Saitama, Japan
Saitama, Japan

RIKEN is a large research institute in Japan. Founded in 1917, it now has approximately 3000 scientists on seven campuses across Japan, the main one in Wako, just outside Tokyo. RIKEN is an Independent Administrative Institution whose formal name in Japanese is Rikagaku Kenkyūsho .RIKEN conducts research in many areas of science, including physics, chemistry, biology, medical science, engineering and computational science, and ranging from basic research to practical applications. It is almost entirely funded by the Japanese government, and its annual budget is approximately ¥88 billion . Wikipedia.


Time filter

Source Type

Patent
Riken and Tokyo Medical University | Date: 2015-01-08

A medical laser light source system including an excitation laser light source apparatus that generates first excitation light having a wavelength greater than or equal to 1.5 m and less than or equal to 2.2 m and second excitation light having a wavelength greater than or equal to 1.5 m and less than or equal to 2.2 m and differing from the first excitation light with respect to at least one of oscillation energy intensity, oscillation pulse width, repeating frequency, and peak power; an optical fiber that is long-distance and propagates the first excitation light and the second excitation light generated by the excitation laser light source apparatus; and a laser device that generates laser light having a wavelength of at least 2.7 m and no greater than 3.2 m, using at least one of the first excitation light and the second excitation light emitted from the optical fiber.


Patent
Riken | Date: 2016-09-16

A seal member is made of a composite material. The composite material includes: any one of an acrylic elastomer, a hydrogenated nitrile elastomer, a fluorinated elastomer, and a fluorosilicone elastomer as a main component; and a particulate filler and a fibrous filler. The particulate filler has a mean particle diameter of 1.0 m or more and 50 m or less. The fibrous filler has a mean diameter of 5.0 m or more and 20 m or less and has a mean length of 0.1 mm or more and 8 mm or less. Content of the particulate filler is 10% by volume or more and 35% by volume or less, and content of the fibrous filler is 5% by volume or more and 15% by volume or less.


Embodiments of the invention provide a hard coat laminated film including a first hard coat, a second hard coat, and a transparent resin film layer in order from the outermost surface layer side, wherein the first hard coat is formed of a coating material containing no inorganic particles; the second hard coat is formed of a coating material containing inorganic particles; and the hard coat laminated film satisfies the following requirements: (i) the total light transmittance is 85% or more; and (ii) the pencil hardness of the surface of the first hard coat is 5H or higher. According to another embodiment, a hard coat laminated film is provided, which includes a first hard coat, a second hard coat, and a transparent resin film layer in order from the outermost surface layer side, wherein the first hard coat is formed of a coating material containing predetermined amounts of (A) a polyfunctional (meth)acrylate; (B) a water repellant; and (C) a silane coupling agent and containing no inorganic particles; and the second hard coat is formed of a coating material containing (A) 100 parts by mass of a polyfunctional (meth)acrylate; and (D) 50 to 300 parts by mass of inorganic fine particles having an average particle size of 1 to 300 nm.


Patent
Riken | Date: 2015-01-26

Embodiments of the invention provide a packing box wherein strength is improved and efficiency of opening, content retrieval, etc. is improved. Embodiments of the invention provide a packing box obtained from an upper cover and a lower box configured from cardboard for accommodating articles therein, in which: the upper cover is obtained from a top board that covers the entire interior of the lower box and side boards that extend vertically downward from each side of the top board and substantially cover the side surfaces of the lower box; and at least one notch is provided on one of the lower edges of the upper cover.


Patent
Riken, University of Tokyo and School Corporation | Date: 2015-04-10

Strains of human-derived bacteria have been obtained from complex fecal samples and shown to induce accumulation of Th17 cells in the intestine and promote immune functions. Pharmaceutical compositions containing these bacteria can be used as anti-infectives and as adjuvants in mucosal vaccines.


Patent
Riken | Date: 2015-04-14

A roller-type rocker arm includes a roller shaft. A sliding surface of an outer circumference surface of the roller shaft includes a number of dimples. An inner ring roller is slidably attached to the outer circumference surface of the roller shaft. An inner circumference surface and an outer circumference surface of the inner ring roller include a number of dimples. An outer ring roller is slidably attached to the outer circumference surface of the inner ring roller. An inner circumference surface of the outer ring roller includes a number of dimples.


Patent
Riken | Date: 2015-02-10

The present invention provides a valve seat of a Co-free, sintered iron-based alloy having excellent heat resistance, oxidation resistance and wear resistance, as well as excellent machinability, which is usable for internal combustion engines using a gas fuel. The valve seat is produced by using a prealloy containing 12% or more by mass of Cr in a matrix for, and hard particles having high strength and hardness at high temperatures are used, such that the entire valve seat has a composition comprising by mass 5.0-20.0% of Cr, 0.4-2.0% of Si, 2.0-6.0% of Ni, 5.0-25.0% of Mo, 0.1-5.0% of W, 0.5-5.0% of V, 1.0% or less of Nb, and 0.5-1.5% of C, the balance being Fe and inevitable impurities.


Patent
Riken | Date: 2015-03-05

An object of the present invention is to provide a plant transformation method that is convenient and is widely applicable to various types of plant cells and nucleic acids. The present invention relates to a method for transforming a target plant, comprising the steps of: a) contacting a carrier peptide comprising a cell-penetrating sequence and a polycation sequence with a nucleic acid to form a complex; b) contacting the obtained complex with a cell of a meristem of the target plant to transfer the nucleic acid to the genome; c) allowing the meristem to grow; and d) selecting a plant harboring the transferred nucleic acid.


Patent
Juntendo Educational Foundation and Riken | Date: 2015-03-11

Provided is an approach for differentially determining the histological type of a lung cancer lesion objectively and rapidly with high accuracy. A method for differentially assessing a lesion in a lung cancer patient as squamous cell carcinoma or adenocarcinoma, comprising a step of measuring an expression level of an expression product of at least one DNA comprising a transcription start site in a biological sample collected from the lesion, wherein the DNA comprises a base at an arbitrary position in the transcription start site and at least one or more bases located immediately downstream thereof in any of nucleotide sequences represented by SEQ ID NOs: 1 to 213, and the transcription start site is a region wherein both ends thereof are defined by the first base and the 101st base counted from the 3 end in any of the nucleotide sequences represented by SEQ ID NOs: 1 to 213.


Patent
Riken | Date: 2016-08-29

Stem cells such as embryonic stem cells (ES cells), including human ES cells, are cultured in a medium comprising a ROCK inhibitor, and a stem cell culture medium, optionally serum free, comprises a ROCK inhibitor.


To provide a magnetic element that controls generation and annihilation of a skyrmion. A magnetic element is provided, and the magnetic element comprises: a magnetic body that has a spiral magnetic structure in a stable state; a skyrmion control unit that generates skyrmion in the magnetic body by supplying energy to the magnetic body that has the spiral magnetic structure. Also, the magnetic element in which the skyrmion control unit brings the magnetic body into an unstable state by supplying thermal energy pulses to the magnetic body is provided. Furthermore, a skyrmion memory comprising the magnetic element is provided.


To provide an oil scraper ring for a piston rod having excellent oil-scraping performance to reduce the amount of drain, and a stuffing box comprising such oil scraper rings, a ring body of the oil scraper ring is circumferentially divided to at least two, the ring body comprising a rail at an inner-side longitudinal center, a coil spring groove at an outer-side longitudinal center, and pluralities of oil drain grooves at least one of upper and lower surfaces, which are inclined such that their cross section areas increase as going from the inner side to the outer side.


The present invention relates to an actinic-ray-curable resin composition which comprises: (A) 100 parts by mass of a polyfunctional (meth)acrylate; (B) 0.2-4 parts by mass of a compound having an alkoxysilyl group and a (meth)acryloyl group; (C) 0.05-3 parts by mass of an organic titanium; and (D) 5-100 parts by mass of fine particles having an average particle diameter of 1-300 nm. The present invention also relates to a layered transparent resin product which comprises a hardcoat layer and a layer of a transparent resin sheet in this order from the outermost layer side, wherein the hardcoat has been formed from a coating material comprising:(A) 100 parts by mass of a polyfunctional (meth)acrylate; (B) 0.2-4 parts by mass of a compound having an alkoxysilyl group and a (meth)acryloyl group; (C) 0.05-3 parts by mass of an organic titanium; and (D) 5-100 parts by mass of fine particles having an average particle diameter of 1-300 nm.


Patent
Riken and Kabushiki Kaisha Dnaform | Date: 2017-02-01

The present invention is intended to provide a novel fluorescent labeled single-stranded nucleic acid, by which the background of an exciton oligomer can be further reduced and the novel use thereof. The present invention relates to a labeled single-stranded nucleic acid having at least two fluorescent atomic group pairs that exhibit an exciton effect. The labeled single-stranded nucleic acid is characterized in that the emission peak wavelength of one of the fluorescent atomic group pairs (fluorescent atomic group pair A) is shorter than the excitation peak wavelength of the other fluorescent atomic group pair (fluorescent atomic group pair B), and the fluorescent atomic group pairs A and B have a Forster resonance energy transfer (FRET) effect. This fluorescent labeled single-stranded nucleic acid is usable as a primer for amplifying a target nucleic acid or a probe to be hybridized with a target nucleic acid.


Patent
Riken | Date: 2017-01-11

An object of the present invention is to provide a plant transformation method that is convenient and is widely applicable to various types of plant cells and nucleic acids. The present invention relates to a method for transforming a target plant, comprising the steps of:a) contacting a carrier peptide comprising a cell-penetrating sequence and a polycation sequence with a nucleic acid to form a complex; b) contacting the obtained complex with a cell of a meristem of the target plant to transfer the nucleic acid to the genome; c) allowing the meristem to grow; and d) selecting a plant harboring the transferred nucleic acid.


Patent
Riken | Date: 2017-03-15

A sliding member 1 according to one aspect of the present invention includes a base material 2 and a thermal spray coating 10 formed on a sliding surface of the base material 2, wherein the thermal spray coating 10 includes a molybdenum phase 11, a chromium carbide phase 12 and a nickel chromium alloy phase 13; the molybdenum phase 11, the chromium carbide phase 12 and the nickel chromium alloy phase are deposited on the sliding surface of the base material 2; and T_(CrC)/T_(Mo) is 0.46 to 1.00 where the average value of the thickness t_(CrC) of the chromium carbide phases 12 in the direction Y perpendicular to the surface of the base material 2 is T_(CrC), and the average value of the thickness t_(Mo) of the molybdenum phases 11 in the same direction thereof is T_(Mo).


Patent
Riken, Animal Allergy Clinical Laboratories Inc. and Nippon Zenyaku Kogyo Co. | Date: 2017-04-19

The present invention provides a synthetic peptide capable of inducing an antibody to an autoantigen, and specifically, provides: a multiplexed same type-antigenic peptide comprising a dendritic core and B-cell recognition peptides, wherein the multiplexed same type-antigenic peptide comprises 4 to 8 B-cell recognition peptides of the same type that are bound to the terminal ends of the dendritic core directly or via a spacer, and each B-cell recognition peptide is bound to the terminal end of the dendritic core directly or via a spacer; an antibody production-inducing agent comprising the peptides; and a method for producing the peptide.


Patent
Riken | Date: 2017-04-12

This invention relates to an agent for inducing a callus comprising a compound represented by Formula (I) or a hydrolysis product of an amide bond thereof:^(1) represents phenyl substituted with substituent or substituents selected from alkoxy and methylenedioxy; Ar^(2) represents phenyl substituted with halogen; R^(1) and R^(2) each represent hydrogen, alkyl, cyano, or carboxyl; R^(1) and R^(2) may together form oxo; R^(3) to R^(10) each represent hydrogen or methyl; and R^(3) and R^(4), R^(5) and R^(6), R^(7) and R^(8), and/or R^(9) and R^(10) may together form oxo; a method for inducing a callus and a method for plant transformation using such agent for inducing a callus.


Saido T.,RIKEN
Cold Spring Harbor Perspectives in Medicine | Year: 2012

The amyloid β-protein (Aβ) is subject to proteolytic degradation by a diverse array of peptidases and proteinases, known collectively as Aβ-degrading proteases (AβDPs). A growing number of AβDPs have been identified, which, under physiological and/or pathophysiological conditions, contribute significantly to the determination of endogenous cerebral Aβ levels. Despite more than a decade of investigation, the complete set of AβDPs remains to be established, and our understanding of even well-established AβDPs is incomplete. Nevertheless, the study of known AβDPs has contributed importantly to our understanding of the molecular pathogenesis of Alzheimer disease (AD) and has inspired the development of several novel therapeutic approaches to the regulation of cerebral Aβ levels. In this article, we discuss the general features of Aβ degradation and introduce the best-characterized AβDPs, focusing on their diverse properties and the numerous conceptual insights that have emerged from the study of each. © 2012 Cold Spring Harbor Laboratory Press; all rights reserved.


Tsuneda T.,Yamanashi University | Hirao K.,RIKEN
Wiley Interdisciplinary Reviews: Computational Molecular Science | Year: 2014

Long-range correction for exchange functionals in Kohn-Sham density functional theory and its applicability are reviewed. Long-range correction simply supplements the long-range exchange effect in exchange functionals by replacing the Hartree-Fock exchange integral with the long-range part of exchange functionals. Nevertheless, this correction has solved many problems in Kohn-Sham calculations. Using this correction, valence occupied and unoccupied orbital energies are quantitatively reproduced in a comprehensive manner for the first time. Long-range correction has also solved the underestimations of charge transfer excitation energies and oscillator strengths in time-dependent Kohn-Sham calculations and has clearly improved poor optical response properties such as hyperpolarizability in coupled-perturbed Kohn-Sham and finite-field calculations. Moreover, this correction has drastically improved the reproducibility of van der Waals bonds by simply combining with conventional van der Waals calculation methods. We, therefore, believe that the long-range correction clearly extends the applicability of the Kohn-Sham method in future quantum chemistry calculations. © 2013 John Wiley & Sons, Ltd.


Diefenbach A.,University of Mainz Medical Center | Colonna M.,University of Washington | Koyasu S.,RIKEN | Koyasu S.,Keio University
Immunity | Year: 2014

Recent years have witnessed the discovery of an unprecedented complexity in innate lymphocyte lineages, now collectively referred to as innate lymphoid cells (ILCs). ILCs are preferentially located at barrier surfaces and are important for protection against pathogens and for the maintenance of organ homeostasis. Inappropriate activation of ILCs has been linked to the pathogenesis of inflammatory and autoimmune disorders. Recent evidence suggests that ILCs can be grouped into two separate lineages, cytotoxic ILCs represented by conventional natural killer (cNK) cells and cytokine-producing helper-like ILCs (i.e., ILC1s, ILC2s, ILC3s). We will focus here on current work in humans and mice that has identified core transcriptional circuitry required for the commitment of lymphoid progenitors to the ILC lineage. The striking similarities in transcriptional control of ILC and Tcell lineages reveal important insights into the evolution of transcriptional programs required to protect multicellular organisms against infections and to fortify barrier surfaces. Innate lymphoid cells (ILCs) are important for protection against pathogens and for maintenance of organ homeostasis. Diefenbach and colleagues examine the core transcriptional circuitry required for commitment to the ILC lineage, as well as the transcriptional programs that drive differentiation into distinct ILC populations. © 2014 Elsevier Inc.


Georgescu I.M.,RIKEN | Ashhab S.,RIKEN | Ashhab S.,Qatar Environment and Energy Research Institute | Nori F.,RIKEN | And 2 more authors.
Reviews of Modern Physics | Year: 2014

Simulating quantum mechanics is known to be a difficult computational problem, especially when dealing with large systems. However, this difficulty may be overcome by using some controllable quantum system to study another less controllable or accessible quantum system, i.e., quantum simulation. Quantum simulation promises to have applications in the study of many problems in, e.g., condensed-matter physics, high-energy physics, atomic physics, quantum chemistry, and cosmology. Quantum simulation could be implemented using quantum computers, but also with simpler, analog devices that would require less control, and therefore, would be easier to construct. A number of quantum systems such as neutral atoms, ions, polar molecules, electrons in semiconductors, superconducting circuits, nuclear spins, and photons have been proposed as quantum simulators. This review outlines the main theoretical and experimental aspects of quantum simulation and emphasizes some of the challenges and promises of this fast-growing field. © 2014 American Physical Society.


Patent
Riken and Hamamatsu Photonics K K | Date: 2010-09-15

Disclosed is a kit for use in the production of a molecular probe for PET drug screening for the purpose of producing a compound containing a short-lived radionuclide for PET applications. Specifically disclosed is a kit comprising a compound represented by the formula (I), (II) or (III) or a salt thereof. In the formulae, X^(1), X^(2), X^(3), X^(4), X^(5) and X^(6) are as defined in the description.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-IP | Phase: HEALTH-2009-2.2.1-1 | Award Amount: 15.81M | Year: 2010

Signalling at nerve cell synapses - a key determinant of all aspects of brain function - depends on the function of hundreds of synaptic proteins and their interactions. Numerous recent studies showed that a wide range of neurological and psychiatric diseases are synaptopathies whose onset and progression are due to mutations of synaptic proteins and subsequent synaptic dysfunctions. EUROSPIN will pursue a multilevel systems biology approach to determine mechanistic relationships between mutations of synaptic proteins and neurological and psychiatric diseases, and to develop new diagnostic tools and therapies. Our concept is based on the current knowledge of disease genes, which we will continuously extend with new human genetic data and complement with large-scale screens of mutant mice in order to identify and characterize disease-relevant mutations in synaptic proteins and corresponding mouse models. Proteomic tools will be used to analyse the protein components of synapses, and protein interaction networks of synaptic disease gene products will be mapped systematically. In parallel, smart libraries will be employed to develop small molecules for perturbing the functions and interactions of disease gene products. Functional models of disease-relevant protein networks will be generated and used to formulate hypotheses as to how specific mutations might affect synaptic physiology and network function, and thus cause disease. These hypotheses will initially be tested in reduced systems by novel physiological and imaging methods. Well-validated disease gene products, the consequences of their dysfunction in disease, and therapeutic modifications of their dysfunction will then be studied in mouse models in vivo, applying novel electrophysiological, imaging, and behavioural techniques. The combined information obtained in the EUROSPIN program will be used for the development of new diagnostic tools and therapeutic interventions that can be tested in patients.


Grant
Agency: Cordis | Branch: FP7 | Program: CP | Phase: ICT-2007.2.1 | Award Amount: 8.16M | Year: 2008

The ITALK project aims to develop artificial embodied agents able to acquire complex behavioural, cognitive, and linguistic skills through individual and social learning. This will be achieved through the development of cognitive robotic agents, such as the iCub humanoid platform, that learn to handle and manipulate objects and tools autonomously, to cooperate and communicate with other robots and humans, and to adapt their abilities to changing internal, environmental, and social conditions. \nThe main theoretical hypothesis behind the project is that the parallel development of action, conceptualisation and social interaction permits the bootstrapping of language capabilities, which on their part enhance cognitive development. This is possible through the integration and transfer of knowledge and cognitive processes involved in sensorimotor learning and the construction of action categories, imitation and other forms of social learning, the acquisition of grounded conceptual representations and the development of the grammatical structure of language. \nThe project will lead to the development of: (a) new theoretical insights, models and scientific explanations of the integration of action, social and linguistic skills and in particular on the hypothesis that action, social and linguistic knowledge co-develop and further bootstrap cognitive development, (b) new interdisciplinary sets of methods for analysing the interaction of language, action and cognition in humans and artificial cognitive agents, (c) new cognitively-plausible engineering principles and approaches for the design of robots with behavioural, cognitive, social and linguistic skills. \nOverall, the project proposes visionary research that will provide a new standard in embodied cognitive science and will demonstrate the effectiveness of the method proposed by integrating interdisciplinary theoretical and experimental research on a single advanced robotic platform.


It is an object of the present invention to provide a method, which comprises allowing a eukaryotic cell to come into contact with a reactive oxygen species or a chemical species that generates such a reactive oxygen species in the cell, and thereby changing the percentage of mutant mtDNA (mitochondrial genomic DNA) in the cell, and cells obtained by the above-described method. The present invention relates to a method, which comprises allowing cells to come into contact with a reactive oxygen species by, for example, adding the reactive oxygen species such as hydrogen peroxide to a medium containing the cells, and then culturing the cells under suitable culture conditions, so that the percentage of mtDNA having specific mutation in the cell can be changed. In addition, the present invention also relates to cells, in which the percentage of the mtDNA having specific mutation has been changed by the above-described method.


Compositions consisting of bioactive molecules derived from the microbiota of a mammal are provided herein. When administered orally with a colonic delivery system, the compositions are useful for the prophylaxis and treatment of diseases, in particular inflammatory, autoimmune and infectious diseases. The compositions comprise combinations of small molecules and bacterial antigens formulated in colonic delivery systems. Use of the compositions results in any or all of: induction of immune tolerance; strengthening of the gut mucosal barrier integrity; reduction of inflammation; and amelioration of a disease state caused by inflammation, an autoimmune reaction or an infectious agent.


Patent
Riken, Medical and Biological Laboratories Co. | Date: 2010-03-17

An object of the present invention is to provide a red or orange fluorescent protein, which is characterized in that the difference (stokes shift) between an excitation peak value (wavelength of maximum absorption) and a fluorescence peak value (wavelength of maximum fluorescence) is greatened, so that the maximum fluorescence can be obtained by the maximum excitation. The present invention provides a novel chromoprotein and fluorescent protein derived from Montipora. Sp.


Patent
Sumitomo Electric Industries and Riken | Date: 2011-04-25

To provide a light-emitting device using a nitride semiconductor which can attain high-power light emission by highly efficient light emission, a method of manufacturing the light-emitting device involves forming a first AlGaN layer of a first conductivity type on a side of a first main surface of a nitride semiconductor substrate, forming a light-emitting layer including an InAlGaN quaternary alloy on the first AlGaN layer, forming a second AlGaN layer of a second conductivity type on the light-emitting layer, and removing the nitride semiconductor substrate after forming the second AlGaN layer.


Patent
Riken, Medical and Biological Laboratories Co. | Date: 2011-10-05

The present invention relates to a fluorescent protein of the following (a) or (b):(a) a protein having an amino acid sequence shown in SEQ ID NO: 3 or 4; or(b) a protein having an amino acid sequence comprising a deletion, substitution and/or addition of 1 to 20 amino acids with respect to the amino acid sequence shown in SEQ ID NO: 3 or 4, and having equivalent fluorescent wavelength and equivalent pH sensitivity to those of proteins having an amino acid sequence shown in SEQ ID NO: 3 or 4. The present invention also provides a fluorescent protein having an amino acid sequence wherein cysteine at position 64 is substituted with alanine with respect to the amino acid sequence shown in SEQ ID NO: 3, or an amino acid sequence wherein glutamic acid at position 211 is substituted with alanine with respect to the amino acid sequence shown in SEX ID NO: 3.


Patent
Riken, Medical and Biological Laboratories Co. | Date: 2011-04-27

The present invention refers to a fluorescent protein described in the following (a) or (b):(a) a protein having the amino acid sequence shown in SEQ ID NO: 41; or(b) a protein, which has an amino acid sequence comprising a deletion, substitution,and/or addition of one to 10 amino acids with respect to the amino acid sequence shown in SEQ ID NO: 41, which has fluorescence properties, and which has a stokes shift of 100 nm or greater.


Patent
Riken, Medical and Biological Laboratories Co. | Date: 2011-04-27

The present, invention refers to a fluorescent protein having either one of the following amino acid sequences:(a) an amino acid sequence shown in SEQ ID NO: 5; or(b) an amino acid sequence comprising a deletion, substitution and/or addition of I to 20 amino acids with respect to the amino acid sequence shown in SEQ ID NO: 5, and having fluorescent properties;and to a. fluorescent protein having an amino acid sequence shown in SEQ ID NO:7.


Grant
Agency: Cordis | Branch: FP7 | Program: CPCSA | Phase: ICT-2013.9.9 | Award Amount: 72.73M | Year: 2013

Understanding the human brain is one of the greatest challenges facing 21st century science. If we can rise to the challenge, we can gain profound insights into what makes us human, develop new treatments for brain diseases and build revolutionary new computing technologies. Today, for the first time, modern ICT has brought these goals within sight. The goal of the Human Brain Project, part of the FET Flagship Programme, is to translate this vision into reality, using ICT as a catalyst for a global collaborative effort to understand the human brain and its diseases and ultimately to emulate its computational capabilities. The Human Brain Project will last ten years and will consist of a ramp-up phase (from month 1 to month 36) and subsequent operational phases.\nThis Grant Agreement covers the ramp-up phase. During this phase the strategic goals of the project will be to design, develop and deploy the first versions of six ICT platforms dedicated to Neuroinformatics, Brain Simulation, High Performance Computing, Medical Informatics, Neuromorphic Computing and Neurorobotics, and create a user community of research groups from within and outside the HBP, set up a European Institute for Theoretical Neuroscience, complete a set of pilot projects providing a first demonstration of the scientific value of the platforms and the Institute, develop the scientific and technological capabilities required by future versions of the platforms, implement a policy of Responsible Innovation, and a programme of transdisciplinary education, and develop a framework for collaboration that links the partners under strong scientific leadership and professional project management, providing a coherent European approach and ensuring effective alignment of regional, national and European research and programmes. The project work plan is organized in the form of thirteen subprojects, each dedicated to a specific area of activity.\nA significant part of the budget will be used for competitive calls to complement the collective skills of the Consortium with additional expertise.


News Article | March 16, 2016
Site: news.mit.edu

Behaviors in complex systems are often more than the sum of their parts, whether in the brain where neurons enable expression of personality, or in fast data storage devices enabled by magnetic interactions. Physicists call these distinctive collective behaviors “emergent” properties. MIT assistant professor of physics Joseph G. Checkelsky is working at the intersection of materials synthesis and quantum physics to discover new materials that host these emergent phenomena, which in turn may foster new technologies. “In the context of solid state physics, emergent behavior often takes the form of collective behavior of electrons,” Checkelsky explains. “For example, looking at an individual electron, one would not imagine that it could form a coherent superconducting condensate by partnering with other electrons in a solid. Nor would one expect that different crystalline solids could give rise to the dynamic family of superconductors we know from experiment. Our goal is to look at materials where the quantum mechanical nature of the underlying electrons is brought out in new types of such collective properties.” Checkelsky recently won a National Science Foundation (NSF) CAREER award to pursue research into particular kinds of quantum materials that combine so-called frustrated atomic lattices and mobile electrons. An ordinary magnet gets its magnetism from the quantum mechanical property that electrons are indistinguishable and may lower their energy by aligning their magnetic moments. In some magnetic materials, known as antiferromagnets, magnetic moments of ions alternate in a repeating up/down pattern to lower their energy. The notion of a frustrated lattice, Checkelsky explains, is to create a repeating structure in the arrangement of atoms that confuses this ordering with competing interactions so that the system is unable to find a suitable way to orient itself. It is expected that this will lead to electrons with stronger quantum mechanical interactions that promote collective behavior. “By using these atomic arrangements one can force the electrons to have to deal with each other,” Checkelsky says. In Checkelsky’s lab, graduate student Linda Ye and postdoc Takehito Suzuki are studying an example of this with various arrangements of iron and tin atoms on the Kagome lattice structure, a series of overlapping triangles and hexagons. This work was inspired by theoretical work from 2011 by Cecil and Ida Green Professor of Physics Xiao-Gang Wen, Checkelsky notes. Many frustrated systems are electrically insulating. Whereas the study of those types of frustrated materials is established (including seminal contributions from MIT), in these new experiments the researchers are adding free electrons to these systems and studying how they behave. Ye explains that theorists proposed that ferromagnetic electrons on this Kagome lattice with strong spin-orbit coupling might give rise to topological bands with fractional excitations. “Generally this is a combination of strong spin-orbit interaction, magnetism, and the lattice degree of freedom,” she says. “It turns out to be a very interesting electronic system.” It differs from much of the low-temperature work in the lab because it displays interesting properties at room temperature. “It has strong ferromagnetism even at room temperature,” she says. The crystal lattice, in a ratio of three iron to two tin atoms, is made with the chemical vapor transport method. The obtained single crystals are hexagonally shaped plates with dimensions of about 1 millimeter (about four one-hundreths of an inch), Ye says. “There is one trick about growing this crystal. It’s not a stable phase at room temperature,” she says. Her approach is to cool down the crystals rapidly from high temperature in cold water so the lattice doesn’t change its phase. It can take up to a full month in the furnace to grow these single-crystal compounds. Ye is studying the mechanism underlying a phenomenon known as the anomalous Hall effect by measuring voltage made in the direction transverse (perpendicular) to a current flowing through a crystal of this material. Ye  presented a report on the work today an American Physical Society meeting in Baltimore. Ye, 26, grew up in the city of Chengdu in Sichuan, China, and earned her bachelor’s degree at Tsinghua University in Beijing. She has a master’s in engineering (applied physics) from the University of Tokyo. Checkelsky was named a Moore Foundation Fellow in Materials Synthesis in August 2013. The award helped him to establish a lab that combines the growth of new materials with analyzing their properties and creating new devices that exploit their unique behavior. “The Moore Foundation has allowed our laboratory the capabilities to both synthesize and study materials. This ranges from thin film growth by molecular beam epitaxy to cryogenic measurements. Because of their support at the inception of our lab, we have been able to make fast progress towards realizing exotic quantum materials and studying their properties,” Checkelsky explains. The lab features a synthesis side with furnaces for growing materials and an analysis side with equipment such as cryogenic refrigerators and superconducting magnets for testing them. “It’s one room, but it has two distinct halves,” he says. “Every day the students are walking across the line between the two sides — we are trying to make this border disappear.” The group includes postdoc Takehito Suzuki, graduate students Linda Ye and Aravind Devarakonda and undergraduate Christina Wicker. A second postdoc is expected to join the group this summer, and Checkelsky plans to add more graduate and undergraduate students. “It’s very exciting to have seen all the big equipment come one by one, and put [it] together,” Ye says. “Many of the things in the lab we design and make by ourselves.” She is making a high vacuum probe for the thermal measurements inside the cryogenic refrigerator. Accurate measurements require using modern tools of nanoscience to probe the electronic properties of materials, Checkelsky says. “One type of life cycle for a project begins with an idea for physics of interest that we have in the office or learn through discussions with our theory colleagues. We then consider what materials systems are most likely to support such behavior and try to synthesize them. With the characterized material in hand we then design ways to incisively probe the physics of interest, which can involve high magnetic field, scattering, or making and measuring nanodevices from the material.” Checkelsky adds, “Accidental discoveries more interesting than our original targets also happen in the lab — which we are more than happy to embrace.” Besides equipment in his own lab, Checkelsky and his research team use facilities on the MIT campus at the Microsystems Technology Lab (MTL), as well as tools at the Harvard Center for Nanoscale Systems, the NIST Center for Neutron Research, and the National High Magnetic Field Laboratory in Tallahassee. The Florida lab features the world’s largest static magnet. “When we finally have our best materials, we bring them down to the magnet lab. They have been very supportive of our projects,” he adds. Checkelsky says he is looking forward to completion of MIT.nano, where he hopes to make use of the state-of-the-art facilities. “Then we will be able to go from thinking of projects to combining the powders to making the crystals to walking them next door to MIT.nano for the next step. It will be a really key facility for our projects,” he says. Checkelsky also is part of the Center for Integrated Quantum Materials. He works closely with MIT experimentalists Nuh Gedik, Ray Ashoori, and Pablo Jarillo-Herrero and theorists Patrick Lee, Liang Fu, Senthil Todadri, Leonid Levitov, and Xiao-Gang Wen. Graduate student Aravind Devarakonda is studying magnetic behavior of heavy metal compounds where static magnetism provides a source of correlation for the electrons. “The basic idea is that certain spinel compounds have a fixed level of magnetic order which can persist even with changing composition of other lattice constituents. By going from lighter to heavier elements surrounding these magnetic atoms, we can introduce topological electronic features into the material,” Devarakonda says. “If we want to combine electronic correlation with the physics of topological insulators and related materials we have to make progress on several fronts,” Checkelsky explains. “In addition to following theoretical predictions, an experimental voyage into material systems is a key component of this. And indeed thus far the work has been experimentally driven. In this sense the theme has been to look at systems where the presence of non-trivial electronic topology is not well-resolved from theory due to the complications of electronic correlation but which we can grow and examine experimentally.” Devarakonda, who earned his bachelor’s in applied science (physics) at Rutgers University, has become expert in the techniques of crystal growth, cryogenics, electrical measurements, nanofabrication, metal work, and first principles calculations — “the full tool belt,” Checkelsky says. Checkelsky received his BS in physics at Harvey Mudd College and PhD in physics at Princeton University in 2010. Before joining the faculty at MIT in January 2014, Checkelsky was a postdoc at Japan’s Institute for Physical and Chemical Research (RIKEN) and a lecturer at the University of Tokyo. His work and continued collaboration there includes studies of the surface properties of topological insulators and more recently unusual electronic properties of a compound material with layers of three elements — bismuth, tellurium, and iodine. “The atoms line up in the same stacking sequence through the whole material,” Checkelsky explains. “So, the system breaks a spatial symmetry and has a direction associated with it.” “This type of compound is called polar because of this directionality. That structural difference has profound implications for the electronic behavior,” he says. In particular this polarity changes the spin degree of freedom of the electron so that the way electrons move in the solid very strictly depends on the spin direction. Experiments published in a 2015 paper demonstrated a spin up channel and a spin down channel with different energy levels in measurement of their electrical resistance under a magnetic field. This work could have implications for future spintronic devices. Checkelsky is in his third term of teaching  8.02 (Electromagnetism) in the Department of Physics. With a typical class size of 100 students, 8.02 is taught in a Technology Enabled Active Learning (TEAL) classroom with students around the teacher. “It gives you not only face-to-face communication with the students, but a technological link as well. They have a clicker with which they can respond to questions, which can offer a view into what they’re thinking,” Checkelsky explains. “I had the good fortune of starting my teaching in 8.02 with Peter Dourmashkin, who is a constant source of insight into how to approach the class. I really enjoy working with the students and trying to convey not only my enthusiasm for physics but also practical, effective ways for them to tackle the course material.” Checkelsky’s lab has a partnership with the Wilson Creek Elementary School located in Johns Creek, Georgia, near his hometown north of Atlanta. With the help of their teachers, students there submit questions about science, and Checkelsky’s team comes up with the best answers they can. Analysis of student submissions showed that the most frequently occurring word in the students’ questions is “possible.” “They’re really at a very young age interested in what is possible for human beings and technology,” Checkelsky says. “We approach their questions as seriously as any kind of scientific question that comes up in our research. We have to read papers and discuss with colleagues; we really try to come up with a complete answer for students.” In addition to the support of the teachers and Principal Andrea Cushing, it is no doubt a great benefit that Checkelsky’s mom, Eileen Checkelsky, is the current principal’s secretary at Wilson Creek Elementary School. Checkelsky’s office windows are lined with towering plants inherited from Tom Greytak, retired professor of physics, who previously had the office. “At first I had to figure out what the names of the plants were. But taking care of them has become a serious hobby of mine.” This dovetails with his interest in cooking. “I think it’s curious that what I do at MIT is synthesizing and studying inorganic materials and my hobbies are basically synthesizing and processing organic ones. It all revolves around finding the right recipe,” he says.


News Article | September 30, 2016
Site: www.chromatographytechniques.com

Mice have brain cells that are dedicated to storing memories of other mice, according to a new study from MIT neuroscientists. These cells, found in a region of the hippocampus known as the ventral CA1, store “social memories” that help shape the mice’s behavior toward each other. The researchers also showed that they can suppress or stimulate these memories by using a technique known as optogenetics to manipulate the cells that carry these memory traces, or engrams. “You can change the perception and the behavior of the test mouse by either inhibiting or activating the ventral CA1 cells,” says Susumu Tonegawa, the Picower Professor of Biology and Neuroscience and director of the RIKEN-MIT Center for Neural Circuit Genetics at the Picower Institute for Learning and Memory. Tonegawa is the senior author of the study, which appears in the Sept. 29 online edition of Science. MIT postdoc Teruhiro Okuyama is the paper’s lead author. In a well-known study published in 2005, researchers at Caltech identified neurons in the human brain that respond specifically to images of celebrities such as Halle Berry or Brad Pitt, leading them to conclude that the brain has cells devoted to storing memories of people who are familiar. Many of these cells were found in and around the hippocampus, which is also where the brain stores memories of events, known as episodic memories. The MIT team suspected that in mice, social memories may be stored in the hippocampus’ ventral CA1, in part because previous studies have suggested that this region is not involved in storing episodic memories. The researchers set out to test this hypothesis using optogenetics: By engineering neurons of the ventral CA1 to express light-sensitive proteins, they could artificially activate or inhibit these cells by shining light on them as the mice interacted with each other. First, the researchers allowed one mouse, known as the “test mouse,” to spend time with another mouse for two hours, letting the mice become familiar with each other. Soon after, the test mouse was placed in a cage with the familiar mouse and a new mouse. Under normal circumstances, mice prefer to interact with mice they haven’t seen before. However, when the researchers used light to shut off a circuit that connects the ventral CA1 to another part of the brain called the nucleus accumbens, the test mouse interacted with both of the other mice equally, because its memory of the familiar mouse was blocked. “The inhibition of ventral CA1 leads to impairment of the social memory,” Okuyama says. “They cannot show any preference for the novel mouse. They approach both mice equally.” On the other hand, when the researchers stimulated ventral CA1 cells while the test mouse was interacting with a novel mouse, the test mouse began to treat the novel mouse as if they were already acquainted. This effect was specific to social interactions: Interfering with the ventral CA1 did not have any effect on the mice’s ability to recognize objects or locations that they had previously seen. When the researchers monitored activity of neurons in the ventral CA1, they found that after a mouse was familiarized with another mouse, a certain population of these neurons began to respond specifically to the familiar mouse. These patterns could be seen even after the mice appeared to “forget” the once-familiar mice. After about 24 hours of separation, the test mice began to treat their former acquaintances as strangers, but the neurons that had been tuned to the familiar mice still fired, although not as frequently. This suggests that the memories are still being stored even though the test mice no longer appear to remember the mice they once knew. Furthermore, the researchers were able to “re-awaken” these memories using optogenetics. In one experiment, when the test mouse first interacted with another mouse, the researchers used a light-sensitive protein called channelrhodopsin to tag only the ventral CA1 cells that were turned on by the familiarization treatment. When these neurons were re-activated with light 24 hours later, the memory of the once-familiar mouse returned. The researchers were also able to artificially link the memory of the familiar mouse with a positive or negative emotion. Tonegawa’s lab has previously used this technique to identify hippocampal cells that store engrams representing episodic memories. The new study offers strong evidence that memory traces for specific individuals are being stored in the neurons of the ventral CA1, Tonegawa says. “There is some kind of persistent change that takes place in those cells as long as memory is still detectable,” he says. Larry Young, a professor of psychiatry and director of the Center for Translational Social Science at Emory University, described the study as “one of the most fascinating papers related to social neuroscience I’ve ever seen.” “In this paper, they identified a subset of cells in a particular brain region that is the engram — a set of cells that through its connections in the nucleus accumbens, actually holds the memory of another individual,” says Young, who was not involved in the study. “They showed that the same group of neurons fired repeatedly in response to the same animal, which is absolutely incredible. Then to go in and control those specific cells is really on the cutting edge.” The MIT researchers are now investigating a possible link between social memory and autism. Some people with autism have a mutation of the receptor for a hormone called oxytocin, which is abundant on the surface of ventral CA1 cells. Tonegawa’s lab hopes to uncover whether these mutations might impair social interactions.


News Article | November 3, 2016
Site: www.eurekalert.org

Research could help explain why some obese people are more prone to diabetes than others For years, scientists have known that someone who is thin could still end up with diabetes. Yet an obese person may be surprisingly healthy. Now, new research led by scientists at the University of Utah College of Health, and carried out with an international team of scientsts, points to an answer to that riddle: accumulation of a toxic class of fat metabolites, known as ceramides, may make people more prone to type 2 diabetes. Among patients in Singapore receiving gastric bypass surgery, ceramide levels predicted who had diabetes better than obesity did. Even though all of the patients were obese, those who did not have type 2 diabetes had less ceramide in their adipose tissue than those who were diagnosed with the condition. "Ceramides impact the way the body handles nutrients," says the study's senior author Scott Summers, Ph.D., also chairman of the University of Utah Department of Nutrition and Integrative Physiology. "They impair the way the body responds to insulin, and also how it burns calories." In the study, published on Nov. 3 in Cell Metabolism online, the researchers also show that a buildup of ceramides prevents the normal function of fat (adipose) tissue in mice. When people overeat, they produce an excess of fatty acids. Those can be stored in the body as triglycerides or burned for energy. However in some people, fatty acids are turned into ceramides. "It's like a tipping point," Summers said. At that point, when ceramides accrue, the adipose tissue stops working appropriately, and fat spills out into the vasculature or heart and does damage to other peripheral tissues. Until now, scientists didn't know how ceramides were damaging the body. The three-year project found that adding excess ceramides to human fat cells, or mice, caused them to become unresponsive to insulin and develop impairments in their ability to burn calories. The mice were also more suceptible to diabetes as well as fatty liver disease. Conversely, they also found that mice with fewer ceramides in their adipose tissue were protected from insulin resistance, a first sign of diabetes. Using genetic engineering, researchers had deleted the gene that converts saturated fats into ceramides. The findings indicate that high ceramides levels may increase diabetes risk and low levels could protect against the disease. The scientists think this could mean that some people are more likely to convert calories into ceramides than others. "That suggests some skinny people will get diabetes or fatty liver disease if something such as genetics triggers ceramide accumulation," said Bhagirath Chaurasia, Ph.D., assistant professor at the University of Utah and the lead author of the study. As a result of the new research, the scientists are now searching for genetic mutations that lead to people's predisposition to accumulating ceramides, developing obesity and type 2 diabetes. Summers notes that some Asian countries have a higher diabetes rate than the United States even though the obesity rate is relatively low. "Some people are just not made to deal with dietary fat," says Summers. "It's not just how much you eat, because some people can eat a lot and they just store all the fat effectively and remain healthy." Adipose tissue exists as three types. White adipose tissue is considered the "bad" kind, because it predominately stores fat. Brown adipose tissue burns fat to generate heat. Beige adipose tissue is a variety of white fat that can change to brown when the body needs to produce heat or create energy. Based on their research, the scientists propose that as ceramides build up, the tissue loses the characteristics of brown fat, effectively becoming more white. This sets off a sequence of events that can lead to disease. Summers previously published research in 2007 proving that the inhibition of ceramide synthesis in rodents prevented the development of fatty liver disease and diabetes. He is now working to develop drugs to target that issue. "By blocking ceramide production, we might be able to prevent the development of type 2 diabetes or other metabolic conditions, at least in some people," Chaurasia said. Knowing how problematic ceramide accumulation is inside adipose tissue will help researchers focus on that specific problem. Funding: National Medical Research Council, Singapore; Victorian State Government OIS scheme, Australia; University of Utah Diabetes and Metabolism Center; University of Utah College of Health. Collaboratoring Institutions: University of Utah College of Health; Baker IDI Heart and Diabetes Institute, Australia; Singapore Bioimaging Consortium; Duke-NUS Graduate Medical School, Singapore; National University of Singapore; Tata Institute of Fundamental Research, India; University of Brunei Darussalam; Yong Loo Lin School of Medicine; University of Michigan; RIKEN Brain Science Institute, Japan.


News Article | November 10, 2016
Site: www.nature.com

Major brain-mapping projects have multiplied in recent years, as neuroscientists develop new technologies to decipher how the brain works. These initiatives focus on understanding the brain, but the World Health Organization (WHO) wants to ensure that they work to translate their early discoveries and technological advances into tests and treatments for brain disorders. “We think there are side branches from projects that could be pursued with a very small investment to benefit public health,” says Shekhar Saxena, director of the WHO’s mental-health and substance-abuse department. Saxena will make that case on 12 November at the annual meeting of the Society for Neuroscience in San Diego, California — continuing a discussion that began in July at the WHO’s headquarters in Geneva, Switzerland. Among the roughly 70 people who attended that first meeting were leaders of the major brain initiatives, including the US BRAIN (Brain Research through Advancing Innovative Neurotechnologies) Initiative, launched in 2013; the European Human Brain Project, started in 2013; and the Japanese Brain/MINDS project, launched in 2014. All of these projects focus on basic research on the brain or the development of sophisticated tools to study it. Clinical applications are an ultimate, rather than an immediate, goal. But at the Geneva meeting, project leaders agreed, in principle, that they should do more to adapt brain-imaging technologies for use in clinical diagnoses. “The WHO is concerned that the emphasis on building these very expensive devices could worsen the health disparities that we have now between the developed and underdeveloped world,” says Walter Koroshetz, director of the US National Institute of Neurological Disorders and Stroke, which is part of the BRAIN Initiative. For instance, researchers funded by the BRAIN Initiative are developing imaging procedures to identify every connection in a mouse’s brain, or watch neurons fire in a circuit in real time. Yet versions of these technologies that are suitable for use in humans are likely to be so expensive and difficult to use that they will be available only at a few research centres — and not at the average US hospital, much less in low-income countries. Still, some researchers have found a sweet spot at which they can develop clinical imaging while working to understand the brain — even when working with limited equipment in developing countries, Koroshetz says. Gretchen Birbeck, a neurologist at the University of Rochester in New York, is working in Zambia to understand how cerebral malaria can lead to epilepsy in children. She uses a magnetic resonance imaging (MRI) machine to watch how neural activity changes over time in the brains of children with malaria — and how, in some cases, epilepsy emerges. Using existing technology, “we can really drill down and ask some important scientific questions that would have implications much more broadly”, Birbeck says. She hopes to do so despite using an MRI machine that is only about 10% as powerful as those in many US hospitals. The WHO meeting participants also noted that existing technologies — such as mobile phones, which are prevalent in many developing countries where doctors are not — can be used to apply research findings to public health. Farrah Mateen, a neurologist at Massachusetts General Hospital in Boston who attended the WHO’s July meeting, has developed a cheap cap studded with electroencephalography sensors and an app that can identify the brain patterns that occur in people with epilepsy when they are between seizures. Her study of 205 people with epilepsy in Bhutan, now in review at a journal, showed that the app could reliably detect this neural activity — allowing health-care workers with little training to identify the type of epilepsy someone has and which drug could best treat it. But one big question looms over the WHO’s push to ensure that brain–mapping projects yield clinical benefits: the agency does not fund research. Instead, it hopes to convert private donors and governments to its way of thinking. “We’re just going to try to influence the scientists as well as the funders to see whether there could be a better balance between long-term outcomes and more short-term, public-health-oriented outcomes,” says Saxena. Not everyone is ready to reset their priorities. Tetsuo Yamamori, a neuroscientist at RIKEN Brain Institute in Saitama and vice project leader of the Brain/MINDS project, says that its primary goal will remain the same: linking behaviour to mapping brain activity in genetically engineered marmosets. But he agrees that developers of cutting-edge technologies should consider how they could be used in people. Yamamori adds that he will continue to participate in the WHO’s brain-mapping discussions. Saxena is optimistic that the WHO’s lobbying will pay off. Eventually, he hopes to establish a network of researchers working to transform advances in brain research to improvements in medicine. “We really don’t understand this organ,” he says. “We need to make incremental advancements, and those need to be translated into something actionable in a short time.”


No statistical methods were used to predetermine sample size. The experiments were not randomized and investigators were not blinded to allocation during experiments and outcome assessment. The human iPS cell lines 201B7, 253G1, and 454E2 were obtained from the RIKEN Bio Resource Center (Tsukuba, Japan)21, 22. The 1231A3 and 1383D2 human iPS cells were provided by the Center for iPS Cell Research and Application, Kyoto University23. All cells were cultured in StemFit medium (Ajinomoto, Tokyo, Japan) on LN511E8-coated (0.5 μg cm−2) dishes23, 24. LN511E8, produced using cGMP-banked CHO-S cells (Life Technologies, Carlsbad, CA), was obtained from Nippi (Tokyo, Japan). In part, LN511E8 was produced using human 293-F cells as previously described12. The 201B7 and 454E2 human iPS cell lines were used in the in vitro experiments, while 201B7 and 1383D2 cells were used in the animal experiments; 253G1 and 1231A3 cells were used in the supplementary experiments, the results of which are reported in Extended Data Fig. 7. All of the experiments using recombinant DNA were approved by the Recombinant DNA Committees of Osaka University and were performed according to our institutional guidelines. The differentiation culture for human iPS cells was performed as indicated in Fig. 3a. First, human iPS cells were seeded on LN511E8-coated dishes at 350–700 cells cm−2, after which they were cultivated in StemFit medium for 8–12 days. The culture medium was then changed to DM (differentiation medium; GMEM (Life Technologies) supplemented with 10% knockout serum replacement (KSR; Life Technologies), 1 mM sodium pyruvate (Life Technologies), 0.1 mM non-essential amino acids (Life Technologies), 2 mM l-glutamine (Life Technologies), 1% penicillin-streptomycin solution (Life Technologies) and 55 μM 2-mercaptoethanol (Life Technologies) or monothioglycerol (Wako, Osaka, Japan))25. In some experiments, as indicated in the Results section, Noggin (R&D systems, Minneapolis, MN), LDN-193189 (Wako) or SB-431542 (Wako) were added for the first four days. BMP4 (R&D systems) was used in some early experiments at concentrations up to 0.125 nM. This had no discernible effect on SEAM formation, however, so its use was discontinued. After four weeks of culture in DM, the medium was changed to corneal differentiation medium (CDM; DM and Cnt-20 or Cnt-PR (w/o; EGF and FGF2) (1:1, CELLnTEC Advanced Cell Systems, Bern, Switzerland) containing 5 ng ml−1 FGF2 (Wako), 20 ng ml−1 KGF (Wako) 10 μM Y-27632 (Wako) and 1% penicillin-streptomycin solution). FGF2 in CDM was not essential for corneal epithelial induction. During CDM culture (around six to eight weeks of differentiation), non-epithelial cells were removed by manual pipetting under microscopy (Extended Data Fig. 2a, b). After pipetting, the medium was changed to fresh CDM. After four weeks of culture in CDM, the medium was changed to corneal epithelium maintenance medium (CEM; DMEM/F12 (2:1), Life Technologies) containing 2% B27 supplement (Life Technologies), 1% penicillin-streptomycin solution, 20 ng ml−1 KGF and 10 μM Y-27632 for two to seven weeks. To achieve retinal differentiation (Fig. 2c) after four weeks of differentiation the medium was directly changed to CEM. Isolated RPE cell colonies were cultivated in CEM on separate dishes coated with LN511E8. Phase-contrast microscopic observations were performed with an Axio-observer.Z1, D1 (Carl Zeiss, Jena, Germany) and an EVOS FL Auto (Life Technologies). Differentiated human iPS cells in CEM were dissociated using Accutase (Life Technologies), and resuspended in ice-cold KCM medium (DMEM without glutamine and Nutrient Mixture F-12 Ham (3:1, Life Technologies) supplemented with 5% FBS (Japan Bio Serum, Hiroshima, Japan), 0.4 μg ml−1 hydrocortisone succinate (Wako), 2 nM 3,3′,5-Triiodo-l-thyronine sodium salt (MP biomedicals, Santa Ana, CA), 1 nM cholera toxin (List Biological Laboratory, Campbell, CA), 2.25 μg ml−1 bovine transferrin HOLO form (Life Technologies), 2 mM l-glutamine, 0.5% insulin transferrin selenium solution (Life Technologies) and 1% penicillin-streptomycin solution). The harvested cells were filtered with a cell strainer (40 μm, BD Biosciences, San Diego, CA) and then stained with anti-SSEA-4 (MC813-70, Biolegend, San Diego, CA), TRA-1-60 (TRA-1-60-R, Biolegend) and CD104 (ITGB4; 58XB4, Biolegend) antibodies for 1 h on ice. After being washed twice with PBS, stained cells underwent cell sorting with a FACSAria II instrument (BD Biosciences). For intracellular protein staining, a BD Cytofix/Cytoperm (BD Biosciences) kit was used. In all of the experiments, cells were stained with non-specific isotype IgG or IgM as controls (Biolegend). The data were analysed using the BD FACSDiva Software (BD Biosciences) and the FlowJo software program (TreeStar, San Carlos, CA). Sorted human iPS cell-derived epithelial cells obtained from zone 3 of the SEAM (human iCECs) were seeded on LN511E8 coated (0.5 μg cm−2) cell culture inserts or temperature-responsive dishes (UpCell, CellSeed, Tokyo, Japan) without cell passaging, and were cultured in CEM until confluence26. To promote maturation, the epithelial cells were cultivated in CMM (corneal epithelium maturation medium; KCM medium containing 20 ng ml−1 KGF and 10 μM Y-27632) for an additional 3–14 days after CEM culture. The human iCECs cultivated on temperature-responsive dishes were released from their substrate by reducing the temperature to 20 °C. Total RNA was obtained from differentiated human iPS cells after specific culture periods, from human epidermal keratinocytes (EKs (foreskin), Life Technologies and TaKaRa Bio, Otsu, Japan), and from human corneal limbal epithelial cells (CECs) using the RNeasy total RNA kit or the QIAzol reagent (Qiagen, Valencia, CA). Reverse transcription was performed using the SuperScript III First-Strand Synthesis System for qRT–PCR (Life Technologies) according to the manufacturer’s protocol, and cDNA was used as a template for PCR. qRT–PCR was performed using the ABI Prism 7500 Fast Sequence Detection System (Life Technologies) in accordance with the manufacturer’s instructions. The TaqMan MGB used in the present study are shown in Supplementary Table 2. The thermocycling program was performed with an initial cycle at 95 °C for 20 s, followed by 45 cycles at 95 °C for 3 s and 60 °C for 30 s. Research grade human skin tissue sections were obtained from US Biomax Inc. (MD, USA) and human oral mucosal tissue was obtained from Science Care (Phoenix, AZ). The cells were fixed in 4% paraformaldehyde (PFA) or cold methanol, washed with Tris-buffered saline (TBS, TaKaRa Bio) three times for 10 min and incubated with TBS containing 5% donkey serum and 0.3% Triton X-100 for 1 h to block non-specific reactions. They were then incubated with the antibodies shown in Supplementary Table 3 at 4 °C overnight or at room temperature for 3 h. The cells were again washed twice with TBS for 10 min, and were incubated with a 1:200 dilution of Alexa Fluor 488-, 568-, 647-conjugated secondary antibodies (Life Technologies) for 1 h at room temperature. Counterstaining was performed with Hoechst 33342 (Molecular Probes) before fluorescence microscopy (Axio Observer.D1, Carl Zeiss). Fabricated human iCEC sheets were fixed with 10% formaldehyde neutral buffer solution (Nacalai Tesque, Kyoto, Japan). After washing with distilled water, the human iCEC sheets were embedded in paraffin from which 3-μm-thick sections were cut. These were stained with haematoxylin and eosin following deparaffinization and hydration. The sections were observed with a NanoZoomer-XR C12000 (Hamamatsu Photonics, Hamamatsu, Japan), BZ-9000 (KEYENCE, Osaka, Japan) and an Axio Observer.D1. Differentiated human iPS cells (more than 12 weeks of differentiation) were fixed with 10% formaldehyde neutral buffer solution, after which PAS staining was performed with a PAS staining kit (MERCK KGaA, Darmstadt Germany) according to the manufacturer’s protocol. The sections were observed with an Axio Observer.D1. Epithelial cells were seeded onto MMC-treated NIH-3T3 feeder layers at a density of 3,000–20,000 cells per well. These were cultivated in CMM for 7–14 days. The colonies were fixed with 10% formaldehyde neutral buffer solution and then stained with rhodamine B (Wako). Colony formation was then assessed using a dissecting microscope and the colony-forming efficiency (CFE) was calculated. For the holoclone analysis, a single human iCEC colony derived from the SEAM was cultivated on 3T3-J2 (provided by H. Green, Harvard Medical School, Boston, MA) in CMM for 7–11 days was picked up under a dissecting microscope and dissociated by TrypLE Select (Life Technologies). The dissociated human iCECs were again seeded on a MMC-treated 3T3-J2 feeder layer and cultivated in CMM for 10–13 days. The colonies were scored under a microscope and classified as holoclones, paraclones or meloclones based on previously reported methods27. Human CECs were harvested from corneoscleral rims (Northwest Lions Eye Bank, Seattle, WA) as reported previously28. Human CECs and human oral keratinocytes (OKs; ScienCell, Carlsbad, CA) along with SEAM-derived human iCECs were cultivated on LN511E8 coated cell culture inserts in CEM until confluent. They were then cultivated in CMM. Human dermal fibroblasts (DFs; ScienCell) were cultivated in DMEM/F12 (2:1) containing 10% FBS. Total RNA was obtained from human iPS cells, iCECs, CECs, OKs, DFs, and six-week differentiated iPS cells (that is, OSE) using the QIAzol reagent. A microarray analysis using Sure Print G3 human 8x60K slides (Agilent technologies, Palo Alto, CA) was performed at Takara Bio. The data were analysed using the GeneSpring GX software program (Agilent technologies). Microarray data used in this study are deposited in Gene Expression Omnibus under accession number GSE73971. The cultivated epithelial cell sheets were fixed in 2.5% glutaraldehyde (Nacalai Tesque) at 4 °C overnight. Subsequently, the sheets were washed in buffer, dehydrated with ethanol and tert-butyl alcohol (Wako), and critical point dried (JFD-320, JEOL, Tokyo, Japan). After sputter-coating with platinum in an auto fine coater (JFCL-1600, JEOL), the samples were observed by scanning electron microscopy (JSM-6510LA, JEOL) at 5 kV. FACS-isolated human iCECs were cultivated on MMC-treated NIH-3T3 feeder layers in CMM up to 70–80% confluence. The human iCECs were harvested using TrypLE Select following the removal of feeder cells by manual pipetting. The total cell numbers were counted, after which the cells were passaged at a 1:8 ratio onto newly prepared feeder layers. These were cultivated in CMM until sub-confluence was reached again. The G-band karyotype analysis for human iCECs was performed at Nihon Gene Research Laboratories (Sendai, Japan). All animal experimentation was performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and was approved by the animal ethics committees of Osaka University. To examine embryonic mouse eyes, pregnant females (C57/BL6, E9.5–18.5) were acquired from SLC Japan (Shizuoka, Japan). For the transplantation experiments, Female New Zealand white rabbits (2.5–3.0 kg (approximately 12–14 weeks)) were obtained from Kitayama Labes (Nagano, Japan). Harvested human iCEC sheets were grafted onto rabbit corneas, in which a total epithelial limbal stem-cell deficiency had been created following a corneal and limbal lamellar keratectomy (Extended Data Fig. 8c–j). After surgery, 0.3% ofloxacin ointment (Santen Pharmaceutical, Osaka, Japan), 0.1% betamethasone phosphate eye drops (Shionogi Pharmaceutical, Osaka, Japan) and 0.1% sodium hyaluronate eye drops (Santen Pharmaceutical) were applied three to four times per day. Triamcinolone acetonide (8 mg; Bristol Myers Squibb, Tokyo, Japan) was also administered by subconjunctival injection. Tacrolimus (0.05 mg kg−1 per day, Astellas Pharma, Tokyo, Japan) and Mizoribine (4.0 mg kg−1 per day Sawai Pharmaceutical, Osaka, Japan) were systemically administered using an osmotic pump (DURECT, Cupertino, CA). The corneal barrier function following surgery was assessed by 0.5% fluorescein eye drop instillation at day 7 and day 14 after surgery and the fluorescein negative area was calculated using the AxioVision software program (Carl Zeiss). Throughout the healing period, the cornea was observed with a digital slit-lamp camera (SL-7F, TOPCON, Tokyo, Japan) and 3D OCT1000 MARK II (TOPCON) or CASIA SS-1000 (TOMEY, Nagoya, Japan) machines. If an infection was found or if unexpected weight loss occurred, animals were excluded from the analysis. The rabbits were euthanized by the intravenous administration of sodium pentobarbitone 14 days after transplantation, after which the eyes were immediately enucleated for the histological analyses. No blinding or randomization was conducted to allocate animals to each group. The data are expressed as means ± standard deviation (s.d.). The statistical analyses were performed using the Mann–Whitney rank sum test or Steel’s test. Bonferroni’s correction was applied to the data in animal experiments. All of the statistical analyses were performed using the JMP software program (SAS institute Inc., Cary, NC). No statistical methods were used to predetermine sample size. Comprehensive technical details can be found in Protocols Exchange, http://dx.doi.org/10.1038/protex.2016.009.


News Article | August 22, 2016
Site: cen.acs.org

For a long time, the club of scientists working with terahertz radiation was fairly exclusive. Its “members” included instrumentation aficionados who made customized equipment for probing molecules in the terahertz range (1 THz = 1012 Hz), also known as the far-infrared range. These scientists used light in this portion of the electromagnetic spectrum, which sits between the infrared and microwave regions, for studies in a number of areas such as spectroscopy and astronomy. For example, astronomers have used it to study the abundance of water, carbon monoxide, and oxygen in interstellar clouds. In recent years, however, affordable commercial instruments for generating and detecting terahertz light have become widely available. As a result, the once-exclusive club now includes many researchers who are applying terahertz light to areas that were difficult to study previously. These scientists are harnessing unique analytical abilities of terahertz light. Unlike infrared light, for example, which induces bending and stretching motions within molecules, terahertz light causes collective motions of groups of molecules. This provides new ways of interrogating molecular systems. In one study, researchers used terahertz spectroscopy to measure the elasticity of polyproline helices (Angew. Chem. Int. Ed. 2016, DOI: 10.1002/anie.201602268). Because polyproline is a key component of collagen, a protein that imparts strength and structural integrity to connective tissues, the elasticity of the biopolymer is related to the springiness of skin and tendons. Polyproline has long been considered a rather rigid molecule, says Syracuse University chemist Timothy M. Korter. The rigidity is often invoked to explain the basis of mechanical strength in proline-based proteins, he adds, but it has been difficult to measure that property directly. Korter and coworkers used terahertz spectroscopy, quantum calculations, and other methods to determine Young’s modulus, a measure of springiness, for two helical forms of poly- -proline: form I, which is a right-handed helix, and form II, which is a left-handed helix. Their findings show that conventional wisdom is wrong about polyproline. It turns out that the helices are considerably less rigid than many other natural and synthetic polymers. And because of differences between peptide bond geometries in the two forms, they differ greatly from each other. The team reports Young’s moduli of 4.9 and 9.6 gigapascals for forms I and II, respectively. For comparison, the polymer poly- -glycine has a Young’s modulus of 42 GPa. In the other terahertz-polymer study, scientists used terahertz light to induce conformational changes and crystallization in poly(3-hydroxybutyrate) (PHB), a well-studied bioderived plastic (Sci. Rep. 2016, DOI: 10.1038/srep27180). The study may offer a new low-energy way to control the orientation of molecular chains and degree to which they are ordered. Those parameters often dictate a polymeric material’s physical properties, such as flexibility, heat resistance, transparency, and toughness. And they affect the biological activity of biopolymers. Hiromichi Hoshina, a senior scientist at Japan’s RIKEN research institute, and coworkers irradiated PHB-chloroform solutions with intense terahertz light as the solvent evaporated. By coupling control experiments with electron microscopy analysis, the researchers showed that the terahertz light induced obvious microscopic changes in the polymer films’ morphologies, but not as a result of thermal effects. And by using spectroscopy methods, they showed that the terahertz light increased the degree of crystallization by up to 20%. The mechanism controlling crystallization remains unclear, Hoshina acknowledges. The studies indicate that terahertz light activates intermolecular motions between polymer chains and solvent molecules, he says, but it probably occurs indirectly, perhaps through the effects of terahertz-generated shock waves. His team is now investigating that hypothesis. The team also aims to study whether the method can induce crystallization in biopolymers that are difficult to crystallize. “It’s exciting to see how terahertz methods are being used nowadays in a growing number of important applications,” says Yale University’s Charles A. Schmuttenmaer, one of the field’s pioneers. The polyproline study “beautifully demonstrates” the power of combining terahertz spectroscopy with high-level computational methods, he says. And the PHB study shows that polymer crystallization can be driven by terahertz radiation’s unique ability to tap into low-frequency intermolecular vibrations. University at Buffalo, SUNY, physicist Andrea Markelz, a terahertz spectroscopist who specializes in biomolecular dynamics, is also enthusiastic about these studies. Regarding the significance of the Syracuse work, Markelz notes that polypeptide elasticity is important biologically, but it has been very challenging to design an experiment to measure that parameter directly. Meanwhile, the RIKEN researchers convincingly conducted control tests and observed a “clear effect of terahertz light on crystal growth,” she says. “I have never seen anything like this before.” Jiang Zhao, a polymer physicist at the Institute of Chemistry of the Chinese Academy of Sciences, notes that after decades of investigations “there still are unsolved problems in basic polymer science.” For example, scientists would like to understand the relationship between polymer chain structure and polymer properties, as well as learn about molecular behavior during phase transitions such as crystallization. “These studies show that terahertz methods can certainly help advance our understanding of fundamental polymer properties.”


News Article | April 14, 2016
Site: news.yahoo.com

The Tully monster likely used its long tail to propel it forward in the water. A tiny clue hidden in the bizarre eyes of the 300-million-year-old remains of a "Tully monster" has helped scientists determine that the curious creature is a vertebrate, a new study finds. Researchers analyzed the so-called monster's eyes, and found that they held two different kinds of pigment cells. Some of these cells looked like microscopic sausages, and the others looked like tiny meatballs, the researchers said. Only vertebrates have these pigment cells that resemble sausages and meatballs, indicating that Tully (Tullimonstrum gregarium) wasn't an invertebrate, but rather had a backbone, they said. [Photos: Ancient Tully Monster's Identity Revealed] "This is an exciting study because not [only] have we discovered the oldest fossil pigment, but the structures seen in Tullimonstrum's eyes suggest it had good vision," the study's lead researcher Thomas Clements, a doctoral student in the Department of Geology at the University of Leicester in the United Kingdom, said in a statement. "The large tail and teeth suggest that the Tully Monster is, in fact, a type of very weird fish." The Tully monster has a storied history. Amateur fossil collector Francis Tully discovered the first fossil of the monster in 1958. Since then, so many Tully monster fossils have been uncovered in Illinois' coal quarries, that the state made it the official state fossil. Even so, scientists couldn't figure out what type of creature the fossils represented. Since the Tully monster's discovery over 60 years ago, "scientists have suggested it is a whole parade of completely different creatures, ranging from mollusks to worms," said study senior researcher Sarah Gabbott, a professor in the Department of Geology at the University of Leicester. "But there was no conclusive evidence, and so speculation continued." In the new study, the researchers focused on the creature's blobby eyes — round balls that sat at the ends of hammerhead-like eyestalks. These dark blobs were composed of hundreds of thousands of microscopic dark granules, they found. Each granule was tiny, about 50 times smaller than the width of a human hair, they said. The granules' shape and chemical makeup suggested that they were organelles found within melanosomes, cells that create and store the pigment melanin, the researchers said. "We used a new technique called Time of Flight Secondary Ion Mass Spectrometry (ToF-SIMS) to identify the chemical signature of the fossil granules, and compared it to known modern melanin from crows," said study co-researcher Jakob Vinther, a senior lecturer of macroevolution at the University of Bristol in the United Kingdom. "This proved that we had discovered the oldest fossil pigment currently known." Most animals produce the pigment melanin, which gives people their skin and hair color. "Melanin is also found in the eyes of many animal groups, where it stops light from bouncing around inside the eyeball and allows the formation of a clear visual image," Clements said. "This is the first unequivocal evidence that Tullimonstrum is a member of the same group of animals as us, the vertebrates." [Photos: Ancient Fish Had Well-Developed Lung] This is the second Tully monster study published this spring. The first study, detailed in the journal Nature by a different group of researchers, characterized the monster as an ancient jawless fish. Before reaching that conclusion, they examined more than 1,200 Tully monster fossils before describing it as a weird, Dr. Seuss-like creature. The new study reaches many of the same conclusions. "Perhaps even weirder fossil vertebrates remain to be dug up," Shigeru Kuratani and Tatsuya Hirasawa, researchers at the Evolutionary Morphology Laboratory at RIKEN, one of Japan's largest research institutions, wrote in a commentary, also published in the journal Nature. The study was published online today (April 13) in the journal Nature. Copyright 2016 LiveScience, a Purch company. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.


News Article | January 5, 2016
Site: www.techtimes.com

By studying Cr-doped (Sb, Bi)2Te3 thin films, researchers have identified the components needed to develop electric devices that consume extremely low levels of power, reporting their findings in the journal Nature Communications. At low temperatures, the film experiences the flow of an electric current around its edges without losing energy, even without an external magnetic field. The attraction present is attributed to the ferromagnetic properties the material has, although it is not clear how it managed to gain such. For the first time, however, researchers reveal the reason why the ferromagnetic properties manifest, in hopes of creating unique materials that can be used at room temperature. Practical applications were not pursued before because for an electric current to flow without losing energy, extremely low temperature and a large external magnetic field have to be present. To address the problem, researchers believed that creating topological insulators with ferromagnetic properties will be key, and they were right. A topological insulator is neither an insulator nor a metal and features exotic properties, such as generating electric currents on its surface or edge without generating any inside. As chromium (Cr) is a magnetic element, its atom is representative of a magnet the size of an atom. North-south orientations of atom-sized magnets have the tendency to align in parallel when Cr atoms interact, and when they do, this results in the Cr-doped (Sb, Bi)2Te3 film's ferromagnetism. Still, the researchers pointed out that interatomic distances between chromium atoms are too long for interactions to be sufficient enough to produce ferromagnetism. It turns out that that atoms from the non-magnetic elements such as selenium and tellurium are the ones that mediate between magnetic interactions in chromium atoms, acting as the bond stabilizing north-south orientations so that they face just one direction. Experiments for the study were mostly conducted at SPring-8, a synchrotron radiation facility situated in Japan's Hyogo Prefecture. The facility was developed by the Japan Atomic Energy Research Institute and RIKEN, Japan's largest comprehensive research institute. "We would not have achieved perfect results without the facilities and staff there," said Akio Kimura, a Hiroshima University professor and one of the members of the research group. "I greatly appreciate their efforts." The research was supported by the Ministry of Science and Technology of China, the Natural Science Foundation of China, JSPS KAKENHI and the Helmholtz Association. Other members of the group include: Mao Ye, Xiaoming Xie, Wei Li, Shan Qiao, Siyuan Zhu, Dawei Shen, Yukiharu Takeda, Zhengtai Liu, Yuji Saitoh, Haifeng Yang, Jiajia Wang, Zhen Liu, Hong Pan, Fuhao Ji, Munisa Nurmamat and Kazuki Sumida.


News Article | October 26, 2016
Site: www.nature.com

List of discoveries shows US contributions have declined, but Japanese, Russian and European work is on the rise. When it comes to discovering nuclear isotopes, retired physicist Gottfried Münzenberg is top, with 222. His colleague Hans Geissel, from the GSI Helmholtz Centre for Heavy Ion Research in Darmstadt, Germany, is next with 211. Then comes Francis Aston, the British chemist who won the 1922 Nobel Prize in Chemistry, with 207. These provisional rankings have been assembled by Michael Thoennessen, a physicist at the National Superconducting Cyclotron Laboratory at Michigan State University in East Lansing. With the help of several undergraduate students, he has assembled a database of the almost 3,100 known nuclear isotopes — atoms that share the same number of protons but have varying numbers of neutrons. He lists the discovery of each by researcher, the lab at which they worked and the method by which they produced the isotope. The vast majority of these isotopes only exist naturally for fleeting moments inside stars, formed during the production of heavy elements. They never exist on Earth at all, except for a few nanoseconds in elite nuclear-physics labs. The International Union of Pure and Applied Chemistry, headquartered in Zurich, Switzerland, assigns the official credit for discovering elements, but Thoennessen is now doing the same for all the isotopes of those elements. "I don't think it matters so much who gets the credit, but historically it's important to identify which countries and labs are driving the field," he says. The database lets Thoennessen rank labs as well as people, and to track how different countries' rising and falling investments in nuclear technology have affected where and how isotopes are discovered (Click here for an animated chart of known isotopes that shows how many were found in quick succession with each new wave of technology). Top of the lab list is Lawrence Berkeley National Laboratory in Berkeley, California, with 634 isotopes. GSI Darmstadt is second with 368; the University of Cambridge, UK, is third with 222, its discoveries made mostly in the days of Aston; and the Joint Institute for Nuclear Research in Dubna, Russia, is fourth with 215. Berkeley may reign supreme in terms of sheer numbers, but the trend over time tells a different story. In the 1980s and 1990s the lab failed to upgrade its equipment and so fell behind other labs. It also lost some credibility in 2002, when allegations surfaced that physicist Victor Ninov had faked the discovery of elements 116 and 118 there. These days, most new finds come from GSI Darmstadt, Dubna and other locations, such as the Radioactive Isotope Beam Factory(RIBF) in Wako, part of Japan's RIKEN national network of labs. Although the decline of Berkeley means that the United States is losing ground, in the longer term Thoennessen expects the country to maintain its supremacy with the Facility for Rare Isotope Beams (FRIB), construction of which is expected to begin in 2012 at Michigan State University. Not everyone agrees that this ranking is the best way to capture the science of the field. Krzysztof Rykaczewski, a nuclear physicist at Oak Ridge National Laboratory in Tennessee, who according to Thoennessen's list has discovered 60 isotopes, would like to see a ranking include not only discoveries, but also the first person to study the properties and nuclear structure of the atoms. "Identifying is only the first step," he says. But Patrick Regan, a physicist at the University of Surrey in Guildford, UK, who has 20 isotope discoveries to his name, thinks that the discovery itself does reflect something important. "I'm proud of each one of those 20," he says, "each of them is like a child to science." Thoennessen set the bar high when deciding what counted as a discovery, in the hope of improving standards in the field. He considers an isotope "discovered" only if its mass and charge have been identified in a peer-reviewed paper. As he dug into the literature, he found that some generally accepted isotopes in fact appeared only in less rigorously vetted sources, such as PhD theses, conference proceedings or unpublished 'private communications'. He discounted such discoveries. "There are numbers people take for granted where one really shouldn't," says Thoennessen. One person who is pleasantly surprised by the ranking is Münzenberg. He was aware that he had made a large contribution, including discovering elements 107–112 and some of their isotopes, but he hadn't realized that he would be top in the world. "I didn't know how many we'd made," he says. GSI Darmstadt is expected to announce a further 60 isotopes in the next year, and as equipment Münzenberg designed is still in use he may well remain ahead for the foreseeable future.


No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Vector expressing both gRNA and mCherry (pCAGmCherry-gRNA) was generated as previously described30. To construct gRNA expression vectors, each 20 bp target sequence was sub-cloned into pCAGmCherry-gRNA or gRNA_Cloning Vector (Addgene 41824). The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined)) used in this study include: scramble, GCTTAGTTACGCGTGGACGA ; mutant GFP, CAGGGTAATCTCGAGAGCTT ; MH1, GCCGCTTTACTTAGGTCCCC ; and MH2, GGAGATCCACTCTCGAGCCC ; for PITCh donor: mouse Tubb3, AGCTGCGAGCAACTTCACTT ; human TUBB3, AGCTGCGAGCAGCTTCACTT ; human KCNQ1, AGTACGTGGGCCTCTGGGGG ; the downstream of CAG promoter in Ai14 mouse, TAGGAACTTCTTAGGGCCCG ; rat Mertk for HITI, GAGGACCACTGCAACGGGGC ; rat Mertk for HDR, TCAGGTGCTTAGGCATTTCG . The Scramble-gRNA target sequence we designed is an artificial sequence that does not exist in human, mouse and rat genomes. We used the off-target finder software Cas-OFFinder (http://www.rgenome.net/cas-offinder/) to confirm that there were no genomic target sites within 2-bp mismatches. We have confirmed that the Scramble-gRNA can cut its target site in the donor vector (Extended Data Fig. 1b). pMDLg/pRRE, pRSV-Rev and pMD2.G (Addgene 12251, 12253 and 12259) were used for packaging lentiviruses. pEGIP*35 and tGFP (Addgene 26776 and 26864) were used for examining HDR and HITI efficiencies. To construct IRESmCherry-0c, IRESmCherry-1c, IRESmCherry-2c, IRESmCherry-MH, IRESmCherry-HDR-0c and IRESmCherry-HDR-2c, IRES and mCherry sequences were amplified with Cas9 target sequence by PCR from pEGIP*35 and pCAGmCherry-gRNA, respectively and co-integrated into pCR-bluntII vector (Invitrogen) with zero, one or two CAS9/gRNA target sequences. Cas9 expression plasmid (hCas9) was purchased from Addgene (41815). To generate different NLS-dCas9 constructs, pMSCV-LTR-dCas9-VP64-BFP (Addgene 46912) was used to amplify dCas9, which was subsequently subcloned into pCAG-containing plasmid with different NLS and 3×Flag tag. To construct pCAG-Cas9 (no NLS), pCAG-1NLS-Cas9-1NLS and pCAG-1BPNLS-Cas9-1BPNLS, D10A and H840A mutations of dCas9 plasmids were exchanged to wild-type sequence by In-Fusion HD Cloning kit (Clontech). Then, pCAG-Cas9-2AGFP (no NLS), pCAG-1NLS-Cas9-1NLS-2AGFP and pCAG-1BPNLS-Cas9-1BPNLS-2AGFP were constructed by adding 2AGFP downstream of Cas9. To construct pCAG-floxSTOP-1BPNLS-Cas9-1BPNLS, 1BPNLS-Cas9-1BPNLS was amplified by PCR and exchanged with GFP of pCAG-floxSTOP-EGFP-N1 vector31. To construct HITI donor plasmids for mouse and human Tubb3 gene (Tubb3-1c, Tubb3-2c, Tubb3-2cd, hTUBB3-1c and hTUBB3-2c) and PITCh donor (Tubb3-MH), GFP was subcloned into pCAG-floxSTOP plasmid with one or two CAS9/gRNA target sequences. To construct HDR donor for mouse Tubb3 gene (Tubb3-HR), GFP, 5′ and 3′ homology arms were amplified from pCAG-GFP-N1 or mouse genome, then subcloned into pCAG-floxSTOP plasmid. pCAG-ERT2-Cre-ERT2 was purchased from Addgene (13777). PX551 and PX552 were purchased from Addgene (60957 and 60958). To construct AAV-Cas9, nEF (hybrid EF1α/HTLV) promoter (Invivogen) was exchanged with Mecp2 promoter of PX551. To construct donor/gRNA AAVs for HITI, donor DNA sandwiched by Cas9/gRNA target sequence, gRNA expression cassette and GFPKASH (or mCherryKASH) expression cassettes were subcloned between ITRs of PX552, and generated pAAV-mTubb3, pAAV-Ai14-HITI, pAAV-Ai14-luc, pAAV-Ai14-scramble and pAAV-rMertk-HITI. For pAAV-rMertk-HITI, exon 2 of rat Mertk gene including the surrounding intron is sandwiched by Cas9/gRNA target sequence, which is expected to integrate within intron 1 of Mertk by HITI. For HDR AAV (pAAV-Ai14-HDR and pAAV-rMertk-HDR), the homology arms were amplified by PCR from mouse and rat genome DNA, and subcloned into AAV backbone plasmid. The plasmids described in this manuscript will be available to academic researchers through Addgene. Genomic DNAs were extracted using Blood & Tissue kit (QIAGEN) or PicoPure DNA Extraction Kit (Thermo Fisher Scientific). Genomic PCRs were performed using PrimeSTAR GXL DNA polymerase (Takara). Genomic DNA from the transfected HEK293 lines was extracted and bisulphite converted using the Zymo EZ DNA methylation-direct Kit (Zymo Research). The DNA methylation profile of mCherry was analysed by TOPO cloning as described previously32. H1 hES cells were purchased from WiCell Research, and maintained in hES cell medium33. HEK293 cell was purchased from ATCC. Cell lines were authenticated by STR analysis. Mycoplasma contamination was checked every 2 months and was found to be negative in all cell lines used. All AAVs were packaged with serotypes 8 or 9 and were generated by the Gene Transfer Targeting and Therapeutics Core (GT3) at the Salk institute for biological studies. ICR, C57BL/6 and ROSA-LSL-tdTomato (known as Ai14)20 mice were purchased from the Jackson laboratory. Some timed pregnant ICR mice were purchased from SLC Japan (Sizuoka, Japan). RCS and Brown Norway rats were purchased from the Jackson laboratory. All mice used in this study were from mixed gender, mixed strains and P1 to 12 weeks old. All mouse experiments were approved by the IACUC committee or the RIKEN Center for Developmental Biology and conform to regulatory standards. All rat procedures were conducted with the approval and under the supervision of the Institutional Animal Care Committee at the University of California San Diego and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The midday of the vaginal plug was designated as embryonic day 0.5 (E0.5). Construction and production of minicircle DNA vectors were performed as previously described34. Briefly, to construct pre-minicircle plasmids (pIRESmCherry-MC, pIRESmCherry-MC-scramble, pTubb3-MC, pTubb3-MC-scramble, pAi14-GFPNLS-MC, pAi14-GFPNLS-MC-scramble, pAi14-luc-MC and pAi14-luc-MC-scramble), IRESmCherry, GFP or luciferase genes with Cas9/gRNA targeting sequence were cloned into ApaI and SmaI sites of the minicircle producer plasmid pMC.BESPX (a gift from M. Kay, Stanford University School of Medicine). The final minicircle constructs were introduced into the E. coli strain 3S2T (a gift from M. Kay) and amplified overnight in Terrific Broth (pH 7.0) (Fisher Scientific). The minicircle production was induced by mixing the overnight TB culture with an equal volume of minicircle induction mix comprising fresh LB and 20% l-arabinose (SBI), followed by a 5 h incubation at 32 °C with shaking at 250 r.p.m. Minicircle DNA was isolated with EndoFree Plasmid Mega Kit (QIAGEN) following the manufacturer’s protocol except that the volumes of P1, P2 and P3 buffers were doubled. To confirm the function of the Scramble-gRNA, we performed Surveyor assay in GFP-correction HEK293 line. Briefly, Cas9, Scramble-gRNA, and different donor DNA (IRESmCherry-MC or IRESmCherry-MC-scramble) were transfected into GFP-correction HEK293 line. Three days later, genomic DNA was extracted with DNeasy Blood & Tissue kit. To examine the activity of the generated nuclear localized Cas9, we performed Surveyor assay in human H1 ES cells. Briefly, each 1.5 × 107 feeder-free cultured H1 ES cells were dissociated by TrypLE (Invitrogen), and resuspended in 1 ml of MEF-conditioned medium containing 10 μM ROCK inhibitor Y-27632 (Biomol Inc.). Cells were electroporated with 25 μg of pCAGmCherry-KCNQ1 and 25 μg of different Cas9 (pCAG-Cas9-2AGFP, pCAG-1NLS-Cas9-1NLS-2AGFP or pCAG-1BPNLS-Cas9-1BPNLS-2AGFP), and were plated onto 100-mm dishes pre-coated with Matrigel. Two days after electroporation, the cells were dissociated by TrypLE, and Cas9 and gRNA expressing cells were sorted out as GFP/mCherry double-positive cells by BD influx cell sorter (BD), and genomic DNA extracted with DNeasy Blood & Tissue kit. The extracted genomic DNA from the transfected GFP-correction HEK293 line and human H1 ES cells were used for Surveyor assay with SURVEYOR Mutation Detection Kits (Transgenomic) as described previously35. To assess the knock-in efficiency in dividing cells and optimize the HITI method, we established a mutated GFP gene-based reporter system in HEK293. Briefly, pEGIP*35 was co-transfected with pMDLg/pRRE, pRSV-Rev and pMD2.G, packaged and purified as lentiviral vectors according to a published protocol36. HEK293 cells were transduced in suspension with lentiviral EGIP*35 vector and 4 μg ml−1 polybrene for 1 h. After brief centrifugation to remove any residual lentiviral vector, the cells were seeded in 100-mm dishes. Three days after transduction, puromycin (1–2 μg ml−1; Invitrogen) was added to the medium. After 10 days, single colonies were individually picked up and expanded as GFP-correction HEK293 line. Primary neurons were obtained from the cortex of E14.5 ICR mouse brains. After the embryo retrieval, all dissection procedures were performed in a cold solution of 1× phosphate-buffered saline (PBS) with 2% glucose (Gibco). Cortical tissue was dissociated by trypsinization, and 1.5 × 105 cells cm−2 were plated over coated poly-d-lysine coverslips (Neuvitro) with Neurobasal media (Gibco) supplemented with 2% B27 (Gibco) and 0.25% Glutamax (Gibco). The cultures were incubated at standard conditions (37 °C in humidified 5% CO /95% air atmosphere). Half volume of culture media was replaced every 3 days. The differentiation protocol from human ES cells to pan neurons was described previously37. Lipofectamine 3000 (Invitrogen), CombiMag Reagent in combination with Lipofectamine 2000 (OZBiosciences) and DNA-In Neuro Transfection Regent (Amsbio) were used for transfection of HEK293 cells, mouse primary cells and human ES cell-derived pan neurons, respectively. Transfection complexes were prepared following the manufacturer’s instructions. To measure the targeted gene knock-in efficiency in GFP-correction HEK293 line, we co-transfected hCas9, gRNA (mutant GFP-gRNA, Scramble-gRNA, MH1-gRNA and/or MH2-gRNA) and donor DNA. Promoterless IRESmCherry plasmids with zero, one, or two CRISPR/Cas9 target sites (IRESmCherry-0c, IRESmCherry-1c and IRESmCherry-2c, respectively) and a minicircle donor (IRESmCherry-MC) were used to measure HITI efficiency. HDR-donors (tGFP and IRESmCherry-HDR-0c) were used to measure HDR efficiency. A PITCh-donor (IRESmCherry-MH) was used to measure PITCh efficiency. IRESmCherry-HDR-2c was used as HDR and HITI dual donors. IRESmCherry-0c and IRESmCherry-MC-scramble were used as genome DNA cut only and donor DNA cut only controls, respectively. The Scramble-gRNA target sequence is an artificial sequence that does not exist in both human and mouse genomes. The Scramble-gRNA was transfected with IRESmCherry-MC-scramble. The MH1-gRNA and MH2-gRNA were co-transfected with IRESmCherry-MH. For other donor shown in Fig. 1a, the mutant GFP-gRNA was co-transfected. The efficiencies of targeted gene knock-in via HDR, PITCh and HITI were determined by calculating the percentage of GFP+ or mCherry+ cells by FACS LSR Fortessa (BD) and the percentages of PITCh, HITI (without indel) or HITI (with indel) per mCherry+ cells were determined by Sanger sequencing. The transfected cells were separated into mCherry+ and mCherry− populations by FACS via BD Influx (BD), and ~500 cells were plated onto 100-mm dishes pre-coated with wild-type HEK293 cells. Two days after transduction, puromycin (2 μg ml−1; Invitrogen) was added to the medium. After 2 weeks, genome-edited HEK293 clones were manually picked and further analysed by PCR and sequencing to determine the genotype. Cells were fixed in 4% paraformaldehyde (PFA) at room temperature for 15 min. Then cells were blocked and permeabilized with 5% Bovine Serum Albumin (BSA) and 0.1% Triton X-100 in PBS for 50 min with shaking at room temperature. Primary antibodies were diluted in 2.5% BSA/PBS and cells were incubated overnight at 4 °C in a wet chamber with anti-GFP (Aves) and anti-βIII tubulin (Sigma) antibodies. Next day, cells were washed with 0.2% Tween 20 in PBS, and incubated for 1 h at room temperature with the secondary antibodies Alexa Fluor 488 (Thermo Fisher) or Alexa Fluor 647 (Thermo Fisher). After a second round of washing with 0.2% Tween 20 in PBS, the cells were mounted using DAPI-Vector Shield mounting media (Vector) and stored at 4 °C. To examine cell proliferation status, we added 2 μM EdU (Invitrogen) in the transfected neurons, and detected EdU positive cells by Click-iT EdU kit (Invitrogen). Animals were harvested after transcardial perfusion using PBS followed by 4% PFA. Organs were dissected out and post-fixed with 2% PFA and 15% sucrose in PBS at 4 °C for 16–20 h, then immersed in 30% sucrose in PBS at 4 °C before sectioning. Mouse brains were fixed in 1% PFA in 0.1 M phosphate buffer (pH 7.4) at 4 °C for 24 h followed by cryoprotection in 25% sucrose overnight at 4 °C. For neonatal brain, brains were embedded in OCT compound (Sakura Tissue-Tek) and sectioned by Cryostat (14 μm). Well-dried sections were washed 3 times with PBST (1% Tween 20 in PBS) and treated with blocking buffer (2% donkey serum and 0.2% Triton X-100 in PBS, pH 7.4) for 1 h at room temperature, followed by incubation with primary antibodies diluted in the same buffer overnight at 4 °C. The primary antibodies used were Anti-GFP (Aves) and anti-mCherry (Abcam). Sections were washed three times in PBST and treated with secondary antibodies conjugated to Alexa Fluor 488 or Alexa Fluor 546 (Thermo Fisher) for 1 h at room temperature. After wash, the sections were mounted with mounting medium (PermaFluor, Thermo scientific). For adult brain, 50 μm coronal brain sections were prepared using a freezing microtome and stored in PBS with 0.01% sodium azide at 4 °C. Free-floating sections were incubated at 4 °C for 16–48 h with goat anti-GFP (Rockland) primary antibodies in PBS/0.5% normal donkey serum/0.1% Triton X-100, followed by the appropriate secondary antibodies conjugated with Alexa Fluor 488 at room temperature for 2–3 h. Sections were counterstained with 10 μM DAPI in PBS for 30 min to visualize cell nuclei. Immunostained tissue sections were mounted on slides with polyvinyl alcohol mounting medium containing DABCO and allowed to air-dry overnight. For other tissues, the harvested tissues were embedded in OCT compounds and frozen. Serial or axial frozen sections (thickness 10–20 μm) were prepared using a cryostat, which were then placed on silanized slides and air-dried. The sections were washed with PBS, followed by 1 h room temperature incubation by blocking buffer containing 3% normal goat serum, 0.3% and Triton X-100 in PBS, then incubated with the first antibody solution overnight. The primary antibodies used were anti-GFP, anti-mCherry, anti-dystrophin (Sigma), anti-actin, anit-smooth-muscle antibody (Sigma) and anti-human-serum-albumin antibody (R&D). After wash, the sections were immunostained with secondary antibody solution for 1 h at room temperature. The secondary antibodies used were Alexa Fluor 488, 568 or 647. After sequential washing with 0.2% Tween 20/PBS, 0.05% Tween 20/PBS, and PBS, the sections were mounted with DAPI Fluoromount-G (Southern Biotech). For rat, retinal cryosections were rinsed in PBS and blocked in 0.5% Triton X-100 in 5% BSA in PBS for 1 h at room temperature. Anti-Mertk antibody (eBioscience) was diluted in 5% BSA in PBS and incubated with sections overnight at 4 °C. The sections were then washed three times with PBS, incubated with IgG secondary antibody tagged with Alexa Fluor 555 (Thermo Fisher) in PBS at room temperature for 1 h, and washed with PBS. Cell nuclei were counterstained with DAPI. Sections were mounted with Fluoromount-G (SouthernBiotech) and coverslipped. Images were captured by Keyence BZ-9000 microscope. To measure intracellular localization of dCas9, we followed a previous report16. In brief, the dCas9-transfected HEK293 cells were fixed with 4% PFA and stained with anti-Flag (Sigma) and DAPI (Vector). The intensity of fluorescence was measured using the PlotProfile tool of ImageJ software. Values were obtained independently in cytoplasmic and nuclear compartments in single transfected cells. Relative fluorescence values of nuclear intensity were divided by the values found in cytoplasm to obtain the nuclear/cytoplasm ratio. The experimental procedures for in utero electroporation have been described previously38. E15.5 pregnant ICR mice were anaesthetized by 500 μl IP injection of 10% Nembutal (Dainippon sumitomo kagaku). 1 μl of DNA mixture, containing the pCAG-1BPNLS-Cas9-1BPNLS (0.5 μg μl−1), mouse Tubb3 gene target pCAGmCherry-gRNA (0.5 μg μl−1) and either donor cut-only control donor (Tubb3-MC-scramble), minicircle donor (Tubb3-MC), 2-cut (Tubb3-2c) or HDR donor (Tubb3-HDR) vectors (0.8 μg μl−1) was injected into the hemisphere of the fetal brain. For visually confirming the injection, 0.005% fast green solution (Wako) was mixed with the DNA. Fetuses were tweezed by paddles of the tweezer electrodes (CUY21 electroporator, NEPA GENE). For tamoxifen (TAM) inducible Cre-dependent Cas9 expression system, fetuses were injected with 1 μl of DNA mixture into the hemisphere, containing the pCAG-floxSTOP-1BPNLS-Cas9-1BPNLS (0.5 μg μl−1), pCAG-ERT2CreERT2 (0.5 μg μl−1), pCAG-mcherry-U6-gRNA (0.5 μg μl−1) and either minicircle donor (Tubb3-MC) or HDR donor (Tubb3-HDR) vectors (0.8 μg μl−1). 50 μl of 10 mg ml−1 tamoxifen (Sigma) dissolved in corn oil were injected to P10 and P11 electroporated pups for induction of the Cas9 expression. The GFP knock-in efficiency was measured by the percentage of GFP+ cells among transfected cells (mCherry+). The DNA mixtures were transfected by in utero electroporation at E15.5 of mouse brain and the mice were euthanized at P10. The collected brains from P10 mice were trypsinized for 40 min at 37 °C, then dissociated to single cells by pipetting. About 22,000 electroporated cells were collected by FACS sorting (SH-800, Sony). Total RNA was extracted from the sorted cells with RNeasy mini kit (Qiagen) and cDNA was synthesized by SuperScript VILO (Invitrogen). RT–PCR was performed with PrimeSTAR GXL polymerase as following the manufacturer’s protocol with 10% of 5 M betaine solution (Sigma). The DNA mixture for Scramble control (25 μg of pCAG-1BPNLS-Cas9-1BPNLS, 25 μg of Scramble-gRNA-mCherry and 10 μg of Ai14-GFPNLS-MC-scramble), without Cas9 (25 μg of empty vector, 25 μg of Ai14gRNA-mCherry and 10 μg of Ai14-luc-MC or Ai14-GFP-MC) and with Cas9 (25 μg of pCAG-1BPNLS-Cas9-1BPNLS, 25 μg of Ai14gRNA-mCherry and 10 μg of Ai14-luc-MC or Ai14-GFP-MC) were prepared in 25 μl TE. Wild-type or Ai14 mice were anaesthetized with intraperitoneal injection of ketamine (100 mg kg−1) and xylazine (16 mg kg−1). For quadriceps muscle electroporation, a small portion of the quadriceps muscle was surgically exposed in the hind limb. Plasmid DNA mixture was injected into the muscle using a 29-gauge insulin syringe. One minute following plasmid DNA injection, a pair of electrodes was inserted into the muscle to a depth of 5 mm to encompass the DNA injection site and muscle was electroporated using an Electro Square Porator T820 (BTX Harvard Apparatus). Electrical stimulation was delivered twenty pulses at 100 V for 20 ms. After electroporation, skin was closed and mice were recovered on a 37 °C warm pad. For panniculus carnosus muscle electroporation, the hair of back skin was depilated with depilatory cream. The above mixture of DNA solutions were conjugated and subcutaneously injected to right and left side, respectively. The injected areas of skin and subcutaneous tissue was vertically sandwiched by plate-and-fork type electrodes, consist of a pair of stainless-steel tweezers, one with a rectangular plate, 10 mm long and 5 mm wide, and the other with a fork consisting of three straight needles at 2.5 mm intervals, which are 10 mm long and 0.5 mm in diameter. The interface of skin and the rectangular electrode was covered with electroconductive gel (SpectraGel 360, Parker Labs). Twenty 18 V/50 ms/1 Hz square pulses followed by another 20 pulses of the opposite polarity were delivered using Electro Square Porator T820. Two weeks after the electroporation, mice were euthanized, and tissues were obtained. The DNA mixture without Cas9 (100 μg of empty vector, 100 μg of Ai14gRNA-mCherry and 50 μg of Ai14-luc-MC) and with Cas9 (100 μg of pCAG-1BPNLS-Cas9-1BPNLS, 100 μg of Ai14gRNA-mCherry and 50 μg of Ai14-luc-MC) were prepared in 200 μl saline. A midline laparotomy was performed and the right kidney of wild-type or Ai14 mouse was exteriorized. After exposure of kidney, mice were intravenously injected with plasmid DNA mixture, immediately followed by pressing the right kidney gripped between thumb and index finger 20 times for a period of 1 s each as described previously39. The DNA mixture for Scramble control (100 μg of pCAG-1BPNLS-Cas9-1BPNLS, 100 μg of Scramble-gRNA-mCherry and 50 μg of Ai14-GFPNLS-MC-scramble), without Cas9 (100 μg of empty vector, 100 μg of Ai14gRNA-mCherry and 50 μg of Ai14-GFP-MC) and with Cas9 (100 μg of pCAG-1BPNLS-Cas9-1BPNLS, 100 μg of Ai14gRNA-mCherry and 50 μg of Ai14-GFP-MC) were prepared in 200 μl saline. A midline laparotomy was performed. The right kidney of Ai14 mouse was exteriorized and subsequently decapsulated, leaving the adrenal gland intact. The exposed kidney was pricked with electrode needles after injection of plasmid DNA mixture from tail vein and subsequently received electroporation 100 V, 50 ms pulse, six times using an Electro Square Porator T820. Mice were examined at 2 weeks after DNA transfection or electroporation by BLI performed using an IVIS Kinetic 2200 (Caliper Life sciences). Mice were IP injected with 150 mg kg−1 d-Luciferin (BIOSYNTH), anaesthetized with isoflurane and dorsal images were then captured 10 min post luciferin injection. Primary cultures of neurons were used after three days in culture, the AAV solution (without Cas9, AAV-mTubb3 (1.5 × 1010 GC); with Cas9, AAV-Cas9 (1.5 × 1010 GC) and AAV-mTubb3 (1.5 × 1010 GC)) was added and cultures were kept at standard conditions for 5 days, following immunocytochemistry or DNA extraction. C57BL/6 mice received AAV8 injections at P75. We used 1:1 mixture of AAV-Cas9 (1.5 × 1013 GC ml−1) and AAV-mTubb3 (2.3 × 1013 GC ml−1). As a control, 1:1 mixture of AAV-mTubb3 and HBSS buffer was used. Mice were anaesthetized with 100 mg kg−1 of ketamine and 10 mg kg−1 of xylazine cocktail via intra-peritoneal injections and mounted in a stereotax (David Kopf Instruments Model 940 series) for surgery and stereotaxic injections. Virus was injected into the centre of V1, using the following coordinates: 3.4 mm rostral, 2.6 mm lateral relative to bregma and 0.5–0.7 mm ventral from the pia. We injected 200 nl of AAVs using air pressure by picospritzer (General Valve Corp). To prevent virus backflow, the pipette was left in the brain for 5–10 min after completion of injection. Mice were housed for two weeks to allow for gene knock-in. Ai14 mice were anaesthetized with intraperitoneal injection of ketamine (100 mg kg−1) and xylazine (16 mg kg−1). A small portion of the quadriceps muscle was surgically exposed in the hind limb. The AAV8 mixture (without Cas9, AAV-Ai14-HITI (1.5 × 1010 GC); with Cas9, AAV-Cas9 (1.5 × 1010 GC) and AAV-Ai14-HITI (1.5 × 1010 GC)) was were injected into the quadriceps muscle using a 29 Gauge insulin syringe. After AAV injection, skin was closed and mice were recovered on a 37 °C warm pad. The newborn (P1) of Ai14 mice were used for IV AAV8 or AAV9 injection following a previous report40. The AAV mixtures (without Cas9, AAV-Ai14-HITI (5 × 1010 or 2 × 1011 GC); with Cas9, AAV-Cas9 (5 × 1010 or 2 × 1011 GC) and AAV-Ai14-HITI (5 × 1010 or 2 × 1011 GC); Scramble control, AAV-Cas9 (5 × 1010 GC) and AAV-Ai14-Scramble (5 × 1010 GC); HDR, AAV-Cas9 (5 × 1010 GC) and AAV-Ai14-HDR (5 × 1010 GC)) were injected via temporal vein of the P1 mouse. The AAV8 mixtures (without Cas9, AAV-Ai14-luc (2 × 1011 GC); with Cas9, AAV-Cas9 (2 × 1011 GC) and AAV-Ai14-luc (2 × 1011 GC)) were injected via tail vein for luciferase knock-in. The AAV mixtures (without Cas9, AAV-Ai14-HITI (2 × 1011 GC); with Cas9, AAV-Cas9 (2 × 1011 GC) and AAV-Ai14-HITI (2 × 1011 GC)) were injected via tail vein for GFP knock-in. For immunocytochemical analyses, the cells and tissues were visualized by confocal microscopy using a Zeiss LSM 780 Laser Scanning Confocal or Olympus FV1000 confocal microscope (Olympus). At least five pictures were obtained from each group and animal. We analysed at least three animals. Pictures were analysed with ZEN 2 (blue edition) and NIH ImageJ (FIJI) software. For the mouse primary neurons and human pan neurons analyses, the total number of positive cells for each marker were directly counted with the multi-point tool of NIH ImageJ software. The percentage of GFP+ cells was calculated among transfected cells (mCherry+) or total cells (DAPI+). The intracellular distribution of GFP was observed in around 100 independent events for each condition, where the focused cell was observed at different stacks to determine the presence or absence of GFP at the nucleus space. To assess the efficiency of GFP knock-in in brain after local AAV injection, we counted number of GFP+, mCherry+ and DAPI+ cells of 300 μm within injection sites and determined the GFP knock-in efficiency per infected cells or per cell. To assess the efficiency of GFP knock-in in liver, heart and muscle after systemic AAV injection, we counted the number of GFP+ and DAPI+ cells and determined the GFP knock-in efficiency per cell. To collect GFP-positive single cells from muscle and heart of AAV-injected mouse, animals were harvested after transcardial perfusion using PBS. Organs were dissected out and isolated as single cells with published methods41, 42. The single nuclei per cell was confirmed by fluorescent microscope with DAPI staining and separated by BD influx cell sorter. Each single GFP+ cell was sorted into 5 μl of lysis buffer from PicoPure DNA Extraction Kit by BD influx cell sorter and used as a template for first round of PCR to amplify the target genome with PrimeSTAR GXL polymerase following the manufacturer’s protocol. The first round of PCR product was purified using Agencourt AMPure XP (Beckman Coulter), then subject to second round PCR and sequencing to confirm the genotype. Based on sequencing result of 5′ junction end, single cell genotyping can separate biallelic GFP knock-in, monoallelic GFP knock-in with indels at another target, monoallelic GFP knock-in without indels at another target, and unknowns. The top 12 predicted off-target sites were searched using The CRISPR Design Tool43. The on-target and potential off-target regions were amplified using PrimeSTAR GXL DNA polymerase from the liver DNA via IV injection and used for library construction. Equal amounts of the genomic DNA was used to amplify genomic regions flanking the on-target and top 12 predicted off-target nuclease binding sites for library construction. Next, PCR amplicons from previous step were purified using Agencourt AMPure XP, then subject to second round PCR to attach Illumina P5 adapters and sample-specific barcodes. The purified PCR products were pooled at equal ratio for single-end sequencing using Illumina MiSeq at the Zhang laboratory (UCSD). The raw reads were mapped to mouse reference genome mm9 or custom built Ai14 mouse genome using BWA44. High quality reads (score >30) were analysed for indel events and Maximum Likelihood Estimate (MLE) calculation as previously described43. As next generation sequencing analysis of indels cannot detect large size deletion and insertion events, CRISPR/Cas9 targeting efficiency and activity shown above is underestimated. Congenic RCS rats at 21 days old were used in the study and divided into three groups. RCS group is non-injection control. The Cas9 + HITI group received a subretinal injection of 2 μl of AAV8 mixture (AAV-Cas9 (1.5 × 1010 GC) and AAV-rMertk-HITI (1.5 × 1010 GC)) in the eyes. The Cas9 + HDR group received a subretinal injection of 2 μl of AAV8 mixture (AAV-Cas9 (1.5 × 1010 GC) and AAV-rMertk-HDR (1.5 × 1010 GC)) in the eyes. Wild-type rats without an injection served as a normal control. Experimental rats were anaesthetized with an intraperitoneal injection of a mixture of ketamine and xylazine. Pupils were dilated with 1% topical tropicamide. Subretinal injection was performed under direct visualization using a dissecting microscope with a pump microinjection apparatus (Picospritzer III; Parker Hannifin Corporation) and a glass micropipette (internal diameter ~50–75 μm). Two microlitres of AAV mixture was injected into the subretinal space through a small scleral incision. A successful injection was judged by creation of a small subretinal fluid bleb. Fundus examination was performed immediately following injection, and rats showing any sign of retinal damage such as bleeding were discarded and excluded from the final animal counts. To monitor the efficacy of gene knock-in in vision rescue, ERG studies were performed at 4 weeks after treatment before the animals were euthanized for histology. The dark-adapted ERG response was recorded as described previously45. In brief, rats were dark-adapted for 14 h before the commencement of each ERG recording session. They were deeply anaesthetized as described for the surgical procedure above. Eyes were treated with 1% topical tropicamide to facilitate pupillary dilation. Each rat was tested in a fixed state and manoeuvred into position for examination within a Ganzfeld bowl (Diagnosys LLC). One active lens electrode was placed on each cornea, with a subcutaneously placed ground needle electrode positioned in the tail and the reference electrodes placed subcutaneously in the head region approximately between the two eyes. Light stimulations were delivered with a xenon lamp at 0.01 and 0.3 cds m−2 in a Ganzfeld bowl. For the flicker ERG measurement, rats were adapted at a background light of 10 cds m−2, and light stimulation was set at 30 cds m−2. The recordings were processed using software supplied by Diagnosys. Following ERG recordings, rats were euthanized and retinal cross-sections were prepared for histological evaluation of ONL preservation. Rats were euthanized with CO , and eyeballs were dissected out and fixed in 4% PFA. Cornea, lens, and vitreous were removed from each eye without disturbing the retina. The remaining retina-containing eyecup was infiltrated with 30% sucrose and embedded in OCT compound. Horizontal frozen sections were cut on a cryostat. Retinal cross-sections were prepared for histological evaluation by staining with haematoxylin and eosin (H&E). Following ERG recordings, rats were euthanized. DNA and RNA were isolated from retina-choroid complex using an AllPrep DNA/RNA Mini Kit (Qiagen). DNA was further used for PCR and TOPO sequencing. cDNA was synthesized from RNA using a Superscript III reverse transcriptase kit (Invitrogen) according to the manufacturer’s instructions. Quantitative PCR was performed via 40 cycle amplification using following primers (MertK-F1: GCATTTCGTGGTGGAAAGAT, MertK-R1: TGGGATCAGACACAACCTCTC) and Power SYBR Green PCR Master Mix on a 7500 Real-Time PCR System (Applied Biosystems). Measurements were performed in triplicate and normalized to endogenous GAPDH levels. The relative fold change in expression was calculated using the ΔΔC method (C values <30). The analysis for insertion and deletion (indel) events and Maximum Likelihood Estimate (MLE) calculation were done as previously described43. All custom scripts can be provided upon request. Raw Illumina sequencing reads for this study have been deposited in the National Center for Biotechnology Information Short Read Archive and accessible through SRA accession number SRP069844.


News Article | November 24, 2016
Site: www.forbes.com

Yes, you have read right.  Toyota has developed what it says is “the world’s first method for observing the behavior of lithium ions in an electrolyte when a battery charges and discharges.” Able to observe those ions for the first time in real time, Toyota researchers think they have found the reason why a battery ages. Once the breakthrough is commercialized, which could take “two to three years,” a new lithium ion battery could improve the battery-powered range of an electric vehicle by 15%, Dr. Hisao Yamashige of Toyota’s  advanced R&D and engineering division told a small group of reporters this morning at the company’s Tokyo HQ. It took three years’ work, and a giant synchrotron northeast of Kobe, Japan, for Toyota to finally be able to observe the travel of ions from a battery’s minus to its plus side, the reason why the desired electricity is created. In the Spring-8 synchrotron, a ring with a 5,000 ft diameter, built around a hill in Japan’s Hyogo Prefecture, researchers bombarded batteries with radiation a billion times stronger than a chest X-ray, to create moving images on a high-speed camera. The synchrotron, one of the world’s largest, was developed jointly by the RIKEN Institute and the Japan Atomic Energy Research Institute. The ring can be rented for only $600 per hour by those who want to keep the research to themselves. Publish your research, and the ring is yours free of charge. Today’s press conference could have saved notoriously frugal Toyota some money. Studying the migration of ions from minus to plus, researchers could observe a kind of ion constipation that develops during the course of battery charging and recharging. When the battery begins to suffer intestinal problems, “the ions can no longer flow freely, they get blocked, and battery performance decreases,” as Yamashige-san tried to explain the phenomena in terms simple enough for the assembled reporters to understand. Despite valiant attempts at popular science, even Reuters’ star reporter Nori Shirouzu had to admit that he “was lost.” To make a long story short, Toyota’s battery-boffins expect to use the new observation method to develop batteries that hold a better charge, and lead a longer life. Yamashige said he hopes to see commercialization in “a couple of years,” for improvements of “10 to 15%.”  When I asked him why we hear so much about huge gains in future battery technology, and then he can promise only a marginal increase after all that scientific effort, Yamashige said that’s all he can do, “sorry to disappoint you.” As I stepped outside of Toyota’s HQ building into a Tokyo experiencing an early dusting of wet snow, Wall Street Journal reporter Sean McLain opened his umbrella next to me, and muttered: “Engineers.” We probably didn’t grasp the momentousness of the discovery. For an audience that can better appreciate the research, the findings will be presented at the 57th International Symposium on Batteries, Fuel Cells and Capacitors, taking place next week at Tokyo’s Makuhari Messe. Follow @bertelschmitt, the "lone voice telling the real story behind the ridiculous, " according to @LynnCSchreiber


News Article | April 1, 2016
Site: www.biosciencetechnology.com

Some mental illnesses may stem, in part, from the brain’s inability to correctly assign emotional associations to events. For example, people who are depressed often do not feel happy even when experiencing something that they normally enjoy. A new study from MIT reveals how two populations of neurons in the brain contribute to this process. The researchers found that these neurons, located in an almond-sized region known as the amygdala, form parallel channels that carry information about pleasant or unpleasant events. Learning more about how this information is routed and misrouted could shed light on mental illnesses including depression, addiction, anxiety, and posttraumatic stress disorder, said Kay Tye, the Whitehead Career Development Assistant Professor of Brain and Cognitive Sciences and a member of MIT’s Picower Institute for Learning and Memory. “I think this project really cuts across specific categorizations of diseases and could be applicable to almost any mental illness,” said Tye, the senior author of the study, which appears in the March 31 online issue of Neuron. The paper’s lead authors are postdoc Anna Beyeler and graduate student Praneeth Namburi. In a previous study, Tye’s lab identified two populations of neurons involved in processing positive and negative emotions. One of these populations relays information to the nucleus accumbens, which plays a role in learning to seek rewarding experiences, while the other sends input to the centromedial amygdala. In the new study, the researchers wanted to find out what those neurons actually do as an animal reacts to a frightening or pleasurable stimulus. To do that, they first tagged each population with a light-sensitive protein called channelrhodopsin. In three groups of mice, they labeled cells projecting to the nucleus accumbens, the centromedial amygdala, and a third population that connects to the ventral hippocampus. Tye’s lab has previously shown that the connection to the ventral hippocampus is involved in anxiety. Tagging the neurons is necessary because the populations that project to different targets are otherwise indistinguishable. “As far as we can tell they’re heavily intermingled,” Tye said. “Unlike some other regions of the brain, there is no topographical separation based on where they go.” After labeling each cell population, the researchers trained the mice to discriminate between two different sounds, one associated with a reward (sugar water) and the other associated with a bitter taste (quinine). They then recorded electrical activity from each group of neurons as the mice encountered the two stimuli. This technique allows scientists to compare the brain’s anatomy (which neurons are connected to each other) and its physiology (how those neurons respond to environmental input). The researchers were surprised to find that neurons within each subpopulation did not all respond the same way. Some responded to one cue and some responded to the other, and some responded to both. Some neurons were excited by the cue while others were inhibited. “The neurons within each projection are very heterogeneous. They don’t all do the same thing,” Tye said. However, despite these differences, the researchers did find overall patterns for each population. Among the neurons that project to the nucleus accumbens, most were excited by the rewarding stimulus and did not respond to the aversive one. Among neurons that project to the central amygdala, most were excited by the aversive cue but not the rewarding cue. Among neurons that project to the ventral hippocampus, the neurons appeared to be more balanced between responding to the positive and negative cues. “This is consistent with the previous paper, but we added the actual neural dynamics of the firing and the heterogeneity that was masked by the previous approach of optogenetic manipulation,” Tye said. “The missing piece of that story was what are these neurons actually doing, in real time, when the animal is being presented with stimuli.” The findings suggest that to fully understand how the brain processes emotions, neuroscientists will have to delve deeper into more specific populations, Tye said. “Five or 10 years ago, everything was all about specific brain regions. And then in the past four or five years there’s been more focus on specific projections. And now, this study presents a window into the next era, when even specific projections are not specific enough. There’s still heterogeneity even when you subdivide at this level,” she said. “We’ve still got a long way to go in terms of appreciating the full complexities of the brain.” “Neuroscience is quickly moving beyond the classical idea of ‘one brain region equals one function,’” said Joshua Johansen, a team leader at the RIKEN Brain Science Institute in Japan, who was not involved in the research. “This paper represents an important step in this process by showing that within the amygdala, the way distinct populations of cells process information is a critical determinant of how emotional responses arise.” Another question still remaining is why these different populations are intermingled in the amygdala. One hypothesis is that the cells responding to different inputs need to be able to quickly interact with each other, coordinating responses to an urgent signal, such as an alert that danger is present. “We are exploring the interactions between these different projections, and we think that could be a key to how we so quickly select an appropriate action when we’re presented with a stimulus,” Tye said. In the long term, the researchers hope their work will lead to new therapies for mental illnesses. “The first step is to define the circuits and then try to go in animal models of these pathologies and see how these circuits are functioning differently. Then we can try to develop strategies to restore them and try to translate that to human patients,” said Beyeler, who is soon starting her own lab at the University of Lausanne to further pursue this line of research.


News Article | October 4, 2016
Site: www.biosciencetechnology.com

Mice have brain cells that are dedicated to storing memories of other mice, according to a new study from MIT neuroscientists. These cells, found in a region of the hippocampus known as the ventral CA1, store “social memories” that help shape the mice’s behavior toward each other. The researchers also showed that they can suppress or stimulate these memories by using a technique known as optogenetics to manipulate the cells that carry these memory traces, or engrams. “You can change the perception and the behavior of the test mouse by either inhibiting or activating the ventral CA1 cells,” said Susumu Tonegawa, the Picower Professor of Biology and Neuroscience and director of the RIKEN-MIT Center for Neural Circuit Genetics at the Picower Institute for Learning and Memory. Tonegawa is the senior author of the study, which appears in the Sept. 29 online edition of Science. MIT postdoc Teruhiro Okuyama is the paper’s lead author. In a well-known study published in 2005, researchers at Caltech identified neurons in the human brain that respond specifically to images of celebrities such as Halle Berry or Brad Pitt, leading them to conclude that the brain has cells devoted to storing memories of people who are familiar. Many of these cells were found in and around the hippocampus, which is also where the brain stores memories of events, known as episodic memories. The MIT team suspected that in mice, social memories may be stored in the hippocampus’ ventral CA1, in part because previous studies have suggested that this region is not involved in storing episodic memories. The researchers set out to test this hypothesis using optogenetics: By engineering neurons of the ventral CA1 to express light-sensitive proteins, they could artificially activate or inhibit these cells by shining light on them as the mice interacted with each other. First, the researchers allowed one mouse, known as the “test mouse,” to spend time with another mouse for two hours, letting the mice become familiar with each other. Soon after, the test mouse was placed in a cage with the familiar mouse and a new mouse. Under normal circumstances, mice prefer to interact with mice they haven’t seen before. However, when the researchers used light to shut off a circuit that connects the ventral CA1 to another part of the brain called the nucleus accumbens, the test mouse interacted with both of the other mice equally, because its memory of the familiar mouse was blocked. “The inhibition of ventral CA1 leads to impairment of the social memory,” Okuyama said. “They cannot show any preference for the novel mouse. They approach both mice equally.” On the other hand, when the researchers stimulated ventral CA1 cells while the test mouse was interacting with a novel mouse, the test mouse began to treat the novel mouse as if they were already acquainted. This effect was specific to social interactions: Interfering with the ventral CA1 did not have any effect on the mice’s ability to recognize objects or locations that they had previously seen. When the researchers monitored activity of neurons in the ventral CA1, they found that after a mouse was familiarized with another mouse, a certain population of these neurons began to respond specifically to the familiar mouse. These patterns could be seen even after the mice appeared to “forget” the once-familiar mice. After about 24 hours of separation, the test mice began to treat their former acquaintances as strangers, but the neurons that had been tuned to the familiar mice still fired, although not as frequently. This suggests that the memories are still being stored even though the test mice no longer appear to remember the mice they once knew. Furthermore, the researchers were able to “re-awaken” these memories using optogenetics. In one experiment, when the test mouse first interacted with another mouse, the researchers used a light-sensitive protein called channelrhodopsin to tag only the ventral CA1 cells that were turned on by the familiarization treatment. When these neurons were re-activated with light 24 hours later, the memory of the once-familiar mouse returned. The researchers were also able to artificially link the memory of the familiar mouse with a positive or negative emotion. Tonegawa’s lab has previously used this technique to identify hippocampal cells that store engrams representing episodic memories. The new study offers strong evidence that memory traces for specific individuals are being stored in the neurons of the ventral CA1, Tonegawa said. “There is some kind of persistent change that takes place in those cells as long as memory is still detectable,” he says. Larry Young, a professor of psychiatry and director of the Center for Translational Social Science at Emory University, described the study as “one of the most fascinating papers related to social neuroscience I’ve ever seen.” “In this paper, they identified a subset of cells in a particular brain region that is the engram — a set of cells that through its connections in the nucleus accumbens, actually holds the memory of another individual,” said Young, who was not involved in the study. “They showed that the same group of neurons fired repeatedly in response to the same animal, which is absolutely incredible. Then to go in and control those specific cells is really on the cutting edge.” The MIT researchers are now investigating a possible link between social memory and autism. Some people with autism have a mutation of the receptor for a hormone called oxytocin, which is abundant on the surface of ventral CA1 cells. Tonegawa’s lab hopes to uncover whether these mutations might impair social interactions. The research was funded by the RIKEN Brain Science Institute, the Howard Hughes Medical Institute, the JPB Foundation, and the Japan Society for the Promotion of Science. Image: MIT neuroscientists have identified neurons that are responsible for storing memories of familiar individuals. These cells, labeled green, are located in a region of the hippocampus known as the vCA1. Credit: Courtesy of Teruhiro Okuyama


News Article | December 9, 2016
Site: www.eurekalert.org

Neurodevelopmental disorders such as autism spectrum disorder (ASD) and attention deficit and hyperactivity disorder (ADHD) are on the rise but its underlying mechanisms are poorly understood. Noriko Osumi, Kaichi Yoshizaki and colleagues at Tohoku University's Graduate School of Medicine collaborated with Shigeru Wakana and Tamio Furuse at RIKEN Bio-Resource Center, and Tucci Valter at Istituto Italiano di Tecnologia, to conduct comprehensive behavioral analyses on how paternal aging influences the behavior of offspring that inherit a genetic risk (a mutation in Pax6 gene*). In the experiments, in order to minimize the physical influence of the father, the male mouse was isolated and in vitro fertilization was used to impregnate the female. The researchers found that the offspring of young fathers exhibited impaired vocal communication, while the offspring of older fathers exhibited hyperlocomotion. The results are significant for both animal researchers and the public. For researchers working on animal models, it shows that the age of male mice can influence the behavior of the offspring, so this should be a consideration when they are used to mate. For the public, the research shows that paternal aging may exacerbate genetic risks - this could explain why there is a rapid rise in the ratio of children with ASD or ADHD, due to men having children later in life. This paper was published online in PLoS ONE on November 17. The research was supported in part by KAKENHI (25640002 to K.Y. and 16H06530 to N.O.) from the Ministry of Education, Culture, Sports, Science and Technology of Japan. *Pax6 gene encodes a transcription factor that regulates expression of many downstream genes and is known to be related to ASD.


News Article | February 15, 2017
Site: cerncourier.com

Shinichiro Michizono from KEK has been appointed as associate director for the International Linear Collider (ILC), taking over from Mike Harrison, while Jim Brau of the University of Oregon has replaced Hitoshi Yamamoto as associate director for physics and detectors. The Linear Collider collaboration, which encompasses the ILC and CLIC, has recently been granted a further three-year mandate by the International Committee for Future Accelerators. The council of the European Southern Observatory (ESO), which builds and operates some of the world’s most powerful ground-based telescopes, has appointed Xavier Barcons as its next director general. The 57 year-old astronomer will take up his new position on 1 September 2017, when the current director general Tim de Zeeuw completes his mandate. He began his career as a physicist, completing a PhD on hot plasmas. In October 2016, Jianwei Qiu joined the Thomas Jefferson National Accelerator Facility as its new associate director for theoretical and computational physics. Qiu, whose research focus is QCD and its applications in both high-energy particle and nuclear physics, will oversee a broad programme of theoretical research in support of the physics studied with the Continuous Electron Beam Accelerator Facility (CEBAF). Rende Steerenberg has been appointed head of operations in CERN’s Beams Department, effective from 1 January 2017. He takes over from Mike Lamont, who has been in the role since 2009 and oversaw operations from the LHC’s rollercoaster start-up to its latest record performance. Lamont remains deputy group leader of the Beams Department. Former CERN Director-General Rolf-Dieter Heuer has been appointed Chevalier de la Légion d’Honneur (Knight of the Legion of Honour), one of the highest recognitions of achievement in France. Heuer, who is currently president of the German Physical Society (DPG) and president-elect of the SESAME Council, among other roles, was presented with the medal on 22 November at the residence of the French permanent representative in Geneva. The 2017 Breakthrough Prize in Fundamental Physics has been awarded to Joseph Polchinski, University of California at Santa Barbara, and Andrew Strominger and Cumrun Vafa of Harvard University. The three winners, who received the $3 million award at a glitzy ceremony in San Francisco on 4 December, have made important contributions to fundamental physics including quantum gravity and string theory. Polchinski was recognised in particular for his discovery of D-branes, while the citation for Strominger and Vafa included their derivation of the Bekenstein–Hawking area-entropy relation, which unified the laws of thermodynamics and black-hole dynamics. Recipients of the previously announced Special Prize in Fundamental Physics – Ronald Drever and Kip Thorne of Caltech and Rainer Weiss of MIT, who were recognised in May along with the entire LIGO team for the discovery of gravitational waves – were also present. A further prize, the $100,000 New Horizons in Physics Prize, went to six early-career physicists: Asimina Arvanitaki (Perimeter Institute), Peter Graham (Stanford University) and Surjeet Rajendran (University of California, Berkeley); Simone Giombi (Princeton University) and Xi Yin (Harvard University); and Frans Pretorius (Princeton). This year’s Breakthrough Prize, which was founded in 2012 by Sergey Brin, Anne Wojcicki, Yuri and Julia Milner, Mark Zuckerberg and Priscilla Chan, saw $25 million in prizes awarded for achievements in the life sciences, fundamental physics and mathematics. On 30 November, the Alexander von Humboldt Foundation in Bonn, Germany, granted a Humboldt Research Award to Raju Venugopalan, a senior physicist at Brookhaven National Laboratory and Stony Brook University. The €60,000 award recognises Venugopalan’s achievements in theoretical nuclear physics, and comes with the opportunity to collaborate with German researchers at Heidelberg University and elsewhere. US physicist and science policy adviser to the US government, Richard Garwin, was awarded the Presidential Medal of Freedom at a White House ceremony on 22 November. The award is the highest honour that the US government can confer to civilians. Garwin was recognised for his long career in research and invention, which saw him play a leading role in the development of the hydrogen bomb, and for his advice to policy makers. Introducing Garwin, President Obama remarked: “Dick’s not only an architect of the atomic age. Reconnaissance satellites, the MRI, GPS technology, the touchscreen all bear his fingerprints – he even patented a mussel washer for shellfish. Dick has advised nearly every president since Eisenhower, often rather bluntly. Enrico Fermi, also a pretty smart guy, is said to have called Dick the only true genius he ever met.” Fumihiko Suekane of Tohoku University, Japan, has been awarded a 2016 Blaise Pascal Chair to further his research into neutrinos. Established in 1996, and named after the 17th-century French polymath Blaise Pascal, the €200,000 grant allows researchers from abroad to work on a scientific project in an institution in the Ile-de-France region. Suekane will spend a year working at the Astroparticle and Cosmology Laboratory in Paris, where he will focus on R&D for novel neutrino detectors and measurements of reactor neutrinos. In late 2016, theorists Mikhail Danilov, from the Lebedev Institute in Moscow, Sergio Ferrara from CERN and David Gross from the Kavli Institute for Theoretical Physics and the University of California in Santa Barbara were elected as members of the Russian Academy of Sciences. Established in 1724, the body has more than 2000 members. President of the Republic of Poland, Andrzej Duda, visited CERN on 15 November and toured the CERN Control Centre. Chi-­Chang Kao, signed the guestbook with CERN Director-General Fabiola Gianotti on 23 November. From 28 November to 2 December, more than 200 flavour physicists gathered at the Tata Institute of Fundamental Research in Mumbai for the 9th International Workshop on the Cabibbo–Kobayashi–Maskawa Unitarity Triangle (CKM2016). The workshop focuses on weak transitions of quarks from one flavour to another, as described by the CKM matrix, and on the charge–parity (CP) violation present in these transitions, as visualised by the unitarity triangle (UT). Input from theory, particularly lattice QCD, is vital to fully leverage the power of such measurements. It is an exciting time for flavour physics. The mass scales potentially involved in such weak processes are much higher than those that can be directly probed at the LHC, due to the presence of quantum loops that mediate many of the processes of interest, such as B0 – B0 mixing. Compared with the absence of new particles so far at the energy frontier, LHCb and other B factories already have significant hints of deviations between measurements and Standard Model (SM) predictions. An example is the persistent discrepancy in the measured differential distributions of the decay products of the rare flavour-changing neutral-current process B0 → K*0 μ+ μ–, first reported by the LHCb collaboration in 2015. A highlight of CKM2016 was the presentation of first results of the same distributions from the Belle experiment in Japan, which also included the related but previously unmeasured process B0 → K*0 e+ e–. The Belle results are more compatible with those of LHCb than the SM, further supporting the idea that new physics may be manifesting itself, via interference effects, in these observables. Progress on measuring CP violation in B decays was also reported, with LHCb presenting the first evidence for time-dependent CP violation in the decay of B0 mesons in two separate final states, D+ K– and K+ K–. The latter involves loop diagrams allowing a new-physics-sensitive determination of a UT angle (γ) that can be compared to a tree-level SM determination in the decay B– → D0 K–. For the first time, LHCb also presented results with data from LHC Run 2, which is ultimately expected to increase the size of the LHCb data samples by approximately a factor four. Longer term, the Belle II experiment based at the SuperKEKB collider recently enjoyed its first beam, and will begin its full physics programme in 2018. By 2024, Belle II should have collected 50 times more data than Belle, allowing unprecedented tests of rare B-meson decays and precision CP-violation measurements. On the same timescale, the LHCb upgrade will also be in full swing, with the goal of increasing the data size by least a factor 10 compared to Run 1 and Run 2. Plans for a second LHCb upgrade presented at the meeting would allow LHCb, given the long-term future of the LHC, to run at much higher instantaneous luminosities to yield an enormous data set by 2035. With more data the puzzles of flavour physics will be resolved thanks to the ongoing programme of LHCb, imminent results from rare-kaon-decay experiments (KOTO and NA62), and the Belle II/LHCb upgrade projects. No doubt there will be more revealing results by the time of the next CKM workshop, to be held in Heidelberg in September 2018. While there are many conferences focusing on physics at the high-energy frontier, the triennial PSI workshop at the Paul Scherrer Institute (PSI) in Switzerland concerns searches for new phenomena at non-collider experiments. These are complementary to direct searches at the LHC and often cover a parameter space that is beyond the reach of the LHC or even future colliders. The fourth workshop in this series, PSI2016, took place from 16–21 October and attracted more than 170 physicists. Theoretical overviews covered: precision QED calculations; beyond-the-Standard-Model implications of electric-dipole-moment (EDM) searches; axions and other light exotic particles; flavour symmetries; the muon g-2 problem; NLO calculations of the rare muon decay μ → eeeνν; and possible models to explain the exciting flavour anomalies presently seen in B decays. On the experimental side, several new results were presented. Fundamental neutron physics featured prominently, ranging from cold-neutron-beam experiments to those with stored ultracold neutrons at facilities such as ILL, PSI, LANL, TRIUMF and Mainz. Key experiments are measurements of the neutron lifetime, searches for a permanent EDM, measurements of beta-decay correlations and searches for exotic interactions. The future European Spallation Source in Sweden will also allow a new and much improved search for neutron–antineutron oscillations. Atomic physics and related methods offer unprecedented sensitivity to fundamental-physics aspects ranging from QED tests, parity violation in weak interactions, EDM and exotic physics to dark-matter (DM) and dark-energy searches. With the absence of signals from direct DM searches so far, light and ultralight DM is a focus of several upcoming experiments. Atomic physics also comprises precision spectroscopy of exotic atoms, and several highlight talks included the ongoing efforts at CERN’s Antiproton Decelerator with antihydrogen and with light muonic atoms at J-PARC and at PSI. For antiprotons and nuclei, impressive results from recent Penning-trap mass and g-factor measurements were presented with impacts on CPT tests, bound-state QED tests and more. Major international efforts are under way at PSI (μ → eγ, μ → eee), FNAL and J-PARC (μ → e conversion) devoted to muons and their lepton-flavour violating decays, and the upcoming muon g-2 experiments at FNAL and J-PARC have reported impressive progress. Last but not least, rare kaon decays (at CERN and J-PARC), new long-baseline neutrino oscillation results, developments towards direct neutrino-mass measurements, and CP and CPT tests with B mesons were reported. The field of low-energy precision physics has grown fast over the past few years, and participants plan to meet again at PSI in 2019. The fields of nanomaterials and nanotechnology are quickly evolving, with discoveries frequently reported across a wide range of applications including nanoelectronics, sensor technologies, drug delivery and robotics, in addition to the energy and healthcare sectors. At an academia–industry event on 20–21 October at GSI in Darmstadt, Germany, co-organised by the technology-transfer network HEPTech, delegates explored novel connections between nanotechnology and high-energy physics (HEP). The forum included an overview of the recent experiments at DESY’s hard X-ray source PETRA III, which allows the investigation of physical and chemical processes in situ and under working conditions and serves a large user community in many fields including nanotechnology. Thermal-scanning probe lithography, an increasingly reliable method for rapid and low-cost prototyping of 2D and quasi-3D structures, was also discussed. Much attention was paid to the production and application of nanostructures, where the achievements of the Ion Beam Center at Helmholtz-Zentrum Dresden-Rossendorf in surface nanostructuring and nanopatterning were introduced. UK firm Hardide Coatings Ltd presented its advanced surface-coating technology, the core of which are nano-structured tungsten-carbide-based coatings that have promising applications in HEP and vacuum engineering. Industry also presented ion-track technology, which is being used to synthesise 3D interconnected nanowire networks in micro-batteries or gas sensors, among other applications. Neutron-research infrastructures and large-scale synchrotrons are emerging as highly suitable platforms for the advanced characterisation of micro- and nano-electronic devices, and the audience heard the latest developments from the IRT Nanoelec Platform for Advanced Characterisation of Grenoble. The meeting addressed how collaboration between academia and industry in the nanotechnology arena can best serve the needs of HEP, with CERN presenting applications in gaseous detectors using the charge-transfer properties of graphene. The technology-transfer office at DESY also shared its experience in developing a marketing strategy for promoting the services of the DESY NanoLab to companies. Both academia and industry representatives left the event with a set of contacts and collaboration arrangements. On 24–25 November, academics and leading companies in the field of superconductivity met in Madrid, Spain, to explore the technical challenges of applying new accelerator technology to medicine. Organised by CIEMAT in collaboration with HEPTech, EUCARD2, CDTI, GSI and the Enterprise Europe Network, the event brought together 120 participants from 19 countries to focus on radioisotope production, particle therapy and gantries. Superconductivity has a range of applications in energy, medicine, fusion and high-energy physics (HEP). The latter are illustrated by CERN’s high-luminosity LHC (HL-LHC), now near construction with superconducting magnets made from advanced Nb Sn technology capable of 12 T fields. The HL-LHC demands greatly advanced superconducting cavities with more efficient and higher-gradient RF systems, plus the development of new devices such as crab cavities that can deflect or rotate single bunches of protons. On the industry side, new superconducting technology is ready to go into production for medical applications. A dedicated session presented novel developments in cyclotron production, illustrated by the AMIT project of CIEMAT (based on a cyclotron with a compact superconducting design that will be able to produce low-to-moderate rates of dose-on-demand 11C and 18F) and the French industry–academia LOTUS project system, which features a compact 12 MeV superconducting helium-free magnet cyclotron suitable for the production of these isotopes in addition to 68Ga. Antaya Science and Technology, meanwhile, reported on the development of a portable high-field superconducting cyclotron for the production of ammonia-13N in near proximity to the PET cameras. The meeting also heard from MEDICIS, the new facility under construction at CERN that will extend the capabilities of the ISOLDE radioactive ion-beam facility for production of radiopharmaceuticals and develop new accelerator technologies for medical applications (CERN Courier October 2016 p28). Concerning particle therapy, industry presented medical accelerators such as the MEVION S250 – a proton-therapy system based on a gantry-mounted 250 MeV superconducting synchrocyclotron that weighs less than 15 tonnes and generates magnetic fields in excess of 10 T. Global medical-technology company IBA described its two main superconducting cyclotrons for particle therapy: the Cyclone 400 for proton/carbon therapy and the S2C2 dedicated to proton therapy, with a particular emphasis on their superconducting coil systems. IBA also introduced the latest developments concerning ProteusONE – a single-room system that delivers the most clinically advanced form of proton-radiation therapy. Researchers from MIT in the US presented a novel compact superconducting synchrocyclotron based on an ironless magnet with a much reduced weight, while the TERA Foundation in Italy is developing superconducting technology for “cyclinacs” – accelerators that combine a cyclotron injector and a linac booster. Finally, the session on gantries covered developments such as a superconducting bending-magnet section for future compact isocentric gantries by researchers at the Paul Scherrer Institute, and a superconducting rotating gantry for carbon radiotherapy designed by the Japanese National Institute of Radiological Sciences. With demand for medical isotopes and advanced cancer therapy rising, we can look forward to rich collaborations between accelerator physics and the medical community in the coming years. The fifth in the series of Higgs Couplings workshops, which began just after the Higgs-boson discovery in 2012 to bring together theorists and experimentalists, was held at SLAC on 9–12 November and drew 148 participants from five continents. Discussions focused on lessons from the current round of LHC analyses that could be applied to future data. Modelling of signal and background is already limiting for some measurements, and new theoretical results and strategies were presented. Other key issues were the use of vector-boson fusion production as a tool, and the power and complementarity of diverse searches for heavy Higgs bosons. Two new themes emerged at the meeting. The first was the possibility of exotic decays of the 125 GeV Higgs boson. These include not only Higgs decays to invisible particles but also decays to lighter Higgs particles, light quarks and leptons (possibly with flavour violation) and new, long-lived particles. A number of searches from ATLAS and CMS reported their first results. The workshop also debated the application of effective field theory as a framework for parametrising precise Higgs measurements. The 6th Higgs Couplings meeting will be held in Heidelberg on 6–10 November 2017. We look forward to new ideas for the creative use of the large data samples of Higgs bosons that will become available as the LHC programme continues. The 8th International Conference on Hard and Electromagnetic Probes of High-energy Nuclear Collisions (Hard Probes 2016) was held in Wuhan, China, on 23–27 September. Hard and electromagnetic probes are powerful tools for the study of the novel properties of hot and dense QCD matter created in high-energy nucleus–nucleus collisions, and have provided much important evidence for the formation of quark–gluon plasma (QGP) in heavy-ion collisions at RHIC and the LHC. Hard Probe 2016 attracted close to 300 participants from 28 countries. The main topics discussed were: jet production and modification in QCD matter; high transverse-momentum hadron spectra and correlations; jet-induced medium excitations; jet properties in small systems; heavy flavour hadrons and quarkonia; photons and dileptons and initial states and related topics. The most recent experimental progress on hard and electromagnetic probes from the ALICE, ATLAS, CMS, LHCb, PHENIX and STAR collaborations, together with many new exciting theoretical and phenomenological developments, were discussed. The next Hard Probe conference will be held in Aix Les Bains, France, in 2018. The International Symposium on EXOtic Nuclei (EXON-2016), took place from 5–9 September in Kazan, Russia, attracting around 170 nuclear experts from 20 countries. The scientific programme focused on recent experiments on the synthesis and study of new super-heavy elements, the discovery of which demonstrates the efficiency of international co-operation. Interesting results were obtained in joint experiments on chemical identification of elements 112 and 114 performed at JINR (Russia), the GSI (Germany) and the Paul Scherrer Institute (Switzerland). A vivid example of co-operation with US scientists is an experiment on the synthesis of element 117 held at the cyclotron of JINR. Recently, the International Union of Pure and Applied Chemistry approved the discovery of the new elements with atomic numbers 113 (“nihonian”), 115 (“moscovium”), 117 (“tennessine”) and 118 (“oganesson”). Five laboratories, which are the co-founders of the symposium, are now creating a new generation of accelerators for the synthesis and study of new exotic nuclei. Projects such as SPIRAL2, RIKEN RI Beam Factory, FAIR, DRIBs, NICA and FRIB will allow us to delve further into the upper limits of the periodic table. The CERN Accelerator School (CAS) and the Wigner Research Centre for Physics jointly organised an introduction-to-accelerator-physics course in Budapest, Hungary, from 2–14 October, attended by more than 120 participants spanning 28 nationalities. This year, CAS will organise a specialised course on beam injection, extraction and transfer (to be held in Erice, Sicily, from 10–19 March) and a second specialised course on vacuum for particle accelerators (near Lund, Sweden, from 6–16 June). The next course on advanced-accelerator physics will be held in the UK in early September, and a Joint International Accelerator School on RF technology will be held in Hayama, Japan, from 16–26 October (www.cern.ch/schools/CAS).


Wiseguyreports.Com Adds “Smart Formaldehyde Detector -Market Demand, Growth, Opportunities and analysis of Top Key Player Forecast to 2022” To Its Research Database The Global Smart Formaldehyde Detector Industry 2016 Market Research Report is a professional and in-depth study on the current state of the Smart Formaldehyde Detector Meter market The report provides a basic overview of the Smart Formaldehyde Detector Meter industry including definitions, classifications, applications and industry chain structure. Development policies and plans are discussed as well as manufacturing processes and cost structures are also analyzed. This report also states importexport consumption, supply and demand figures, cost, price, revenue and gross margins. Request for Sample Report @ https://www.wiseguyreports.com/sample-request/982408-global-smart-formaldehyde-detector-industry-2017-market-research-report The report then analyzes the global Smart Formaldehyde Detector Meter market size (volume and value), and the sales segment market is also discussed by product type, applications and region. The major Smart Formaldehyde Detector Meter market (including North America, Europe, China, Japan) is analyzed, data including market size, import and export, sale segment market by product type and applications. Then we forecast the 2016-2021 market size of Smart Formaldehyde Detector Meter. The report focuses on global major leading companies providing information such as company profiles, sales, sales revenue, market share and contact information. Finally the marketing, feasibility of new investment projects are assessed and overall research conclusions offered. With 213 tables and figures the report provides key statistics on the state of the industry and is a valuable source of guidance and direction for companies and individuals interested in the market Analytics and data presented in each report pertain to several parameters such as – Global and Regional Market Sizes, Market Shares, Market Trends Product (Global and Regional) Market Sizes, Market Shares, Market Trends Technology Trends Corporate Intelligence Key Companies By Sales, Brands, Products Other Strategic Business Affecting Data Global Smart Formaldehyde Detector Industry 2016 Market Research Report 1 1 Industry Overview 1 1.1 Definition and Specifications of Smart Formaldehyde Detector 1 1.1.1 Definition of Smart Formaldehyde Detector 1 1.1.2 Specifications of Smart Formaldehyde Detector 2 1.2 Classification of Smart Formaldehyde Detector 3 1.2.1 Portable Type 3 1.2.3 Stationary Type 4 1.3 Applications of Smart Formaldehyde Detector 4 1.3.1 Industrial 5 1.3.2 Commercial 6 1.3.3 Household 7 1.4 Industry Chain Structure of Smart Formaldehyde Detector 7 1.5 Industry Overview and Major Regions Status of Smart Formaldehyde Detector 8 1.5.1 Industry Overview of Smart Formaldehyde Detector 8 1.5.2 Global Major Regions Status of Smart Formaldehyde Detector 8 1.6 Industry Policy Analysis of Smart Formaldehyde Detector 9 1.7 Industry News Analysis of Smart Formaldehyde Detector 10 8 Major Manufacturers Analysis of Smart Formaldehyde Detector 76 8.1 New Cosmos-Bie 76 8.1.1 Company Profile 76 8.1.2 Product Picture and Specifications 77 8.1.3 Capacity, Production, Price, Cost, Gross and Revenue 77 8.1.4 Contact Information 79 8.2 RIKEN KEIKI 79 8.2.1 Company Profile 79 8.2.2 Product Picture and Specifications 80 8.2.3 Capacity, Production, Price, Cost, Gross and Revenue 81 8.2.4 Contact Information 82 8.3 PPM Technology 83 8.3.1 Company Profile 83 8.3.2 Product Picture and Specifications 83 8.3.3 Capacity, Production, Price, Cost, Gross and Revenue 84 8.3.4 Contact Information 86 8.4 RAE System 86 8.4.1 Company Profile 86 8.4.2 Product Picture and Specifications 88 8.4.3 Capacity, Production, Price, Cost, Gross and Revenue 89 8.4.4 Contact Information 91 8.5 Sper Scientific 91 8.5.1 Company Profile 91 8.5.2 Product Picture and Specifications 92 8.5.3 Capacity, Production, Price, Cost, Gross and Revenue 93 8.5.4 Contact Information 95 8.6 Hal Technology 95 8.6.1 Company Profile 95 8.6.2 Product Picture and Specifications 96 8.6.3 Capacity, Production, Price, Cost, Gross and Revenue 97 8.6.4 Contact Information 98 8.7 Begood 98 8.7.1 Company Profile 98 8.7.2 Product Picture and Specifications 99 8.7.3 Capacity, Production, Price, Cost, Gross and Revenue 100 8.7.4 Contact Information 102 8.8 E Instruments 102 8.8.1 Company Profile 102 8.8.2 Product Picture and Specifications 103 8.8.3 Capacity, Production, Price, Cost, Gross and Revenue 103 8.8.4 Contact Information 105 8.9 Extech 105 8.9.1 Company Profile 105 8.9.2 Product Picture and Specifications 106 8.9.3 Capacity, Production, Price, Cost, Gross and Revenue 107 8.9.4 Contact Information 109 8.10 Lanbao 109 8.10.1 Company Profile 109 8.10.2 Product Picture and Specifications 110 8.10.3 Capacity, Production, Price, Cost, Gross and Revenue 110 8.10.4 Contact Information 112 8.11 GrayWolf 112 8.11.1 Company Profile 112 8.11.2 Product Picture and Specifications 113 8.11.3 Capacity, Production, Price, Cost, Gross and Revenue 114 8.11.4 Contact Information 116 8.12 Uni-Trend 116 8.12.1 Company Profile 116 8.12.2 Product Picture and Specifications 117 8.12.3 Capacity, Production, Price, Cost, Gross and Revenue 118 8.12.4 Contact Information 120 8.13 RKI Instruments 120 8.13.1 Company Profile 120 8.13.2 Product Picture and Specifications 121 8.13.3 Capacity, Production, Price, Cost, Gross and Revenue 122 8.13.4 Contact Information 124 8.14 Environmental Sensors 124 8.14.1 Company Profile 124 8.14.2 Product Picture and Specifications 125 8.14.3 Capacity, Production, Price, Cost, Gross and Revenue 126 8.14.4 Contact Information 128 8.15 Bacharach 128 8.15.1 Company Profile 128 8.15.2 Product Picture and Specifications 129 8.15.3 Capacity, Production, Price, Cost, Gross and Revenue 130 8.15.4 Contact Information 132 For more information, please visit https://www.wiseguyreports.com/sample-request/982408-global-smart-formaldehyde-detector-industry-2017-market-research-report


News Article | March 17, 2016
Site: www.biosciencetechnology.com

In the early stages of Alzheimer’s disease, patients are often unable to remember recent experiences. However, a new study from MIT suggests that those memories are still stored in the brain — they just can’t be easily accessed. The MIT neuroscientists report in Nature that mice in the early stages of Alzheimer’s can form new memories just as well as normal mice but cannot recall them a few days later. Furthermore, the researchers were able to artificially stimulate those memories using a technique known as optogenetics, suggesting that those memories can still be retrieved with a little help. Although optogenetics cannot currently be used in humans, the findings raise the possibility of developing future treatments that might reverse some of the memory loss seen in early-stage Alzheimer’s, the researchers say. “The important point is, this a proof of concept. That is, even if a memory seems to be gone, it is still there. It’s a matter of how to retrieve it,” said Susumu Tonegawa, the Picower Professor of Biology and Neuroscience and director of the RIKEN-MIT Center for Neural Circuit Genetics at the Picower Institute for Learning and Memory. Tonegawa is the senior author of the study, which appears in the March 16 online edition of Nature. Dheeraj Roy, an MIT graduate student, is the paper’s lead author. In recent years, Tonegawa’s lab has identified cells in the brain’s hippocampus that store specific memories. The researchers have also shown that they can manipulate these memory traces, or engrams, to plant false memories, activate existing memories, or alter a memory’s emotional associations. Last year, Tonegawa, Roy, and colleagues found that mice with retrograde amnesia, which follows traumatic injury or stress, had impaired memory recall but could still form new memories. That led the team to wonder whether this might also be true for the memory loss seen in the early stages of Alzheimer’s disease, which occurs before characteristic amyloid plaques appear in patients’ brains. To investigate that possibility, the researchers studied two different strains of mice genetically engineered to develop Alzheimer’s symptoms, plus a group of healthy mice. All of these mice, when exposed to a chamber where they received a foot shock, showed fear when placed in the same chamber an hour later. However, when placed in the chamber again several days later, only the normal mice still showed fear. The Alzheimer’s mice did not appear to remember the foot shock. “Short-term memory seems to be normal, on the order of hours. But for long-term memory, these early Alzheimer’s mice seem to be impaired,” Roy said. The researchers then showed that while the mice cannot recall their experiences when prompted by natural cues, those memories are still there. To demonstrate this, they first tagged the engram cells associated with the fearful experience with a light-sensitive protein called channelrhodopsin, using a technique they developed in 2012. Whenever these tagged engram cells are activated by light, normal mice recall the memory encoded by that group of cells. Likewise, when the researchers placed the Alzheimer’s mice in a chamber they had never seen before and shined light on the engram cells encoding the fearful experience, the mice immediately showed fear. “Directly activating the cells that we believe are holding the memory gets them to retrieve it,” Roy said. “This suggests that it is indeed an access problem to the information, not that they’re unable to learn or store this memory.” The researchers also showed that the engram cells of Alzheimer’s mice had fewer dendritic spines, which are small buds that allow neurons to receive incoming signals from other neurons. Normally, when a new memory is generated, the engram cells corresponding to that memory grow new dendritic spines, but this did not happen in the Alzheimer’s mice. This suggests that the engram cells are not receiving sensory input from another part of the brain called the entorhinal cortex. The natural cue that should reactivate the memory — being in the chamber again — has no effect because the sensory information doesn’t get into the engram cells. “If we want to recall a memory, the memory-holding cells have to be reactivated by the correct cue. If the spine density does not go up during learning process, then later, if you give a natural recall cue, it may not be able to reach the nucleus of the engram cells,” Tonegawa said. “This is a remarkable study providing the first proof that the earliest memory deficit in Alzheimer’s involves retrieval of consolidated information,” said Rudolph Tanzi, a professor of neurology at Harvard Medical School, who was not involved in the research. “As a result, the implications for treatment of memory deficits Alzheimer’s disease based on strengthening synapses are extremely exciting.” The researchers were also able to induce a longer-term reactivation of the “lost” memories by stimulating new connections between the entorhinal cortex and the hippocampus. To achieve this, they used light to optogenetically stimulate entorhinal cortex cells that feed into the hippocampal engram cells encoding the fearful memory. After three hours of this treatment, the researchers waited a week and tested the mice again. This time, the mice could retrieve the memory on their own when placed in the original chamber, and they had many more dendritic spines on their engram cells. However, this approach does not work if too large a section of the entorhinal cortex is stimulated, suggesting that any potential treatments for human patients would have to be very targeted. Optogenetics is very precise but too invasive to use in humans, and existing methods for deep brain stimulation — a form of electrical stimulation sometimes used to treat Parkinson’s and other diseases — affect too much of the brain. “It’s possible that in the future some technology will be developed to activate or inactivate cells deep inside the brain, like the hippocampus or entorhinal cortex, with more precision,” Tonegawa said. “Basic research as conducted in this study provides information on cell populations to be targeted, which is critical for future treatments and technologies.”


News Article | March 16, 2016
Site: motherboard.vice.com

This image represents a coronal brain section from a mouse model of early Alzheimer’s disease. Image: Dheeraj Roy We all know the disorienting feeling of realizing we’ve lost a memory—forgetting your best friend’s birthday party from ten years ago, or the road trip you took to Florida as a kid. New research suggests that these memories aren’t really gone for good, they’ve just drifted out of reach. In a new study, published Wednesday in Nature, scientists from the Massachusetts Institute of Technology managed to retrieve lost memories in mice by zapping their brains with lasers, stimulating their neurons with light. It could lead to new treatments for Alzheimer’s disease, the most common type of brain degeneration, but it also teaches us something new about memories and how they’re stored. “Our lab is interested in how we form long-term memories,” said lead author Dheeraj Roy, a fourth-year PhD student in the of Susumu Tonegawa, director of the RIKEN-MIT Center for Neural Circuit Genetics at the Picower Institute for Learning and Memory. Roy studies early Alzheimer’s, when memories begin to slip away, but nerve cells haven’t yet begun to rapidly die off. “We’re hoping it will teach us about the components of the brain in normal animals that allow us to form a memory,” he explained. Scientists already know that a brain region called the is important for storing memories, but the next step is finding out which specific neurons are involved. “These big structures in the brain have hundreds of thousands of neurons,” Roy said. “It doesn’t make sense that, for every memory, the entire structure is used. Can we pinpoint a group of neurons that are crucial for one memory?” Once these neurons are found, they could theoretically be targeted with some sort of memory drug, but that will come later. In this study, Roy, Tonegawa and their team took two groups of mice: one healthy, and another genetically engineered to mimic Alzheimer’s. All the mice were placed in a chamber, where they got a shock to the foot. When they were put back in that same space an hour later, they all showed fear. But several days later, when they went back again, only the normal mice were scared. The mice with Alzheimer’s didn’t seem to remember. This image depicts a single memory engram cell (green) in the hippocampal dentate gyrus (DG) region of a mouse model of early Alzheimer’s disease. Image: Dheeraj Roy Using a virus, scientists tagged certain neurons in their brains with a light-sensitive protein, then installed a hollow optic fiber above the area they wanted to investigate. This is a technique called , which involves using light to turn neurons on and off. “We can plug the mice into lasers, and send light into deep parts of the brain,” Roy said, activating specific cells. When these cells were switched on, the mice recalled feeling afraid. The Alzheimer’s mice were put in a room they’d never seen before, as cells coding for the fearful experience were activated. The mice immediately froze, a sign of fear. It’s a fascinating result, but brain-zapping lasers probably won’t be used to treat memory loss anytime soon. As scientists begin to identify specific neurons that code memories, Roy said, others can work on developing ways to target them, including with drugs. “I think people would be very excited to get similar results,” he said, “without viruses and lasers.”


MarketStudyReport.com adds “Global Smart Formaldehyde Detector Market by Manufacturers, Regions, Type and Application, Forecast to 2021” new report to its research database. The report spread across 119 pages with table and figures in it. Smart Formaldehyde Detector is used to measure Formaldehyde content in air. Scope of the Report: This report focuses on the Smart Formaldehyde Detector in Global market, especially in North America, Europe and Asia-Pacific, South America, Middle East and Africa. This report categorizes the market based on manufacturers, regions, type and application. Browse full table of contents and data tables at https://www.marketstudyreport.com/reports/global-Smart Formaldehyde Detector-market-by-manufacturers-regions-type-and-application-forecast-to-2021/ Market Segment by Manufacturers, this report covers New Cosmos-Bie RIKEN KEIKI PPM Technology RAE System Sper Scientific Hal Technology Begood E Instruments Extech Lanbao GrayWolf Uni-Trend RKI Instruments Environmental Sensors Bacharach Market Segment by Regions, regional analysis covers North America (USA, Canada and Mexico) Europe (Germany, France, UK, Russia and Italy) Asia-Pacific (China, Japan, Korea, India and Southeast Asia) South America, Middle East and Africa Market Segment by Type, covers Portable Stationary Market Segment by Applications, can be divided into Industrial Commercial Household Others Request a sample copy at https://www.marketstudyreport.com/request-a-sample/?search=global-smart-formaldehyde-detector-market-by-manufacturers-regions-type-and-application-forecast-to-2021/ There are 13 Chapters to deeply display the global Smart Formaldehyde Detector market. Chapter 1, to describe Smart Formaldehyde Detector Introduction, product scope, market overview, market opportunities, market risk, market driving force; Chapter 2, to analyze the top manufacturers of Smart Formaldehyde Detector, with sales, revenue, and price of Smart Formaldehyde Detector, in 2015 and 2016; Chapter 3, to display the competitive situation among the top manufacturers, with sales, revenue and market share in 2015 and 2016; Chapter 4, to show the global market by regions, with sales, revenue and market share of Smart Formaldehyde Detector, for each region, from 2011 to 2016; Chapter 5, 6, 7 and 8, to analyze the key regions, with sales, revenue and market share by key countries in these regions; Chapter 9 and 10, to show the market by type and application, with sales market share and growth rate by type, application, from 2011 to 2016; Chapter 11, Smart Formaldehyde Detector market forecast, by regions, type and application, with sales and revenue, from 2016 to 2021; Chapter 12 and 13, to describe Smart Formaldehyde Detector sales channel, distributors, traders, dealers, appendix and data source. To receive personalized assistance write to us @ [email protected] with the report title in the subject line along with your questions or call us at +1 866-764-2150


News Article | November 30, 2016
Site: physicsworld.com

Flash Physics is our daily pick of the latest need-to-know developments from the global physics community selected by Physics World's team of editors and reporters Radioactive waste from nuclear reactors could be used to create tiny diamonds that produce small amounts of electricity for thousands of years. That is the claim at the heart of a proposal from researchers at the University of Bristol in the UK, who say they have a practical way of dealing with some of the nearly 95,000 tonnes of radioactive graphite that was used as a moderator in the UK's nuclear reactors. The idea is to make the waste less radioactive by removing radioactive carbon-14 nuclei, which are concentrated on the surface of the graphite. The isotope would then be integrated into artificial diamonds. Carbon-14 has a half-life of about 5700 years and decays to non-radioactive nitrogen-14 by emitting a high-energy electron. It turns out that diamond is very good at turning the energy released in the decay into an electrical current – essentially creating a battery that will last for thousands of years. Embedding carbon-14 in diamond is a safe option, say the researchers, because diamond is hard and non-reactive, so it is unlikely that the radioactive carbon will leak into the environment. And because nearly all of the decay energy is deposited within the diamond, the radiation emitted by such a battery would be about the same as that emitted by a banana. The team reckons that a diamond battery containing about 1 g of carbon-14 would deliver about 15 joules per day. A standard 20 g AA battery could sustain this power for about 2.5 years, whereas the diamond battery would last hundreds of years without a significant drop in output. "We envision these batteries to be used in situations where it is not feasible to charge or replace conventional batteries," says Bristol's Tom Scott. "Obvious applications would be in low-power electrical devices where long life of the energy source is needed, such as pacemakers, satellites, high-altitude drones or even spacecraft." The team has already shown that the device could work by placing a non-radioactive diamond next to nickel-63, which emits high-energy electrons. The Indian particle physicist and cosmic-ray expert M G K Menon has died at the age of 88. Menon was educated at Jaswant College, Jodhpur, and the Royal Institute of Science in Bombay (now Mumbai), before moving to the University of Bristol in 1953, where he did a PhD in particle physics under the supervision of Nobel laureate Cecil Powell. Two years later, he joined the Tata Institute of Fundamental Research in Bombay, researching cosmic rays before becoming the institute's director from 1966 to 1975. Later in his career, Menon was appointed to a number of notable policy positions. He became a member of India's Planning Commission from 1982 to 1989 and was science advisor to Indian prime minister Rajiv Gandhi from 1986 to 1989. In 1989 he became minister of state for science and technology and education, and a year later was elected as a member of parliament. The International Union of Pure and Applied Chemistry (IUPAC) has officially named four new elements: 113, 115, 117 and 118. Element 113 was discovered at the RIKEN Nishina Center for Accelerator-Based Science in Japan and will be called nihonium (Nh). Nihon is a transliteration of "land of the rising sun", which is a Japanese name for Japan. Moscovium (Mc) is the new moniker for element 115 and was discovered at the Joint Institute for Nuclear Research (JINR) in Moscow. Element 117 will be called tennessine (Ts) after the US state of Tennessee, which is home to the Oak Ridge National Laboratory, while element 118 will be named oganesson after the Russian physicist Yuri Oganessian, who led the team at JINR that discovered the element. "The names of the new elements reflect the realities of our present time," says IUPAC president Natalia Tarasova. She adds that the names reflect the "universality of science, honouring places from three continents where the elements have been discovered – Japan, Russia, the US – and the pivotal role of human capital in the development of science, honouring an outstanding scientist – Yuri Oganessian". The names were proposed in June and then underwent a five-month consultation period before they were approved by the IUPAC Bureau on Monday.


News Article | November 23, 2016
Site: www.businesswire.com

SALT LAKE CITY--(BUSINESS WIRE)--SC16, the 28th annual international conference of high performance computing, networking, storage and analysis, celebrated the contributions of researchers and scientists - from those just starting their careers to those whose contributions have made lasting impacts. The conference drew more than 11,100 registered attendees and featured a technical program spanning six days. The exhibit hall featured 349 exhibitors from industry, academia and research organizations from around the world. “There has never been a more important time for high performance computing, networking and data analysis,” said SC16 General Chair John West from the Texas Advanced Computing Center. “But it is also an acute time for growing our workforce and expanding diversity in the industry. SC16 was the perfect blend of research, technological advancement, career recognition and improving the ways in which we attract and retain that next generation of scientists.” According to Trey Breckenridge, SC16 Exhibits Chair from Mississippi State University, the SC16 Exhibition was the largest in the history of the conference. The overall size of the exhibition was 150,000 net square feet (breaking the 2015 record of 141,430). The 349 industry and research-focused exhibits included 44 first-timers and 120 organizations from 25 countries outside the United States. During the conference, Salt Lake City also became the hub for the world’s fastest computer network: SCinet, SC16’s custom-built network which delivered 3.15 terabits per second in bandwidth. The network featured 56 miles of fiber deployed throughout the convention center and $32 million in loaned equipment. It was all made possible by 200 volunteers representing global organizations spanning academia, government and industry. For the third year, SC featured an opening “HPC Matters” plenary that this year focused on Precision Medicine, which examined what the future holds in this regard and how advances are only possible through the power of high performance computing and big data. Leading voices from the frontlines of clinical care, medical research, HPC system evolution, pharmaceutical R&D and public policy shared diverse perspectives on the future of precision medicine and how it will impact society. The Technical Program again offered the highest quality original HPC research. The SC workshops set a record with more than 2,500 attendees. There were 14 Best Paper Finalists and six Gordon Bell Finalists. These submissions represent the best of the best in a wide variety of research topics in HPC. “These awards are very important for the SC Conference Series. They celebrate the best and the brightest in high performance computing,” said Satoshi Matsuoka, SC16 Awards Chair from Tokyo Institute of Technology. “These awards are not just plaques or certificates. They define excellence. They set the bar for the years to come and are powerful inspiration for both early career and senior researchers.” Following is the list of Technical Program awards presented at SC16: SC16 received 442 paper submissions, of which 81 were accepted (18.3 percent acceptance rate). Of those, 13 were selected as finalists for the Best Paper (six) and Best Student Paper (seven) awards. The Best Paper Award went to “Daino: A High-Level Framework for Parallel and Efficient AMR on GPUs” by Mohamed Wahib Attia and Naoya Maruyama, RIKEN; and Takayuki Aoki, Tokyo Institute of Technology. The Best Student Paper Award went to “Flexfly: Enabling a Reconfigurable Dragonfly Through Silicon Photonics” by Ke Wen, Payman Samadi, Sebastien Rumley, Christine P. Chen, Yiwen Shen, Meisam Bahadori, and Karen Bergman, Columbia University and Jeremiah Wilke, Sandia National Laboratories. The ACM Gordon Bell Prize is awarded for outstanding team achievement in high performance computing and tracks the progress of parallel computing. This year, the prize was awarded to a 12-member Chinese team for their research project, “10M-Core Scalable Fully-Implicit Solver for Nonhydrostatic Atmospheric Dynamics.” The winning team presented a solver (method for calculating) atmospheric dynamics. In the abstract of their presentation, the winning team writes, “On the road to the seamless weather-climate prediction, a major obstacle is the difficulty of dealing with various spatial and temporal scales. The atmosphere contains time-dependent multi-scale dynamics that support a variety of wave motions.” To simulate the vast number of variables inherent in a weather system developing in the atmosphere, the winning group presents a highly scalable fully implicit solver for three-dimensional nonhydrostatic atmospheric simulations governed by fully compressible Euler equations. Euler equations are a set of equations frequently used to understand fluid dynamics (liquids and gasses in motion). Winning team members are Chao Yang, Chinese Academy of Sciences; Wei Xue, Weimin Zheng, Guangwen Yang, Ping Xu, and Haohuan Fu, Tsinghua University; Hongtao You, National Research Center of Parallel Computer Engineering and Technology; Xinliang Wang, Beijing Normal University; Yulong Ao and Fangfang Liu, Chinese Academy of Sciences, Lin Gan, Tsinghua University; Lanning Wang, Beijing Normal University. This year, SC received 172 detailed poster submissions that went through a rigorous review process. In the end, 112 posters were accepted and five finalists were selected for the Best Poster Award. As part of its research poster activities, SC16 also hosted the ACM Student Research Competition for both undergraduate and graduate students. In all 63 submissions were received, 26 Student Research Competition posters were accepted – 14 in the graduate category and 12 in the undergraduate category. The Best Poster Award went to “A Fast Implicit Solver with Low Memory Footprint and High Scalability for Comprehensive Earthquake Simulation System” with Kohei Fujita from RIKEN as the lead author. First Place: “Touring Dataland? Automated Recommendations for the Big Data Traveler” by Willian Agnew and Michael Fischer, Advisors: Kyle Chard and Ian Foster. Second Place: “Analysis of Variable Selection Methods on Scientific Cluster Measurement Data” by Jonathan Wang, Advisors: Wucherl Yoo and Alex Sim. Third Place: “Discovering Energy Usage Patterns on Scientific Clusters” by Matthew Bae, Advisors: Wucherl Yoo, Alex Sim and Kesheng Wu. First Place: “Job Startup at Exascale: Challenges and Solutions” by Sourav Chakroborty, Advisor: Dhabaleswar K. Panda. Second Place: “Performance Modeling and Engineering with Kerncraft,” by Julian Hammer, Advisors: Georg Hager and Gerhard Wellein. Third Place: “Design and Evaluation of Topology-Aware Scatter and AllGather Algorithms for Dragonfly Networks” by Nathanael Cheriere, Advisor: Matthieu Dorier. The Scientific Visualization and Data Analytics Award featured six finalists. The award went to “Visualization and Analysis of Threats from Asteroid Ocean Impacts” with John Patchett as the lead author. The Student Cluster Competition returned for its 10th year. The competition which debuted at SC07 in Reno and has since been replicated in Europe, Asia and Africa, is a real-time, non-stop, 48-hour challenge in which teams of six undergraduates assemble a small cluster at SC16 and race to complete a real-world workload across a series of scientific applications, demonstrate knowledge of system architecture and application performance, and impress HPC industry judges. The students partner with vendors to design and build a cutting-edge cluster from commercially available components, not to exceed a 3120-watt power limit and work with application experts to tune and run the competition codes. For the first-time ever, the team that won top honors also won the award for achieving highest performance for the Linpack benchmark application. The team “SwanGeese” is from the University of Science and Technology of China. In traditional Chinese culture, the rare Swan Goose stands for teamwork, perseverance and bravery. This is the university’s third appearance in the competition. Also, an ACM SIGHPC Certificate of Appreciation is presented to the authors of a recent SC paper to be used for the SC16 Student Cluster Competition Reproducibility Initiative. The selected paper was “A Parallel Connectivity Algorithm for de Bruijn Graphs in Metagenomic Applications” by Patrick Flick, Chirag Jain, Tony Pan and Srinivas Aluru from Georgia Institute of Technology. The George Michael Memorial HPC Fellowship honors exceptional Ph.D. students. The first recipient is Johann Rudi from the Institute for Computational Engineering and Sciences at the University of Texas at Austin for his project, “Extreme-Scale Implicit Solver for Nonlinear, Multiscale, and Heterogeneous Stokes Flow in the Earth’s Mantle.” The second recipient is Axel Huebl from Helmholtz-Zentrum Dresden-Rossendorf at the Technical University of Dresden for his project, “Scalable, Many-core Particle-in-cell Algorithms to Stimulate Next Generation Particle Accelerators and Corresponding Large-scale Data Analytics.” The SC Conference Series also serves as the venue for recognizing leaders in the HPC community for their contributions during their careers. Here are the career awards presented at SC16: The IEEE-CS Seymour Cray Computer Engineering Award recognizes innovative contributions to high performance computing systems that best exemplify the creative spirit demonstrated by Seymour Cray. The 2016 IEEE-CS Seymour Cray Computer Engineering Award was presented to William J. Camp of Los Alamos National Laboratory “for visionary leadership of the Red Storm project, and for decades of leadership of the HPC community.” Camp previously served as Intel’s Chief Supercomputing Architect and directed Intel’s Exascale R&D efforts. Established in memory of Ken Kennedy, the founder of Rice University's nationally ranked computer science program and one of the world's foremost experts on high-performance computing, the ACM/IEEE-CS Ken Kennedy Award recognizes outstanding contributions to programmability or productivity in high-performance computing together with significant community service or mentoring contributions. The 2016 Ken Kennedy Award was presented to William D. Gropp “for highly influential contributions to the programmability of high-performance parallel and distributed computers, and extraordinary service to the profession.” Gropp Is the Acting Director of the National Center for Supercomputing Applications and Director, Parallel Computing Institute, Thomas M. Siebel Chair in Computer Science at the University of Illinois Urbana-Champaign. The IEEE-CS Sidney Fernbach Memorial Award is awarded for outstanding contributions in the application of high performance computers using innovative approaches. The 2016 IEEE-CS Sidney Fernbach Memorial Award was presented to Vipin Kumar “for foundational work on understanding scalability, and highly scalable algorithms for graph positioning, sparse linear systems and data mining.” Kumar is a Regents Professor at the University of Minnesota. The Supercomputing Conference Test of Time Award recognizes an outstanding paper that has appeared at the SC conference and has deeply influenced the HPC discipline. It is a mark of historical impact and recognition that the paper has changed HPC trends. The winning paper is “Automatically Tuned Linear Algebra Software” by Clint Whaley from University of Tennessee and Jack Dongarra from University of Tennessee and Oak Ridge National Laboratory. IEEE TCSC Award for Excellence in Scalable Computing for Early Career Researchers: The IEEE TCHPC Award for Excellence in Scalable Computing for Early Career Researchers recognizes individuals who have made outstanding and potentially long-lasting contributions to the field within five years of receiving their Ph.D. The 2016 awards were presented to Kyle Chard, Computation Institute , University of Chicago and Argonne National Laboratory; Sunita Chandrassekaran, University of Delaware; and Seyong Lee, Oak Ridge National Laboratory. SC17 will be held next November 12-17 in Denver, Colorado. For more details, go to http://sc17.supercomputing.org/. SC16, sponsored by the IEEE Computer Society and ACM (Association for Computing Machinery), offers a complete technical education program and exhibition to showcase the many ways high performance computing, networking, storage and analysis lead to advances in scientific discovery, research, education and commerce. This premier international conference includes a globally attended technical program, workshops, tutorials, a world-class exhibit area, demonstrations and opportunities for hands-on learning. For more information on SC16, visit: http://sc16.supercomputing.org.


News Article | November 16, 2016
Site: www.eurekalert.org

LA JOLLA--(November 16, 2016) Salk Institute researchers have discovered a holy grail of gene editing--the ability to, for the first time, insert DNA at a target location into the non-dividing cells that make up the majority of adult organs and tissues. The technique, which the team showed was able to partially restore visual responses in blind rodents, will open new avenues for basic research and a variety of treatments, such as for retinal, heart and neurological diseases. "We are very excited by the technology we discovered because it's something that could not be done before," says Juan Carlos Izpisua Belmonte, a professor in Salk's Gene Expression Laboratory and senior author of the paper published on November 16, 2016 in Nature. "For the first time, we can enter into cells that do not divide and modify the DNA at will. The possible applications of this discovery are vast." Until now, techniques that modify DNA--such as the CRISPR-Cas9 system--have been most effective in dividing cells, such as those in skin or the gut, using the cells' normal copying mechanisms. The new Salk technology is ten times more efficient than other methods at incorporating new DNA into cultures of dividing cells, making it a promising tool for both research and medicine. But, more importantly, the Salk technique represents the first time scientists have managed to insert a new gene into a precise DNA location in adult cells that no longer divide, such as those of the eye, brain, pancreas or heart, offering new possibilities for therapeutic applications in these cells. To achieve this, the Salk researchers targeted a DNA-repair cellular pathway called NHEJ (for "non-homologous end-joining"), which repairs routine DNA breaks by rejoining the original strand ends. They paired this process with existing gene-editing technology to successfully place new DNA into a precise location in non-dividing cells. "Using this NHEJ pathway to insert entirely new DNA is revolutionary for editing the genome in live adult organisms," says Keiichiro Suzuki, a senior research associate in the Izpisua Belmonte lab and one of the paper's lead authors. "No one has done this before." First, the Salk team worked on optimizing the NHEJ machinery for use with the CRISPR-Cas9 system, which allows DNA to be inserted at very precise locations within the genome. The team created a custom insertion package made up of a nucleic acid cocktail, which they call HITI, or homology-independent targeted integration. Then they used an inert virus to deliver HITI's package of genetic instructions to neurons derived from human embryonic stem cells. "That was the first indication that HITI might work in non-dividing cells," says Jun Wu, staff scientist and co-lead author. With that feat under their belts, the team then successfully delivered the construct to the brains of adult mice. Finally, to explore the possibility of using HITI for gene-replacement therapy, the team tested the technique on a rat model for retinitis pigmentosa, an inherited retinal degeneration condition that causes blindness in humans. This time, the team used HITI to deliver to the eyes of 3-week-old rats a functional copy of Mertk, one of the genes that is damaged in retinitis pigmentosa. Analysis performed when the rats were 8 weeks old showed that the animals were able to respond to light, and passed several tests indicating healing in their retinal cells. "We were able to improve the vision of these blind rats," says co-lead author Reyna Hernandez-Benitez, a Salk research associate. "This early success suggests that this technology is very promising." The team's next steps will be to improve the delivery efficiency of the HITI construct. As with all genome editing technologies, getting enough cells to incorporate the new DNA is a challenge. The beauty of HITI technology is that it is adaptable to any targeted genome engineering system, not just CRISPR-Cas9. Thus, as the safety and efficiency of these systems improve, so too will the usefulness of HITI. "We now have a technology that allows us to modify the DNA of non-dividing cells, to fix broken genes in the brain, heart and liver," says Izpisua Belmonte. "It allows us for the first time to be able to dream of curing diseases that we couldn't before, which is exciting." Other researchers on the study were Euiseok J. Kim, Fumiyuki Hatanaka, Mako Yamamoto, Toshikazu Araoka, Masakazu Kurita, Tomoaki Hishida, Mo Li, Emi Aizawa, April Goebl, Rupa Devi Soligalla, Concepcion Rodriguez Esteban, Travis Berggren and Edward M. Callaway of the Salk Institute; Yuji Tsunekawa and Fumio Matsuzaki of RIKEN Center for Developmental Biology; Pierre Magistretti of King Abdullah University of Science and Technology; Jie Zhu, Tingshuai Jiang, Xin Fu, Maryam Jafari and Kang Zhang of Shiley Eye Institute and Institute for Genomic Medicine, University of California San Diego; Zhe Li, Shicheng Guo, Song Chen and Kun Zhang of Institute of Engineering in Medicine, University of California San Diego; Jing Qu and Guang-Hui Liu of Chinese Academy of Sciences; Jeronimo Lajara, Estrella Nuñez and Pedro Guillen of Universidad Catolica San Antonio de Murcia; and Josep M. Campistol of the University of Barcelona. The work and the researchers involved were supported in part by the National Institutes of Health, The Leona M. and Harry B. Helmsley Charitable Trust, the G. Harold and Leila Y. Mathers Charitable Foundation, The McKnight Foundation, The Moxie Foundation, the Dr. Pedro Guillen Foundation and Universidad Catolica San Antonio de Murcia, Spain. Every cure has a starting point. The Salk Institute embodies Jonas Salk's mission to dare to make dreams into reality. Its internationally renowned and award-winning scientists explore the very foundations of life, seeking new understandings in neuroscience, genetics, immunology and more. The Institute is an independent nonprofit organization and architectural landmark: small by choice, intimate by nature and fearless in the face of any challenge. Be it cancer or Alzheimer's, aging or diabetes, Salk is where cures begin. Learn more at: salk.edu.


News Article | February 15, 2017
Site: www.spie.org

From the SPIE Photonics West Show Daily : Three plenary speakers at LASE 2017 discussed the LIGO discovery of gravitational waves in space, laser-based direct-write methods, and high-power EUV light sources for lithography. For more than a quarter of a century, Karsten Danzmann has dedicated his career to developing technology that could expand our understanding of the universe by detecting gravitational waves emanating from exotic objects in space. On September 14, 2015, the Laser Interferometer Gravitational-wave Observatory (LIGO) finally did just that. For the first time, US LIGO detectors in Livingston, LA, and Hanford, WA, heard the first "peep" from an event in the distant universe — in this case the collision of two black holes. The event confirmed a major prediction of Albert Einstein's 1915 general theory of relativity and opened a new window into the cosmos. It was such a major breakthrough that it took several days for the LIGO team to accept that it might actually be real, according to Danzmann, director of the Max Planck Institute for Gravitational Physics, a member of the LIGO Scientific Collaboration. And it was another five months before they made their findings public. "I've been chasing this for 27 years, and when it finally happened it was unbelievable," said Danzmann, who noted that a second, similar event, the detection of gravitational waves produced by two black holes colliding 1.4 billion light years away, was captured in June 2016 at the same two observatories. "We've been looking at the universe with our eyes for thousands of years, and we know it looks very different depending on whether we look at it with visible light, infrared light, gamma rays, xrays, ... but we haven't been able to hear it. And suddenly now we can. And we have hope that the dark side of the universe, which makes up 99% of the universe, is now accessible to us." During the LASE plenary session at SPIE Photonics West 2017 in February, Danzmann's enthusiasm was contagious as he described the developments leading up to that historic moment, from the physics and technology to the thousands of people involved worldwide for decades (the first published paper, in Physics Review Letters, listed 1004 authors from 133 institutions). For Danzmann, one of the key turning points came when Advanced LIGO, a $200 million upgrade to LIGO, was unveiled in mid-2015. With the upgrade, which took five years to complete, the observatories are now 10 times more sensitive than their predecessors, thanks to advances in the optical layout, new high-power (165W) stabilized laser systems, advanced mirror suspension, and improved pre-isolation for detecting very low frequencies, according to Danzmann. "The upgrade to Advanced LIGO was drastic," Danzmann said. "The building is still the same, and the stainless steel of vacuum tubes are the same, but everything else has changed." Danzmann is equally excited about a more recent development: LISA Pathfinder, a satellite mission launched in December 2015 whose payload includes the first laser interferometer in space. "On the ground we are listening to the high frequencies of the universe, but if we want to listen to low frequencies, we have to go into space," said Danzmann, who is co-principal investigator on the LISA technology package. "Some of the most interesting things in the universe are supermassive black holes. When galaxies collide, which happens all the time, these super black holes merge and emit a huge signal, and that is what we want to listen to in space." Another LASE plenary talk featured an overview of the current state-of-the-art in using laser-based direct-write (LDW) methods to print hybrid electronics. The talk was given by Alberto Pique, acting head of the Materials and Sensor Branch of the Materials Science Division at the US Naval Research Laboratory. "The goal is very simple: can we go from a design to a printed part that is not faithful in a structural sense but in a functional sense?" Pique posited. "To do that, we need a substrate, we need to wire it up, place the devices, then connect the wires and devices. If you do it right, you end up with a functional circuit." This is where additive manufacturing (AM) comes in. AM is considered a game changer for design and fabrication of 3D parts by reducing the number of steps from concept to part, while direct-write processes make it possible to fabricate custom electronics in less time and at lower cost than other techniques. Combining the two paves the way for more efficient and cost-effective printing of hybrid electronics. The ability of LDW to deposit functional materials over a wide viscosity range onto many diverse surfaces makes it unique among direct write processes, Pique noted. For example, when manufacturing inkjet nozzles, "you have to be careful about the material you put on the nozzle and you have to worry about the nature of the fluid. But when you use the LDW forward transfer technique, the nature of material is not that critical." Advances in lasers, materials, and positioning have spurred the development of LDW in AM, he added. In particular, the availability of high-repetition rate solid-state UV lasers with stable, moderate energies has allowed LDW to deposit materials rapidly in all three dimensions. By comparison, low-rep rate UV lasers with more uniform beam profiles have enabled printing larger area voxels, which also speeds up the LDW process. "Over the years, we have shown that with LDW we can both add and remove material, and this gives the laser technique an edge (over other direct-write techniques) because you can do two things with the same set up," Pique said. "The same system performs both additive and subtractive processes." In the final LASE plenary talk, Hakaru Mizoguchi, executive vice president of Gigaphoton, provided an update on the company's efforts to develop high-power EUV light sources for high-volume manufacturing (HVM) lithography. In July 2016, Gigaphoton demonstrated 250W light output at 4% conversion efficiency with a laser-produced plasma (LPP) light source prototype for EUV scanners. Since then, Gigaphoton has continued to test and refine its EUV light sources, with a goal of eventually reaching 500W, according to Mizoguchi. Photolithography equipment manufacturers are keen for a 250W power EUV source to deliver the kind of wafer productivity throughput their customers demand. To achieve these powers, Gigaphoton uses a dual-laser "priming" pulse from a yv04 (vanadate) laser ahead of a nanosecond-duration carbon dioxide blast, plus sub 20 μm micro droplet supply technology, proprietary energy control technology, and magnetic field-enabled debris mitigation technology. In anticipation of introducing these systems to the commercial market, the company is preparing to move into a new headquarters in Japan that doubles its office space and provides 1.5 times the production space, Mizoguchi noted. Symposium chairs for LASE 2017 were SPIE Fellows Koji Sugioka of RIKEN (Japan) and Reinhart Poprawe of Fraunhofer-Institut für Lasertechnik (Germany). Cochairs were SPIE Fellow Yongfeng Lu of University of Nebraska, Lincoln (USA), and Guido Hennig of Daetwyler Graphics (Switzerland). Photonics West 2017, 28 January through 2 February at the Moscone Center in San Francisco, CA (USA), encompassed more than 4700 presentations on light-based technologies across more than 95 conferences. It was also the venue for dozens of technical courses for professional development, the Prism Awards for Photonics Innovation, the SPIE Startup Challenge, a two-day job fair, two major exhibitions, and a diverse business program with more than 25 events. SPIE Photonics West 2018 will run 27 January through 1 February at Moscone Center.


Ha S.,Chonnam National University | Tran L.-S.,RIKEN
Critical Reviews in Biotechnology | Year: 2014

In both prokaryotes and eukaryotes, including plants, phosphorus (P) is an essential nutrient that is involved in various biochemical processes, such as lipid metabolism and the biosynthesis of nucleic acids and cell membranes. P also contributes to cellular signaling cascades by function as mediators of signal transduction and it also serves as a vital energy source for a wide range of biological functions. Due to its intensive use in agriculture, P resources have become limited. Therefore, it is critically important in the future to develop scientific strategies that aim to increase P use efficiency and P recycling. In addition, the biologically available soluble form of P for uptake (phosphate; Pi) is readily washed out of topsoil layers, resulting in serious environmental pollution. In addition to this environmental concern, the wash out of Pi from topsoil necessitates a continuous Pi supply to maintain adequate levels of fertilization, making the situation worse. As a coping mechanism to P stress, plants are known to undergo drastic cellular changes in metabolism, physiology, hormonal balance and gene expression. Understanding these molecular, physiological and biochemical responses developed by plants will play a vital role in improving agronomic practices, resource conservation and environmental protection as well as serving as a foundation for the development of biotechnological strategies, which aim to improve P use efficiency in crops. In this review, we will discuss a variety of plant responses to low P conditions and various molecular mechanisms that regulate these responses. In addition, we also discuss the implication of this knowledge for the development of plant biotechnological applications. © 2014 Informa Healthcare USA, Inc. All rights reserved: reproduction in whole or part not permitted.


Mazzola G.,CNR Institute of Materials | Yunoki S.,RIKEN | Sorella S.,International School for Advanced Studies
Nature communications | Year: 2014

The study of the high pressure phase diagram of hydrogen has continued with renewed effort for about one century as it remains a fundamental challenge for experimental and theoretical techniques. Here we employ an efficient molecular dynamics based on the quantum Monte Carlo method, which can describe accurately the electronic correlation and treat a large number of hydrogen atoms, allowing a realistic and reliable prediction of thermodynamic properties. We find that the molecular liquid phase is unexpectedly stable, and the transition towards a fully atomic liquid phase occurs at much higher pressure than previously believed. The old standing problem of low-temperature atomization is, therefore, still far from experimental reach.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-FP | Phase: HEALTH-2007-2.1.2-5 | Award Amount: 3.83M | Year: 2009

Background. Parkinson Disease is the second most common progressive neurodegenerative disorder. The selective degeneration of subsets of midbrain dopaminergic neurons is believed to be the primary cause for disruption of the ability to control movements. Objective. We propose to apply a highly interdisciplinary approach to construct complex networks consisting of protein coding genes, non-protein-coding genes and cis-regulatory elements within dopaminergic neurons in the brain across three chordate organisms (Mouse, Zebrafish and Ciona) to identify and compare gene regulatory networks in these neurons. This will be achieved by: Expression profiling of genes on single dopaminergic neurons via laser microdissection and transgenic lines in Mouse, Ciona and Zebrafish HT-Sequencing of microCAGE assays on dopaminergic neurons, providing TSS usage and transcript discovery Microscopy HTS of cis-regulatory elements siRNA and morpholino network perturbation experiments Innovative systems biology approaches to decipher and define molecular networks Data generated by microCAGE and microarray will define a set of key genes in dopaminergic neurons, in which cis-regulatory elements will be predicted and screened utilizing HTS in zebrafish. The data will aid network reconstruction, which will be validated by perturbation experiments. This project relies also on the availability of data produced through the many existing collaborations among consortium partners such as FP6 funded TRANSCODE project as well as the international Fantom3 consortium. Potential impact: The prevalence of PD in Europe today is ~2 million people. Within the next 50 years, the number is expected to rise to 5 million. Thus, the burden placed by dementia on the working-age population will rise dramatically. No treatments are known to slow the progression of the disease. Deciphering the basic networks of dopaminergic neurons will generate novel diagnostic and therapeutic candidates.


Grant
Agency: GTR | Branch: EPSRC | Program: | Phase: Fellowship | Award Amount: 1.05M | Year: 2015

Healthcare is in need of more advanced therapies that integrate closely with the biological and physical systems of the human body. These include new treatments for age-related physical degradation, for example in the circulatory system, and post-operative functional restoration following surgery, including cancer removal, and trauma including traffic accidents. Unfortunately current medical treatments and devices rely heavily on conventional hard technologies that limit effectiveness and raise safety and cost issues. In contrast soft robotic technologies have the potential for close bio-integration by exploiting the soft-soft interfacing that is so prevalent in Nature. Soft robotics offers safer, scalable, lower cost and more effective personalised medical treatments. This fellowship will develop innovative modular soft robotic technologies for rapid exploitation in the next generation bio-integrative medical and therapeutic systems. To enable future soft robotic healthcare technologies requires a concerted effort across the development pipeline from fundamental biocompatible smart materials and their corresponding nonlinear viscoelastic mathematical modelling to efficient compliant mechanisms and complete compliant machines. Fundamental studies into materials and mechanisms will be undertaken and will feed into the identification and characterisation of a set of modular soft robotic components that act as building blocks for complete implantable medical devices. The technologies identified and developed will contribute directly to a step change in the sophistication of bio-integrative medical treatments. These will strengthen the UKs capability in the field of healthcare technologies and will make a significant contribution to improvements in standards of care and quality of life for a wide range of patients.


Patent
Basf and Riken | Date: 2011-05-31

A paint and an adhesive composition of the present invention containing (a) a vinyl ester resin or unsaturated polyester resin by 20 to 40 mass %, (b) a modifying agent by 0.1 to 50 mass %, (c) a vinyl monomer and/or (meth)acrylate monomer by 30 to 70 mass % (provided that the total of the components (a), (b) and (c) is 100 mass %) and (d) an initiator by 0.1 to 15 parts by mass to a total of 100 parts by mass of the components (a), (b) and (c).


An adhesive composition or a coating composition of the present invention contains (a) 10 to 30% by mass of an epoxy resin; (b) 25 to 55% by mass of an oxetane compound; (c) 25 to 55% by mass of a vinyl ether compound; (d) 1 to 15% by mass of a modifier (wherein the total amount of the components (a) to (d) is 100% by mass); and (e) 3 to 15 parts by mass of a photocationic polymerization initiator with respect to 100 parts by mass of the total amount of the components (a) to (d).


A hard coat paint according to the present invention contains (a) vinyl ester resin or unsaturated polyester resin by 10 to 30 mass%, (b) vinyl monomer and/or (meth)acrylate monomer by 50 to 75 mass%, (c) monomer having a cyclic structure and at least one ethylenically unsaturated group in a molecule by 3 to 20 mass%, (d) a modifying agent by 0 to 10 mass% (provided that the total of the components (a) to (d) is 100 mass%) and (e) at least one radical polymerization initiator selected from a group of organic peroxides, UV reaction initiators and electron beam reaction initiators by 0.1 to 15 parts by mass relative to the total of 100 parts by mass of the components (a) to (d).


A coating composition for a solar cell backsheet of the present invention includes: (a) 10 to 40 mass% of vinyl ester resin or unsaturated polyester resin; (b) 30 to 60 mass% of vinyl monomer and/or (meth) acrylate monomer; (c) 5 to 40 mass% of denaturant (The components (a) to (c) are 100 mass% in total); (d) 0.1 to 15 parts by mass of an ultraviolet curing agent relative to 100 parts by mass in total of the components (a) to (c) ; and (e) 5 to 20 parts by mass of a white colorant relative to 100 parts by mass in total of the components (a) to (c)


Grant
Agency: Cordis | Branch: FP7 | Program: CP-IP | Phase: HEALTH.2010.2.1.2-1 | Award Amount: 16.86M | Year: 2011

Cancer is a complex disease involving multiple genetic and epigenetic events occurring, and influencing each other, over a long period of time. Understanding cancer, and ultimately developing effective targeted therapies, will therefore require that mutations and epigenetic alterations be systematically investigated during the multiple stages of disease development, from identifiable pre-neoplastic phases to overt cancer. Until now, no systematic effort has been undertaken to investigate these multiple layers of genome organization and function during cancer development. MODHEP aims at providing a 360 understanding of liver cancer, one of the most common types of tumors and, because of the homogeneity of the hepatic tissue, the most experimentally tractable one. The consortium brings together elite European scientists in the fields of genetics, chromatin regulation, genomics, liver cancer, computational and systems biology. This combination of skills will allow us to investigate and model at unprecedented resolution the chain of events leading from environmental perturbations and the occurrence of driver mutations to preneoplastic disease and cancer. Our experimental plan reflects some grounded assumptions: 1. cancer cannot be modeled without detailed information on the preneoplastic stages of disease; 2. genetic heterogeneity in humans would make systems-level modeling non realistic from a practical point of view. Both of these limitations are bypassed by the use of well-defined mouse models, followed by evaluation of the main conclusions in clinical samples; 3. many early stage driving events in cancer represent epigenetic alterations, which are invisible to classical genetic analysis, and are confounded by secondary and tertiary events in established tumors. Our approach will enable the identification of therapeutically relevant early-stage genetic and epigenetic alterations and the definition of their interplay in tumor development and maintenance.


Patent
Riken, Chiba University and Mitsubishi Group | Date: 2013-05-01

In a coated high-temperature superconducting wire (1) in which a superconducting yttrium-based wire (high-temperature superconducting wire) (2) having a rectangular cross section is coated by an insulating layer (6), the insulating layer (6) is an electrodeposited film made of block copolymerized polyimide which contains siloxane bonds in a polyimide main chain and which has molecules with anionic groups. A coil formed from the superconducting yttrium-based wire (2) is impregnated with epoxy resin, and the epoxy resin is cured. The coil is configured such that the epoxy resin is completely separated from the superconducting yttrium-based wire (2) by the insulating layer (6).


A coating composition for a solar cell backsheet of the present invention includes: (a) 10 to 40 mass % of vinyl ester resin or unsaturated polyester resin; (b) 30 to 60 mass % of vinyl monomer and/or (meth)acrylate monomer; (c) 5 to 40 mass % of denaturant (The components (a) to (c) are 100 mass % in total); (d) 0.1 to 15 parts by mass of an ultraviolet curing agent relative to 100 parts by mass in total of the components (a) to (c); and (e) 5 to 20 parts by mass of a white colorant relative to 100 parts by mass in total of the components (a) to (c)


Grant
Agency: Cordis | Branch: FP7 | Program: MC-ITN | Phase: FP7-PEOPLE-ITN-2008 | Award Amount: 3.32M | Year: 2009

Brain disorders, in particular neurodegenerative diseases and mental illnesses are among the most prevalent and debilitating diseases. Because they are chronic, quality of life and socio-economic prospects are dramatically impaired. Increased life expectancy further enhances the impact of brain dysfunction on society. In coming decades this burden will grow into one of most pressing and costly problems of the EU. Prevalent brain disorders are typically caused by the interplay of environmental factors and genetic variation in multiple genes, which is currently being mapped by large international efforts. Future brain research should aim at integrative projects as a next step to characterize complex interplay between these multiple genetic and environmental factors to reveal how this translates into disease. To succeed, a new generation of neuroscientists is needed, capable of integrating information across different levels, from genes and proteins to synapses, and from networks up to complex brain (dys)function. Eight leading EU institutes (Amsterdam, London, Paris, Heidelberg, Stockholm, Magdeburg, Leuven and Trieste) together with the Japanese RIKEN, five commercial partners and FENS have formed BrainTrain ITN. Partners were selected on their outstanding publication records and ability to integrate different disciplines. BrainTrain builds on our knowledge of genome information and exploits innovative technologies and infrastructure to integrate this to unravel the (dys)function of living neurons, networks and the whole brain. Local specialists offer network-wide training and meetings. Our existing EU funded resources (IP EUsynapse, NeuroCypres and Neuromics EST) will provide an excellent, multicultural and inspiring environment for a new generation of integrative neuroscientists. BrainTrain will deliver 15 skilled ESR prepared for future challenges in neuroscience with optimal career opportunities and the ability to contribute to the fight against brain disorders.


Grant
Agency: Cordis | Branch: H2020 | Program: MSCA-ITN-ETN | Phase: MSCA-ITN-2014-ETN | Award Amount: 3.95M | Year: 2015

The recent explosion of next generation sequencing (NGS) data has caught Europe unprepared and led to a critical shortage of computational biology expertise. As NGS methods are expected to become pervasive from basic science to personalised medicine there is an urgent need for highly skilled young scientists trained in both computational biology and experimental wet lab biology. Our network addresses this important problem of the postgenomic era. We aim to provide multi-disciplinary skills for a solid foundation in computational biology and developmental genomics. Developmental genomics is central to understanding of ontogeny and many genetic and congenital anomalies, but was outside the scope of the landmark ENCODE and FANTOM projects. ENCODE highlighted the need for an in vivo vertebrate model that enables high throughput in vivo functional testing of hypotheses generated from genome scale annotation. Zebrafish is an ideal model for extending the scope of genomics to vertebrate development. We aim to comprehensively annotate functional elements, decipher genomic codes of transcription, as well as coding and non-coding gene function during development and enhance zebrafish as an attractive developmental, comparative and disease model. The participants include 7 non-academic members (2 of which are beneficiaries), major zebrafish genomics laboratories, eminent computational biologists and world class genomics technology experts active in FANTOM and ENCODE. The training program involves 15 ESRs, more than 40 intersectoral and interdisciplinary secondments totalling 19 months, 7 training courses and 2 workshops/conferences. The main outcome of this programme is a cohort of researchers with computational, experimental laboratory and transferable skills ready to further their career in academia, public health and the private sector.


Baumjohann D.,University of California at San Francisco | Okada T.,RIKEN | Ansel K.M.,University of California at San Francisco
Journal of Immunology | Year: 2011

T follicular helper (TFH) cells are central to the development and regulation of T cell-dependent humoral immune responses. The transcriptional repressor BCL6 is required for TFH responses, but the kinetics of BCL6 protein expression in activated CD4+ T cells have not been established. We measured BCL6 expression during TFH cell development at the single-cell level using intracellular staining and YFP-BCL6 fusion protein reporter mice. BCL6 was immediately upregulated in all dividing T cells during dendritic cell-T cell interactions. A second wave of early BCL6 expression coincided with the induction of CXCR5, resulting in a distinct and stable TFH cell population. Cognate B cells were not required for the induction of BCL6, but supported the expansion of TFH cells. These data suggest that BCL6 participates in very early events in TFH cell development, and that repeated encounters with APCs reinforce BCL6 expression, thereby establishing the TFH cell phenotype. Copyright © 2011 by The American Association of Immunologists, Inc.


Patent
Riken, Mitsubishi Group and Chiba University | Date: 2012-10-23

In a coated high-temperature superconducting wire 1 in which a superconducting yttrium-based wire (high-temperature superconducting wire) 2 having a rectangular cross section is coated by an insulating layer 6, the insulating layer 6 is an electrodeposited film made of block copolymerized polyimide which contains siloxane bonds in a polyimide main chain and which has molecules with anionic groups. A coil formed from the superconducting yttrium-based wire 2 is impregnated with epoxy resin, and the epoxy resin is cured. The coil is configured such that the epoxy resin is completely separated from the superconducting yttrium-based wire 2 by the insulating layer 6.


Patent
Basf and Riken | Date: 2010-05-20

A hard coat paint according to the present invention contains (a) vinyl ester resin or unsaturated polyester resin by 10 to 30 mass %, (b) vinyl monomer and/or (meth)acrylate monomer by 50 to 75 mass %, (c) monomer having a cyclic structure and at least one ethylenically unsaturated group in a molecule by 3 to 20 mass %, (d) a modifying agent by 0 to 10 mass % (provided that the total of the components (a) to (d) is 100 mass %) and (e) at least one radical polymerization initiator selected from a group of organic peroxides, UV reaction initiators and electron beam reaction initiators by 0.1 to 15 parts by mass relative to the total of 100 parts by mass of the components (a) to (d).


Patent
Basf and Riken | Date: 2010-09-02

A floor coating material of the present invention contains (a) 20 to 40% by mass of a vinyl ester resin or an unsaturated polyester resin; (b) 50 to 70% by mass of a vinyl monomer and/or a (meth)acrylate monomer; (c) 1 to 20% by mass of a modifying agent (provided that the total amount of the components (a) to (c) is 100% by mass); and (d) 0.1 to 15 parts by mass of at least one radical polymerization initiator selected from the group consisting of organic peroxides, UV initiators and electron-beam initiators, with respect to 100 parts by mass of the total amount of the components (a) to (c).


An adhesive composition or a coating composition of the present invention contains (a) 10 to 30 % by mass of an epoxy resin; (b) 25 to 55 % by mass of an oxetane compound; (c) 25 to 55 % by mass of a vinyl ether compound; (d) 1 to 15 % by mass of a modifier (wherein the total amount of the components (a) to (d) is 100 % by mass); and (e) 3 to 15 parts by mass of a photocationic polymerization initiator with respect to 100 parts by mass of the total amount of the components (a) to (d).


Patent
Riken and Medical & Biological Laboratories Co. | Date: 2011-04-27

It is an object of the present invention to provide a novel fluorescent protein and a novel chromoprotein. The present invention provides a novel fluorescent protein derived from Montipora sp., Acropora sp. and Lobophytum crassum, and a novel chromoprotein derived from Actinia equine.


A paint and an adhesive composition of the present invention containing (a) a vinyl ester resin or unsaturated polyester resin by 20 to 40 mass%, (b) a modifying agent by 0.1 to 50 mass%, (c) a vinyl monomer and/or (meth)acrylate monomer by 30 to 70 mass% (provided that the total of the components (a), (b) and (c) is 100 mass%) and (d) an initiator by 0.1 to 15 parts by mass to a total of 100 parts by mass of the components (a), (b) and (c).


Patent
Riken and Basf | Date: 2013-07-10

A floor coating material of the present invention contains (a) 20 to 40 % by mass of a vinyl ester resin or an unsaturated polyester resin; (b) 50 to 70 % by mass of a vinyl monomer and/or a (meth) acrylate monomer; (c) 1 to 20 % bey mass of a modifying agent (provided that the total amount of the components (a) to (c) is 100 % by mass); and (d) 0.1 to 15 parts by mass of at least one radical polymerization initiator selected from the group consisting of organic peroxides, UV initiators and electron-beam initiators, with respect to 100 parts by mass of the total amount of the components (a) to (c).


Patent
Medical & Biological Laboratories Co. and Riken | Date: 2011-08-02

An object of the present invention is to provide a red or orange fluorescent protein, which is characterized in that the difference (stokes shift) between an excitation peak value (wavelength of maximum absorption) and a fluorescence peak value (wavelength of maximum fluorescence) is greatened, so that the maximum fluorescence can be obtained by the maximum excitation. The present invention provides a novel fluorescent protein monomerized by introducing a mutation into a florescent protein derived from Fungia sp., and a novel chromoprotein and fluorescent protein derived from Montipora. sp.


Wild-type male C57BL/6 mice and B6.129S4–PDGFRαtm11(EGFP)Sor/J mice (Jackson strain number 007669), which contain an H2B–eGFP fusion protein knocked into the Pdgfra locus, were obtained from Jackson Laboratories. Young adult mice were 6–8 weeks of age; aged mice were 22–24 months of age. Mice were housed and maintained in the Veterinary Medical Unit at the Veterans Affairs Palo Alto Health Care System. Animal protocols were performed in accordance with the policies of the Administrative Panel on Laboratory Animal Care of Stanford University. Mice were anaesthetized using isoflurane. To assess muscle regeneration, 50 μl of a 1.2% barium chloride (BaCl ) solution (Sigma-Aldrich) was injected into tibialis anterior muscles as described previously5. To isolate activated FAPs for western blot analysis and FACS analysis, 50 μl of 1.2% BaCl or 50% (v/v) glycerol/water was injected throughout the lower hindlimb muscles. For induction of fibrosis, 30 μl of 50% (v/v) glycerol or 30 μl 1.2% BaCl solution was injected into tibialis anterior muscles. Muscles were dissected from mice and dissociated mechanically. All hindlimb muscles were used except in experiments where FAPs were isolated from VMOs injected into tibialis anterior muscles. In this case, only the tibialis anterior muscle was dissected. The muscle suspension was digested using collagenase II (760 U ml−1; Worthington Biochemical Corporation) in Ham’s F10 medium (Invitrogen) with 10% horse serum (Invitrogen) for 90 min at 37 °C with agitation. The suspension was then washed and digested in collagenase II (152 U ml−1; Worthington Biochemical Corporation) and dispase (2 U ml−1; Invitrogen) for 30 min at 37 °C with agitation. The resultant mononuclear cells were then stained with the following antibodies: VCAM-1-biotin (clone 429; BioLegend, 105704), CD31-APC (clone MEC 13.3; BioLegend, 102510), CD45-APC (clone 30-F11; BioLegend, 103112) and Sca-1-Pacific Blue (clone D7; BioLegend, 108120) at 1:75. Streptavidin-PE-Cy7 (BioLegend, 405206) at 1:75 was used to amplify the VCAM-1 signal. FAPs were collected according to the following sorting criteria: CD31−CD45−Sca-1+. FACS was performed using BD-FACS Aria II and BD-FACS Aria III cell sorters equipped with 488 nm, 633 nm and 405 nm lasers. The cell sorters were carefully optimized for purity and viability and sorted cells were subjected to FACS analysis immediately after sorting to confirm FAP purity. FAPs were isolated from uninjured C57BL/6 mice as described above and lysed. RNA was prepared with the RNeasy Mini Kit as per the manufacturer’s instructions (Qiagen). A 3′ blocking reaction was performed using a poly(A) tailing kit (Ambion) and 3′-dATP (Jena Bioscience) and the reaction mixture was incubated at 37 °C for 30 min. RNA was hybridized to flow cell surfaces for direct RNA sequencing as previously described18. Raw direct RNA sequencing reads were filtered using the Helicos-developed pipeline, Helisphere, to eliminate reads less than 25 nucleotides long or of low quality. These reads were then mapped to the mouse genome (NCBI37/mm9) using an IndexDPgenomic module and reads with a score above 4.3 were allowed. To avoid artefacts from mispriming, reads mapping to regions in the genome where more than four consecutive adenines were coded immediately 3′ to the mapping sequence were excluded from further analysis. Reads were viewed using the Integrative Genomics Viewer32, 33. Total RNA was extracted from FAPs isolated from uninjured C57BL/6 mice using TRIzol (Invitrogen) as per the manufacturer’s instructions. To identify the polyadenylation sites, the sample was reverse transcribed using the SMARTer RACE cDNA amplification kit (Clontech) according to the manufacturer’s instructions using the primers listed in Extended Data Table 1. The amplified fragments were subcloned into pGEM-T-Easy (Promega) and sequenced. Sequencing data were visualized with 4Peaks. To assess levels of the intronic variant and UTR variants, primers were designed to span the Pdgfra transcript (Extended Data Table 2). Variant expression was normalized to Gapdh using the comparative C method27 and reported relative to the average of control-treated samples. A construct corresponding to In-PDGFRα (DNAFORM, AK035501, RIKEN clone 9530057A20) was obtained. This construct was subcloned into the pMXs-IRES-GFP retroviral backbone (Cell BioLabs, Inc.) to generate pMXs-I-Pα. Replication-incompetent retroviral particles were generated by transfection of the 293T human embryonic kidney cell-derived Phoenix helper cell line (gift from G. Nolan). Viral supernatant was filtered through 0.45-μm polyethersulfone filters, concentrated using PEG precipitation and stored at −80 °C. FAPs were plated in 6-well plates and grown in DMEM supplemented with 10% fetal bovine serum (FBS). When cells reached 70% confluency, viral supernatant and polybrene (at a final concentration of 4 μg ml−1) were added to the medium. For overexpression experiments, FAPs were incubated with the viral supernatant for 48 h before analysis. For signalling assays, FAPs were incubated with the viral supernatant for 24 h. Afterwards the medium was changed to serum-free DMEM containing viral supernatant and the cells were incubated for an additional 24 h. The FAPs were then treated with 1 ng ml−1 PDGF-AA for 15 min, after which the cells were used for western blot analysis. A peptide with the sequence GKSAHAHSGKYDLSVV, which represents the unique C-terminal region of In-PDGFRα protein, was generated (Thermo Scientific Pierce, OE0726). To generate In-PDGFRα rabbit polyclonal antibodies directed against In-PDGFRα, New Zealand white rabbits that were specific pathogen free were immunized with 0.25 mg of the peptide in Complete Freund’s Adjuvant. The rabbits received three boosters of antigen consisting of 0.10 mg in Incomplete Freund’s Adjuvant at days 14, 42 and 56 after immunization. Serum was collected at days 70 and 72 (Thermo Scientific Pierce). Cells and homogenized tissues were lysed with RIPA lysis buffer supplemented with protease and phosphatase inhibitors (Roche). The lysates were run on Criterion SDS–PAGE gels (Bio-Rad), transferred to nitrocellulose membranes (Fisher Scientific), and analysed by western blot using the following rabbit antibodies: PDGFRα polyclonal (1:1,000, Cell Signaling, 3174), PDGFRα centre (1:100, Abgent, AP14254c), In-PDGFRα custom (1:1,000), pPDGFRαTyr754 polyclonal (1:1,000, Cell Signaling, 4547), Akt polyclonal (1:1,000, Cell Signaling, 9272), pAkt polyclonal (1:1,000, Cell Signaling, 9271), PLCγ polyclonal (1:1,000, Cell Signaling, 5690), pPLCγ polyclonal (1:1,000, Cell Signaling, 2821), ERK polyclonal (1:2,000, Cell Signaling, 4695), pERK polyclonal (1:2,000, Cell Signaling, 4370), SMAD2/3 monoclonal (1:1,000, Cell Signaling, 8685), and pSMAD2Ser465/Ser467/SMAD3Ser423/Ser425 monoclonal (1:1,000, Cell Signaling, 8828). Membranes were incubated in horseradish-peroxidase-labelled secondary antibodies and bands were visualized with enhanced chemiluminescence (Advansta). siRNAs were designed using the Dharmacon siDESIGN Center for knockdown of In-PDGFRα and FL-PDGFRα (Extended Data Table 2). To knockdown either In-PDGFRα or FL-PDGFRα in FAPs, approximately 8 × 104 cells were plated in a 12-well plate containing DMEM supplemented with 10% FBS and grown to 70–80% confluence. Cells were incubated in 200 nM of either PDGFRα or control siRNAs using Lipofectamine 2000 (Invitrogen). To assess knockdown, cells were collected at 24 h for qPCR analysis. For western blot analyses, 3 × 105 cells were plated in 6-well plates and incubated in Ham’s F10 medium (Invitrogen) supplemented with 10% horse serum (Invitrogen) for 24 h. The medium was then replaced with serum-free Ham’s F10 (Invitrogen) supplemented with 200 nM siRNA and incubated for an additional 24 h. Morpholinos were designed to target two polyadenylation sites on the intronic variant (pA : 5′-TGATTACATTATATCTGTCTTTATT-3′ and pA : 5′-AGCAAAGACCATCATAGCAGAATGA-3′) and the upstream 5′ splice site of the intron (5′ss: 5′-ATGGGCACTTTTACCTAGCATGGAT-3′) (Gene Tools, LLC). For in vitro treatment, cells were grown to 70–80% confluency in DMEM (Invitrogen) supplemented with 10% FBS (Atlanta Biologicals). Cells were incubated in 10 μM of the indicated morpholino using the Endo-Porter transfection reagent (Gene Tools, LLC). Cells were collected at 24 h for qPCR analysis with RNA isolated using the RNeasy Plus Mini kit with on-column DNase digestion as per manufacturer’s instructions (Qiagen). For western blot analysis, cells were transfected for 24 h in Ham’s F10 medium (Invitrogen) supplemented with 10% horse serum (Invitrogen). The medium was then replaced with serum-free Ham’s F10 (Invitrogen) and incubated for an additional 24 h. For signalling assays, cells were then incubated for 15 min with PDGF-AA (Peprotech) at 0.1 ng ml−1 or 20 ng ml−1 for cells treated with pA-AMOs or 5′ss-AMO, respectively, and lysed for western blot analysis as described above. For AMO treatment, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice and seeded at 1 × 105 cells per well in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). Cells were transfected with 10 μM AMO using Endoporter (Gene Tools) and expanded for 2 days in Ham’s F10 (Invitrogen) supplemented with 10% horse serum (Invitrogen). The medium was then replaced with Opti-MEM supplemented with 2 ng ml−1 PDGF-AA ligand and 10 μm EdU (Invitrogen). Cells were fixed in 4% paraformaldehyde (Sigma-Aldrich) after 24 h. For siRNA treatment, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice and seeded at 2 × 105 cells per well in poly-d-lysine coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). The medium was supplemented with 200 nM siRNA and transfected using Lipofectamine 2000 (Invitrogen). After 24 h, the medium was replaced with Opti-Mem and the cells were re-transfected with 200 nM siRNA and 50 ng ml−1 PDGF-AA. In siRNA-treated samples, EdU was not included in this medium. Rather, after 20 h the medium was replaced with Opti-Mem containing 10 μm EdU (Invitrogen). Cells were fixed 4 h later. For retroviral overexpression of In-PDGFRα, FAPs were isolated from uninjured hindlimbs of C57BL/6 mice and seeded at 2 × 105 cells per well in poly-d-lysine coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). FAPs were cultured in DMEM supplemented with 10% FBS along with viral supernatant and 4 μg ml−1 polybrene. After 24 h, the medium was replaced with serum-free DMEM containing viral supernatant and 20 ng ml−1 PDGF-AA. Twenty hours later, the medium was replaced with Opti-MEM containing 10 μM EdU. Cells were fixed after 4 h. For EdU incorporation experiments, cells were stained using the Click-iT EdU Imaging Kit (Invitrogen). Cells were analysed on a Zeiss Observer Z1 fluorescent microscope (Carl Zeiss) equipped with a Hamamatsu Orca-ER camera (Hamamatsu) and Improvision Volocity software (Perkin Elmer). Cells isolated by FACS from uninjured hindlimb muscles were seeded at a density of 3.5 × 104 cells per well in 96-well plates in Ham’s F10 medium supplemented with 2% horse serum. After 48 h, cells were nearly confluent and the medium was changed to Ham’s F10 with 2% horse serum and 20 ng ml−1 PDGF-AA. A wound was made by scratching a 200-μl pipette tip across the monolayer of cells. The initial scratch area was determined immediately and set to 100%. Images were taken at regular intervals and the scratch area at each time point was measured and calculated as a percentage of the initial scratch area. Scratch closure is defined as the inverse of the cell-free area as a percentage of total area. For in vitro microarray analysis, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice. Cells were plated at 1 × 106 cells per well in 12-well plates. Cells were grown for 2.5 days in DMEM supplemented with 10% FBS. The medium was switched to Ham’s F10 supplemented with 10% horse serum and transfected with 10 μM AMO as indicated for 48 h. The medium was then replaced with Opti-Mem and cells were re-transfected with 10 μM AMO. After 48 h, the cells were lysed and RNA was prepared with the RNeasy Mini Kit as per the manufacturer’s instructions (Qiagen). For in vivo microarray analysis, tibialis anterior muscles were injured with 30 μl of glycerol each and injected with the indicated VMO after 3 days. FAPs were then isolated from the muscles 2 days after VMO injection. Cells were pelleted and RNA prepared from samples as indicated above. The microarray data were obtained using Affymetrix Mouse 1.0 ST. For gene set enrichment analysis (GSEA), the samples were normalized and processed using GenePattern ExpressionFileCreator and PreProcessData set modules. Expression data were analysed and visualized with GSEA28 and GENE-E (http://www.broadinstitute.org/cancer/software/GENE-E/). For ingenuity pathway analysis, including causal network analysis, the samples were normalized using Affymetrix Expression Console Software and analysed for enrichment using IPA (Ingenuity Systems, http://www.ingenuity.com). Array data were deposited into Gene Expression Omnibus (Accessions GSE60099 and GSE81744). Vivo-morpholinos were designed to target two polyadenylation sites on the intronic variant (pA -VMO: 5′-TGATTACATTATATCTGTCTTTATT-3′ and pA -VMO: 5′-AGCAAAGACCATCATAGCAGAATGA-3′) and the upstream 5′ splice site of the intron (5′ss-VMO: 5′-ATGGGCACTTTTACCTAGCATGGAT-3′) (Gene Tools, LLC). For treatment in vitro, cells were isolated from hindlimb muscles of C57BL/6 mice and grown to 70–80% confluency in DMEM (Invitrogen) supplemented with 10% FBS (Atlanta Biologicals). Cells were incubated in the 10 μM of the indicated morpholino (Gene Tools, LLC). Cells were collected at 24 h for qPCR analysis. For in vivo qPCR analysis, tibialis anterior muscles were injured with glycerol as described above and injected with 250 ng of the indicated VMO at the site of injury 3 days later. FAPs were sorted by FACS 7 days after VMO injection for qPCR analysis. For ex vivo proliferation and scratch assays, tibialis anterior muscles were injured with glycerol and injected with 250 ng of the indicated VMO 3 days after injury. FAPs were isolated 2 days later by FACS. In EdU incorporation studies, cells were seeded at 4 × 104 cells per well in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). Cells were incubated in 10 ng ml−1 PDGF-AA (Peprotech) and 10 μM EdU (Invitrogen) for 24 h. The cells were fixed and stained. In the ex vivo proliferation studies as well as the in vivo proliferation studies described below, the proliferation index was used to denote the percentage EdU incorporation normalized to control. In the scratch assays, cells were seeded and treated as described above. For in vivo proliferation studies, tibialis anterior muscles were injected with 150 ng of the indicated VMO at 0 and 24 h. FAPs were isolated at 48 h via FACS. To assess in vivo proliferation, the cells were exposed to 10 μM EdU immediately after muscle isolation and incubated in 10 μM EdU ex vivo during the collagenase, collagenase/dispase, and antibody incubations as described above. The cells were plated in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich), fixed 1 h after plating, and stained using the Click-iT EdU Imaging Kit (Invitrogen). For histological analysis, tibialis anterior muscles were injured with glycerol or BaCl and injected at the site of injury with 250 ng of the indicated VMO. After 7 days, the muscles were snap frozen in isopentane cooled in liquid nitrogen immediately after dissection. Muscles sections were stained with Gomori-trichrome (Richard-Allan Scientific) per manufacturer’s instructions or oil red O (Sigma-Aldrich) as previously described29. The fibrotic index was calculated as the area of fibrosis divided by total area of muscle normalized to control-treated muscle. The fibro–adipose index was defined as the area of fibrosis plus the area of adiposis (as detected by oil red O staining) divided by total area of muscle, normalized to control. Major factors in determining sample size included the level of the effect and the inherent variability in measurements obtained. No statistical methods were used to predetermine sample size. Animals were excluded from the study only if their health status was compromised, such as occurred when animals had visible wounds from fighting. Samples were not specifically randomized or blinded. However, mouse identifiers were used when possible to blind evaluators to experimental conditions, and all samples within experiments were processed identically for measurement quantification using automated tools as specified. The sequencing data were deposited into the NCBI Sequence Read Archive (accession number SRP079186). Array data were deposited into Gene Expression Omnibus (accession numbers GSE60099 and GSE81744).


News Article | February 17, 2017
Site: www.eurekalert.org

Address and deliver: A gold catalyst can be delivered to a target organ in a higher organism where it performs a chemical transformation visualized by bioimaging. This intriguing approach has been introduced by a Japanese team of scientists in the journal Angewandte Chemie. It could make organometallic catalysis applicable for therapy or diagnostics. How is a therapeutically useful catalyst guided into its target tissue to synthesize bioactive molecules and drugs in higher level? How can its activity be visualized there? Noninvasive targeting for therapy, biological sensing, and imaging has become one of the most active biomedical research areas. Katsunori Tanaka and his colleagues at RIKEN, Waseda University, and JST-PRESTO (Japan) and Kazan Federal University (Russia) are especially interested in biocompatible metal complexes and, among them, gold catalysts to perform synthetic transformations in a target tissue. The challenge, however, is to bring the gold specifically to its target organ and to establish a visualization scheme to monitor the ongoing biochemical transformation. Gold ions can be conjugated to a hydrophobic protein ligand, and this complex can be bound to albumin, an abundant water-soluble protein. The albumin is then furnished with sugar-type molecules, the glycans, which carry the chemical groups responsible for glycoalbumin accumulation in a target organ: "This work explores the adaptation and usage of organ-targeting glycans as biologically-compatible metal carriers," the scientists wrote. Thus the glycoalbumin can deliver the biocompatible metal catalyst, namely the gold complex. Intriguingly, this gold complex efficiently acts as an organometallic catalyst that can perform the reaction between biologically relevant molecules and organic substrates, which means it could be a relevant drug or diagnostic compound. The scientists used the gold complex to bind a fluorescent dye to certain surface proteins present in the target tissue, which was either the liver or the intestine. To visualize the reaction, they performed fluorescent imaging of the whole living mouse. Within two hours after the injection of the catalyst and the substrate (the functionalized fluorescent dye) into the blood circuit, strong fluorescence in the two organs demonstrated successful in vivo gold catalysis. Thus, a catalytically active gold complex was sent and delivered to a target organ within a short time and without the laborious development of antibodies. As an outlook the scientists envisage biomedical applications, especially for metal catalysts with their unique reactivities: "Example therapies may include uncaging of active, cancer therapeutic enzymes selectively at tumor sites or [...] reactions to produce active drug molecules at targeted organs," they wrote. Dr. Katsunori Tanaka is an Associate Chief Scientist in RIKEN, Japan. His research interests include developing synthetic methodologies, exploring in vivo glycan pattern recognition with its diagnostic and therapeutic application, and synthesizing bioactive molecules in living biological systems, which he named "therapeutic in vivo synthetic chemistry". He is the recipient of the Horace S. Isbell Award from ACS Division of Carbohydrate Chemistry.


News Article | September 26, 2016
Site: www.biosciencetechnology.com

A global genetic interaction map is revolutionizing how genes are being studied. A new study, involving University of Minnesota researchers, is no longer looking at genes as loners, but instead as a social network of the body, interacting in groups. The new approach may ultimately change our understanding of the genetic roots of diseases. The map will help scientists predict how genes function in order to understand, and thwart, the culprits behind diseases, with a potential for developing finely-tuned therapies. The research findings were published today in the journal Science. Prior studies of yeast cells have shown only a fraction of genes, one out of five, was essential for a cell’s survival. This discovery was made by an international consortium of scientists over a decade ago where they targeted each of the yeast cell’s 6,000 genes for deletion. Recent advances in gene editing technology has allowed scientists to tackle the same question in human cells, resulting in the same answer—only a fraction of genes are essential to cell life. Building on this research, University of Minnesota computer science and engineering Associate Professor Chad Myers, along with Professors Brenda Andrews and Charles Boone from the University of Toronto’s Donnelly Centre, have created the first complete genetic interaction network of a yeast cell, one that begins to explain how thousands of genes coordinate with one another to orchestrate cellular life. “Even though many common diseases are thought to be caused by many different loci in the genome, we don't really understand the basic principles for how multiple genes combine to have effects,” Myers said. “Our comprehensive study of double mutant combinations in yeast establishes a set of first principles that we expect to apply in many different species, including humans.” These findings suggest that most genes within our genomes are “buffered” to protect the cell from mutations and environmental stresses. Cells contain backup systems to ensure the essential functions of life keep working properly, even when one part is damaged. To address this buffering property, scientists had to ask if cells can survive upon losing more than one gene at a time, and they had to test millions of gene pairs. Andrews, Boone, and Myers led the pioneering work in yeast cells by studying cell survival in the context of double mutants. To do so, they automated yeast genetic analysis, and they used robots to construct and examine almost all of the 18 million pairwise double mutant combinations. The global genetic interaction map catalogues the pairs of genes that provide back up for one another—if the gene function of one is lost, the other gene in the genome fills its role. Consider a bicycle analogy: a wheel is akin to an essential gene — a part without which it would be impossible to ride. Front brakes? That depends, because you could ride just fine as long as the back brakes are working. But what if you were to lose both sets of brakes? Without back brakes, the front brakes become essential, and vice versa. Geneticists would call the relationship between front and back brakes as “synthetic lethal," meaning that losing both, but neither by themselves, spells doom. Synthetic lethal double mutant gene pairs are relatively rare, but when they are found, they reveal important information on gene pairs that work together to control essential functions. What’s more, the global map shows that synthetic lethal gene pairs are more likely to control the same biological process in the cell. This way, scientists are able to predict what a gene actually does in the cell simply based on its genetic interaction patterns, a process referred to as “guilt by association”. If most genes in the human genome have one or more backup genes, then instead of searching for single genes underlying diseases, researchers now must look for gene pairs. This poses a huge challenge because they must somehow examine on the order of 200 million (!) possible gene pairs in the human genome that are associated with a disease. Fortunately, with the know-how from the yeast map, researchers can now begin to map genetic interactions in human cells, and even expand it to a number of different cell types. “Technology to manipulate human genomes on a large scale exists now,” Myers said. “Our work in yeast provides a blueprint for how we can learn about the human genome through systematic manipulation in cell lines.” The concept of synthetic lethality is already changing cancer treatment because of its potential to identify drug targets that exist only in tumor cells. Cancer cells differ from normal cells in that they have scrambled genomes, littered with mutations. If scientists could find the highly vulnerable back-up genes in cancer, they could target specific drugs at them to destroy only the cells that are sick, leaving the healthy ones untouched. This work was primarily supported by the National Institutes of Health, Canadian Institutes of Health Research, RIKEN Strategic Programs for R&D, Japan Society for the Promotion of Science Kakeni Grants, and the National Science Foundation.


News Article | February 17, 2017
Site: www.eurekalert.org

COLLEGE PARK, Md. - A new scientific paper by a University of Maryland-led international team of distinguished scientists, including five members of the National Academies, argues that there are critical two-way feedbacks missing from current climate models that are used to inform environmental, climate, and economic policies. The most important inadequately-modeled variables are inequality, consumption, and population. In this research, the authors present extensive evidence of the need for a new paradigm of modeling that incorporates the feedbacks that the Earth System has on humans, and propose a framework for future modeling that would serve as a more realistic guide for policymaking and sustainable development. Twelve of the interdisciplinary team of 20 coauthors are from the University of Maryland, with multiple other universities (Northeastern University, Columbia University, George Mason University, Johns Hopkins University, and Brown University) and other institutions (Joint Global Change Research Institute, University Corporation for Atmospheric Research, the Institute for Global Environment and Society, Japan's RIKEN research institute, and NASA's Goddard Space Flight Center) also represented. The study explains that the Earth System (e.g., atmosphere, ocean, land, and biosphere) provides the Human System (e.g., humans and their production, distribution, and consumption) not only the sources of its inputs (e.g., water, energy, biomass, and materials) but also the sinks (e.g., atmosphere, oceans, rivers, lakes, and lands) that absorb and process its outputs (e.g., emissions, pollution, and other wastes). Titled "Modeling Sustainability: Population, Inequality, Consumption, and Bidirectional Coupling of the Earth and Human Systems", the paper describes how the rapid growth in resource use, land-use change, emissions, and pollution has made humanity the dominant driver of change in most of the Earth's natural systems, and how these changes, in turn, have critical feedback effects on humans with costly and serious consequences, including on human health and well-being, economic growth and development, and even human migration and societal conflict. However, the paper argues that these two-way interactions ("bidirectional coupling") are not included in the current models. The Oxford University Press's multidisciplinary journal National Science Review, which published the paper, has highlighted the work in its current issue, pointing out that "the rate of change of atmospheric concentrations of CO2, CH4, and N2O [the primary greenhouse gases] increased by over 700, 1000, and 300 times (respectively) in the period after the Green Revolution when compared to pre-industrial rates." See Figure 1 from the Highlights article, reproduced below. "Many datasets, for example, the data for the total concentration of atmospheric greenhouse gases, show that human population has been a strong driver of the total impact of humans on our planet Earth. This is seen particularly after the two major accelerating regime shifts: Industrial Revolution (~1750) and Green Revolution (~1950)" said Safa Motesharrei, UMD systems scientist and lead author of the paper. "For the most recent time, we show that the total impact has grown on average ~4 percent between 1950 and 2010, with almost equal contributions from population growth (~1.7 percent) and GDP per capita growth (~2.2 percent). This corresponds to a doubling of the total impact every ~17 years. This doubling of the impact is shockingly rapid." "However, these human impacts can only truly be understood within the context of economic inequality," pointed out political scientist and co-author Jorge Rivas of the Institute for Global Environment and Society. "The average per capita resource use in wealthy countries is 5 to 10 times higher than in developing countries, and the developed countries are responsible for over three quarters of cumulative greenhouse gas emissions from 1850 to 2000." University of Maryland geographer and co-author Klaus Hubacek added: "The disparity is even greater when inequality within countries is included. For example, about 50 percent of the world's people live on less than $3 per day, 75 percent on less than $8.50, and 90 percent on less than $23. One effect of this inequality is that the top 10 percent produce almost as much total carbon emissions as the bottom 90 percent combined." The study explains that increases in economic inequality, consumption per capita, and total population are all driving this rapid growth in human impact, but that the major scientific models of Earth-Human System interaction do not bidirectionally (interactively) couple Earth System Models with the primary Human System drivers of change such as demographics, inequality, economic growth, and migration. The researchers argue that current models instead generally use independent, external projections of those drivers. "This lack of two-way coupling makes current models likely to miss critical feedbacks in the combined Earth-Human system," said National Academy of Engineering member and co-author Eugenia Kalnay, a Distinguished University Professor of Atmospheric and Oceanic Science at the University of Maryland. "It would be like trying to predict El Niño with a sophisticated atmospheric model, but with the Sea Surface Temperatures taken from external, independent projections by, for example, the United Nations," said Kalnay. "Without including the real feedbacks, predictions for coupled systems cannot work; the model will get away from reality very quickly." "Ignoring this bidirectional coupling of the Earth and Human Systems can lead to missing something important, even decisive, for the fate of our planet and our species," said co-author Mark Cane, G. Unger Vetlesen Professor of Earth and Climate Sciences at Columbia University's Lamont-Doherty Earth Observatory, who recently won the Vetlesen Prize for creating the first coupled ocean-atmosphere model with feedbacks that successfully predicted El Niño. Co-author Matthias Ruth, Director and Professor at the School of Public Policy and Urban Affairs, Northeastern University, said: "The result of not dynamically modeling these critical Human-Earth System feedbacks would be that the environmental challenges humanity faces may be significantly underestimated. Moreover, there's no explicit role given to policies and investments to actively shape the course in which the dynamics unfold. Rather, as the models are designed now, any intervention -- almost by definition -- comes from the outside and is perceived as a cost. Such modeling, and the mindset that goes with it, leaves no room for creativity in solving some of the most pressing challenges." "The paper correctly highlights that other human stressors, not only the climate ones, are very important for long-term sustainability, including the need to reduce inequality'', said Carlos Nobre (not a co-author), one of the world's leading Earth System scientists, who recently won the prestigious Volvo Environment Prize in Sustainability for his role in understanding and protecting the Amazon. "Social and economic equality empowers societies to engage in sustainable pathways, which includes, by the way, not only the sustainable use of natural resources but also slowing down population growth, to actively diminish the human footprint on the environment." Michael Mann, Distinguished Professor and Director of the Earth System Science Center at Penn State University, who was not a co-author of the paper, commented: "We cannot separate the issues of population growth, resource consumption, the burning of fossil fuels, and climate risk. They are part of a coupled dynamical system, and, as the authors show, this has dire potential consequences for societal collapse. The implications couldn't be more profound." This work was supported by the University of Maryland Council on the Environment 2014 Seed Grant (1357928). The authors would like to acknowledge the following grants and institutions: SM, KF, and KH: National Socio-Environmental Synthesis Center (SESYNC)--US National Science Foundation (NSF) award DBI-1052875; JR: The Institute of Global Environment and Society (IGES); GRA: Laboratory Directed Research and Development award by the Pacific Northwest National Laboratory, which is managed by the Battelle Memorial Institute for the US Department of Energy; MAC: Office of Naval Research, research grant MURI N00014-12-1-0911; FMW: NSF award CBET-1541642; VMY: The Institute for New Economic Thinking (INET). "Modeling Sustainability: Population, Inequality, Consumption, and Bidirectional Coupling of the Earth and Human Systems" is available at: https:/ and https:/ or PDF https:/


News Article | February 24, 2017
Site: www.prweb.com

A recent scientific paper by a University of Maryland-led international team of distinguished scientists, including five members of the National Academies, argues that there are critical two-way feedbacks missing from current climate models that are used to inform environmental, climate, and economic policies. The most important inadequately-modeled variables are inequality, consumption, and population. In this research, the authors present extensive evidence of the need for a new paradigm of modeling that incorporates the feedbacks that the Earth system has on humans, and propose a framework for future modeling that would serve as a more realistic guide for policy making and sustainable development. The large, interdisciplinary team of 20 coauthors are from a number of universities (University of Maryland, Northeastern University, Columbia University, George Mason University, Johns Hopkins University, and Brown University) and other institutions (Joint Global Change Research Institute, University Corporation for Atmospheric Research, the Institute for Global Environment and Society, Japan’s RIKEN research institute, and NASA’s Goddard Space Flight Center). The study explains that the Earth System (e.g., atmosphere, ocean, land, and biosphere) provides the Human System (e.g., humans and their production, distribution, and consumption) not only the sources of its inputs (e.g., water, energy, biomass, and materials) but also the sinks (e.g., atmosphere, oceans, rivers, lakes, and lands) that absorb and process its outputs (e.g., emissions, pollution, and other wastes). Titled "Modeling Sustainability: Population, Inequality, Consumption, and Bidirectional Coupling of the Earth and Human Systems", the article describes how the recent rapid growth in resource use, land-use change, emissions, and pollution has made humanity the dominant driver of change in most of the Earth’s natural systems, and how these changes, in turn, have critical feedback effects on humans with costly and serious consequences, including on human health and well-being, economic growth and development, and even human migration and societal conflict. However, the paper argues that these two-way interactions ("bidirectional coupling") are not included in the current models. The Oxford University Press's multidisciplinary journal National Science Review, which published the paper, also highlighted the paper in a separate "Research Highlight", pointing out that "the rate of change of atmospheric concentrations of CO2, CH4, and N2O [the primary greenhouse gases] increased by over 700, 1000, and 300 times (respectively) in the period after the Green Revolution when compared to pre-industrial rates." See attached figure. "Many datasets, for example, the data for the total concentration of atmospheric greenhouse gases, show that human population has been a strong driver of the total impact of humans on our planet Earth. This is seen particularly after the two major accelerating regime shifts: Industrial Revolution (~1750) and Green Revolution (~1950)" said Safa Motesharrei, UMD systems scientist and lead author of the paper. "For the most recent time, we show that the total impact has grown on average ~4 percent between 1950 and 2010, with almost equal contributions from population growth (~1.7 percent) and GDP per capita growth (~2.2 percent). This corresponds to a doubling of the total impact every ~17 years. This doubling of the impact is shockingly rapid." "However, these human impacts can only truly be understood within the context of economic inequality,” pointed out political scientist and co-author Jorge Rivas of the Institute for Global Environment and Society. "The average per capita resource use in wealthy countries is 5 to 10 times higher than in developing countries, and the developed countries are responsible for over three quarters of cumulative greenhouse gas emissions from 1850 to 2000." "The disparity is even greater when inequality within countries is included," added University of Maryland geographer and coauthor Klaus Hubacek. "For example, about 50 percent of the world’s people live on less than $3 per day, 75 percent on less than $8.50, and 90 percent on less than $23. One effect of this inequality is that the top 10 percent produce almost as much total carbon emissions as the bottom 90 percent combined." The study explains that increases in economic inequality, consumption per capita, and total population are all driving this rapid growth in human impact, but that the major scientific models of Earth-Human System interaction do not bidirectionally couple Earth System Models with the primary Human System drivers of change such as demographics, inequality, economic growth, and migration. Instead of two-way coupling with these primary human drivers of change, the researchers argue that current models usually use independent, external projections of those drivers. "This lack of two-way coupling makes current models likely to miss critical feedbacks in the combined Earth-Human system", said National Academy of Engineering member and co-author Eugenia Kalnay, a Distinguished University Professor of Atmospheric and Oceanic Science at the University of Maryland. "It would be like trying to predict El Niño with a sophisticated atmospheric model but with the Sea Surface Temperatures taken from external, independent projections by, for example, the United Nations. Without including the real feedbacks, predictions for coupled systems cannot work; the model will get away from reality very quickly," said Kalnay In this new scientific research, the authors present extensive evidence of the need for a new paradigm of modeling that incorporates the feedbacks that the Earth System has on humans, and propose a framework for future modeling that would serve as a more realistic guide for policymaking and sustainable development. "Ignoring this bidirectional coupling of the Earth and Human Systems can lead to missing something important, even decisive, for the fate of our planet and our species," said co-author Mark Cane, G. Unger Vetlesen Professor of Earth and Climate Sciences at Columbia University’s Lamont-Doherty Earth Observatory, who recently won the Vetlesen Prize for creating the first coupled ocean–atmosphere model with feedbacks that successfully predicted El Niño. "The result of not dynamically modeling these critical Human-Earth System feedbacks would be that the environmental challenges humanity faces may be significantly underestimated. Moreover, there’s no explicit role given to policies and investments to actively shape the course in which the dynamics unfold. Rather, as the models are designed now, any intervention — almost by definition — comes from the outside and is perceived as a cost," said co-author Matthias Ruth, Director and Professor at the School of Public Policy and Urban Affairs, Northeastern University. "Such modeling, and the mindset that goes with it, leaves no room for creativity in solving some of the most pressing challenges." ''The paper correctly highlights that other human stressors, not only the climate ones, are very important for long-term sustainability, including the need to reduce inequality'', said Carlos Nobre (not a co-author), one of the world’s leading Earth System scientists, who recently won the prestigious Volvo Environment Prize in Sustainability for his role in understanding and protecting the Amazon. ''Social and economic equality empowers societies to engage in sustainable pathways, which includes, by the way, not only the sustainable use of natural resources but also slowing down population growth, to actively diminish the human footprint on the environment.'' Michael Mann, Distinguished Professor and Director of the Earth System Science Center at Penn State University, who is not a co-author of the paper, commented: "We cannot separate the issues of population growth, resource consumption, the burning of fossil fuels, and climate risk. They are part of a coupled dynamical system, and, as the authors show, this has dire potential consequences for societal collapse. The implications couldn’t be more profound." This work was supported by the University of Maryland Council on the Environment 2014 Seed Grant (1357928). The authors would like to acknowledge the following grants and institutions: SM, KF, and KH: National Socio-Environmental Synthesis Center (SESYNC)--US National Science Foundation (NSF) award DBI-1052875; JR: The Institute of Global Environment and Society (IGES); GRA: Laboratory Directed Research and Development award by the Pacific Northwest National Laboratory, which is managed by the Battelle Memorial Institute for the US Department of Energy; MAC: Office of Naval Research, research grant MURI N00014-12-1-0911; FMW: NSF award CBET-1541642; VMY: The Institute for New Economic Thinking (INET). "Modeling Sustainability: Population, Inequality, Consumption, and Bidirectional Coupling of the Earth and Human Systems" is available at: https://academic.oup.com/nsr/article/doi/10.1093/nsr/nww081/2669331/Modeling-Sustainability-Population-Inequality and https://doi.org/10.1093/nsr/nww081; or PDF https://academic.oup.com/nsr/article-pdf/3/4/470/10325470/nww081.pdf


News Article | December 27, 2016
Site: www.eurekalert.org

Using a mouse model, scientists from the RIKEN-Max Planck Joint Research Center for Systems Chemical Biology and a number of other institutes have identified a sugar molecule that reduced the inflammatory response and progress of emphysema, a common component of chronic obstructive pulmonary disease (COPD). According to Naoyuki Taniguchi, the leader of the group, this discovery could lead to the development of drugs based on glycans--biological sugar molecules--for the treatment of diseases such as COPD, which is the fourth leading cause of death worldwide. As part of the research group's work to explore the roles of sugar molecules in health and disease, they found that keratan sulfate, a large negatively charged saccharide found in the small airway of the lung, is decreased in mice that have been exposed to cigarette smoke. They wondered if this decrease might be associated with the damage that smoking causes to the lung. Taniguchi says, "We are not absolutely sure of the mechanism through which smoking leads to a reduction in keratan sulfate, but felt that clearly the reduction is important in thinking about glycan-based strategies for combating emphysema and COPD." They wondered whether the keratan sulfate might be playing a protective role in COPD. To test the hypothesis, they prepared a repeating disaccharide element of keratan sulfate, named L4, and administered it into two mouse models of emphysema--one a model of emphysema triggered by the enzyme elastase, and the other an exacerbation of smoking-induced emphysema triggered by LPS, a toxin found in bacterial cell walls. In the first model, they found that that treatment with L4 prevented destruction of the alveoli--the small air sacs in lungs that are used to exchange gases, and in addition that it reduced the infiltration of a type of white blood cell called neutrophils, which is symptomatic of an inflammatory response, as well as levels of inflammatory cytokines and tissue-degrading enzymes. Although L4 was shown to inhibit these enzymes, they did not find any ability of L4 to directly reduce the production of cytokines or reactive oxygen species, so concluded that the action was also being done indirectly, through mechanisms involving the neutrophils. In the exacerbation model, they found that the L4 administration prevented the influx of neutrophils. According to Taniguchi, "We found that L4 was as effective as dexamethasone in reducing neutrophil infiltration. This is very exciting, because dexamethasone, the treatment currently used for COPD, is a steroid medication that can have serious side effects and can in some cases make the outcome worse. It will be exciting if we can show that L4--a sugar molecule which we found had no adverse effects in the mice even at high doses--can be used as a treatment for this condition, which exerts a tremendous health burden." According to Taniguchi, there is still work to be done in the area. "We plan now to try to determine exactly how L4 blocks neutrophil migration, by finding a target receptor protein, and how L4 can suppress inflammation in vivo, as this could give us important insights into the mechanism of COPD progression and how it can be halted." The work was published in the American Journal of Physiology, Lung Cellular and Molecular Physiology.


News Article | August 22, 2016
Site: news.mit.edu

Just as magnetic materials have opposing North and South poles, ferroelectric materials have opposing positive charges and negative charges that exhibit measurable differences in electric potential. Researchers at MIT and colleagues in China recently demonstrated this ferroelectric behavior along the edges of atomically thin tin-tellurium film at room temperature. Measurements showed the energy gap, or bandgap, of this ultra-thin (2-D) film to be about eight times higher than the bandgap in bulk (3-D) tin-tellurium, with an on/off ratio as high as 3,000, they report July 15 in the journal Science. Their findings hold promise for making random access memory (RAM) devices from this special semiconductor material, which is known as a topological crystalline insulator. “This discovery is very exciting because usually when you decrease the thickness from the 3-D to 2-D, the phase transition temperature always decreases and therefore could destroy the ferroelectricity. But in this case, the [ferroelectric] phase transition temperature increased. It’s quite unusual,” explains MIT postdoc Junwei Liu, a first author of the paper. “As far as we know, this might be the first time to observe this very unusual property.” MIT assistant professor of physics Liang Fu is one of the paper’s senior authors. These results follow three years of work based on a prediction by Fu, former student Timothy Hsieh PhD ’15, postdoc Liu (who was then a graduate student at Tsinghua University), and collaborators, that ferroelectric structural distortion in tin-tellurium and similar topological crystalline insulators, would open a tunable bandgap on the surface. Hsieh is now a postdoc at University of California at Santa Barbara. Researchers in the U.S. and Europe, including Vidya Madhavan and Ilija Zeljkovic at Boston College, confirmed this prediction experimentally in bulk materials. “The importance of ferroelectricity in topological crystalline insulators led us to study thin films of tin telluride,” Fu says. Tin-tellurium, which is also known as tin telluride, is classified as a IV-VI semiconductor, because tin (Sn) is from Group IV on the periodic table and tellurium (Te) from Group VI-A. At extremely cold temperatures, below about -283 degrees Fahrenheit, bulk tin-tellurium is a ferroelectric material, which means it becomes polarized with positive and negative electric charges splitting into opposing alignments, but it is not practical for room temperature applications. Liu, whose work involves theoretical calculations, says in 2013 MIT researchers partnered with experimentalists at Tsinghua University in China to explore ferroelectricity in thin films of the tin-tellurium material. Kai Chang of Tsinghua University in China conducted experiments and is a first author of the Science paper. The paper’s co-authors also include a dozen colleagues at Tsinghua and Renmin Universities and other research facilities in China, and RIKEN Center for Emergent Matter Science in Japan. A unit cell is the smallest repeating pattern of atoms in the tin-tellurium molecular structure. Built on a base of graphene and silicon carbide, the tin-tellurium layers in the experiments ranged in size from 1 to 8 unit cells. In an actual device, the tin-tellurium would be capped with insulating material, as seen in the illustration in the slideshow above. The new study shows this ferroelectric state persists up to only about 26 F in the single-unit cell thin film tin-tellurium material, but in 2-, 3- and 4-unit cells, the ferroelectric state was robust to 300 kelvins, or 80 F, the highest temperature the experimental apparatus could measure. “Room-temperature devices could have a very large commercial application. That’s why we are very excited about this work; it’s really robust even in room temperature,” Liu says. Tests showed that memory could be written through a top gate voltage, which “flips” the in-plane polarization of the ferroelectric film, and read by a voltage tunneling through an edge without erasing the memory state. Evidence of this behavior in a sample that was a mere 16-nanometers in width means that tin-tellurium memory cells could be densely packed. Nanosensors and electronics are also possible. Advantages of ferroelectric memory include lower-power consumption, fast write operations, and durable storage, Liu says. The MIT-Tsinghua results show the separation of positive and negative charges, or polarization, in their sample was in-plane, or parallel, with the atomically flat sample, creating a potential change on the edges of square-shaped islands of the material. Since this potential difference along edges is measurably different, one with large tunneling current, the other small, it can realize two different states that represent either a zero or a one, and these states can be detected simply by measuring the current. “Based on this property, we proposed a new kind of random access memory. We call it ferroelectric tunneling random access memory,” says Liu, who proposed the initial architecture for this kind of memory, along with Fu and three coauthors at Tsinghua University: Kai Chang, Xi Chen, and Shuai-Hua Ji. MIT has filed for provisional patent protection and is in the process of filing a utility covering the findings regarding in-plane polarization and tunneling current. “It’s very simple, and it’s really practical, and I think it could be realized in the near future,” Liu says. Previous conventional capacitive ferroelectric random access memory technologies had to destroy a state to read it, Liu says, which meant an extra step of rewriting the information stored in memory after reading it. “In our case, we read the signal without destroying it,” Liu says. “This is the intrinsic advantage of our approach. … Therefore it can have much higher read operation performance.” “In our experiments, we found that ferroelectricity persists for the very small islands, as small as 25 nanometers by 25 nanometers by 0.5 nanometers; even in these very small islands, the ferroelectricity persists. We could achieve much higher storage density because it is really small,” he explains. “The authors and their collaborators use a state-of-the-art combination of molecular beam epitaxy and scanning tunneling microscopy to demonstrate a completely unexpected enhancement of ferroelectricity in ultrathin films of [tin-tellurium],” comments Ilija Zeljkovic, an assistant professor of physics at Boston College, who was not involved in this research. “This discovery can potentially be employed in nanodevices, such as the ferroelectric RAM nanodevice the authors describe [in Figure 4 of the Science report].” Although the 3-D bulk form of tin-tellurium has been studied for decades, the new results in ultrathin 2-D film of the same material exhibit this surprising new phenomenon, Zeljkovic notes. “The study itself is extremely thorough, and the data presented is of the highest quality in spite of the high difficulty of the experiment performed. The study also highlights the recent effort in the condensed matter physics community to search for novel interface phenomena in ultrathin films of existing materials, for example, graphite versus graphene.” Mathematical calculations known as density functional theory matched the experimental findings that there are 1/20 to 1/30 as many tin vacancies in the atomically thin tin-tellurium film than in the bulk form of the material. This lack of defects is believed to contribute to formation of the ferroelectric state. The next step will be to show these results in actual devices. Future challenges include how to easily and inexpensively produce high quality tin-tellurium thin films and how to precisely control the polarization direction. The research was supported by the U.S. Department of Energy, the STC Center for Integrated Quantum Materials, the National Natural& Science Foundation, and Ministry of Science and Technology of China.


News Article | December 22, 2016
Site: www.eurekalert.org

A member of the Lomonosov Moscow State University together with his colleagues, using new interaction between neutrons, have theoretically justified the low-energy tertaneutron resonance obtained recently experimentally. This proves the existence for a very short period of time of a particle consisting of four neutrons. According to the supercomputer simulations, the tetraneutron lifetime is 5×10-22 sec. The research results are published in a top-ranked journal Physical Review Letters. A team, consisting of Russian, German and American scientists, and among them Andrey Shirokov, Senior Researcher at the Skobeltsyn Institute of Nuclear Physics, has calculated the energy of the resonant tetraneutron state. Their theoretical computations, based on a new approach and new interaction between neutrons, correlate with the results of the experiment in which the tetraneutron has been produced. A neutron lives about 15 min before it decays producing a proton, electron and antineutrino. There is also another known stable system consisting of a huge number of neutrons - a neutron star. Scientists have aimed to find out whether there are other systems, even short-lived, composed purely of neutrons. A system made up of two neutrons doesn't form even a short-lived state. Due to multi-year experimental and fundamental researches, scientists conclude that there are no such states in a system made up of three neutrons. Searches for a tetraneutron, a cluster of four neutrons, have been conducted for more than 50 years. These searches were fruitless until 2002 when a group of French researchers in an experiment at the Large Heavy Ion National Accelerator (Grand accélérateur national d'ions lourds - GANIL) in Caen has found 6 events which could be interpreted as the tetraneutron production. However, the reproduction of this experiment failed, and some scientists suppose that at least a part of the original data analysis was incorrect. A new phase of the tetraneutron searches takes place at the Radioactive Ion Beam Factoryin the RIKEN Institute, Japan, where a high-quality beam of 8He nuclei is available. The 8He nucleus consists of an α-particle (the 4He nuclei) and four neutrons. A few research teams from different countries have proposed the tetraneutron searches in RIKEN. In the first of these experimental searches, the 8He nuclei were bombarding the 4He target. As a result of the collision, the α-particle was knocked out from 8He leaving the system of 4 neutrons. Four events interpreted as the short-lived tetraneutron resonant statehave been detected. This experiment of the Japanese group has been published at the beginning of this year, and it will be continued. The scientist from Lomonosov Moscow State University and his collaborators have published in their article theoretical evaluations of the tetraneutron resonant state energy and its lifetime. They have contributed to the preparation of one of the proposed experimental searches for the tetraneutron when a group of experimentalists from Germany asked for the assistance. Andrey Shirokov, the first author of the article, says: "Such evaluations were made by us in different models, and the obtained results were used to support the experiment application. Afterwards, we thoroughly elaborated thetheoretical approach and performed numerous simulations on supercomputers. The results have been published in our paper in Physical Review Letters". The theoretical results for the energy of tetraneutron resonance of 0.84 MeV correlate well with the Japanese experimental findingof 0.83 MeV which is however characterized by a large uncertainty (about ±2 MeV). The calculated width of the resonant tetraneutron state is 1.4 MeV which corresponds to the lifetime of about 5×10-22 sec. Andey Shirokov continues: "It's worth noting that none of theoretical papers up to now has predicted the existence of the resonant tetraneutron state at such low energies of about 1 MeV". The new theoretical result probably stems from a new theoretical approach to the studies of resonant states in nuclear systems developed by the scientists. This approach has been carefully tested on model problems and in less complicated systems and only afterwards applied to the tetraneutron studies accounting for the specifics of the four-particle decay of this system. Andrey Shirokov however indicates an alternative possibility: "Another possible reason is the fact that we've used a new interaction between neutrons elaborated by our team. Our tetraneutron studies will be continued, we'll perform simulations with other more traditional interactions. At the same time, our French colleagues are going to study thetetraneutron with our interaction within their approach. Of course, all of us are looking forward for the results of new experimental tetraneutron searches". The research has been conducted by a large international team of theorists with Russia been represented by scientists not only from the Lomonosov Moscow State University, but also from the Pacific National University (Khabarovsk). This team includes also collaborators from USA and Germany. Researchers from South Korea are joining the group for future studies. The Russian side has been at the forefront of this research leading the elaboration of the theoretical approach to the resonant states and the design of the new interaction between particles in atomic nuclei.


News Article | February 15, 2017
Site: www.nature.com

Stem-cell trial Japan is resuming pioneering clinical research using induced pluripotent stem (iPS) cells. A team led by Masayo Takahashi at the RIKEN Center for Developmental Biology in Kobe will make suspensions of iPS cells derived from retinal cells, and transplant them into people with age-related macular degeneration, an eye condition that can cause blindness. Takahashi started a similar study in 2014 — the first to use iPS cells in humans — but the cells prepared for the second patient were found to have genetic abnormalities and no other participants were recruited. On 1 February, Japan’s health ministry approved a new five-patient study. This time the team will use banked iPS cells created from anonymous, healthy donor cells rather than from the participants themselves. Martian polar ice cap sculpted by wind A seasonal layer of carbon dioxide frost coats Mars’s northern polar ice cap in this image, which was released on 2 February by the European Space Agency (ESA). Each winter, carbon dioxide precipitates out of the cold atmosphere and onto the ice cap. The image is a composite of pictures taken between 2004 and 2010 by ESA’s Mars Express spacecraft. The distinctive spiral troughs were probably carved by wind. Radar investigation by Mars Express and NASA’s Mars Reconnaissance Orbiter revealed that the ice cap consists of many layers of ice and dust extending to a depth of about 2 kilometres. GM wheat trial A UK research laboratory has been granted permission to begin field trials of a wheat plant that has been genetically modified (GM) to improve photosynthesis. Scientists at Rothamsted Research in Harpenden have already shown that wheat plants modified with a gene from stiff brome grass (Brachypodium distachyon) are more efficient at photosynthesis in greenhouses than conventional wheat, and they now hope to see improved yields from plants grown outside in more realistic conditions. In 2012, GM trials at Rothamsted attracted small but high-profile protests. The lab’s researchers have been among the leading advocates of such trials in Europe. Swedish stimulus The Swedish government unveiled plans on 2 February to make the country carbon neutral in less than two decades. A law expected to pass through parliament in March would set a binding target of reducing domestic greenhouse-gas emissions from industry and transport by 85% by 2045, relative to 1990 levels. Remaining emissions would be offset by natural carbon capture through forestation and by investment abroad. On announcing the move, Sweden’s environment minister, Isabella Lövin, said that her country wants to set an example at a time when climate action in the United States is threatening to lose momentum. Romanian protests Angry Romanian scientists have called on their new government to reverse its order for national science-advisory bodies to immediately stop their work, pending reorganization. The government made the order on 31 January, when it also issued a decree giving amnesty to some officials accused of corruption; this was later withdrawn after mass protests. An open letter signed by nearly 600 academics and their supporters says that the councils, which are non-political, should be immune to government change. Signatories fear that the proposed reorganization may allow amnesty for politicians who have committed scientific misconduct. UK science czar The UK government’s chief scientific adviser has been appointed to possibly the biggest science job in the country. The government announced on 2 February that Mark Walport will take the helm of a new body called UK Research and Innovation (UKRI), which is expected to oversee a pot of more than £6 billion (US$7.5 billion) in government science spending when it comes into being in 2018. Walport’s appointment is significant because there are fears that UKRI could reduce the freedom of the nine individual bodies that currently allocate much government science funding. Researcher on trial An Iranian researcher in disaster medicine, who is accused of collaboration with a “hostile government”, has been threatened with the death sentence by a judge on Iran’s revolutionary court, according to close contacts of the scientist. Ahmadreza Djalali, who had been affiliated with research institutes in Italy, Sweden and Belgium, was arrested in April 2016 during an academic visit to Iran. According to sources close to Djalali, he has been kept in solitary confinement for three months in a Tehran prison and was forced to sign a confession. Djalali’s trial is scheduled to start later this month. Ice station The British Antarctic Survey (BAS) announced on 2 February that it had completed moving its Halley VI research station 23 kilometres across the floating ice platform on which it rests. The 13-week operation, which used tractors to tow the station’s 8 modules (pictured), was prompted by fears about a growing crack in the Brunt ice shelf. Staff were evacuated last month for the coming Antarctic winter after another unpredictable crack in the ice was discovered. The base, which is designed to be relocated periodically, is ready for re-occupation in November, the BAS said. Borehole record The Iceland Deep Drilling Project completed the deepest-ever geothermal well on 25 January. After 168 days of drilling, the well bottomed out at 4,659 metres, just shy of its 5-kilometre goal. But temperatures and pressures were so high at the bottom of the well that fluids were observed behaving in a ‘supercritical’ fashion — as neither liquid nor gas — an observation that was one of the project’s goals. The well, on Iceland’s volcanic Reykjanes peninsula, is being used to explore the source of geothermal systems and to see whether supercritical fluids can be tapped as an energy resource. India’s budget Health research, biotechnology and space science are the main beneficiaries of robust budget increases announced by the Indian government on 1 February. Overall, science spending in 2017 by eight ministries (excluding nuclear and defence research) will increase by 11% — well above the projected 5% inflation rate — to 360 billion rupees (US$5.3 billion). Health research, including the fight against diseases such as leprosy and measles, will get 31% more government funding. Biotechnology will get an extra 22%, and India’s aspirations in space, including plans to land a rover on the Moon in 2018, will benefit from a 21% budget increase for space science. Dual tribute The CRISPR gene-editing system, which has transformed biological research and biomedicine, drew yet more major prizes last week. On 31 January, the Madrid-based BBVA Foundation announced that its €400,000 (US$427,000) Frontiers of Knowledge Award in Biomedicine would be shared by Francisco Mojica, Emmanuelle Charpentier and Jennifer Doudna. Mojica discovered the CRISPR repeating DNA sequences that some bacteria use to fight viral infections. Charpentier and Doudna developed the universal CRISPR editing tool — for which they have also won the ¥50-million (US$445,000) Japan Prize, announced on 2 February. They share it with cryptographer Adi Shamir. Women, non-Asian ethnic minorities and disabled people are under-represented in science and engineering in the United States, according to the National Center for Science and Engineering Statistics (NCSES). Women receive about half of all science and engineering degrees but hold less than 30% of jobs in these areas. White men, who in 2015 comprised only 31% of the US population, held nearly half of these jobs. Although female and minority representation has risen, disparities remain. 11–15 February Biophysicists gather in New Orleans, Louisiana, for the Biophysical Society’s 61st annual meeting. go.nature.com/2jtfz17 12–16 February At an international meeting in Queenstown, New Zealand, scientists discuss the latest research in advanced materials and nanotechnology. confer.co.nz/amn8 15 February India’s Polar Satellite Launch Vehicle launches a high-resolution Earth-observation satellite from the Satish Dhawan Space Center in Sriharikota. go.nature.com/2jteerk


News Article | December 8, 2016
Site: www.eurekalert.org

Jülich, 8 December 2016. An international team of scientists has succeeded in making further improvements to the lifetime of superconducting quantum circuits. An important prerequisite for the realization of high-performance quantum computers is that the stored data should remain intact for as long as possible. The researchers, including Jülich physicist Dr. Gianluigi Catelani, have developed and tested a technique that removes unpaired electrons from the circuits. These are known to shorten the qubit lifetime (to be published online by the journal Science today, DOI: 10.1126/science.aah5844). Quantum computers could one day achieve significantly higher computing speeds than conventional digital computers in performing certain types of tasks. Superconducting circuits belong to the most promising candidates for implementing quantum bits, known as qubits, with which quantum computers can store and process information. The high error rates associated with previously available qubits have up to now limited the size and efficiency of quantum computers. Dr. Gianluigi Catelani of the Peter Grünberg Institute (PGI-2) in Jülich, together with his colleagues has now found a way to prolong the time in which the superconducting circuits are able to store a "0" or a "1" without errors. Beside Catelani, the team comprises researchers working in the USA (Massachusetts Institute of Technology, Lincoln Laboratory, and the University of California, Berkeley), Japan (RIKEN), and Sweden (Chalmers University of Technology). When superconducting materials are cooled below a material-specific critical temperature, electrons come together to form pairs; then current can flow without resistance. However, so far it has not been possible to build superconducting circuits in which all electrons bundle together. Single electrons remain unpaired and are unable to flow without resistance. Due to these so-called quasiparticles, energy is lost and this limits the length of time that the circuits can store data. Researchers have now developed and tested a technique that can temporarily remove unpaired electrons away from the circuit; with the help of microwave pulses, they are in effect "pumped out". This results in a three-fold improvement in the lifespan of the qubits. "The technique can in principle be put to immediate use for all superconducting qubits", explained Catelani, who, as a theoretical physicist has contributed to the analysis and interpretation of the experimental data. However, he emphasised that the lifespan of qubits is only one of many hurdles in the development of complex quantum computers. Moreover, the new technique means that the quasiparticles are not permanently removed, but flow back again and again. The scientists have another solution ready to solve this problem: the pumping technique can be combined with another method that permanently traps the quasiparticles. Catelani, together with his colleagues from Jülich and Yale, has already analysed and tested such a quasiparticle "trap". Their results were published in September in the journal Physical Review B (DOI: 10.1103/PhysRevB.94.104516). Suppressing relaxation in superconducting qubits by quasiparticle pumping; Simon Gustavsson et al.; Science (to be published online on 8. Dec. 2016), DOI: 10.1126/science.aah5844 (available from 8:00 pm CET). Illustration of the filtering of unwanted quasiparticles (red spheres) from a stream of superconducting electron pairs (blue spheres) using a microwave-driven pump. Copyright: Philip Krantz, Krantz NanoArt


News Article | December 22, 2016
Site: www.eurekalert.org

A new study from the laboratory of Hiroki Ueda at the RIKEN Quantitative Biology Center investigates circadian timekeeping with a novel approach to creating genetic knock-out rescue mice. Published in Molecular Cell, the study shows how this technique was used to quickly create numerous mouse lines, each with different mutations in a circadian regulator called CRY1. Studying each mutation and the effects on behavior showed that specific changes to the protein affected the duration of the circadian period. Circadian rhythms are physiological changes at the cellular levels in almost all plants and animals that follow a 24-hour cycle. They are guided by internal biological clocks, and are affected by many internal genetics factors, which in turn can influence behavior. Next-generation mammalian genetics is a specialty of Ueda and his team. Recently, they succeeded in efficiently creating gene knockout (KO) mice without backcrossing or breeding. Until now however, the inverse procedures called knock-in (KI) and KO-rescue have been laborious, time-consuming, and costly. Ueda and his team have now developed a method for efficiency producing KI and KO-rescue that involves using three-inhibitor (3i) treatment of mouse embryonic stem cells. With this procedure, they can begin with KO embryonic stem cells, insert rescue genes, and then analyze the behavior of the mouse when it matures--all within a single generation. The group used this new KO-rescue technique to better understand cryptochromes--proteins associated with physiological functions that are controlled by environmental light. While cryptochromes are related to circadian rhythms in both plants and animals, their exact physiological roles appear quite different. In mammals, cryptochrome gene CRY1 is essential for a normal circadian rhythm, but its exact role in regulating the length of circadian periods remains unclear. Guided by mass spectrometry-based identification of certain sites at CRY1, and comprehensive analysis of all CRY1 mutants at each site, Ueda and his team identified more than ten areas in the gene that affect the period of the circadian clock in cultured cells. Ueda and his team selected 17 CRY1 mutations, and added each mutant CRY1 into different mouse embryonic stem cells that lacked all cryptochrome genes. When the mice grew up, they then analyzed their activity patterns. "Mice without these genes lack a circadian rhythm," explains first author Koji Ode. "By adding the Cry1 gene back in these mice, we were able to rescue the circadian rhythm. Most interestingly, the lengths of the restored circadian periods depended on nature of the mutations." The most effective versions of the Cry1 genes to be knocked-in had a mutation near the p-loop, which codes for a pocket-like area on the protein that can be modified through a process called phosphorylation--the attachment of phosphate groups. The KO-rescue mice with mutations that limited the amount of phosphorylation around the CRY1 p-loop had longer than normal circadian periods. "This p-loop is critical for CRY1 to function as a circadian clock" says Ueda. "We think that the accumulation of phosphorylation at this site serves as a time-keeping mechanism and thus the quality of the p-loop is a fundamental element that regulates circadian rhythm. Our next challenge is to actually observe changes in phosphorylation level on the p-loop over the course of a day."


Thao N.P.,Vietnam National University, Hanoi | Tran L.-S.P.,RIKEN
Critical Reviews in Biotechnology | Year: 2012

Soybean (Glycine max) is one of the most important crops in legume family. Soybean and soybean-based products are also considered as popular food for human and animal husbandry. With its high oil content, soybean has become a potential resource for the production of renewable fuel. However, soybean is considered one of the most drought-sensitive crops, with approximately 40% reduction of the yield in the worst years. Recent research progresses in elucidation of biochemical, morphological and physiological responses as well as molecular mechanisms of plant adaptation to drought stress in model plants have provided a solid foundation for translational genomics of soybean toward drought tolerance. In this review, we will summarize the recent advances in development of drought-tolerant soybean cultivars by gene transfer. © 2012 Informa Healthcare USA, Inc.


Nagaosa N.,University of Tokyo | Nagaosa N.,RIKEN | Sinova J.,Texas A&M University | Sinova J.,ASCR Institute of Physics Prague | And 3 more authors.
Reviews of Modern Physics | Year: 2010

The anomalous Hall effect (AHE) occurs in solids with broken time-reversal symmetry, typically in a ferromagnetic phase, as a consequence of spin-orbit coupling. Experimental and theoretical studies of the AHE are reviewed, focusing on recent developments that have provided a more complete framework for understanding this subtle phenomenon and have, in many instances, replaced controversy by clarity. Synergy between experimental and theoretical works, both playing a crucial role, has been at the heart of these advances. On the theoretical front, the adoption of the Berry-phase concepts has established a link between the AHE and the topological nature of the Hall currents. On the experimental front, new experimental studies of the AHE in transition metals, transition-metal oxides, spinels, pyrochlores, and metallic dilute magnetic semiconductors have established systematic trends. These two developments, in concert with first-principles electronic structure calculations, strongly favor the dominance of an intrinsic Berry-phase-related AHE mechanism in metallic ferromagnets with moderate conductivity. The intrinsic AHE can be expressed in terms of the Berry-phase curvatures and it is therefore an intrinsic quantum-mechanical property of a perfect crystal. An extrinsic mechanism, skew scattering from disorder, tends to dominate the AHE in highly conductive ferromagnets. The full modern semiclassical treatment of the AHE is reviewed which incorporates an anomalous contribution to wave-packet group velocity due to momentum-space Berry curvatures and correctly combines the roles of intrinsic and extrinsic (skew-scattering and side-jump) scattering-related mechanisms. In addition, more rigorous quantum-mechanical treatments based on the Kubo and Keldysh formalisms are reviewed, taking into account multiband effects, and demonstrate the equivalence of all three linear response theories in the metallic regime. Building on results from recent experiment and theory, a tentative global view of the AHE is proposed which summarizes the roles played by intrinsic and extrinsic contributions in the disorder strength versus temperature plane. Finally outstanding issues and avenues for future investigation are discussed. © 2010 The American Physical Society.


Xiang Z.-L.,RIKEN | Xiang Z.-L.,Fudan University | Ashhab S.,RIKEN | Ashhab S.,University of Michigan | And 5 more authors.
Reviews of Modern Physics | Year: 2013

Hybrid quantum circuits combine two or more physical systems, with the goal of harnessing the advantages and strengths of the different systems in order to better explore new phenomena and potentially bring about novel quantum technologies. This article presents a brief overview of the progress achieved so far in the field of hybrid circuits involving atoms, spins, and solid-state devices (including superconducting and nanomechanical systems). How these circuits combine elements from atomic physics, quantum optics, condensed matter physics, and nanoscience is discussed, and different possible approaches for integrating various systems into a single circuit are presented. In particular, hybrid quantum circuits can be fabricated on a chip, facilitating their future scalability, which is crucial for building future quantum technologies, including quantum detectors, simulators, and computers. © 2013 American Physical Society.


Suzuki N.,Sophia University | Hashizume D.,RIKEN
Coordination Chemistry Reviews | Year: 2010

In this account [3]- and [5]cumulene complexes of group 4 metallocenes that form five-membered metallacycles are described. These complexes have a "triple bond" despite their five-membered ring structure, showing that they are regarded as 1-metallacyclopent-3-ynes. The molecular structures show their strained alkyne character. These complexes react with transition metals to form alkyne-coordinated bimetallic complexes. They also receive electrophilic attack by protons and boranes resulting in M-C bond cleavage. When a [3]cumulene couples with an alkyne on the metal, the reaction produces seven-membered metallacycloalkynes that have a strained structure showing an interaction between the "triple bond" and the metal center. Hexapentaenes, [5]cumulenes, form conjugated 1-metallacyclopent-3-ynes. The aryl-substituted [5]cumulene complex was reduced by alkali metal to give dianionic species that reacted with protons to give 1-metallacyclopent-3-ene, a cycloalkene, and with iodomethane to give 1-metallacyclopenta-2,3-diene, a cycloallene. The hexapentaene with tert-butyl groups reacts with zirconocene to form an η2-π-coordinated complex in the presence of trimethylphosphine, although it gave a 1-metallacyclopent-3-yne in the absence of the phosphine. The former was transformed into the latter by addition of a phosphine, and vice versa by removing the phosphine, showing a "haptotropic" shift. © 2009 Elsevier B.V. All rights reserved.


A novel biomarker for use in lung cancer diagnosis is provided.


Patent
MAYEKAWA Manufacturing CO. and Riken | Date: 2011-10-07

Disease resistance is conferred to a plant by a technique completely differing from conventional techniques. The method of the present invention comprises a step of introducing at least one of the genes belonging to the TIFY family to a plant or enhancing the expression of the gene endogenous to the plant.


Patent
Riken, Otsuka Pharmaceutical Factory Inc. and Hayashi Kasei Co. | Date: 2010-01-13

The present invention relates to a single-chain circular RNA having a sustained or slow-releasing RNA interference effect, characterized in that the single-chain circular RNA comprises a sense strand sequence, an antisense strand sequence complementary to the sense strand sequence, identical or different two loop sequences between the sense strand and the antisense strand, connecting both strands, wherein the sense strand and the antisense strand are paired to form a stem.


Patent
Shimadzu Corporation and Riken | Date: 2013-07-16

In order to provide an analysis method that is capable of determining a glycan structure with high detection sensitivity, a method of the present invention includes the steps of: carrying out triple quadrupole mass spectrometry at various values of CID energy; creating an energy-resolved profile including yield curves representing relationships between (i) a value of the CID energy and (ii) measured amounts of specific types of product ions; preparing a reference profile, and identifying a glycan structure of a test material by comparing the energy-resolved profile with the reference profile.


Patent
Shimadzu Corporation and Riken | Date: 2014-01-06

In order to provide an analysis method that is capable of determining a glycan structure with high detection sensitivity, a method of the present invention includes the steps of: carrying out triple quadrupole mass spectrometry at various values of CID energy; creating an energy-resolved profile including yield curves representing relationships between (i) a value of the CID energy and (ii) measured amounts of specific types of product ions; preparing a reference profile, and identifying a glycan structure of a test material by comparing the energy-resolved profile with the reference profile.


Caring Patient Robot is a kind intelligent robot with the sense of hearing, vision and smell. At the same time, it can lift, move and take care of the patients. Scope of the Report:  This report focuses on the Caring Patient Robot in Global market, especially in North America, Europe and Asia-Pacific, South America, Middle East and Africa. This report categorizes the market based on manufacturers, regions, type and application. Market Segment by Regions, regional analysis covers  North America (USA, Canada and Mexico)  Europe (Germany, France, UK, Russia and Italy)  Asia-Pacific (China, Japan, Korea, India and Southeast Asia)  South America, Middle East and Africa Market Segment by Applications, can be divided into  Hospital  Nursing Home  Other Global Caring Patient Robot Market by Manufacturers, Regions, Type and Application, Forecast to 2021 1 Market Overview  1.1 Caring Patient Robot Introduction  1.2 Market Analysis by Type  1.2.1 Patient Assist Robot  1.2.2 Nursing Support Robot  1.2.3  1.3 Market Analysis by Applications  1.3.1 Hospital  1.3.2 Nursing Home  1.3.3 Other  1.4 Market Analysis by Regions  1.4.1 North America (USA, Canada and Mexico)  1.4.1.1 USA  1.4.1.2 Canada  1.4.1.3 Mexico  1.4.2 Europe (Germany, France, UK, Russia and Italy)  1.4.2.1 Germany  1.4.2.2 France  1.4.2.3 UK  1.4.2.4 Russia  1.4.2.5 Italy  1.4.3 Asia-Pacific (China, Japan, Korea, India and Southeast Asia)  1.4.3.1 China  1.4.3.2 Japan  1.4.3.3 Korea  1.4.3.4 India  1.4.3.5 Southeast Asia  1.4.4 South America, Middle East and Africa  1.4.4.1 Brazil  1.4.4.2 Egypt  1.4.4.3 Saudi Arabia  1.4.4.4 South Africa  1.4.4.5 Nigeria  1.5 Market Dynamics  1.5.1 Market Opportunities  1.5.2 Market Risk  1.5.3 Market Driving Force 2 Manufacturers Profiles  2.1 RIKEN  2.1.1 Business Overview  2.1.2 Caring Patient Robot Type and Applications  2.1.2.1 Type 1  2.1.2.2 Type 2  2.1.3 RIKEN Caring Patient Robot Sales, Price, Revenue, Gross Margin and Market Share  2.2 TOYOTA  2.2.1 Business Overview  2.2.2 Caring Patient Robot Type and Applications  2.2.2.1 Type 1  2.2.2.2 Type 2  2.2.3 TOYOTA Caring Patient Robot Sales, Price, Revenue, Gross Margin and Market Share  2.3 Yaskawa  2.3.1 Business Overview  2.3.2 Caring Patient Robot Type and Applications  2.3.2.1 Type 1  2.3.2.2 Type 2  2.3.3 Yaskawa Caring Patient Robot Sales, Price, Revenue, Gross Margin and Market Share  2.4 Fraunhofer  2.4.1 Business Overview  2.4.2 Caring Patient Robot Type and Applications  2.4.2.1 Type 1  2.4.2.2 Type 2  2.4.3 Fraunhofer Caring Patient Robot Sales, Price, Revenue, Gross Margin and Market Share  2.5 iRobot  2.5.1 Business Overview  2.5.2 Caring Patient Robot Type and Applications  2.5.2.1 Type 1  2.5.2.2 Type 2  2.5.3 iRobot Caring Patient Robot Sales, Price, Revenue, Gross Margin and Market Share  2.6 Cyberoye  2.6.1 Business Overview  2.6.2 Caring Patient Robot Type and Applications  2.6.2.1 Type 1  2.6.2.2 Type 2 3 Global Caring Patient Robot Market Competition, by Manufacturer  3.1 Global Caring Patient Robot Sales and Market Share by Manufacturer  3.2 Global Caring Patient Robot Revenue and Market Share by Manufacturer  3.3 Market Concentration Rate  3.3.1 Top 3 Caring Patient Robot Manufacturer Market Share  3.3.2 Top 6 Caring Patient Robot Manufacturer Market Share  3.4 Market Competition Trend 4 Global Caring Patient Robot Market Analysis by Regions  4.1 Global Caring Patient Robot Sales, Revenue and Market Share by Regions  4.1.1 Global Caring Patient Robot Sales by Regions (2011-2016)  4.1.2 Global Caring Patient Robot Revenue by Regions (2011-2016)  4.2 North America Caring Patient Robot Sales and Growth (2011-2016)  4.3 Europe Caring Patient Robot Sales and Growth (2011-2016)  4.4 Asia-Pacific Caring Patient Robot Sales and Growth (2011-2016)  4.5 South America Caring Patient Robot Sales and Growth (2011-2016)  4.6 Middle East and Africa Caring Patient Robot Sales and Growth (2011-2016) 5 North America Caring Patient Robot by Countries  5.1 North America Caring Patient Robot Sales, Revenue and Market Share by Countries  5.1.1 North America Caring Patient Robot Sales by Countries (2011-2016)  5.1.2 North America Caring Patient Robot Revenue by Countries (2011-2016)  5.2 USA Caring Patient Robot Sales and Growth (2011-2016)  5.3 Canada Caring Patient Robot Sales and Growth (2011-2016)  5.4 Mexico Caring Patient Robot Sales and Growth (2011-2016) 6 Europe Caring Patient Robot by Countries  6.1 Europe Caring Patient Robot Sales, Revenue and Market Share by Countries  6.1.1 Europe Caring Patient Robot Sales by Countries (2011-2016)  6.1.2 Europe Caring Patient Robot Revenue by Countries (2011-2016)  6.2 Germany Caring Patient Robot Sales and Growth (2011-2016)  6.3 UK Caring Patient Robot Sales and Growth (2011-2016)  6.4 France Caring Patient Robot Sales and Growth (2011-2016)  6.5 Russia Caring Patient Robot Sales and Growth (2011-2016)  6.6 Italy Caring Patient Robot Sales and Growth (2011-2016)


Home > Press > Further improvement of qubit lifetime for quantum computers: New technique removes quasiparticles from superconducting quantum circuits Abstract: An international team of scientists has succeeded in making further improvements to the lifetime of superconducting quantum circuits. An important prerequisite for the realization of high-performance quantum computers is that the stored data should remain intact for as long as possible. The researchers, including Jülich physicist Dr. Gianluigi Catelani, have developed and tested a technique that removes unpaired electrons from the circuits. These are known to shorten the qubit lifetime (to be published online by the journal Science today, DOI: 10.1126/science.aah5844). Quantum computers could one day achieve significantly higher computing speeds than conventional digital computers in performing certain types of tasks. Superconducting circuits belong to the most promising candidates for implementing quantum bits, known as qubits, with which quantum computers can store and process information. The high error rates associated with previously available qubits have up to now limited the size and efficiency of quantum computers. Dr. Gianluigi Catelani of the Peter Grünberg Institute (PGI-2) in Jülich, together with his colleagues has now found a way to prolong the time in which the superconducting circuits are able to store a "0" or a "1" without errors. Beside Catelani, the team comprises researchers working in the USA (Massachusetts Institute of Technology, Lincoln Laboratory, and the University of California, Berkeley), Japan (RIKEN), and Sweden (Chalmers University of Technology). When superconducting materials are cooled below a material-specific critical temperature, electrons come together to form pairs; then current can flow without resistance. However, so far it has not been possible to build superconducting circuits in which all electrons bundle together. Single electrons remain unpaired and are unable to flow without resistance. Due to these so-called quasiparticles, energy is lost and this limits the length of time that the circuits can store data. Researchers have now developed and tested a technique that can temporarily remove unpaired electrons away from the circuit; with the help of microwave pulses, they are in effect "pumped out". This results in a three-fold improvement in the lifespan of the qubits. "The technique can in principle be put to immediate use for all superconducting qubits", explained Catelani, who, as a theoretical physicist has contributed to the analysis and interpretation of the experimental data. However, he emphasised that the lifespan of qubits is only one of many hurdles in the development of complex quantum computers. Moreover, the new technique means that the quasiparticles are not permanently removed, but flow back again and again. The scientists have another solution ready to solve this problem: the pumping technique can be combined with another method that permanently traps the quasiparticles. Catelani, together with his colleagues from Jülich and Yale, has already analysed and tested such a quasiparticle "trap". Their results were published in September in the journal Physical Review B (DOI: 10.1103/PhysRevB.94.104516). For more information, please click If you have a comment, please us. Issuers of news releases, not 7th Wave, Inc. or Nanotechnology Now, are solely responsible for the accuracy of the content.


News Article | November 4, 2016
Site: phys.org

Chinese licorice, which is closely related to the plant—Glycyrrhiza glabra—used for licorice candy, is an important component of Chinese traditional medicine. According to Kazuki Saito of CSRS, who led the team, "It is incorporated in approximately 70 percent of the 200 major formulations used in traditional Kampo medicine in Japan. Considering that 90 percent of Japanese physicians prescribe Kampo medicine in their practices, it is easy to see the importance of this plant." The team chose to examine the genome of Chinese licorice rather than other related species partly because it is known to contain the highest concentration of glycyrrhizin, a compound that is associated with the medical properties of the plant, which include anti-inflammatory, anti-cancer, anti-allergic, and anti-viral activities. To conduct the screening, they chose a strain of G. uralensis kept at the Takeda Garden for Medicinal Plant Conservation in Kyoto. Using a combination of long read and short read sequencing, and by comparing the genome to published sequences of other legume species, they predicted that the plant's genome coded just over 34,000 proteins, a number somewhat higher than the 20,000 in the human genome. They focused in particular on two genetic regions—one coding saponins, which are important plant compounds including glycyrrhizin, and the other producing isoflavonoids, which are also known as medicinal components. Through the research, the group demonstrated that there is a close conservation of genes between licorice and other related plants such as barrelclover (s species close to alfalfa) and chickpea, showing that legumes use a small number of genes to create "scaffolds" that allow for the production of an enormous diversity of compounds. Keiichi Mochida, the first author of the paper, says, "Chinese licorice is an important and heavily consumed medicinal plant, and we hope that our work will make it possible to carry out molecular breeding to create strains that will grow sustainably in Japan, and which produce large concentrations of useful compounds such as glycyrrhizin." According to Saito, "We very much hope that our draft genome sequence will facilitate the identification, isolation, and editing of useful genes to improve the agronomic and medicinal traits of licorice through molecular breeding. There remains much to learn about the immense diversity of plant metabolism, and this research will contribute to further progress in that direction." The group plans to do further work to examines differences between the genome of G. uralensis and other licorice species, to further deepen their understanding of the production of useful compounds. The work was carried out by RIKEN CSRS in collaboration with a group including Chiba University, Kochi University, and Osaka University. More information: Keiichi Mochida et al. Draft genome assembly and annotation of, a medicinal legume, The Plant Journal (2016). DOI: 10.1111/tpj.13385


News Article | November 4, 2016
Site: www.eurekalert.org

In research published in The Plant Journal, a group of scientists led by researchers from the RIKEN Center for Sustainable Resource Science in Japan have decoded the genome of Glycyrrhiza uralensis, or Chinese licorice, a plant that is important for its use in Chinese medicine and as a natural sweetener. Chinese licorice, which is closely related to the plant--Glycyrrhiza glabra--used for licorice candy, is an important component of Chinese traditional medicine. According to Kazuki Saito of CSRS, who led the team, "It is incorporated in approximately 70 percent of the 200 major formulations used in traditional Kampo medicine in Japan. Considering that 90 percent of Japanese physicians prescribe Kampo medicine in their practices, it is easy to see the importance of this plant." The team chose to examine the genome of Chinese licorice rather than other related species partly because it is known to contain the highest concentration of glycyrrhizin, a compound that is associated with the medical properties of the plant, which include anti-inflammatory, anti-cancer, anti-allergic, and anti-viral activities. To conduct the screening, they chose a strain of G. uralensis kept at the Takeda Garden for Medicinal Plant Conservation in Kyoto. Using a combination of long read and short read sequencing, and by comparing the genome to published sequences of other legume species, they predicted that the plant's genome coded just over 34,000 proteins, a number somewhat higher than the 20,000 in the human genome. They focused in particular on two genetic regions--one coding saponins, which are important plant compounds including glycyrrhizin, and the other producing isoflavonoids, which are also known as medicinal components. Through the research, the group demonstrated that there is a close conservation of genes between licorice and other related plants such as barrelclover (s species close to alfalfa) and chickpea, showing that legumes use a small number of genes to create "scaffolds" that allow for the production of an enormous diversity of compounds. Keiichi Mochida, the first author of the paper, says, "Chinese licorice is an important and heavily consumed medicinal plant, and we hope that our work will make it possible to carry out molecular breeding to create strains that will grow sustainably in Japan, and which produce large concentrations of useful compounds such as glycyrrhizin." According to Saito, "We very much hope that our draft genome sequence will facilitate the identification, isolation, and editing of useful genes to improve the agronomic and medicinal traits of licorice through molecular breeding. There remains much to learn about the immense diversity of plant metabolism, and this research will contribute to further progress in that direction." The group plans to do further work to examines differences between the genome of G. uralensis and other licorice species, to further deepen their understanding of the production of useful compounds. The work was carried out by RIKEN CSRS in collaboration with a group including Chiba University, Kochi University, and Osaka University.


News Article | December 8, 2016
Site: phys.org

Illustration of the filtering of unwanted quasiparticles (red spheres) from a stream of superconducting electron pairs (blue spheres) using a microwave-driven pump. Credit: Philip Krantz, Krantz NanoArt An international team of scientists has succeeded in making further improvements to the lifetime of superconducting quantum circuits. An important prerequisite for the realization of high-performance quantum computers is that the stored data should remain intact for as long as possible. The researchers, including Jülich physicist Dr. Gianluigi Catelani, have developed and tested a technique that removes unpaired electrons from the circuits. These are known to shorten the qubit lifetime. The study is published online by the journal Science today. Quantum computers could one day achieve significantly higher computing speeds than conventional digital computers in performing certain types of tasks. Superconducting circuits belong to the most promising candidates for implementing quantum bits, known as qubits, with which quantum computers can store and process information. The high error rates associated with previously available qubits have up to now limited the size and efficiency of quantum computers. Dr. Gianluigi Catelani of the Peter Grünberg Institute (PGI-2) in Jülich, together with his colleagues has now found a way to prolong the time in which the superconducting circuits are able to store a "0" or a "1" without errors. Beside Catelani, the team comprises researchers working in the USA (Massachusetts Institute of Technology, Lincoln Laboratory, and the University of California, Berkeley), Japan (RIKEN), and Sweden (Chalmers University of Technology). When superconducting materials are cooled below a material-specific critical temperature, electrons come together to form pairs; then current can flow without resistance. However, so far it has not been possible to build superconducting circuits in which all electrons bundle together. Single electrons remain unpaired and are unable to flow without resistance. Due to these so-called quasiparticles, energy is lost and this limits the length of time that the circuits can store data. Researchers have now developed and tested a technique that can temporarily remove unpaired electrons away from the circuit; with the help of microwave pulses, they are in effect "pumped out". This results in a three-fold improvement in the lifespan of the qubits. "The technique can in principle be put to immediate use for all superconducting qubits", explained Catelani, who, as a theoretical physicist has contributed to the analysis and interpretation of the experimental data. However, he emphasised that the lifespan of qubits is only one of many hurdles in the development of complex quantum computers. Moreover, the new technique means that the quasiparticles are not permanently removed, but flow back again and again. The scientists have another solution ready to solve this problem: the pumping technique can be combined with another method that permanently traps the quasiparticles. Catelani, together with his colleagues from Jülich and Yale, has already analysed and tested such a quasiparticle "trap". Their results were published in September in the journal Physical Review B (DOI: 10.1103/PhysRevB.94.104516). Explore further: New 3-D wiring technique brings scalable quantum computers closer to reality More information: "Suppressing relaxation in superconducting qubits by quasiparticle pumping" Science, science.sciencemag.org/lookup/doi/10.1126/science.aah5844


News Article | October 26, 2016
Site: www.eurekalert.org

OAK RIDGE, Tenn., Oct. 26, 2016--For many of us, the term "doubly magic" may evoke images of Penn & Teller. However, for nuclear physicists, it describes atomic nuclei that have greater stability than their neighbors thanks to having shells that are fully occupied by both protons and neutrons. Theoretical physicists at the Department of Energy's Oak Ridge National Laboratory recently used Titan, America's most powerful supercomputer, to compute the nuclear structure of nickel-78, consisting of 28 protons and 50 neutrons, and found that this neutron-rich nucleus is indeed doubly magic. The results, published in the journal Physical Review Letters, may improve understanding of the origin, organization and interactions of stable matter. "Using first-principle calculations run on Titan, we confirmed that a very exotic nucleus about which little is known, nickel-78, is doubly magic," said theoretical physicist Gaute Hagen, who performed the study with Gustav Jansen and Thomas Papenbrock. The DOE Office of Science supported the research. The term "doubly magic" is thought to have been coined by Eugene Wigner, former research and development director of the Manhattan Project-era facility that became ORNL. At magic numbers, which include 2, 8, 20, 28, 50, 82 and 126, either the protons or the neutrons fill complete shells of an atom's nucleus. The shells for protons and the shells for neutrons are independent of each other. If the number of protons and the number of neutrons are both magic, the nucleus is said to be "doubly magic." "The binding energy, or energy needed to remove either a proton or a neutron, is larger for doubly magic nuclei compared to their neighbors," Hagen explained. The nuclear chart shows that several doubly magic isotopes--atomic elements that chemically behave identically but physically differ in numbers of neutrons--exist near the "valley of stability," the region that comprises all stable and long-lived nuclei. Examples are helium-4, oxygen-16, calcium-40, calcium-48 and lead-208. Away from this valley is a frontier, called the "neutron drip line," at which no more neutrons can be added without loss of nuclear binding. "If you add another neutron to the nucleus, the nucleus just falls apart, or the neutron 'drips' out of the nucleus," Hagen said. "It defines the borders of the nuclear chart, which includes all nuclei that exist and are bound by the strong force." The ORNL team's work addresses such questions as: How many neutrons can be added to a nucleus before it falls apart? How many stable nuclei exist? How do lighter atomic nuclei capture neutrons to create heavier elements in stars? "With this heavy nucleus, we have 78 strongly interacting protons and neutrons as the fundamental degrees of freedom, and interactions between them that we try to describe," Hagen explained. "Solving this many-body quantum mechanical problem numerically is tremendously costly. You cannot solve it on a piece of paper. You need a supercomputer." To elucidate the underpinnings of nickel-78's magicity, the team members turned to the Titan Cray XK7 computing system at the Oak Ridge Leadership Computing Facility, a DOE Office of Science User Facility at ORNL. They ran the nuclear structure code NUCCOR (Nuclear Coupled Cluster at Oak Ridge) for approximately 5 million central processing unit hours, allocated through the Innovative and Novel Computational Impact on Theory and Experiment program, or INCITE. Through OLCF's Center for Accelerated Application Readiness, Hagen leads work to improve the algorithms used in NUCCOR to compute larger nuclei more efficiently on increasingly more powerful supercomputers. "This is the first realistic calculation of the structure of nickel-78 and its neighbors from first principles," said Hagen. A nucleus has many energy configurations. In their simulations, the ORNL physicists computed the first excited state in nickel-78 and a neighbor, nickel-80. Experimenters at RIKEN in Japan have recently measured this state, and it will be interesting to compare the ORNL theoretical prediction with those data. The ORNL calculation predicts this state in nickel-78 from a correlation with the precisely known similar state in calcium-48. It revealed "a signature of magicity" for nickel-78, Hagen said. "Our prediction says that you can add one or two neutrons to nickel-78, and the nucleus will still be bound. We predict the drip line extends beyond nickel-80," Hagen said. "This was also an important finding." Next, the scientists will explore heavier stable nuclei, such as tin-100 and its neighbors. Because tin-100 is located right at the proton drip line, adding another proton causes the nucleus to fall apart. "These are all interesting features of the nucleus that we can compute," Hagen said. The title of the Physical Review Letters paper is "Structure of 78Ni from First-Principles Computations." UT-Battelle manages ORNL for DOE's Office of Science. The single largest supporter of basic research in the physical sciences in the United States, the Office of Science is working to address some of the most pressing challenges of our time. For more information, please visit http://science. .


News Article | November 4, 2016
Site: www.sciencedaily.com

In research published in The Plant Journal, a group of scientists led by researchers from the RIKEN Center for Sustainable Resource Science in Japan have decoded the genome of Glycyrrhiza uralensis, or Chinese licorice, a plant that is important for its use in Chinese medicine and as a natural sweetener. Chinese licorice, which is closely related to the plant -- Glycyrrhiza glabra -- used for licorice candy, is an important component of Chinese traditional medicine. According to Kazuki Saito of CSRS, who led the team, "It is incorporated in approximately 70 percent of the 200 major formulations used in traditional Kampo medicine in Japan. Considering that 90 percent of Japanese physicians prescribe Kampo medicine in their practices, it is easy to see the importance of this plant." The team chose to examine the genome of Chinese licorice rather than other related species partly because it is known to contain the highest concentration of glycyrrhizin, a compound that is associated with the medical properties of the plant, which include anti-inflammatory, anti-cancer, anti-allergic, and anti-viral activities. To conduct the screening, they chose a strain of G. uralensis kept at the Takeda Garden for Medicinal Plant Conservation in Kyoto. Using a combination of long read and short read sequencing, and by comparing the genome to published sequences of other legume species, they predicted that the plant's genome coded just over 34,000 proteins, a number somewhat higher than the 20,000 in the human genome. They focused in particular on two genetic regions -- one coding saponins, which are important plant compounds including glycyrrhizin, and the other producing isoflavonoids, which are also known as medicinal components. Through the research, the group demonstrated that there is a close conservation of genes between licorice and other related plants such as barrelclover (s species close to alfalfa) and chickpea, showing that legumes use a small number of genes to create "scaffolds" that allow for the production of an enormous diversity of compounds. Keiichi Mochida, the first author of the paper, says, "Chinese licorice is an important and heavily consumed medicinal plant, and we hope that our work will make it possible to carry out molecular breeding to create strains that will grow sustainably in Japan, and which produce large concentrations of useful compounds such as glycyrrhizin." According to Saito, "We very much hope that our draft genome sequence will facilitate the identification, isolation, and editing of useful genes to improve the agronomic and medicinal traits of licorice through molecular breeding. There remains much to learn about the immense diversity of plant metabolism, and this research will contribute to further progress in that direction." The group plans to do further work to examines differences between the genome of G. uralensis and other licorice species, to further deepen their understanding of the production of useful compounds. The work was carried out by RIKEN CSRS in collaboration with a group including Chiba University, Kochi University, and Osaka University.


Saito K.,RIKEN | Saito K.,Chiba University
Current Opinion in Plant Biology | Year: 2013

Phytochemical genomics is a recently emerging field, which investigates the genomic basis of the synthesis and function of phytochemicals (plant metabolites), particularly based on advanced metabolomics. The chemical diversity of the model plant Arabidopsis thaliana is larger than previously expected, and the gene-to-metabolite correlations have been elucidated mostly by an integrated analysis of transcriptomes and metabolomes. For example, most genes involved in the biosynthesis of flavonoids in Arabidopsis have been characterized by this method. A similar approach has been applied to the functional genomics for production of phytochemicals in crops and medicinal plants. Great promise is seen in metabolic quantitative loci analysis in major crops such as rice and tomato, and identification of novel genes involved in the biosynthesis of bioactive specialized metabolites in medicinal plants. © 2013 The Author.


Yamaya T.,Tohoku University | Kusano M.,RIKEN
Journal of Experimental Botany | Year: 2014

The functions of the three isoenzymes of cytosolic glutamine synthetase (GS1;1, GS1;2, and GS1;3) and two NADH-glutamate synthases (NADH-GOGAT1 and NADH-GOGAT2) in rice (Oryza sativa L.) were characterized using a reverse genetics approach and spatial expression of the corresponding genes. OsGS1;2 and OsNADH-GOGAT1 were mainly expressed in surface cells of rice roots in an NH4+-dependent manner. Disruption of either gene by the insertion of endogenous retrotransposon Tos17 caused reduction in active tiller number and hence panicle number at harvest. Re-introduction of OsGS1;2 cDNA under the control of its own promoter into the knockout mutants successfully restored panicle number to wild-type levels. These results indicate that GS1;2 and NADH-GOGAT1 are important in the primary assimilation of NH4+ taken up by rice roots. OsGS1;1 and OsNADH-GOGAT2 were mainly expressed in vascular tissues of mature leaf blades. OsGS1;1 mutants showed severe reduction in growth rate and grain filling, whereas OsNADH-GOGAT2 mutants had marked reduction in spikelet number per panicle. Complementation of phenotypes seen in the OsGS1;1 mutant was successfully observed when OsGS1;1 was re-introduced. Thus, these two enzymes could be important in remobilization of nitrogen during natural senescence. Metabolite profling data showed a crucial role of GS1;1 in coordinating metabolic balance in rice. Expression of OsGS1:3 was spikelet-specific, indicating that it is probably important in grain ripening and/or germination. Thus, these isoenzymes seem to possess distinct and non-overlapping functions and none was able to compensate for the individual function of another. © The Author 2014.


Matsukura F.,Tohoku University | Tokura Y.,RIKEN | Tokura Y.,University of Tokyo | Ohno H.,Tohoku University
Nature Nanotechnology | Year: 2015

The electrical manipulation of magnetism and magnetic properties has been achieved across a number of different material systems. For example, applying an electric field to a ferromagnetic material through an insulator alters its charge-carrier population. In the case of thin films of ferromagnetic semiconductors, this change in carrier density in turn affects the magnetic exchange interaction and magnetic anisotropy; in ferromagnetic metals, it instead changes the Fermi level position at the interface that governs the magnetic anisotropy of the metal. In multiferroics, an applied electric field couples with the magnetization through electrical polarization. This Review summarizes the experimental progress made in the electrical manipulation of magnetization in such materials, discusses our current understanding of the mechanisms, and finally presents the future prospects of the field. © 2015 Macmillan Publishers Limited. All rights reserved.


Lambert N.,RIKEN | Chen Y.-N.,National Cheng Kung University | Cheng Y.-C.,National Taiwan University | Li C.-M.,National Cheng Kung University | And 3 more authors.
Nature Physics | Year: 2013

Recent evidence suggests that a variety of organisms may harness some of the unique features of quantum mechanics to gain a biological advantage. These features go beyond trivial quantum effects and may include harnessing quantum coherence on physiologically important timescales. In this brief review we summarize the latest results for non-trivial quantum effects in photosynthetic light harvesting, avian magnetoreception and several other candidates for functional quantum biology. We present both the evidence for and arguments against there being a functional role for quantum coherence in these systems. © 2013 Macmillan Publishers Limited.


Saito K.,RIKEN | Saito K.,Chiba University | Matsuda F.,RIKEN
Annual Review of Plant Biology | Year: 2010

Metabolomics now plays a significant role in fundamental plant biology and applied biotechnology. Plants collectively produce a huge array of chemicals, far more than are produced by most other organisms; hence, metabolomics is of great importance in plant biology. Although substantial improvements have been made in the field of metabolomics, the uniform annotation of metabolite signals in databases and informatics through international standardization efforts remains a challenge, as does the development of new fields such as fluxome analysis and single cell analysis. The principle of transcript and metabolite cooccurrence, particularly transcriptome coexpression network analysis, is a powerful tool for decoding the function of genes in Arabidopsis thaliana. This strategy can now be used for the identification of genes involved in specific pathways in crops and medicinal plants. Metabolomics has gained importance in biotechnology applications, as exemplified by quantitative loci analysis, prediction of food quality, and evaluation of genetically modified crops. Systems biology driven by metabolome data will aid in deciphering the secrets of plant cell systems and their application to biotechnology. Copyright © 2010 by Annual Reviews. All rights reserved.


Higaki T.,RIKEN | Takahashi F.,Tohoku University
Journal of High Energy Physics | Year: 2012

We argue that dark radiation is naturally generated from the decay of the overall volume modulus in the LARGE volume scenario. We consider both sequestered and non-sequestered cases, and find that the axionic superpartner of the modulus is produced by the modulus decay and it can account for the dark radiation suggested by observations, while the modulus decay through the Giudice-Masiero term gives the dominant contribution to the total decay rate. In the sequestered case, the lightest supersymmetric particles produced by the modulus decay can naturally account for the observed dark matter density. In the non-sequestered case, on the other hand, the supersymmetric particles are not produced by the modulus decay, since the soft masses are of order the heavy gravitino mass. The QCD axion will then be a plausible dark matter candidate. © SISSA 2012.

Loading RIKEN collaborators
Loading RIKEN collaborators