/NK-cell lymphoma is a disease of adults, and its incidence begins to increase in the third decade and comprises the major subtype of T/NK LPD throughout life. Aggressive NK-cell leukemia and nodal T/NK-cell lymphoma of the elderly are fulminant diseases, and immune senescence may be an important pathogenetic factor. This review describes the current progress in identifying different types of EBV-associated T/NK-cell LPD and includes a brief presentation of data from Korea. © 2014 Japanese Dermatological Association.


Kong K.,University of Kansas | Park J.-C.,University of Kansas | Park J.-C.,Sungkyunkwan University
Nuclear Physics B | Year: 2014

Annihilation of light dark matter of mDM≈(10-40) GeV into the Standard Model fermions has been suggested as a possible origin of the gamma-ray excess at GeV energies in the Fermi-LAT data. In this paper, we examine possible model-independent signatures of such dark matter models in other experiments such as AMS-02, colliders, and cosmic microwave background (CMB) measurements. We point out that first generation of fermion final states is disfavored by the existing experimental data. Currently AMS-02 positron measurements provide stringent bounds on cross sections of dark matter annihilation into leptonic final states, and e+e- final state is in severe tension with this constraint, if not ruled out. The e+e- channel will be complementarily verified in an early stage of ILC and future CMB measurements. Light quark final states (qq-) are relatively strongly constrained by the LHC and dark matter direct detection experiments even though these bounds are model-dependent. Dark matter signals from annihilations into qq- channels would be constrained by AMS-02 antiproton data which will be released in very near future. In optimistic case, diffuse radio emission from nearby galaxy (clusters) and the galactic center might provide another hint or limit on dark matter annihilation. © 2014 The Authors.


Kim H.,Sungkyunkwan University
Molecules and cells | Year: 2010

UDP-glucose pyrophosphorylases (UGPase; EC 2.7.7.9) catalyze the conversion of UTP and glucose-1-phosphate to UDP-glucose and pyrophosphate and vice versa. Prokaryotic UGPases are distinct from their eukaryotic counterparts and are considered appropriate targets for the development of novel antibacterial agents since their product, UDP-glucose, is indispensable for the biosynthesis of virulence factors such as lipopolysaccharides and capsular polysaccharides. In this study, the crystal structures of UGPase from Helicobacter pylori (HpUGPase) were determined in apo- and UDP-glucose/Mg(2+)-bound forms at 2.9 A and 2.3 A resolutions, respectively. HpUGPase is a homotetramer and its active site is located in a deep pocket of each subunit. Magnesium ion is coordinated by Asp130, two oxygen atoms of phosphoryl groups, and three water molecules with octahedral geometry. Isothermal titration calorimetry analyses demonstrated that Mg(2+) ion plays a key role in the enzymatic activity of UGPase by enhancing the binding of UGPase to UTP or UDP-glucose, suggesting that this reaction is catalyzed by an ordered sequential Bi Bi mechanism. Furthermore, the crystal structure explains the specificity for uracil bases. The current structural study combined with functional analyses provides essential information for understanding the reaction mechanism of bacterial UGPases, as well as a platform for the development of novel antibacterial agents.


Lee J.H.,National Police Hospital | Lee S.W.,Sungkyunkwan University
Journal of Sexual Medicine | Year: 2015

Introduction: Chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS) is a common etiology of premature ejaculation (PE). However, the current data are insufficient to explain this relationship and to support routine screening of men with PE. Aims: This study aims to evaluate the relationship between PE and CP/CPPS. Methods: A cross-sectional study was conducted that included 8,261 men who had participated in a health examination. The Premature Ejaculation Diagnostic Tool (PEDT), the National Institutes of Health-Chronic Prostatitis Symptom Index (NIH-CPSI), and the International Index of Erectile Function-5 (IIEF) were used for assessment of symptoms. A full metabolic work-up and serum testosterone level checks were also performed. We then investigated the relationship using the Spearman correlation test, multiple linear regression, and logistic regression analyses. Main Outcome Measures: Associations of PEDT with NIH-CPSI. Results: The mean age was 50.4±5.5 years. In total, 2,205 (24.9%) men had prostatitis-like symptoms (NIH-CPSI pain score of ≥4 and perineal or ejaculatory pain), and 618 (7.0%) men had moderate to severe symptoms (NIH-CPSI pain score of ≥8). Additionally, 2,144 men (24.2%) were classified as demonstrating PE (PEDT>10). The PEDT score was found to have a significant positive correlation with the NIH-CPSI pain domain score (correlation coefficient=0.206; P<0.001). After adjusting for age, metabolic syndrome status, testosterone level, and IIEF score, there was no change in the positive correlation between the NIH-CPSI pain domain score and PEDT score (Beta=0.175; P<0.001). After adjusting for age, testosterone level, metabolic syndrome, and IIEF score, the odds ratio (OR) for PE significantly increased with the severity of pelvic pain (mild prostatitis-like symptoms, OR for PE: 1.269, 95% confidence interval: 1.113-1.447; moderate to severe symptoms, OR for PE: 2.134: 95% confidence interval: 1.782-2.557). Conclusions: Our data showed a significant correlation between the PEDT score and the NIH-CPSI score. We suggest routine screening for CP/CPPS in men with PE and PE in men with CP/CPPS. © 2014 International Society for Sexual Medicine.


Kawai S.,Sungkyunkwan University | Okada N.,University of Alabama
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2014

We discuss the physics resulting from the supersymmetric Higgs-lepton inflation model and the recent CMB B-mode observation by the BICEP2 experiment. The tensor-to-scalar ratio r=0.20-0.05+0.07 of the primordial fluctuations indicated by the CMB B-mode polarization is consistent with the prediction of this inflationary model for natural parameter values. A salient feature of the model is that it predicts the seesaw mass scale M from the amplitude of the tensor mode fluctuations. It is found that the 68% (95%) confidence level (CL) constraints from the BICEP2 experiment give 927GeV. <. M<. 1.62TeV (751GeV. <. M<. 2.37TeV) for 50 e-foldings and 391GeV. <. M<. 795GeV (355GeV. <. M<. 1.10TeV) for 60 e-foldings. In the type I seesaw case, the right-handed neutrinos in this mass range are elusive in collider experiments due to the small mixing angle. In the type III seesaw, in contrast, the heavy leptons will be within the reach of future experiments. We point out that a significant portion of the parameter region corresponding to the 68% CL of the BICEP2 experiment will be covered by the Large Hadron Collider experiments at 14 TeV. © 2014 Elsevier B.V.


Flacke T.,Korea Advanced Institute of Science and Technology | Kong K.,University of Kansas | Park S.C.,Sungkyunkwan University
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2014

The discovery of a Higgs boson and precise measurements of its properties open a new window to test physics beyond the standard model. Models with Universal Extra Dimensions are not an exception. Kaluza-Klein excitations of the standard model particles contribute to the production and decay of the Higgs boson. In particular, parameters associated with third generation quarks are constrained by Higgs data, which are relatively insensitive to other searches often involving light quarks and leptons. We investigate implications of the 126 GeV Higgs in next-to-minimal Universal Extra Dimensions, and show that boundary terms and bulk masses allow a lower compactification scale as compared to in minimal Universal Extra Dimensions. © 2013 The Authors.


Song D.,Sungkyunkwan University | Choi Y.-J.,University of Tokyo
Renewable and Sustainable Energy Reviews | Year: 2012

According to the International Energy Agency (IEA), the energy demand for the building sector constituted about 25.3% of the final energy use in South Korea. The energy demand for residential buildings counts for 50.3% of the building sector and has also increased by 2.9 percent every year. The Korean government has shifted focus and is now promoting energy efficiency within the building sector and has set long-term energy conservation goals. Despite these efforts to minimize building energy, the Korean government has changed the building regulation to allow remodeling of the balcony space as a living space. Remodeling the balcony space to become an indoor space means that a buffer space for the outdoor environment is lost, causing thermal discomfort and discomfort glare and moreover, increasing the heating and cooling energy demand in residential buildings. Also, it results in an increase in building energy demand in South Korea. In this study, the effect of the alteration of balcony space on the indoor thermal environment and the heating and cooling energy demand of residential buildings in Korea were investigated by field measurement and simulation. From the measurement results, the indoor temperature of the condition without a balcony was 0.8 °C lower than that with a balcony. The heating and cooling load of the unit without the balcony space was 39% and 22% higher, respectively, than that of the unit with the balcony space. This increase results in considerable energy loss in the national scale and the ratio will be 0.3% of the final energy use in Korea. Also, it represents about 1.3% of the final energy use within the building sector of Korea. © 2011 Elsevier Ltd. All rights reserved.


Cho H.-K.,Sungkyunkwan University | Kee C.,Sungkyunkwan University
American Journal of Ophthalmology | Year: 2012

Purpose: To investigate the progression rates of superior and inferior hemifield defects and each hemifield in bihemifield defects in normal-tension glaucoma patients and to compare the progression rates of each hemifield between groups in eyes with similar baseline hemifield defects. Design: Retrospective, observational cohort study. Methods: Medical records of 142 normal-tension glaucoma patients who performed more than 5 reliable standard visual field tests with superior (group 2; n = 51), inferior (group 1; n = 44), or both hemifield (group 3; n = 47) defects were analyzed retrospectively. The changes in the mean thresholds of the 10 zones of the glaucoma hemifield test and the entire hemifield were inspected. A linear mixed effect model was used with age, gender, initial intraocular pressure, mean deviation, and pattern standard deviation controlled. Results: There were no significant differences in age and systemic and ocular factors between groups except for female gender, which showed a significant difference among the 3 groups (P =.032). The progression rate in group 2 was significantly faster than in group 1 (-0.713 dB/year vs -0.516 dB/year; P =.019), especially in central and nasal zones or than in the superior hemifield of group 3 (-0.717 dB/year vs -0.470 dB/year; P =.001). There was no significant difference in the progression rates between group 1 and the inferior hemifield in group 3 (-0.508 dB/year vs -0.441 dB/year; P =.312) or between the superior and inferior hemifields in group 3 (-0.468 dB/year vs -0.442 dB/year; P =.662). Conclusions: More careful examination and caution is required in the treatment of normal-tension glaucoma patients with superior hemifield defect. © 2012 Elsevier Inc. All rights reserved.


Bae S.Y.,Sungkyunkwan University
Clinical and molecular hepatology | Year: 2012

We compared the accuracy and usefulness of clinical diagnostic criteria for hepatocellular carcinoma in a hepatitis B virus (HBV)-endemic area. We reviewed the medical records of 355 patients who had undergone liver resection or biopsy at our institution between January 2008 and December 2009. These patients were reevaluated using four noninvasive diagnostic criteria for hepatocellular carcinoma proposed by the European Association for the Study of the Liver (EASL), the American Association for the Study of Liver Diseases (AASLD), the Korean Liver Cancer Study Group and the National Cancer Center (KLCSG/NCC), and National Comprehensive Cancer Network (NCCN) guidelines. The overall sensitivity was highest using the KLCSG/NCC criteria (79.8%), followed by the AASLD (51.5%), EASL (38.4%), and NCCN (10.1%; P<0.001) criteria, whereas the specificity (84.5-98.3%) and positive predictive value (96.2-98.3%) were similar for all of the criteria. The KLCSG/NCC criteria had an acceptable false-positive rate and the highest sensitivity among all of the patients, including those positive for HBsAg, those without liver cancer, and those with a tumor of at least 2 cm. The KLCSG/NCC and AASLD criteria exhibited the highest sensitivity, and all four guidelines had a high specificity among all of the patients. Based on the sensitivity and false-positive rate, the KLCSG/NCC criteria was the most useful in the majority of patients. Inclusion of HBV infection in the clinical diagnostic criteria for hepatocellular carcinoma would be reasonable and may lead to an improvement in the sensitivity, with acceptable false-positive rates, in HBV-endemic areas.


Yoon J.H.,Sungkyunkwan University
International psychogeriatrics / IPA | Year: 2011

Agraphia in Korean patients may be different from agraphia in other patients who use alphabetical writing systems due to the "visuoconstructional script" characteristics of the Korean writing system, Hangul. Patients with early onset Alzheimer's disease (EOAD) have a severe degree of hypometabolism in the parietal area, which is known to be involved in processing visuospatial function. Thus, we explored the diverse error patterns manifested in writing single syllables in Korean patients with EOAD. A study sample of 35 patients with EOAD and 18 healthy controls (HC) performed a Hangul writing task. We analyzed the erroneous responses of the subjects according to visuoconstructional and linguistic characteristics. In addition, we evaluated the relationship between Hangul writing and the neuropsychological variables as well as the severity of dementia. When comparing the total number of erroneous responses between EOAD and HC groups, the performances of EOAD patients were significantly worse than those of HC. EOAD patients demonstrated visuoconstructional errors even in the early stages of the disease. Severity of dementia and multiple cognitive domains such as attention, language, immediate memory, and frontal executive functions significantly correlated with the performance of Hangul writing. Our findings suggest that patients with EOAD exhibit not only linguistic errors but also visuoconstructional manifestations of agraphia, which are associated with cognitive impairments in the multiple domains.


Gao L.,Sungkyunkwan University | Kang B.C.,Sungkyunkwan University | Hwang G.-S.,Korea Basic Science Institute | Ryu D.H.,Sungkyunkwan University
Angewandte Chemie - International Edition | Year: 2012

Breaking kamp: A catalytic route toward chiral α-alkyl-β- ketoesters using the title reaction of α-alkyl diazoester with aldehydes has been developed (see scheme). The reaction proceeds with high to excellent enantioselectivities and this methodology was applied to a concise two-step synthesis of the natural pheromone sitophilate. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.


Guruacharya S.,Nanyang Technological University | Niyato D.,Nanyang Technological University | Kim D.I.,Sungkyunkwan University | Hossain E.,University of Manitoba
IEEE Transactions on Wireless Communications | Year: 2013

This paper considers the problem of downlink power allocation in an orthogonal frequency-division multiple access (OFDMA) cellular network with macrocells underlaid with femtocells. The femto-access points (FAPs) and the macro-base stations (MBSs) in the network are assumed to compete with each other to maximize their capacity under power constraints. This competition is captured in the framework of a Stackelberg game with the MBSs as the leaders and the FAPs as the followers. The leaders are assumed to have foresight enough to consider the responses of the followers while formulating their own strategies. The Stackelberg equilibrium is introduced as the solution of the Stackelberg game, and it is shown to exist under some mild assumptions. The game is expressed as a mathematical program with equilibrium constraints (MPEC), and the best response for a one leader-multiple follower game is derived. The best response is also obtained when a quality-of-service constraint is placed on the leader. Orthogonal power allocation between leader and followers is obtained as a special case of this solution under high interference. These results are used to build algorithms to iteratively calculate the Stackelberg equilibrium, and a sufficient condition is given for its convergence. The performance of the system at a Stackelberg equilibrium is found to be much better than that at a Nash equilibrium. © 2002-2012 IEEE.


Yang J.,Queen's University | Kim I.-M.,Queen's University | Kim D.I.,Sungkyunkwan University
IEEE Transactions on Wireless Communications | Year: 2013

Cooperative jamming for multiuser multiple input multiple output (MIMO) broadcast channel is studied to enhance the physical layer security with the help of a friendly jammer. We assume the base station transmits multiple independent data streams to multiple legitimate users. During the transmission, however, there are multiple eavesdroppers with multiple antennas that have interests in the streams from the base station. In order to wiretap the desired streams, the eavesdroppers may collude or not, and maximize the signal-to-interference-plus-noise ratio (SINR) of the desired streams using receive beamforming. The optimal cooperative jammer is designed to keep the achieved SINR at eavesdroppers below a threshold to guarantee that the transmission from the base station to legitimate users is confidential. One main advantage of the proposed cooperative jamming scheme is that no modification is needed for the existing precoding schemes at the base station and decoding schemes at legitimate users. Thus, any existing practical precoding/decoding schemes for multiuser MIMO broadcast channel can be applied directly with the help of a friendly jammer using the proposed cooperative jamming. © 2002-2012 IEEE.


Shin J.,Sungkyunkwan University | Soo Ko K.,Sungkyunkwan University
Journal of Antimicrobial Chemotherapy | Year: 2014

Objectives: To determine and compare the complete nucleotide sequences of plasmids carrying blaCTX-M-15 from three different Klebsiella pneumoniae clones. Methods: IncFII-type plasmids pKP02022, pKP09085 and pKP007 were extracted from three K. pneumoniae strains. These strains belong to sequence types (STs) ST15, ST48 and ST23, respectively, and were isolated in Korea. Plasmids were sequenced using the 454 Genome Sequencer FLX system. Results: The three plasmids, pKP02022 (203577 bp), pKP09085 (213019 bp) and pKP007 (246 176 bp), all exhibited a very similar structure, with a pKPN3-like backbone and a resistance region including blaOXA-1, aac(6')-Ib-cr and cat genes as well as blaCTX-M-15. They were also very similar to pUUH239.2, previously isolated in Sweden. Iron (III) uptake-related genes were found in pKP007 from the ST23 strain, which has been reported to be associated with liver abscesses. The resistance region contained several insertion sequences, such as IS26, which may play an important role in structural rearrangements of plasmids. Conclusions: The very similar structure of the three plasmids, extracted from different clones, suggests that the spread of CTX-M-producing K. pneumoniae isolates might result from the horizontal transfer of plasmids and subsequent integration and recombination. © The Author 2013. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved.


Lee J.-H.,Telecom Bretagne | Bonnin J.-M.,Telecom Bretagne | You I.,Korean Bible University | Chung T.-M.,Sungkyunkwan University
IEEE Transactions on Industrial Electronics | Year: 2013

IPv6 mobility management is one of the most challenging research topics for enabling mobility service in the forthcoming mobile wireless ecosystems. The Internet Engineering Task Force has been working for developing efficient IPv6 mobility management protocols. As a result, Mobile IPv6 and its extensions such as Fast Mobile IPv6 and Hierarchical Mobile IPv6 have been developed as host-based mobility management protocols. While the host-based mobility management protocols were being enhanced, the network-based mobility management protocols such as Proxy Mobile IPv6 (PMIPv6) and Fast Proxy Mobile IPv6 (FPMIPv6) have been standardized. In this paper, we analyze and compare existing IPv6 mobility management protocols including the recently standardized PMIPv6 and FPMIPv6. We identify each IPv6 mobility management protocol's characteristics and performance indicators by examining handover operations. Then, we analyze the performance of the IPv6 mobility management protocols in terms of handover latency, handover blocking probability, and packet loss. Through the conducted numerical results, we summarize considerations for handover performance. © 2012 IEEE.


OBJECTIVE:: To evaluate the association between anesthetic management before and after graft reperfusion and early graft regeneration in living donor liver transplantation (LDLT). BACKGROUND:: Sufficient graft regeneration is essential for the success of LDLT. Diverse signals start to trigger liver regeneration immediately after graft reperfusion. METHODS:: : Graft volume at 14?±?2 days after LDLT was measured in 379 consecutive recipients using computed tomography images with 3-dimensional reconstruction. The association between anesthetic variables and the degree of graft regeneration for 2 weeks was analyzed using simple and multiple linear regressions. The anesthetic variables included hemodynamics, laboratory measurements, vasoactive drugs, and blood products transfusion. RESULTS:: The degree of graft regeneration for 2 weeks was 52% in median and ranged from 5% to 123%. Platelet transfusion was identified as the sole independent anesthetic factor contributing to graft regeneration. Platelet concentrate transfusion of 1 to 6 units vs none was correlated with a 6.5% increase in graft regeneration (P = 0.012). Platelet concentrate transfusion of more than 6 units vs none was further correlated with an 18.4% increase in regeneration (P < 0.001). In the subgroup of recipients without intraoperative platelet transfusion, mean platelet count measured during the intraoperative reperfusion phase was positively associated with graft regeneration (P = 0.033). CONCLUSIONS:: Graft regeneration after LDLT increased in relation to a graded increase in the amount of transfused platelets and higher postreperfusion platelet counts during surgery. These results offer additional evidence regarding the important role of platelets in initiating liver regeneration and, furthermore, the indications for and the benefits vs risks of platelet transfusion during LDLT. Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.


OBJECTIVE:: To determine whether autotransfusion of red blood cells (RBCs) salvaged during liver transplantation is associated with the recurrence of hepatocellular carcinoma (HCC). BACKGROUND:: Blood salvage is widely used during liver transplantation to reinfuse salvaged autologous RBCs and reduce allogeneic transfusion. However, the reintroduction of cancer cells via autotransfusion is a major concern in HCC patients. METHODS:: Among 397 patients who underwent living-donor liver transplantation for HCC, 97 of 114 recipients without intraoperative autotransfusion were matched with 222 of 283 recipients with intraoperative autotransfusion with unfixed matching ratio using the propensity score based on age, sex, allogeneic transfusion, immunosuppression, tumor biology, and others. Competing risks Cox regression was used to compare HCC recurrence risk of the 2 paired groups. RESULTS:: Recipients in autotransfusion group received 1177?±?1318 mL of salvaged RBCs during surgery. A leukocyte depletion filter was used for all autotransfused RBCs. Cumulative HCC recurrence rate at 1, 2, and 5 years after transplantation were 10.4% (5.3%–17.6%), 19.1% (11.6%–28.0%), and 24.1% (15.2%–34.0%) for nonautotransfusion group and 10.8% (7.2%–15.4%), 14.9% (10.5%–20.0%), and 20.3% (14.9%–26.4%) for autotransfusion group, respectively. Autotransfusion versus nonautotransfusion group was not significantly different in overall recurrence [hazard ratio (HR) 0.85, 95% confidence interval (CI) 0.47–1.53, P?=?0.579] and intrahepatic recurrence (HR 0.75, 95% CI 0.36–1.56) or extrahepatic recurrence (HR 1.00, 95% CI 0.49–2.04). CONCLUSIONS:: We found no evidence of a significant impact of autotransfusion on posttransplant HCC recurrence. Thus, salvaged and filtered RBCs could be used in HCC patients undergoing liver transplantation with potential benefits from avoiding allogeneic RBCs transfusion and its complications. Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.


Rocha L.E.C.,Umeå University | Liljeros F.,University of Stockholm | Holme P.,Umeå University | Holme P.,Sungkyunkwan University
Proceedings of the National Academy of Sciences of the United States of America | Year: 2010

Like many other social phenomena, prostitution is increasingly coordinated over the Internet. The online behavior affects the offline activity; the reverse is also true. We investigated the reported sexual contacts between 6,624 anonymous escorts and 10,106 sex buyers extracted from an online community from its beginning and six years on. These sexual encounters were also graded and categorized (in terms of the type of sexual activities performed) by the buyers. From the temporal, bipartite network of posts, we found a full feedback loop in which high grades on previous posts affect the future commercial success of the sex worker, and vice versa. We also found a peculiar growth pattern in which the turnover of community members and sex workers causes a sublinear preferential attachment. There is, moreover, a strong geographic influence on network structure-the network is geographically clustered but still close to connected, the contacts consistent with the inverse-square law observed in trading patterns. We also found that the number of sellers scales sublinearly with city size, so this type of prostitution does not, comparatively speaking, benefit much from an increasing concentration of people.


Jeon N.J.,Korea Research Institute of Chemical Technology | Lee H.G.,Korea Research Institute of Chemical Technology | Kim Y.C.,Korea Research Institute of Chemical Technology | Seo J.,Korea Research Institute of Chemical Technology | And 4 more authors.
Journal of the American Chemical Society | Year: 2014

Three spiro-OMeTAD derivatives have been synthesized and characterized by 1H/13C NMR spectroscopy and mass spectrometry. The optical and electronic properties of the derivatives were modified by changing the positions of the two methoxy substituents in each of the quadrants, as monitored by UV-vis spectroscopy and cyclic voltammetry measurements. The derivatives were employed as hole-transporting materials (HTMs), and their performances were compared for the fabrication of mesoporous TiO2/CH 3NH3PbI3/HTM/Au solar cells. Surprisingly, the cell performance was dependent on the positions of the OMe substituents. The derivative with o-OMe substituents showed highly improved performance by exhibiting a short-circuit current density of 21.2 mA/cm2, an open-circuit voltage of 1.02 V, and a fill factor of 77.6% under 1 sun illumination (100 mW/cm2), which resulted in an overall power conversion efficiency (PCE) of 16.7%, compared to ∼15% for conventional p-OMe substituents. The PCE of 16.7% is the highest value reported to date for perovskite-based solar cells with spiro-OMeTAD. © 2014 American Chemical Society.


Min Y.W.,Sungkyunkwan University | Rhee P.-L.,Sungkyunkwan University
Clinical Therapeutics | Year: 2015

Purpose: The human gut contains >100 trillion microbes. This microbiota plays a crucial role in the gut homeostasis. Importantly, the microbiota contributes to the development and regulation of the gut immune system. Dysbiosis of the gut microbiota could also cause several intestinal and extraintestinal diseases. Many experimental studies help us to understand the complex interplay between the host and microbiota. Methods: This review presents our current understanding of the mucosal immune system and the role of gut microbiota for the development and functionality of the mucosal immunity, with a particular focus on gut-associated lymphoid tissues, mucosal barrier, TH17 cells, regulatory T cells, innate lymphoid cells, dendritic cells, and IgA-producing B cells and plasma cells. Findings: Comparative studies using germ-free and conventionally-raised animals reveal that the presence of microbiota is important for the development and regulation of innate and adaptive immune systems. The host-microbial symbiosis seems necessary for gut homeostasis. However, the precise mechanisms by which microbiota contributes to development and functionality of the immune system remain to be elucidated. Implications: Understanding the complex interplay between the host and microbiota and further investigation of the host-microbiota relationship could provide us the insight into the therapeutic and/or preventive strategy for the disorders related to dysbiosis of the gut microbiota. © 2015 Elsevier HS Journals, Inc. All rights reserved.


Park K.,Sungkyunkwan University
Automatica | Year: 2015

A block decoupling problem in linear multivariable systems is treated for one-degree-of-freedom controller configuration with unity output feedback. The plant transfer matrix, which may be non-square, is assumed to have unstable simple poles and zeros that may coincide. A simple existence condition of a block decoupling controller is obtained by directional interpolation approaches. © 2014 Elsevier Ltd. All rights reserved.


Agiwal M.,Sungkyunkwan University | Roy A.,Samsung | Saxena N.,Sungkyunkwan University
IEEE Communications Surveys and Tutorials | Year: 2016

The vision of next generation 5G wireless communications lies in providing very high data rates (typically of Gbps order), extremely low latency, manifold increase in base station capacity, and significant improvement in users' perceived quality of service (QoS), compared to current 4G LTE networks. Ever increasing proliferation of smart devices, introduction of new emerging multimedia applications, together with an exponential rise in wireless data (multimedia) demand and usage is already creating a significant burden on existing cellular networks. 5G wireless systems, with improved data rates, capacity, latency, and QoS are expected to be the panacea of most of the current cellular networks' problems. In this survey, we make an exhaustive review of wireless evolution toward 5G networks. We first discuss the new architectural changes associated with the radio access network (RAN) design, including air interfaces, smart antennas, cloud and heterogeneous RAN. Subsequently, we make an in-depth survey of underlying novel mm-wave physical layer technologies, encompassing new channel model estimation, directional antenna design, beamforming algorithms, and massive MIMO technologies. Next, the details of MAC layer protocols and multiplexing schemes needed to efficiently support this new physical layer are discussed. We also look into the killer applications, considered as the major driving force behind 5G. In order to understand the improved user experience, we provide highlights of new QoS, QoE, and SON features associated with the 5G evolution. For alleviating the increased network energy consumption and operating expenditure, we make a detail review on energy awareness and cost efficiency. As understanding the current status of 5G implementation is important for its eventual commercialization, we also discuss relevant field trials, drive tests, and simulation experiments. Finally, we point out major existing research issues and identify possible future research directions. © 1998-2012 IEEE.


Nguyen M.K.,Sungkyunkwan University | Lee D.S.,Sungkyunkwan University
Macromolecular Bioscience | Year: 2010

Injectable biodegradable copolymer hydrogels, which exhibit a sol-gel phase transition in response to external stimuli, such as temperature changes or both pH and temperature (pH/ temperature) alterations, have found a number of uses in biomedical and pharmaceutical applications, such as drug delivery, cell growth, and tissue engineering. These hydrogels can be used in simple pharmaceutical formulations that can be prepared by mixing the hydrogel with drugs, proteins, or cells. Such formulations are administered in a straightforward manner, through site-specific control of release behavior, and the hydrogels are compatible with biological systems. This review will provide a summary of recent progress in biodegradable temperature-sensitive polymers including polyesters, polyphosphazenes, polypeptides, and chitosan, and pH/ temperature-sensitive polymers such as sulfamethazine-, poly(b-amino ester)-, poly(amino urethane)-, and poly(amidoamine)-based polymers. The advantages of pH/temperature-sensitive polymers over simple temperature-sensitive polymers are also discussed. A perspective on the future of injectable biodegradable hydrogels is offered. (Figure Presented). © 2010 Wiley-VCH Verlag GmbH & Co. KGaA.


To compare the diagnostic accuracy and sensitivity of combined gadoxetic acid-enhanced magnetic resonance imaging (MRI) and diffusion-weighted imaging (DWI) with each imaging approach alone for detecting small hepatic metastases (≤ 1.5 cm). Institutional review board approved this retrospective study and waived informed patient consent. Eighty-six patients with 179 liver metastases underwent liver MRI including unenhanced and gadoxetic acid-enhanced imaging and DWI at 3.0 T. Three image sets including unenhanced images-gadoxetic acid set (early dynamic and hepatocyte phase), DWI set, and the combined set-were analyzed independently and in consensus by 2 observers for detecting liver metastases using receiver operating characteristic analysis. There was a tendency toward an increased diagnostic accuracy for the combined set (mean, 0.965) compared with that for each image set alone (mean, 0.911 for gadoxetic acid set; 0.926 for DWI set). The combined set showed better sensitivity (mean, 97.47%/95.0%: values on per-lesion/per-patient basis) than each imaging set alone (mean, 90.7%/83.7% for gadoxetic acid set; 91.6%/83.0% for DWI set) (P < 0.05) on both per-lesion basis and per-patient basis. All image sets showed similar positive predictive values. The combination of gadoxetic acid-enhanced MRI and DWI yielded better diagnostic accuracy and sensitivity in the detection of small liver metastasis than each magnetic resonance scan sequence alone.


Kyae B.,Pusan National University | Park J.-C.,Sungkyunkwan University
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2014

Light fermionic/scalar dark matter (DM) (mDM ≈ 8GeV) neutral under the standard model can be responsible for the CDMS and CoGeNT signals, and the Fermi-LAT gamma-ray excesses. In order to explain them in a relatively simple framework, we have explored various DM annihilation and scattering processes, discussing important phenomenological constraints coming from particle physics. Assuming that the two independent observations have a common DM origin and the processes arise through a common mediator, DM should annihilate into tau/anti-tau lepton pairs through an s-channel, and scatter with nuclei through a t-channel process. To avoid the p-wave suppression, a new Higgs-like scalar field with a mass of O(1)TeV is necessary as a common mediator of both the processes. We propose a supersymmetric model realizing the scenario. © 2014 The Authors.


Park J.-C.,Sungkyunkwan University | Park S.C.,Sungkyunkwan University
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2014

As the electromagnetic gauge symmetry makes the electron stable, a new abelian gauge symmetry may be responsible for the stability of superheavy dark matter. The gauge boson associated with the new gauge symmetry naturally plays the role of dark radiation and contributes to the effective number of 'neutrino species', which has been recently measured by Planck. We estimate the contribution of dark radiation from the radiative decay of a scalar particle induced by the WIMPZILLA in the loop. The scalar particle may affect the invisible decay of the Higgs boson by the Higgs portal type coupling. © The Authors. Published by Elsevier B.V.


Park J.-C.,University of Kansas | Park J.-C.,Sungkyunkwan University | Kong K.,University of Kansas | Park S.C.,Sungkyunkwan University
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2014

Recently a weak X-ray emission around Eγ ≃ 3.5keV was detected in the Andromeda galaxy and various galaxy clusters including the Perseus galaxy cluster but its source has been unidentified. Axino, the superpartner of axion, with a mass 2Eγ is suggested as a possible origin of the line with R-parity violating decay into photon and neutrino. Moreover, most of parameter space is consistent with recent observation by the BICEP2 experiment. © 2014 The Authors.


Mak K.F.,Columbia University | Lee C.,Sungkyunkwan University | Hone J.,Columbia University | Shan J.,Case Western Reserve University | Heinz T.F.,Columbia University
Physical Review Letters | Year: 2010

The electronic properties of ultrathin crystals of molybdenum disulfide consisting of N=1,2,...,6 S-Mo-S monolayers have been investigated by optical spectroscopy. Through characterization by absorption, photoluminescence, and photoconductivity spectroscopy, we trace the effect of quantum confinement on the material's electronic structure. With decreasing thickness, the indirect band gap, which lies below the direct gap in the bulk material, shifts upwards in energy by more than 0.6 eV. This leads to a crossover to a direct-gap material in the limit of the single monolayer. Unlike the bulk material, the MoS2 monolayer emits light strongly. The freestanding monolayer exhibits an increase in luminescence quantum efficiency by more than a factor of 104 compared with the bulk material. © 2010 The American Physical Society.


Kim S.-J.,Sungkyunkwan University | Lee S.-M.,Sungkyunkwan University
Free Radical Biology and Medicine | Year: 2013

d-Galactosamine (GalN) and lipopolysaccharide (LPS) are commonly used to study mechanisms of hepatic malfunction that result in hepatic inflammation and subsequent fulminant hepatic failure. Inflammasomes are intracellular multiprotein complexes that in response to cellular danger signals trigger the biological maturation of proinflammatory cytokines. Heme oxygenase-1 (HO-1) is a cytoprotective enzyme that induces anti-inflammatory and antioxidant activity against oxidative cellular stress. This study examined activation of the NACHT, LRR, and PYD domain-containing protein 3 (NLRP3) inflammasome in GalN/LPS-induced hepatic injury and the role of HO-1 in the signaling pathways of inflammasome. Mice (C57BL/6) were pretreated twice with hemin (HO-1 inducer, 30 mg/kg) and zinc protoporphyrin (ZnPP; HO-1 inhibitor, 10 mg/kg) at 12 and 2 h before GalN (800 mg/kg)/LPS (40 μg/kg) administration. HO-1 induction with hemin reversed the lethality induced by GalN/LPS administration, and ZnPP pretreatment blocked this change. Lipid peroxidation markedly increased after GalN/LPS treatment, whereas glutathione content decreased in the GalN/LPS group. These changes were attenuated by hemin, but ZnPP reversed the effects of hemin. Serum levels of tumor necrosis factor-α (TNF-α) and interleukin (IL)-1β increased after GalN/LPS treatment; these increases were attenuated by hemin. Hepatic mRNA levels of TNF-α, IL-1β, and NLRP3 increased after GalN/LPS treatment, and hemin attenuated increases in TNF-α and IL-1β. After GalN/LPS treatment, the hepatic expression of NLRP3, ASC, and caspase-1 (p10) was increased. In immunoprecipitation studies, hemin attenuated the interaction of NLRP3 with ASC and caspase-1. GalN/LPS induced expression of the thioredoxin-interacting protein (TXNIP) gene and the interaction between NLRP3 and TXNIP; again, hemin attenuated these effects. The effects of hemin were reversed by ZnPP. Our findings suggest that activation of the NLRP3 inflammasome leads to a GalN/LPS-induced inflammatory response through TXNIP-NLRP3 interaction. Furthermore, HO-1 overexpression may protect the liver against GalN/LPS-induced inflammation through suppression of the NLRP3 signaling pathway. © 2013 Elsevier Inc.


Zhou S.,Sungkyunkwan University | Kim D.,Sungkyunkwan University
Electrochimica Acta | Year: 2012

Sulfonated poly(arylene ether ketone) (SPAEK) with pendant carboxylic acid groups was synthesized. The pendant carboxylic acid groups were functionalized by unsaturated groups in order to produce a series of cross-linked SPAEK (CSPAEK) membranes. The cross-linking was employed to limit the high degree of water uptake and improve the dimensional stability of the membrane. The proton conductivity, water uptake, methanol permeability, thermal stability, and cell performance were investigated in order to evaluate the application of the prepared CSPAEK membranes in fuel cell. The CSPAEK80-20% system, CSPAEK membrane with 80% sulfonation and 20% cross-linking degree, exhibited a comparable proton conductivity to Nafion 117 but much lower low methanol permeability - about a half of that of Nafion 117, suggesting that it is a promising candidate as a polymer proton exchange membrane for fuel cells. © 2011 Elsevier Ltd. All rights reserved.


Le Q.N.,Sungkyunkwan University | Jeon J.-W.,Sungkyunkwan University
IEEE Transactions on Industrial Electronics | Year: 2010

We present a low-speed-damping controller for a stepper motor using artificial neural networks (ANNs). This controller is designed to remove nonlinear disturbance at low speeds. The proposed controller improves the stepper motor performance at less than the resonance speed of the stepper motor system. Due to its ability to learn, the proposed controller can adapt to different resonant speed ranges without any identification process for system parameters. Conversely, we also introduce the implementation of an ANN-based controller, online backpropagation learning, and a microstep driver on a single field-programmable gate array. An implementation and experimental results are conducted to verify the feasibility and the effectiveness of the proposed controller. © 2006 IEEE.

Loading Sungkyunkwan University collaborators
Loading Sungkyunkwan University collaborators