Shimadzu

Kyoto, Japan
Kyoto, Japan
SEARCH FILTERS
Time filter
Source Type

— Global LC-MS Industry Report offers market overview, segmentation by types, application, countries, key manufactures, cost analysis, industrial chain, sourcing strategy, downstream buyers, marketing strategy analysis, distributors/traders, factors affecting market, forecast and other important information for key insight. Companies profiled in this report are Thermo Fisher Scientific, Waters, Agilent Technologies, Shimadzu, PerkinElmer, SCIEX, Bruker in terms of Basic Information, Manufacturing Base, Sales Area and Its Competitors, Sales, Revenue, Price and Gross Margin (2012-2017). Split by Product Types, with sales, revenue, price, market share of each type, can be divided into • Single Quadrupole LC-MS • Triple Quadrupole LC-MS • Ion Trap LC-MS • Others Split by applications, this report focuses on sales, market share and growth rate of LC-MS in each application, can be divided into • Academic • Pharma • Food & Environment & Forensic • Clinical Purchase a copy of this report at: https://www.themarketreports.com/report/buy-now/495864 Table of Content: 1 LC-MS Market Overview 2 Global LC-MS Sales, Revenue (Value) and Market Share by Manufacturers 3 Global LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 4 Global LC-MS Manufacturers Profiles/Analysis 5 North America LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 6 Latin America LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 7 Europe LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 8 Asia-Pacific LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 9 Middle East and Africa LC-MS Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 10 LC-MS Manufacturing Cost Analysis 11 Industrial Chain, Sourcing Strategy and Downstream Buyers 12 Marketing Strategy Analysis, Distributors/Traders 13 Market Effect Factors Analysis 14 Global LC-MS Market Forecast (2017-2022) 15 Research Findings and Conclusion 16 Appendix Inquire more for more details about this report at: https://www.themarketreports.com/report/ask-your-query/495864 For more information, please visit https://www.themarketreports.com/report/2017-2022-global-top-countries-lc-ms-market-report


— Global Universal Testing Machine Industry Report offers market overview, segmentation by types, application, countries, key manufactures, cost analysis, industrial chain, sourcing strategy, downstream buyers, marketing strategy analysis, distributors/traders, factors affecting market, forecast and other important information for key insight. Companies profiled in this report are Mts, Instron, Zwick/Roell, Shimadzu, Admet, Hegewald & Peschke, Ametek(Lloyd), Torontech Group, Keysight Technologies, Qualitest International, Tinius Olsen, Applied Test Systems, Ets Intarlaken, Jinan Shijin Group, Suns, Tenson, Changchun Kexin Test Instrument, Wance Group, Shanghai Hualong, Tianshui Hongshan, Laizhou Huayin, Shenzhen Reger, Hung Ta, Shandong Drick, Jinan Kehui, Jinan Fine, Jinan Liangong, Hrj in terms of Basic Information, Manufacturing Base, Sales Area and Its Competitors, Sales, Revenue, Price and Gross Margin (2012-2017). Split by Product Types, with sales, revenue, price, market share of each type, can be divided into • Single Column Testing Machine • Dual Column Testing Machine • Other (Four Column Testing Machine, etc.) Split by applications, this report focuses on sales, market share and growth rate of Universal Testing Machine in each application, can be divided into • Scientific and Education • Industrial Application Purchase a copy of this report at: https://www.themarketreports.com/report/buy-now/424286 Table of Content: 1 Universal Testing Machine Market Overview 2 Global Universal Testing Machine Sales, Revenue (Value) and Market Share by Manufacturers 3 Global Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 4 Global Universal Testing Machine Manufacturers Profiles/Analysis 5 North America Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 6 Latin America Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 7 Europe Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 8 Asia-Pacific Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 9 Middle East and Africa Universal Testing Machine Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 10 Universal Testing Machine Manufacturing Cost Analysis 11 Industrial Chain, Sourcing Strategy and Downstream Buyers 12 Marketing Strategy Analysis, Distributors/Traders 13 Market Effect Factors Analysis 14 Global Universal Testing Machine Market Forecast (2017-2022) 15 Research Findings and Conclusion 16 Appendix Inquire more for more details about this report at: https://www.themarketreports.com/report/ask-your-query/424286 For more information, please visit https://www.themarketreports.com/report/2017-2022-global-top-countries-universal-testing-machine-market-report


— Global FTIR Spectrometer Industry Report offers market overview, segmentation by types, application, countries, key manufactures, cost analysis, industrial chain, sourcing strategy, downstream buyers, marketing strategy analysis, distributors/traders, factors affecting market, forecast and other important information for key insight. Companies profiled in this report are Thermo Fisher, Agilent, Perkin Elmer, Shimadzu, ABB, Bruker, Netzsch, Mettler Toledo, Jasco, Foss, MKS in terms of Basic Information, Manufacturing Base, Sales Area and Its Competitors, Sales, Revenue, Price and Gross Margin (2012-2017). Split by Product Types, with sales, revenue, price, market share of each type, can be divided into • Portable Type • Laboratory Type Split by applications, this report focuses on sales, market share and growth rate of FTIR Spectrometer in each application, can be divided into • Organic synthesis • Polymer science • Petrochemical engineering • Pharmaceutical industry • Food analysis Purchase a copy of this report at: https://www.themarketreports.com/report/buy-now/424358 Table of Content: 1 FTIR Spectrometer Market Overview 2 Global FTIR Spectrometer Sales, Revenue (Value) and Market Share by Manufacturers 3 Global FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 4 Global FTIR Spectrometer Manufacturers Profiles/Analysis 5 North America FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 6 Latin America FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 7 Europe FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 8 Asia-Pacific FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 9 Middle East and Africa FTIR Spectrometer Sales, Revenue (Value) by Countries, Type and Application (2012-2017) 10 FTIR Spectrometer Manufacturing Cost Analysis 11 Industrial Chain, Sourcing Strategy and Downstream Buyers 12 Marketing Strategy Analysis, Distributors/Traders 13 Market Effect Factors Analysis 14 Global FTIR Spectrometer Market Forecast (2017-2022) 15 Research Findings and Conclusion 16 Appendix Inquire more for more details about this report at: https://www.themarketreports.com/report/ask-your-query/424358 For more information, please visit https://www.themarketreports.com/report/2017-2022-global-top-countries-ftir-spectrometer-market-report


Drugs of Abuse Testing Market by Samples, Products, Tests, Growth Trends and Forecast to 2021, Upcoming Report by iHealthcareAnalyst, Inc. Drugs of Abuse Testing Market by Sample Type (Blood, Breath, Hair & Sweat, Saliva, Urine), Product Type (Analyzers - Breath Analyzers, Chromatographic Devices, Immunoassays Analyzers, Rapid Testing Devices - Oral Fluid Testing Devices, Urine Testing Devices, Consumables, Fluid Collection Devices, Others), Test Type (Criminal Justice Testing, Pain Management Testing, Work Place Screening), End Users (Diagnostics Laboratories, Forensic Laboratories, Hospitals, On-Site Testing) and Forecast Maryland Heights, MO, April 27, 2017 --( Browse Drugs of Abuse Testing Market by Sample Type (Blood, Breath, Hair & Sweat, Saliva, Urine), Product Type (Analyzers - Breath Analyzers, Chromatographic Devices, Immunoassays Analyzers, Rapid Testing Devices - Oral Fluid Testing Devices, Urine Testing Devices, Consumables, Fluid Collection Devices, Others), Test Type (Criminal Justice Testing, Pain Management Testing, Work Place Screening), End Users (Diagnostics Laboratories, Forensic Laboratories, Hospitals, On-Site Testing) and Forecast 2017-2021 at https://www.ihealthcareanalyst.com/report/drugs-of-abuse-testing-market/ The global drugs of abuse testing market segmentation is based on sample type (blood, breath, hair & sweat, saliva, urine), product type (analyzers - breath analyzers, chromatographic devices, immunoassays analyzers, rapid testing devices - oral fluid testing devices, urine testing devices, consumables, fluid collection devices, others), test type (criminal justice testing, pain management testing, work place screening), end users (diagnostics laboratories, forensic laboratories, hospitals, on-site testing). The global drugs of abuse testing market report provides market size (Revenue USD Million 2014 to 2021), market share, trends and forecasts growth trends (CAGR%, 2017 to 2021). The global drugs of abuse testing market research report is further segmented by geography into North America (U.S., Canada), Latin America (Brazil, Mexico, Rest of LA), Europe (U.K., Germany, France, Italy, Spain, Rest of EU), Asia Pacific (Japan, China, India, Rest of APAC), and Rest of the World. The global drugs of abuse testing market report also provides the detailed market landscape (market drivers, restraints, opportunities), market attractiveness analysis and also tracks the major competitors operating in the market by company overview, financial snapshot, key products, technologies and services offered, market share analysis and recent trends in the global market. Major players operating in the global drugs of abuse testing market and profiled in this report include Alere, Inc., Drägerwerk AG & Co. KGaA, Express Diagnostics International, Inc., F. Hoffmann La-Roche Ltd, Laboratory Corporation of America Holdings, Shimadzu Corporation, Siemens Healthineers, and Thermo Fisher Scientific, Inc. 1. Sample Type 1.1. Blood 1.2. Breath 1.3. Hair & Sweat 1.4. Saliva 1.5. Urine 2. Product Type 2.1. Analyzers 2.1.1. Breath Analyzers 2.1.2. Chromatographic Devices 2.1.3. Immunoassays Analyzers 2.2. Rapid Testing Devices 2.2.1. Oral Fluid Testing Devices 2.2.2. Urine Testing Devices 2.3. Consumables 2.3.1. Fluid Collection Devices 2.4. Others 3. Test Type 3.1. Criminal Justice Testing 3.2. Pain Management Testing 3.3. Work Place Screening 4. End Users 4.1. Diagnostics Laboratories 4.2. Forensic Laboratories 4.3. Hospitals 4.4. On-Site Testing 5. Geography (Region, Country) 5.1. North America (U.S., Canada) 5.2. Latin America (Brazil, Mexico, Rest of LA) 5.3. Europe (U.K., Germany, France, Italy, Spain, Rest of EU) 5.4. Asia Pacific (Japan, China, India, Rest of APAC) 5.5. Rest of the World 6. Company Profiles 6.1. Alere, Inc. 6.2. Drägerwerk AG & Co. KGaA 6.3. Express Diagnostics International, Inc. 6.4. F. Hoffmann La-Roche Ltd 6.5. Laboratory Corporation of America Holdings 6.6. Shimadzu Corporation 6.7. Siemens Healthineers 6.8. Thermo Fisher Scientific, Inc. To request Table of Contents and Sample Pages of this report visit: https://www.ihealthcareanalyst.com/report/drugs-of-abuse-testing-market/ About Us iHealthcareAnalyst, Inc. is a global healthcare market research and consulting company providing market analysis, and competitive intelligence services to global clients. The company publishes syndicate, custom and consulting grade healthcare reports covering animal healthcare, biotechnology, clinical diagnostics, healthcare informatics, healthcare services, medical devices, medical equipment, and pharmaceuticals. In addition to multi-client studies, we offer creative consulting services and conduct proprietary single-client assignments targeted at client’s specific business objectives, information needs, time frame and budget. Please contact us to receive a proposal for a proprietary single-client study. Contact Us iHealthcareAnalyst, Inc. 2109, Mckelvey Hill Drive, Maryland Heights, MO 63043 United States Email: sales@ihealthcareanalyst.com Website: https://www.ihealthcareanalyst.com Maryland Heights, MO, April 27, 2017 --( PR.com )-- Drugs of abuse testing is used to screen for and confirm the presence of several drugs in a person's sample, such as urine, blood, breath, saliva or hair. Drug testing is used so that a person may receive appropriate medical treatment or be screened for or monitored for illegal drug use. Some of the most commonly screened drugs include amphetamine and methamphetamine, barbiturates such as phenobarbital, secobarbital and pentobarbital, benzodiazepines such as diazepam, lorazepam and oxazepam, marijuana, cocaine, methadone, opiates, such as heroin, codeine and morphine, and phencyclidine. Drugs of abuse testing may be used for medical screening, legal or forensic information, employment drug testing, sports or athletics testing, and monitoring pain medication use.Browse Drugs of Abuse Testing Market by Sample Type (Blood, Breath, Hair & Sweat, Saliva, Urine), Product Type (Analyzers - Breath Analyzers, Chromatographic Devices, Immunoassays Analyzers, Rapid Testing Devices - Oral Fluid Testing Devices, Urine Testing Devices, Consumables, Fluid Collection Devices, Others), Test Type (Criminal Justice Testing, Pain Management Testing, Work Place Screening), End Users (Diagnostics Laboratories, Forensic Laboratories, Hospitals, On-Site Testing) and Forecast 2017-2021 at https://www.ihealthcareanalyst.com/report/drugs-of-abuse-testing-market/The global drugs of abuse testing market segmentation is based on sample type (blood, breath, hair & sweat, saliva, urine), product type (analyzers - breath analyzers, chromatographic devices, immunoassays analyzers, rapid testing devices - oral fluid testing devices, urine testing devices, consumables, fluid collection devices, others), test type (criminal justice testing, pain management testing, work place screening), end users (diagnostics laboratories, forensic laboratories, hospitals, on-site testing).The global drugs of abuse testing market report provides market size (Revenue USD Million 2014 to 2021), market share, trends and forecasts growth trends (CAGR%, 2017 to 2021). The global drugs of abuse testing market research report is further segmented by geography into North America (U.S., Canada), Latin America (Brazil, Mexico, Rest of LA), Europe (U.K., Germany, France, Italy, Spain, Rest of EU), Asia Pacific (Japan, China, India, Rest of APAC), and Rest of the World. The global drugs of abuse testing market report also provides the detailed market landscape (market drivers, restraints, opportunities), market attractiveness analysis and also tracks the major competitors operating in the market by company overview, financial snapshot, key products, technologies and services offered, market share analysis and recent trends in the global market.Major players operating in the global drugs of abuse testing market and profiled in this report include Alere, Inc., Drägerwerk AG & Co. KGaA, Express Diagnostics International, Inc., F. Hoffmann La-Roche Ltd, Laboratory Corporation of America Holdings, Shimadzu Corporation, Siemens Healthineers, and Thermo Fisher Scientific, Inc.1. Sample Type1.1. Blood1.2. Breath1.3. Hair & Sweat1.4. Saliva1.5. Urine2. Product Type2.1. Analyzers2.1.1. Breath Analyzers2.1.2. Chromatographic Devices2.1.3. Immunoassays Analyzers2.2. Rapid Testing Devices2.2.1. Oral Fluid Testing Devices2.2.2. Urine Testing Devices2.3. Consumables2.3.1. Fluid Collection Devices2.4. Others3. Test Type3.1. Criminal Justice Testing3.2. Pain Management Testing3.3. Work Place Screening4. End Users4.1. Diagnostics Laboratories4.2. Forensic Laboratories4.3. Hospitals4.4. On-Site Testing5. Geography (Region, Country)5.1. North America (U.S., Canada)5.2. Latin America (Brazil, Mexico, Rest of LA)5.3. Europe (U.K., Germany, France, Italy, Spain, Rest of EU)5.4. Asia Pacific (Japan, China, India, Rest of APAC)5.5. Rest of the World6. Company Profiles6.1. Alere, Inc.6.2. Drägerwerk AG & Co. KGaA6.3. Express Diagnostics International, Inc.6.4. F. Hoffmann La-Roche Ltd6.5. Laboratory Corporation of America Holdings6.6. Shimadzu Corporation6.7. Siemens Healthineers6.8. Thermo Fisher Scientific, Inc.To request Table of Contents and Sample Pages of this report visit:https://www.ihealthcareanalyst.com/report/drugs-of-abuse-testing-market/About UsiHealthcareAnalyst, Inc. is a global healthcare market research and consulting company providing market analysis, and competitive intelligence services to global clients. The company publishes syndicate, custom and consulting grade healthcare reports covering animal healthcare, biotechnology, clinical diagnostics, healthcare informatics, healthcare services, medical devices, medical equipment, and pharmaceuticals.In addition to multi-client studies, we offer creative consulting services and conduct proprietary single-client assignments targeted at client’s specific business objectives, information needs, time frame and budget. Please contact us to receive a proposal for a proprietary single-client study.Contact UsiHealthcareAnalyst, Inc.2109, Mckelvey Hill Drive,Maryland Heights, MO 63043United StatesEmail: sales@ihealthcareanalyst.comWebsite: https://www.ihealthcareanalyst.com


Global Metabolomics Market by Detection and Separation Techniques, and Applications, Growth Trends and Forecast to 2021, by iHealthcareAnalyst, Inc. Metabolomics Market by Detection and Separation Techniques, and Applications (Biomarker Discovery, Clinical Toxicology, Drug Assessment, and Nutrigenomics) and Forecast 2017-2021 Maryland Heights, MO, April 15, 2017 --( Browse Metabolomics Market by Detection and Separation Techniques, and Applications (Biomarker Discovery, Clinical Toxicology, Drug Assessment, and Nutrigenomics) and Forecast 2017-2021 report at https://www.ihealthcareanalyst.com/report/metabolomics-market/ The global metabolomics market report estimates the market size (Revenue USD million - 2014 to 2021) and key market segments based on detection and separation techniques used, its applications (biomarker discovery, clinical toxicology, drug assessment, and nutrigenomics), and forecasts growth trends (CAGR% - 2017 to 2021). The global metabolomics market research report is further segmented by geography into North America (U.S., Canada), Latin America (Brazil, Mexico, Rest of LA), Europe (U.K., Germany, France, Italy, Spain, Rest of EU), Asia Pacific (Japan, China, India, Rest of APAC), and Rest of the World. The global metabolomics market report also provides the detailed market landscape, market drivers, restraints, opportunities), market attractiveness analysis and profiles of major competitors in the global market including company overview, financial snapshot, key products, technologies and services offered, and recent developments. Major players operating in the global metabolomics market and included in this report are Agilent Technologies, Inc., Thermo Fisher Scientific, Inc., Shimadzu Corporation, and Waters Corporation. 1. Technique 1.1. Detection Techniques 1.2. Separation Techniques 2. Application 2.1. Biomarker Discovery 2.2. Clinical Toxicology 2.3. Drug Assessment 2.4. Nutrigenomics 3. Geography (Region, Country) 3.1. North America (U.S., Canada) 3.2. Latin America (Brazil, Mexico, Rest of LA) 3.3. Europe (U.K., Germany, France, Italy, Spain, Rest of EU) 3.4. Asia Pacific (Japan, China, India, Rest of APAC) 3.5. Rest of the World 4. Company Profiles 4.1. Agilent Technologies Inc. 4.2. Biocrates Life Sciences AG 4.3. Bio-Rad Laboratories, Inc. 4.4. Bruker Corporation 4.5. Human Metabolome Technologies Inc. 4.6. LECO Corporation 4.7. Metabolon Inc. 4.8. Shimadzu Corporation 4.9. ThermoFisher Scientific Inc. 4.10. Waters Corporation To request Table of Contents and Sample Pages of this report visit: https://www.ihealthcareanalyst.com/report/metabolomics-market/ About Us iHealthcareAnalyst, Inc. is a global healthcare market research and consulting company providing market analysis, and competitive intelligence services to global clients. The company publishes syndicate, custom and consulting grade healthcare reports covering animal healthcare, biotechnology, clinical diagnostics, healthcare informatics, healthcare services, medical devices, medical equipment, and pharmaceuticals. In addition to multi-client studies, we offer creative consulting services and conduct proprietary single-client assignments targeted at client’s specific business objectives, information needs, time frame and budget. Please contact us to receive a proposal for a proprietary single-client study. Contact Us iHealthcareAnalyst, Inc. 2109, Mckelvey Hill Drive, Maryland Heights, MO 63043 United States Email: sales@ihealthcareanalyst.com Website: https://www.ihealthcareanalyst.com Maryland Heights, MO, April 15, 2017 --( PR.com )-- Metabolomics is the scientific study of chemical processes involving metabolites, whereas metabolome represents the collection of all metabolites in a biological cell, tissue, organ or organism, which are the end products of cellular processes. mRNA gene expression data and proteomic analyses reveal the set of gene products being produced in the cell, data that represents one aspect of cellular function including systems biology and functional genomics that integrates proteomic, transcriptomic, and metabolomic information to provide a better understanding of cellular biology. Metabolomics is an advanced, specialized form of analytical biochemistry that involves the study of chemical processes involving metabolites. Metabolomics enables simultaneous identification and analysis of multiple metabolites in cells, tissues and body fluids. The research funding for metabolomics has increased over the years in the major areas of research includes characterization and identification of novel biomarkers, therapeutic targets, and disease signatures in the area of cancer metabolomics.Browse Metabolomics Market by Detection and Separation Techniques, and Applications (Biomarker Discovery, Clinical Toxicology, Drug Assessment, and Nutrigenomics) and Forecast 2017-2021 report at https://www.ihealthcareanalyst.com/report/metabolomics-market/The global metabolomics market report estimates the market size (Revenue USD million - 2014 to 2021) and key market segments based on detection and separation techniques used, its applications (biomarker discovery, clinical toxicology, drug assessment, and nutrigenomics), and forecasts growth trends (CAGR% - 2017 to 2021). The global metabolomics market research report is further segmented by geography into North America (U.S., Canada), Latin America (Brazil, Mexico, Rest of LA), Europe (U.K., Germany, France, Italy, Spain, Rest of EU), Asia Pacific (Japan, China, India, Rest of APAC), and Rest of the World. The global metabolomics market report also provides the detailed market landscape, market drivers, restraints, opportunities), market attractiveness analysis and profiles of major competitors in the global market including company overview, financial snapshot, key products, technologies and services offered, and recent developments.Major players operating in the global metabolomics market and included in this report are Agilent Technologies, Inc., Thermo Fisher Scientific, Inc., Shimadzu Corporation, and Waters Corporation.1. Technique1.1. Detection Techniques1.2. Separation Techniques2. Application2.1. Biomarker Discovery2.2. Clinical Toxicology2.3. Drug Assessment2.4. Nutrigenomics3. Geography (Region, Country)3.1. North America (U.S., Canada)3.2. Latin America (Brazil, Mexico, Rest of LA)3.3. Europe (U.K., Germany, France, Italy, Spain, Rest of EU)3.4. Asia Pacific (Japan, China, India, Rest of APAC)3.5. Rest of the World4. Company Profiles4.1. Agilent Technologies Inc.4.2. Biocrates Life Sciences AG4.3. Bio-Rad Laboratories, Inc.4.4. Bruker Corporation4.5. Human Metabolome Technologies Inc.4.6. LECO Corporation4.7. Metabolon Inc.4.8. Shimadzu Corporation4.9. ThermoFisher Scientific Inc.4.10. Waters CorporationTo request Table of Contents and Sample Pages of this report visit: https://www.ihealthcareanalyst.com/report/metabolomics-market/About UsiHealthcareAnalyst, Inc. is a global healthcare market research and consulting company providing market analysis, and competitive intelligence services to global clients. The company publishes syndicate, custom and consulting grade healthcare reports covering animal healthcare, biotechnology, clinical diagnostics, healthcare informatics, healthcare services, medical devices, medical equipment, and pharmaceuticals.In addition to multi-client studies, we offer creative consulting services and conduct proprietary single-client assignments targeted at client’s specific business objectives, information needs, time frame and budget. Please contact us to receive a proposal for a proprietary single-client study.Contact UsiHealthcareAnalyst, Inc.2109, Mckelvey Hill Drive,Maryland Heights, MO 63043United StatesEmail: sales@ihealthcareanalyst.comWebsite: https://www.ihealthcareanalyst.com


News Article | April 26, 2017
Site: www.eurekalert.org

A highly sensitive method that can detect even the earlier stages of colorectal cancer has been developed by researchers in Japan. Shimadzu Corporation, the Kobe University Graduate School of Medicine, and the National Cancer Center in Japan have collaborated to develop a new screening method that comprehensively analyzes the metabolites in our blood. The results of this research were published in the online edition of Oncotarget, a U.S. scientific publication, on February 4, 2017. Colorectal cancer is one of the most common causes of cancer death, and cases of this cancer are increasing in developed countries. In 2012, a group headed by Associate Professor YOSHIDA Masaru at Kobe University used gas chromatography-mass spectrometry (GC/MS) and clinical metabolomic analysis methods to analyze serum samples from colorectal cancer patients and healthy subjects. The group succeeded in identifying four metabolite markers that can be used to diagnose colorectal cancer and developed a highly reliable diagnostic prediction model using those markers. This model was considered to be more practical in comparison with existing tumor markers, but it lacked sensitivity and specificity when actually used as a screening method. Following this, a research team combining members from Shimadzu Corporation and Kobe University developed an analytical approach that enabled much more accurate measurement of metabolites in blood plasma. To achieve this, they used high-speed and high-sensitivity GC-MS/MS, which relies on Shimadzu's Advanced Scanning Speed Protocol (ASSP) and Smart MRM technologies. By using this approach to analyze a large number of samples (at least 600) with known clinical data stored at the National Cancer Center, they were able to develop a high-performance screening method. After reviewing the results of comprehensive analyses of the metabolites contained in blood plasma from colorectal cancer patients and healthy subjects, they discovered eight multi-biomarkers that can be used to diagnose colorectal cancer. Based on the data for these eight metabolites, they were able to create a diagnostic prediction model for colorectal cancer that exceeded 96% for both sensitivity and specificity. They also confirmed that the sensitivity of this new model remained at high levels even with early-stage colorectal cancer patients (stage 0 and stage I).


No statistical methods were used to predetermine sample sizes. All behaviour data were collected in a random manner. No blinding method was used in assessing experimental outcomes. The following flies were obtained from Bloomington Stock Center: isogenized w1118 (BL5905), norpAP24 (BL9048), ninaE-norpA (rh1>norpA; this is a direct fusion of the ninaE promoter to the norpA coding region; BL52276), ninaE–Gal4 (rh1–Gal4; BL8691), trpMB (BL23636), trplMB (BL29314), UAS–mcherry-NLS (BL38425), gl60j (BL 509), pdf–Gal4 (BL6900), and two UAS–plc21C RNAi lines (01210, BL 31269 and 01211, BL31270). GMR–hid31 was obtained from the Drosophila Genetic Resource Center, Kyoto (108419). We used w1118 as the control strain. The UAS–rh7 RNAi line (v1478) was from VDRC Stock Center. The tim–Gal4 transgene32 was provided by A. Sehgal. The cry–Gal4.E13 transgene2 was from M. Rosbash. The cryb and cry01 flies2, 33 were provided by M. Wu and the rh502, rh601, UAS-rh3, UAS-rh4 and UAS-rh5 lines34, 35 were provided by C. Desplan. We also used ninaEI17 flies36. To clone the rh7 coding region, we prepared mRNA from w1118 heads, performed reverse transcription (RT)-PCR using the following primers, and cloned the cDNA into the TOPO vector (pCR2.1-TOPO, Invitrogen). Primers: rh7 forward, GCGGCCGCCACCATGGAGGCCATCATCATGACG; rh7 reverse, GCGGCCGCTCAGAACTTACTCTGTTCCATGAC. To generate the UAS–rh7 transgene, we subcloned the rh7 open reading frame into the NotI site of the pUAST vector. To construct the plasmid for expression of Rh7 in HEK293T cells, we subcloned the rh7 open reading frame between the BamH1 and Xba1 sites of the pCS2+MT vector using the following primers: rh7 forward, ATCAGATCTCACCATGGAGGCCATCATCATGACG; rh7 reverse, ATCTCTAGATCAGAACTTACTCTGTTCCATGAC. To generate transgenic flies expressing an Rh7–FLAG fusion protein, we first constructed the pUAST–FLAG vector using the following two oligonucleotides, which we annealed and cloned into the XhoI and XbaI sites of the pUAST vector: FLAG 5′-XbaI, TCGAGGGGATTACAAGGATGACGACGATAAGTAAT and FLAG 3′-XhoI, CTAGATTACTTATCGTCGTCATCCTTGTAATCCCC. We amplified the rh7 coding region using the same forward primer as above, in conjunction with the following reverse primer to eliminate the stop codon: rh7 reverseno-stop, GCGGCCGCGAACTTACTCTGTTCCATGAC. Both the UAS–rh7 and UAS–rh7–FLAG transgenic flies were obtained by germline transformation using w1118 embryos (Bestgene Inc.). To generate flies expressing an rh7+ genomic transgene (P[rh7+]), a BAC genomic DNA clone (CH322180G19) was obtained from the P[acman] collection37. The germline transformation took advantage of site-specific integration using the Φ31-attB/attP system (Bestgene Inc.). We produced the plasmid for knocking out rh7 by ends-out homologous recombination38 as follows. We PCR amplified two homologous arms (left, 3.2 kb and right, 3.3 kb) using the following primers: left arm forward, AATTGCTGGGATCCCTCAATTGGCCTAATCGGTTTCTG; left arm reverse, AATTGCTGGGTACCGACTGACTTGGCCAAATATTTACG; right arm forward, AATGCTGGCGGCCGCTTAAAATGCTGCCCGAGACT; right arm reverse, AATTGCTGGCGGCCGCTGGCTTATGAAGTTGCAAAAAG. We cloned the two arms into the targeting vector, pw35loxp–Gal4. This construct was designed to delete 540 base pairs (bp) 3′ to the rh7 translational start site, and was replaced with a cassette containing the mini-white marker and Gal4 flanked by two loxP sites. The upstream loxP sequence contained a translational start site that rendered the Gal4 coding region out of frame. Consequently, the Gal4 was not functional. To obtain the donor lines for generating the rh7 knockout (rh71 allele), the targeting vector was injected into w1118 embryos (Bestgene Inc.). We mobilized the donor insertion by crossing the donor line to y,w;P[70FLP]11 P[70I-SceI]2B nocSco/CyO flies (Bloomington Stock Center, BL6934). The progeny were screened for gene targeting in the rh7 locus by PCR using two pairs of primers. The first pair (P1 and P2) were the following two primers that annealed to the first and second coding exons, and produced a DNA product (885 bp) only in the wild-type (Extended Data Fig. 2g): P1, CTCTCGCTCTCCGAGATGTT and P2, ACCACCGAAATCAGGCAATA. The following second pair of primers (P3 and P4) annealed to the mini-white gene and to a sequence 3′ to rh7, and therefore only generated a product in the rh71 mutant (4.4 kb; Extended Data Fig. 2g): P3, TGTACATAAAAGCGAACCGAACCT and P4, ACTGTGCGACAGAGTGAGAGAGCAATAGTA. After generating rh71, we outcrossed the flies to the control stain (w1118) for five generations. To determine whether the key fly lines used in this study harboured the perSLIH, timls or jetc mutations in the genetic background, we performed DNA sequencing. We extracted genomic DNA from adult flies, and amplified the relevant regions in the per, tim and jet genes by PCR (Phusion High-Fidelity DNA Polymerase, NEB) using the following primers: per: forward, GTCCACACACAACACCAAGG; reverse, TTGATGATCATGTCGCTGCT. tim: forward, TGGCTGGGGATTGAAAATAA; reverse, TTACAGATACCGCGCAAATG. jet: forward, AGCCGATCATAGTGGAGTGC; reverse, AAGGCACGCACAGGTTTACT. We purified the PCR products and subjected them to DNA sequencing (DNA Sequencing Facility at the University of California, Berkeley). The perSLIH allele has a C to A transversion at nucleotide 2688438. The control (per+) sequence encompassing this region (2688436–2688448, Drosophila genome release r6.14) is CTCCGGCAGCAGT. The perSLIH sequence is CTACGGCAGCAGT. All of the fly lines checked had sequences that matched per+. These include: (1) rh71, (2) rh71 cryb, (3) rh71 cry01, (4) pdf–Gal4 and (5) rh7-RNAi. The timls allele has a single nucleotide insertion (C) after nucleotide 3504474 relative to tims. The sequence spanning this region in the control (timls) is ATCAAAGTTCTGAT (3504473–3504486, Drosophila genome release r6.14) and in tims is ATAAAGTTCTGAT. We sequenced the following lines, all which had sequences that matched the control (tims): (1) cry01, (2) rh71 and (3) P[rh7+]; rh71. The jetc allele has a T-to-A transversion at nucleotide 4949048. The control (jet+) sequence spanning this region (4949059–4949047, Drosophila genome release r6.14) is CTTGATTATCTTC, while the jetc sequence is CTTGATTATCTAC. We sequenced the following lines, all of which had sequences that matched the control (jet+): (1) cry01, (2) rh71 and (3) P[rh7+];rh71. To quantify expression of opsin genes (Fig. 1b), we isolated total RNA from ~50 fly heads from each of the indicated fly stocks, and used 1 μg total RNA from each sample as a template for reverse transcription using SuperScript III Reverse Transcriptase (ThermoFisher, cat. 18080093). Oligo dT primers were used for cDNA synthesis. cDNA preparation was subjected to real-time quantitative PCR (Roche, LightCycler 480 system) according to the LightCycler 480 SYBR Green 1 Master Mix (cat. 04707516001) protocol. The primers used for real-time quantitative PCR were: rh1: forward CGCTACCAAGTGATCGTCAA, reverse GTATGAGCGTGGGTTCCAGT. rh2: forward TCCGTGCTGGACAATGTG, reverse AATCATGCACATGGACCAGA. rh3: forward CGAGCAAAAGAACAGGAAGC, reverse TCGATACGCGACTCTTTGTG. rh4: forward GTAGCCCTCTGGCACGAAT, reverse TCTTCAGCACATCCAAGTCG. rh5: forward TCCTGACCACCTGCTCCTTC, reverse GCTCCAGCTCCAGACGATAC. rh6: forward CAAGGACTGGTGGAACAGGT, reverse GTACTTCGGGTGGCTCAATC. rh7: forward GTTTCCACGGGTCTGACAAT, reverse GCTGTAGCACCAGATCAGCA. rp49: forward GACGCTTCAAGGGACAGTATCTG, reverse AAACGCGGTTCTGCATGAG. We also analysed opsin gene expression using an RNA-seq dataset (Fig. 1c). For each genotype, three independent RNA libraries were prepared from ~50 heads using the TruSeq Stranded mRNA Library Prep Kit. Pair-end sequencing was performed using the TruSeq platform (Illumina). Details of the RNA-seq experiments and data analysis will be presented elsewhere (J.D.N., I. Tekin and C.M., in preparation). Opsin RNA-seq mRNA levels were quantified as RPKM. RPKMs for each opsin were calculated independently and the average RPKMs are plotted. To knock-down plc21C expression, we combined each UAS–plc21C RNAi transgene (01210 and 01211) with UAS–Dicer2;;actin–Gal4. To quantify the efficacy of the RNAi, we extracted total RNA from ten adult flies (five male and five female), and used 1 μg total RNA from each sample as a template for reverse transcription using SuperScript III Reverse Transcriptase (ThermoFisher, cat. 18080093). Oligo dT primers were used for cDNA synthesis. cDNA preparation was subjected to quantitative PCR (Roche, LightCycler 480 system) according to the LightCycler 480 SYBR Green 1 Master Mix (cat. 04707516001) protocol. The plc21C primers used were: forward, GGATCTCTCCAAGTCGTTCG; reverse, TAGCCGCTTCACCAGCTTAT. The rp49 primers were: forward, GACGCTTCAAGGGACAGTATCTG; reverse, AAACGCGGTTCTGCATGAG. In each reaction, we normalized expression of plc21C transcripts to rp49. To obtain Rh7 antibodies, we generated a GST–Rh7 fusion protein by subcloning the region encoding the N-terminal 80 amino acids into the pGEX6P-1 vector (GE Healthcare Life Science). We expressed the fusion protein in Escherichia coli (BL21), purified the recombinant protein using glutathione sepharose beads (GE Healthcare Life Science) and generated antiserum in a rabbit (Covance). We affinity purified the antibodies by conjugating the antigen to Affi-Gel 10 (Bio-Rad). We performed immunohistochemistry using whole-mounted fly brains as described previously39. Briefly, we fixed dissected brains for 15–20 min at 4 °C in 4% paraformaldehyde in phosphate buffer (0.1 M Na PO , pH 7.4) with 0.3% Triton-X100 (Sigma), hereafter referred to as PBT. The brains were blocked with 5% normal goat serum (Sigma) in phosphate buffer for 1 h at 4 °C. We then incubated the tissue with primary antibodies at 4 °C for ≥24 h. After three washes in PBT, the brains were incubated overnight at 4 °C with the following secondary antibodies from Life Technologies: anti-mouse Alexa Fluor 488 or 568 Dyes, anti-rabbit Alexa Fluor 488 or 568 Dyes or Alexa dyes. The brains were washed three times with PBT and mounted in VECTASHIELD mounting medium (Vector Labs) for imaging. For Rh7 and PDF co-staining (Fig. 2d–i), four brains were examined. To analyse light-mediated degradation of Tim (Fig. 3c–f), we entrained the flies for 3 days under 12 h light–12 h dark cycles (~600 lx LED white light). The flies were then exposed to a 5-min LED light stimulation (~600 lx) at ZT22, kept in the dark for 55 min, fixed at ZT23 under a red photographic safety light (for 45 min), and dissected for whole-mount immunostaining. Flies that were not exposed to the nocturnal light treatment were fixed and stained at the same time. To examine Per staining at different ZT points (Extended Data Fig. 9), flies were entrained for 4 days under 12 h light (~400 lx)–12 h dark cycles, and were collected at the indicated ZTs. For nighttime samples, we handled the flies under a red photographic safety light. We prefixed whole flies at 4 °C with 4% paraformaldehyde in PBT for 45 min before dissecting out the brains. After the dissections, the brains were fixed again for 15–20 min at 4 °C in 4% paraformaldehyde in PBT. We used the following primary antibodies: anti-Rh7 (1:250, rabbit), anti-Per (1:1,000, guinea pig), anti-Tim (1:1,000, rat)40, anti-PDF (1:1,000, c7 mouse monoclonal antibody from the Developmental Studies Hybridoma Bank), anti-dsRed (1:500, mouse, Clontech Catalog #632392). The Per and Tim antibodies were contributed by A. Sehgal. The secondary antibodies (Thermo Fisher Scientific) were anti-rat Alexa Fluor 568 Dye and anti-guinea pig Alexa Fluor 555 Dye. We acquired the images using a Zeiss LSM 700 confocal microscope. To perform whole-mount staining of the retina, we dissected the retina (within the eye cup) and fixed the tissue at 4 °C in 4% paraformaldehyde in PBT for 20 min. After washing briefly in PBT, we blocked the retina for 1 h in PBT plus with 5% normal goat serum. We used the following primary antibodies: anti-Rh7 (1:250, rabbit), anti-Rh3 (1:200, mouse, gift from S. Britt, University of Colorado, Denver) and anti-Rh5 (1:200, mouse, gift from S. Britt, University of Colorado, Denver). The secondary antibodies were: anti-rabbit Alexa Fluor 568 Dye (1:1000) and anti-mouse Alexa Fluor 488 Dye (1:1000). Circadian experiments were performed at 25 °C using the Drosophila Activity Monitoring (DAM) System (Trikinetics). Individual 3–7-day-old male flies were loaded into monitoring tubes, which contained 1% agarose (Invitrogen) and 5% sucrose (Sigma) as the food source. The flies were entrained to 12 h light–12 h dark cycles for 4 days and released to constant darkness or constant light (10 lx for dim light conditions and 400 lx for bright light conditions, unless indicated otherwise) for at least six days to measure periodicity. Data collection and analyses were performed using Clocklab (Actimetrics). Activity data for each fly were binned every 30 min for the circadian analyses. To obtain the periodicities, data from constant darkness were subjected to χ2 periodograms and fast Fourier transfer analysis using Clocklab software. The rhythm strength of a fly was measured as the power minus the significance (p − s). Flies were considered arrhythmic based on either p − s < 10 or FFT < 0.03. Actograms of weakly rhythmic flies were visually inspected to confirm rhythmicity. To investigate the effects on activity of 5-min light pulses at night (Fig. 3a, b; Extended Data Figs 4, 10), we first entrained the flies for 3 days under 12 h light–12 h dark cycles (~600 lx LED white light). During the night of the fourth L–D cycle (at ZT14, ZT16, ZT18, ZT20 or ZT22), we exposed the flies to a single 5-min light pulse (LED white light, ~600 lx), and then maintained the flies under constant darkness. The phase shift was calculated as the phase difference of the evening peaks before and after the light pulse. Negative and positive phase changes indicate phase delays and phase advances, respectively. To conduct the phase delay experiments (Fig. 3g–l), we first entrained the flies for 4 days under 12 h light–12 h dark cycles (~400 lx LED white light). To obtain a phase delay of 8 h, on day 5 we extended the light phase to 20 h, and then returned the flies to normal 12 h dark–12 h light cycles. The phase shift magnitude was calculated as the phase difference between the evening peak of the day before the phase shift and the indicated day after the phase shift. To assess light-dependent arousal, we entrained the flies for 4 days under 12 h light–12 h dark cycles and then exposed the flies to a 5-min white light pulse (~600 lx LED lights) at ZT22. We binned the activity data for each fly every minute. ‘Light-coincident arousal’ is the increase in locomotion activity (bin-crosses) during the 5-min stimulation compared to the previous 5 min. ‘Arousal delay’ is the time between lights on and maximum activity. The HEK293T cells were obtained from the ATCC, which authenticates their lines. This line has not been tested for mycoplasma contamination. The HEK293T cells were cultured to 70% confluency and transfected with 2 μg pCS2+MT-rh7 plasmid per 10-cm dish. We used the FuGENE HD Transfection Reagent (Cat.E2311) to perform the transfections. Cells were harvested 24–36 h after transfection and stored at −80 °C. For reconstitution of Rh7 with the chromophore, the HEK293T cells were resuspended in cold PBS (pH 7.4, Quality Biological Inc.) supplemented with a protease inhibitor cocktail (Sigma P8340) and incubated with 40 μM 11-cis-retinal in the dark for 4 h. We prepared membrane protein extracts by resuspending membrane pellets in 0.1% CHAPs in PBS, rotating for 2 h at 4 °C, then centrifuging (14,000g) for 20 min at 4 °C. The supernatants were removed and analysed with a UV3600 UV-Nir-NIR Spectrometer (Shimadzu). To obtain the spectral absorption for Rh7, we used membrane extracts from untransfected cells as the blank. ERG recordings were performed by filling two glass electrodes with Drosophila Ringer’s solution (3 mM CaCl , 182 mM KCl, 46 mM NaCl, 10 mM Tris pH 7.2) and placing small droplets of electrode cream on the surface of the compound eye and the thorax to increase conductance. We inserted the recording electrode into the cream on the surface of the compound eye and the reference electrode into the cream on the thorax. Flies were dark adapted for 1 min before stimulating with a 2-s pulse using a halogen light (~30 mV/cm2 unless indicated otherwise). The ERG signals were amplified with a Warner electrometer and recorded with a Powerlab 4/30 analogue-to-digital converter (AD Instruments). Data were collected and analysed with the Laboratory Chart version 6.1 program (AD Instruments). Patch-clamp measurements were performed on acutely dissected adult fly brains as described previously18, 19. Briefly, all patch-clamp recordings were performed during the daytime to avoid clock-dependent variance in firing rate. All l-LNvs were recorded within a relatively narrow daytime window, and recordings for each genotype were normally distributed for the time of day and did not vary significantly among all three genotypes. l-LNv recordings were made in whole-cell current clamp mode. After allowing the membrane properties to stabilize after whole cell break-in, we recorded for 30–60 s in the current clamp configuration (unless otherwise stated) under nearly dark conditions (~0.05 mW/cm2) before the lights were turned on. Lights-on data were collected for 5–20 s and this was followed by 60–120 s of darkness. Multiple light sources were used for these studies. We used a standard halogen light source on an Olympus BX51 WI microscope (Olympus USA) for all experiments with white light (400–1,000 nm, 4 mW/cm2). Orange light (550–1,000 nm; 4 mW/cm2) for electrophysiological recordings was achieved by placing appropriate combinations of 25 mm long- and short-pass filters (Edmund Industrial Optics) over the halogen light source directly beneath the recording chamber. We changed the filters during the recordings to internally match the neuronal responses to different wavelengths of light. Recordings using 405 nm violet light (0.8 mW/cm2) were obtained using LEDs obtained from Prizmatix 405 LED (UHP-Mic-LED-405), which provide >2 W collimated purple light (405 nm peak, 15 nm spectrum half width). Light was measured for all sources using a Newport 818-UV sensor and the Optical Power/Energy Meter (842-PE, Newport Corporation) and expressed as mW/cm2. The control genotype for the electrophysiological recordings was w;pdf-Gal4-dORK-NC1-GFP. The cry01 and rh71 recordings were performed using w;pdf-Gal4-dORK-NC1-GFP;cry01 and w;pdf-Gal4-dORK-NC1-GFP; rh71, respectively. To analyse two sets of data, we used the unpaired Student’s t-test. To compare multiple sets of behavioural data, we used a one-away ANOVA (Kruskal–Wallis test) followed by Dunn’s test. Data are presented as mean ± s.e.m. We used Fisher’s exact test to analyse the percentages of rhythmic flies. For the patch-clamp recordings, the data are presented as mean ± s.e.m. Values of n refer to the number of measured light on–off cycles. In all cases the n values were obtained from at least 5 separate recordings (see legends). ANOVAs were performed using SigmaPlot 11 (Systat Software Inc.) or Prism 6 (Graphpad Software). The data were first tested for normal distribution. If the data were not normally distributed, we performed Kruskal–Wallis one way analysis of variance on ranks, followed by Dunn’s test. ANOVAs on normally distributed data were followed by Tukey’s test to determine significant differences between genotypes. All data are available from the corresponding author upon reasonable request.


Research and Markets has announced the addition of the "Spectroscopy Equipment and Accessories - Global Strategic Business Report" report to their offering. The report provides separate comprehensive analytics for the US, Canada, Japan, Europe, Asia-Pacific, Latin America, and Rest of World. Annual estimates and forecasts are provided for the period 2015 through 2022. Also, a six-year historic analysis is provided for these markets. Market data and analytics are derived from primary and secondary research. This report analyzes the worldwide markets for Spectroscopy Equipment and Accessories in US$ Thousand by the following Product Segments: The report profiles 117 companies including many key and niche players such as: 1. OUTLOOK A Prelude Overview Current and Future Analysis Sustained Growth for Aftermarket Products and Services 2. MARKET OVERVIEW Government Funding and Research Activities Propel Molecular Spectroscopy Market Growing Preference for Handheld Instruments Infrared Spectroscopy - A Peek into Technology and Application Trends Raman Spectroscopy - A Review of Advanced Technologies and Applications Tip-enhanced Raman Spectroscopy (TERS) Surface-enhanced Raman Spectroscopy (SERS) Spatially Offset Raman Spectroscopy (SORS) Magnetic Photoacoustoic Raman (MPR) Raman Spectroscopy Emerges as Attractive Analytical Tool for Pharmaceutical Industry Fluorescence Spectroscopy - A Gold Standard Technology Atomic Spectroscopy - An Overview Mass Spectrometry: Technological Developments and Expanding End-Use Applications to Bolster Growth Review of Select MS Technologies The Way Ahead for FT-MS and Magnetic Sector MS Technologies Portability: A Major Driving Force for MS Systems Market Nanotube Coating to Enable Miniaturization in Mass Spectrometers High Prices of MS Systems Hold Down Sales Growth Purpose-Built Mass Spectrometers to Transform Personalized Medicine Leading End Users of Mass Spectrometry Devices A Peek into Regulatory and Competitive Landscape in MS Ion-Trap Mass Spectrometry Technology Losses Sheen Reduced Government Spending on Laboratory Testing Lack of Suitable Software and Diversity of MS Systems - A Major Challenge Smaller Clinical Laboratories Continue to Shy Away from Mass Spectrometers 3. MARKET TRENDS & ISSUES Rise in Drug Development Outsourcing to Fuel Global Spectroscopy Market Growing Significance of Miniaturization in Spectroscopy Shift of Analytical Instruments Industry to Mass Customization Improved Mobility Broadens the Role of Spectroscopy Improved Analyzer Reliability and Performance Hyphenated Technologies Exhibit Growth Spectroscopy Makes Inroads into Novel Applications Applications Extend to Defense and Civilian Areas Atomic and Molecular Spectrometers Benefit from Technological Improvements Demand for Used Spectroscopy Instruments to Grow Robustly in Future 4. COMPETITIVE LANDSCAPE Competition in the Spectrometry Market: An Insight Molecular Spectroscopy: A Highly Fragmented Market List of Leading Players in the Global Molecular Spectroscopy Market by Product Type Atomic Spectroscopy Market List of Leading Players in the Global Atomic Spectroscopy Market Mass Spectrometry Market List of Leading Players in the Global Mass Spectrometry Market 5. PRODUCT OVERVIEW Spectroscopy Spectrophotometer Fluorometer Different Types of Spectrophotometry Analysis Infrared Spectrophotometry Near-Infrared Spectrophotometry Visible Spectrophotometry Ion Mobility Spectrometry Color Spectrophotometry Near-Ultraviolet Spectrophotometry Spectrometry Spectrometers: A Broad Spectrum of Devices A. Molecular Spectroscopy - The Study of Absorption of Light by Molecules Ultraviolet/Visible (UV/VIS) Spectroscopy Raman Spectroscopy Nuclear Magnetic Resonance (NMR) Spectrometers Near Infrared (NIR) Spectroscopy Applications of Near-IR Techniques Process Analysis Applications of the NIR Spectroscopy Infrared Spectroscopy Fourier-Transform Infrared (FTIR) Spectroscopy B. Atomic Spectroscopy Arc/Spark Spectrometry ICP and ICP-MS Atomic Absorption Spectroscopy Atomic Absorption Analysis Instrumentation Atomizers Double Beam Systems Applications Trends and Future Developments X-Ray Fluorescence Spectrometers (XRF) C. Mass Spectrometry (MS) Mass Spectrometer Types of Mass Spectrometers and their Applications Liquid Chromatography-Mass Spectrometry (LC-MS) Gas Chromatography-Mass Spectrometry (GC-MS) MALDI-TOF Fluorescence Spectroscopy - An Overview Biomedical Applications of Fluorescence Spectroscopy Fluorescence Quenching Fluorescence Polarization Resonance Energy Transfer Filter Fluorimeters Spectrofluorimeters Monochromators Fluorescence-Lifetime Measurements 6. PRODUCT INNOVATIONS/INTRODUCTIONS Shimadzu Launches LCMS-8045 Mass Spectrometer in Europe JUKI Group Commercializes AY555 Spectrophotometer Avantes Launches AvaSpec-Hero Sensline Spectrometer Agilent Launches New 4210 Microwave Plasma-Atomic Emission Spectrometer Princeton Launches FERGIE Spectroscopy System Konica Minolta Introduces Automobile Specific Spectrophotometers, CM-25cG and CM-M6 Shimadzu Launches New GC-MS/MS System, GCMS-TQ8050 Datacolor Introduces Datacolor 20D for Paint Retailers StellarNet Launches Portable Research Grade Raman Spectroscopy System Jenway® Launches New Visible Scanning Spectrophotometer, 7200 IRsweep to Launch IRspectrometer Shimadzu Introduces Atomic Absorption Spectrophotometer, AA-6880F Bruker Launches timsTOF System Thermo Fisher Launches New Spectrometry Devices Techkon Launches Continuous Scanning Spectrophotometer, SpectroEdge ES7500 Sciex Introduces SCIEX QTRAP® 6500+ LC-MS/MS System StellarNet Launches RED-Wave-NIRX-SR Spectrometer Thermo Scientific Launches NanoDrop One Spectrophotometers Thermo Scientific Launches GENESYS 30 Visible-Range Spectrophotometer Thermo Scientific Launches New DXR2 Line of Raman Microscopes Bruker Launches Total Reflection X-Ray Fluorescence Spectrometer, S4 TStar Agilent Launches 5110 ICP-OES Magritek Introduces 60 MHz Benchtop NMR Spectrometers, Spinsolve 60 Thermo Scientific Launches New FT-NIR Spectrometer, Nicolet iS5N Rigaku Launches New Benchtop Variable Spot EDXRF Spectrometer, Rigaku NEX DE Advion Introduces TIDES EXPRESS Merck Introduces Spectroquant® Prove Spectrophotometers Shimadzu Introduces Inductively Coupled Plasma Mass Spectrometer, ICPMS-2030 AQULABO Group Introduces Uviline 9300 and Uviline 9600 Rigaku Launches Rigaku ZSX Primus IV StellarNet BLUE-Wave Compact Spectrometers Line SPECTRO Introduces New Line of SPECTRO XEPOS Spectrometers Thermo Fisher Introduces Thermo Scientific 253 Ultra HR-IRMS StellarNet Launches BLACK-Comet-HR Specac Introduces Pearl Liquid Analysis Accessory Agilent Introduces Agilent 5977B HES GC/MSD System in China Datacolor Introduces New Line of Color Measurement Spectrophotometers Bruker Introduces HH-LIBS Device, EOS 500 Bruker Launches 10 kHz rapifleX MALDI-TOF/TOF Mass Spectrometer Konica Minolta Introduces Auto-Scanning Spectrophotometer, FD-9 Rigaku Introduces Rigaku NANOHUNTER II TXRF Spectrometer SPECTRO Introduces New SPECTROLAB Arc/Spark Optical Emission Spectrometers SPECTRO Introduces SPECTROSCOUT X-ray Fluorescence Spectrometer Bruker Introduces S2 PUMA Shimadzu Introduces Shimadzu LCMS-8060 Triple Quadrupole Mass Spectrometer Thermo Scientific Launches Orbitrap Fusion Lumos Tribrid Mass Spectrometer Agilent Introduces Agilent 6470 Triple Quadrupole LC/MS Waters Introduces Vion IMS QTof Mass Spectrometer DeNovix Introduces DS-11 FX+ Spectrophotometer / Fluorometer Agilent Launches Agilent 6545 Q-TOF Mass Spectrometry System Implen Introduces Fourth Generation NanoPhotometer® Spectrophotometers Shimadzu Corporation Compact Monochromator System Package, SPG-120-REV JEOL Develops JPS-9030, X-ray Photoelectron Spectrometer Datacolor Introduces CHECK 3 Portable Spectrophotometer SPECTRO Launches SPECTRO xSort Handheld EDXRF Spectrometers Bruker Handheld Raman Spectrometer, BRAVO Shimadzu Launches RF-6000 Spectrofluorophotometer X-Rite Introduces X-Rite Ci7800 and X-Rite Ci7600 SPECTRO Introduces SPECTRO xSORT Line of Handheld EDXRF Spectrometers Analytik Jena Introduces New ICP-MS Products, PlasmaQuant® MS and PlasmaQuant® MS Elite Ocean Optics Introduces New Miniature Spectrometer, Flame Shimadzu Launches UV1280 UVVIS Spectrophotometer in the US SPECTRO Introduces SPECTRO ARCOS High-Resolution Spectrometer JEOL Launches JMS-T200GC High-end GC-TOFMS Thermo Scientific Launches Orbitrap Based Q Exactive Focus LC MS/MS Mass Spectrometer 7. RECENT INDUSTRY ACTIVITY Bruker Acquires Active Spectrum Inc. Wasatch Photonics Acquires Process Raman Spectroscopy Technology from Mustard Tree Instruments Shimadzu Institutes Shimadzu China Mass Spectrometry Center INSION Enters into Distribution Agreement with Digilab - The United States (75) - Canada (2) - Japan (11) - Europe (40) - France (3) - Germany (11) - The United Kingdom (18) - Italy (1) - Spain (1) - Rest of Europe (6) - Asia-Pacific (Excluding Japan) (9) - Middle East (1) For more information about this report visit http://www.researchandmarkets.com/research/gxbsmg/spectroscopy


News Article | February 28, 2017
Site: www.prweb.com

Shimadzu Scientific Instruments, Inc. (Columbia, MD) and MIDI, Inc. (Newark, DE) have formed a strategic partnership to develop and market automated chromatographic solutions for agri-biotech, biodefense, dietary supplement, food science, forensics and renewable energy laboratories. These automated testing solutions will save analysis time and reduce labor costs, while providing unprecedented analytical accuracy over the “manual” chromatography approaches used in these industries. Under the terms of the agreement, Shimadzu is combining its 2010 GC, i-Series UHPLC, GCMS chromatography systems and LabSolutions™ software with MIDI, Inc.’s expert system software. Sherlock™ chromatography analysis software is a comprehensive and powerful data analysis platform, which precisely names compounds, performs complex pattern recognition and gives customers the ability to visually analyze their data in many different ways. Results are delivered automatically, reproducibly and objectively. The first product launch will be for automated microbial identification and soil phospholipid fatty acid (PLFA) analysis on Shimadzu’s 2010 GC product line, followed by solutions for the UHPLC and GCMS instruments. Gary Jackoway, MIDI Inc.'s Vice President and Director of Software Development, said, “We are delighted to partner with Shimadzu Scientific Instruments and have been impressed by their technology, team and customer support philosophy. This partnership will make automated and precise chromatography available to more customers than ever before and allow those customers to achieve maximum efficiency, reduce the learning curve and lower their labor costs.” “Shimadzu Scientific Instruments, Inc. is pleased to establish this important partnership. MIDI, Inc. has a long history of expertise in successfully automating and analyzing complex chromatographic data in growth markets. By combining their Sherlock™ software platform with state-of-the-art Shimadzu analytical instrumentation, along with our breadth of sales and support, we can offer even more customer-focused solutions,” said Mark Janeczko, Shimadzu Scientific Instruments, Inc. Marketing Manager. The Shimadzu and MIDI-integrated products will be exhibited at the 2017 Pittsburgh Conference and Expo - booth #4112. About Shimadzu Scientific Instruments, Inc. Established in 1975, Shimadzu Scientific Instruments (SSI), the American subsidiary of Shimadzu Corporation (Kyoto, Japan), provides a comprehensive range of analytical solutions to laboratories throughout North, Central, and parts of South America. SSI maintains a network of nine regional offices strategically located across the United States, with experienced technical specialists, service and sales engineers situated throughout the country, as well as applications laboratories on both coasts. For more information, please visit http://www.ssi.shimadzu.com. About MIDI, Inc. MIDI, Inc. is a private biotechnology company that specializes in automated and precise chromatography solutions. Founded in 1991, MIDI’s Sherlock™ software platform is used by scientists in more than 45 countries for automated analysis of: dietary supplements, fatty acids (FAME), fire debris, microbes, soil phospholipid fatty acids (PLFA) and spices. Sherlock™ has been US FDA 501(k) cleared for the identification of Bacillus anthracis (Anthrax pathogen) and Mycobacterium tuberculosis (TB pathogen). In addition, Sherlock™ is AOAC INTERNATIONAL cleared for Bacillus anthracis and US CDC-NIOSH cleared for aerobic bacterial identification. For more information, please visit http://www.midi-inc.com


News Article | February 22, 2017
Site: marketersmedia.com

The Global Universal Testing Machine Industry 2016 Market Research Report is a professional and in-depth study on the current state of the Universal Testing Machine industry. Firstly, the report provides a basic overview of the industry including definitions, classifications, applications and industry chain structure. The Universal Testing Machine market analysis is provided for the international market including development history, competitive landscape analysis, and major regions’ development status. Secondly, development policies and plans are discussed as well as manufacturing processes and cost structures. This report also states importexport, supply and consumption figures as well as cost, price, revenue and gross margin by regions (United States, Europe, China and Japan), and other regions can be added. Then, the report focuses on global major leading industry players with information such as company profiles, product picture and specification, capacity, production, price, cost, revenue and contact information. Upstream raw materials, equipment and downstream consumers analysis is also carried out. What’s more, the Universal Testing Machine industry development trends and marketing channels are analyzed. Finally, the feasibility of new investment projects is assessed, and overall research conclusions are offered. In a word, the report provides major statistics on the state of the industry and is a valuable source of guidance and direction for companies and individuals interested in the market. Analytics and data presented in each report pertain to several parameters such as – Global and Regional Market Sizes, Market Shares, Market Trends Product (Global and Regional) Market Sizes, Market Shares, Market Trends Technology Trends Corporate Intelligence Key Companies By Sales, Brands, Products Other Strategic Business Affecting Data 1 Industry Overview of Universal Testing Machine 1 1.1 Definition and Specifications of Universal Testing Machine 1 1.1.1 Definition of Universal Testing Machine 1 1.1.2 Specifications of Universal Testing Machine 2 1.1.3 Structure of Universal Testing Machine 3 1.2 Classification of Universal Testing Machine 3 1.2.1 Classification of Universal Testing Machine by Structure 3 1.2.2 Classification of Universal Testing Machine by Driving Method 5 1.2.3 Classification of Universal Testing Machine by Load Capacity 8 1.3 Applications of Universal Testing Machine 8 1.3.1 Scientific and Education 10 1.3.2 Industrial 10 1.4 Industry Chain Structure of Universal Testing Machine 12 1.5 Industry Overview and Major Regions Status of Universal Testing Machine 12 1.5.1 Industry Overview of Universal Testing Machine 12 1.5.2 Global Major Regions Status of Universal Testing Machine 13 1.6 Industry Policy Analysis of Universal Testing Machine 13 1.7 Industry News Analysis of Universal Testing Machine 14 8 Major Manufacturers Analysis of Universal Testing Machine 90 8.1 MTS (US) 90 8.1.1 Company Profile 90 8.1.2 Product Picture and Specifications 91 8.1.3 Capacity, Production, Price, Cost, Gross, and Revenue 93 8.1.4 Contact Information 94 8.2 Instron (US) 94 8.2.1 Company Profile 94 8.2.2 Product Picture and Specifications 96 8.2.3 Capacity, Production, Price, Cost, Gross, and Revenue 98 8.2.4 Contact Information 99 8.3 ZwickRoell (GE) 100 8.3.1 Company Profile 100 8.3.2 Product Picture and Specifications 101 8.3.3 Capacity, Production, Price, Cost, Gross, and Revenue 104 8.3.4 Contact Information 105 8.4 Shimadzu (JP) 105 8.4.1 Company Profile 105 8.4.2 Product Picture and Specifications 106 8.4.3 Capacity, Production, Price, Cost, Gross, and Revenue 110 8.4.4 Contact Information 112 8.5 ADMET (US) 112 8.5.1 Company Profile 112 8.5.2 Product Picture and Specifications 113 8.5.3 Capacity, Production, Price, Cost, Gross, and Revenue 115 8.5.4 Contact Information 117 8.6 Hegewald?&?Peschke (GE) 117 8.6.1 Company Profile 117 8.6.2 Product Picture and Specifications 118 8.6.3 Capacity, Production, Price, Cost, Gross, and Revenue 121 8.6.4 Contact Information 123 8.7 AMETEK (US) 123 8.7.1 Company Profile 123 8.7.2 Product Picture and Specifications 125 8.7.3 Capacity, Production, Price, Cost, Gross, and Revenue 126 8.7.4 Contact Information 128 8.8 Torontech (CA) 129 8.8.1 Company Profile 129 8.8.2 Product Picture and Specifications 130 8.8.3 Capacity, Production, Price, Cost, Gross, and Revenue 132 8.8.4 Contact Information 134 8.9 Keysight Technologies (US) 134 8.9.1 Company Profile 134 8.9.2 Product Picture and Specifications 135 8.9.3 Capacity, Production, Price, Cost, Gross, and Revenue 136 8.9.4 Contact Information 138 8.10 Qualitest?International (CA) 138 8.10.1 Company Profile 138 8.10.2 Product Picture and Specifications 139 8.10.3 Capacity, Production, Price, Cost, Gross, and Revenue 141 8.10.4 Contact Information 143 8.11 Tinius?Olsen 143 8.11.1 Company Profile 143 8.11.2 Product Picture and Specifications 144 8.11.3 Capacity, Production, Price, Cost, Gross, and Revenue 146 8.11.4 Contact Information 148 8.12 Applied Test Systems (USA) 148 8.12.1 Company Profile 148 8.12.2 Product Picture and Specifications 149 8.12.3 Capacity, Production, Price, Cost, Gross, and Revenue 152 8.12.4 Contact Information 154 8.13 ETS Intarlaken (IN) 154 8.13.1 Company Profile 154 8.13.2 Product Picture and Specifications 155 8.13.3 Capacity, Production, Price, Cost, Gross, and Revenue 156 8.13.4 Contact Information 158 8.14 Jinan Shijin Group (CN) 158 8.14.1 Company Profile 158 8.14.2 Product Picture and Specifications 159 8.14.3 Capacity, Production, Price, Cost, Gross, and Revenue 162 8.14.4 Contact Information 164 8.15 Shenzhen Suns (CN) 164 8.15.1 Company Profile 164 8.15.2 Product Picture and Specifications 165 8.15.3 Capacity, Production, Price, Cost, Gross, and Revenue 168 8.15.4 Contact Information 170 8.16 Jinan Tianchen (CN) 170 8.16.1 Company Profile 170 8.16.2 Product Picture and Specifications 171 8.16.3 Capacity, Production, Price, Cost, Gross, and Revenue 174 8.16.4 Contact Information 176 8.17 Changchun Kexin Test Instrument (CN) 176 8.17.1 Company Profile 176 8.17.2 Product Picture and Specifications 177 8.17.3 Capacity, Production, Price, Cost, Gross, and Revenue 178 8.17.4 Contact Information 180 8.18 WANCE Group (CN) 180 8.18.1 Company Profile 180 8.18.2 Product Picture and Specifications 181 8.18.3 Capacity, Production, Price, Cost, Gross, and Revenue 184 8.18.4 Contact Information 186 8.19 Shanghai?Hualong (CN) 186 8.19.1 Company Profile 186 8.19.2 Product Picture and Specifications 187 8.19.3 Capacity, Production, Price, Cost, Gross, and Revenue 191 8.19.4 Contact Information 193 8.20 Tianshui Hongshan 193 8.20.1 Company Profile 193 8.20.2 Product Picture and Specifications 194 8.20.3 Capacity, Production, Price, Cost, Gross, and Revenue 196 8.20.4 Contact Information 197 8.21 Laizhou Huayin (CN) 197 8.21.1 Company Profile 197 8.21.2 Product Picture and Specifications 199 8.21.3 Capacity, Production, Price, Cost, Gross, and Revenue 200 8.21.4 Contact Information 202 8.22 Shenzhen Reger (CN) 202 8.22.1 Company Profile 202 8.22.2 Product Picture and Specifications 203 8.22.3 Capacity, Production, Price, Cost, Gross, and Revenue 206 8.22.4 Contact Information 207 8.23 Hung Ta Instrument (TW) 207 8.23.1 Company Profile 207 8.23.2 Product Picture and Specifications 208 8.23.3 Capacity, Production, Price, Cost, Gross, and Revenue 209 8.23.4 Contact Information 211 8.24 Shandong Drick (CN) 211 8.24.1 Company Profile 211 8.24.2 Product Picture and Specifications 212 8.24.3 Capacity, Production, Price, Cost, Gross, and Revenue 215 8.24.4 Contact Information 216 8.25 Jinan?Kehui (CN) 216 8.25.1 Company Profile 216 8.25.2 Product Picture and Specifications 218 8.25.3 Capacity, Production, Price, Cost, Gross, and Revenue 219 8.25.4 Contact Information 221 8.26 Jinan Fine (CN) 221 8.26.1 Company Profile 221 8.26.2 Product Picture and Specifications 222 8.26.3 Capacity, Production, Price, Cost, Gross, and Revenue 224 8.26.4 Contact Information 225 8.27 Jinan Liangong (CN) 225 8.27.1 Company Profile 225 8.27.2 Product Picture and Specifications 226 8.27.3 Capacity, Production, Price, Cost, Gross, and Revenue 229 8.27.4 Contact Information 231 8.28 HRJ (CN) 231 8.28.1 Company Profile 231 8.28.2 Product Picture and Specifications 232 8.28.3 Capacity, Production, Price, Cost, Gross, and Revenue 235 8.28.4 Contact Information 236 For more information, please visit https://www.wiseguyreports.com/sample-request/982411-global-universal-testing-machine-industry-2017-deep-market-research-report

Loading Shimadzu collaborators
Loading Shimadzu collaborators