Madison, WI, United States
Madison, WI, United States

Time filter

Source Type

News Article | February 22, 2017
Site: www.nature.com

Pre-B acute lymphoblastic leukaemia (ALL) cells were obtained from patients who gave informed consent in compliance with the guidelines of the Internal Review Board of the University of California San Francisco (Supplementary Table 2). Leukaemia cells from bone marrow biopsy of patients with ALL were xenografted into sublethally irradiated NOD/SCID (non-obese diabetic/severe combined immunodeficient) mice via tail vein injection. After passaging, leukaemia cells were collected. Cells were cultured on OP9 stroma cells in minimum essential medium-α (MEMα; Invitrogen), supplemented with 20% fetal bovine serum (FBS), 2 mM l-glutamine, 1 mM sodium pyruvate, 100 IU/ml penicillin and 100 μg/ml streptomycin. Primary chronic myeloid leukaemia (CML) cases were obtained with informed consent from the University Hospital Jena in compliance with institutional internal review boards (including the IRB of the University of California San Francisco; Supplementary Table 3). Cells were cultured in Iscove’s modified Dulbecco’s medium (IMDM; Invitrogen) supplemented with 20% BIT serum substitute (StemCell Technologies); 100 IU/ml penicillin and 100 μg/ml streptomycin; 25 μmol/l β-mercaptoethanol; 100 ng/ml SCF; 100 ng/ml G-CSF; 20 ng/ml FLT3; 20 ng/ml IL-3; and 20 ng/ml IL-6. Human cell lines (Supplementary Table 2) were obtained from DSMZ and were cultured in Roswell Park Memorial Institute medium (RPMI-1640; Invitrogen) supplemented with GlutaMAX containing 20% FBS, 100 IU/ml penicillin and 100 μg/ml streptomycin. Cell cultures were kept at 37 °C in a humidified incubator in a 5% CO atmosphere. None of the cell lines used was found in the database of commonly misidentified cell lines maintained by ICLAC and NCBI Biosample. All cell lines were authenticated by STR profiles and tested negative for mycoplasma. BML275 (water-soluble) and imatinib were obtained from Santa Cruz Biotechnology and LC Laboratories, respectively. Stock solutions were prepared in DMSO or sterile water at 10 mmol/l and stored at −20 °C. Prednisolone and dexamethasone (water-soluble) were purchased from Sigma-Aldrich and were resuspended in ethanol or sterile water, respectively, at 10 mmol/l. Stock solutions were stored at −20 °C. Fresh solutions (pH-adjusted) of methyl pyruvate, OAA, 3-OMG (an agonist of TXNIP), d-allose (an agonist of TXNIP) and recombinant insulin (Sigma-Aldrich) were prepared for each experiment. DMS was obtained from Acros Organics, and fresh solutions (pH-adjusted) were prepared before each experiment. For competitive-growth assays, 5 mmol/l methyl pyruvate, 5 mmol/l dimethyl succinate (DMS) and 5 mmol/l OAA were used. The CNR2 agonist HU308 was obtained from Cayman Chemical. To avoid inflammation-related effects in mice, bone marrow cells were extracted from mice (Supplementary Table 4) younger than 6 weeks of age without signs of inflammation. All mouse experiments were conducted in compliance with institutional approval by the University of California, San Francisco Institutional Animal Care and Use Committee. Bone marrow cells were obtained by flushing cavities of femur and tibia with PBS. After filtration through a 70-μm filter and depletion of erythrocytes using a lysis buffer (BD PharmLyse, BD Biosciences), washed cells were either frozen for storage or subjected to further experiments. Bone marrow cells were cultured in IMDM (Invitrogen) with GlutaMAX containing 20% fetal bovine serum, 100 IU/ml penicillin, 100 μg/ml streptomycin and 50 μM β-mercaptoethanol. To generate pre-B ALL (Ph+ ALL-like) cells, bone marrow cells were cultured in 10 ng/ml recombinant mouse IL-7 (PeproTech) and retrovirally transformed by BCR–ABL1. BCR–ABL1-transformed pre-B ALL cells were propagated only for short periods of time and usually not for longer than 2 months to avoid acquisition of additional genetic lesions during long-term cell culture. To generate myeloid leukaemia (CML-like) cells, the myeloid-restricted protocol described previously30 was used. Bone marrow cells were cultured in 10 ng/ml recombinant mouse IL-3, 25 ng/ml recombinant mouse IL-6, and 50 ng/ml recombinant mouse SCF (PeproTech) and retrovirally transformed by BCR–ABL1. Immunophenotypic characterization was performed by flow cytometry. For conditional deletion, a 4-OHT-inducible, Cre-mediated deletion system was used. For retroviral constructs used, see Supplementary Table 5. Transfection of retroviral constructs (Supplementary Table 5) was performed using Lipofectamine 2000 (Invitrogen) with Opti-MEM medium (Invitrogen). Retroviral supernatant was produced by co-transfecting HEK 293FT cells with the plasmids pHIT60 (gag-pol) and pHIT123 (ecotropic env). Lentiviral supernatant was produced by co-transfecting HEK 293FT cells with the plasmids pCDNL-BH and VSV-G or EM140. 293FT cells were cultured in high glucose Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) with GlutaMAX containing 10% fetal bovine serum, 100 IU/ml penicillin, 100 μg/ml streptomycin, 25 mmol/l HEPES, 1 mmol/l sodium pyruvate and 0.1 mmol/l non-essential amino acids. Regular medium was replaced after 16 h by growth medium containing 10 mmol /l sodium butyrate. After incubation for 8 h, the medium was changed back to regular growth medium. After 24 h, retroviral supernatant was collected, filtered through a 0.45-μm filter and loaded by centrifugation (2,000g, 90 min at 32 °C) onto 50 μg/ml RetroNectin- (Takara) coated non-tissue 6-well plates. Lentiviral supernatant produced with VSV-G was concentrated using Lenti-X Concentrator (Clontech), loaded onto RetroNectin-coated plates and incubated for 15 min at room temperature. Lentiviral supernatant produced with EM140 was collected, loaded onto RetroNectin-coated plates and incubated for 30 min at room temperature. Per well, 2–3 × 106 cells were transduced by centrifugation at 600g for 30 min and maintained for 48 h at 37 °C with 5% CO before transferring into culture flasks. For cells transduced with lentiviral supernatant produced with EM140, supernatant was removed the day after transduction and replaced with fresh culture medium. Cells transduced with oestrogen-receptor fusion proteins were induced with 4-OHT (1 μmol/l). Cells transduced with constructs carrying an antibiotic-resistance marker were selected with its respective antibiotic. For loss-of-function studies, dominant-negative variants of IKZF1 (DN-IKZF1, lacking the IKZF1 zinc fingers 1–4) and PAX5 (DN-PAX5; PAX5–ETV6 fusion) were cloned from patient samples. Expression of DN-IKZF1 was induced by doxycycline (1 μg/ml), while activation of DN-PAX5 was induced by 4-OHT (1 μg/ml) in patient-derived pre-B ALL cells carrying IKZF1 and PAX5 wild-type alleles, respectively. Inducible reconstitution of wild-type IKZF1 and PAX5 in haploinsufficient pre-B ALL cells carrying deletions of either IKZF1 (IKZF1∆) or PAX5 (PAX5∆) were also studied. Lentiviral constructs used are listed in Supplementary Table 5. A doxycycline-inducible TetOn vector system was used for inducible expression of PAX5 in mouse BCR–ABL1 pre-B ALL. The retroviral constructs used are listed in Supplementary Table 5. To study the effects of B-cell- versus myeloid-lineage identity in genetically identical mouse leukaemia cells, a doxycycline-inducible TetOn-CEBPα vector system31 was used to reprogram B cells. Mouse BCR–ABL1 pre-B ALL cells expressing doxycycline-inducible CEBPα or an empty vector were induced with doxycycline (1 μg/ml). Conversion from the B-cell lineage (CD19+Mac1−) to the myeloid lineage (CD19−Mac1+) was monitored by flow cytometry. For western blots, B-lineage cells (CD19+Mac1−) and CEBPα-reprogrammed cells (CD19−Mac1+) were sorted from cells expressing an empty vector or CEBPα, respectively, following doxycycline induction. For metabolic assays, sorted B-lineage cells and CEBPα-reprogrammed cells were cultured (with doxycycline) for 2 days following sorting, and were then seeded in fresh medium for measurement of glucose consumption (normalized to cell numbers) and total ATP levels (normalized to total protein). To study Lkb1 deletion in the context of CEBPα-mediated reprogramming, BCR–ABL1-transformed Lkb1fl/fl pre-B ALL cells expressing doxycycline-inducible CEBPα were transduced with 4-OHT(1 μg/ml) inducible Cre-GFP (Cre-ERT2-GFP). Without sorting for GFP+ cells, cells were induced with doxycycline and 4-OHT. Viability (expressed as relative change of GFP+ cells) was measured separately in B-lineage (gated on CD19+ Mac1−) and myeloid lineage (gated on CD19− Mac1+) populations. To study whether Lkb1 deletion causes CEBPα-dependent effects on metabolism and signalling, Lkb1fl/fl BCR–ABL1 B-lineage ALL cells expressing doxycycline-inducible CEBPα or an empty vector were transduced with 4-OHT-inducible Cre-GFP. After sorting for GFP+ populations, cells were induced with doxycycline. B-lineage cells (CD19+ Mac1−) and CEBPα-reprogrammed cells (CD19− Mac1+) were sorted from cells expressing an empty vector or CEBPα, respectively. Sorted cells were cultured with doxycycline and induced with 4-OHT. Protein lysates were collected on day 2 following 4-OHT induction. For metabolomics, sorted cells were re-seeded in fresh medium on day 2 following 4-OHT induction and collected for metabolite extraction. For CRISPR/Cas9-mediated deletion of target genes, all constructs including lentiviral vectors expressing gRNA and Cas9 nuclease were purchased from Transomic Technologies (Supplementary Table 5; see Supplementary Table 6 for gRNA sequences). In brief, patient-derived pre-B ALL cells transduced with GFP-tagged, 4-OHT-inducible PAX5 or an empty vector were transduced with pCLIP-hCMV-Cas9-Nuclease-Blast. Blasticidin-resistant cells were subsequently transduced with pCLIP-hCMV-gRNA-RFP. Non-targeting gRNA was used as control. Constructs including lentiviral vectors expressing gRNA and dCas9-VPR used for CRISPR/dCas9-mediated activation of gene expression are listed in Supplementary Table 5. Nuclease-null Cas9 (dCas9) fused with VP64-p65-Rta (VPR) was cloned from SP-dCas9-VPR (a gift from G. Church; Addgene plasmid #63798) and then subcloned into pCL6 vector with a blasticidin-resistant marker. gRNA sequences (Supplementary Table 6) targeting the transcriptional start site of each specific gene were obtained from public databases (http://sam.genome-engineering.org/ and http://www.genscript.com/gRNA-database.html)32. gBlocks Gene Fragments were used to generate single-guide RNAs (sgRNAs) and were purchased from Integrated DNA Technologies, Inc. Each gRNA was subcloned into pCL6 vector with a dsRed reporter. Patient-derived pre-B ALL cells transduced with either GFP-tagged inducible PAX5 or an empty vector were transduced with pCL6-hCMV-dCas9-VPR-Blast. Blasticidin-resistant cells were used for subsequent transduction with pCL6-hCMV-gRNA-dsRed, and dsRed+ cells were further analysed by flow cytometry. For each target gene, 2–3 sgRNA clones were pooled together to generate lentiviruses. Non-targeting gRNA was used as control. To elucidate the mechanistic contribution of PAX5 targets, the percentage of GFP+ cells carrying gRNA(s) for each target gene was monitored by flow cytometry upon inducible activation of GFP-tagged PAX5 or an empty vector in patient-derived pre-B ALL cells in competitive-growth assays. Cells were lysed in CelLytic buffer (Sigma-Aldrich) supplemented with a 1% protease inhibitor cocktail (Thermo Fisher Scientific). A total of 20 μg of protein mixture per sample was separated on NuPAGE (Invitrogen) 4–12% Bis-Tris gradient gels or 4–20% Mini-PROTEAN TGX precast gels, and transferred onto nitrocellulose membranes (Bio-Rad). The primary antibodies used are listed in Supplementary Table 7. For protein detection, the WesternBreeze Immunodetection System (Invitrogen) was used, and light emission was detected by either film exposure or the BioSpectrum Imaging system (UPV). Approximately 106 cells per sample were resuspended in PBS blocked using Fc blocker for 10 min on ice, followed by staining with the appropriate dilution of the antibodies or their respective isotype controls for 15 min on ice. Cells were washed and resuspended in PBS with propidium iodide (0.2 μg/ml) or DAPI (0.75 μg/ml) as a dead-cell marker. The antibodies used for flow cytometry are listed in Supplementary Table 7. For competitive-growth assays, the percentage of GFP+ cells was monitored by flow cytometry. For annexin V staining, annexin V binding buffer (BD Bioscience) was used instead of PBS and 7-aminoactinomycin D (7AAD; BD Bioscience) instead of propidium iodide. Phycoerythrin-labelled annexin V was purchased from BD Bioscience. For BrdU staining, the BrdU Flow Kit was purchased from BD Bioscience and used according to the manufacturer’s protocol. Methylcellulose colony-forming assays were performed with 10,000 BCR–ABL1 pre-B ALL cells. Cells were resuspended in mouse MethoCult medium (StemCell Technologies) and cultured on 3-cm dishes, with an extra water supply dish to prevent evaporation. Images were taken and colony numbers were counted after 14 days. Cell viability upon the genetic loss of function of target genes and/or inducible expression of PAX5 was monitored by flow cytometry using propidium iodide (0.2 μg/ml) as a dead-cell marker. To study the effects of an AMPK inhibitor (BML275), glucocorticoids (dexamethasone and prednisolone), CNR2 agonist (HU308), or TXNIP agonists (3-OMG and d-allose), 40,000 human or mouse leukaemia cells were seeded in a volume of 80 μl in complete growth medium on opaque-walled, white 96-well plates (BD Biosciences). Compounds were added at the indicated concentrations giving a total volume of 100 μl per well. After culturing for 3 days, cells were subjected to CellTiter-Glo Luminescent Cell Viability Assay (Promega). Relative viability was calculated using baseline values of cells treated with vehicle control as a reference. Combination index (CI) was calculated using the CalcuSyn software to determine interaction (synergistic, CI < 1; additive, CI = 1; or antagonistic, CI > 1) between the two agents. Constant ratio combination design was used. Concentrations of BML275, d-allose, 3-OMG and HU308 used are indicated in the figures. Concentrations of Dex used were tenfold lower than those of BML275. Concentrations of prednisolone used were twofold lower than those of BML275. To determine the number of viable cells, the trypan blue exclusion method was applied, using the Vi-CELL Cell Counter (Beckman Coulter). ChIP was performed as described previously33. Chromatin from fixed patient-derived Ph+ ALL cells (ICN1) was isolated and sonicated to 100–500-bp DNA fragments. Chromatin fragments were immunoprecipitated with either IgG (as a control) or anti-Pax5 antibody (see Supplementary Table 7). Following reversal of crosslinking by formaldehyde, specific DNA sequences were analysed by quantitative real-time PCR (see Supplementary Table 8 for primers). Primers were designed according to ChIP–seq tracks for PAX5 antibodies in B lymphocytes (ENCODE, Encyclopedia of DNA Elements, GM12878). ChIP–seq tracks for PAX5, IKZF1, EBF1 and TCF3 antibodies in a normal B-cell sample (ENCODE GM12878, UCSC genome browser) on INSR, GLUT1, GLUT3, GLUT6, HK2, G6PD, NR3C1, TXNIP, CNR2 and LKB1 gene promoter regions are shown. CD19 and ACTA1 served as a positive and a negative control gene, respectively. The y axis represents the normalized number of reads per million reads for peak summit for each track. The ChIP–seq peaks were called by the MACS peak-caller by comparing read density in the ChIP experiment relative to the input chromatin control reads, and are shown as bars under each wiggle track. Gene models are shown in UCSC genome browser hg19. Extracellular glucose levels were measured using the Amplex Red Glucose/Glucose Oxidase Assay Kit (Invitrogen), according to the manufacturer’s protocol. Glucose concentrations were measured in fresh and spent medium. Total ATP levels were measured using the ATP Bioluminescence Assay Kit CLS II (Roche) according to the manufacturer’s protocol. In fresh medium, 1 × 106 cells per ml were seeded and treated as indicated in the figure legends. Relative levels of glucose consumed and total ATP are shown. All values were normalized to cell numbers (Figs 1b, c, 2c (glucose uptake), 3a and Extended Data Figs 2c, 4f, 6d) or total protein (Fig. 2c, ATP levels). Numbers of viable cells were determined by applying trypan blue dye exclusion, using the Vi-CELL Cell Counter (Beckman Coulter). Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using a Seahorse XFe24 Flux Analyzer with an XF Cell Mito Stress Test Kit and XF Glycolysis Stress Test Kit (Seahorse Bioscience) according to the manufacturer’s instructions. All compounds and materials were obtained from Seahorse Bioscience. In brief, 1.5 × 105 cells per well were plated using Cell-Tak (BD Biosciences). Following incubation in XF-Base medium supplemented with glucose and GlutaMAX for 1 h at 37 °C (non-CO incubator) for pH stabilization, OCR was measured at the resting stage (basal respiration in XF Base medium supplemented with GlutaMax and glucose) and in response to oligomycin (1 μmol/l; mitochondrial ATP production), mitochondrial uncoupler FCCP (5 μmol/l; maximal respiration), and respiratory chain inhibitor antimycin and rotenone (1 μmol/l). Spare respiratory capacity is the difference between maximal respiration and basal respiration. ECAR was measured under specific conditions to generate glycolytic profiles. Following incubation in glucose-free XF Base medium supplemented with GlutaMAX for 1 h at 37 °C (non-CO incubator) for pH stabilization, basal ECAR was measured. Following measurement of the glucose-deprived, basal ECAR, changes in ECAR upon the sequential addition of glucose (10 mmol/l; glycolysis), oligomycin (1 μmol/l; glycolytic capacity), and 2-deoxyglucose (0.1 mol/l) were measured. Glycolytic reserve was determined as the difference between oligomycin-stimulated glycolytic capacity and glucose-stimulated glycolysis. All values were normalized to cell numbers (Extended Data Fig. 2c) or total protein (Extended Data Figs 3a, 7a, b 8f) and are shown as the fold change relative to basal ECAR or OCR. Metabolite extraction and mass-spectrometry-based analysis were performed as described previously34. Metabolites were extracted from 2 × 105 cells per sample using the methanol/water/chloroform method. After incubation at 37 °C for the indicated time, cells were rinsed with 150 mM ammonium acetate (pH 7.3), and 400 μl cold 100% methanol (Optima* LC/MS, Fisher) and then 400 μl cold water (HPLC-Grade, Fisher) was added to cells. A total of 10 nmol norvaline (Sigma) was added as internal control, followed by 400 μl cold chloroform (HPLC-Grade, Fisher). Samples were vortexed three times over 15 min and spun down at top speed for 5 min at 4 °C. The top layer (aqueous phase) was transferred to a new Eppendorf tube, and samples were dried on Vacufuge Plus (Eppendorf) at 30 °C. Extracted metabolites were stored at −80 °C. For mass spectrometry-based analysis, the metabolites were resuspended in 70% acetonitrile and 5 μl used for analysis with a mass spectrometer. The mass spectrometer (Q Exactive, Thermo Scientific) was coupled to an UltiMate3000 RSLCnano HPLC. The chromatography was performed with 5 mM NH AcO (pH 9.9) and acetonitrile at a flow rate of 300 μl/min starting at 85% acetonitrile, going to 5% acetonitrile at 18 min, followed by an isocratic step to 27 min and re-equilibration to 34 min. The separation was achieved on a Luna 3u NH2 100A (150 × 2 mm) (Phenomenex). The Q Exactive was run in polarity switching mode (+3 kV/−2.25 kV). Metabolites were detected based on retention time (t ) and on accurate mass (± 3 p.p.m.). Metabolite quantification was performed as area-under-the-curve (AUC) with TraceFinder 3.1 (Thermo Scientific). Data analysis was performed in R (https://www.r-project.org/), and data were normalized to the number of cells. Relative amounts were log -transformed, median-centred and are shown as a heat map. To generate a model for pre-leukaemic B cell precursors expressing BCR–ABL1, BCR–ABL1 knock-in mice were crossed with Mb1-Cre deleter strain (Mb1-Cre; Bcr+/LSL-BCR/ABL) for excision of a stop-cassette in early pre-B cells. Bone marrow cells collected from Mb1-Cre; Bcr+/LSL-BCR/ABL mice cultured in the presence of IL-7 were primed with vehicle control or a combination of OAA (8 mmol/l), DMS (8 mmol/l) and insulin (210 pmol/l). Following a week of priming, cells were maintained and expanded in the presence of IL-7, supplemented with vehicle control or a combination of OAA (0.8 mmol/l) and DMS (0.8 mmol/l) for 4 weeks. Pre-B cells from Mb1-Cre; Bcr+/LSL-BCR/ABL mice expressed low levels of BCR–ABL1 tagged to GFP, and were analysed by flow cytometry for surface expression of GFP and CD19. The methylcellulose colony-forming assays were performed with 10,000 cells treated with vehicle control or metabolites. Cells were resuspended in mouse MethoCult medium (StemCell Technologies) and cultured on 3-cm diameter dishes, with an extra water supply dish to prevent evaporation. Images were taken and colony numbers counted after 14 days. For in vivo transplantation experiments, cells were treated with vehicle control or metabolites (OAA/DMS) for 6 weeks. One million cells were intravenously injected into sublethally irradiated (250 cGy) 6–8-week-old female NSG mice (n = 7 per group). Mice were randomly allocated into each group, and the minimal number of mice in each group was calculated by using the ‘cpower’ function in R/Hmisc package. No blinding was used. Each mouse was killed when it became terminally sick and showed signs of leukaemia burden (hunched back, weight loss and inability to move). The bone marrow and spleen were collected for flow cytometry analyses for leukaemia infiltration (CD19, B220). After 63 days, all remaining mice were killed and bone marrow and spleens from all mice were analysed by flow cytometry. Statistical analysis was performed using the Mantel–Cox log-rank test. All mouse experiments were in compliance with institutional approval by the University of California, San Francisco Institutional Animal Care and Use Committee. Following cytokine-independent proliferation, BCR–ABL1-transformed Lkb1fl/fl or AMPKa2fl/fl pre-B ALL cells were transduced with 4-OHT-inducible Cre or an empty vector control. For ex vivo deletion, deletion was induced 24 h before injection. For in vivo deletion, deletion was induced by 4-OHT (0.4 mg per mouse; intraperitoneal injection). Approximately 106 cells were injected into each sublethally irradiated (250 cGy) NOD/SCID mouse. Seven mice per group were injected via the tail vein. We randomly allocated 6–8-week-old female NOD/SCID or NSG mice into each group. The minimal number of mice in each group was calculated using the ‘cpower’ function in R/Hmisc package. No blinding was used. When a mouse became terminally sick and showed signs of leukaemia burden (hunched back, weight loss and inability to move), it was killed and the bone marrow and/or spleen were collected for flow cytometry analyses for leukaemia infiltration. Statistical analysis was performed by Mantel–Cox log-rank test. In vivo expansion and leukaemia burden were monitored by luciferase bioimaging. Bioimaging of leukaemia progression in mice was performed at the indicated time points using an in vivo IVIS 100 bioluminescence/optical imaging system (Xenogen). d-luciferin (Promega) dissolved in PBS was injected intraperitoneally at a dose of 2.5 mg per mouse 15 min before measuring the luminescence signal. General anaesthesia was induced with 5% isoflurane and continued during the procedure with 2% isoflurane introduced through a nose cone. All mouse experiments were in compliance with institutional approval by the University of California, San Francisco Institutional Animal Care and Use Committee. Data are shown as mean ± s.d. unless stated. Statistical significance was analysed by using Grahpad Prism software or R software (https://www.r-project.org/) by using two-tailed t-test, two-way ANOVA, or log-rank test as indicated in figure legends. Significance was considered at P < 0.05. For in vitro experiments, no statistical methods were used to predetermine the sample size. For in vivo transplantation experiments, the minimal number of mice in each group was calculated through use of the ‘cpower’ function in the R/Hmisc package. No animals were excluded. Overall survival and relapse-free survival data were obtained from GEO accession number GSE11877 (refs 35, 36) and TCGA. Kaplan–Meier survival analysis was used to estimate overall survival and relapse-free survival. Patients with high risk pre-B ALL (COG clinical trial, P9906, n = 207; Supplementary Table 10) were segregated into two groups on the basis of high or low mRNA levels with respect to the median mRNA values of the probe sets for the gene of interest. A log-rank test was used to compare survival differences between patient groups. R package ‘survival’ Version 2.35-8 was used for the survival analysis and Cox proportional hazards regression model in R package for the multivariate analysis (https://www.r-project.org/). The investigators were not blinded to allocation during experiments and outcome assessment. Experiments were repeated to ensure reproducibility of the observations. Gel scans are provided in Supplementary Fig. 1. Gene expression data were obtained from the GEO database accession numbers GSE32330 (ref. 12), GSE52870 (ref. 37), and GSE38463 (ref. 38). Patient-outcome data were derived from the National Cancer Institute TARGET Data Matrix of the Children’s Oncology Group (COG) Clinical Trial P9906 (GSE11877)35, 36 and from TCGA (the Cancer Genome Atlas). GEO accession details are provided in Supplementary Tables 9 and 10. ChIP–seq tracks for PAX5, IKZF1, EBF1 and TCF3 antibodies in a normal B-cell sample (ENCODE GM12878, UCSC genome browser) on INSR, GLUT1, GLUT3, GLUT6, HK2, G6PD, NR3C1, TXNIP, CNR2 and LKB1 gene promoter regions are shown in UCSC genome browser hg19. All other data are available from the corresponding author upon reasonable request.


News Article | February 15, 2017
Site: www.nature.com

Polybrene, bafilomycin A, nocodazole and cyclohexamide were purchased from Sigma. CLAAAP (protease inhibitor cocktail) and PhosStop (phosphatase inhibitor) were purchased from Roche. Cytochalasin D was obtained from Fluka. Each antibody was obtained as follows: α-tubulin (B-5-1-2, Santa Cruz Biotechnology), AIF (sc-13116, Santa Cruz Biotechnology), β-actin (AC-74, Sigma), calnexin (ADI-SPA-860, ENZO Life Sciences), catalase (219010, Millipore), Drp1 (611113, BD Transduction Laboratories), FLAG (M2, Sigma), GFP for western blots (JL-8, Clontech), GFP (anti FP) for electron microscopy and immunoprecipitation (A6455, Life Technology), IP R1 (8568, Cell Signalling), KDEL (ab50601, Abcam), Lamp1b (H5G11, Santa Cruz Biotechnology), MCU (HPA016480, Sigma), MUL1 (HPA017681, Sigma), myc (4A6, Upstate), PEX14 (ABC142, Millipore), PMP70 (sab4200181, Sigma), PRDX3 (ref. 30), Tom20 (FL-145, Santa Cruz Biotechnology), ubiquitin (P4D1-A11, Millipore), VDAC1 (20B12AF2, Abcam), Vps35 (2D3, Novus). The human peroxisomal biogenesis-deficient fibroblast cell line PBD400-T1 was derived from a patient with Zellweger syndrome carrying a single nucleotide insertion (c542insT) leading to a premature stop codon in the core peroxin gene PEX3 (called Pex3mut), a gift from P. Kim (Univ. Toronto, Canada). Pex16mut cells were derived from a patient with Zellweger syndrome carrying a terminating mutation in PEX16, R176ter (GM06231 cells, Coriell Institute, called Pex16mut), which were immortalized as described in ref. 31. Control human fibroblasts (cell line MCH64) were obtained from Montreal Children’s Hospital. The cell lines were validated using qRT–PCR to confirm the loss of Pex3 or Pex16 (data shown in Extended Data Fig. 1a). Cells were maintained in DMEM (GIBCO) supplied with 10% fetal bovine serum (Wisent Bio Products) and non-essential amino acids (GIBCO) in 5.0% CO at 37 °C. Cells were tested for mycoplasma contamination using MycoAlert Mycoplasma Detection kit (Lonza). Transfection with plasmid DNA or siRNA was performed with Lipofectamine 3000, Nucleofector (Lonza) or RNAiMAX (Invitrogen) following the manufacturer’s instructions. Addition of drugs to monitor peroxisome biogenesis was performed using the following conditions: 0.02% DMSO, 20 nM bafilomycin A, 2 μM MG132, 1 μM cytochalasin D or 1.5 μM nocodazole for 14 h. Series of ON-TARGETplus siRNAs were purchased from Dharmacon. Non-targeting control pool (D-001810-10), targeted sequences are as follows: ON-TARGETplus DNML1 siRNA smart pool (J-012092-09 – 12, GUUAACCCGUGGAUGAUAA, CGUAAAAGGUUGCCUGUUA, CAUCAGAGAUGUUUACCA, GGAGCCAGCUAGAUAUUAA), ON-TARGETplus smart pool siVps35 (GAACAUAUUGCUACCAGUA, GAAAGAGCAUGAGUUGUUA, GUUGUAAACUGUAGGGAUG, GAACAAAUUUGGUGCGCCU), ON-TARGETplus siPEX19 (J-012594-05, J-012594-06, J-012594-07, J-012594-08) C-terminal YFP-fused Pex3 (UniProtKB: P56589) and Pex16 (UniprtoKB: Q9Y5Y5) (obtained from P. Kim12, GFP tag switched for YFP using standard procedures) were subcloned into D2-MCS viral vector (BioVector) under the control of a CMV promoter. Ad-GFP, Ad-Pex3–YFP and Ad-Pex16–YFP were used to infect cells at 50, 500 and 200 pfu per cell, respectively, in the presence of 4 μg/ml polybrene. Medium was replaced 1 day after infection. Cells were fixed with pre-warmed 5% PFA that was added directly to cells just after removing the culture medium without PBS wash. After incubation at 37 °C for 15 min, PFA was quenched with 50 mM NH Cl/PBS for 10 min at room temperature. Cells were permeabilized with 0.1% Triton X-100/PBS (v/v) for 10 min at room temperature and blocked with 5% FBS/PBS for 10 min at room temperature. Cells were incubated with appropriate primary antibodies for 2 h. After the wash with PBS, cells were incubated with secondary antibodies for 1 h. Cells were observed with spinning confocal microscopy (Olympus IX81 with Andor/Yokogawa spinning disk system (CSU-X), sCMOS camera and 100× or 60× objective lenses (NA1.4)). For quantification analysis, more than 30 cells in each condition were randomly chosen and counted based on the definitions on main figures (stages of de novo synthesis: Fig. 1a; localization of Pex3–YFP: Fig. 2b, left). Cells plated in a glass-bottom cell culture dish (MatTek) were infected with adenoviruses. Twenty-four hours after infection, cells were incubated with 100 nM MitoTracker Deep Red FM (Molecular Probes) for 20 min at 37 °C. Cells were washed in DMEM and observed in DMEM containing no phenol red (31053028, GIBCO) supplied with 10% FBS and 2 mM l-glutamine, NEAA and 10 mM HEPES pH 7.4 using a spinning disk confocal microscope (described above) with a 100× objective and EMCCD camera. For long-term imaging (40–48 h), infected cells in phenol red-free medium were monitored with Viva View FL Incubator microscope fitted with a 40× objective (Olympus) beginning 24 h after initial infection. Pex3mut and Pex16mut cells were transfected with Pex16–mRFP and infected with Ad-Pex3–YFP. Sixteen hours later, cells were trypsinized and co-plated into a glass bottom cell culture dish (MatTek). One day after that, cells were fused with 50% (w/v) PEG (Fluka, MW: 1,500 Da) in MEM (Invitrogen) containing medium for 1 min. After extensive washing (5×) with DMEM, cells were monitored with the spinning disk confocal microscope beginning 1 h after whole-cell fusion32. Cells prepared for electron microscopy were infected as indicated for 1 day before processing to capture the early events in peroxisomal biogenesis. As previously described33, cells were fixed with 5% PFA and 1.6% glutaraldehyde (GA) in 0.1 M sodium cacodylate buffer (pH 7.4) for 10 min at room temperature, then further fixed at 4 °C in the same buffer overnight. After washing with 0.1 M cacodylate buffer, cells were fixed with 1% osmium tetroxide for 60 min at 4 °C. Cells were washed with water, stained with saturated aqueous uranyl acetate for 45 min at room temperature, and then gradually dehydrated with a series of increasing concentrations of ethanol (70–100%). After dehydrating with 100% acetone, cells were gradually embedded in Spurr’s resin, and polymerized for 48 h at 60 °C. Samples were sectioned to a 100-nm thickness and sections were mounted on 200-mesh copper grids. Sections were imaged at 120 kV using a FEI Tecnai 12 TEM outfitted with an AMT XR80C CCD Camera System, housed in the Facility for Electron Microscopy Research (FEMR) at McGill University. The sizes of pre-peroxisomes on mitochondria were measured with ImageJ (NIH). For immuno-gold labelling, cells infected with Ad-Pex3–YFP or Ad-Pex16–YFP for 24 h were fixed in 5% PFA and 0.1% GA in PBS for 15 min at 37 °C. After washing with PBS, aldehydes were quenched with 50 mM glycine in PBS. Cells were permeabilized with 0.1% saponin and 5% BSA in PBS for 30 min at room temperature. Cells were incubated with anti GFP-antibody for 1 h at room termperature. After washing with 1% BSA in PBS, cells were incubated with 1.4 nm nanogold-conjugated goat anti-rabbit IgG for one hour at room temperature. After washing with PBS, cells were post-fixed with 1.6% GA in PBS for 10 min at room temperature. Cells were washed with water, then nanogold particles were enhanced using the HQ Silver Enhancement Kit (Nanoprobes) according to the manufacturer’s instructions. Cells were stored in 1.6% GA in 0.1 M sodium cacodylate at 4 °C overnight and processed as for conventional TEM (described above). Cells resuspended in ice-cold homogenization buffer (HB, 10 mM HEPES-KOH pH 7.4, 220 mM manitol, 70 mM sucrose, protease inhibitor cocktail) were homogenized with a 27-G needle (BD). Post-nuclear supernatants after centrifugation at 800g for 10 min were centrifuged at 2,300g for 10 min. Supernatants were further centrifuged at 23,000g for 15 min and at 100,000g for 1 h. After each centrifugation, pellets were resuspended in HB. Protein concentrations were measured by the Bradford method and analysed by immunoblotting. Twenty-five micrograms of 2.3 K for mitochondrial or 23 K for peroxisomal fractions suspended in 40 μl of mitochondrial isolation buffer (MIB, 10 mM HEPES pH 7.4, 68 mM sucrose, 80 mM KCl, 0.5 mM EDTA, 2 mM Mg(CH COO) ) containing varying amounts of trypsin (Sigma) were incubated on ice for 20 min. Digestion was terminated by adding soybean trypsin inhibitor (2.5 mg/ml, Sigma). For alkaline carbonate extraction, 50 μg of each fraction suspended in 50 μl of 0.1 M Na CO pH 11.5 was incubated on ice for 30 min. Soluble and membrane fractions were separated by centrifugation at 200,000g for 15 min at 4 °C. Cell-free mitochondrial import assays were performed as previously described34, with some modifications. In brief, Pex3– and Pex16–myc-His inserted into pCDNA3.1 myc-His (-) B (Invitrogen) were linearized by AglII restriction enzyme (NEB) before in vitro transcription. Capped RNA was synthesized in vitro using T7 polymerase (Promega). For the co-translational import assay, synthesized RNA was incubated with rabbit reticulocyte lysate (RRL, Promega) and 14.4 μg of canine pancreas microsomes35, 36 for 30 min at 30 °C. Microsomes were collected by centrifugation at 100,000g for 15 min after washing with MIB twice. For post-translational import into isolated mitochondria, synthesized RNA was incubated with RRL for 30 min at 30 °C. Reaction products were incubated with 50 μg mitochondria isolated from mouse heart34 in 50 μl reaction mix (10 mM HEPES pH 7.4, 110 mM Mannitol, 68 mM sucrose, 80 mM KCl, 0.5 mM EGTA, 2 mM Mg(CH COO) , 0.5 mM GTP, 2 mM K HPO , 1 mM ATP (K+), 0.08 mM ADP, 5 mM sodium succinate) for 30 min at 30 °C. Mitochondria were washed with MIB twice and subjected to further analysis for suborganellular localization as described above or directly analysed by immunoblotting. Pex3mut cells infected with Ad-GFP or Ad-Pex3–YFP for 10 h were further treated with or without 500 nM MG132 for 14 h. Cells were lysed with 0.1% SDS lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 5 mM EDTA, 0.1% SDS, 1% Triton-X 100, protease inhibitor cocktail and PhosStop). Soluble fractions were obtained by centrifugation at 20,000g for 20 min at 4 °C. Non-specific binding proteins were removed by rotating with protein-G sepharose (GE Healthcare) for 1 h at 4 °C. Lysates were subjected to immunoprecipitation using rabbit polyclonal anti-GFP antibodies (Invitrogen). Immmunoprecipitates were eluted by adding SDS–PAGE sample buffer and analysed by immunoblotting. Total RNA was isolated from each cell using RNeasy kit (QIAGEN). qRT–PCR and data analysis were performed at IRIC Genomics Platform (University de Montreal). Primers are as follows: ACTB (endogenous control) (Fw: attggcaatgagcggttc, Rv: tgaaggtagtttcgtggatgc), GAPDH (endogenous control) (Fw: agccacatcgctcagacac, Rv: gcccaatacgaccaaatcc), Pex19 (Fw: gcaagtcggaggtagcaaga, Rv: ctttatcgaaatcatcaagagcac), Pex3 (Fw: aaccagaggacttgcaatatgac, Rv: tgctgcattaaggcctctct), Pex16 (Fw: aggtgtggggtgaagtgg, Rv: caggagcatccgcagtaca). The means of each condition were calculated from three independent experiments, counting at least 30 cells per condition to generate enough power for statistical significance. P values for data comparison were calculated by Student’s t-test. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. All data shown here have been reproduced at least three times by the authors. All data supporting the findings of this study are available within the paper and the supplementary information files.


News Article | February 15, 2017
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. Cell lines used in this study were obtained from American Type Culture Collection (ATCC) and cultured under standard conditions. HCT116 cells were authenticated by karyotyping. All cell lines were confirmed to be free of mycoplasma contamination. EGFP was PCR amplified from EGFP-hAGO2 (Addgene catalogue number 21981) and cloned into pMSCV-Puro (Clontech) using the BglII and XhoI restriction sites. The puromycin resistance cassette was then removed by EcoRI and ClaI digestion and replaced with an insert containing eight imperfect miR-19 binding sites (modelled from ref. 39), synthesized as a gBlock (IDT) (sequence in Supplementary Table 8). For the EGFP-only reporter, the puromycin resistance cassette was removed by EcoRI and ClaI digestion followed by re-ligation after filling-in overhangs. Reporters for miR-16 and miR-200c were generated by replacing the puromycin cassette in the pMSCV-Puro vector containing EGFP by digesting with EcoRI and ClaI and ligating in oligonucleotides containing single miRNA binding sites (sequences in Supplementary Table 8). Multiple cloning cycles were performed using MfeI and ClaI to generate the final reporters containing eight total binding sites. MSCV-EGFP, MSCV-EGFP-miR-19, MSCV-EGFP-miR-16, and MSCV-EGFP-miR-200 retrovirus was generated by first seeding 6 × 105 cells per well in a six-well dish. The following day, cells were transfected using 1 μg of plasmid (MSCV-EGFP or MSCV-EGFP-miR-19), 3 μl of FuGENE HD (Promega), and 200 μl Opti-MEM (Thermo Fisher) per well according to the manufacturer’s instructions. Media were changed the next day. Two days after transfection, media were collected and passed through a 0.45 μm SFCA sterile filter. Recipient HCT116 cells were transduced overnight at a multiplicity of infection (MOI) of approximately 0.2 using media supplemented with 8 μg/ml polybrene (EMD Millipore). Cells expressing EGFP were enriched by FACS and single-cell clonal lines were derived. Heterogeneous knockout cell populations were generated using lentiCRISPR v2 (Addgene catalogue number 52961) or lentiCRISPR-hygro. lentiCRISPR-hygro was constructed by replacing the puromycin resistance open reading frame (ORF) in lentiCRISPR v2 with a hygromycin resistance ORF. A silent mutation was introduced into a BsmBI restriction site within the hygromycin resistance ORF to prevent fragmentation of the vector when cloning sgRNA oligonucleotides. sgRNA sequences (Supplementary Table 8) were cloned as described previously12. An sgRNA targeting an irrelevant gene (PPID) or a non-targeting guide were used as negative controls. To generate active lentivirus, 6 × 105 293T cells were first seeded in six-well dishes and transfected the following day using a 5:3:2 ratio of lentiCRISPR:psPAX2 (Addgene catalogue number 12260):pMD2.G (Addgene catalogue number 12259) using FuGENE HD and 1 μg of total plasmid per well. Media were changed the next day. Two days after transfection, media were collected and passed through a 0.45 μm SFCA sterile filter. Media containing the virus were diluted 1:1 with fresh media and used to transduce recipient cells overnight in a final polybrene concentration of 8 μg/ml. Media were changed 24 h later, and cells were split into fresh media containing 1 μg/ml puromycin 48 h after transduction. To generate clonal knockout lines, single-cell cloning was performed after infection with lentiCRISPR v2, lentiCRISPR-hygro, or after transient transfection of PX330 (Addgene catalogue number 42230) targeting the gene of interest. lentiCRISPR v2-derived clones were used in Figs 2d, 4d, e and 5a, e and Extended Data Figs 2, 4e, 5c, and 9a, b. A lentiCRISPR-hygro derived ANKRD52–/– clone was used in Fig. 2e. PX330-derived clones were used in Figs 2a, f and Extended Data Figs 3, 4c, 6, 7, 8c, d, 9a, b, d and 10. Three hundred thousand reporter cells were seeded per well in six-well dishes. Cells were transfected the following day with a mixture of inhibitors for miR-19a and miR-19b at 5 nM each (MiRIDIAN microRNA Hairpin Inhibitors, GE Dharmacon) using Lipofectamine RNAiMAX (Thermo Fisher). Fluorescence was assessed by flow cytometry 48 h after transfection. Lentiviral sgRNA library production. The human GeCKO v2 library was obtained from Addgene (catalogue number 1000000048) and amplified according to the provided instructions. Plasmid was purified from bacterial pellets using a Qiagen Plasmid Maxi Kit. Active lentivirus was prepared in 293T cells by first seeding 3.2 × 106 cells per 10-cm dish. GeCKO library A and library B were prepared independently using 15 dishes per library. The day after seeding, each dish was transfected using 10 μg of total plasmid (5:3:2 ratio of GeCKO library:psPAX2:pMD2.G), 30 μl of FuGENE HD, and 900 μl of Opti-MEM. Medium was exchanged the following day. Media collections at 48 and 72 h after transfection were pooled before filtering through a 0.45 μm SFCA sterile filter. Aliquots of the library were snap frozen on dry ice and ethanol before being stored at −80 °C. Library titre was determined as described12. Transduction of reporter cell lines with lentiCRISPR library. Genome-wide CRISPR–Cas9 screens using HCT116EGFP-miR-19, HCT116EGFP, or ANKRD52–/– HCT116EGFP-miR-19 cells were performed using both GeCKO v2 libraries A and B. Biological replicates were performed for all screens. For each transduction, five 12-well plates were seeded with 5 × 105 reporter cells per well. An overnight transduction was performed the following day by diluting virus to an MOI of 0.2–0.4 in 8 μg/ml polybrene. Cells were then trypsinized and pooled before being plated into fresh medium in six 15-cm dishes. Forty-eight hours later, cells were trypsinized, pooled, counted, and seeded into five 15-cm dishes with 1 μg/ml puromycin using 2.4 × 107 cells per dish. In parallel, a small aliquot of cells was used to confirm that an MOI of 0.2–0.4 was achieved. Cells were passaged for 12–14 days before sorting. At every passage, 1 × 107 cells were seeded per dish into four 15-cm dishes with medium containing puromycin. At least 2 × 107 cells were transduced with each library for each screen, corresponding to ~300× or greater coverage. Cell sorting. Two days before sorting, ten 15-cm dishes with 1.2 × 107 cells per dish were seeded for each library–reporter pair. Samples were prepared for FACS by trypsinization in 0.25% trypsin-EDTA (Thermo Fisher) for 7 min. Cells were dissociated by pipetting up and down approximately 20 times with a P1000 pipet to minimize doublets. Dissociated cells were pipetted directly into media, pelleted at 300g for 5 min, and washed once with PBS. Cells were resuspended at 1.4 × 107 cells per millilitre in PBS supplemented with 3% FBS. Cells were sorted at the University of Texas Southwestern Flow Cytometry Core Facility using a MoFlo cell sorter (Beckman Coulter). The brightest or dimmest 0.5% of cells were collected on the basis of EGFP fluorescence. Cell sorting was performed on approximately 9 × 107 cells, and typical yields ranged from 2 × 105 to 3 × 105 sorted bright/dim cells. Cells were pelleted at 300g and frozen at −80 °C for genomic DNA (gDNA) extraction. Unsorted cells were similarly collected. Genomic DNA extraction. gDNA was extracted from the unsorted cells using a Qiagen DNeasy Blood & Tissue Kit according to the manufacturer’s instructions. Extractions were performed on 4 × 107 cells using 5 × 106 cells per column to ensure enough gDNA for 300× coverage of the library. DNA was eluted by adding 125 μl of water to each column. The same eluate was added back to the column for a second elution. The DNA concentration in the final eluate was assessed using a Qubit dsDNA BR assay kit (Thermo Fisher). To facilitate maximum recovery of gDNA from the sorted cells, a previously described method40 was used with the following modifications: sorted cell pellets were resuspended in 500 μl of tissue lysis buffer, consisting of 460 μl of STE buffer (1 mM EDTA (pH 8.0), 10 mM Tris-HCl (pH 8.0), 100 mM NaCl) supplemented with 10 μl of 0.5 M EDTA, 10 μl of proteinase K (10 mg/ml in TE buffer containing 10 mM Tris-HCl (pH 8.0) and 1 mM EDTA), and 20 μl of 10% SDS. Pellets were digested overnight at 55 °C while shaking at 1,000 r.p.m. on a Thermomixer (Eppendorf). The following day, 5 μl of 2 mg/ml RNase A was added to each tube and incubated at 37 °C for 1 h while shaking at 1,000 r.p.m. Extractions were performed with an equal volume of pH 7.9-buffer saturated phenol, followed by phenol:chloroform:isoamyl alcohol (25:24:1), followed by chloroform. Twenty micrograms of glycogen (Roche) and 1.5 ml of 100% ethanol were added to each tube and DNA was precipitated at −80 °C for 1 h followed by centrifugation at 18,000g for 10 min at 4 °C. Pellets were washed with 1 ml of 75% ethanol, dried, and resuspended in 21 μl of water by incubating at 37 °C for a minimum of 4 h. DNA concentration was determined with the Qubit dsDNA BR assay kit. Sequencing library preparation. Methods to prepare PCR amplicon libraries for deep sequencing were adapted from a previously published protocol12. All primer sequences are provided in Supplementary Table 8. For unsorted cells, an initial round of PCR (PCR I) was performed using 6.6 μg of gDNA per 100 μl PCR reaction. To maintain 300× coverage, 20 reactions were assembled for each sample. For sorted cells, all extracted gDNA for a given sample was distributed into two 100 μl reactions. In both cases, 18 cycles of amplification were performed using Herculase II Fusion polymerase (Agilent). All reactions for a given sample from PCR I were then pooled together and a second round of PCR (PCR II) was performed to add the necessary adapters for Illumina sequencing. Owing to variable PCR efficiency between samples, the cycle number for PCR II was adjusted so that each library was amplified in a 50 μl reaction to a common endpoint with respect to DNA quantity (approximately 50 ng of DNA library in a 50 μl PCR sample). DNA was purified for sequencing using AMPure XP beads (Agencourt) according to the manufacturer’s instructions with the following modifications: each 50 μl PCR II reaction was mixed with 25 μl of beads and incubated for 5 min. Magnetic separation was used to collect the supernatant. The supernatant was mixed with 90 μl of beads and incubated for 5 min. The supernatant was collected and discarded. Beads were washed twice with 200 μl of 70% ethanol and then dried for approximately 12 min. Bound DNA was eluted from the beads using 40 μl of water. Next-generation sequencing. Before sequencing, all DNA libraries were analysed using a Bioanalyzer High Sensitivity DNA Analysis Kit (Agilent). Library concentration was then determined by qPCR using a KAPA Library Quantification Kit for Illumina platforms. All samples were sequenced on an Illumina HiSeq 2500 or a NextSeq 500 with 75 bp single reads. Approximately 15 million to 20 million reads were sequenced per library. Sequencing data analysis. A reference file for all sgRNAs in the library was acquired from Addgene, and identical sgRNAs targeting more than one protein-coding gene were removed. Demultiplexed FASTQ files were mapped to the reference file using Bowtie 2 requiring unique alignments with no mismatches. Normalized read counts were calculated as described previously12. Screen hits were identified using RIGER16 with the following parameters: log(fold-change ranking), 1 × 106 permutations, second-best rank (SBR) scoring algorithm. RNA was extracted from cells using a miRNeasy Mini Kit (Qiagen) with an on-column DNase digestion. cDNA was generated using either the SuperScript IV First-Strand Synthesis System (Thermo Fisher) or MultiScribe Reverse Transcriptase (Thermo Fisher). SYBR Green assays were performed using SYBR Green PCR Master Mix (Applied Biosystems) with custom primer pairs or qRT–PCR assays for mature miRNAs or mRNAs were performed using pre-designed assays and the TaqMan Universal Master Mix II (Applied Biosystems). Primer sequences and catalogue numbers provided in Supplementary Table 8. A custom Taqman assay was designed for pri-miR-17-92 (sequences provided in Supplementary Table 8). For all co-immunoprecipitation assays, 3.2 × 106 293T cells were seeded 1 day before transfection. Cells were transfected using FuGENE HD with 10 μg of total plasmid. Media were changed the following day. Cells were harvested 48 h after transfection. Cells were washed once, scraped in PBS, and lysed on ice for 10 min in 1 ml of lysis buffer composed of 25 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM MgCl , 0.5% NP-40, 1 mM DTT, and a protease inhibitor cocktail (cOmplete EDTA-free, Roche). Lysates were spun at 10,000g for 10 min. Supernatants were collected and diluted with 0.5 volumes of fresh lysis buffer. One and a half microlitres of immunoprecipitation antibody (anti-V5 (Invitrogen catalogue number 46-0705) or anti-HA (Cell Signaling catalogue number 2367S)) were added to each sample and rotated at 4 °C for 30 min. Thirty microlitres of washed Dynabeads Protein G (Thermo Fisher) were added to each sample and incubated for 6 h. RNase A (Thermo Fisher) was added to a final concentration of 20 μg/ml where indicated. Samples were washed four times in ice-cold lysis buffer. Fifty microlitres of 2× Laemmli sample buffer were added to each sample and aliquots were used for western blot analysis. Antibodies used for western blotting included anti-HA (2367S, Cell Signaling), anti-V5 (46-0705, Invitrogen), anti-AGO2 (SAB4200085, Sigma), anti-GAPDH (2118S, Cell Signaling), anti-α-tubulin (T6199-200UL, Sigma), anti-BRD4 (13440S, Cell Signaling), anti-CTNNB1 (9587S, Cell Signaling), anti-POU2F1 (8157S, Cell Signaling), anti-ANKRD52 (A302-372A, Bethyl), and anti-CSNK1A1 (sc-6477, Santa Cruz). SDS–PAGE gels (7%) were supplemented with Phos-tag AAL solution (Wako) according to the manufacturer’s recommendations. Gels were run at 100 V in an XCELL SureLOCK Mini-Cell (Invitrogen) until the dye front completely exited the gel. Gels were incubated in transfer buffer supplemented with 1 mM EDTA for 10 min. Gels were then soaked in normal transfer buffer for 10 min. Proteins were transferred to a nitrocellulose membrane and standard western blotting procedures were subsequently followed. For lambda phosphatase treatments, lysates were generated as described in the co-immunoprecipitation assays. Lysate (50 μl) was mixed with 10× MnCl buffer and 10× reaction buffer provided with the lambda protein phosphatase kit (NEB). Samples treated with enzyme received 1 μl of purified lambda protein phosphatase. Incubations were performed for 45 min at 30 °C, and samples were subjected to chloroform–methanol precipitation41 before Phos-tag electrophoresis. Endogenous AGO2 was purified from ANKRD52+/+ and ANKRD52–/– HCT116 cells. AGO2–/– cells were used as a control. Ten million cells were seeded per 15-cm dish, and eight dishes were used per cell line. AGO2 was immunoprecipitated using methods adapted from an established protocol42 with 100 μl of Dynabeads Protein G loaded with 18 μg of anti-AGO2 antibody (SAB4200085, Sigma) per purification. Immunoprecipitation eluates were resuspended in 5× Laemmli sample buffer. FH-AGO2 constructs (WT, T830A, S824A/T830A) were stably expressed using MSCV-puro in ANKRD52–/– cells. Ten million cells were seeded per 15-cm dish, and eight dishes were used per cell line. Media were changed 48 h later. Cells were scraped in PBS 72 h after plating. Lysates were generated using methods similar to the co-immunoprecipitation assays, with the exception that a phosphatase inhibitor cocktail (PhosStop, Roche) was included and lysate supernatants were diluted with one volume of lysis buffer. Proteins were immunoprecipitated using 100 μl of Dynabeads Protein G loaded with 20 μg of anti-Flag antibody (F1804, Sigma). Beads were rotated at 4 °C for 3 h. Beads were washed five times in lysis buffer. Proteins were eluted using 70 μl of 2× Laemmli sample buffer per 100 μl of beads. Purified AGO2 proteins were separated by SDS–PAGE and stained using InstantBlue (Expedeon). Gel slices containing AGO2 bands were reduced by DTT, alkylated by iodoacetic acid, and digested with trypsin (Trypsin Gold; Promega). The digestion was stopped by adding formic acid, followed by peptide extraction in acetonitrile. Extracted peptides were desalted by C18 ZipTip (Millipore). Peptide mixtures were separated by C-18 resin (100 Å, 3 μm, MICHROM Bioresources) in-house packed into a silica capillary emitter (100 μm ID, 100 mm resin length). LC gradient was generated by a Dionex Ultimate 3000 nanoLC system (Thermo Scientific), with mobile phase A: 0.1% formic acid and B: 0.1% formic acid in acetonitrile. Mobile phase gradient: 2% B at 0–15 min, 30% B at 81 min, 35% B at 85 min, 40% B at 87 min, 60% B at 95 min, 80% B at 96–107 min and 2% B at 108–120 min. Flow rate: 600 nl/min at 0–13.5 min, 250 nl/min at 13.5–120 min. Peptide eluents were sprayed online with a nano-electrospray ion source (Thermo Scientific) at spray voltage of 1.5 kV and capillary temperature of 250 °C. High-resolution MS analysis was performed on a QExactive Quadrupole-Orbitrap Hybrid mass spectrometer (Thermo Scientific), operating in data-dependent mode with dynamic exclusion of 30 s. Full-scan MS was acquired at an m/z range of 300–1650, resolution of 70,000, and automatic gain control target of 3 × 106 ions. The top 15 most intense ions were subsequently selected for higher-energy collisional dissociation fragmentation at resolution of 17,500, collision energy of 27 eV, and automatic gain control target of 1 × 105 ions. Proteome data analysis used Mascot (Matrix Science) and Proteome Discoverer (1.4, Thermo Scientific). The raw data were searched against the human proteome database (Uniprot, UP000005640) plus common contaminants. Static modification was cysteine carbamidomethylation; variable modifications were serine or threonine phosphorylation, methionine oxidation, and glutamine or asparagine deamination. Precursor mass tolerance was 20 p.p.m. and fragment mass tolerance, 0.05 Da. The maximum number of miscleavage sites allowed was 2. After peptide identification, precursor ion intensities were quantified manually in XCalibur using extracted ion chromatogram. Sequences of all primers used for cloning are provided in Supplementary Table 8. Flag–HA-AGO2 (FH-AGO2) was PCR amplified from pIRES-neo-Flag/HA AGO2 (Addgene catalogue number 10822) and subcloned into pcDNA3.1+. FH-AGO2 mutants were generated using a QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) or by cloning customized gBlocks (IDT) into the parental pcDNA3.1+ vector containing FH-AGO2 (sequence of all mutants provided in Supplementary Table 8). Stable expression of wild-type or mutant FH-AGO2 was achieved in one of two ways. In one, constructs were subcloned into pMSCV-puro (Clontech). In another, stable expression of AGO2 for RNA-seq and eCLIP experiments was achieved by cloning individual mutants into a modified pLJM1-EGFP vector (Addgene catalogue number 19319) where EGFP was resected using AgeI and BsrGI before blunt-end ligation. AGO2 constructs were introduced at the EcoRI cloning site. Flag–HA-AGO1 was subcloned from pIRESneo-Flag/HA AGO1 (Addgene catalogue number 10820) into pMSCV-PIG (Addgene catalogue number 21654). V5-tagged ANKRD52 (corresponding to NP_775866.2) was constructed by PCR amplification from HCT116 cDNA followed by cloning into pcDNA3.1+. cDNA clones for human PPP6C and CSNK1A1 were obtained from the Invitrogen Ultimate ORF LITE Library (Clone ID IOH7224 and IOH59150, respectively) and subcloned into pCAGIG (Addgene catalogue number 11159) using Gateway LR Clonase (Thermo Fisher). For tethering assays, a 5× BoxB sequence adapted from a previous report32 was designed as a gBlock (IDT) and cloned in the XbaI site of pGL3-Control (Promega) (sequence in Supplementary Table 8). For the λN constructs, a gBlock containing the λN peptide sequence with an HA tag32 was subcloned into pcDNA3.1-FH-AGO2, replacing the Flag–HA tag. To generate control plasmid expressing λN-HA peptide alone, the λN-HA sequence was PCR amplified and cloned into pcDNA3.1+. Active lentivirus was generated using FH-AGO2 mutants (WT, 5XA, S828A, and empty vector) cloned into a modified pLJM1 vector with EGFP resected. A viral packaging protocol analogous to that used for the lentiCRISPR lentivirus preparations was used. Recipient ANKRD52–/– HCT116EGFP-miR-19 cells were transduced at an MOI of approximately 0.2. Transduced cells were selected in puromycin for at least 10 days, before use in flow cytometry experiments (Fig. 2f). For experiments involving endogenous AGO2, HCT116EGFP-miR-19 cells were used. For analysis of FH-AGO2 miRNA or mRNA binding, cells stably expressing the indicated wild-type or mutant FH-AGO2 protein were first generated by infecting AGO2–/– HCT116 cells with MSCV retroviruses. Then, for each immunoprecipitation sample, 6 × 106 cells were seeded per 10-cm dish. Cells were harvested 48 h later by scraping in PBS. Pelleted cells were resuspended in 1 ml of a lysis buffer consisting of 25 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM MgCl , 0.5% NP-40, 1 mM DTT, a protease inhibitor cocktail (cOmplete, EDTA-free, Roche), and 250 U/ml Recombinant RNasin Ribonuclease Inhibitor (Promega). Cells were lysed on ice for 10 min. Samples were spun at 10,000g for 10 min. Supernatant fractions were retained. Protein concentration was determined using a Bio-Rad DC Protein Assay Kit, and all samples were adjusted to the same concentration with lysis buffer. Dynabeads Protein G (Thermo Fisher) were prepared by pre-incubating with 1.5 μg of antibody (either anti-Flag (F1804, Sigma) or anti-AGO2 (SAB4200085, Sigma)) and pre-blocking with 0.5 mg/ml BSA, 0.5 mg/ml yeast tRNA, and 0.2 mg/ml heparin. Each sample was incubated with 25 μl of prepared Dynabeads Protein G for 3 h at 4 °C. Samples were washed three times in lysis buffer. Captured protein was eluted from the beads using either 2.5 mg/ml 3× Flag peptide (Sigma) or 3.5 mg/ml AGO2 peptide (sequence derived from ref. 42, synthesized at the University of Texas Southwestern Protein Chemistry Technology Core) dissolved in lysis buffer. Eighty per cent of the eluate was harvested for RNA extraction and 20% was diluted with 2× Laemmli sample buffer for western blot analysis. For each immunoprecipitation, qRT–PCR assays were performed to determine input and immunoprecipitation levels for mature miRNAs and mRNA targets of interest. Western blot analysis determined the relative amount of AGO2 in the immunoprecipitation eluate. RNA quantity as a percentage of input was determined for all immunoprecipitation eluates and then normalized to the relative amount of protein captured in each eluate. Experiments to capture AGO2 loaded with miRNA were adapted from a previously published method30. ANKRD52+/+ and ANKRD52–/– HCT116EGFP-miR-19 cells were seeded at 1.35 × 107 cells per dish in six 15-cm dishes per cell line. Forty-eight hours later, cells from each dish were scraped in PBS, pelleted, and lysed on ice for 10 min in 1 ml of a buffer containing 25 mM Tris-HCl (pH 8.0), 150 mM NaCl, 2 mM MgCl , 0.5% NP-40, 1 mM DTT, a protease inhibitor cocktail (cOmplete, EDTA-free, Roche), a phosphatase inhibitor cocktail (PhosStop, Roche), and 250 U/ml Recombinant RNasin Ribonuclease Inhibitor (Promega). Lysates were spun at 10,000g for 10 min and supernatants were further diluted with one volume of lysis buffer. To assess binding of AGO2 to the target mimic, 1.8 ml of each lysate was incubated with 50 μl of washed Dynabeads MyOne Streptavidin C1 (Thermo Fisher) pre-loaded with 300 pmol of wild-type or mutant RNA oligonucleotide (Supplementary Table 8) and pre-blocked with 1 mg/ml BSA, 0.5 mg/ml yeast tRNA, and 0.2 mg/ml heparin. To assess AGO2 phosphorylation after immunoprecipitation, 1.8 ml of each lysate was incubated with 50 μl of washed Dynabeads Protein G (Thermo Fisher) pre-incubated with 5 μl of anti-AGO2 antibody (SAB4200085, Sigma42) and pre-blocked as noted previously. Lysates were incubated with beads for 3 h at room temperature. Beads were washed four times in lysis buffer before 50 μl of 2× Laemmli sample buffer was added. Phos-tag electrophoresis was performed on captured protein complexes and on input protein samples subjected to chloroform–methanol precipitation41. The 293T cells were seeded in 24-well plates using 7.5 × 104 cells per well. Cells were transfected the following day using FuGENE HD and 301 ng of total plasmid. Each transfection consisted of 1 ng of phRL-SV40 (Promega), 20 ng of pGL3-Control or pGL3-BoxB, 150 ng of pcDNA3.1+ (expressing tethered or untethered proteins), and 130 ng of empty pcDNA3.1+. Cells were harvested 24 h later for luciferase activity assays using a Dual-Luciferase Reporter Assay System (Promega). Firefly luciferase activity was normalized to Renilla luciferase activity in each well to control for variation in transfection efficiency. Biological triplicates were performed for each transfection. ANKRD52–/– HCT116EGFP-miR-19 cells were seeded in six-well dishes at 6 × 105 cells per well. The following day, cells were treated with 10, 50, or 200 nM rapamycin for 72 h (fresh medium with rapamycin was exchanged at 48 h). Cells were harvested in 2× Laemmli sample buffer at the experimental endpoint. AGO2–/– cells were infected with MSCV retroviral constructs to stably express FH-AGO2WT or FH-AGO25XA. FH-AGO2-expressing cells were seeded using 1.5 × 107 cells per dish in 15-cm dishes with three dishes per cell line. Lysates were generated using methods similar to the co-immunoprecipitation assays, with the exception that 2 ml of lysis buffer was used per dish. Lysates were diluted with one volume of lysis buffer. FH-AGO2 was immunoprecipitated using 9 μg of anti-Flag antibody (F1804, Sigma) and 150 μl of washed Dynabeads. Samples were rotated at 4 °C overnight. Beads were washed three times with lysis buffer and then treated with lambda protein phosphatase (NEB) for 45 min. Beads were washed three times with lysis buffer and then resuspended in 100 μl reaction buffer composed of 25 mM Tris-HCl (pH 7.5), 10 mM MgCl , 2.5 mM DTT, 0.01% Triton X-100, 0.5 mg/ml BSA, 0.5 mM EGTA, 0.5 mM Na VO , 5 mM β-glycerophosphate, 170 ng of recombinant CSNK1A1 (PV3850, Thermo Fisher), and 200 μM [γ-32P]ATP (SA = 100–500 c.p.m./pmol). Reactions were incubated at 37 °C for 2 h. Beads were separated and mixed with 50 μl of 2× Laemmli sample buffer. SDS–PAGE was performed, and gels were stained using SimplyBlue SafeStain (Invitrogen). 32P signal was detected using a phosphor screen (GE Healthcare) and Typhoon FLA 7000 (GE Healthcare). In vitro CSNK1A1 kinase assays were performed using assay conditions adapted from the manufacturer’s recommendations (Recombinant CSNK1A1, PV3850, Thermo Fisher). All reactions were performed in a 50 μl volume for 90 min at 30 °C. Assay buffer was composed of 25 mM Tris-HCl (pH 7.5), 10 mM MgCl , 2.5 mM DTT, 0.01% Triton X-100, 0.5 mg/ml BSA, 0.5 mM EGTA, 0.5 mM Na VO , 5 mM β-glycerophosphate, 1 mM peptide (Supplementary Table 8), 170 ng of recombinant CSNK1A1, and 200 μM [γ-32P]ATP (SA = 100–500 c.p.m./pmol). Reactions were terminated using 75 mM H PO and spotted onto P81 phosphocellulose squares. Samples were washed four times in 75 mM H PO for 5 min per wash and immersed in acetone for 5 min before drying. 32P incorporation was assessed by Cerenkov counting. The linear form of ciRS-7 was constructed by amplifying the endogenous ciRS-7 locus from human genomic DNA (Roche) by PCR (Phusion Polymerase, Thermo Scientific) using primer sequences described previously36 (Supplementary Table 8). The PCR fragment was then cloned into the HindIII and NotI cloning sites of pcDNA3.1+ (Invitrogen). To generate the ciRS-7 construct capable of circularization, an ~800-bp region upstream of the splice acceptor was amplified using previously described primers36 (Supplementary Table 8) and inserted in the inverse orientation downstream of the linear ciRS-7 sequence at the XhoI cloning site of pcDNA3.1+. The effect of ciRS-7 expression on AGO2 phosphorylation was assessed through co-transfection experiments. Cells were seeded at a density of 9 × 105 cells per well in six-well dishes. Cells were transfected according to the manufacturer’s recommendations using Lipofectamine 2000 (Thermo Fisher). Where indicated, each well received 2 μg of plasmid and 10 nM miRNA mimics (miRIDIAN miRNA mimics, GE Dharmacon). Cells were harvested 28 h later for western blot analysis. Parental HCT116EGFP-miR-19, AGO2–/– HCT116EGFP-miR-19, ANKRD52–/– HCT116EGFP-miR-19, and ANKRD52–/–;CSNK1A1–/– HCT116EGFP-miR-19 cells were used for RNA-seq. Three independent clonal AGO2–/–, ANKRD52–/–, and ANKRD52–/–;CSNK1A1–/– knockout cell lines and three biological triplicates of parental cells were sequenced. Five hundred thousand cells were seeded per well in six-well dishes. Cells were harvested 48 h later, and RNA was extracted using a RNeasy Mini Kit (Qiagen) with an on-column DNase digestion. Sequencing libraries were generated using a TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) and run on a NextSeq 500 using a NextSeq 500/550 High Output v2 Kit, 75 cycle (Illumina). AGO2–/– HCT116EGFP-miR-19 cells generated using PX330 were reconstituted with either empty pLJM1 vector (with EGFP previously resected), FH-AGO2-WT (AGO2WT), or FH-AGO2-5XA (AGO25XA). Biological triplicates for each cell line were seeded with 5.0 × 105 cells per well in six-well dishes. Cells were collected 48 h later, and RNA was extracted using a miRNeasy Mini Kit (Qiagen) with an on-column DNase digestion. Sequencing libraries were generated using a TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat Low-throughput (LT) kit (Illumina) and run as performed in the previous RNA-seq experiment. Quality assessment of the RNA-seq data was done using the NGS-QC-Toolkit43 with default settings. Quality-filtered reads generated by the tool were then aligned to the human reference genome hg19 (for AGO2–/–, ANKRD52–/–, and ANKRD52–/–;CSNK1A1–/– RNA-seq experiments) or hg38 (for FH-AGO2 reconstitution experiments) using the TopHat2 (version 2.0.12) aligner44 using default settings. Read counts obtained from featureCounts45 were used as input for edgeR (version 3.8.6)46 for differential expression analysis. Genes with FDR ≤ 0.05 were regarded as differentially expressed for comparisons of each sample group. Cell culture, library preparation, and deep sequencing. AGO2–/– cells or AGO2–/– cells reconstituted with FH-AGO2WT or FH-AGO25XA via lentiviral expression (described above) were seeded in 15-cm dishes with five dishes per cell line at 1.0 × 107 cells per dish. Cells were cultured for 48 h and subsequently ultraviolet crosslinked at 400 mJ/cm2. Aliquots of 2.0 × 107 cells were then frozen at −80 °C. eCLIP was performed using the frozen samples as previously described37, using anti-Flag antibody for immunoprecipitations (F1804, Sigma). For each cell line, duplicate input and immunoprecipitation samples were prepared and sequenced. The RiL19 RNA adaptor (Supplementary Table 8) was used as the 3′ RNA linker for all samples. PAGE-purified DNA oligonucleotides were obtained from Sigma for the PCR library amplification step (Supplementary Table 8). PCR amplification was performed using between 11 and 15 cycles for all samples. Paired-end sequencing was performed on a NextSeq 500 using a NextSeq 500/550 High Output v2 Kit, 75 cycle (Illumina). Mapping deep sequencing reads. Adapters were trimmed from original reads using Cutadapt (version 1.9.1)47 with default settings. Next, the randomer sequence from the rand103Tr3 linker (Supplementary Table 8) was trimmed and recorded. TopHat2 (version 2.0.12)44 was used to align mate 2 to hg38. Only the uniquely mapped reads were retained. PCR duplicates were then removed using the randomer information with an in-house script. All reads remaining after PCR duplicate removal were regarded as usable reads and used for cluster calling. eCLIP cluster calling and annotation. eCLIP clusters were identified using a previously described method6 with the following modifications. Genome coverage by usable reads was determined at nucleotide resolution for each data set, and regions of continuous coverage greater than expected from a Poisson noise distribution were identified (P ≤ 0.001). For each region, read counts were obtained using Bedtools (version 2.17)48. If 50% of a read overlapped a region on the same strand, it was counted as a read covering that region. For each region, normalization to total usable reads was performed and a fold change between immunoprecipitation and input samples was calculated. Significant CLIP clusters in each data set were defined by (1) the presence of significantly greater coverage in the region than expected by chance on the basis of the Poisson distribution, and (2) log (fold change) of normalized reads in the cluster was ≥2 comparing immunoprecipitation to input. The final CLIP clusters for FH-AGO2WT and FH-AGO25XA were identified by first identifying significant clusters present in both experimental replicates. A region was considered to be present in both replicates if it occurred on the same strand and the replicate clusters overlapped by at least one-third of their total length. Significant clusters from both replicates were then merged to define the final cluster length. Lastly, all clusters identified in the AGO2–/– samples were subtracted to generate the final CLIP cluster calls (Supplementary Table 7). Clusters were annotated on the basis of their genomic locations (Ensembl GRCh38.85) if 55% of the cluster overlapped with a given genomic region. If a cluster was assigned to multiple annotations, the annotation was selected using the following priority: CDS exon > 3′ UTR > 5′ UTR > protein-coding gene intron > noncoding RNA exon > noncoding RNA intron > intergenic. Identification of active miRNA seed families and calculation of CLIP coverage at miRNA binding sites. Active miRNAs in HCT116 were identified using an approach similar to that described previously6 with the following modifications. The top 100 most highly expressed miRNAs in HCT116 cells were identified on the basis of a previously published small RNA sequencing experiment in this cell line49 and collapsed to 66 7-nucleotide seed families with identical sequence from nucleotides 2–8. Eight-nucleotide binding sites for these seeds, defined as in ref. 3, were identified in the 3′ UTRs of all expressed genes (FPKM > 0) using seqMap (version 1.0.12)50. The locations were then transformed to genomic coordinates and extended 10 nucleotides upstream and downstream to obtain a seed match region (excluding sites on exon–exon junctions). The numbers of crosslinking sites in these seed match regions for each miRNA seed family in FH-AGO2WT CLIP data were counted, normalized to the total usable reads in each replicate library, and averaged across replicates. To determine the significance cut-off, all possible 8-nucleotide sequences except for known miRNA seeds and those with four consecutive A, C, G, or T nucleotides were used to generate a null distribution. These background 8-nucleotide sequences were divided into 13 groups with 1,000 8-nucleotide sequences in the first 12 groups and 678 8-nucleotide sequences in the final group. CLIP crosslinking to each 8-nucleotide sequence in expressed 3′ UTRs was quantified as described above for actual miRNA seeds. An mRNA seed family was considered to be active in HCT116 cells if it obtained more crosslinking events than expected by chance, defined by the average number of crosslinking events from each of the 13 background 8-nucleotide groups above which P < 0.01. On the basis of this analysis, 15 active miRNA seed families were identified (representative miRNA: miR-423-5p, miR-17-5p, miR-200a-3p, miR-19a-3p, miR-23a-3p, miR-148a-3p, miR-221-3p, miR-125-5p, miR-182-5p, miR-21-5p, miR-30a-5p, miR-25-3p, let-7a-5p, miR-27a-3p, miR-24-3p). To quantify CLIP coverage of miRNA binding sites in FH-AGO2WT and FH-AGO25XA CLIP data (Fig. 6c), 8-, 7-, and 6-nucleotide binding sites, defined as in ref. 3, for all active miRNAs were identified within FH-AGO2WT CLIP clusters in 3′ UTRs using seqMap. Clusters with only a single type of binding site (8, 7, and 6 nucleotides) were identified. If an 8-nucleotide binding site was identified, this site was excluded from 7- or 6-nucleotide categories. Likewise, 7-nucleotide sites were excluded from the 6-nucleotide sites. Clusters were further filtered for those that were present in transcripts with FPKM > 0 in both FH-AGO2WT and FH-AGO25XA cell lines, yielding 228, 89, and 80 clusters containing 6, 7, or 8 nucleotides, respectively. For each cluster with a given type of binding site, CLIP coverage was calculated by determining the average number of CLIP reads in the cluster in each replicate normalized to the total number of reads in all clusters in each replicate, divided by FPKM of the transcript. The final reported CLIP coverage is the average of both replicates. To quantify CLIP coverage of miRNA binding sites in FH-AGO25XA-unique clusters versus FH-AGO2WT/FH-AGO25XA-common clusters (Extended Data Fig. 10e), 8-, 7-, and 6-nucleotide binding sites for all active miRNAs were identified within each class of CLIP cluster. Windows around each site were then extended 10 nucleotides upstream and downstream to obtain a seed match region. The numbers of crosslinking sites within these regions were counted and normalized to the total number of reads in clusters of each class (FH-AGO25XA-unique or FH-AGO2WT/FH-AGO25XA-common) to derive the CLIP coverage used to draw the CDF plots. CLIP coverage of FH-AGO25XA rescued versus non-rescued transcripts. Genes whose repression in AGO2–/– cells was rescued by FH-AGO25XA were defined by first identifying the genes that were significantly upregulated in AGO2–/– cells compared with parental HCT116 (FDR ≤ 0.05), then, among these genes, those that were significantly downregulated in FH-AGO25XA versus AGO2–/– (FDR ≤ 0.05). All other genes upregulated in AGO2–/– cells were considered not-rescued. The FH-AGO2WT CLIP coverage for each gene in these classes was calculated as the sum of all reads in CLIP clusters in a given 3′ UTR, normalized to total reads in all clusters, divided by the FPKM of the transcript. The final reported CLIP coverage (Extended Data Fig. 10d) is the average of both FH-AGO2WT replicates. mRNA half-life analysis. Half-lives of transcripts with FH-AGO25XA CLIP clusters in their 3′ UTRs were obtained from a previously published study38. Genes that had half-lives assigned to more than one RefSeq mRNA isoform were removed to avoid ambiguity. Genes in the top quartile of half-lives were defined as having a long half-life (n = 273) and genes in the bottom quartile of half-lives were defined as having a short half-life (n = 274). The total numbers of CLIP reads in clusters in a given 3′ UTR were obtained for each replicate, and edgeR (version 3.8.6)46 was used to calculate the normalized fold change of CLIP coverage comparing FH-AGO25XA with FH-AGO2WT (Extended Data Fig. 10f). All high-throughput sequencing data generated in the course of this study (CRISPR–Cas9 screens, RNA-seq, eCLIP) have been deposited in Gene Expression Omnibus under accession number GSE89946. All other data are available from the corresponding author upon reasonable request.


News Article | December 14, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Human skin tissue was obtained from healthy donors undergoing corrective breast or abdominal surgery after informed consent in accordance with our institutional guidelines. This study was approved by the Medical Ethics Review Committee of the Academic Medical Center. Split-skin grafts of 0.3 mm in thickness were obtained using a dermatome (Zimmer). After incubation with Dispase II (1 U ml−1, Roche Diagnostics), epidermal sheets were separated from the dermis and cultured in in Iscoves Modified Dulbeccos’s Medium (IMDM, Thermo Fischer Scientific) supplemented with 10% FCS, gentamycine (20 μg ml−1, Centrafarm), pencilline/streptomycin (10 U ml−1 and 10 μg ml−1, respectively; Invitrogen). Further LC purification was performed using a Ficoll gradient (Axis-shield) and CD1a microbeads (Miltenyl Biotec) as described before4, 10. Isolated LCs were routinely 90% pure and expressed high levels of Langerin and CD1a. MUTZ-LCs were differentiated from CD34+ human AML cell line MUTZ3 progenitors in the presence of GM-CSF (100 ng ml−1, Invitrogen), TGF-β (10 ng ml−1, R&D) and TNF-α (2.5 ng ml−1, R&D) and cultured as described before14. Immature DCs were differentiated from monocytes, isolated from buffy coats of healthy volunteer blood donors (Sanquin, The Netherlands), in the presence of IL-4 (500 U ml−1, Invitrogen) and GM-CSF (800 U ml−1, Invitrogen) and used at day 6 or 7 as previously described20. CD4+ T cells were obtained from peripheral blood mononuclear cells (PBMCs) activated with phytohaemagglutinin (1 mg ml−1; L2769, Sigma Aldrich) for 3 days, enriched for CD4+ T cells by negative selection using MACS beads (130-096-533, Miltenyi) and cultured overnight with IL-2 (20 U ml−1; 130-097-745, Miltenyi) as described before5. The following inhibitors were used: rapamycin (mTOR inhibitor, tlrl-rap, Invivogen), bafilomycin A1 (V-ATPase inhibitor; tlrl-baf1; Invivogen) and MG-132 (proteasome inhibitor; 474790; Calbiochem). All cell lines were obtained from ATCC and tested negative for mycoplasma contamination, determined in 3-day-old cell cultures by PCR. Langerin and Langerin mutant W264R expression plasmid pcDNA3.1 were obtained from Life Technologies and subcloned into lentiviral construct pWPXLd (Addgene). HIV-1-based lentiviruses were produced by co-transfection of 293T cells with the lentiviral vector construct, the packaging construct (psPAX2, Addgene) and vesicular stomatitis virus glycoprotein envelope (pMD2.G, Addgene) as described previously31. U87 cell lines stably expressing CD4 and wild-type CCR5 co-receptor (obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: U87 CD4+CCR5+ cells from H. K. Deng and D. R. Littman32) were transduced with HIV-1-based lentiviruses expressing sequences coding human TRIM5α33, rhesus TRIM5α33, wild-type Langerin or Langerin(W264R). NL4.3, NL4.3-BaL, SF162, NL4.3eGFP-BaL, NL4.3-BlaM-Vpr and VSV-G-pseudotyped NL4.3(ΔEnv) HIV-1 were generated as described10. All produced viruses were quantified by p24 ELISA (Perkin Elmer Life Sciences) and titrated using the indicator cells TZM-Bl. Primary LCs and MUTZ-LCs were infected with a multiplicity of infection of 0.2–0.4 and HIV-1 infection was assessed by flow cytometry at day 7 after infection by intracellular p24 staining. Double staining with CD1a (LCs marker; HI149-APC; BD Pharmigen) and p24 (KC57-RD1-PE; Beckman Coulter) was used to discriminate the percentage of CD1a+p24+ infected LCs. CD4+CCR5+ U87 parental or transduced cells were infected at a multiplicity of infection of 0.1–0.2 and HIV-1 infection was assessed at day 3 after infection by intracellular p24 staining or GFP expression. For analysis of transmission of HIV-1 to T cells, LCs were stringently washed 3 days after infection followed by co-culture with activated allogeneic CD4+ T cells for 3 days. Triple staining with CD1a (LCs marker), CD3 (T cells marker; 552851-PercP, BD Pharmigen) and p24 was used to discriminate the percentage of CD3+CD1a−p24+ infected T cells. HIV-1 infection and transmission was assessed by FACSCanto II flow cytometer (BD Biosciences) and data analysis was carried out with FlowJo software (Treestar). HIV-1 production was determined by a p24 antigen ELISA in culture supernatants (ZeptoMetrix). mRNA was isolated with an mRNA Capture kit (Roche) and cDNA was synthesized with a reverse-transcriptase kit (Promega). For real-time PCR analysis, PCR amplification was performed in the presence of SYBR green in a 7500 Fast Realtime PCR System (ABI). Specific primers were designed with Primer Express 2.0 (Applied Biosystems; Extended Data Table 1). The cycling threshold (C ) value is defined as the number of PCR cycles in which the fluorescence signal exceeds the detection threshold value. For each sample, the normalized amount of target mRNA (N ) was calculated from the C values obtained for both target and household (GAPDH, primary LCs, DCs and U87 cells lines; β-actin, MUTZ-LCs) mRNA with the equation N  = 2Ct(control) − Ct(target). For relative mRNA expression, control siRNA sample was set at 1 within the experiment and for each donor. A two-step Alu-long terminal repeat (LTR) PCR was used to quantify the integrated HIV-1 DNA in infected cells as previously described20. Total cell DNA was isolated at 16 h after infection (multiplicity of infection of 0.4) with a QIAamp blood isolation kit (Qiagen). In the first round of PCR, the DNA sequence between HIV-1 LTR (LTR R region, extended with a marker region at the 5′ end) and the nearest Alu repeat was amplified (primer sequences, Extended Data Table 1). The second round was nested quantitative real-time PCR of the first-round PCR products using primers annealing to the aforementioned marker region in combination with another HIV-1-specific primer (LTR U5 region) by real-time quantitative PCR. Two different dilutions of the PCR products from the first-round of PCR were assayed to ensure that PCR inhibitors were absent. For monitoring the signal contributed by unintegrated HIV-1 DNA, the first-round PCR was also performed using the HIV-1-specific primer (LTR R region) only. HIV-1 integration was normalized relative to GAPDH DNA levels. For relative HIV-1 integration, control siRNA-infected cells (total signal; Supplementary Table 1) was set as 1 for one experiment or for each donor. A BlaM-Vpr-based assay was used to quantify fusion of HIV-1 to the host membrane in infected LCs as previously described10. LCs were infected with NL4.3-BlaM-Vpr for 2 h and then loaded with CCF2/AM (1 mM, LiveBLAzer FRET-B/G Loading Kit, Life technologies) in serum-free IMDM medium for 1 h at 25 °C. After washing, BlaM reaction was allowed to develop for 16 h at 22 °C in IMDM supplemented with 10% FCS and 2.5 mM anion transport inhibitor probenecid (Sigma Pharmaceuticals). HIV-1 fusion was determined by monitoring the changes in fluorescence of CCF2/AM dye, which reflect the presence of BlaM-Vpr into the cytoplasm of target cells upon viral fusion. The shift from green emission fluorescence (500 nm) to blue emission fluorescence (450 nm) of CCF2/AM dye was assessed by flow cytometer LSRFortessa (BD Biosciences) and data analysis was carried out with FlowJo software. Percentages of blue fluorescent CCF2/AM+ cells are depicted as percentage of HIV-1 fusion. A fluorescent bead adhesion assay was used to examine the ability of HIV-1 gp120-coated fluorescent beads to bind Langerin in CD4+CCR5+ U87 transfectants as previously described5. Binding was measured by FACSCanto II flow cytometer and data analysis was carried out with FlowJo software. Skin LCs and DCs were transfected with 50 nm siRNA with the transfection reagent DF4 (Dharmacon) whereas MUTZ-LCs, CD4+CCR5+ U87 parental or transduced cells were transfected with transfection reagent DF1 (Dharmacon) and were used for experiments 48–72 h after transfection. The siRNA (SMARTpool; Dharmacon) were specific for Atg5, (M-004374-04), Atg16L1 (M-021033), LSP-1 (M-012640-00), TRIM5α (M-007100-00) and non-targeting siRNA (D-001206-13) served as control. Langerin was silenced in MUTZ-LCs by electroporation with Neon Transfection System (ThermoFischer Scientific) using siRNA Langerin (10 μM siRNA, M-013059-01, SMARTpool; Dharmacon). Silencing of the aforementioned targets was verified by real-time PCR, flow cytometer and immunoblotting (Extended Data Figs 1d, e, 2a–k). Cells were pre-treated with bafilomycin A1 for 2 h or left untreated followed by incubation with HIV-1 for 16 h. Quantification of intracellular LC3 II levels by saponin extraction was performed as described before34, 35. LCs were washed in PBS and permeabilized with 0.05% saponin in PBS. Cells were incubated at 4 °C for 30 min with mouse anti-LC3 primary antibody (M152-3; MBL International) or with mouse anti-IgG1 isotype control (MOPC-21; BD Pharmingen) followed by incubation with Alexa Fluor 488-conjugated goat-anti mouse IgG antibody (A-21121, Life Technologies) in saponin buffer. Intracellular LC3 II levels were assessed by FACSScan or FACSCanto II flow cytometers (BD Biosciences) and data analysis was carried out with FlowJo. Cells were pre-treated with bafilomycin for 2 h or left untreated followed by incubation with HIV-1 for 4 h. Quantification of intracellular LC3 II levels by saponin extraction was performed as described before35. Whole-cell extracts were prepared using RIPA lysis buffer supplemented with protease inhibitors (9806; Cell Signalling). 20–30 μg of extract were resolved by SDS–PAGE (15%) and immunoblotted with LC3 (2G6; Nanotools) and β-actin (sc-81178; Santa Cruz) antibodies, followed by incubation with HRP-conjugated secondary rabbit-anti-mouse antibody (P0161; Dako) and luminol-based enhanced chemiluminescence (ECL) detection (34075; Thermo Scientific). For gel source data, see Supplementary Fig. 1. MUTZ-LCs (2 × 106) were incubated for 16 h with HIV-1 NL4.3 (multiplicity of infection, 0.5) or left untreated as a control, fixed in 4% paraformaldehyde and 1% glutaraldehyde in sodium cacodylate buffer for 10 min at room temperature followed by 24 h at 4 °C. After fixation, cells were collected by centrifugation and the pellet was washed in sodium cacodylate buffer. Cells were post-fixed for 1 h at 4 °C (1% osmium tetroxide, 0.8% potassium ferrocyanide in the same buffer), contrasted in 0.5% uranyl acetate, dehydrated in a graded ethanol series and embedded in epon LX112. Ultrathin sections were stained with uranylacetate/lead citrate and examined with a FEI Tecnai-12 transmission electron microscope. Numbers of autophagosomes per cell was determined in 50 cells for each condition counted by two independent researchers. LCs were left to adhere onto poly-l-lysine coated slides. Cells were fixed in 4% paraformaldehyde and permeabilized with PBS/0.1% saponin/1% BSA/1 mM Hepes. Cells were stained with anti-Langerin (AF2088; R&D Systems) and TRIM5α (ab109709; Abcam) antibodies followed by Alexa Fluor 647-conjugated anti-goat (A-21447; Life Technologies) and Alexa Fluor 488-conjugated anti-rabbit (A-21206; Life Technologies). For detection of autophagic vesicles, LCs were pre-loaded with the Cyto-ID Green detection autophagy reagent (ENZ-51031; Enzo Life Sciences), which was previously shown to specifically stain autophagic vesicles36 before adherence to microscope slides and stained with p24 (KC57-RD1-PE; Beckman Coulter) followed by Alexa-Fluor-546-conjugated anti-mouse (A-11003; Life Technologies). Nuclei were counterstained with Hoechst (10 μg ml−1; Molecular Probes). Single plane images were obtained by Leica TCS SP-8 X confocal microscope and data analysis was carried out with Leica LAS AF Lite (Leica Microsystems). Whole-cell extracts were prepared using RIPA lysis buffer supplemented with protease inhibitors. Atg16L1, DC-SIGN, Langerin, p62 and TRIM5α were immunoprecipitated from 40 μg of extract with anti- Atg16L1 (PM040; MBL International), DC-SIGN (AZN-D1)19, Langerin (10E2)5, p62 (ab56416; Abcam), TRIM5α (ab109709; Abcam), mouse IgG1 isotype control (MOPC-21; BD Pharmingen), mouse IgG2a isotype control (IC003A; R&D systems) and rabbit IgG control (sc-2077; Santa Cruz) coated on protein A/G PLUS agarose beads (sc-2003; Santa Cruz), washed twice with ice-cold RIPA lysis buffer and resuspended in Laemmli sample buffer (161-0747, Bio-Rad). Immunoprecipitated samples were resolved by SDS–PAGE (12.5%), and detected by immunoblotting with Atg5 (PM050; MBL), Atg16L1 (MBL), DC-SIGN (551186; BD Biosciences), Langerin (AF2088; R&D Systems), LSP-1 (3812S; Cell Signalling), TRIM5α (Abcam) and HIV-p24 (KC57-RD1-PE; Beckman Coulter) antibodies, followed by incubation with Clean-Blot IP Detection Kit-HRP (21232; Thermo Scientific) and ECL detection (34075; Thermo Scientific). Data acquisition was carried out with ImageQuant LAS 4000 (GE Healthcare). Immunoprecipitation with TRIM5α, Langerin, DC-SIGN, Atg16L1 and p62 pulls-down mostly the TRIM5α (approximately 56 kDa) form. Relative intensity of the bands was quantified using Image Studio Lite 5.2 software by normalizing β-actin and set at 1 in untreated cells. For gel source data, see Supplementary Fig. 1. Two-tailed Student’s t-test for paired observations (differences of stimulations within the same donor or cell-type) or unpaired observation (differences between U87 transfectants). Statistical analyses were performed using GraphPad 6.0 software and significance was set at P < 0.05 (*P < 0.05; **P < 0.01). The data that support the findings of this study are available from the corresponding author upon reasonable request.


News Article | February 22, 2017
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Animal experiments were neither randomized nor blinded. All animals used in this study (ADicerKO, Dicerlox/lox, or C57BL/6) were males and 6 months of age unless specifically indicated otherwise. All animal experiments were conducted in accordance with IRB protocols with respect to live vertebrate experimentation. Human serum was obtained from human subjects after obtaining IRB approval and patients were given informed consent. Mouse and human sera were centrifuged at 1,000g for 5 min and then at 10,000g for 10 min to remove whole cells, cell debris and aggregates. The serum was subjected to 0.1-μm filtration and ultracentrifuged at 100,000g for 1 h. Pelleted vesicles were suspended in 1× PBS, ultracentrifuged again at 100,000g for washing, resuspended in 1× PBS and prepared for electron microscopy and immune-electron microscopy or miRNA extraction. All in vitro experiments were carried out using exosome-free FBS. AML-12 cells were acquired from ATCC (cat no. CRL-2254) and were tested for mycoplasma contamination. Dicerfl/fl brown preadipocytes were generated as previously described16. For exosome loading, exosome preparations were isolated and diluted with PBS to final volume of 100 μl. Exosome electroporation was carried out by using a variation of a previously described technique45. Exosome preparations were mixed with 200 μl phosphate-buffered sucrose (272 mM sucrose 7 mM, K HPO ) with 10 nΜ of a miRNA mimic, and the mixture was pulsed at 500 mV with 250 μF capacitance using a Bio-Rad Gene Pulser (Bio-Rad). Electroporated exosomes were resuspended in a total volume of 500 μl PBS and added to the target cells. Isolated exosomes were subjected to immune-electron microscopy using standard techniques7. In brief, exosome suspensions were fixed with 2% glutaraldehyde supplemented with 0.15 M sodium cacodylate and post-fixed with 1% OsO . They were then dehydrated with ethanol and embedded in Epon 812. Samples were sectioned, post-stained with uranyl acetate and lead citrate, and examined with an electron microscope. For immune-electron microscopy, cells were fixed with a solution of 4% paraformaldehyde, 2% glutaraldehyde and 0.15 M sodium cacodylate and processed as above. Sections were probed with anti-CD63 (Santa Cruz Biotechnology, sc15363) or anti-CD9 (Abcam, ab92726) antibodies (or rabbit IgG as a control) and visualized with immunogold-labelled secondary antibodies. Immuno-electron microscopy analysis revealed that the isolated exosomes were 50–200 nM in diameter and stained positively for the tetraspanin exosome markers CD63 and CD9 (ref. 46). Exosomal concentration was assessed using the EXOCET ELISA assay (System Biosciences), which measured the esterase activity of cholesteryl ester transfer protein (CETP) activity. CETP is known to be enriched in exosomal membranes. The assay was calibrated using a known isolated exosome preparation (System Biosciences). Additionally, exosome preparations were subjected to the qNano system employing tunable resistive pulse sensing technology (IZON technologies) to measure the number and size distribution of exosomes. For total serum miRNA isolation, 100 μl of serum was obtained from ADicerKO mice or Lox littermates and miRNAs were isolated using an Exiqon miRCURY Biofluid RNA isolation kit following the manufacturer’s protocol. RNA was isolated from exosomal preparations using TRIzol, following the manufacturer’s protocol (Life Sciences). Subsequently, 50 ng of exosomal RNA was subjected to reverse transcription into cDNA by using a mouse miRNome profiler kit (System Biosciences). qPCR was then performed in 6-μl reaction volumes containing cDNA along with universal primers for each miRNA and SYBR Green PCR master mix (Bio-Rad). In line with previous research, for all serum and exosomal miRNA quantitative PCR reactions the C values were normalized using U6 snRNA as an internal control. To estimate miRNA abundance in fat tissue, data were normalized using the global average of expressed C values per sample47, as the snRNA U6 was differentially expressed between depots. For all quantitative PCR reactions involving gene expression calculations for FGF21, normalization was carried out by using the TATA-binding protein as an internal control. Differential expression analysis of the high-throughput −ΔC values was done using the Bioconductor limma package48 in R (www.r-project.org). Fold differences in comparisons were expressed as 2−ΔΔC . Ct Principal component analysis plots were created using R with the ggplot2 package. A detection threshold was set to C  = 34 for all mouse miRNA PCR reactions; no threshold was used for human miRNA PCR, according to the manufacturer’s recommendation (System Biosciences). An miRNA was plotted only if its raw C value was ≤34 in at least three samples, except for the brown pre-adipocyte and 4-week-old mouse experiments, in which the raw C only had to be ≤34 twice. miRNA −ΔC values were Z scored and heatmaps were created by Cluster 3.0 and TreeView programs as previously described49. Fat tissue transplantation was carried out as previously described50. In brief, 10-week-old male Lox donor mice (C57BL/6 males) were killed, and their inguinal, epididymal, and BAT fat depots were isolated, cut into several 20-mg pieces and transplanted into 10-week-old male ADicerKO mice (n = 5 male mice per group). Each recipient ADicerKO mice received the equivalent transplanted fat mass of two donor Lox control mice. Transplanted mice received post-surgical analgesic intraperitoneal injections (buprenorphine, 50 mg/kg) for 7 days. At day 12, a glucose tolerance test was performed after a 16-h fast by intraperitoneal injection of 2 g/kg glucose. All mice were killed after 14 days. All procedures were conducted in accordance with Institutional Animal Care and Use Committee regulations. An adenoviral Fgf21 3′ UTR reporter was created by cloning the 3′ UTR of Fgf21 into the pMir-Report vector. Subsequently, the luciferase-tagged 3′ UTR fragment was cloned into the adenoviral vector pacAd5-CMV-IRES-GFP, creating an adenovirus bearing the Fgf21 3′UTR reporter. Hsa-miR-302f-3′-UTR was created by cloning the synthesized Luc-miR-302f-3′-UTR fragment (Genescript) into the Viral Power Adenoviral Expression System (Invitrogen). In vitro bioluminescence was measured using a dual luciferase kit (Promega). Eight-week-old male ADicerKO or wild-type mice were injected intravenously with adenovirus bearing the 3′-UTR of Fgf21 fused to the luciferase gene to create two groups of liver-reporter mice—one with a ADicerKO background and one with a wild-type background. One day later, a third group of ADicerKO mice, which had also been injected intravenously with an adenovirus bearing the 3′-UTR of Fgf21 fused to the luciferase gene, were injected intravenously with exosomes isolated from the serum of wild-type mice. After 24 h, in vivo luminescence of the Fgf21 3′ UTR was measured using the IVIS imaging system (Perkin Elmer) by administering d-luciferin (20 mg/kg) according to the manufacturer’s protocol (Perkin Elmer). For the second group, 8-week-old male ADicerKO or wild-type mice were also transfected with adenovirus bearing the 3′ UTR of Fgf21 fused to the luciferase gene by intravenous injection. After 1 day, mice received an intravenous injection of exosomes isolated from the serum of either ADicerKO mice or ADicerKO mice reconstituted in vitro with 10 nM miR-99b by electroporation. Twenty-four hours later, in vivo luminescence was measured using the IVIS imaging system by administering d-luciferin (20 mg/kg) according to the manufacturer’s protocol (Perkin Elmer). Protocol 1. On day 0, adenovirus bearing either pre-hsa_miR-302f or lacZ mRNA (as a control) was injected directly into the BAT of 8-week-old male C57BL/6 mice. Hsa_miR-302f is human-specific and does not have a mouse homologue. This procedure was conducted under ketamine-induced anaesthesia. Four days later, the same mice were injected intravenously with an adenovirus bearing the 3′ UTR of miR-302f in-frame with the luciferase gene, thereby transducing the liver tissue of the mouse with this human 3′ UTR miRNA reporter. Suppression of the 3′ UTR miR-302f reporter would occur only if there was communication between the BAT-produced miRNA and the liver. In vivo luminescence was measured on day 6 using the IVIS imaging system as described above. Protocol 2. To assess specifically the role of exosomal miR-302f in the regulation of its target reporter in the liver, two separate cohorts of 8-week-old male C57BL/6 mice were generated. One cohort was injected with adenovirus bearing pre-miR-302f or lacZ directly into the BAT (the donor cohort); the second cohort was transfected with an adenovirus bearing the 3′ UTR reporter of this miR-302f in the liver, as described for Protocol 1 (the acceptor cohort). Serum was obtained on days 3 and 6 from the donor cohorts; the exosomes were isolated and then injected intravenously into the acceptor mice the next day (days 4 and 7). On day 8, in vivo luminescence was measured in the acceptor mice using the IVIS imaging system as described above. To test for the presence of adenovirus in the liver and BAT of C57BL/6 mice, 100 mg tissue was homogenized in 1 ml sterile 1× PBS. The homogenate was spun down and 150 μl cleared supernatant was used to isolate adenoviral DNA using the Nucleospin RNA and DNA Virus kit, following the manufacturer’s protocol (Takara). PCR was performed on 2 μl isolated adenoviral DNA using SYBR green to detect lacZ or miR-302f amplicons. For all PCR data obtained in the fat-tissue-transplantation experiment, an miRNA was considered to be present only if its mean C in the wild-type group was <34. We then identified those miRNAs that were significantly decreased in ADicerKO serum. For an miRNA to be considered restored after transplantation by a particular depot it had to be significantly increased from ADicerKO serum with a mean C  < 34 and its C had to be more than 50% of the way from ADicerKO to the wild type on the C scale. ANOVA tests were followed by two-tailed Dunn’s post-hoc analysis or Tukey’s multiple comparisons test to identify statistically significant comparisons. All t-tests and Mann–Whitney U-tests were two-tailed. P values less than 0.05 were considered significant. All ANOVA, t-tests, and area-under-the-curve calculations were carried out in GraphPad Prism 5.0. For miRDB analysis (http://www.mirdb.org), a search by target gene was performed against the mouse database. A target score of 85 was set to exclude potential false-positive interacting miRNAs. All high-throughput qRT–PCR data (raw C values), the code used to analyse them (in the free statistical software R), and its output (including supplementary tables, tables used to generate heatmaps, and statements in the text) can be freely downloaded and reproduced from https://github.com/jdreyf/fat-exosome-microrna. All other data are available from the corresponding author upon reasonable request.


MADISON, Wis.--(BUSINESS WIRE)--Soon scientists will be able to perform efficient DNA analysis right at their bench. Promega Corporation has announced the development of a benchtop capillary electrophoresis (CE) instrument in collaboration with Hitachi High-Technologies Corporation. The Spectrum Compact CE System meets small batch and single sample needs in DNA analysis and performs both sequencing and fragment analysis at a moment’s notice. The Spectrum Compact CE System allows laboratories of all sizes the freedom to carry out single nucleotide polymorphism, PCR sizing and microsatellite analysis, de novo sequencing, NGS validation, and mutation detection. This benchtop CE instrument runs up to 32 samples at once and features 4-capillary, 6-dye detection along with an integrated touch-screen for instrument operation. Plug-and-play prefilled reagent cartridges with a guided software user interface brings capillary electrophoresis capabilities to the hands of any scientist in the laboratory regardless of skill level or expertise. “This opens new possibilities to scientists seeking high quality DNA detection on a smaller scale,” says Doug Storts, Head of Research - Nucleic Acid Technologies at Promega. “This system supports the unique workflows of the lab versus the lab needing to batch samples as a work around and cost savings measure when using a high throughput instrument or service. When we ask for early input from labs worldwide, the consistent response we get from scientists is ‘thank you’.” The first prototype will be on display at the Advances in Genome Biology and Technology Meeting February 13-16, 2017. It will also be featured at the American Academy of Forensic Sciences Annual Meeting February 13-18, 2017. It is anticipated to be commercially available in the second half of 2017. The collaboration between Promega and Hitachi High-Technologies leverages the two companies’ respective strengths as the industry’s leading manufacturer of reagents and STR kits and the world’s chief developer of capillary electrophoresis, allowing them to offer a high-performing, high-value, compact capillary electrophoresis instrument. Promega will also release a new Sanger sequencing kit designed for the Spectrum Compact CE System that features increased base-calling accuracy and applies Promega expertise in enzymology, dye manufacturing and master mixes. The Spectrum Compact CE System joins the Promega Spectrum CE System to support laboratories worldwide and is for research use only. To learn more about the Spectrum Compact CE System, visit www.promega.com/NewSpectrumCompact. Hitachi High-Technologies Corporation, headquartered in Tokyo, Japan, is engaged in activities in a broad range of fields, including Science & Medical Systems, Electronic Device Systems, Industrial Systems, and Advanced Industrial Products. The company's consolidated sales for FY2015 were approx. JPY629 billion [USD6 billion]. For further information, visit http://www.hitachi-hitec.com/global/. Promega Corporation has provided products for DNA-based human identification for more than 25 years. Promega is a leader in providing innovative solutions and technical support to the life sciences industry. The company’s 3,500 products enable scientists worldwide to advance their knowledge in genomics, proteomics, cellular analysis, molecular diagnostics and human identification. Founded in 1978, the company is headquartered in Madison, WI, USA with branches in 16 countries and over 50 global distributors. For more information about Promega, visit www.promega.com.


News Article | February 22, 2017
Site: hosted2.ap.org

(AP) — The Supreme Court has sided with California-based Life Technologies Corp. in a patent infringement case that limits the international reach of U.S. patent laws. The justices ruled unanimously on Wednesday that the company's shipment of a single part of a patented invention for assembly in another country did not violate patent laws. Life Technologies supplied an enzyme used in DNA analysis kits to a plant in London and combined it with several other components to make kits sold worldwide. Wisconsin-based Promega Corp. sued, arguing that the kits infringed a U.S. patent. A jury awarded $52 million in damages to Promega. A federal judge set aside the verdict and said the law did not cover export of a single component.


News Article | February 22, 2017
Site: phys.org

The justices ruled unanimously that the company's shipment of a single part of a patented invention for assembly in another country did not violate patent laws. Life Technologies supplied an enzyme used in DNA analysis kits to a plant in London and combined it with several other components to make kits sold worldwide. Wisconsin-based Promega Corp. sued, arguing that the kits infringed a U.S. patent. A jury awarded $52 million in damages to Promega. A federal judge set aside the verdict and said the law did not cover export of a single component. The federal appeals specializing in patent cases reversed and reinstated the verdict. Patent laws are designed to prevent U.S. companies from mostly copying a competitor's invention and simply completing the final phase overseas to skirt the law. A violation occurs when "all or a substantial portion of the components of a patent invention" are supplied from the United States to a foreign location. Writing for the high court, Justice Sonia Sotomayor said the law addresses only the quantity of components, not the quality. That means the law "does not cover the supply of a single component of a multicomponent invention," Sotomayor said. Only seven justices took part in the ruling. Chief Justice John Roberts heard arguments in the case, but later withdrew after discovering he owned shares in the parent company of Life Technologies.


News Article | February 22, 2017
Site: www.sciencenewsdaily.org

(Reuters) - The U.S. Supreme Court on Wednesday cleared a subsidiary of biotech company Thermo Fisher Scientific Inc of infringing a genetic-testing kit patent held by Promega Corp, overturning a lower court's decision. The Supreme Court has sided with California-based Life Technologies Corp. in a patent infringement case that limits the international reach of U.S. patent laws. Thermo Fisher did not infringe genetic-testing patent, U.S. top court says (Reuters) - The U.S. Supreme Court on Wednesday cleared a subsidiary of biotech company Thermo Fisher Scientific Inc of infringing a genetic-testing kit patent held by Promega Corp, overturning ...


News Article | February 22, 2017
Site: www.reuters.com

(Reuters) - The U.S. Supreme Court on Wednesday cleared a subsidiary of biotech company Thermo Fisher Scientific Inc of infringing a genetic-testing kit patent held by Promega Corp, overturning a lower court's decision.

Loading Promega collaborators
Loading Promega collaborators