Sino Us Center For Grazingland Ecosystem Sustainability

Lanzhou, China

Sino Us Center For Grazingland Ecosystem Sustainability

Lanzhou, China
SEARCH FILTERS
Time filter
Source Type

Yang C.-D.,Gansu Agricultural University | Yang C.-D.,Pratacultural Engineering Laboratory of Gansu Province | Yang C.-D.,Sino Us Center For Grazingland Ecosystem Sustainability | Yao Y.-L.,Gansu Agricultural University | And 8 more authors.
Plant Disease | Year: 2016

A leaf blight disease of Poa pratensis was observed at Gansu Province, China, in July 2013. Initially, symptoms appeared on the tips and margin of the upper leaves of the grass, and then enlarged rapidly to produce yellow lesions that covered large areas of the leaf. In moist weather, gray moldy growth was present on the lesions. Numerous pycnidia were often observed within the diseased tissue. Six symptomatic leaves from six plants were collected and the diseased tissues were surface sterilized with 75% alcohol for 2 min, and then directly transferred to potato dextrose agar (PDA) medium. Ten fungal isolates (named HZ-1 to HZ-10) that varied in culture characteristic were obtained from the diseased samples. The pathogenicities of all 10 isolates were evaluated. For each isolate, five tubs of P. pratensis (approximately 50 P. pratensis plants per tub) were sprayed with a conidial suspension (106 cfu/ml) of the isolate. Control P. pratensis plants were sprayed with sterile water. The inoculated plants were kept in an incubator at 25°C for 48 h with relative humidity of 100%. Assays were repeated three times. Typical symptoms of the leaf blight disease were observed approximately 14 days after inoculation with the strain HZ-2. No symptoms were observed on the control plants and plants inoculated with the nine other isolates. Pycnidia of HZ-2 were recovered from the lesions of inoculated plants after 4 weeks and placed on PDA medium. The HZ-2 colonies were white initially, and then became olive green to dark brown. Concentric lines were visible on the back of medium. The mycelium was septate, and hyaline or light brown. Conidia were long, ellipsoid, single-celled, and hyaline with guttules on both sides. The size of the conidia ranged from 4.2 × 1.8 µm to 7.7 × 4.8 µm (avg. 5.8 × 3.4 µm). Pycnidia were globose, ovoid or oblong, with an orifice, and ranged from 48.3 × 193.1 µm to 38.5 × 139.6 µm (avg. 106.0 × 86.4 µm). The fungus shared morphological characteristics of Peyronellaea glomerata as described by Janke (1956) and Boerema et al. (1965, 1977). Genomic DNA was extracted with SK8259 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 543-bp amplicon (GenBank Accession No. KT387236) was 99% identical to the ITS sequence from P. glomerata available from GenBank (AB470828). To our knowledge, this was the first report of P. glomerata causing leaf blight on P. pratensis in China. Since green space areas are increasing in China and P. glomerata is the predominant species of lawn planted, leaf blight caused by P. glomerata threatens the aesthetics of this green space. © 2016, American Phytopathological Society. All rights reserved.


Zhou W.-H.,Gansu Agricultural University | Zhou W.-H.,Ministry of Education Key Laboratory of Ecosystem Gansu Province Laboratory of Pratacultural Engineering | Zhou W.-H.,Sino Us Center For Grazingland Ecosystem Sustainability | Shi S.-L.,Gansu Agricultural University | And 5 more authors.
Chinese Journal of Applied Ecology | Year: 2012

In order to explore the regulation approaches for improving the salt-tolerance of alfalfa, the seedlings of Medicago sativa L. cv. Gannong No. 4 were taken to study their growth and nitrogen metabolism under salt stress as affected by NO-donor SNP, NO-scavenger c-PTIO, and sodium ferrocyanide (a SNP analogue with NO not released). Exogenous NO could obviously alleviate the inhibition effects of salt stress on the seedling growth and photosynthesis via increasing plant dry matter and leaf chlorophyll content, net photosynthesis rate, transpiration rate, and soluble protein content. Exogenous NO enhanced the activities of leaf nitrate reductase, glutamine synthetase, and glutamate-oxoglutarate aminotransferase, restrained the activities of protease and glutamate dehydrogenase, decreased the free amino acid content, and improved the nitrate content and ammonium assimilation under salt stress. Applying sodium ferrocyanide did not show any alleviation effect on the seedling growth and nitrogen metabolism under salt stress. As a NO-scavenger, c-PTIO inhibited the growth and nitrogen metabolism under salt stress, but the inhibition effect could be mitigated by supplementing SNP. It was suggested that exogenous and endogenous NO were involved in the regulation of alfalfa nitrogen metabolism under salt stress.


Kou J.T.,Gansu Agricultural University | Kou J.T.,Sino Us Center For Grazingland Ecosystem Sustainability | Shi S.L.,Gansu Agricultural University | Shi S.L.,Sino Us Center For Grazingland Ecosystem Sustainability | And 4 more authors.
Shengtai Xuebao/ Acta Ecologica Sinica | Year: 2014

Plant photosynthetic capability usually changes after damage by a herbivorous pest. Photosynthetic compensation is the physiological response of the plant to pest damage with the level of compensation varying with the change in pest damage. This paper explores the photosynthetic response mechanism of alfalfa to the dominant insect-Odontothrips loti -and explains the compensatory mechanism of alfalfa to thrip damage. The thrip resistant clone, R-1 and susceptible clone, I-1 were used to investigate the gas exchange and chlorophyll fluorescence parameter changes under different insect densities (0, 1, 3, 5, and 7 per branch, respectively), Photosynthesis equipment, GFS-3000 (Walz, Germany) and modulated chlorophyll fluorometer imaging-PAM (Walz, Germany) were used. For the 7 per branch treatment, the results indicate that the chlorophyll content of R-1 initially increased and then decreased, while the chlorophyll content of I-1 decreased. For R-1, the chlorophyll content was 11.32% lower than CK (0 thrip per branch), and for the 3, 5, and 7 per branch treatments of I-1, the chlorophyll contents were 14.05%, 22.02% and 26.27% lower than CK, respectively. For both R-1 and I-1, the net photosynthetic rate (Pn) and water use efficiency (WUE) decreased, while the intracellular concentration of CO2(Ci), stomatal conductance (Gs) and transpiration rate (Tr) increased. For R-1, the Pn of 3, 5, and 7 per branch treatments were 6.98%, 19.03% and 20.11% lower than CK, and the WUE of all the treatments were 16.32%, 23.95%, 37.12% and 45.89% lower than CK. For I-1 treatments, the Pn of all the treatments were 5.38%, 8.77%, 22.47% and 35.66% lower than CK, and the WUE were 25.23%, 31.05%, 45.78% and 61.81% lower than CK, respectively. The chlorophyll content, WUE and Pn of R-1 were all greater than I-1 under the same insect density. As insect density increased, the initial fluorescence (F0) increased, which for the R-1 clone resulted in F0 for 5 and 7 per branch treatments of 6.99% and 9.13% higher than CK, respectively. For the I-1 clone, all the treatments were 2.81%, 6.45%, 12.36% and 14.93% higher than CK, respectively. The actual photosynthetic efficiency (ΦPSII) of PSII, non-photochemical quenching coefficient (NPQ), photochemical quenching coefficient (qP), potential activity (Fv/ F0) of PSIIand original light transformation efficiency (ΦPSII) of PSIIdecreased for both R-1 and I-1. Among which the Fv/ F0of 3, 5 and 7 per branch treatments for the R-1 clone were 5.07%, 16.74% and 21.19% lower than CK and the Fv/ Fmof 5 and 7 per branch treatments were 3.50% and 4.63% lower than CK, respectively. For the I-1 clone, Fv/ F0of all the treatments were 8.24%, 13.68%, 22.88% and 28.04% lower than CK, and the Fv/ Fmwere 1.67%, 2.91%, 5.31% and 6.86% lower than CK, respectively. Under the same insect density, R-1 was found to have a lower F0 but higher ΦPSII, qP, Fv/ F0 and Fv/ Fm, when compared with I-1. As a rule, the gas exchange parameter and chlorophyll fluorescence kinetic parameter of R-1 fluctuated less than I-1, indicating that the thrip's rasping-sucking damage had injured the chloroplast tissue of alfalfa leaves, decreased the anabolism of chlorophyll, aggravated leaf transpiration, decreased WUE, and therefore affected alfalfa photosynthesis. The thylakoid membrane in the alfalfa leaves and PSIIreaction center were injured, which decreased the absorption of light energy, and impeded the photosynthetic electron transport, reducing its photosynthetic efficiency. While under lower insect densities (1 per branch, 3 per branch), the R-1 clone had a stronger capability to adjust for water loss and usage after being damaged by the thrip, demonstrating adaptability to the thrip's rasping-sucking damage through internal regulation, lowering PSIIdamage, with higher absorption, transmission, use and conversion efficiency. Therefore the R-1 clone was found to have a stronger resistance to thrips when compared with the I-1 clone, as expressed by the higher photosynthetic efficiency and photosynthetic compensation effect. © 2014, Science Press. All rights reserved.

Loading Sino Us Center For Grazingland Ecosystem Sustainability collaborators
Loading Sino Us Center For Grazingland Ecosystem Sustainability collaborators