STEMCELL Technologies

United States

STEMCELL Technologies

United States
SEARCH FILTERS
Time filter
Source Type

Revenue from the global bone marrow transplant market is anticipated to expand at a CAGR of 4.1% during the forecast period. By procedure type, the market is divided into segments viz. autologous bone marrow transplant and allogeneic bone marrow transplant. Allogeneic bone marrow transplant procedure segment accounted for a highest revenue share of 63.4% in 2014, and revenue from this segment is expected to expand at CAGR of 4.4%, thereby accounting for market share to 65.7%. However, in terms of volume, the autologous bone marrow transplant procedure segment is expected to continue to lead the global bone marrow transplant market as a result of increasing adoption of the procedure owing to low chances of side effects. On the basis of disease indications, the leukemia segment is expected to remain the leading segment and is expected to be valued at US$ 2,679.6 Mn by the end of 2021. By disease indication, lymphoma segment currently ranks second in terms of both value and volume. By end user, the market is segmented into hospitals, multispecialty clinics, and ambulatory surgical centers (ASC). Among these, hospital end user segment leads the global bone marrow transplant market, accounting for over 91% volume share of global bone marrow transplant market in 2014. This is partly attributed to requirement for advanced healthcare infrastructure for conducting the procedure. The multispecialty clinics segment is expected to register highest CAGR of 4.8% during the forecast period, with 1.4X increase in procedural count. Market growth is primarily driven by factors such as global increase in prevalence of blood cancers, expansion of bone marrow transplant registry, growing investment in logistic services, and improvement in survival rate after treatment. Being a procedure with the likelihood of highest success rate for the treatment of leukemia and other blood cancers, adoption of bone marrow transplant procedures is increasing, and is expected to fuel market growth to a significant extent over the forecast period. However, high cost of the treatment, scarcity of bone marrow donors, and uncertainty of reimbursement in several developing countries are factors expected to hamper growth of the global bone marrow transplant market over the forecast period. This report covers trends in the global market as well as trends for each segment, and offers analysis of market potential. Globally, the market in Europe is expected to remain dominant among other markets in the global bone marrow transplant market, accounting for over 59% revenue share. This is attributed to high density of bone marrow transplant centers in the region and expanding bone marrow registries. The market in Latin America is anticipated to witness rapid increase growth in terms of volume owing to high number of potential candidates for the procedure. For More Information Request TOC (desk of content material), Figures and Tables of the report @ http://www.persistencemarketresearch.com/market-research/bone-marrow-transplantation-market/toc The report begins with the evolution of the bone marrow transplant procedure, offering an overview of the global bone marrow transplant market in terms of value and volume. Comparative analysis of bone marrow transplant centers and number of procedures being conducted annually in regions such as North America, Europe, Latin America, Asia-Pacific, and Middle East & Africa explains the reasons for gaps in the market. Key market players covered in this report include Lonza Group Ltd., Merck Millipore Corporation, Sanofi-Aventis LLC, AllCells LLC, STEMCELL Technologies, and American Type Culture Collection (ATCC) Inc.


News Article | November 10, 2016
Site: www.prnewswire.co.uk

The global cell isolation market is expected to reach USD 7.89 billion by 2021, at a CAGR of 17.2% driven by increasing government funding for cell based research and expanding biotechnology and biopharmaceutical industries while human cells segment is projected to witness the largest growth rate in cell separation market. Complete report on global cell isolation/ cell separation market spread across 172 pages, profiling 10 companies and supported with 124 tables and 46 figures is now available at http://www.rnrmarketresearch.com/cell-isolationcell-separation-market-by-product-reagent-media-bead-centrifuge-cell-type-human-stem-cell-animal-technique-filtration-surface-marker-application-research-ivd-by-end-market-report.html. On the basis of product, the cell isolation market is segmented into consumables and instruments. In 2016, the consumables segment is expected to account for the largest share of the global cell separation. Growth in this segment can primarily be attributed to the increasing investments by companies to develop advanced products and rising government initiatives for enhancing cell-based research. On the basis of technique, the cell isolation market is segmented into centrifugation-based cell isolation, surface marker-based cell separation, and filtration-based cell separation. In 2016, the centrifugation-based cell isolation segment is expected to account for the largest share of the global cell isolation market primarily due to the wide usage of this technique among end users. This system is used on a large scale by biotechnology and biopharmaceutical companies as well as on a small scale by clinical research organizations and academia for manufacturing vaccines, enzymes, and antibodies. On the basis of cell type, the cell isolation market is segmented into human cells and animal cells. The human cells segment is expected to account for the largest share of the global cell isolation market during the forecast period. Technological advancements in treatments and increasing incidence of skin diseases are the key factors propelling the growth of the cell separation market. On the basis of application, the cell isolation market is segmented into bio molecule isolation, stem cell research, cancer research, in vitro diagnostics, and therapeutics. Increasing company investments to develop new biopharmaceutical products is a major factor contributing to the growth of this market segment. North America is the largest regional segment in the cell separation market, followed by Europe, Asia, and the Rest of the World (RoW). However, Asia is projected to grow at the highest CAGR during the forecast period. Factors such as increasing interest in emerging markets, government support, and high prevalence of diseases are driving the growth of this market. Key players in the cell isolation/cell separation market include by Beckman Coulter (U.S.), BD Biosciences (U.S.), GE Healthcare (U.K.), Merck Millipore (U.S.), Miltenyi Biotec (Germany), pluriSelect (Germany), STEMCELL Technologies Inc. (Canada), Terumo BCT (U.S.), Thermo Fisher Scientific, Inc. (U.S.), and Bio-Rad Laboratories Inc.(U.S.). Order a copy of Cell Isolation/Cell Separation Market by Product (Reagents, Media, Serum, Beads, Centrifuge), Cell Type (Human, Stem, Animal), Technique (Surface marker, Filtration), Application (Cancer, IVD), End User (Hospitals, Biotechnology) - Global Forecast to 2021 research report at http://www.rnrmarketresearch.com/contacts/purchase?rname=213818. Apart from comprehensive geographic and product analysis and market sizing, the report also provides a competitive landscape that covers the growth strategies adopted by industry players over the last three years. In addition, the company profiles comprise the product portfolios, developments, and strategies adopted by the market players to maintain and increase their shares in the market. On a related note, another research on Cell Expansion Market Global Forecasts to 2021 says, the cell expansion market is dominated by North America, followed by Europe, Asia, and the Rest of the World (RoW). Increasing government funding for research, high prevalence of chronic diseases, and growing number of GMP-certified production facilities are the major growth factors. The overall market is expected to reach USD18.76 billion by 2021 from USD 8.34 billion in 2016 at a CAGR of 17.6%. Companies like Beckman Coulter, Inc., Becton, Dickinson and Company, Corning, Inc., GE Healthcare, Lonza, Merck KGaA, Miltenyi Biotec, STEMCELL Technologies, Inc., Terumo BCT, Inc. and Thermo Fisher Scientific, Inc. have been profiled in this 189 pages research report available at http://www.rnrmarketresearch.com/cell-expansion-market-by-product-reagent-media-serum-bioreactors-centrifuge-cell-type-human-animal-application-stem-cell-research-regenerative-medicine-clinical-diagnostics-end-user-h-market-report.html. Explore more reports on Life Sciences market at http://www.rnrmarketresearch.com/reports/life-sciences. RnRMarketResearch.com is your single source for all market research needs. Our database includes 100,000+ market research reports from over 95 leading global publishers & in-depth market research studies of over 5000 micro markets. With comprehensive information about the publishers and the industries for which they publish market research reports, we help you in your purchase decision by mapping your information needs with our huge collection of reports. We provide 24/7 online and offline support to our customers.


News Article | April 6, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment. Human oocyte donation and pES and swaPS cell line derivation procedures were described previously11, 23. Oocyte donors gave informed consent. Experiments were approved by the embryonic stem cell research oversight committee and the institutional review board at Columbia University Medical Center. Briefly, mature MII oocytes were activated using a calcium ionophore and/or an electrical pulse, followed by 4 h of culture with puromycin. Polar body extrusion and the presence of a single pronucleus indicating haploidy were confirmed, and oocytes were allowed to develop to the blastocyst stage. swaPS cells were derived following activation of an oocyte whose nuclear genome had been swapped with that of another oocyte11. ES cell lines were derived by laser ablation of the trophectoderm24 and addition of ROCK inhibitor Y-27632 at 10 μM to the derivation medium23. Then 2–3 days after plating, remaining trophectoderm cells were laser ablated, and inner cell mass cells were allowed to grow for 10–14 days until manual picking of the outgrowth was feasible. Unless otherwise stated, human ES cells were cultured on a feeder layer of growth-arrested mouse embryonic fibroblasts (MEFs) in standard human ES cell medium composed of Knockout Dulbecco’s Modified Eagle’s Medium supplemented with 15% Knockout Serum Replacement (KSR, Thermo Fisher Scientific), 2 mM l-glutamine, 0.1 mM nonessential amino acids, 50 units ml−1 penicillin, 50 μg ml−1 streptomycin, 0.1 mM β-mercaptoethanol and 8 ng ml–1 basic fibroblast growth factor (bFGF). Cells were free of mycoplasma and maintained in a humidified incubator at 37 °C and 5% CO . Passaging was carried out either mechanically with gentle trypsinization using trypsin solution A without EDTA (Biological Industries), or enzymatically using TrypLE Express (Thermo Fisher Scientific) with addition of 10 μM ROCK inhibitor Y-27632 (Stemgent) for 1 day after splitting. Haploid ES cells could also be grown in feeder-free conditions on Matrigel-coated plates (Corning) in mTeSR1 (STEMCELL Technologies) or StemFitN.AK03 (Ajinomoto) media. Following identification of haploid cells in human parthenogenetic ES cell lines at passages 6–7 by either metaphase spread analysis or sub-2c-cell sorting (see below and Extended Data Tables 1 and 2), haploid ES cell lines were established by sorting the 1c-cell population, with diploid cells serving as a reference. Haploid ES cell cultures were further maintained by enrichment rounds of 1c-cell sorting every 3–4 passages. For induction of mitotic arrest, growing cells were incubated for 40 min in the presence of 100 ng ml–1 colcemid (Biological Industries), added directly to the culture medium in a humidified incubator at 37 °C with 5% CO . The cells were then trypsinized, centrifuged at 1,000 r.p.m. at room temperature and gently resuspended in 37 °C warmed hypotonic solution (2.8 mg ml−1 KCl and 2.5 mg ml–1 sodium citrate) followed by 20 min of incubation at 37 °C. Cells were fixed by addition of fixative solution (3:1 methanol:acetic acid) and incubation for 5 min at room temperature. Fixation was repeated at least three times following centrifugation and resuspension in fixative solution. Metaphase spreads were prepared on slides and stained using the standard G-banding technique. Karyotype integrity was determined according to the International System for Human Cytogenetic Nomenclature (ISCN) based on the observation of a normal karyotype in at least 80% of analysed metaphases (minimum of 20 metaphases per analysis). Cells were washed with phosphate buffered saline (PBS), dissociated using either TrypLE Select or TrypLE Express (Thermo Fisher Scientific) and stained with 10 μg ml−1 Hoechst 33342 (ref. 2) (Sigma-Aldrich) in human ES cell medium at 37 °C for 30 min. Following centrifugation, cells were resuspended in PBS containing 15% KSR and 10 μM ROCK inhibitor Y-27632, filtered through a 70-μm cell strainer (Corning) and sorted using the 405 nm laser in either BD FACSAria III or BD Influx (BD Biosciences). For continued growth, sorted cells were plated with fresh medium containing 10 μM ROCK inhibitor Y-27632 for 24 h. For comparative analyses, G1-phase cells were sorted from isogenic haploid-enriched and unsorted diploid cultures. Cells that had undergone diploidization relatively recently in culture (within 3 passages after haploid cell enrichment) were isolated by sorting the 4c peak in haploid-enriched cultures and compared with 4c diploid cells from unsorted diploid cultures. Note that haploid-enriched cultures also consist of a mixed 2c-cell population of G2/M-phase haploids and G1-phase diploids. Sorting purity was confirmed by rerunning a fraction of sorted samples through the instrument. All DNA content profiles were generated based on flow cytometry with Hoechst 33342 staining. Haploid cell proportion was estimated based on the percentage of 1c cells and the relative contribution of G1 cells with regards to other phases of the cell cycle. Estimation of diploidization rate was based on the proportion of haploid cells between consecutive enrichment rounds as well as experimental analysis of h-pES10 diploidization kinetics throughout 7 passages (30 days) by analysing the DNA content of 2–3 replicates at each passage using flow cytometry with propidium iodide in methanol-fixed and RNase-treated cells. Diploidization rate was estimated by fitting the data to an exponential decay curve. For simultaneous flow cytometry analysis of DNA content and cell surface molecules, cells were washed, dissociated and incubated on ice for 30 min in the presence of 10 μg ml−1 Hoechst 33342 (Sigma-Aldrich) and either a conjugated antibody or a secondary antibody diluted 1:200 following a 60 min incubation with a primary antibody. For simultaneous flow cytometry analysis of DNA content and intracellular PDX1, dissociated cells were treated as described for immunofluorescence procedures, with Hoechst 33342 for DNA staining. Primary antibodies are detailed in Supplementary Table 1. In all flow cytometry procedures, samples were filtered through a 70-μm cell strainer (Corning Life Sciences) and analysed with either BD FACSAria III or BD Influx (BD Biosciences). DNA FISH was performed as described elsewhere25 using probes for human chromosomes 2 and 4 and DNA staining with 4′,6-diamidino-2-phenylindole (DAPI). Haploidy and diploidy were respectively determined per nucleus based on single or double hybridization signals. ES cells subject to FISH were grown on Matrigel-coated plates in StemFitN.AK03 medium for several passages before analysis. Alkaline phosphatase staining was performed using the Leukocyte Alkaline Phosphatase Kit (Sigma-Aldrich). For immunofluorescence staining, samples were washed with PBS, fixed with 4% paraformaldehyde for 10 min, and permeabilized and blocked in blocking solution (0.1% Triton X-100 and 5% donkey serum in PBS). Cells were incubated with primary antibodies (detailed in Supplementary Table 1) and secondary antibodies diluted 1:500 in blocking solution, and DAPI was used for DNA staining. Cells were washed twice with PBS subsequently to fixation and each incubation step. Images were taken using Zeiss LSM 510 Meta Confocal Microscope. Centromere quantification was carried out by manually counting centromere foci across individual planes along the z axis. EdU staining was performed using the Click-iT EdU Alexa Fluor 488 Imaging Kit (Thermo Fisher Scientific). ES cells subject to centromere staining in Fig. 1e and Extended Data Fig. 1e were grown on Matrigel-coated plates in StemFitN.AK03 for several passages before analysis. To generate a gene trap mutant library, 9 replicates of approximately 4 × 106 haploid pES10 cells (within one passage after 1c-cell enrichment) were co-transfected with 20 μg 5′-PTK-3′ gene trap vector26 and 20 μg pCyL43 piggyBac transposase plasmid27 using Bio-Rad Gene Pulser (suspended in 800 μL Opti-MEM, 4-mm cuvettes, 320 V, 250 μF), and replated on a 100 × 20 mm dish with DR3 MEFs and ROCK inhibitor Y-27632. Selection for insertions into expressed loci was carried out using 0.3 μg ml−1 puromycin starting 48 h post transfection, followed by pooling into a single library, represented by approximately 16,000 resistant colonies. Transfection with 5′-PTK-3′ only was used as a negative control. To screen for 6-TG-resistant mutants, the mutant library was grown in the presence of 6 μM 6-TG (Sigma-Aldrich) on DR4 MEFs for 18 days, during which 6 resistant colonies were independently isolated and characterized. Analysis of a resistant clone showed persistence of haploid cells. Genomic DNA was extracted (NucleoSpin Tissue Kit, MACHEREY-NAGEL) and insertion sites were detected using splinkerette PCR as described previously28, followed by PCR product purification and Sanger sequencing (ABI PRISM 3730xl DNA Analyzer (Applied Biosystems)). Sequences were mapped to the human genome (GRCh38/hg38) using UCSC BLAT search tool. Total DNA was isolated using the NucleoSpin Tissue Kit (MACHEREY-NAGEL). Total RNA was isolated using Qiagen RNeasy Kits according to the manufacturer’s protocols. To determine total RNA levels per cell, haploid and diploid cells were isolated from the same cultures by sorting the 1c (haploid G1) and 4c (diploid G2/M) populations, respectively. Following growth for 2 passages, cells were harvested and counted, and RNA was isolated from triplicates of 400,000 cells from each cell line and ploidy state (pES10 and pES12, haploid and diploid; 12 samples in total). RNA amounts were quantified using NanoDrop. Copy number variation (CNV) analysis was carried out on DNA samples of G1-sorted haploid and diploid pES10 and pES12 cells (see Supplementary Table 2) using Infinium Omni2.5Exome-8 BeadChip single nucleotide polymorphism (SNP) arrays (Illumina) following the manufacturer’s protocols. Raw data were processed using Genome Studio Genotyping Module (Illumina) to obtain log R ratios values for analysis using R statistical programming language. As expected, diploid pES10 and pES12 cells were homozygous across all chromosomes. For a detailed list of samples analysed by RNA-seq, see Supplementary Table 3. Total RNA samples (200 ng–1 μg, RNA integrity number (RIN) >9) were enriched for mRNAs by pulldown of poly(A)+ RNA. RNA-seq libraries were prepared using the TruSeq RNA Library Prep Kit v2 (Illumina) according to the manufacturer’s protocol and sequenced using Illumina NextSeq 500 to generate 85 bp single-end reads. RNA-seq reads were aligned to the human reference genome (GRCh37/hg19) using TopHat (version 2.0.8b) allowing 5 mismatches. Reads per kilobase per million fragments mapped (RPKM) values were quantified using Cuffquant and normalized using Cuffnorm in Cufflinks (version 2.1.1) to generate relative gene expression levels. Hierarchical clustering analyses were performed on RPKM values using Pearson correlation and average linkage. Analysis of differential gene expression relative to total RNA in haploid and diploid human ES cells (n = 4 in each group) was carried out by two complementary strategies, as follows: first, we used Cuffdiff with default parameters, considering differences of greater than twofold with FDR <0.05 as significant; second, to identify possibly subtle yet consistent transcriptional differences, we tested for genes whose minimal expression levels across all replicates of a certain group were higher than their maximal expression level across all replicates of the other group. Statistical significance was then determined by two-tailed unpaired Student’s t-test. Functional annotation enrichment analysis was done by DAVID (using the Benjamini method to determine statistical significance). Imprinting analyses included 75 human imprinted genes (http://www.geneimprint.com/), listed in Supplementary Table 4. RNA-seq data from control ES cell line NYSCF1 were published elsewhere29 (GEO accession number GSE61657). Genome-wide gene expression moving median plots were generated using the R package zoo (version 1.7–12) after removal of genes that were not expressed in the averaged reference diploid sample by flooring to 1 and setting an expression threshold of above 1. RNA-seq data from different tissues were retrieved from the Genotype-Tissue Expression (GTEx) portal (http://www.gtexportal.org/)30. Colour-coded scales in Fig. 4d correspond to gene expression levels relative to the mean across tissues (left scale) and across each set of ES cell duplicate and EB sample (right scale). Expression microarray analysis was performed as previously31 by using Affymetrix Human Gene 1.0 ST arrays. DNA methylation analysis was performed on genomic DNA from the samples detailed in Supplementary Table 2 using Infinium HumanMethylation450 BeachChips (Illumina) following the Infinium HD Methylation Protocol as described previously29. DNA methylation data from control ES cell line NYSCF1 were published before29 (GEO accession number GSE61657). Data were processed and normalized by using subset-quantile within array normalization (SWAN) and adjusted for batch effects using the R package ChAMP (version 1.4.0). DNA methylation levels at CpG sites associated with pluripotency-specific genes and iDMRs were analysed as described before29. For analysis of DNA methylation levels on the X chromosome, probes with average β values of less than 0.4 were filtered out. DMR analysis was facilitated by the lasso function in ChAMP using default settings. DMRs were then assigned to genes by proximity and analysed for functional annotation enrichment using DAVID (using the Benjamini method to determine statistical significance). Following sorting of haploid and diploid cell populations in G1, the diameter (2r) of viable single cells was measured by Countess Automated Cell Counter (Invitrogen) and their surface area and volume were calculated as 4πr2 and 4/3πr3, respectively. Analysis included 7, 4, 8 and 4 technical replicates for 1n pES10, 1n pES12, 2n pES10 and 2n pES12, respectively. Relative mtDNA abundance was analysed by quantitative PCR (qPCR) by using primers for the mitochondrial gene MT-ND2 (forward primer: 5′–TGTTGGTTATACCCTTCCCGTACTA–3′; reverse primer: 5′–CCTGCAAAGATGGTAGAGTAGATGA–3′) and normalization to nuclear DNA by using primers for the nuclear gene BECN1 (forward primer: 5′–CCCTCATCACAGGGCTCTCTCCA–3′; reverse primer: 5′–GGGACTGTAGGCTGGGAACTATGC–3′), as described elsewhere32. Analysis was performed using Applied Biosystems 7300 Real-Time PCR System with PerfeCTa SYBR Green FastMix (Quanta Biosciences). Analysis included all G1-sorted samples detailed in Supplementary Table 2 (n = 4 for each group, with two biological replicates for each cell line). EB differentiation was carried out by detaching ES cell colonies with Trypsin solution A without EDTA (Biological Industries), followed by resuspension and further culture of cell aggregates in human ES cell medium without bFGF on low attachment plates. Differentiation of haploid ES cells was initiated within 2 passages after 1c-cell enrichment. After 21 days, EB RNA was extracted from unsorted and/or sorted EB cells in G1 following dissociation and staining with 10 μg ml−1 Hoechst 33342 (Sigma-Aldrich) at 37 °C for 30 min. Metaphase spread analysis was performed on dissociated EB cells plated on 0.2% gelatin and expanded in human ES cell medium without bFGF. NCAM1-positive ES cell-derived neural progenitor cells were obtained using a 10-days protocol for efficient neural differentiation33 with slight modification34. Differentiation was initiated within 2 passages after 1c-cell enrichment. RNA was extracted from sorted haploid NCAM1-positive cells in G1 by co-staining with Hoechst 33342 and an anti-human NCAM-1/CD56 primary antibody (see Supplementary Table 1) and a Cy3-conjugated secondary antibody (Jackson Immunoresearch Laboratories) diluted 1:200. Differentiation into neurons was carried out by following a published protocol35 based on synergistic inhibition of SMAD signalling36 with modification, as follows: differentiation was initiated within 2 passages after 1c-cell enrichment with fully confluent ES cells cultured on Matrigel-coated plates in mTeSR1 by replacing the medium with human ES cell medium without bFGF, containing 10 μM SB431542 (Selleckchem) and 2.5 μM LDN-193189 (Stemgent) for 4 days. Subsequently, cells were kept in N2 medium35 supplemented with 10 μM SB431542 and 2.5 μM LDN-193189 for an additional 4 days, followed by 2 days in N2 medium supplemented with B-27 (Thermo Fisher Scientific) and 10 μM DAPT (Stemgent). The cells were then dissociated and replated on 0.01% poly-l-ornithine coated (Sigma-Aldrich) and laminin coated (4 μg ml−1, Thermo Fisher Scientific) plates in the presence of 10 μM ROCK inhibitor Y-27632 (Selleckchem), and further cultured in the same medium without Y-27632 for the next 4 days. Neuronal cultures were maintained in N2 medium supplemented with B-27 and 20 ng ml–1 BDNF (R&D) until analysis by immunostaining and FISH on day 20. 80–90% confluent ES cells grown on Matrigel-coated plates in mTeSR1 were subject to an 11-day regimen37 based on consecutive GSK3 and WNT inhibition with CHIR99021 and IWP-2 (Selleckchem), respectively. Differentiation was initiated within 2 passages after 1c-cell enrichment. On day 11 of differentiation, 1c cells were sorted and plated for immunostaining. The protocol used here was developed based on several recent publications38, 39, 40. ES cells grown in feeder-free conditions were differentiated into definitive endoderm by using STEMdiff Definitive Endoderm Kit (StemCell Technologies) for 3–4 days. Subsequent specification was achieved by a step-wise protocol involving treatment with recombinant human KGF/FGF7 (R&D Systems), LDN-193189 (Stemgent), KAAD-cyclopamine (Stemgent) and retinoic acid (Stemgent). On days 8–11, EGF (R&D System) was used to induce pancreatic cells. Differentiation was initiated within as few as 2 passages after 1c-cell enrichment. All experimental procedures in animals were approved by the ethics committee of the Hebrew University. ES cells were trypsinized and approximately 2 × 106 cells were resuspended in 100 μl human ES cell medium and 100 μl Matrigel (BD Biosciences), followed by subcutaneous injection into NOD-SCID Il2rg−/− immunodeficient mice (Jackson Laboratory). 8–12 weeks after injection tumours were dissected and subjected to further analysis. Histological slides were prepared from tumour slices cryopreserved in O.C.T. compound (Sakura Finetek) using Leica CM1850 cryostat (Leica Biosystems, 10-μm sections), followed by immunostaining, haematoxylin and eosin staining or FISH analysis. Flow cytometry with Hoechst 33342 staining was performed on dissociated cells from freshly dissected tumours.


WHISTLER, BC--(Marketwired - October 24, 2016) - Stem cells and cell therapy transplants make headlines frequently in Canada, thanks to ground-breaking research and clinical trials taking place in the nation's university labs and hospitals. Cutting-edge advances in Canada's regenerative medicine community will be on display when international stem cell scientists and engineers convene in Whistler, British Columbia, to attend the Till & McCulloch Meetings (TMM) and share the latest research in this pioneering field of medicine. Regenerative medicine harnesses the power of stem cells, biomaterials and molecules to repair, regenerate or replace diseased cells, tissues and organs. The current global market for regenerative medicine is USD$36B and forecasted to grow to reach USD$49.41B by 2021.(1) This year's conference has many highlights, including the popular Till & McCulloch Award Lecture -- on October 25 at 11:40 a.m. PT -- recognizing the impressive body of work of Dr. Molly Shoichet, University of Toronto, and her paper, published in Stem Cell Reports in 2015, which demonstrated that stem cells could be injected into the retinas of blind mice to improve their vision by 15 per cent. In addition to hearing from researchers and scientists from Canada, the United States and Japan, Canadian Tina Ceroni will share her extraordinary experience of being the second patient in the world to have a stem cell transplant -- in this case at Ottawa Hospital -- for her life-threatening and rare disease: stiff-person syndrome (SPS). The Meetings will also include industry-hosted workshops, mentoring lunches and award ceremonies. The Meetings, co-hosted by CCRM, the Stem Cell Network and the Ontario Institute for Regenerative Medicine (OIRM), will take place from October 24-26 at the Whistler Conference Centre. The agenda, featuring speakers and special events, is available here. The conference hosts would like to acknowledge the principal sponsors of TMM2016 and thank them for their support. Travel Award Sponsors: Stem Cell Network, Medicine by Design, OIRM and ThéCell; Platinum Sponsors: BD Biosciences, STEMCELL Technologies and ThéCell; Gold Sponsors: Beckman Coulter Life Sciences and CellCAN; Silver Sponsors: Biological Industries, FroggaBio, GE, Roche and Thermo Fisher Scientific. "Canada's strength in regenerative medicine keeps growing as more government funding gets allocated to supporting the best minds and organizations we have. It's always valuable to attend TMM and hear from researchers and graduate students about their important work. With so much momentum in the community right now, I expect the 2016 Meetings to be better than ever." - Dr. Michael May, president and CEO of CCRM. "Stem cell science was pioneered in Canada over 50 years ago, and has the potential to be an iconic Canadian contribution to medical science. Through stem cell research we are unlocking the potential for regenerative medicine, and the 2016 TMM will once again bring together Canada's world class researchers to discuss the current state of the science and its promise for the future." - Dr. Michael Rudnicki, Scientific Director of the Stem Cell Network and Director of the Regenerative Medicine Program & the Sprott Centre for Stem Cell Research. "Every day, new advances are bringing regenerative medicine and cell therapies closer to clinical application for patients around the globe. It is therefore vitally important that researchers, clinicians, policymakers, NGOs and industry have the opportunity to meet, form collaborations and share knowledge to ensure this happens in the most effective and efficient way possible. The Till and McCulloch Meetings are the best place in Canada -- and possibly the world -- to do this." - Dr. Duncan Stewart, president and scientific director of the Ontario Institute for Regenerative Medicine (OIRM). About the Till & McCulloch Meetings The Till & McCulloch Meetings are Canada's premier stem cell research event. As the only conference of its kind in Canada, the Till & McCulloch Meetings provide a forum for the exchange of ideas and research among Canada's leading stem cell scientists, clinicians, bioengineers and ethicists, as well as representatives from industry, government, health and NGO sectors from around the world. CCRM, the Stem Cell Network and the Ontario Institute for Regenerative Medicine are pleased to be co-hosting the 2016 Meetings, which will be held in Whistler, British Columbia, from October 24-26, 2016. For more information, please visit www.tillandmcculloch.ca. About CCRM CCRM, a Canadian not-for-profit organization funded by the Government of Canada, the Province of Ontario, and leading academic and industry partners, supports the development of regenerative medicines and associated enabling technologies, with a specific focus on cell and gene therapy. A network of researchers, leading companies, strategic investors and entrepreneurs, CCRM aims to accelerate the translation of scientific discovery into marketable products for patients with specialized teams, funding, and infrastructure. CCRM is the commercialization partner of the Ontario Institute for Regenerative Medicine and the University of Toronto's Medicine by Design. CCRM is hosted by the University of Toronto. Visit us at ccrm.ca. About the Stem Cell Network The Stem Cell Network, established in 2001, brings together approximately 150 leading scientists, clinicians, engineers and ethicists from universities and hospitals across Canada. The Network supports cutting-edge projects that translate research discoveries into new and better treatments for millions of patients in Canada and around the world. Hosted by the University of Ottawa, and the Ottawa Hospital Research Institute (OHRI), the Stem Cell Network is funded by the Government of Canada. For more information on the Stem Cell Network, please visit www.stemcellnetwork.ca. About OIRM Building on more than 50 years of world-leading research in stem cells and regenerative medicine, the Ontario Institute for Regenerative Medicine (OIRM) was launched in 2014 with a vision to revolutionize the treatment of degenerative diseases and make Ontario a global leader in the development of stem cell-based products and therapies. More than 170 research programs at universities and institutions across the province are involved with OIRM, with additional contributions from key clinical and health charity partners and from OIRM's commercialization partner, CCRM (formerly the Centre for Commercialization of Regenerative Medicine). OIRM is based in Toronto and was realized with investment from Ontario's Ministry of Research and Innovation. Visit www.oirm.ca.


HSP90 inhibitors used in this study including PU-H71, PU-DZ13, NVP-AUY922, and SNX-2112 were synthesized as previously reported7, 19. 17-DMAG was purchased from Sigma. HSP90 bait (PU-H71 beads)21, HSP70 bait (YK beads)22, biotinylated YK (YK-biotin)22, fluorescently labelled PU-H71 (PU-FITC)23, the control derivatives PU-TEG and PU-FITC9 (ref. 24), and the radiolabelled PU-H71-derivative 124I-PU-H71 (ref. 25) were generated as previously described. The specificity of PU-H71 for HSP90 and over other proteins was extensively analysed7. Thus binding of PU-H71 in cell homogenates, live cells and organisms denotes binding to HSP90 species characteristic of each analysed tumour or tissue. Combined with the findings that PU-H71 binds more tightly to HSP90 in type 1 than in type 2 cells, an observation true for cell homogenates, live cells, and in vivo, at the organismal level, we propose that labelled versions of PU-H71 are reliable tools to perturb, identify and measure the expression of the high-molecular-weight, multimeric HSP90 complexes in tumours. The specificity of YK probes for HSP70 was previously reported22, 26, 27, 28. Cell lines were obtained from laboratories at WCMC or MSKCC, or were purchased from the American Type Culture Collection (ATCC) or Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ). Cells were cultured as per the providers’ recommended culture conditions. Cells were authenticated using short tandem repeat profiling and tested for mycoplasma. The pancreatic cancer cell lines include: ASPC-1 (CRL-1682), PL45 (CRL-2558), MiaPaCa2 (CRL-1420), SU.86.86 (CRL-1837), CFPAC (CRL-1918), Capan-2 (HTB-80), BxPc-3 (CRL-1687), HPAFII (CRL-1997), Capan-1 (HTB-79), Panc-1 (CRL-1469), Panc05.04 (CRL-2557) and Hs766t (HTB-134) (purchased from the ATCC); 931102 and 931019 are patient derived cell lines provided by Y. Janjigian, MSKCC. Breast cancer cell lines were obtained from ATCC and include MDA-MB-468 (HTB-132), HCC1806 (CRL-2335), MDA-MB-231 (CRM-HTB-26), MDA-MB-415 (HTB-128), MCF-7 (HTB-22), BT-474 (HTB-20), BT-20 (HTB-19), MDA-MB-361 (HTB-27), SK-Br-3 (HTB-30), MDA-MB-453 (HTB-131), T-47D (HTB-133), AU565 (CRL-2351), ZR-75-30 (CRL-1504), ZR-75-1 (CRL-1500). Lymphoma cell lines include: Akata1, Mutu-1 and Rae-1 (provided by W. Tam, WCMC); BCP-1 (CRL-2294), Daudi (CCL-213), EB1 (HTB-60), NAMALWA (CRL-1432), P3HR-1 (HTB-62), SU-DHL-6 (CRL-2959), Farage (CRL-2630), Toledo (CRL-2631) and Pfeiffer (CRL-2632) (obtained from ATCC); HBL-1, MD901 and U2932 (kindly provided by J. Angel Martinez-Climent, Centre for Applied Medical Research, Pamplona, Spain); Karpas422 (ACC-32), RCK8 (ACC-561) and SU-DHL-4 (ACC-495) (obtained from the DSMZ); OCI-LY1, OCI-LY3, OCI-LY4, OCI-LY7 and OCI-LY10 (obtained from the Ontario Cancer Institute); TMD8 (kindly provided by L. M. Staudt, NIH); BC-1 (derived from an AIDS-related primary effusion lymphoma); IBL-1 and IBL-4 (derived from an AIDS-related immunoblastic lymphoma) and BC3 (derived from a non-HIV primary effusion lymphoma). Leukaemia cell lines include: REH (CRL-8286), HL-60 (CCL-240), KASUMI-1 (CRL-2724), KASUMI-4 (CRL-2726), TF-1 (CRL-2003), KG-1 (CCL-246), K562 (CCL-243), TUR (CRL-2367), THP-1 (TIB-202), U937 (CRL-1593.2), MV4-11 (CRL-9591) (obtained from ATCC); KCL-22 (ACC-519), OCI-AML3 (ACC-582) and MOLM-13 (ACC-554) (obtained from DSMZ). The lung cancer cell lines include: NCI-H3122, NCI-H299 (provided by M. Moore, MSKCC); EBC1 (provided by Dr Mellinghoff, MSKCC); PC9 (kindly provided by D. Scheinberg, MSKCC), HCC15 (ACC-496) (DSMZ), HCC827 (CRL-2868), NCI-H2228 (CRL-5935), NCI-H1395 (CRL-5868), NCI-H1975 (CRL-5908), NCI-H1437 (CRL-5872), NCI-H1838 (CRL-5899), NCI-H1373 (CRL-5866), NCI-H526 (CRL-5811), SK-MES-1 (HTB-58), A549 (CCL-185), NCI-H647 (CRL-5834), Calu-6 (HTB-56), NCI-H522 (CRL-5810), NCI-H1299 (CRL-5803), NCI-H1666 (CRL-5885) and NCI-H1703 (CRL-5889) (obtained from ATCC). The gastric cancer cell lines include: MKN74 (obtained from G. Schwarz, Columbia University), SNU-1 (CRL-5971) and NCI-N87 (CRL-5822) (obtained from ATCC), OE19 (ACC-700) (DSMZ). The non-transformed cell lines MRC-5 (CCL-171), human lung fibroblast and HMEC (PCS-600-010), human mammary epithelial cells were obtained from ATCC. NIH-3T3, and NIH-3T3 cell lines stably expressing either mutant MET (Y1248H) or vSRC, were provided by L. Neckers, National Cancer Institute (NCI), USA, and were previously reported29, 30. Patient tissue was obtained with informed consent and authorized through institutional review board (IRB)-approved bio-specimen protocol number 09-121 at Memorial Sloan Kettering Cancer Centre (New York, New York). Specimens were treated for 24 h or 48 h with the indicated concentrations of PU-H71 as previously described31. Following treatment, slices were fixed in 4% formalin solution for 1 h, then stored in 70% ethanol. For tissue analysis, slices were embedded in paraffin, sectioned, slide-mounted, and stained with haematoxylin and eosin (H&E). Apoptosis and necrosis of the tumour cells (as percentage) was assessed by reviewing all the H&E slides of the case (controls and treated ones) in toto, blindly, allowing for better estimation of the overall treatment effect to the tumour. In addition, any effects to precursor lesions (if present) and any off-target effects to benign surrounding tissue, were analysed. Tissue slides were assessed blindly by a breast cancer pathologist who determined the apoptotic events in the tumour, as well as any effect on adjacent normal tissue31. Cryopreserved primary AML samples were obtained with informed consent and Weill Cornell Medical College IRB approval (IRB number 0910010677 and IRB number 0909010629). Samples were thawed and cultured for in vitro treatment as described previously32. The microdose 124I-PU-H71 PET-CT (Dunphy, M. PET imaging of cancer patients using 124I-PUH71: a pilot study available from: http://clinicaltrials.gov; NCT01269593) and phase I PU-H71 therapeutic (Gerecitano, J. The first-in-human phase I trial of PU-H71 in patients with advanced malignancies available from: http://clinicaltrials.gov; NCT01393509) studies were approved by the institutional review board (protocols 10-139 and 11-041, respectively), and conducted under an exploratory investigational new drug (IND) application approved by the US Food and Drug Administration. Patients provided signed informed consent before participation. 124I-PU-H71 tracer was synthesized in-house by the institutional cyclotron core facility at high specific activity. For PU-PET, research PET-CT was performed using an integrated PET-CT scanner (Discovery DSTE, General Electric). CT scans for attenuation correction and anatomic coregistration were performed before tracer injection. Patients received 185 megabecquerel (MBq) of 124I-PU-H71 by peripheral vein over two minutes. PET data were reconstructed using a standard ordered subset expected maximization iterative algorithm. Emission data were corrected for scatter, attenuation, and decay. 124I-PU-H71 scans (PU-PET) were performed at 24 h after tracer administration. Each picture shown in Fig. 4c and Extended Fig. 6a is a scan taken of an individual patient. PET window display intensity scales for FDG and PU-PET fusion PET-CT images are given for both PU-PET and FDG-PET. Numbers in the scale bar indicate upper and lower SUV thresholds that define pixel intensity on PET images. The phase I trial included patients with solid tumours and lymphomas who had undergone prior treatment and currently had no curative treatment options. Patient cohorts were treated with PU-H71 at escalating dose levels determined by a modified continuous reassessment model. Each patient was treated with his or her assigned dose of PU-H71 on day 1, 4, 8, and 11 of each 21-day cycle. Human embryonic stem cells (hESCs) were differentiated with a modified dual-SMAD inhibition protocol towards floor plate-based midbrain dopaminergic (mDA) neurons as described previously33. hESCs were maintained on mouse embryonic fibroblasts and passaged with Dispase (STEMCELL Technologies). For each differentiation, hESCs were harvested with Accutase (Innovative Cell Technology). At day 30 of differentiation, hESC-derived mDA neurons were replated and maintained on dishes precoated with polyornithine (PO; 15 μg ml−1), laminin (1 μg ml−1), and fibronectin (2 μg ml−1) in Neurobasal/B27/l-glutamine-containing medium (NB/B27; Life Technologies) supplemented with 10 μM Y-27632 (until day 32) and with BDNF (brain-derived neurotrophic factor, 20 ng ml−1; R&D), ascorbic acid (AA; 0.2 mM, Sigma), GDNF (glial cell line-derived neurotrophic factor, 20 ng ml−1; R&D), TGFβ3 (transforming growth factor type β3, 1 ng ml−1; R&D), dibutyryl cAMP (0.5 mM; Sigma), and DAPT (10 nM; Tocris). Two days after replating, mDA neurons were treated with 1 μg ml−1 mitomycin C (Tocris) for 1 h to kill any remaining non-post mitotic contaminants. Assays were performed at day 65 of neuron differentiation. The PU-FITC assay was performed as previously described7, 23. Briefly, cells were incubated with 1 μM PU-FITC at 37 °C for 4 h. Then cells were washed twice with FACS buffer (PBS/0.5% FBS), and resuspended in FACS buffer containing 1 μg ml−1 DAPI. HL-60 cells were used as internal control to calculate fold binding for all cell lines tested. The mean fluorescence intensity (MFI) of PU-FITC in treated viable cells (DAPI negative) was evaluated by flow cytometry. For primary AML specimens, cells were also stained with anti-CD45-APC-H7, to identify blasts and lymphocyte populations (BD biosciences). Blasts and lymphocyte populations were gated based on SSC versus CD45. The fold PU-FITC binding of leukaemic blasts (CD45dim) was calculated relative to lymphocytes (CD45hiSSClow). The FITC derivative FITC9 was used as a negative control. Cells were seeded on coverslips in 6-well plate and cultured overnight. Cells were treated with 1 μM PU-FITC or negative control (PU-FITC9, an HSP90 inert PU-H71 derivative labelled with FITC). At 4 h post-treatment, cells were fixed with 4% formaldehyde at room temperature for 30 min, and the coverslips were mounted on slides with DAPI-Fluoromount-G Mounting Media (Southern Biotech). The images were captured using EVOS FL Auto imaging system (ThermoFisher Scientific) or a confocal microscope (Zeiss LSM5). Cells were seeded on coverslips and cultured overnight. Cells were fixed with 4% formaldehyde at room temperature for 30 min, washed three times with PBS, and permeabilized with 0.2% Triton X-100 in blocking buffer (PBS/5% BSA) for 10 min. Cells were incubated in blocking buffer for 30 min, and then incubated with rabbit anti-human HSP90α antibody (1:500, Abcam 2928) and mouse anti-human HSP90β (1:500, Stressmarq H9010), or rabbit and mouse normal IgG, in blocking buffer for 1 h. Cells were washed three times with PBS, and incubated with goat anti-mouse Alexa Fluor 568 and goat anti-rabbit Alexa Fluor 488 (1:1,000, ThermoFisher Scientific) in blocking buffer in the dark for 1 h. Cells were then washed three times with PBS, and the coverslips were removed from the plate, and mounted on slides with DAPI-Fluoromount-G Mounting Media (Southern Biotech). The images were captured using EVOS FL Auto imaging system (ThermoFisher Scientific) or a confocal microscope (Zeiss LSM5). Fluorescence intensity was quantified by the integrated density algorithm as implemented in ImageJ. Assays were carried out in black 96-well microplates (Greiner Microlon Fluotrac 200). A stock of 10 μM PU-FITC (or GM-cy3B34) was prepared in DMSO and diluted with Felts buffer (20 mM Hepes (K), pH 7.3, 50 mM KCl, 2 mM DTT, 5 mM MgCl , 20 mM Na MoO , and 0.01% NP40 with 0.1 mg ml−1 BGG). To each well was added the fluorescent dye-labelled HSP90 ligand (3 nM PU-FITC or 6 nM GM-cy3B), and cell lysates (7.5 μg) in a final volume of 100 μl Felts buffer. For each assay, background wells (buffer only), and tracer controls (PU-FITC only) were included on assay plate. To determine the equilibrium binding of GM-cy3b, increasing amounts of lysate (up to 20 μg of total protein) were incubated with tracer. The assay plate was placed on a shaker at room temperature for 60 min and the FP values in mP were measured every 5 min. At time t = 60 min, dissociation of fluorescent ligand was initiated by adding 1 μM PU-H71 in Felts buffer to each well and then placing the assay plate on a shaker at room temperature and measuring the FP values in mP every 5 min. The assay window was calculated as the difference between the FP value recorded for the bound fluorescent tracer and the FP value recorded for the free fluorescent tracer (defined as mP − mPf). Measurements were performed on a Molecular Devices SpectraMax Paradigm instrument (Molecular Devices, Sunnyvale, CA), and data were imported into SoftMaxPro6 and analysed in GraphPad Prism 5. To identify and separate chaperome complexes in tumours, and to overcome the limitations of classical protein chromatography methods for resolving complexes of similar composition and size, we took advantage of a capillary-based platform that combines isoelectric focusing (IEF) with immunoblotting capabilities35. This methodology uses an immobilized pH gradient to separate native multimeric protein complexes based on their isoelectric point (pI), and allows for subsequent probing of immobilized complexes with specific antibodies. The method uses only minute amounts of sample, thus enabling the interrogation of primary specimens. Cultured cells were lysed in 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl , 0.01% NP40, 20 mM Na MoO buffer, containing protease and phosphatase inhibitors. Primary specimens were lysed in either Bicine-Chaps or RIPA buffers (ProteinSimple). Total protein assay was performed on an automated system, NanoPro 1000 Simple Western (ProteinSimple), for charge-based separation. Briefly, total cell lysates were diluted to a final protein concentration of 250 ng μl−1 using a master mix containing 1× Premix G2 pH 3-10 separation gradient (Protein simple) and 1× isoelectric point standard ladders (ProteinSimple). Samples diluted in this manner maintained their native charge state, and were loaded into capillaries (ProteinSimple) and separated based on their isoelectric points at a constant power of 21,000 μWatts for 40 min. Immobilization was performed by UV-light embedded in the Simple Western system, followed by incubations with anti-HSP90β (SMC-107A, StressMarq Biosciences), anti-HSP90α (ab2928, Abcam), anti-HSP70 (SPA-810, Enzo), AKT (4691), P-AKT (9271) or BCL2 (2872) from Cell Signaling Technology and subsequently with HRP-conjugated anti-Mouse IgG (1030-05, SouthernBiotech) or with HRP-conjugated anti-Rabbit IgG (4010-05, SouthernBiotech). Protein signals were quantitated by chemiluminescence using SuperSignal West Dura Extended Duration Substrate (Thermo Scientific), and digital imaging and associated software (Compass) in the Simple Western system, resulting in a gel-like representation of the chromatogram. This representation is shown for each figure. Protein was extracted from cultured cells in 20 mM Tris pH 7.4, 150 mM NaCl, 1% NP-40 buffer with protease and phosphatase inhibitors added (Complete tablets and PhosSTOP EASYpack, Roche). Ten to fifty μg of total protein was subjected to SDS–PAGE, transferred onto nitrocellulose membrane, and incubated with indicated antibodies. HSP90β (SMC-107) and HSP110 (SPC-195) antibodies were purchased from Stressmarq; HER2 (28-0004) from Zymed; HSP70 (SPA-810), HSC70 (SPA-815), HIP (SPA-766), HOP (SRA-1500), and HSP40 (SPA-400) from Enzo; HSP90β (ab2927), HSP90α (ab2928), p23 (ab2814), GAPDH (ab8245) and AHA1 (ab56721) from Abcam; cleaved PARP (G734A) from Promega; CDC37 (4793), CHIP (2080), EGFR (4267), S6K (2217), phospho-S6K (S235/236) (4858), P-AKT (S473) (9271), AKT (4691), P-ERK (T202/Y204) (4377), ERK (4695), MCL1 (5453), Bcl-XL (2764), BCL2 (2872), c-MYC (5605) and HER3 (4754) from Cell Signaling Technology; and β-actin (A1978) from Sigma-Aldrich. The blots were washed with TBS/0.1% Tween 20 and incubated with appropriate HRP-conjugated secondary antibodies. Chemiluminescent signal was detected with Enhanced Chemiluminescence Detection System (GE Healthcare) following the manufacturer’s instructions. We screened a panel of anti-chaperome antibodies for those that interacted with the target protein in its native form. We reasoned that these antibodies were more likely to capture stable multimeric forms of the chaperome members. These native-cognate antibodies were used in native-PAGE and IEF analyses of chaperome complexes. HSP90β (SMC-107) and HSP110 (SPC-195) antibodies were purchased from Stressmarq; HSP70 (SPA-810), HSC70 (SPA-815), HOP (SRA-1500), and HSP40 (SPA-400) from Enzo; HSP90β (ab2927), HSP90α (ab2928), and AHA1 (ab56721) from Abcam; CDC37 (4793) from Cell Signaling Technology. Cells were lysed in 20 mM Tris pH 7.4, 20 mM KCl, 5 mM MgCl , 0.01% NP40, and 10% glycerol buffer by a freeze-thaw procedure. Primary samples were lysed in either Bicine-Chaps or RIPA buffers (ProteinSimple). Twenty-five to one hundred μg of protein was loaded onto 4–10% native gradient gel and resolved at 4 °C. The gels were immunoblotted as described above following either incubation in Tris-Glycine-SDS running buffer for 15 min before transfer in regular transfer buffer for 1 h, or directly transferred in 0.1% SDS-containing transfer buffer for 1 h. Cells were plated at 1 × 106 per 6 well-plate and transfected with an siRNA against human AHA1 (AHSA1; 5′-TTCAAATTGGTCCACGGATAA-3′), HSP90α (HSP90AA1; no. 1 5′-ATGGCATGACAACTACTTTAA-3′; no. 2 5′-AACCCTGACCATTCCATTATT-3′; no.3 5′-TGCACTGTAAGACGTATGTAA-3′), HSP90β (HSP90AB1; no., 5′-CAAGAATGATAAGGCAGTTAA-3′; no. 5′-TACGTTGCTCACTATTACGTA-3′; no.3 5′-CAGAAGACAAGGAGAATTACA-3′) HSP90α/β (no.1 5′-CAGAATGAAGGAGAACCAGAA-3′, no.2 5′-CACAACGATGATGAACAGTAT-3′), HSP110 (HSPH1; 5′-AGGCCGCTTTGTAGTTCAGAA-3′) from Qiagen or HOP (STIP1) (Dharmacon; M-019802-01), or a negative control (scramble; 5′-CAGGGTATCGACGATTACAAA-3′) with Lipofectamine RNAiMAX reagent (Invitrogen), incubated for 72 h and subjected to further analysis. Total mRNA was isolated using TRIzol Reagent (Invitrogen) following the manufacturer’s recommended protocol. Reverse transcription of mRNA into cDNA was performed using QuantiTect Reverse Transcription Kit (Qiagen). qRT–PCR was performed using PerfeCTa SYBR (Quanta Bioscience), 10 nM AHSA1 (forward: 5′-GCGGCCGCTTCTAGTAGTTT-3′ and reverse: 5′-CATCTCTCTCCGTCCAGTGC-3′) and GAPDH (forward: 5′-CAAAGGCACAGTCAAGGCTGA-3′ and reverse: 5′-TGGTGAAGACGCCAGTAGATT-3′) primers, or 1× QuantiTect Primers for HSP110 (HSPH1), HSP90α (HSP90AA1), HSP90β (HSP90AB1), HSP70 (HSPA1A), HOP (STIP1) (Qiagen) following recommended PCR cycling conditions. Melting curve analysis was performed to ensure product uniformity. To investigate which of the two HSP70 paralogues is involved in epichaperome formation we performed immunodepletions with HSP70 and HSC70 antibodies. Protein lysates were immunoprecipitated consecutively three times with either an HSP70 (Enzo, SPA-810), HSC70 (Enzo, SPA-815) or HOP (kindly provided by M. B. Cox, University of Texas at El Paso), or with the same species normal antibody as a negative control (Santa Cruz). The resulting supernatant was collected and run on a native or a denaturing gel. Tumour lysates were mixed with 10 M urea (dissolved in Felts buffer) to reach the indicated final concentrations of 2 M, 4 M and 6 M. After incubation for 10 min at room temperature or frozen overnight at −80 °C, the lysates were loaded onto 4–10% native gradient gel and resolved at 4 °C or applied to the IEF capillary. The HSP90β bands were detected by using antibody purchased from Stressmarq (SMC-107). A lentiviral vector expressing the MYC shRNA, as previously described36, was requested from Addgene (Plasmid 29435, c-MYC shRNA sequence: GACGAGAACAGTTGAAACA). Viruses were prepared by co-transfecting the shRNA vector, the packaging plasmid psPAX2 and the envelop plasmid pMD2.G into HEK293 cells. OCI-LY1 cells were then infected with lentiviral supernatants in the presence of 4 μg ml−1 polybrene for 24 h. Following flow cytometry selection for positive cells, cells were expanded for further experiments. The MYC protein level was confirmed at 10 days post-infection by western blot using the anti-MYC antibody (Cell Signaling Technology, 5605). Viruses were prepared by co-transfection of the lentiviral vector expressing the MYC shRNA with pLM-mCerulean-2A-cMyc (Addgene, 23244) or pCDH-puro-cMYC (Addgene, 46970), the packaging plasmid psPAX2, and the envelope plasmid pMD2.G into HEK293 cells. ASPC1 cells were then infected with lentiviral supernatants in the presence of 4 μg ml−1 polybrene for 24 h and sorted for mCerulean positive cells or selected with puromycin treatment. Changes in cell size after infection were monitored by analysing the forward scatter (FSC) of intact cells via flow cytometry. MYC protein levels were analysed at 4 days post-infection by western blot. Whole cell extracts were prepared by homogenizing cells in RIPA buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1% NP40, 0.25% sodium deoxycholate, 10% glycerol, protease inhibitors). MYC activity was determined using the TransAM c-Myc Kit (Active Motif, 43396), following the manufacturer’s instructions. Cell viability was assessed using CellTiter-Glo luminescent Cell Viability Assay (Promega) after a 72 h PU-H71 treatment. The method determines the number of viable cells in culture based on quantification of the ATP present, which signals the presence of metabolically active cells, and was performed as previously reported37. For the annexin V staining, cells were labelled with Annexin V-PE and 7AAD after PU-H71 treatment for 48 h, as previously reported38. The necrotic cells were defined as annexin V+/7AAD+, and the early apoptotic cells were defined as annexin V+/7AAD−. For the LDH assay the release of lactate dehydrogenase (LDH) into the culture medium only occurs upon cell death. Following indicated treatment, the culture medium was collected and centrifuged to remove living cells and cell debris. The collected medium was incubated at room temperature for 30 min with the Cytotox-96 Non-radioactive Assay kit (Promega) LDH substrate. All animal studies were conducted in compliance with MSKCC’s Institutional Animal Care and Use Committee (IACUC) guidelines. Female athymic nu/nu mice (NCRNU-M, 20–25 g, 6 weeks old) were obtained from Harlan Laboratories and were allowed to acclimatize at the MSKCC vivarium for 1 week before implanting tumours. Mice were provided with food and water ad libitum. Tumour xenografts were established on the forelimbs for PET imaging and on the flank for efficacy studies. Tumours were initiated by sub-cutaneous injection of 1 × 107 cells for MDA-MB-468 and 5 × 106 for ASPC1 in a 200 μl cell suspension of a 1:1 v/v mixture of PBS with reconstituted basement membrane (BD Matrigel, Collaborative Biomedical Products). Before administration, a solution of PU-H71 was formulated in citrate buffer. Sample size was chosen empirically based on published data39. No statistical methods were used to predetermine sample size. Animals were randomly assigned to groups. Studies were not conducted blinded. Imaging was performed with a dedicated small-animal PET scanner (Focus 120 microPET; Concorde Microsystems, Knoxville, TN). Mice were maintained under 2% isoflurane (Baxter Healthcare, Deerfield, IL) anaesthesia in oxygen at 2 litres per min during the entire scanning period. To reduce the thyroid uptake of free iodide arising from metabolism of tracer, mice received 0.01% potassium iodide solution in their drinking water starting 48 h before tracer administration. For PET imaging, each mouse was administered 9.25 MBq (250 μCi) of 124I-PU-H71 via the tail vein. List-mode data (10 to 30 min acquisitions) were obtained for each animal at various time points post-tracer administration. An energy window of 420–580 keV and a coincidence timing window of 6 ns were used. The resulting list-mode data were sorted into 2-dimensional histograms by Fourier rebinning; transverse images were reconstructed by filtered back projection (FBP). The image data were corrected for non-uniformity of scanner response, dead-time count losses, and physical decay to the time of injection. There was no correction applied for attenuation, scatter, or partial-volume averaging. The measured reconstructed spatial resolution of the Focus 120 is 1.6-mm FWHM at the centre of the field of view. Region of interest (ROI) analysis of the reconstructed images was performed using ASIPro software (Concorde Microsystems, Knoxville, TN), and the maximum pixel value was recorded for each tissue/organ ROI. A system calibration factor (that is, μCi per ml per cps per voxel) that was derived from reconstructed images of a mouse-size water-filled cylinder containing 18F was used to convert the 124I voxel count rates to activity concentrations (after adjustment for the 124I positron branching ratio). The resulting image data were then normalized to the administered activity to parameterize the microPET images in terms of per cent injected dose per gram (%ID per g) (corrected for decay of 124I to the time of injection). Post-reconstruction smoothing was applied only for visual representation of images in the figures. Upon euthanasia, radioactivity (124I) was measured in a gamma-counter (Perkin Elmer 1480 Wizard 3 Auto Gamma counter) using a 400–600 keV energy window. Count data were background- and decay-corrected to the time of injection, and the percent injected dose per gram (%ID per g) for each tumour sample was calculated using a calibration curve to convert counts to radioactivity, followed by normalization to the total activity injected. Mice (n = 5) bearing MDA-MB-468 or ASPC1 tumours reaching a volume of 100–150 mm3 were treated i.p. using PU-H71 (75mg per kg) or vehicle, on a 3 times per week schedule, as indicated. Tumour volume (in mm3) was determined by measurement with Vernier calipers, and was calculated as the product of its length × width2 × 0.5. Tumour volume was expressed on indicated days as the median tumour volume ± s.d. indicated for groups of mice. Mice were euthanized after similar PU-H71 treatment periods, and at a time before tumours reached a size that resulted in discomfort or difficulty in physiological functions of mice in the individual treatment group, in accordance with our IUCAC protocol. Frozen tissue was dried and weighed before homogenization in acetonitrile/H O (3:7). PU-H71 was extracted in methylene chloride, and the organic layer was separated and dried under vacuum. Samples were reconstituted in mobile phase. The concentrations of PU-H71 in tissue or plasma were determined by high-performance LC-MS/MS. PU-H71-d was added as the internal standard40. Compound analysis was performed on the 6410 LC-MS/MS system (Agilent Technologies) in multiple reaction monitoring mode using positive-ion electrospray ionization. For tissue samples, a Zorbax Eclipse XDB-C18 column (2.1 × 50 mm, 3.5 μm) was used for the LC separation, and the analyte was eluted under an isocratic condition (80% H O + 0.1% HCOOH: 20% CH CN) for 3 min at a flow rate of 0.4 ml min−1. For plasma samples, a Zorbax Eclipse XDB-C18 column (4.6 × 50 mm, 5 μm) was used for the LC separation, and the analyte was eluted under a gradient condition (H O + 0.1% HCOOH:CH CN, 95:5 to 70:30) at a flow rate of 0.35 ml min−1. Protein extracts were prepared either in 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl , 1% NP40, and 20 mM Na MoO for PU-H71 beads pull-down, or in 20 mM Tris pH 7.4, 150 mM NaCl, and 1% NP40 for YK beads pull-down. Samples were incubated with the PU-H71 beads (HSP90 bait) for 3–4 h or with the YK beads (HSP70 bait, for chemical precipitation) overnight, at 4 °C, then washed and subjected to SDS–PAGE with subsequent immunoblotting and western blot analysis. For HSP70 proteomic analyses, cells were incubated with a biotinylated YK-derivative, YK-biotin. Briefly, MDA-MB-468 cells were treated for 4 h with 100 μM biotin-YK5 or d-biotin as a negative control. Cells were collected and lysed in 20 mM Tris pH 7.4, 150 mM NaCl, and 1% NP40 buffer. Protein extracts were incubated with streptavidin agarose beads (Thermo Scientific) for 1 h at 4 °C, washed with 20 mM Tris pH 7.4, 150 mM NaCl, and 0.1% NP40 buffer and applied onto SDS–PAGE. The gels were stained with SimplyBlue Coomassie stain (Invitrogen Life Science Technologies). Proteomic analyses were performed using the published protocol7, 18, 22. Control beads contained an inert molecule as previously described7, 18, 22. Affinity-purified protein complexes from type 1 tumours (n = 6; NCI-H1975, MDA-MB-468, OCI-LY1, Daudi, IBL1, BC3), type 2 tumours (n = 3; ASPC1, OCI-LY4, Ramos) and from non-transformed cells (n = 3; MRC5, HMEC and neurons) were resolved using SDS-polyacrylamide gel electrophoresis, followed by staining with colloidal, SimplyBlue Coomassie stain (Invitrogen Life Science Technologies) and excision of the separated protein bands. Control beads that contained an inert molecule were subjected to the same steps as PU-H71 and YK beads and served as a control experiment. To ensure that we captured a majority of the HSP90 complexes in each cell type, we performed these studies under conditions of HSP90-bait saturation. The number of gel sections per lane averaged to be 14. In situ trypsin digestion of gel bound proteins, purification of the generated peptides and LC–MS/MS analysis were performed using our published protocols7, 18, 22. After the acquisition of raw files, Proteowizard (version 3.0.3650)41 was used to create a Mascot Generic Format (mgf) file containing accurate mass for each peak and its corresponding ms2 ions. Each mgf was then subjected to search a human segment of Uniprot protein database (20,273 sequences, European Bioinformatics Institute, Swiss Institute of Bioinformatics and Protein Information Resource) using Mascot (Matrix Science; version 2.5.0; http://www.matrixscience.com). Decoy proteins were added to the search to allow for the calculation of false discovery rates (FDR). The search parameters were as follows: (i) two missed cleavage tryptic sites were allowed; (ii) precursor ion mass tolerance = 10 p.p.m.; (iii) fragment ion mass tolerance = 0.8 Da; and (iv) variable protein modifications were allowed for methionine oxidation, deamidation of asparagine and glutamines, cysteine acrylamide derivatization and protein N-terminal acetylation. MudPit scoring was typically applied using significance threshold score P < 0.01. Decoy database search was always activated and, in general, for merged LS–MS/MS analysis of a gel lane with P < 0.01, false discovery rate averaged around 1%. The Mascot search result was finally imported into Scaffold (Proteome Software, Inc.; version 4_4_1) to further analyse tandem mass spectrometry (MS/MS) based protein and peptide identifications. X! Tandem (The GPM, http://thegpm.org; version CYCLONE (2010.12.01.1) was then performed and its results are merged with those from Mascot. The two search engine results were combined and displayed at 1% FDR. Protein and peptide probability was set at 95% with a minimum peptide requirement of 1. Protein identifications were expressed as Exclusive Spectrum Counts that identified each protein listed. Primary data, such as raw mass spectrometry files, Mascot generic format files and proteomics data files created by Scaffold have been deposited onto the Massive site (https://massive.ucsd.edu/ProteoSAFe/static/massive.jsp; MassIVE Accession ID: MSV000079877). In each of the Scaffold files that validate and import Mascot searched files, peptide matches, scoring information (Mascot, as well as X! Tandem search scores) for peptide and protein identifications, MS/MS spectra, protein views with sequence coverage and more, can be easily accessed. To read the Scaffold files, free viewer software can be found at (http://www.proteomesoftware.com/products/free-viewer/). Peptide matches and scoring information that demonstrate the data processing are available in Supplementary Table 1f–q. The exclusive spectrum count values, an alternative for quantitative proteomic measurements42, were used for protein analyses. CHIP and PP5 were examined and used as internal quality controls among the samples. Statistics were performed using R (version 3.1.3) limma package43, 44. For entries with zero spectral counts, and to enable further analyses, we assigned an arbitrary small number of 0.1. The data were then transformed into logarithmic base 10 for analysis. Linear models were fit to the transformed data and moderated standard errors were calculated using empirical Bayesian methods. For Fig. 1f and Extended Data Fig. 5a, a moderated t-statistic was used to compare protein enrichment between type 1 cells and combined type 2 and non-transformed cells45. For Extended Data Fig. 5b, the t-statistic was performed to compare protein enrichment among type 1 cells, type 2 cells and non-transformed cells (see Supplementary Table 1). Heat maps were created to display the selected proteins using the package “gplots” and “lattice”46, 47. See Supplementary Table 1 in which the table tab ‘a’ corresponds to Fig. 1f and contains core chaperome networks in type 1, type 2 and non-transformed cells; the table tab ‘b’ corresponds to Extended Data Fig. 5a and contains comprehensive chaperome networks in type 1, type 2 and non-transformed cells; the table tab ‘c’ corresponds to Extended Data Fig. 5b and Extended Data Fig. 8b and contains the HSP90 interactome as isolated by the HSP90 bait in type 1, type 2 and non-transformed cells; the table tab ‘d’ corresponds to Extended Data Fig. 8a and contains upstream transcriptional regulators that explain the protein signature of type1 tumours and the table tab ‘e’ contains metastasis-related proteins characteristic of type 1 tumours. To understand the physical and functional protein-interaction properties of the HSP90-interacting chaperome proteins enriched in type 1 tumours, we used the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database48. Proteins displayed in the heat map were uploaded in STRING database to generate the PPI networks. STRING builds functional protein-association networks based on compiled available experimental evidence. The thickness of the edges represents the confidence score of a functional association. The score was calculated based on four criteria: co-expression, experimental and biochemical validation, association in curated databases, and co-mentioning in PubMed abstracts48. Proteins with no adjacent interactions were not shown. The colour scale in nodes indicates the average enrichment of the protein (measured as exclusive spectral counts) in type 1, type 2, and non-transformed cells, respectively. The network layout for type 1 tumours was generated using edge-weighted spring-electric layout in Cytoscape with slight adjustments of marginal nodes for better visualization49. The layout for type 2 and non-transformed cells retains that of type 1 for better comparison. Proteins with average relative abundance values less than 1 were deleted from analyses. The biological processes in which they participate and the functionality of proteins enriched in type 1 tumours were assigned based on gene ontology terms and based on their designated interactome from UniProtKB, STRING, and/or I2D databases48, 50, 51, 52, 53. The Upstream Regulator analytic, as implemented in Ingenuity Pathways Analysis (IPA, QIAGEN Redwood City, http://www.qiagen.com/ingenuity), was used to identify the cascade of upstream transcriptional regulators that can explain the observed protein expression changes in type 1 tumours. The analysis is based on prior knowledge of expected effects between transcriptional regulators and their target genes stored in the Ingenuity Knowledge Base. The analysis examines how many known targets of each transcription regulator are present in the data set, and calculates an overlap P value for upstream regulators based on significant overlap between dataset genes and known targets regulated by a transcription regulator. For Extended Data Fig. 8b, proteins were selected based on 3 pre-curated lists (MYC target genes based on the analysis report from INGENUITY, MYC signature genes based on the reported list provided in ref. 54 and MYC expression/function activators were manually curated from UniProt and GeneCards databases). Cell lines with information available in the cBioPortal for cancer genomics (http://www.cbioportal.org) were evaluated for mutations in pathways implicated in cancer: P53, RAS, RAF, PTEN, PIK3CA, AKT, EGFR, HER2, CDK2NA/B, RB, MYC, STAT1, STAT3, JAK2, MET, PDGFR, KDM6A, KIT. Mutations in major chaperome members (HSP90AA1, HSP90AB1, HSPH1, HSPA8, STIP1, AHSA1) were also evaluated. Data were visualized and statistical analyses performed using GraphPad Prism (version 6; GraphPad Software) or R statistical package. In each group of data, estimate variation was taken into account and is indicated in each figure as s.d. or s.e.m. If a single panel is presented, data are representative of 2 or 3 biological or technical replicates, as indicated. P values for unpaired comparisons between two groups with comparable variance were calculated by two-tailed Student’s t-test. Pearson’s tests were used to identify correlations among variables. Significance for all statistical tests was shown in figures for not significant (NS), *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001. No samples or animals were excluded from analysis, and sample size estimates were not used. Animals were randomly assigned to groups. Studies were not conducted blinded, with the exception of all patient specimen histological analyses.


We studied eight subjects in the United States with previous or recent ZIKV infection (Extended Data Table 2). The studies were approved by the Institutional Review Board of Vanderbilt University Medical Center; samples were obtained after informed consent was obtained by the Vanderbilt Clinical Trials Center. Two subjects (972 and 973) were infected with an African lineage strain in 2008 (one subject while working in Senegal, the second acquired the infection by sexual transmission from the first, as previously reported24). The other six subjects were infected during the current outbreak of an Asian lineage strain, following exposure in Brazil, Mexico or Haiti. Peripheral blood mononuclear cells (PBMCs) from heparinized blood were isolated with Ficoll-Histopaque by density gradient centrifugation. The cells were used immediately or cryopreserved in the vapour phase of liquid nitrogen until use. Ten million PBMCs were cultured in 384-well plates (Nunc) using culture medium (ClonaCell-HY Medium A, StemCell Technologies) supplemented with 8 μg ml−1 of the TLR agonist CpG (phosphorothioate-modified oligodeoxynucleotide ZOEZOEZZZZZOEEZOEZZZT, Invitrogen), 3 μg ml−1 of Chk2 inhibitor (Sigma), 1 μg ml−1 of cyclosporine A (Sigma), and clarified supernatants from cultures of B95.8 cells (ATCC) containing Epstein–Barr virus. After 7 days, cells from each 384-well culture plate were expanded into four 96-well culture plates (Falcon) using ClonaCell-HY Medium A containing 8 μg ml−1 of CpG, 3 μg ml−1 of Chk2 inhibitor, and 107 irradiated heterologous human PBMCs (Nashville Red Cross) and cultured for an additional 4 days. Supernatants were screened in ELISA (described below) for reactivity with various ZIKV E proteins, which are described below. The minimal frequency of ZIKV E-reactive B cells was estimated based on the number of wells with E protein-reactive supernatants compared with the total number of lymphoblastoid cell line colonies in the transformation plates (calculation: E-reactive B-cell frequency = (number of wells with E-reactive supernatants) divided by (number of LCL colonies in the plate) × 100). The ectodomains of ZIKV E (H/PF/2013; GenBank Accession KJ776791) and the fusion-loop mutant E-FLM (containing four mutations: T76A, Q77G, W101R, L107R) were expressed transiently in Expi293F cells and purified as described previously7. ZIKV DIII (residues 299–407 of strain H/PF/2013), WNV DIII (residues 296–405 of strain New York 1999) and DENV-2 DIII (residues 299-410 of strain 16681) were expressed in BL21 (DE3) as inclusion bodies and refolded in vitro25. Briefly, inclusion bodies were denatured and refolded by gradual dilution into a refolding buffer (400 mM l-arginine, 100 mM Tris (pH 8.3), 2 mM EDTA, 5 and 0.5 mM reduced and oxidized glutathione) at 4 °C. Refolded proteins were purified by size-exclusion chromatography using a Superdex 75, 16/60 (GE Healthcare). Cells from wells with transformed B cells containing supernatants that exhibited reactivity to ZIKV E protein were fused with HMMA2.5 myeloma cells (gift from L. Cavacini) using an established electrofusion technique26. After fusion, hybridomas were suspended in a selection medium containing 100 μM hypoxanthine, 0.4 μM aminopterin, 16 μM thymidine (HAT Media Supplement, Sigma), and 7 μg ml−1 ouabain (Sigma) and cultured in 384-well plates for 18 days before screening hybridomas for antibody production by ELISA. After fusion with HMMA2.5 myeloma cells, hybridomas producing ZIKV E-specific antibodies were cloned biologically by single-cell fluorescence-activated cell sorting. Hybridomas were expanded in post-fusion medium (ClonaCell-HY Medium E, STEMCELL Technologies) until 50% confluent in 75-cm2 flasks (Corning). For antibody production, cells from one 75-cm2 flask were collected with a cell scraper and expanded to four 225-cm2 flasks (Corning) in serum-free medium (Hybridoma-SFM, Life Technologies). After 21 days, supernatants were clarified by centrifugation and filtered using 0.45-μm pore size filter devices. HiTrap Protein G or HiTrap MabSelectSure columns (GE Healthcare Life Sciences) were used to purify antibodies from filtered supernatants. Total cellular RNA was extracted from pelleted cells from hybridoma clones, and an RT–PCR reaction was performed using mixtures of primers designed to amplify all heavy-chain or light-chain antibody variable regions27. The generated PCR products were purified using AMPure XP magnetic beads (Beckman Coulter) and sequenced directly using an ABI3700 automated DNA sequencer. The variable region sequences of the heavy and light chains were analysed using the IMGT/V-Quest program28, 29. Wells of microtitre plates were coated with purified, recombinant ectodomain of ZIKV E, DIII, DIII-LR mutants (DIII containing A310E and T335K mutations) or DIII of related flaviviruses DENV-2 or WNV and incubated at 4 °C overnight. In ELISA studies with purified mAbs, we used recombinant ZIKV E protein ectodomain with His tag produced in Sf9 insect cells (Meridian Life Sciences R01635). Plates were blocked with 5% skimmed milk in PBS-T for 1 h. B-cell culture supernatants or purified antibodies were added to the wells and incubated for 1 h at ambient temperature. The bound antibodies were detected using goat anti-human IgG (γ-specific) conjugated with alkaline phosphatase (Southern Biotech) and pNPP disodium salt hexahydrate substrate (Sigma). In ELISAs that assessed binding of mAbs to DIII and DIII LR mutants, we used previously described murine mAbs ZV-2 and ZV-54 (ref. 7) as controls. A goat anti-mouse IgG conjugated with alkaline phosphatase (Southern Biotech) was used for detection of these antibodies. Colour development was monitored at 405 nm in a spectrophotometer (Biotek). For determining EC , microtitre plates were coated with ZIKV E or E-FLM that eliminated interaction of fusion-loop specific antibodies. Purified antibodies were diluted serially and applied to the plates. Bound antibodies were detected as above. A nonlinear regression analysis was performed on the resulting curves using Prism (GraphPad) to calculate EC values. Fetal head and placental tissues were collected at E13.5 from groups treated with ZIKV-117 or PBS (as a negative control), homogenized in PBS (250 μl) and stored at −20 °C. ELISA plates were coated with ZIKV E protein, and thawed, clarified tissue homogenates were applied undiluted in triplicate. Bound antibodies were detected using goat anti-human IgG (Fc-specific) antibody conjugated with alkaline phosphatase. The quantity of antibody was determined by comparison with a standard curve constructed using purified ZIKV-117 in a dilution series. His -tagged ZIKV E protein was immobilized on anti-His coated biosensor tips (Pall) for 2 min on an Octet Red biosensor instrument. After measuring the baseline signal in kinetics buffer (PBS, 0.01% BSA, and 0.002% Tween 20) for 1 min, biosensor tips were immersed into the wells containing first antibody at a concentration of 10 μg ml−1 for 7 min. Biosensors then were immersed into wells containing a second mAb at a concentration of 10 μg ml−1 for 7 min. The signal obtained for binding of the second antibody in the presence of the first antibody was expressed as a percentage of the uncompeted binding of the second antibody that was derived independently. The antibodies were considered competing if the presence of first antibody reduced the signal of the second antibody to less than 30% of its maximal binding and non-competing if the signal was greater than 70%. A level of 30–70% was considered intermediate competition. Epitope mapping was performed by shotgun mutagenesis essentially as described previously6. A ZIKV prM/E protein expression construct (based on ZIKV strain SPH2015) was subjected to high-throughput alanine scanning mutagenesis to generate a comprehensive mutation library. Each residue within prM/E was changed to alanine, with alanine codons mutated to serine. In total, 672 ZIKV prM/E mutants were generated (100% coverage), sequence confirmed, and arrayed into 384-well plates. Each ZIKV prM/E mutant was transfected into HEK-293T cells and allowed to express for 22 h. Cells were fixed in 4% (v/v) paraformaldehyde (Electron Microscopy Sciences), and permeabilized with 0.1% (w/v) saponin (Sigma-Aldrich) in PBS plus calcium and magnesium (PBS++). Cells were incubated with purified mAbs diluted in PBS++, 10% normal goat serum (Sigma), and 0.1% saponin. Primary antibody screening concentrations were determined using an independent immunofluorescence titration curve against wild-type ZIKV prM/E to ensure that signals were within the linear range of detection. Antibodies were detected using 3.75 μg ml−1 of AlexaFluor488-conjugated secondary antibody (Jackson ImmunoResearch Laboratories) in 10% NGS/0.1% saponin. Cells were washed three times with PBS++/0.1% saponin followed by two washes in PBS. Mean cellular fluorescence was detected using a high-throughput flow cytometer (HTFC, Intellicyt). Antibody reactivity against each mutant prM/E clone was calculated relative to wild-type prM/E protein reactivity by subtracting the signal from mock-transfected controls and normalizing to the signal from wild-type prM/E-transfected controls. Mutations within clones were identified as critical to the mAb epitope if they did not support reactivity of the test MAb, but supported reactivity of other ZIKV antibodies. This counter-screen strategy facilitates the exclusion of prM/E mutants that are locally misfolded or have an expression defect. This study was carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (Assurance number A3381-01). Inoculations were performed under anaesthesia induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. ZIKV strain H/PF/2013 (French Polynesia, 2013) was obtained from X. de Lamballerie (Aix Marseille Université). ZIKV Brazil Paraiba 2015 was provided by S. Whitehead (Bethesda) and originally obtained from P. F. C. Vasconcelos (Instituto Evandro Cargas). ZIKV MR 766 (Uganda, 1947), Malaysia P6740 (1966), and Dakar 41519 (Senegal, 1982) were provided by the World Reference Center or Emerging Viruses and Arboviruses (R. Tesh, University of Texas Medical Branch). Nicaraguan DENV strains (DENV-1 1254-4, DENV-2 172-08, DENV-3 N2845-09, and DENV-4 N703-99) were provided generously by E. Harris (University of California, Berkeley). Virus stocks were propagated in C6/36 Aedes albopictus cells (DENV) or Vero cells (ZIKV). ZIKV Dakar 41519 (ZIKV-Dakar) was passaged twice in vivo in Rag1−/− mice (M. Gorman and M. Diamond, unpublished data) to create a mouse-adapted strain. Virus stocks were titrated by focus-forming assay (FFA) on Vero cells. All cell lines were checked regularly for mycoplasma contamination and were negative. Cell lines were authenticated at acquisition with short tandem repeat method profiling; Vero cells, though commonly misidentified in the field, were used as they are the standard cell line for flavivirus titration. Serial dilutions of mAbs were incubated with 102 FFU of different ZIKV strains (MR 766, Dakar 41519, Malaysia P6740, H/PF/2013, or Brazil Paraiba 2015) for 1 h at 37 °C. The mAb–virus complexes were added to Vero cell monolayers in 96-well plates for 90 min at 37 °C. Subsequently, cells were overlaid with 1% (w/v) methylcellulose in MEM supplemented with 4% heat-inactivated FBS. Plates were fixed 40 h later with 1% PFA in PBS for 1 h at room temperature. The plates were incubated sequentially with 500 ng ml−1 mouse anti-ZIKV (ZV-16, E.F. and M.S.D., unpublished data) and horseradish-peroxidase-conjugated goat anti-mouse IgG in PBS supplemented with 0.1% (w/v) saponin (Sigma) and 0.1% BSA. ZIKV-infected cell foci were visualized using TrueBlue peroxidase substrate (KPL) and quantitated on an ImmunoSpot 5.0.37 macroanalyzer (Cellular Technologies). C6/36 Aedes albopictus cells were inoculated with a MOI 0.01 of ZIKV (H/PF/2013) or different DENV serotypes (Nicaraguan strains DENV-1 1254-4, DENV-2 172-08, DENV-3 N2845-09, DENV-4 N703-99). At 120 h post infection, cells were fixed with 4% PFA diluted in PBS for 20 min at room temperature and permeabilized with HBSS supplemented with 10 mM HEPES, 0.1% saponin and 0.025% NaN for 10 min at room temperature. 50,000 cells were transferred to U-bottom plates and incubated for 30 min at 4 °C with 5 μg ml−1 of anti-ZIKV human mAbs or negative (hCHK-152)12, or positive (hE60)30 isotype controls. After washing, cells were incubated with Alexa-Fluor-647-conjugated goat anti-human IgG (Invitrogen) at 1:500, fixed in 1% PFA in PBS, processed on MACSQuant Analyzed (Miltenyi Biotec), and analysed using FlowJo software (Tree Star). Total RNA was extracted from hybridoma cells and genes encoding the VH and VL domains were amplified in RT–PCR using IgExp primers31. The PCR products were directly cloned into antibody expression vectors containing the constant domains of wild-type γ1 chain, LALA mutant (leucine (L) to alanine (A) substitution at positions 234 and 235) γ1 chain for the VH domains, and wild-type κ chain for the VL domain in an isothermal amplification reaction (Gibson reaction)32. Plasmids encoding the heavy and light chain were transfected into 293F cells and full-length recombinant IgG was secreted into transfected cell supernatants. Supernatants were collected and IgG purified using Protein G chromatography and eluted into PBS. The functional abrogation of the binding of the LALA variant IgG was confirmed in an ELISA binding assay with recombinant human FcγRI. The binding of wild-type ZIKV-117 or LALA antibody to FcγRI was evaluated, in comparison with the binding pattern of control antibodies (human mAb CKV063 (ref. 33) LALA mutated IgG). C57BL/6 male mice (4–5-week-old, Jackson Laboratories) were inoculated with 103 FFU of mouse-adapted ZIKV-Dakar by subcutaneous route in the footpad. One-day before infection, mice were treated with 2 mg anti-Ifnar1 mAb (MAR1-5A3, Leinco Technologies) by intraperitoneal injection. ZIKV-specific human mAb (ZIKV-117) or an isotype control (hCHK-152) was administered as a single dose at day +1 (100 μg) or day +5 (250 μg) after infection through an intraperitoneal route. Animals were monitored for 21 days. Wild-type C57BL/6 mice were bred in a specific pathogen-free facility at Washington University School of Medicine. (1) Ifnar1−/− dams, prophylaxis studies: Ifnar1−/− female and wild-type male mice were mated; at E5.5, dams were treated with a single 250 μg dose of ZIKV mAb or isotype control by intraperitoneal injection. At E6.5, mice were inoculated with 103 FFU of ZIKV Brazil Paraiba 2015 by subcutaneous injection in the footpad. (2) Wild-type dams, prophylaxis studies: wild-type female and male mice were mated; at embryonic days E5.5, dams were treated with a single 250 μg dose of ZIKV mAb or isotype control by intraperitoneal injection as well as a 1 mg injection of anti-Ifnar1 (MAR1-5A3). At E6.5, mice were inoculated with 103 FFU of mouse-adapted ZIKV-Dakar by subcutaneous injection in the footpad. At E7.5, dams received a second 1 mg dose of anti-Ifnar1 through an intraperitoneal route. (3) Wild-type dams, therapy studies: wild-type female and male mice were mated; at embryonic days E5.5, dams were treated with a 1 mg injection of anti-Ifnar1 (MAR1-5A3). At E6.5, mice were inoculated with mouse-adapted 103 FFU of ZIKV-Dakar by subcutaneous injection in the footpad. At E7.5, dams received a second 1 mg dose of anti-Ifnar1 as well as a single 250 μg dose of ZIKV mAb or isotype control through an intraperitoneal route. All animals were euthanized at E13.5, and placentas, fetuses and maternal tissues were collected. Fetus size was measured as the crown-rump length × occipitofrontal diameter of the head. ZIKV-infected tissues were weighed and homogenized with stainless steel beads in a Bullet Blender instrument (Next Advance) in 200 μl of PBS. Samples were clarified by centrifugation (2,000g for 10 min). All homogenized tissues from infected animals were stored at −20 °C. Tissue samples and serum from ZIKV-infected mice were extracted with RNeasy 96 Kit (tissues) or Viral RNA Mini Kit (serum) (Qiagen). ZIKV RNA levels were determined by TaqMan one-step quantitative reverse transcriptase PCR (qRT–PCR) on an ABI7500 Fast Instrument using published primers and conditions34. Viral burden was expressed on a log scale as viral RNA equivalents per g or ml after comparison with a standard curve produced using serial tenfold dilutions of ZIKV RNA. RNA in situ hybridization was performed with RNAscope 2.5 (Advanced Cell Diagnostics) according to the manufacturer’s instructions. PFA-fixed paraffin embedded placental sections were deparaffinized by incubation for 60 min at 60 °C. Endogenous peroxidases were quenched with H O for 10 min at room temperature. Slides were boiled for 15 min in RNAscope Target Retrieval Reagents and incubated for 30 min in RNAscope Protease Plus before probe hybridization. The probe targeting ZIKV RNA was designed and synthesized by Advanced Cell Diagnostics (catalogue number 467771). Negative (targeting bacterial gene dapB) control probes were also obtained from Advanced Cell Diagnostics (catalogue number 310043). Tissues were counterstained with Gill’s haematoxylin and visualized with standard bright-field microscopy. Collected placentas were fixed in 10% neutral buffered formalin at room temperature and embedded in paraffin. At least three placentas from different litters with the indicated treatments were sectioned and stained with haematoxylin and eosin to assess morphology. Surface area and thickness of placenta and different layers were measured using Image J software. For immunofluorescence staining on mouse placentas, deparaffinized tissues were blocked in blocking buffer (1% BSA, 0.3% Triton, PBS) for 2 h and incubated with anti-vimentin antibody (1:500, rabbit, Abcam ab92547). Secondary antibody conjugated with Alexa 488 (1:500 in PBS) was applied for 1 h at room temperature. Samples were counterstained with DAPI (4′6′-diamidino-2-phenilindole, 1:1,000 dilution). All virological data were analysed with GraphPad Prism software. Kaplan–Meier survival curves were analysed by the log rank test, and viraemia was compared using an ANOVA with a multiple comparisons test. P < 0.05 indicated statistically significant differences. All relevant data are included with the manuscript; source data for each of the main text figures is provided.


Short B.,STEMCELL Technologies | Wagey R.,STEMCELL Technologies
Methods in Molecular Biology | Year: 2013

The bone marrow (BM) of numerous species, including rodents and man, contains a rare population of cells termed marrow stromal cells or mesenchymal stem cells (MSC). Given the ability of these cells to differentiate into cells of the osteogenic, chondrogenic and adipogenic lineages, there is considerable interest in utilizing MSCs in a broad repertoire of cell-based therapies for the treatment of human disease. Before such potential therapies can be realized, a preclinical animal model in which to test and refine strategies utilizing MSC is required. Here we describe methods for the isolation of a highly enriched population of MSC from mouse cortical/compact bone (CB), quantitation using the colony forming unit-fibroblast assay (CFU-F) and in vitro expansion. These cells are both multipotent and capable of extensive in vitro expansion and thus represent an ideal cellular source to explore both the biological properties of MSC as well as their potential efficacy in a variety of cellular therapies. © 2013 Springer Science+Business Media, LLC.


Moody J.,STEMCELL Technologies
Methods in Molecular Biology | Year: 2013

The continued success of pluripotent stem cell research is ultimately dependent on access to reliable and defined reagents for the consistent culture and cryopreservation of undifferentiated, pluripotent cells. The development of defined and feeder-independent culture media has provided a platform for greater reproducibility and standardization in this field. Here we provide detailed protocols for the use of mTeSR™1 and TeSR™2 with various cell culture matrices as well as defined cryopreservation protocols for human embryonic and human induced pluripotent stem cells. © 2013 Springer Science+Business Media, LLC.


VANCOUVER, British Columbia--(BUSINESS WIRE)--STEMCELL Technologies Inc. has signed an exclusive license agreement with Cincinnati Children’s Hospital Medical Center to commercialize its fundamental technology for generating gastrointestinal organoids from pluripotent stem cells (PSCs). This agreement grants STEMCELL a license to novel methods for generating organoid models and to develop cell culture media and tools that would enable scientists to create organoids from PSCs in their own laboratories. Organoids are three-dimensional structures, or small clusters of cells representing ‘mini-organs’, which are grown in a dish. Organoids more closely mimic the complex structure and physiology of whole organs than standard two-dimensional cell culture models. Generating organoids from PSCs allows for an inexhaustible source of tissue, and opens this field to researchers who may not have access to primary tissues from patient biopsies or other sources. The technology licensed from Cincinnati Children’s describes methods for generating gastrointestinal organoids, including intestinal and stomach, from human PSCs. These discoveries were developed in the laboratory of Dr. James Wells, Director of the Pluripotent Stem Cell Center at Cincinnati Children’s, and are further described in a series of Nature publications (J.R. Spence et al. 2011 and K.W. McCracken et al. 2014). Commenting on the agreement, Dr. Wells said, “There is a tremendous opportunity to use these new organoid models for advancing studies in human development, as well as for applying them in many powerful applications such as disease modeling, drug screening, and for developing therapeutics. I am pleased to partner with STEMCELL given their outstanding reputation for bringing quality research tools to the market.” STEMCELL has previously announced key partnerships with pioneering leaders in the organoid research field. Recently, the company signed an exclusive license with the Hubrecht Organoid Technology Foundation (The HUB) for patented tissue-derived organoid technology generated from the laboratory of Dr. Hans Clevers. Additionally, STEMCELL has exclusively partnered with the Institute of Molecular Biotechnology (IMBA) of the Austrian Academy of Sciences to develop cerebral organoids, or ‘mini-brains’, as described by Drs. Jürgen Knoblich and Madeline Lancaster. Dr. Allen Eaves, President and CEO of STEMCELL, commented that “This license with Cincinnati Children’s will enable STEMCELL Technologies to further expand upon our growing portfolio of products supporting organoid studies, including the recently released IntestiCult™ Organoid Growth Medium. STEMCELL Technologies is pleased to be the leading organoid company. We are developing world-class organoid expertise, which we will leverage to deliver important, cutting edge research tools to the scientific community.” As Scientists Helping Scientists, STEMCELL Technologies Inc. is committed to providing high-quality cell culture media, cell isolation products and accessory reagents for life science research. Driven by science and a passion for quality, STEMCELL provides over 2500 products to more than 90 countries worldwide. STEMCELL’s specialty cell culture reagents, instruments and tools are designed to support science along the basic to translational research continuum. To learn more, visit http://www.stemcell.com.


Sarasota, FL, Dec. 22, 2016 (GLOBE NEWSWIRE) -- Zion Market Research has published a new report titled “Cell Separation Technologies Market by Technology (Gradient Centrifugation and Separation Based on Surface Markers) for Stem Cell Research, Immunology, Neuroscience and Cancer Research: Global Industry Perspective, Comprehensive Analysis and Forecast, 2015 – 2021”. According to the report, the global cell separation technologies market was valued at around USD 2.23 billion in 2015 and is expected to reach approximately USD 3.82 billion by 2021, growing at a CAGR of around 9.5% between 2016 and 2021. Cell separation is an essential tool, which is broadly used in many strands of biomedical and biological research and in clinical therapy. Cell separation tool are used to separate specific cells from the heterogeneous cell mixture. Cell separation reagent allows the isolation of any cell from any species. Browse through 27 Market Tables and 17 Figures spread over 110 Pages and in-depth TOC on “Global Cell Separation Technologies Market: Type, Technology, Application, Size, Share, Analysis, Segment and Forecast 2015-2021”. The cell separation technologies market is expected to witness significant growth in the years to come. The market is mainly driven by growing aging population coupled with increasing incidences of chronic diseases such as cancer. Furthermore, increasing government support and strong growth in research & development activities targeting cell therapies is anticipated to fuel the cell separation technologies market growth in the coming years. However, the high cost of cell separation tools is expected to pose a threat to the market growth within the forecast period. Nonetheless, the noteworthy technological advancements over the decade and their adoption in the healthcare sector are expected to act as new growth opportunity during the forecast period. Based on technology, cell separation market can be segmented into technology such as separation based on surface markers and gradient centrifugation. Separation based on surface marker technology is also bifurcated into Fluorescence Activated Cell Sorting (FACS) and Magnetic Activated Cell Sorting (MACS).  In 2015, magnetic activated cell sorting was the leading segment due to the accuracy level and faster results provided. Browse the full "Cell Separation Technologies Market by Technology (Gradient Centrifugation and Separation Based on Surface Markers) for Stem Cell Research, Immunology, Neuroscience and Cancer Research: Global Industry Perspective, Comprehensive Analysis and Forecast, 2015 – 2021" report at https://www.zionmarketresearch.com/report/cell-separation-technologies-market Some of the key technologies such as gradient centrifugation techniques and FACS, chromatography sieving, panning, and lab on a chip are currently under development. The global cell separation technologies market is segmented on the basis of application such as immunology, stem cell research, cancer research and neuroscience research. The stem cell research segment accounted for the largest share in 2015. Rising demand for cell therapies and higher potential of stem cells have increased research and development activities within the stem cell research segment. Cancer research was another leading segment and is expected to propel the market growth in the years to come. This growth is mainly due increasing incidences of cancer and other cell-based diseases worldwide. In terms of revenue, North America accounted for largest share of the global cell separation technologies market and is set to dominate the world marketplace within the forecast period. This growth is mainly due to the increasing demand for treatment from the aging population. Moreover, increasing investments in the healthcare industry and growing R&D initiatives is further expected to boost the market growth in the near future in this region. North America cell separation technologies market was led by the U.S. as a result of increasing technological advancement in this region. Inquire more about this report @ https://www.zionmarketresearch.com/inquiry/cell-separation-technologies-market In terms of revenue, North America closely followed by Europe in 2015. Europe is expected to exhibit witness significant growth in the years to come. The growth is mainly due to increase concern regarding health among people. Moreover, technological advancement and improvement in health care infrastructure expected to boost the market growth in the years to come. Asia Pacific cell separation technologies market is projected to be the fastest growing regional market within the forecast period. Furthermore, cell separation technologies market has the huge opportunity in the emerging markets of Asia Pacific due to the escalating aging population, increasing health awareness about cell separation technologies treatment and increasing investment in the healthcare sector especially in China and India. The Middle East & Africa is expected to experience significant growth in the years to come. This growth is attributed to the increasing healthcare awareness coupled with advancement in technology. Latin America is another key regional market and is expected to experience significant growth over the forecast period. The growth is mainly due to the increasing demand for cell separation technologies treatment coupled with technological advancement. Thus, all aforementioned parameters are expected to drive the market growth in this region. Some of the key players in cell separation technologies market include EMD Millipore, Mitenyi Biotec GmbH, BD Bioscience, and STEMCELL Technologies, Terumo BCT, pluriSelect GmbH, and Thermo Fisher Scientific, Inc. This report segments the global cell separation technologies market as follows: Global Cell Separation Technologies Market: Technology Segment Analysis Zion Market Research is an obligated company. We create futuristic, cutting edge, informative reports ranging from industry reports, the company reports to country reports. We provide our clients not only with market statistics unveiled by avowed private publishers and public organizations but also with vogue and newest industry reports along with pre-eminent and niche company profiles. Our database of market research reports comprises a wide variety of reports from cardinal industries. Our database is been updated constantly in order to fulfill our clients with prompt and direct online access to our database. Keeping in mind the client’s needs, we have included expert insights on global industries, products, and market trends in this database. Last but not the least, we make it our duty to ensure the success of clients connected to us—after all—if you do well, a little of the light shines on us.

Loading STEMCELL Technologies collaborators
Loading STEMCELL Technologies collaborators