Entity

Time filter

Source Type

United States

Moody J.,STEMCELL Technologies
Methods in Molecular Biology | Year: 2013

The continued success of pluripotent stem cell research is ultimately dependent on access to reliable and defined reagents for the consistent culture and cryopreservation of undifferentiated, pluripotent cells. The development of defined and feeder-independent culture media has provided a platform for greater reproducibility and standardization in this field. Here we provide detailed protocols for the use of mTeSR™1 and TeSR™2 with various cell culture matrices as well as defined cryopreservation protocols for human embryonic and human induced pluripotent stem cells. © 2013 Springer Science+Business Media, LLC. Source


Liu M.,Terry Fox Laboratory | Liu M.,Chinese Culture University | Miller C.L.,STEMCELL Technologies | Eaves C.J.,British Columbia Cancer Agency
Methods in Molecular Biology | Year: 2013

The long-term culture initiating cell (LTC-IC) assay, founded on the bone marrow long-term culture (LTC) system, measures primitive hematopoietic stem cells (termed LTC-IC) based on their capacity to produce myeloid progeny for at least 5 weeks. Adaptations of the LTC system including the use of stromal cell lines, application of limiting dilution analysis, and estimation of average hematopoietic progenitor output per LTC-IC under defined conditions have made it possible to accurately determine LTC-IC content in minimally separated and highly purified cell populations from human hematopoietic tissue sources such as bone marrow, peripheral blood, cord blood, fetal liver as well as cord blood and mobilized peripheral blood. Methodologies for measuring human LTC-IC using bulk cultures, limiting dilution analysis, and single cell cultures are described. © 2013 Springer Science+Business Media, LLC. Source


Woehrer S.,BC Cancer Agency | Woehrer S.,Medical University of Vienna | Miller C.L.,STEMCELL Technologies | Eaves C.J.,British Columbia Cancer Agency
Methods in Molecular Biology | Year: 2013

The long-term culture-initiating cell (LTC-IC) assay is a well-established in vitro assay used to enumerate primitive mouse hematopoietic stem cells (HSCs) and relies on the two cardinal functions of HSCs: ability to self-renew and differentiation capacity. LTC-ICs present in minimally processed and purified cell suspensions and cocultured on a supportive feeder layer are detected by their sustained ability to produce hematopoietic progenitors (colony forming cells) after ≥ 4 weeks in culture. Refinements including the use of a defined stromal cell line, and extending the in vitro culture to 6 weeks allow detection of LTC-IC at similar frequencies to transplantable HSCs quantified using in vivo assays. © 2013 Springer Science+Business Media, LLC. Source


Louis S.A.,STEMCELL Technologies | Mak C.K.H.,STEMCELL Technologies | Reynolds B.A.,University of Florida
Methods in Molecular Biology | Year: 2013

Since the discovery of neural stem cells (NSC) in the embryonic and adult mammalian central nervous system (CNS), there have been a growing numbers of tissue culture media and protocols to study and functionally characterize NSCs and its progeny in vitro. One of these culture systems introduced in 1992 is referred to as the Neurosphere Assay, and it has been widely used to isolate, expand, differentiate and even quantify NSC populations. Several years later because its application as a quantitative in vitro assay for measuring NSC frequency was limited, a new single-step semisolid based assay, the Neural Colony Forming Cell (NCFC) assay was developed to accurately measure NSC numbers. The NCFC assay allows the discrimination between NSCs and progenitors by the size of colonies they produce (i.e., their proliferative potential). The evolution and continued improvements made to these tissue culture tools will facilitate further advances in the promising application of NSCs for therapeutic use. © 2013 Springer Science+Business Media, LLC. Source


News Article
Site: http://www.nature.com/nature/current_issue/

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment. Human oocyte donation and pES and swaPS cell line derivation procedures were described previously11, 23. Oocyte donors gave informed consent. Experiments were approved by the embryonic stem cell research oversight committee and the institutional review board at Columbia University Medical Center. Briefly, mature MII oocytes were activated using a calcium ionophore and/or an electrical pulse, followed by 4 h of culture with puromycin. Polar body extrusion and the presence of a single pronucleus indicating haploidy were confirmed, and oocytes were allowed to develop to the blastocyst stage. swaPS cells were derived following activation of an oocyte whose nuclear genome had been swapped with that of another oocyte11. ES cell lines were derived by laser ablation of the trophectoderm24 and addition of ROCK inhibitor Y-27632 at 10 μM to the derivation medium23. Then 2–3 days after plating, remaining trophectoderm cells were laser ablated, and inner cell mass cells were allowed to grow for 10–14 days until manual picking of the outgrowth was feasible. Unless otherwise stated, human ES cells were cultured on a feeder layer of growth-arrested mouse embryonic fibroblasts (MEFs) in standard human ES cell medium composed of Knockout Dulbecco’s Modified Eagle’s Medium supplemented with 15% Knockout Serum Replacement (KSR, Thermo Fisher Scientific), 2 mM l-glutamine, 0.1 mM nonessential amino acids, 50 units ml−1 penicillin, 50 μg ml−1 streptomycin, 0.1 mM β-mercaptoethanol and 8 ng ml–1 basic fibroblast growth factor (bFGF). Cells were free of mycoplasma and maintained in a humidified incubator at 37 °C and 5% CO . Passaging was carried out either mechanically with gentle trypsinization using trypsin solution A without EDTA (Biological Industries), or enzymatically using TrypLE Express (Thermo Fisher Scientific) with addition of 10 μM ROCK inhibitor Y-27632 (Stemgent) for 1 day after splitting. Haploid ES cells could also be grown in feeder-free conditions on Matrigel-coated plates (Corning) in mTeSR1 (STEMCELL Technologies) or StemFitN.AK03 (Ajinomoto) media. Following identification of haploid cells in human parthenogenetic ES cell lines at passages 6–7 by either metaphase spread analysis or sub-2c-cell sorting (see below and Extended Data Tables 1 and 2), haploid ES cell lines were established by sorting the 1c-cell population, with diploid cells serving as a reference. Haploid ES cell cultures were further maintained by enrichment rounds of 1c-cell sorting every 3–4 passages. For induction of mitotic arrest, growing cells were incubated for 40 min in the presence of 100 ng ml–1 colcemid (Biological Industries), added directly to the culture medium in a humidified incubator at 37 °C with 5% CO . The cells were then trypsinized, centrifuged at 1,000 r.p.m. at room temperature and gently resuspended in 37 °C warmed hypotonic solution (2.8 mg ml−1 KCl and 2.5 mg ml–1 sodium citrate) followed by 20 min of incubation at 37 °C. Cells were fixed by addition of fixative solution (3:1 methanol:acetic acid) and incubation for 5 min at room temperature. Fixation was repeated at least three times following centrifugation and resuspension in fixative solution. Metaphase spreads were prepared on slides and stained using the standard G-banding technique. Karyotype integrity was determined according to the International System for Human Cytogenetic Nomenclature (ISCN) based on the observation of a normal karyotype in at least 80% of analysed metaphases (minimum of 20 metaphases per analysis). Cells were washed with phosphate buffered saline (PBS), dissociated using either TrypLE Select or TrypLE Express (Thermo Fisher Scientific) and stained with 10 μg ml−1 Hoechst 33342 (ref. 2) (Sigma-Aldrich) in human ES cell medium at 37 °C for 30 min. Following centrifugation, cells were resuspended in PBS containing 15% KSR and 10 μM ROCK inhibitor Y-27632, filtered through a 70-μm cell strainer (Corning) and sorted using the 405 nm laser in either BD FACSAria III or BD Influx (BD Biosciences). For continued growth, sorted cells were plated with fresh medium containing 10 μM ROCK inhibitor Y-27632 for 24 h. For comparative analyses, G1-phase cells were sorted from isogenic haploid-enriched and unsorted diploid cultures. Cells that had undergone diploidization relatively recently in culture (within 3 passages after haploid cell enrichment) were isolated by sorting the 4c peak in haploid-enriched cultures and compared with 4c diploid cells from unsorted diploid cultures. Note that haploid-enriched cultures also consist of a mixed 2c-cell population of G2/M-phase haploids and G1-phase diploids. Sorting purity was confirmed by rerunning a fraction of sorted samples through the instrument. All DNA content profiles were generated based on flow cytometry with Hoechst 33342 staining. Haploid cell proportion was estimated based on the percentage of 1c cells and the relative contribution of G1 cells with regards to other phases of the cell cycle. Estimation of diploidization rate was based on the proportion of haploid cells between consecutive enrichment rounds as well as experimental analysis of h-pES10 diploidization kinetics throughout 7 passages (30 days) by analysing the DNA content of 2–3 replicates at each passage using flow cytometry with propidium iodide in methanol-fixed and RNase-treated cells. Diploidization rate was estimated by fitting the data to an exponential decay curve. For simultaneous flow cytometry analysis of DNA content and cell surface molecules, cells were washed, dissociated and incubated on ice for 30 min in the presence of 10 μg ml−1 Hoechst 33342 (Sigma-Aldrich) and either a conjugated antibody or a secondary antibody diluted 1:200 following a 60 min incubation with a primary antibody. For simultaneous flow cytometry analysis of DNA content and intracellular PDX1, dissociated cells were treated as described for immunofluorescence procedures, with Hoechst 33342 for DNA staining. Primary antibodies are detailed in Supplementary Table 1. In all flow cytometry procedures, samples were filtered through a 70-μm cell strainer (Corning Life Sciences) and analysed with either BD FACSAria III or BD Influx (BD Biosciences). DNA FISH was performed as described elsewhere25 using probes for human chromosomes 2 and 4 and DNA staining with 4′,6-diamidino-2-phenylindole (DAPI). Haploidy and diploidy were respectively determined per nucleus based on single or double hybridization signals. ES cells subject to FISH were grown on Matrigel-coated plates in StemFitN.AK03 medium for several passages before analysis. Alkaline phosphatase staining was performed using the Leukocyte Alkaline Phosphatase Kit (Sigma-Aldrich). For immunofluorescence staining, samples were washed with PBS, fixed with 4% paraformaldehyde for 10 min, and permeabilized and blocked in blocking solution (0.1% Triton X-100 and 5% donkey serum in PBS). Cells were incubated with primary antibodies (detailed in Supplementary Table 1) and secondary antibodies diluted 1:500 in blocking solution, and DAPI was used for DNA staining. Cells were washed twice with PBS subsequently to fixation and each incubation step. Images were taken using Zeiss LSM 510 Meta Confocal Microscope. Centromere quantification was carried out by manually counting centromere foci across individual planes along the z axis. EdU staining was performed using the Click-iT EdU Alexa Fluor 488 Imaging Kit (Thermo Fisher Scientific). ES cells subject to centromere staining in Fig. 1e and Extended Data Fig. 1e were grown on Matrigel-coated plates in StemFitN.AK03 for several passages before analysis. To generate a gene trap mutant library, 9 replicates of approximately 4 × 106 haploid pES10 cells (within one passage after 1c-cell enrichment) were co-transfected with 20 μg 5′-PTK-3′ gene trap vector26 and 20 μg pCyL43 piggyBac transposase plasmid27 using Bio-Rad Gene Pulser (suspended in 800 μL Opti-MEM, 4-mm cuvettes, 320 V, 250 μF), and replated on a 100 × 20 mm dish with DR3 MEFs and ROCK inhibitor Y-27632. Selection for insertions into expressed loci was carried out using 0.3 μg ml−1 puromycin starting 48 h post transfection, followed by pooling into a single library, represented by approximately 16,000 resistant colonies. Transfection with 5′-PTK-3′ only was used as a negative control. To screen for 6-TG-resistant mutants, the mutant library was grown in the presence of 6 μM 6-TG (Sigma-Aldrich) on DR4 MEFs for 18 days, during which 6 resistant colonies were independently isolated and characterized. Analysis of a resistant clone showed persistence of haploid cells. Genomic DNA was extracted (NucleoSpin Tissue Kit, MACHEREY-NAGEL) and insertion sites were detected using splinkerette PCR as described previously28, followed by PCR product purification and Sanger sequencing (ABI PRISM 3730xl DNA Analyzer (Applied Biosystems)). Sequences were mapped to the human genome (GRCh38/hg38) using UCSC BLAT search tool. Total DNA was isolated using the NucleoSpin Tissue Kit (MACHEREY-NAGEL). Total RNA was isolated using Qiagen RNeasy Kits according to the manufacturer’s protocols. To determine total RNA levels per cell, haploid and diploid cells were isolated from the same cultures by sorting the 1c (haploid G1) and 4c (diploid G2/M) populations, respectively. Following growth for 2 passages, cells were harvested and counted, and RNA was isolated from triplicates of 400,000 cells from each cell line and ploidy state (pES10 and pES12, haploid and diploid; 12 samples in total). RNA amounts were quantified using NanoDrop. Copy number variation (CNV) analysis was carried out on DNA samples of G1-sorted haploid and diploid pES10 and pES12 cells (see Supplementary Table 2) using Infinium Omni2.5Exome-8 BeadChip single nucleotide polymorphism (SNP) arrays (Illumina) following the manufacturer’s protocols. Raw data were processed using Genome Studio Genotyping Module (Illumina) to obtain log R ratios values for analysis using R statistical programming language. As expected, diploid pES10 and pES12 cells were homozygous across all chromosomes. For a detailed list of samples analysed by RNA-seq, see Supplementary Table 3. Total RNA samples (200 ng–1 μg, RNA integrity number (RIN) >9) were enriched for mRNAs by pulldown of poly(A)+ RNA. RNA-seq libraries were prepared using the TruSeq RNA Library Prep Kit v2 (Illumina) according to the manufacturer’s protocol and sequenced using Illumina NextSeq 500 to generate 85 bp single-end reads. RNA-seq reads were aligned to the human reference genome (GRCh37/hg19) using TopHat (version 2.0.8b) allowing 5 mismatches. Reads per kilobase per million fragments mapped (RPKM) values were quantified using Cuffquant and normalized using Cuffnorm in Cufflinks (version 2.1.1) to generate relative gene expression levels. Hierarchical clustering analyses were performed on RPKM values using Pearson correlation and average linkage. Analysis of differential gene expression relative to total RNA in haploid and diploid human ES cells (n = 4 in each group) was carried out by two complementary strategies, as follows: first, we used Cuffdiff with default parameters, considering differences of greater than twofold with FDR <0.05 as significant; second, to identify possibly subtle yet consistent transcriptional differences, we tested for genes whose minimal expression levels across all replicates of a certain group were higher than their maximal expression level across all replicates of the other group. Statistical significance was then determined by two-tailed unpaired Student’s t-test. Functional annotation enrichment analysis was done by DAVID (using the Benjamini method to determine statistical significance). Imprinting analyses included 75 human imprinted genes (http://www.geneimprint.com/), listed in Supplementary Table 4. RNA-seq data from control ES cell line NYSCF1 were published elsewhere29 (GEO accession number GSE61657). Genome-wide gene expression moving median plots were generated using the R package zoo (version 1.7–12) after removal of genes that were not expressed in the averaged reference diploid sample by flooring to 1 and setting an expression threshold of above 1. RNA-seq data from different tissues were retrieved from the Genotype-Tissue Expression (GTEx) portal (http://www.gtexportal.org/)30. Colour-coded scales in Fig. 4d correspond to gene expression levels relative to the mean across tissues (left scale) and across each set of ES cell duplicate and EB sample (right scale). Expression microarray analysis was performed as previously31 by using Affymetrix Human Gene 1.0 ST arrays. DNA methylation analysis was performed on genomic DNA from the samples detailed in Supplementary Table 2 using Infinium HumanMethylation450 BeachChips (Illumina) following the Infinium HD Methylation Protocol as described previously29. DNA methylation data from control ES cell line NYSCF1 were published before29 (GEO accession number GSE61657). Data were processed and normalized by using subset-quantile within array normalization (SWAN) and adjusted for batch effects using the R package ChAMP (version 1.4.0). DNA methylation levels at CpG sites associated with pluripotency-specific genes and iDMRs were analysed as described before29. For analysis of DNA methylation levels on the X chromosome, probes with average β values of less than 0.4 were filtered out. DMR analysis was facilitated by the lasso function in ChAMP using default settings. DMRs were then assigned to genes by proximity and analysed for functional annotation enrichment using DAVID (using the Benjamini method to determine statistical significance). Following sorting of haploid and diploid cell populations in G1, the diameter (2r) of viable single cells was measured by Countess Automated Cell Counter (Invitrogen) and their surface area and volume were calculated as 4πr2 and 4/3πr3, respectively. Analysis included 7, 4, 8 and 4 technical replicates for 1n pES10, 1n pES12, 2n pES10 and 2n pES12, respectively. Relative mtDNA abundance was analysed by quantitative PCR (qPCR) by using primers for the mitochondrial gene MT-ND2 (forward primer: 5′–TGTTGGTTATACCCTTCCCGTACTA–3′; reverse primer: 5′–CCTGCAAAGATGGTAGAGTAGATGA–3′) and normalization to nuclear DNA by using primers for the nuclear gene BECN1 (forward primer: 5′–CCCTCATCACAGGGCTCTCTCCA–3′; reverse primer: 5′–GGGACTGTAGGCTGGGAACTATGC–3′), as described elsewhere32. Analysis was performed using Applied Biosystems 7300 Real-Time PCR System with PerfeCTa SYBR Green FastMix (Quanta Biosciences). Analysis included all G1-sorted samples detailed in Supplementary Table 2 (n = 4 for each group, with two biological replicates for each cell line). EB differentiation was carried out by detaching ES cell colonies with Trypsin solution A without EDTA (Biological Industries), followed by resuspension and further culture of cell aggregates in human ES cell medium without bFGF on low attachment plates. Differentiation of haploid ES cells was initiated within 2 passages after 1c-cell enrichment. After 21 days, EB RNA was extracted from unsorted and/or sorted EB cells in G1 following dissociation and staining with 10 μg ml−1 Hoechst 33342 (Sigma-Aldrich) at 37 °C for 30 min. Metaphase spread analysis was performed on dissociated EB cells plated on 0.2% gelatin and expanded in human ES cell medium without bFGF. NCAM1-positive ES cell-derived neural progenitor cells were obtained using a 10-days protocol for efficient neural differentiation33 with slight modification34. Differentiation was initiated within 2 passages after 1c-cell enrichment. RNA was extracted from sorted haploid NCAM1-positive cells in G1 by co-staining with Hoechst 33342 and an anti-human NCAM-1/CD56 primary antibody (see Supplementary Table 1) and a Cy3-conjugated secondary antibody (Jackson Immunoresearch Laboratories) diluted 1:200. Differentiation into neurons was carried out by following a published protocol35 based on synergistic inhibition of SMAD signalling36 with modification, as follows: differentiation was initiated within 2 passages after 1c-cell enrichment with fully confluent ES cells cultured on Matrigel-coated plates in mTeSR1 by replacing the medium with human ES cell medium without bFGF, containing 10 μM SB431542 (Selleckchem) and 2.5 μM LDN-193189 (Stemgent) for 4 days. Subsequently, cells were kept in N2 medium35 supplemented with 10 μM SB431542 and 2.5 μM LDN-193189 for an additional 4 days, followed by 2 days in N2 medium supplemented with B-27 (Thermo Fisher Scientific) and 10 μM DAPT (Stemgent). The cells were then dissociated and replated on 0.01% poly-l-ornithine coated (Sigma-Aldrich) and laminin coated (4 μg ml−1, Thermo Fisher Scientific) plates in the presence of 10 μM ROCK inhibitor Y-27632 (Selleckchem), and further cultured in the same medium without Y-27632 for the next 4 days. Neuronal cultures were maintained in N2 medium supplemented with B-27 and 20 ng ml–1 BDNF (R&D) until analysis by immunostaining and FISH on day 20. 80–90% confluent ES cells grown on Matrigel-coated plates in mTeSR1 were subject to an 11-day regimen37 based on consecutive GSK3 and WNT inhibition with CHIR99021 and IWP-2 (Selleckchem), respectively. Differentiation was initiated within 2 passages after 1c-cell enrichment. On day 11 of differentiation, 1c cells were sorted and plated for immunostaining. The protocol used here was developed based on several recent publications38, 39, 40. ES cells grown in feeder-free conditions were differentiated into definitive endoderm by using STEMdiff Definitive Endoderm Kit (StemCell Technologies) for 3–4 days. Subsequent specification was achieved by a step-wise protocol involving treatment with recombinant human KGF/FGF7 (R&D Systems), LDN-193189 (Stemgent), KAAD-cyclopamine (Stemgent) and retinoic acid (Stemgent). On days 8–11, EGF (R&D System) was used to induce pancreatic cells. Differentiation was initiated within as few as 2 passages after 1c-cell enrichment. All experimental procedures in animals were approved by the ethics committee of the Hebrew University. ES cells were trypsinized and approximately 2 × 106 cells were resuspended in 100 μl human ES cell medium and 100 μl Matrigel (BD Biosciences), followed by subcutaneous injection into NOD-SCID Il2rg−/− immunodeficient mice (Jackson Laboratory). 8–12 weeks after injection tumours were dissected and subjected to further analysis. Histological slides were prepared from tumour slices cryopreserved in O.C.T. compound (Sakura Finetek) using Leica CM1850 cryostat (Leica Biosystems, 10-μm sections), followed by immunostaining, haematoxylin and eosin staining or FISH analysis. Flow cytometry with Hoechst 33342 staining was performed on dissociated cells from freshly dissected tumours.

Discover hidden collaborations