Rhode Island Blood Center

Pine Island Center, United States

Rhode Island Blood Center

Pine Island Center, United States
SEARCH FILTERS
Time filter
Source Type

News Article | July 20, 2017
Site: www.eurekalert.org

West Warwick, RI, July 20, 2017 - Blood Centers of America (BCA) announced today that New York Blood Center (NYBC) has joined its network of blood and source plasma collection centers. BCA is a national, member-owned network of over 50 independent blood centers -- each of which has a singular focus of providing high-quality blood products for patients in their communities. As one of the largest independent community-based blood centers in the world, NYBC will expand BCA's share of the total U.S. blood supply to nearly 40 percent. "New York Blood Center's commitment to quality blood products, innovative research and transfusion medicine leadership make them an ideal member of BCA," said John Armitage, M.D., Chairman of BCA. "We are excited to add New York Blood Center's unique services and expertise to our own, and collaborate to serve more communities across the country." Christopher D. Hillyer, M.D., President and CEO of NYBC, said: "We're extremely pleased to be partnering with such an excellent organization. NYBC is looking forward to working with all of the members of BCA to move our missions forward through the collaborative efforts of BCA." NYBC was founded in 1964 and serves more than 40 million people across New York, New Jersey, Minnesota, Nebraska, Connecticut, Pennsylvania and the Kansas City metropolitan area. The organization collects approximately 3,500 units of blood each day in collaboration with its partners Community Blood Center of Kansas City, Missouri (CBC), Innovative Blood Resources (IBR), headquartered in St. Paul, Minnesota and Rhode Island Blood Center (RIBC) in Providence, RI. Blood Centers of America (BCA) is a member-owned organization comprised of over 50 independent blood centers throughout the North America, representing nearly 40 percent of the U.S. blood supply. Along with their core business of providing a substantial portion of U.S. blood supply, other BCA member services include patient blood management, transfusion services, immunohematology testing, therapeutic apheresis, and tissue and cord blood banking. In addition, BCA members provide a variety of human blood products, cells and tissues to the therapeutic, diagnostic and cell therapy industries. Learn more at http://www. .


PROVIDENCE, R.I., June 15, 2017 /PRNewswire/ -- The Rhode Island Blood Center (RIBC) launches a new public service campaign encouraging our community to "Help Someone Else" by becoming a blood donor. Using humor and a lovable character, the campaign launches with video spots that...


News Article | November 11, 2015
Site: www.nature.com

No statistical methods were used to predetermine sample size. HUDEP clone 2 (HUDEP-2) was used as previously described34. HUDEP-2 cells were expanded in StemSpan SFEM (Stem Cell Technologies) supplemented with 10−6 M dexamethasone (Sigma), 100 ng ml−1 human stem cell factor (SCF) (R&D), 3 international units (IU) ml−1 erythropoietin (Amgen), 1% l-glutamine (Life Technologies), and 2% penicillin/streptomycin. 1 μg ml−1 doxycycline (Sigma) was included in the culture to induce expression of the human papilloma virus type 16 E6/E7 genes34. HUDEP-2 cells were differentiated in Iscove’s Modified Dulbecco’s Medium (IMDM) (Life Technologies) supplemented with 330 μg ml−1 holo-transferrin (Sigma), 10 μg ml−1 recombinant human insulin (Sigma), 2 IU ml−1 heparin (Sigma), 5% human solvent detergent pooled plasma AB (Rhode Island Blood Center), 3 IU ml−1 erythropoietin, 100 ng ml−1 human SCF, 1 μg ml−1 doxycycline, 1% l-glutamine, and 2% penicillin/streptomycin. Tandem sgRNA lentiviruses were transduced into HUDEP-2 with stable Cas9 expression (Supplementary Table 1). Bulk cultures were incubated for 7–10 days with 10 μg ml−1 blasticidin and 1 μg ml−1 puromycin selection to allow for editing. Then bulk cultures were plated clonally at limiting dilution. 96 well plates with greater than 30 clones per plate were excluded to avoid mixed clones. After approximately 14 days of clonal expansion, genomic DNA was extracted using 50 μl QuickExtract DNA Extraction Solution per well (Epicentre). Clones were screened for deletion by conventional PCR with one PCR reaction internal to segment to be deleted (non-deletion band) and one gap-PCR reaction across the deletion junction (deletion band) that would only amplify in the presence of deletion36. Biallelic deletion clones were identified as the absence of the non-deletion PCR band and the presence of the deletion PCR band (Supplementary Table 2). Inversion clones were identified as previously described by PCR36 (Supplementary Table 3). Briefly, inversion clones had one inverted allele and one deleted allele without the presence of non-deletion alleles. In our experience biallelic inversion clones are very rare events36. PCR was performed using the Qiagen HotStarTaq 2× master mix and the following cycling conditions: 95 °C for 15 min; 35 cycles of 95 °C for 15 s, 60 °C for 1 min, 72 °C for 1 min; 72 °C for 10 min. Alternatively, PCR was also performed using 2× Accuprime Supermix II (Life Technologies) with the following cycling conditions: 94 °C for 2 min; 35 cycles of 94 °C for 20 s, 60 °C for 20 s, 68 °C for 1 min kb−1 of PCR product; 68 °C for 5 min. RNA was extracted from each positive clone using a kit (Qiagen) and quantitative real-time RT-qPCR was performed using iQ SYBR Green Supermix (Bio-Rad). Primers used are found in Supplementary Table 5. Gene expression was normalized to that of GAPDH. We isolated four control, one BCL11A null, three composite enhancer deleted, one h+55 deleted, one h+58 deleted, five h+62 deleted, three h+55 inverted, and two h+58 inverted clones. The BCL11A null clone had a 216 bp interstitial deletion of exon 2, preventing binding of the RT–qPCR primers. All gene expression data reported from these clones represents the mean of at least three technical replicates. Every 20-mer sequence upstream of an NGG or NAG PAM sequence on the plus or minus strand was identified for both the human and mouse orthologous +55, +58 and +62 DHS as well as BCL11A/Bcl11a exon 2 (Fig. 1 and Extended Data Figs 2, 6). Relative to the human hg19 reference genome, a reference was used with the following substitutions to approximate a common low-HbF-associated haplotype: rs1427407-G, rs1896293-T, rs6706648-T, rs6738440-G, rs7606173-C. The mouse orthologous sequences to each of the human DHSs were defined by using the liftOver tool of UCSC Genome Browser as previously described28. Each of the sgRNA oligos were synthesized as previously described25, 51, 52 and cloned using a Gibson Assembly master mix (New England Biolabs) into lentiGuide-Puro (Addgene plasmid ID 52963) which had been BsmBI digested, gel purified, and dephosphorylated. Gibson Assembly products were transformed to electrocompetent cells (E. cloni, Lucigen). Sufficient colonies were isolated to ensure ~90× library coverage for both human and mouse libraries. Plasmid libraries were deep sequenced to 533× and 813× coverage for human and mouse libraries, respectively, to confirm representation. To produce lentivirus, HEK293T cells were cultured with Dulbecco’s Modified Eagle’s Medium (DMEM) (Life Technologies) supplemented with 10% fetal bovine serum (FBS) (Omega Scientific) and 2% penicillin-streptomycin (Life Technologies) in 15 cm tissue culture treated Petri dishes. HEK293T cells were transfected at 80% confluence in 12 ml of media with 13.3 μg psPAX2, 6.7 μg VSV-G, and 20 μg of the lentiviral construct plasmid of interest using 180 μg of linear polyethylenimine (Polysciences). Medium was changed 16–24 h after transfection. Lentiviral supernatant was collected at 48 and 72 h post-transfection and subsequently concentrated by ultracentrifugation (24,000 rpm for 2 h at 4 °C with Beckman Coulter SW 32 Ti rotor). HUDEP-2 cells with stable Cas9 expression were transduced at low multiplicity with the human sgRNA library lentivirus pool while in expansion medium. Control transductions were performed to ensure transduction rate did not exceed 50%. Cell numbers were maintained throughout the experiment at levels adequate to exceed 1,000× representation of the library. 10 μg ml−1 blasticidin (Sigma) and 1 μg ml−1 puromycin (Sigma) were added 24 h after transduction to select for lentiviral library integrants in cells with Cas9. Cells were cultured in expansion media for one week followed by differentiation media for an additional week. Intracellular staining was performed by fixing cells with 0.05% glutaraldehyde (grade II) (Sigma) for 10 min at room temperature. Cells were centrifuged for 5 min at 600g and then resuspended in 0.1% Triton X-100 (Life Technologies) for 5 min at room temperature for permeabilization. Triton X-100 was diluted with phosphate buffered saline (PBS) with 0.1% BSA and then centrifuged at 600g for 15 min. Cells were stained with anti-human antibodies for HbF (clone HbF-1 with FITC or APC conjugation; Life Technologies) and β-haemoglobin antibody (clone 37-8 with PerCP-Cy5 or PE conjugation; Santa Cruz) for 20 min in the dark. Cells were washed to remove unbound antibody before FACS analysis. 0.2 μg HbF and 2 μg of adult haemoglobin (HbA) (β-haemoglobin) antibodies were used per 5 million cells. Control cells exposed to a non-targeting sgRNA sample and BCL11A exon 2 were used as negative and positive controls, respectively, to establish flow cytometry conditions. Populations of cells with the top and bottom 10% of expression of HbF were sorted by FACS. After sorting the HbF-high and HbF-low pools, library preparation and deep sequencing was performed as previously described25. Briefly, genomic DNA was extracted using the Qiagen Blood and Tissue kit. Herculase PCR reaction (Agilent) using lentiGuide-Puro specific primers (5′-AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG-3′ and 5′-CTTTAGTTTGTATGTCTGTTGCTATTATGTCTACTATTCTTTCCC-3′) including a handle sequence was performed as follows: Herculase II reaction buffer (1×), forward and reverse primers (0.5 μM each), dimethyl sulfoxide (DMSO) (8%), deoxynucleotide triphosphates (dNTPs) (0.25 mM each), Herculase II Fusion DNA Polymerase (0.5 reactions) using the following cycling conditions: 95 °C for 2 min; 20 cycles of 95 °C for 15 s, 60 °C for 20 s, 72 °C for 30 s; 72 °C for 5 min. Multiple reactions of no more than 200 ng each were used to amplify from 6.6 μg gDNA (~1×106 cell genomes) per pool. Samples were subjected to a second PCR using handle-specific primers25 to add adaptors and indexes to each sample using the following conditions: Herculase II reaction buffer (1×), forward and reverse primers (0.5 μM each), dNTPs (0.25 mM each), Herculase II Fusion DNA Polymerase (0.5 reactions) with the following cycling conditions: 95 °C for 2 min; 25 cycles of 95 °C for 15 s, 60 °C for 20 s, 72 °C for 30 s; 72 °C for 5 min. PCR products were run on an agarose gel and the band of expected size was gel purified. Illumina MiSeq 150 bp paired end sequencing was performed. sgRNA sequences present in the plasmid pool as well as in the HbF-high and HbF-low pools were enumerated. Guide sequences were mapped to the guides comprising the sgRNA library without allowing mismatches. Total reads were normalized to library sequencing depth. Cellular dropout score was determined by calculating (1) the ratio of normalized reads in the cells at end of experiment (average of reads in the HbF-high and HbF-low pools) to reads in the plasmid pool; (2) log transformation; and (3) median of biological replicates. HbF enrichment score was determined by calculating (1) the ratio of normalized reads in the HbF-high compared to reads in the HbF-low pools; (2) log transformation; and (3) median of biological replicates. After exclusion of sgRNAs with dropout scores <2−3 and NAG PAM sgRNAs, a quantile–quantile plot was made with a line fitted through the first and third quantiles using R software. HbF enrichment scores and cellular dropout scores were compared by Spearman rank correlation. sgRNA sequences were mapped to the human genome (hg19) with cleavage positions set to between positions 17 and 18 given PAM positions 21–23. For visual comparisons to targeting sgRNAs, non-targeting sgRNAs were pseudomapped each separated by 5 bp. Primary human CD34+ HSPCs from G-CSF mobilized healthy adult donors were obtained from the Center of Excellence in Molecular Hematology at the Fred Hutchinson Cancer Research Center, Seattle, Washington. CD34+ HSPCs were subject to erythroid differentiation liquid culture as previously described53. Briefly, HSPCs were thawed on day 0 into erythroid differentiation medium (EDM) consisting of IMDM supplemented with 330 μg ml−1 holo-human transferrin, 10 μg ml−1 recombinant human insulin, 2 IU ml−1 heparin, 5% human solvent detergent pooled plasma AB, 3 IU ml−1 erythropoietin, 1% l-glutamine, and 2% penicillin/streptomycin. During days 0–7 of culture, EDM was further supplemented with 10−6 M hydrocortisone (Sigma), 100 ng ml−1 human SCF, and 5 ng ml−1 human IL-3 (R&D). During days 7–11 of culture, EDM was supplemented with 100 ng ml−1 human SCF only. During days 11–18 of culture, EDM had no additional supplements. HSPCs were transduced with lentiCas9-Blast (Addgene plasmid ID 52962) 24 h after thawing in the presence of 10 μM 16,16-dimethylprostaglandin E2 (PGE2; Cayman Chemical). At 48 h after thawing, medium was changed and cells were transduced with lentiGuide-Puro or lentiGuide-Crimson cloned with relevant sgRNA sequence in the presence of 10 μM PGE2. Three independent transductions were performed per sgRNA. At 72 h after thawing, medium was changed and HSPCs were selected with 10 μg ml−1 blasticidin and 1 μg ml−1 puromycin or 10 μg ml−1 blasticidin followed by sorting for lentiGuide-Crimson+ cells on day 16 of culture. Blasticidin and/or puromycin selection occurred from days 3 to 8 of culture. Differentiation was assessed on day 18 of culture using anti-human antibodies against the transferrin receptor (CD71) (Clone OKT9 with FITC conjugation; eBioscience) and glycophorin A (CD235a) (Clone HIR2 with PE conjugation; eBioscience). Enucleation was assessed using 2 μg ml−1 of the cell-permeable DNA dye Hoescht 33342 (Life Technologies). CD235a+Hoescht 33342− cells were determined to be enucleated erythroid cells. Cells were intracellularly stained for HbF and HbA on day 18 of culture as described above. 50,000–100,000 cells were centrifuged onto microscope slides at 350 rpm for 4 min. Slides were stained with Harleco May–Grünwald stain (Millipore) for 2 min, Giemsa stain (Sigma) for 12 min, and two water washes for 30 s each. Slides were air dried and then coverslipped using Fisher Chemical Permount Mounting Medium (Fisher). RNA isolation and RT–qPCR was performed as above. Gene expression was normalized to that of GAPDH. All gene expression data represent the mean of at least three technical replicates. PCR primers were designed to amplify the genomic cleavage site for a given sgRNA. Resulting PCR products were subjected to Sanger sequencing. Sequencing traces were used for editing quantification using a previously described publically available tool54. Human erythroid H3K27ac ChIP-seq was obtained from Xu et al.7 and mouse erythroid H3K27ac ChIP-seq was obtained from Kowalczyk et al.55 and Dogan et al.56. We uniformly processed all the data sets using the same pipeline with the same criteria to call super-enhancers. Specifically, we started from raw reads and realigned each data set with Bowtie2 with the default parameters. We then removed duplicate reads with the Picard Suite. To call the peaks we used MACS2 in the narrow mode. Finally, to call the super-enhancers we used the ROSE algorithm with the default parameters10. Using these settings, peaks closer than 12.5 kb are stitched together and then ranked based on the H3K27ac intensity. To assign super-enhancers to genes we used again ROSE with default settings. In particular, the tool reports three categories of genes for each super-enhancer: (1) overlapping genes (genes for which the gene body region overlaps a super-enhancer); (2) proximal genes (genes close to a super-enhancer considering a window of 50 kb); (3) closest gene (closest gene considering its TSS and the centre of the super-enhancer). To generate a Venn diagram of genes for super-enhancer data sets, we used the union of these three gene categories. HMM segmentation was performed to automatically segment the enrichment score signals into enhancer regions with active, repressive and neutral effect. We designed a HMM with 3 states using the GHMM package (http://ghmm.sourceforge.net/). To learn the HMM parameters we used the Baum–Welch algorithm. To find the best segmentation for each region we used the Viterbi algorithm. The emission probability for each state was modelled as a Gaussian distribution and all the possible transitions between states were allowed as shown in Extended Data Fig. 4a. Since the signal was not obtained with a constant genomic resolution, we interpolated and smoothed the signal using a Gaussian kernel over 12 bp and applied the HMM to the smoothed signal. To set the initial parameters, we used the 1%, 50% and 99% percentile of the smoothed signal for the prior of the means of the repressive, neutral and active states, respectively, while the prior for the standard deviation was set to 0.001 for all the three states. Motif analysis was performed to evaluate the human and mouse enhancer regions for potential binding sites for known transcription factors. We used the FIMO software57 with a P-value threshold of <10−4. For each region we extracted sequences using the hg19 and mm9 assemblies respectively for human and mouse. The motif database was the latest version of the JASPAR database58. Deep sequencing paired-end reads of genomic amplicons from genome editing target sites were first filtered for reads with PHRED quality score <30, merged with the FLASH (Fast Length Adjustment of SHort reads) software, and subsequently aligned to a reference amplicon using the needle aligner from the EMBOSS suite (http://emboss.sourceforge.net/) to quantify insertions and deletions. Per nucleotide frequency of deletion of a position, insertion directly adjacent to the position, or no mutation at the position was quantitated using CRISPResso (https://github.com/lucapinello/CRISPResso). Murine erythroleukaemia (MEL, MEL-745A cl. DS19) cells were cultured in DMEM supplemented with 10% FBS, 1% l-glutamine, and 2% penicillin/streptomycin as previously described28, 36. Cell lines tested negative for mycoplasma contamination. εy:mCherry reporter MEL cells with stable Cas9 expression were transduced at low multiplicity with the mouse sgRNA library lentivirus pool (see Supplementary Information and Extended Data Fig. 6 for additional technical details). Control transductions were performed to ensure that the transduction rate did not exceed 50%. Cell numbers were maintained throughout the experiment at levels adequate to exceed 1,000× representation of the library. 10 μg ml−1 blasticidin and 1 μg ml−1 puromycin were added 24 h after transduction to select for lentiviral library integrants in cells with Cas9. Subsequently cells were cultured for 2 weeks. The top and bottom 5% of εy-mCherry-expressing cells exposed to the library were sorted by FACS. A non-targeting sgRNA sample was used as a negative control and Bcl11a exon 2 as a positive control to establish flow cytometry conditions. After sorting, library preparation and deep sequencing were performed as described for the human library25. sgRNA sequences present in the Hbb-εy:mCherry-high and Hbb-εy:mCherry-low pools were enumerated. Cellular dropout and εy enrichment scores were calculated analogously to the human screen. sgRNA sequences were then mapped to the mouse genome (mm9). Deletions in MEL cells were generated using two sgRNA as previously described36. Briefly, sgRNA sequences were cloned into pX330 (Addgene plasmid ID 42230) using a Golden Gate assembly cloning strategy (Supplementary Table 1). MEL cells were electroporated with 5 μg of each pX330-sgRNA plasmid and 0.5 μg pmax–GFP (Lonza) in BTX electroporation buffer using a BTX electroporator (Harvard Apparatus). Approximately 48 h post-electroporation, the top 1–3% of GFP+ cells were sorted and plated clonally at limiting dilution. Clones were allowed to grow for 7–10 days. Clones were screened for deletion by conventional PCR using the same strategy as with the HUDEP-2 cells (Supplementary Tables 2 and 4). Inversion clones were identified by PCR as previously described36 (Supplementary Table 3). mESCs were maintained on irradiated mouse embryonic fibroblasts (GlobalStem) and cultured in high glucose DMEM supplemented with 15% FBS, 1% l-glutamine, 2% penicillin/streptomycin (Life Technologies), 100 μM non-essential amino acids (Life Technologies), 1% nucleosides (Sigma), 10−4 M β-mercaptoethanol (Sigma), and 103 U ml−1 leukaemia inhibitory factor (Millipore). Cells were passaged using 0.25% trypsin (Life Technologies). The Bcl11a +62 deletion mice were derived from CRISPR-Cas9 modified CJ9 ES cells. Using Amaxa ES Cell transfection reagent (Lonza), two million mESCs were electroporated with 2 μg of each pX330 plasmid vector containing individual target sequences flanking the +62 site along with 0.5 μg of a GFP plasmid. After 48 h, the top 5% of GFP expressing cells were sorted, plated on irradiated fibroblasts and maintained. Individual ES cell colonies were then picked and screened for biallelic deletion using the same strategy as HUDEP-2 and MEL cells36. DNA for screening CRISPR-Cas9 modified clones was obtained from gelatin adapted ES cell clones to avoid genomic contamination from the fibroblasts. Correctly targeted clones with greater than 80% normal karyotype were used to generate mice. Clones were injected into embryonic day 3.5 (E3.5) C57BL/6 blastocysts and implanted into pseudo-pregnant females. The β-YAC mouse line (A20), previously described as containing a transgene encompassing ~150 kb of the human β-globin locus43, was used to analyse human globin expression. The mouse line was maintained in a hemizygous state and bred with Bcl11a +62 deletion mice. Sufficient matings were established to ensure adequate homozygotes for analysis. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. For developmental haematopoiesis, fetal liver cells were taken at E12.5, E14.5, E16.5 and E18.5 and mechanically dissociated to form single cell suspensions from which RNA was extracted using the RNeasy Plus Mini Kit (Qiagen) and analysed. At E16.5, fetal livers were also stained with CD19-PerCP-Cy5.5 (Clone 1D3; eBioscience), B220-APC (RA3-6B2; Biolegend), CD71-PE (Clone C2; BD Biosciences), and Ter119-FITC (Clone Ter119; BD Biosciences) to isolate B cells (B220+CD19+) and erythroid cells (Ter119+CD71+) by FACS for RNA extraction and Bcl11a quantification. Additionally, flow cytometry was used to analyse fetal liver from E18.5 embryos. Single cell suspensions were stained with IgM-FITC (Clone Il-41; eBioscience), CD19-PerCP-Cy5.5, (Clone 1D3; eBioscience), CD43-PE (Clone S7; eBioscience), AA4.1-PE-Cy7 (Clone AA4.1; BD Biosciences), B220-APC, (RA3-6B2; Biolegend), and DAPI (Invitrogen). For adult haematopoietic assays, peripheral blood was obtained from the tail vein of 4-week-old male and female mice. Blood was collected in EDTA-coated tubes, red cells removed by 2% dextran (Sigma), residual red cells lysed with ammonium chloride solution (Stem Cell Technologies) and stained with the following anti-mouse antibodies: CD3e-FITC (Clone 145-2C11; Biolegend), CD19-PerCP-Cy5.5 (Clone 1D3; eBioscience), CD71-PE (Clone C2; BD Biosciences), NK1.1-PE-Cy5 (Clone PK136; Biolegend), Ter119-APC (Clone TER-119; Biolegend), Gr-1-eF450 (Clone RB6-8C5; eBioscience), B220-BV605 (RA3-6B2; Biolegend), Mac-1-BV510 (Clone M1/70; Biolegend), and 7-AAD (BD Biosciences). Fetal brain analysis was conducted on whole brains from E16.5 mouse embryos on ice-cold PBS. Tissue was directly lysed into the RLT plus buffer (Qiagen) and total RNA extracted according to manufacturer’s instructions provided in the RNeasy Plus Mini Kit. RT-qPCR was performed as above, with gene expression normalized to Gapdh. All gene expression data represent the mean of at least three technical replicates. All animal experiments were conducted under the approval of the local Institutional Animal Care and Use Committee. Venus template59 was PCR amplified to add BamHI (5′) and EcoRI (3′) restriction sites (lowercase font) for cloning purposes using the following conditions: KOD buffer (1×), MgSO (1.5 mM), dNTPs (0.2 mM each), forward primer (0.3 μM; [GGCCGGCCggatccGGCGCAACAAACTTCTCTCTGCTGAAACAAGCCGGAGATGTCGAAGAGAATCCTGGACCGATGGTGAGCAAGGGCGAGGA), reverse primer (0.3 μM; GGCCGGCCgaattcTTACTTGTACAGCTCGTCCA), and KOD Hot Start DNA Polymerase (0.02 U μl−1) (Millipore). KOD PCR reaction used the following cycling conditions: 95 °C for 2 min; 50 cycles of 95 °C for 20 s, 60 °C for 20 s, and 70 °C for 30 s; 60 °C for 5 min. PCR products were purified (QIAquick PCR Purification Kit, Qiagen) and blunt end cloned with Zero Blunt PCR cloning kit (Invitrogen). PCR-blunt cloned products and lentiCas9-Blast (Addgene plasmid ID 52962) were separately digested with BamHI-HF (New England Biolabs) and EcoRI-HF (New England Biolabs) in 1× Buffer CutSmart at 37 °C (New England Biolabs). Digest of lentiCas9-Blast was performed to remove the blasticidin cassette. Then digested PCR product was ligated into the lentiCas9 backbone. E2-Crimson template (Clontech) was PCR amplified to add BsiWI (5′) and MluI (3′) restriction sites for cloning purposes using the following conditions: KOD buffer (1×), MgSO (1.5 mM), dNTPs (0.2 mM each), forward primer (0.3 μM; GGCCGGCCCGTACGcgtacgGCCACCATGGATAGCACTGAGAACGTCATCAAGCCCTT), reverse primer (0.3 μM; GGCCGGCCacgcgtCTACTGGAACAGGTGGTGGCGGGCCT), and KOD Hot Start DNA Polymerase (0.02 U μl−1). KOD PCR reaction used the following cycling conditions: 95 °C for 2 min; 50 cycles of 95 °C for 20 s, 60 °C for 20 s, and 70 °C for 30 s; 60 °C for 5 min. PCR products were purified (QIAquick PCR Purification Kit) and cloned with Zero Blunt PCR cloning kit. Cloned products and lentiGuide-puro were separately digested with BsiWI (New England Biolabs) and MluI (New England Biolabs) in 1× buffer 3.1 at 37 °C (New England Biolabs). Digest of lentiGuide-Puro (Addgene plasmid ID 52963) was performed to remove the puromycin cassette. Then digested PCR product was ligated into the lentiGuide backbone. lentiGuide-Puro (Addgene plasmid ID 52963) was digested with BsmBI in 1× buffer 3.1 at 55 °C (New England Biolabs) for linearization. One unit of TSAP thermosensitive alkaline phosphatase (Promega) was added for 1 h at 37 °C to dephosphorylate the linearized lentiGuide and then TSAP was heat inactivated at 74 °C for 15 min. Linearized and dephosphorylated lentiGuide was run on an agarose gel and gel purified. sgRNA-specifying oligos were phosphorylated and annealed using the following conditions: sgRNA sequence oligo (10 μM); sgRNA sequence reverse complement oligo (10 μM); T4 ligation buffer (1×) (New England Biolabs); and T4 polynucleotide kinase (5 units) (New England Biolabs) with the following temperature conditions: 37 °C for 30 min; 95 °C for 5 min; and then ramp down to 25 °C at 5 °C min−1. Annealed oligos were ligated into lentiGuide in a 1:3 ratio (vector:insert) using T4 ligation buffer (1×) and T4 DNA Ligase (750 units) (New England Biolabs). Plasmids were verified by sequencing using a U6 promoter forward primer CGTAACTTGAAAGTATTTCGATTTCTTGGC. sgRNA-specifying oligos using sgRNA sequences from the screen library (see Source Data associated with Figs 2 and 5) were obtained and cloned as described into either lentiGuide-Puro or lentiGuide-Crimson. sgRNA constructs were used to produce lentivirus and transduce HUDEP-2 with stable Cas9 expression. Bulk cultures were incubated for 7–10 days with 10 μg ml−1 blasticidin and 1 μg ml−1 puromycin selection to allow for editing. Then bulk cultures were plated clonally at limiting dilution. Clones were allowed to grow for approximately 14 days and then genomic DNA was extracted using 50 μl QuickExtract DNA Extraction Solution per well. lentiGuide-sgRNA1 was digested with PspXI and XmaI at 37 °C for 4 h (New England Biolabs). Digests were run on an agarose gel and gel purified. lentiGuide-sgRNA2 was linearized using NotI (New England Biolabs). The hU6 promoter and sgRNA chimaeric backbone for lentiGuide-sgRNA2 was PCR amplified using the following conditions: KOD buffer (1×), MgSO (1.5 mM), dNTPs (0.2 mM each), forward primer (0.3 μM; GGCCGGCCgctcgaggGAGGGCCTATTTCC), reverse primer (0.3 μM; CCGGCCGGcccgggTTGTGGATGAATACTGCCATTT), and KOD Hot Start DNA Polymerase (0.02 U μl−1) (Millipore). KOD PCR reaction used the following cycling conditions: 95 °C for 2 min; 50 cycles of 95 °C for 20 s, 60 °C for 20 s, and 70 °C for 30 s; 60 °C for 5 min. PCR products were purified (QIAquick PCR Purification Kit), blunt-ended cloned with Zero Blunt PCR cloning kit, transformed, and plated. Colonies were screened by digesting minipreps with EcoRI. Mini-preps were then digested with PspXI and XmaI as described above followed by PCR purification. After PCR purification, sgRNA2 was ligated into digested lentiGuide-sgRNA1. Sequence was verified with following primers: GGAGGCTTGGTAGGTTTAAGAA and CCAATTCCCACTCCTTTCAA. lentiCas9-Blast (Addgene plasmid ID 52962) or lentiCas9-Venus were produced as described above and used to transduce HUDEP-2 cells. Transduced cells were selected with 10 μg ml−1 blasticidin or Venus+ cells were sorted. Functional Cas9 was confirmed using the pXPR-011 (Addgene plasmid ID 59702) GFP reporter assay as previously described60. A reporter MEL line in which mCherry was knocked into the Hbb-y locus was created (Extended Data Fig. 6c). Briefly, a TALEN-induced DSB was created adjacent to the Hbb-y transcriptional start site. A targeting vector with mCherry and a neomycin cassette was introduced through homology-directed repair. Homology arms included mm9 sequences from Chr7:111,001,667–111,002,675 and Chr7:111,000,661–111,001,666. Cre-mediated recombination was used to remove the neomycin cassette. Long-range PCR spanning each homology arm was used to ensure appropriate targeted integration. Cells were tested upon Bcl11a disruption by RT–qPCR and flow cytometry to confirm expected effects on εy:mCherry derepression. Subsequently, CRISPR-Cas9 was used as described above to produce cells with monoallelic composite enhancer deletion to maximize screening sensitivity for enhancer disruption. lentiCas9-Blast (Addgene plasmid ID 52962) lentivirus was produced as described above and used to transduce MEL cells. Transduced cells were selected with 10 μg ml−1 blasticidin. Functional Cas9 was confirmed using the pXPR-011 (Addgene plasmid ID 59702) GFP reporter assay as previously described60.


Herwaldt B.L.,Centers for Disease Control and Prevention | Linden J.V.,New York State Department of Health | Bosserman E.,Centers for Disease Control and Prevention | Young C.,Rhode Island Blood Center | And 2 more authors.
Annals of Internal Medicine | Year: 2011

Background: Babesiosis is a potentially life-threatening disease caused by intraerythrocytic parasites, which usually are tickborne but also are transmissible by transfusion. Tickborne transmission of Babesia microti mainly occurs in 7 states in the Northeast and the upper Midwest of the United States. No Babesia test for screening blood donors has been licensed. Objective: To ascertain and summarize data on U.S. transfusionassociated Babesia cases identified since the first described case in 1979. Design: Case series. Setting: United States. Patients: Case patients were transfused during 1979-2009 and had posttransfusion Babesia infection diagnosed by 2010, without reported evidence that another transmission route was more likely than transfusion. Implicated donors had laboratory evidence of infection. Potential cases were excluded if all pertinent donors tested negative. Measurements: Distributions of ascertained cases according to Babesia species and period and state of transfusion. Results: 159 transfusion-associated B. microti cases were included; donors were implicated for 136 (86%). The case patients' median age was 65 years (range, <1 to 94 years). Most cases were associated with red blood cell components; 4 were linked to whole blood-derived platelets. Cases occurred in all 4 seasons and in 22 (of 31) years, but 77% (122 cases) occurred during 2000-2009. Cases occurred in 19 states, but 87% (138 cases) were in the 7 main B. microti-endemic states. In addition, 3 B. duncani cases were documented in western states. Limitation: The extent to which cases were not diagnosed, investigated, reported, or ascertained is unknown. Conclusion: Donor-screening strategies that mitigate the risk for transfusion transmission are needed. Babesiosis should be included in the differential diagnosis of unexplained posttransfusion hemolytic anemia or fever, regardless of the season or U.S. region. © 2011 American College of Physicians.


Young C.,Rhode Island Blood Center | Young C.,Hasbro Childrens Hospital of Rhode Island | Young C.,Imugen Inc. | Young C.,Women and Infants Hospital | And 32 more authors.
Transfusion | Year: 2012

BACKGROUND: Babesiosis is the most common transfusion-transmitted infection reported to the Food and Drug Administration (FDA). We developed and implemented the first laboratory-based blood donor screening program for Babesia microti to help reduce and prevent transfusion-transmitted babesiosis (TTB) and report results for the initial year. STUDY DESIGN AND METHODS: Selective B. microti donor screening was performed using real-time polymerase chain reaction (PCR) and indirect immunofluorescence assay (IFA) to reduce the incidence of TTB in neonates and pediatric sickle cell and thalassemia patients under an FDA-approved investigational new drug application. We compared the reports of TTB in these patients in the first 12 months of the study with those of patients who received unscreened blood from 2005 to 2010. RESULTS: There were 2113 units tested with 2086 negative results, 26 positive IFA results (1.23%), and one indeterminate PCR result (0.05%). No reported case of TTB occurred with any B. microti-screened unit transfused to the targeted patients (0/787 units) or to any patient who received the screened units (0/2086 units). Before screening, there were seven cases of TTB in neonates, sickle cell, and thalassemia patients from 6500 unscreened units (one case/929 units) and 24 cases in the total transfused population from 496,545 units distributed (one case/20,686 units). CONCLUSION: Implementation of B. microti IFA and PCR screening is compatible with blood center operations to provide tested units. While the results after 1 year are not powered to demonstrate a change in the rate of TTB after testing, they are encouraging. © 2012 American Association of Blood Banks.


PubMed | Rhode Island Blood Center
Type: Clinical Trial | Journal: Transfusion | Year: 2012

Babesiosis is the most common transfusion-transmitted infection reported to the Food and Drug Administration (FDA). We developed and implemented the first laboratory-based blood donor screening program for Babesia microti to help reduce and prevent transfusion-transmitted babesiosis (TTB) and report results for the initial year.Selective B. microti donor screening was performed using real-time polymerase chain reaction (PCR) and indirect immunofluorescence assay (IFA) to reduce the incidence of TTB in neonates and pediatric sickle cell and thalassemia patients under an FDA-approved investigational new drug application. We compared the reports of TTB in these patients in the first 12 months of the study with those of patients who received unscreened blood from 2005 to 2010.There were 2113 units tested with 2086 negative results, 26 positive IFA results (1.23%), and one indeterminate PCR result (0.05%). No reported case of TTB occurred with any B. microti-screened unit transfused to the targeted patients (0/787 units) or to any patient who received the screened units (0/2086 units). Before screening, there were seven cases of TTB in neonates, sickle cell, and thalassemia patients from 6500 unscreened units (one case/929 units) and 24 cases in the total transfused population from 496,545 units distributed (one case/20,686 units).Implementation of B. microti IFA and PCR screening is compatible with blood center operations to provide tested units. While the results after 1 year are not powered to demonstrate a change in the rate of TTB after testing, they are encouraging.

Loading Rhode Island Blood Center collaborators
Loading Rhode Island Blood Center collaborators