Kyoto, Japan
Kyoto, Japan

Time filter

Source Type

News Article | May 12, 2017
Site: www.prnewswire.com

Browse 70 market data tables and 57 figures spread through 157 pages and in-depth TOC on "Moisture Analyzer Market - Global Forecast to 2022" http://www.marketsandmarkets.com/Market-Reports/moisture-analyzer-market-72110933.html Early buyers will receive 10% customization on this report. Food and beverage vertical holds the largest share of the moisture analyzer market The food and beverage vertical held the largest market share of the overall moisture analyzer market in 2016. This huge demand from the food and beverage vertical can be attributed to the stringent government regulations for maintaining the high quality of edible products by maintaining the moisture content in the product at the desired level. Near-infrared expected to be the fastest growing analyzing technique in the moisture analyzer market The moisture analyzer market for the near-infrared (NIR) analyzing technique is expected to grow at the fastest rate during the forecast period. This is mainly because NIR analyzers provide the opportunity to measure moisture content in the product during the manufacturing process. With the growing process automation in various industries, the demand for in-line moisture analysis is growing, and NIR analyzers are the best fit for the continuous analysis of moisture during the product manufacturing process. The Americas is the major consumer of moisture analyzers The Americas accounted for largest share of the overall moisture analyzer market in 2016. This region is home to several moisture analyzer manufacturers, along with industries such as food and beverages, and pharmaceuticals, which are the major consumers of this equipment. The report also profiles the most promising players in the moisture analyzer market. The competitive landscape of the market is highly dynamic because of the presence of a significant number of big and small players. The key players in the market are PCE Instruments (Germany), Michell Instruments Inc. (England), Ametek Inc. (US), SpectraSesnsors Inc. (US), General Electric Co. (US), A&D Co., Ltd. (Japan), Kett Electric Laboratory (Japan), Mettler-Toledo International Inc. (US), Sartorius AG (Germany), Shimadzu Corp. (Japan), Gow-Mac Instrument Co. (US), Mitsubishi Chemical Holdings Corp. (Japan), Sinar Technology (England), Thermo Fisher Scientific Inc. (US), and U-Therm International (H.K.) Ltd. (Hong Kong). Tunable Diode Laser Analyzer (TDLA) Market by Methodology (In-Situ and Extractive), Gas Analyzer Type (Oxygen (O2), Ammonia (NH3), COX, Moisture (H2O), CxHx, HX), Industry (Oil & Gas, Cement, Power), and Geography - Global Forecast to 2022 http://www.marketsandmarkets.com/Market-Reports/tunable-diode-laser-analyzer-market-120588467.html Soil Moisture Sensor Market by Type (Volumetric and Water Potential), Application (Agriculture, Residential, Landscaping, Sports Turf, Weather Forecasting, Forestry, Research Studies and Construction), & Geography - Global trends & Forecast to 2020 http://www.marketsandmarkets.com/Market-Reports/soil-moisture-sensor-market-140653896.html MarketsandMarkets™ provides quantified B2B research on 30,000 high growth niche opportunities/threats which will impact 70% to 80% of worldwide companies' revenues. Currently servicing 5000 customers worldwide including 80% of global Fortune 1000 companies as clients. Almost 75,000 top officers across eight industries worldwide approach MarketsandMarkets™ for their painpoints around revenues decisions. Our 850 fulltime analyst and SMEs at MarketsandMarkets™ are tracking global high growth markets following the "Growth Engagement Model - GEM". The GEM aims at proactive collaboration with the clients to identify new opportunities, identify most important customers, write "Attack, avoid and defend" strategies, identify sources of incremental revenues for both the company and its competitors. MarketsandMarkets™ now coming up with 1,500 MicroQuadrants (Positioning top players across leaders, emerging companies, innovators, strategic players) annually in high growth emerging segments. MarketsandMarkets™ is determined to benefit more than 10,000 companies this year for their revenue planning and help them take their innovations/disruptions early to the market by providing them research ahead of the curve. MarketsandMarkets's flagship competitive intelligence and market research platform, "RT" connects over 200,000 markets and entire value chains for deeper understanding of the unmet insights along with market sizing and forecasts of niche markets.


WASHINGTON--(BUSINESS WIRE)--Medical cannabis education leader United Patients Group, in cooperation with the Congressional Cannabis Caucus, will spearhead a comprehensive bipartisan seminar on the science of cannabis on Capitol Hill on Monday, May 15th. Corinne and John Malanca, co-founders of California-based UPG, will lead the bipartisan conversation about safe and effective medical cannabis in Science of Safe Cannabis: A Regulatory Primer. UPG will brief congressional staff, policy makers, industry experts, and patients on the science of cannabinoids, cannabis supply chain safety, the latest testing technology and techniques, as well as patient treatment and outcomes to ensure safe and effective usage of medical cannabis. Science of Safe Cannabis: A Regulatory Primer will also feature a keynote speech by U.S. Rep. Tom Garrett (R-VA), as well as presentations from leading companies such as Steep Hill Labs, Shimadzu, Pathogen DX and the Cannabis Distribution Association. America is experiencing a tidal shift in public perception and opinion around medical cannabis - with a recent CBS poll finding 88 percent of Americans in favor of legal medical cannabis and 29 states, the District of Columbia, Guam and Puerto Rico recently voting to legalize medical use. In the shadow of a partisan divide, Monday’s comprehensive and bipartisan Science of Safe Cannabis: A Regulatory Primer from United Patients Group might be the seed not just for national regulatory reform, but to help find common ground on Capitol Hill. For more information please call 415-524-8099 or email info@unitedpatientsgroup.com United Patients Group is a trusted leader in medical cannabis education for physicians, patients, organizations and governments. UPG offers CME education courses and one-on-one consulting to physicians and medical institutions. Additionally, United Patients Group’s distinguished Seal of Approval is awarded to medical professionals, organizations and companies for superior medical cannabis services and reliable medical cannabis products. Recognizing the importance of promoting continuity, quality service and unification within the medical cannabis industry, UPG is dedicated to establishing and maintaining the highest level of Ethics. Launched in February of 2017, the Congressional Cannabis Caucus is a bipartisan effort by founding members Rep. Blumenauer (D-OR); Rep. Jared Polis (D-CO), Rep. Dana Rohrabacher (R-CA), and Rep. Don Young (R-AK) to shepherd sensible cannabis reform into the national framework.


No statistical methods were used to predetermine sample sizes. All behaviour data were collected in a random manner. No blinding method was used in assessing experimental outcomes. The following flies were obtained from Bloomington Stock Center: isogenized w1118 (BL5905), norpAP24 (BL9048), ninaE-norpA (rh1>norpA; this is a direct fusion of the ninaE promoter to the norpA coding region; BL52276), ninaE–Gal4 (rh1–Gal4; BL8691), trpMB (BL23636), trplMB (BL29314), UAS–mcherry-NLS (BL38425), gl60j (BL 509), pdf–Gal4 (BL6900), and two UAS–plc21C RNAi lines (01210, BL 31269 and 01211, BL31270). GMR–hid31 was obtained from the Drosophila Genetic Resource Center, Kyoto (108419). We used w1118 as the control strain. The UAS–rh7 RNAi line (v1478) was from VDRC Stock Center. The tim–Gal4 transgene32 was provided by A. Sehgal. The cry–Gal4.E13 transgene2 was from M. Rosbash. The cryb and cry01 flies2, 33 were provided by M. Wu and the rh502, rh601, UAS-rh3, UAS-rh4 and UAS-rh5 lines34, 35 were provided by C. Desplan. We also used ninaEI17 flies36. To clone the rh7 coding region, we prepared mRNA from w1118 heads, performed reverse transcription (RT)-PCR using the following primers, and cloned the cDNA into the TOPO vector (pCR2.1-TOPO, Invitrogen). Primers: rh7 forward, GCGGCCGCCACCATGGAGGCCATCATCATGACG; rh7 reverse, GCGGCCGCTCAGAACTTACTCTGTTCCATGAC. To generate the UAS–rh7 transgene, we subcloned the rh7 open reading frame into the NotI site of the pUAST vector. To construct the plasmid for expression of Rh7 in HEK293T cells, we subcloned the rh7 open reading frame between the BamH1 and Xba1 sites of the pCS2+MT vector using the following primers: rh7 forward, ATCAGATCTCACCATGGAGGCCATCATCATGACG; rh7 reverse, ATCTCTAGATCAGAACTTACTCTGTTCCATGAC. To generate transgenic flies expressing an Rh7–FLAG fusion protein, we first constructed the pUAST–FLAG vector using the following two oligonucleotides, which we annealed and cloned into the XhoI and XbaI sites of the pUAST vector: FLAG 5′-XbaI, TCGAGGGGATTACAAGGATGACGACGATAAGTAAT and FLAG 3′-XhoI, CTAGATTACTTATCGTCGTCATCCTTGTAATCCCC. We amplified the rh7 coding region using the same forward primer as above, in conjunction with the following reverse primer to eliminate the stop codon: rh7 reverseno-stop, GCGGCCGCGAACTTACTCTGTTCCATGAC. Both the UAS–rh7 and UAS–rh7–FLAG transgenic flies were obtained by germline transformation using w1118 embryos (Bestgene Inc.). To generate flies expressing an rh7+ genomic transgene (P[rh7+]), a BAC genomic DNA clone (CH322180G19) was obtained from the P[acman] collection37. The germline transformation took advantage of site-specific integration using the Φ31-attB/attP system (Bestgene Inc.). We produced the plasmid for knocking out rh7 by ends-out homologous recombination38 as follows. We PCR amplified two homologous arms (left, 3.2 kb and right, 3.3 kb) using the following primers: left arm forward, AATTGCTGGGATCCCTCAATTGGCCTAATCGGTTTCTG; left arm reverse, AATTGCTGGGTACCGACTGACTTGGCCAAATATTTACG; right arm forward, AATGCTGGCGGCCGCTTAAAATGCTGCCCGAGACT; right arm reverse, AATTGCTGGCGGCCGCTGGCTTATGAAGTTGCAAAAAG. We cloned the two arms into the targeting vector, pw35loxp–Gal4. This construct was designed to delete 540 base pairs (bp) 3′ to the rh7 translational start site, and was replaced with a cassette containing the mini-white marker and Gal4 flanked by two loxP sites. The upstream loxP sequence contained a translational start site that rendered the Gal4 coding region out of frame. Consequently, the Gal4 was not functional. To obtain the donor lines for generating the rh7 knockout (rh71 allele), the targeting vector was injected into w1118 embryos (Bestgene Inc.). We mobilized the donor insertion by crossing the donor line to y,w;P[70FLP]11 P[70I-SceI]2B nocSco/CyO flies (Bloomington Stock Center, BL6934). The progeny were screened for gene targeting in the rh7 locus by PCR using two pairs of primers. The first pair (P1 and P2) were the following two primers that annealed to the first and second coding exons, and produced a DNA product (885 bp) only in the wild-type (Extended Data Fig. 2g): P1, CTCTCGCTCTCCGAGATGTT and P2, ACCACCGAAATCAGGCAATA. The following second pair of primers (P3 and P4) annealed to the mini-white gene and to a sequence 3′ to rh7, and therefore only generated a product in the rh71 mutant (4.4 kb; Extended Data Fig. 2g): P3, TGTACATAAAAGCGAACCGAACCT and P4, ACTGTGCGACAGAGTGAGAGAGCAATAGTA. After generating rh71, we outcrossed the flies to the control stain (w1118) for five generations. To determine whether the key fly lines used in this study harboured the perSLIH, timls or jetc mutations in the genetic background, we performed DNA sequencing. We extracted genomic DNA from adult flies, and amplified the relevant regions in the per, tim and jet genes by PCR (Phusion High-Fidelity DNA Polymerase, NEB) using the following primers: per: forward, GTCCACACACAACACCAAGG; reverse, TTGATGATCATGTCGCTGCT. tim: forward, TGGCTGGGGATTGAAAATAA; reverse, TTACAGATACCGCGCAAATG. jet: forward, AGCCGATCATAGTGGAGTGC; reverse, AAGGCACGCACAGGTTTACT. We purified the PCR products and subjected them to DNA sequencing (DNA Sequencing Facility at the University of California, Berkeley). The perSLIH allele has a C to A transversion at nucleotide 2688438. The control (per+) sequence encompassing this region (2688436–2688448, Drosophila genome release r6.14) is CTCCGGCAGCAGT. The perSLIH sequence is CTACGGCAGCAGT. All of the fly lines checked had sequences that matched per+. These include: (1) rh71, (2) rh71 cryb, (3) rh71 cry01, (4) pdf–Gal4 and (5) rh7-RNAi. The timls allele has a single nucleotide insertion (C) after nucleotide 3504474 relative to tims. The sequence spanning this region in the control (timls) is ATCAAAGTTCTGAT (3504473–3504486, Drosophila genome release r6.14) and in tims is ATAAAGTTCTGAT. We sequenced the following lines, all which had sequences that matched the control (tims): (1) cry01, (2) rh71 and (3) P[rh7+]; rh71. The jetc allele has a T-to-A transversion at nucleotide 4949048. The control (jet+) sequence spanning this region (4949059–4949047, Drosophila genome release r6.14) is CTTGATTATCTTC, while the jetc sequence is CTTGATTATCTAC. We sequenced the following lines, all of which had sequences that matched the control (jet+): (1) cry01, (2) rh71 and (3) P[rh7+];rh71. To quantify expression of opsin genes (Fig. 1b), we isolated total RNA from ~50 fly heads from each of the indicated fly stocks, and used 1 μg total RNA from each sample as a template for reverse transcription using SuperScript III Reverse Transcriptase (ThermoFisher, cat. 18080093). Oligo dT primers were used for cDNA synthesis. cDNA preparation was subjected to real-time quantitative PCR (Roche, LightCycler 480 system) according to the LightCycler 480 SYBR Green 1 Master Mix (cat. 04707516001) protocol. The primers used for real-time quantitative PCR were: rh1: forward CGCTACCAAGTGATCGTCAA, reverse GTATGAGCGTGGGTTCCAGT. rh2: forward TCCGTGCTGGACAATGTG, reverse AATCATGCACATGGACCAGA. rh3: forward CGAGCAAAAGAACAGGAAGC, reverse TCGATACGCGACTCTTTGTG. rh4: forward GTAGCCCTCTGGCACGAAT, reverse TCTTCAGCACATCCAAGTCG. rh5: forward TCCTGACCACCTGCTCCTTC, reverse GCTCCAGCTCCAGACGATAC. rh6: forward CAAGGACTGGTGGAACAGGT, reverse GTACTTCGGGTGGCTCAATC. rh7: forward GTTTCCACGGGTCTGACAAT, reverse GCTGTAGCACCAGATCAGCA. rp49: forward GACGCTTCAAGGGACAGTATCTG, reverse AAACGCGGTTCTGCATGAG. We also analysed opsin gene expression using an RNA-seq dataset (Fig. 1c). For each genotype, three independent RNA libraries were prepared from ~50 heads using the TruSeq Stranded mRNA Library Prep Kit. Pair-end sequencing was performed using the TruSeq platform (Illumina). Details of the RNA-seq experiments and data analysis will be presented elsewhere (J.D.N., I. Tekin and C.M., in preparation). Opsin RNA-seq mRNA levels were quantified as RPKM. RPKMs for each opsin were calculated independently and the average RPKMs are plotted. To knock-down plc21C expression, we combined each UAS–plc21C RNAi transgene (01210 and 01211) with UAS–Dicer2;;actin–Gal4. To quantify the efficacy of the RNAi, we extracted total RNA from ten adult flies (five male and five female), and used 1 μg total RNA from each sample as a template for reverse transcription using SuperScript III Reverse Transcriptase (ThermoFisher, cat. 18080093). Oligo dT primers were used for cDNA synthesis. cDNA preparation was subjected to quantitative PCR (Roche, LightCycler 480 system) according to the LightCycler 480 SYBR Green 1 Master Mix (cat. 04707516001) protocol. The plc21C primers used were: forward, GGATCTCTCCAAGTCGTTCG; reverse, TAGCCGCTTCACCAGCTTAT. The rp49 primers were: forward, GACGCTTCAAGGGACAGTATCTG; reverse, AAACGCGGTTCTGCATGAG. In each reaction, we normalized expression of plc21C transcripts to rp49. To obtain Rh7 antibodies, we generated a GST–Rh7 fusion protein by subcloning the region encoding the N-terminal 80 amino acids into the pGEX6P-1 vector (GE Healthcare Life Science). We expressed the fusion protein in Escherichia coli (BL21), purified the recombinant protein using glutathione sepharose beads (GE Healthcare Life Science) and generated antiserum in a rabbit (Covance). We affinity purified the antibodies by conjugating the antigen to Affi-Gel 10 (Bio-Rad). We performed immunohistochemistry using whole-mounted fly brains as described previously39. Briefly, we fixed dissected brains for 15–20 min at 4 °C in 4% paraformaldehyde in phosphate buffer (0.1 M Na PO , pH 7.4) with 0.3% Triton-X100 (Sigma), hereafter referred to as PBT. The brains were blocked with 5% normal goat serum (Sigma) in phosphate buffer for 1 h at 4 °C. We then incubated the tissue with primary antibodies at 4 °C for ≥24 h. After three washes in PBT, the brains were incubated overnight at 4 °C with the following secondary antibodies from Life Technologies: anti-mouse Alexa Fluor 488 or 568 Dyes, anti-rabbit Alexa Fluor 488 or 568 Dyes or Alexa dyes. The brains were washed three times with PBT and mounted in VECTASHIELD mounting medium (Vector Labs) for imaging. For Rh7 and PDF co-staining (Fig. 2d–i), four brains were examined. To analyse light-mediated degradation of Tim (Fig. 3c–f), we entrained the flies for 3 days under 12 h light–12 h dark cycles (~600 lx LED white light). The flies were then exposed to a 5-min LED light stimulation (~600 lx) at ZT22, kept in the dark for 55 min, fixed at ZT23 under a red photographic safety light (for 45 min), and dissected for whole-mount immunostaining. Flies that were not exposed to the nocturnal light treatment were fixed and stained at the same time. To examine Per staining at different ZT points (Extended Data Fig. 9), flies were entrained for 4 days under 12 h light (~400 lx)–12 h dark cycles, and were collected at the indicated ZTs. For nighttime samples, we handled the flies under a red photographic safety light. We prefixed whole flies at 4 °C with 4% paraformaldehyde in PBT for 45 min before dissecting out the brains. After the dissections, the brains were fixed again for 15–20 min at 4 °C in 4% paraformaldehyde in PBT. We used the following primary antibodies: anti-Rh7 (1:250, rabbit), anti-Per (1:1,000, guinea pig), anti-Tim (1:1,000, rat)40, anti-PDF (1:1,000, c7 mouse monoclonal antibody from the Developmental Studies Hybridoma Bank), anti-dsRed (1:500, mouse, Clontech Catalog #632392). The Per and Tim antibodies were contributed by A. Sehgal. The secondary antibodies (Thermo Fisher Scientific) were anti-rat Alexa Fluor 568 Dye and anti-guinea pig Alexa Fluor 555 Dye. We acquired the images using a Zeiss LSM 700 confocal microscope. To perform whole-mount staining of the retina, we dissected the retina (within the eye cup) and fixed the tissue at 4 °C in 4% paraformaldehyde in PBT for 20 min. After washing briefly in PBT, we blocked the retina for 1 h in PBT plus with 5% normal goat serum. We used the following primary antibodies: anti-Rh7 (1:250, rabbit), anti-Rh3 (1:200, mouse, gift from S. Britt, University of Colorado, Denver) and anti-Rh5 (1:200, mouse, gift from S. Britt, University of Colorado, Denver). The secondary antibodies were: anti-rabbit Alexa Fluor 568 Dye (1:1000) and anti-mouse Alexa Fluor 488 Dye (1:1000). Circadian experiments were performed at 25 °C using the Drosophila Activity Monitoring (DAM) System (Trikinetics). Individual 3–7-day-old male flies were loaded into monitoring tubes, which contained 1% agarose (Invitrogen) and 5% sucrose (Sigma) as the food source. The flies were entrained to 12 h light–12 h dark cycles for 4 days and released to constant darkness or constant light (10 lx for dim light conditions and 400 lx for bright light conditions, unless indicated otherwise) for at least six days to measure periodicity. Data collection and analyses were performed using Clocklab (Actimetrics). Activity data for each fly were binned every 30 min for the circadian analyses. To obtain the periodicities, data from constant darkness were subjected to χ2 periodograms and fast Fourier transfer analysis using Clocklab software. The rhythm strength of a fly was measured as the power minus the significance (p − s). Flies were considered arrhythmic based on either p − s < 10 or FFT < 0.03. Actograms of weakly rhythmic flies were visually inspected to confirm rhythmicity. To investigate the effects on activity of 5-min light pulses at night (Fig. 3a, b; Extended Data Figs 4, 10), we first entrained the flies for 3 days under 12 h light–12 h dark cycles (~600 lx LED white light). During the night of the fourth L–D cycle (at ZT14, ZT16, ZT18, ZT20 or ZT22), we exposed the flies to a single 5-min light pulse (LED white light, ~600 lx), and then maintained the flies under constant darkness. The phase shift was calculated as the phase difference of the evening peaks before and after the light pulse. Negative and positive phase changes indicate phase delays and phase advances, respectively. To conduct the phase delay experiments (Fig. 3g–l), we first entrained the flies for 4 days under 12 h light–12 h dark cycles (~400 lx LED white light). To obtain a phase delay of 8 h, on day 5 we extended the light phase to 20 h, and then returned the flies to normal 12 h dark–12 h light cycles. The phase shift magnitude was calculated as the phase difference between the evening peak of the day before the phase shift and the indicated day after the phase shift. To assess light-dependent arousal, we entrained the flies for 4 days under 12 h light–12 h dark cycles and then exposed the flies to a 5-min white light pulse (~600 lx LED lights) at ZT22. We binned the activity data for each fly every minute. ‘Light-coincident arousal’ is the increase in locomotion activity (bin-crosses) during the 5-min stimulation compared to the previous 5 min. ‘Arousal delay’ is the time between lights on and maximum activity. The HEK293T cells were obtained from the ATCC, which authenticates their lines. This line has not been tested for mycoplasma contamination. The HEK293T cells were cultured to 70% confluency and transfected with 2 μg pCS2+MT-rh7 plasmid per 10-cm dish. We used the FuGENE HD Transfection Reagent (Cat.E2311) to perform the transfections. Cells were harvested 24–36 h after transfection and stored at −80 °C. For reconstitution of Rh7 with the chromophore, the HEK293T cells were resuspended in cold PBS (pH 7.4, Quality Biological Inc.) supplemented with a protease inhibitor cocktail (Sigma P8340) and incubated with 40 μM 11-cis-retinal in the dark for 4 h. We prepared membrane protein extracts by resuspending membrane pellets in 0.1% CHAPs in PBS, rotating for 2 h at 4 °C, then centrifuging (14,000g) for 20 min at 4 °C. The supernatants were removed and analysed with a UV3600 UV-Nir-NIR Spectrometer (Shimadzu). To obtain the spectral absorption for Rh7, we used membrane extracts from untransfected cells as the blank. ERG recordings were performed by filling two glass electrodes with Drosophila Ringer’s solution (3 mM CaCl , 182 mM KCl, 46 mM NaCl, 10 mM Tris pH 7.2) and placing small droplets of electrode cream on the surface of the compound eye and the thorax to increase conductance. We inserted the recording electrode into the cream on the surface of the compound eye and the reference electrode into the cream on the thorax. Flies were dark adapted for 1 min before stimulating with a 2-s pulse using a halogen light (~30 mV/cm2 unless indicated otherwise). The ERG signals were amplified with a Warner electrometer and recorded with a Powerlab 4/30 analogue-to-digital converter (AD Instruments). Data were collected and analysed with the Laboratory Chart version 6.1 program (AD Instruments). Patch-clamp measurements were performed on acutely dissected adult fly brains as described previously18, 19. Briefly, all patch-clamp recordings were performed during the daytime to avoid clock-dependent variance in firing rate. All l-LNvs were recorded within a relatively narrow daytime window, and recordings for each genotype were normally distributed for the time of day and did not vary significantly among all three genotypes. l-LNv recordings were made in whole-cell current clamp mode. After allowing the membrane properties to stabilize after whole cell break-in, we recorded for 30–60 s in the current clamp configuration (unless otherwise stated) under nearly dark conditions (~0.05 mW/cm2) before the lights were turned on. Lights-on data were collected for 5–20 s and this was followed by 60–120 s of darkness. Multiple light sources were used for these studies. We used a standard halogen light source on an Olympus BX51 WI microscope (Olympus USA) for all experiments with white light (400–1,000 nm, 4 mW/cm2). Orange light (550–1,000 nm; 4 mW/cm2) for electrophysiological recordings was achieved by placing appropriate combinations of 25 mm long- and short-pass filters (Edmund Industrial Optics) over the halogen light source directly beneath the recording chamber. We changed the filters during the recordings to internally match the neuronal responses to different wavelengths of light. Recordings using 405 nm violet light (0.8 mW/cm2) were obtained using LEDs obtained from Prizmatix 405 LED (UHP-Mic-LED-405), which provide >2 W collimated purple light (405 nm peak, 15 nm spectrum half width). Light was measured for all sources using a Newport 818-UV sensor and the Optical Power/Energy Meter (842-PE, Newport Corporation) and expressed as mW/cm2. The control genotype for the electrophysiological recordings was w;pdf-Gal4-dORK-NC1-GFP. The cry01 and rh71 recordings were performed using w;pdf-Gal4-dORK-NC1-GFP;cry01 and w;pdf-Gal4-dORK-NC1-GFP; rh71, respectively. To analyse two sets of data, we used the unpaired Student’s t-test. To compare multiple sets of behavioural data, we used a one-away ANOVA (Kruskal–Wallis test) followed by Dunn’s test. Data are presented as mean ± s.e.m. We used Fisher’s exact test to analyse the percentages of rhythmic flies. For the patch-clamp recordings, the data are presented as mean ± s.e.m. Values of n refer to the number of measured light on–off cycles. In all cases the n values were obtained from at least 5 separate recordings (see legends). ANOVAs were performed using SigmaPlot 11 (Systat Software Inc.) or Prism 6 (Graphpad Software). The data were first tested for normal distribution. If the data were not normally distributed, we performed Kruskal–Wallis one way analysis of variance on ranks, followed by Dunn’s test. ANOVAs on normally distributed data were followed by Tukey’s test to determine significant differences between genotypes. All data are available from the corresponding author upon reasonable request.


News Article | May 23, 2017
Site: www.eurekalert.org

AbeXXa is identifying targets for cancer from the many thousands of intracellular proteins AbeXXa Biologics, a faculty startup at The University of Texas at Arlington, was named one of the 40 "Best University Startups 2017" by the National Council of Entrepreneurial Tech Transfer, a Washington-based association of startup officers from the top research universities in the United States. AbeXXa Biologics co-founder and chief scientific officer, Jon Weidanz, is a UTA biology professor and associate vice-president for research. He has worked for more than 25 years in the immuno-oncology field and has already developed two successful life science startups. Jon Weidanz co-founded the company with UTA alumna Debra Wawro Weidanz, who serves as chief executive officer. Ms. Weidanz brings many years of experience as an inventor and entrepreneur and previously co-founded the life science startup company Resonant Sensors Incorporated based on technology invented at UTA. "Through AbeXXa, we are identifying a new series of biomarkers or targets for cancer from the many thousands of proteins found within a tumor cell, a new field of research that could potentially result in immunotherapies that prove effective for a broad range of patients," Jon Weidanz said. In any cell, protein molecules are continually synthesized and degraded, breaking up into smaller pieces known as peptides. These peptides bind with cell surface proteins known as the major histocompatibility complex or MHC, which plays an important role in immune response. In cancer cells, the protein compositions are different. By identifying the specific peptides that bind to MHC in cancer cells, it is possible to establish biomarkers for the disease and develop new cancer therapies. "Current therapeutic antibodies target cell surface or secreted proteins and not intracellular proteins," he continued. "We are developing different platforms for using the antibodies, including coupling cytotoxic drugs to immune or T cell receptor-like antibodies to deliver therapy to the cell. Another possibility would be for the T cell receptor-like antibodies to be used to genetically modify immune cells to attack these specific intracellular targets." Jon Weidanz recently demonstrated the effectiveness of his modified T cell receptor or TCR-like antibody-drug complexes against cancer in a new paper, "TCR-like antibody drug conjugates mediate killing of tumor cells with low peptide/HLA targets," which was published in mAbs, an international journal that focuses on antibodies. "Our data showed proof-of-concept results for our TCR-like antibody coupled with a cytotoxic drug to kill tumor cells," Jon Weidanz added. "Efforts are now underway to improve clinical efficiency by improving the properties of this conjugate therapy, which enables sensitive discrimination between healthy and diseased tissue." AbeXXa Biologics is housed at the Shimadzu Institute for Research Technologies in the NanoFab Building on the UTA campus, and already has 12 employees. The company is also setting up an office and laboratory at LabCentral in Cambridge, Mass., after winning a Massachusetts Biotechnology Council- sponsored Innovation Day competition earlier this year. Two of the new employees are UTA doctoral students and the company has also hired an intern for the summer from the College of Business. Duane Dimos, UTA vice president of research, underlined the increased role of start-ups as part of the entrepreneurship and innovation ecosystem developing on campus. "AbeXXa Biologics is already one of the largest users of Shimadzu Institute for Research Technologies equipment and is fully integrated in the UTA community, creating new opportunities for graduate students and even our business school students," Dimos said. "Going forward, we expect to see many more UTA research initiatives move out of the lab and into the marketplace," he added.


— Global FTIR Spectrometer Industry Report offers market overview, segmentation by types, application, countries, key manufactures, cost analysis, industrial chain, sourcing strategy, downstream buyers, marketing strategy analysis, distributors/traders, factors affecting market, forecast and other important information for key insight. Companies profiled in this report are Thermo Fisher, Agilent, Perkin Elmer, Shimadzu, ABB, Bruker, Netzsch, Mettler Toledo, Jasco, Foss, MKS in terms of Basic Information, Manufacturing Base, Sales Area and Its Competitors, Sales, Revenue, Price and Gross Margin (2012-2017). Split by Product Types, with sales, revenue, price, market share of each type, can be divided into • Portable Type • Laboratory Type Split by applications, this report focuses on sales, market share and growth rate of FTIR Spectrometer in each application, can be divided into • Organic synthesis • Polymer science • Petrochemical engineering • Pharmaceutical industry • Food analysis Purchase a copy of this report at: https://www.themarketreports.com/report/buy-now/424358 Table of Content: 1 FTIR Spectrometer Market Overview 2 Global FTIR Spectrometer Sales, Revenue (Value) and Market Share by Manufacturers 3 Global FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 4 Global FTIR Spectrometer Manufacturers Profiles/Analysis 5 North America FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 6 Latin America FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 7 Europe FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 8 Asia-Pacific FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 9 Middle East and Africa FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 10 FTIR Spectrometer Manufacturing Cost Analysis 11 Industrial Chain, Sourcing Strategy and Downstream Buyers 12 Marketing Strategy Analysis, Distributors/Traders 13 Market Effect Factors Analysis 14 Global FTIR Spectrometer Market Forecast (2017-2022) 15 Research Findings and Conclusion 16 Appendix Inquire more for more details about this report at: https://www.themarketreports.com/report/ask-your-query/424358 For more information, please visit https://www.themarketreports.com/report/2017-2022-global-top-countries-ftir-spectrometer-market-report


— Global LC-MS Industry Report offers market overview, segmentation by types, application, countries, key manufactures, cost analysis, industrial chain, sourcing strategy, downstream buyers, marketing strategy analysis, distributors/traders, factors affecting market, forecast and other important information for key insight. Companies profiled in this report are Thermo Fisher Scientific, Waters, Agilent Technologies, Shimadzu, PerkinElmer, SCIEX, Bruker in terms of Basic Information, Manufacturing Base, Sales Area and Its Competitors, Sales, Revenue, Price and Gross Margin (2012-2017). Split by Product Types, with sales, revenue, price, market share of each type, can be divided into • Single Quadrupole LC-MS • Triple Quadrupole LC-MS • Ion Trap LC-MS • Others Split by applications, this report focuses on sales, market share and growth rate of LC-MS in each application, can be divided into • Academic • Pharma • Food & Environment & Forensic • Clinical Purchase a copy of this report at: https://www.themarketreports.com/report/buy-now/495864 Table of Content: 1 LC-MS Market Overview 2 Global LC-MS Sales, Revenue (Value) and Market Share by Manufacturers 3 Global LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 4 Global LC-MS Manufacturers Profiles/Analysis 5 North America LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 6 Latin America LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 7 Europe LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 8 Asia-Pacific LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 9 Middle East and Africa LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 10 LC-MS Manufacturing Cost Analysis 11 Industrial Chain, Sourcing Strategy and Downstream Buyers 12 Marketing Strategy Analysis, Distributors/Traders 13 Market Effect Factors Analysis 14 Global LC-MS Market Forecast (2017-2022) 15 Research Findings and Conclusion 16 Appendix Inquire more for more details about this report at: https://www.themarketreports.com/report/ask-your-query/495864 For more information, please visit https://www.themarketreports.com/report/2017-2022-global-top-countries-lc-ms-market-report


— Global Universal Testing Machine Industry Report offers market overview, segmentation by types, application, countries, key manufactures, cost analysis, industrial chain, sourcing strategy, downstream buyers, marketing strategy analysis, distributors/traders, factors affecting market, forecast and other important information for key insight. Companies profiled in this report are Mts, Instron, Zwick/Roell, Shimadzu, Admet, Hegewald & Peschke, Ametek(Lloyd), Torontech Group, Keysight Technologies, Qualitest International, Tinius Olsen, Applied Test Systems, Ets Intarlaken, Jinan Shijin Group, Suns, Tenson, Changchun Kexin Test Instrument, Wance Group, Shanghai Hualong, Tianshui Hongshan, Laizhou Huayin, Shenzhen Reger, Hung Ta, Shandong Drick, Jinan Kehui, Jinan Fine, Jinan Liangong, Hrj in terms of Basic Information, Manufacturing Base, Sales Area and Its Competitors, Sales, Revenue, Price and Gross Margin (2012-2017). Split by Product Types, with sales, revenue, price, market share of each type, can be divided into • Single Column Testing Machine • Dual Column Testing Machine • Other (Four Column Testing Machine, etc.) Split by applications, this report focuses on sales, market share and growth rate of Universal Testing Machine in each application, can be divided into • Scientific and Education • Industrial Application Purchase a copy of this report at: https://www.themarketreports.com/report/buy-now/424286 Table of Content: 1 Universal Testing Machine Market Overview 2 Global Universal Testing Machine Sales, Revenue (Value) and Market Share by Manufacturers 3 Global Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 4 Global Universal Testing Machine Manufacturers Profiles/Analysis 5 North America Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 6 Latin America Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 7 Europe Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 8 Asia-Pacific Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 9 Middle East and Africa Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 10 Universal Testing Machine Manufacturing Cost Analysis 11 Industrial Chain, Sourcing Strategy and Downstream Buyers 12 Marketing Strategy Analysis, Distributors/Traders 13 Market Effect Factors Analysis 14 Global Universal Testing Machine Market Forecast (2017-2022) 15 Research Findings and Conclusion 16 Appendix Inquire more for more details about this report at: https://www.themarketreports.com/report/ask-your-query/424286 For more information, please visit https://www.themarketreports.com/report/2017-2022-global-top-countries-universal-testing-machine-market-report


Global Metabolomics Market by Detection and Separation Techniques, and Applications, Growth Trends and Forecast to 2021, by iHealthcareAnalyst, Inc. Metabolomics Market by Detection and Separation Techniques, and Applications (Biomarker Discovery, Clinical Toxicology, Drug Assessment, and Nutrigenomics) and Forecast 2017-2021 Maryland Heights, MO, April 15, 2017 --( Browse Metabolomics Market by Detection and Separation Techniques, and Applications (Biomarker Discovery, Clinical Toxicology, Drug Assessment, and Nutrigenomics) and Forecast 2017-2021 report at https://www.ihealthcareanalyst.com/report/metabolomics-market/ The global metabolomics market report estimates the market size (Revenue USD million - 2014 to 2021) and key market segments based on detection and separation techniques used, its applications (biomarker discovery, clinical toxicology, drug assessment, and nutrigenomics), and forecasts growth trends (CAGR% - 2017 to 2021). The global metabolomics market research report is further segmented by geography into North America (U.S., Canada), Latin America (Brazil, Mexico, Rest of LA), Europe (U.K., Germany, France, Italy, Spain, Rest of EU), Asia Pacific (Japan, China, India, Rest of APAC), and Rest of the World. The global metabolomics market report also provides the detailed market landscape, market drivers, restraints, opportunities), market attractiveness analysis and profiles of major competitors in the global market including company overview, financial snapshot, key products, technologies and services offered, and recent developments. Major players operating in the global metabolomics market and included in this report are Agilent Technologies, Inc., Thermo Fisher Scientific, Inc., Shimadzu Corporation, and Waters Corporation. 1. Technique 1.1. Detection Techniques 1.2. Separation Techniques 2. Application 2.1. Biomarker Discovery 2.2. Clinical Toxicology 2.3. Drug Assessment 2.4. Nutrigenomics 3. Geography (Region, Country) 3.1. North America (U.S., Canada) 3.2. Latin America (Brazil, Mexico, Rest of LA) 3.3. Europe (U.K., Germany, France, Italy, Spain, Rest of EU) 3.4. Asia Pacific (Japan, China, India, Rest of APAC) 3.5. Rest of the World 4. Company Profiles 4.1. Agilent Technologies Inc. 4.2. Biocrates Life Sciences AG 4.3. Bio-Rad Laboratories, Inc. 4.4. Bruker Corporation 4.5. Human Metabolome Technologies Inc. 4.6. LECO Corporation 4.7. Metabolon Inc. 4.8. Shimadzu Corporation 4.9. ThermoFisher Scientific Inc. 4.10. Waters Corporation To request Table of Contents and Sample Pages of this report visit: https://www.ihealthcareanalyst.com/report/metabolomics-market/ About Us iHealthcareAnalyst, Inc. is a global healthcare market research and consulting company providing market analysis, and competitive intelligence services to global clients. The company publishes syndicate, custom and consulting grade healthcare reports covering animal healthcare, biotechnology, clinical diagnostics, healthcare informatics, healthcare services, medical devices, medical equipment, and pharmaceuticals. In addition to multi-client studies, we offer creative consulting services and conduct proprietary single-client assignments targeted at client’s specific business objectives, information needs, time frame and budget. Please contact us to receive a proposal for a proprietary single-client study. Contact Us iHealthcareAnalyst, Inc. 2109, Mckelvey Hill Drive, Maryland Heights, MO 63043 United States Email: sales@ihealthcareanalyst.com Website: https://www.ihealthcareanalyst.com Maryland Heights, MO, April 15, 2017 --( PR.com )-- Metabolomics is the scientific study of chemical processes involving metabolites, whereas metabolome represents the collection of all metabolites in a biological cell, tissue, organ or organism, which are the end products of cellular processes. mRNA gene expression data and proteomic analyses reveal the set of gene products being produced in the cell, data that represents one aspect of cellular function including systems biology and functional genomics that integrates proteomic, transcriptomic, and metabolomic information to provide a better understanding of cellular biology. Metabolomics is an advanced, specialized form of analytical biochemistry that involves the study of chemical processes involving metabolites. Metabolomics enables simultaneous identification and analysis of multiple metabolites in cells, tissues and body fluids. The research funding for metabolomics has increased over the years in the major areas of research includes characterization and identification of novel biomarkers, therapeutic targets, and disease signatures in the area of cancer metabolomics.Browse Metabolomics Market by Detection and Separation Techniques, and Applications (Biomarker Discovery, Clinical Toxicology, Drug Assessment, and Nutrigenomics) and Forecast 2017-2021 report at https://www.ihealthcareanalyst.com/report/metabolomics-market/The global metabolomics market report estimates the market size (Revenue USD million - 2014 to 2021) and key market segments based on detection and separation techniques used, its applications (biomarker discovery, clinical toxicology, drug assessment, and nutrigenomics), and forecasts growth trends (CAGR% - 2017 to 2021). The global metabolomics market research report is further segmented by geography into North America (U.S., Canada), Latin America (Brazil, Mexico, Rest of LA), Europe (U.K., Germany, France, Italy, Spain, Rest of EU), Asia Pacific (Japan, China, India, Rest of APAC), and Rest of the World. The global metabolomics market report also provides the detailed market landscape, market drivers, restraints, opportunities), market attractiveness analysis and profiles of major competitors in the global market including company overview, financial snapshot, key products, technologies and services offered, and recent developments.Major players operating in the global metabolomics market and included in this report are Agilent Technologies, Inc., Thermo Fisher Scientific, Inc., Shimadzu Corporation, and Waters Corporation.1. Technique1.1. Detection Techniques1.2. Separation Techniques2. Application2.1. Biomarker Discovery2.2. Clinical Toxicology2.3. Drug Assessment2.4. Nutrigenomics3. Geography (Region, Country)3.1. North America (U.S., Canada)3.2. Latin America (Brazil, Mexico, Rest of LA)3.3. Europe (U.K., Germany, France, Italy, Spain, Rest of EU)3.4. Asia Pacific (Japan, China, India, Rest of APAC)3.5. Rest of the World4. Company Profiles4.1. Agilent Technologies Inc.4.2. Biocrates Life Sciences AG4.3. Bio-Rad Laboratories, Inc.4.4. Bruker Corporation4.5. Human Metabolome Technologies Inc.4.6. LECO Corporation4.7. Metabolon Inc.4.8. Shimadzu Corporation4.9. ThermoFisher Scientific Inc.4.10. Waters CorporationTo request Table of Contents and Sample Pages of this report visit: https://www.ihealthcareanalyst.com/report/metabolomics-market/About UsiHealthcareAnalyst, Inc. is a global healthcare market research and consulting company providing market analysis, and competitive intelligence services to global clients. The company publishes syndicate, custom and consulting grade healthcare reports covering animal healthcare, biotechnology, clinical diagnostics, healthcare informatics, healthcare services, medical devices, medical equipment, and pharmaceuticals.In addition to multi-client studies, we offer creative consulting services and conduct proprietary single-client assignments targeted at client’s specific business objectives, information needs, time frame and budget. Please contact us to receive a proposal for a proprietary single-client study.Contact UsiHealthcareAnalyst, Inc.2109, Mckelvey Hill Drive,Maryland Heights, MO 63043United StatesEmail: sales@ihealthcareanalyst.comWebsite: https://www.ihealthcareanalyst.com


Drugs of Abuse Testing Market by Samples, Products, Tests, Growth Trends and Forecast to 2021, Upcoming Report by iHealthcareAnalyst, Inc. Drugs of Abuse Testing Market by Sample Type (Blood, Breath, Hair & Sweat, Saliva, Urine), Product Type (Analyzers - Breath Analyzers, Chromatographic Devices, Immunoassays Analyzers, Rapid Testing Devices - Oral Fluid Testing Devices, Urine Testing Devices, Consumables, Fluid Collection Devices, Others), Test Type (Criminal Justice Testing, Pain Management Testing, Work Place Screening), End Users (Diagnostics Laboratories, Forensic Laboratories, Hospitals, On-Site Testing) and Forecast Maryland Heights, MO, April 27, 2017 --( Browse Drugs of Abuse Testing Market by Sample Type (Blood, Breath, Hair & Sweat, Saliva, Urine), Product Type (Analyzers - Breath Analyzers, Chromatographic Devices, Immunoassays Analyzers, Rapid Testing Devices - Oral Fluid Testing Devices, Urine Testing Devices, Consumables, Fluid Collection Devices, Others), Test Type (Criminal Justice Testing, Pain Management Testing, Work Place Screening), End Users (Diagnostics Laboratories, Forensic Laboratories, Hospitals, On-Site Testing) and Forecast 2017-2021 at https://www.ihealthcareanalyst.com/report/drugs-of-abuse-testing-market/ The global drugs of abuse testing market segmentation is based on sample type (blood, breath, hair & sweat, saliva, urine), product type (analyzers - breath analyzers, chromatographic devices, immunoassays analyzers, rapid testing devices - oral fluid testing devices, urine testing devices, consumables, fluid collection devices, others), test type (criminal justice testing, pain management testing, work place screening), end users (diagnostics laboratories, forensic laboratories, hospitals, on-site testing). The global drugs of abuse testing market report provides market size (Revenue USD Million 2014 to 2021), market share, trends and forecasts growth trends (CAGR%, 2017 to 2021). The global drugs of abuse testing market research report is further segmented by geography into North America (U.S., Canada), Latin America (Brazil, Mexico, Rest of LA), Europe (U.K., Germany, France, Italy, Spain, Rest of EU), Asia Pacific (Japan, China, India, Rest of APAC), and Rest of the World. The global drugs of abuse testing market report also provides the detailed market landscape (market drivers, restraints, opportunities), market attractiveness analysis and also tracks the major competitors operating in the market by company overview, financial snapshot, key products, technologies and services offered, market share analysis and recent trends in the global market. Major players operating in the global drugs of abuse testing market and profiled in this report include Alere, Inc., Drägerwerk AG & Co. KGaA, Express Diagnostics International, Inc., F. Hoffmann La-Roche Ltd, Laboratory Corporation of America Holdings, Shimadzu Corporation, Siemens Healthineers, and Thermo Fisher Scientific, Inc. 1. Sample Type 1.1. Blood 1.2. Breath 1.3. Hair & Sweat 1.4. Saliva 1.5. Urine 2. Product Type 2.1. Analyzers 2.1.1. Breath Analyzers 2.1.2. Chromatographic Devices 2.1.3. Immunoassays Analyzers 2.2. Rapid Testing Devices 2.2.1. Oral Fluid Testing Devices 2.2.2. Urine Testing Devices 2.3. Consumables 2.3.1. Fluid Collection Devices 2.4. Others 3. Test Type 3.1. Criminal Justice Testing 3.2. Pain Management Testing 3.3. Work Place Screening 4. End Users 4.1. Diagnostics Laboratories 4.2. Forensic Laboratories 4.3. Hospitals 4.4. On-Site Testing 5. Geography (Region, Country) 5.1. North America (U.S., Canada) 5.2. Latin America (Brazil, Mexico, Rest of LA) 5.3. Europe (U.K., Germany, France, Italy, Spain, Rest of EU) 5.4. Asia Pacific (Japan, China, India, Rest of APAC) 5.5. Rest of the World 6. Company Profiles 6.1. Alere, Inc. 6.2. Drägerwerk AG & Co. KGaA 6.3. Express Diagnostics International, Inc. 6.4. F. Hoffmann La-Roche Ltd 6.5. Laboratory Corporation of America Holdings 6.6. Shimadzu Corporation 6.7. Siemens Healthineers 6.8. Thermo Fisher Scientific, Inc. To request Table of Contents and Sample Pages of this report visit: https://www.ihealthcareanalyst.com/report/drugs-of-abuse-testing-market/ About Us iHealthcareAnalyst, Inc. is a global healthcare market research and consulting company providing market analysis, and competitive intelligence services to global clients. The company publishes syndicate, custom and consulting grade healthcare reports covering animal healthcare, biotechnology, clinical diagnostics, healthcare informatics, healthcare services, medical devices, medical equipment, and pharmaceuticals. In addition to multi-client studies, we offer creative consulting services and conduct proprietary single-client assignments targeted at client’s specific business objectives, information needs, time frame and budget. Please contact us to receive a proposal for a proprietary single-client study. Contact Us iHealthcareAnalyst, Inc. 2109, Mckelvey Hill Drive, Maryland Heights, MO 63043 United States Email: sales@ihealthcareanalyst.com Website: https://www.ihealthcareanalyst.com Maryland Heights, MO, April 27, 2017 --( PR.com )-- Drugs of abuse testing is used to screen for and confirm the presence of several drugs in a person's sample, such as urine, blood, breath, saliva or hair. Drug testing is used so that a person may receive appropriate medical treatment or be screened for or monitored for illegal drug use. Some of the most commonly screened drugs include amphetamine and methamphetamine, barbiturates such as phenobarbital, secobarbital and pentobarbital, benzodiazepines such as diazepam, lorazepam and oxazepam, marijuana, cocaine, methadone, opiates, such as heroin, codeine and morphine, and phencyclidine. Drugs of abuse testing may be used for medical screening, legal or forensic information, employment drug testing, sports or athletics testing, and monitoring pain medication use.Browse Drugs of Abuse Testing Market by Sample Type (Blood, Breath, Hair & Sweat, Saliva, Urine), Product Type (Analyzers - Breath Analyzers, Chromatographic Devices, Immunoassays Analyzers, Rapid Testing Devices - Oral Fluid Testing Devices, Urine Testing Devices, Consumables, Fluid Collection Devices, Others), Test Type (Criminal Justice Testing, Pain Management Testing, Work Place Screening), End Users (Diagnostics Laboratories, Forensic Laboratories, Hospitals, On-Site Testing) and Forecast 2017-2021 at https://www.ihealthcareanalyst.com/report/drugs-of-abuse-testing-market/The global drugs of abuse testing market segmentation is based on sample type (blood, breath, hair & sweat, saliva, urine), product type (analyzers - breath analyzers, chromatographic devices, immunoassays analyzers, rapid testing devices - oral fluid testing devices, urine testing devices, consumables, fluid collection devices, others), test type (criminal justice testing, pain management testing, work place screening), end users (diagnostics laboratories, forensic laboratories, hospitals, on-site testing).The global drugs of abuse testing market report provides market size (Revenue USD Million 2014 to 2021), market share, trends and forecasts growth trends (CAGR%, 2017 to 2021). The global drugs of abuse testing market research report is further segmented by geography into North America (U.S., Canada), Latin America (Brazil, Mexico, Rest of LA), Europe (U.K., Germany, France, Italy, Spain, Rest of EU), Asia Pacific (Japan, China, India, Rest of APAC), and Rest of the World. The global drugs of abuse testing market report also provides the detailed market landscape (market drivers, restraints, opportunities), market attractiveness analysis and also tracks the major competitors operating in the market by company overview, financial snapshot, key products, technologies and services offered, market share analysis and recent trends in the global market.Major players operating in the global drugs of abuse testing market and profiled in this report include Alere, Inc., Drägerwerk AG & Co. KGaA, Express Diagnostics International, Inc., F. Hoffmann La-Roche Ltd, Laboratory Corporation of America Holdings, Shimadzu Corporation, Siemens Healthineers, and Thermo Fisher Scientific, Inc.1. Sample Type1.1. Blood1.2. Breath1.3. Hair & Sweat1.4. Saliva1.5. Urine2. Product Type2.1. Analyzers2.1.1. Breath Analyzers2.1.2. Chromatographic Devices2.1.3. Immunoassays Analyzers2.2. Rapid Testing Devices2.2.1. Oral Fluid Testing Devices2.2.2. Urine Testing Devices2.3. Consumables2.3.1. Fluid Collection Devices2.4. Others3. Test Type3.1. Criminal Justice Testing3.2. Pain Management Testing3.3. Work Place Screening4. End Users4.1. Diagnostics Laboratories4.2. Forensic Laboratories4.3. Hospitals4.4. On-Site Testing5. Geography (Region, Country)5.1. North America (U.S., Canada)5.2. Latin America (Brazil, Mexico, Rest of LA)5.3. Europe (U.K., Germany, France, Italy, Spain, Rest of EU)5.4. Asia Pacific (Japan, China, India, Rest of APAC)5.5. Rest of the World6. Company Profiles6.1. Alere, Inc.6.2. Drägerwerk AG & Co. KGaA6.3. Express Diagnostics International, Inc.6.4. F. Hoffmann La-Roche Ltd6.5. Laboratory Corporation of America Holdings6.6. Shimadzu Corporation6.7. Siemens Healthineers6.8. Thermo Fisher Scientific, Inc.To request Table of Contents and Sample Pages of this report visit:https://www.ihealthcareanalyst.com/report/drugs-of-abuse-testing-market/About UsiHealthcareAnalyst, Inc. is a global healthcare market research and consulting company providing market analysis, and competitive intelligence services to global clients. The company publishes syndicate, custom and consulting grade healthcare reports covering animal healthcare, biotechnology, clinical diagnostics, healthcare informatics, healthcare services, medical devices, medical equipment, and pharmaceuticals.In addition to multi-client studies, we offer creative consulting services and conduct proprietary single-client assignments targeted at client’s specific business objectives, information needs, time frame and budget. Please contact us to receive a proposal for a proprietary single-client study.Contact UsiHealthcareAnalyst, Inc.2109, Mckelvey Hill Drive,Maryland Heights, MO 63043United StatesEmail: sales@ihealthcareanalyst.comWebsite: https://www.ihealthcareanalyst.com

Loading Shimadzu collaborators
Loading Shimadzu collaborators