Torrance, CA, United States
Torrance, CA, United States

Time filter

Source Type

News Article | February 22, 2017
Site: www.nature.com

Pre-B acute lymphoblastic leukaemia (ALL) cells were obtained from patients who gave informed consent in compliance with the guidelines of the Internal Review Board of the University of California San Francisco (Supplementary Table 2). Leukaemia cells from bone marrow biopsy of patients with ALL were xenografted into sublethally irradiated NOD/SCID (non-obese diabetic/severe combined immunodeficient) mice via tail vein injection. After passaging, leukaemia cells were collected. Cells were cultured on OP9 stroma cells in minimum essential medium-α (MEMα; Invitrogen), supplemented with 20% fetal bovine serum (FBS), 2 mM l-glutamine, 1 mM sodium pyruvate, 100 IU/ml penicillin and 100 μg/ml streptomycin. Primary chronic myeloid leukaemia (CML) cases were obtained with informed consent from the University Hospital Jena in compliance with institutional internal review boards (including the IRB of the University of California San Francisco; Supplementary Table 3). Cells were cultured in Iscove’s modified Dulbecco’s medium (IMDM; Invitrogen) supplemented with 20% BIT serum substitute (StemCell Technologies); 100 IU/ml penicillin and 100 μg/ml streptomycin; 25 μmol/l β-mercaptoethanol; 100 ng/ml SCF; 100 ng/ml G-CSF; 20 ng/ml FLT3; 20 ng/ml IL-3; and 20 ng/ml IL-6. Human cell lines (Supplementary Table 2) were obtained from DSMZ and were cultured in Roswell Park Memorial Institute medium (RPMI-1640; Invitrogen) supplemented with GlutaMAX containing 20% FBS, 100 IU/ml penicillin and 100 μg/ml streptomycin. Cell cultures were kept at 37 °C in a humidified incubator in a 5% CO atmosphere. None of the cell lines used was found in the database of commonly misidentified cell lines maintained by ICLAC and NCBI Biosample. All cell lines were authenticated by STR profiles and tested negative for mycoplasma. BML275 (water-soluble) and imatinib were obtained from Santa Cruz Biotechnology and LC Laboratories, respectively. Stock solutions were prepared in DMSO or sterile water at 10 mmol/l and stored at −20 °C. Prednisolone and dexamethasone (water-soluble) were purchased from Sigma-Aldrich and were resuspended in ethanol or sterile water, respectively, at 10 mmol/l. Stock solutions were stored at −20 °C. Fresh solutions (pH-adjusted) of methyl pyruvate, OAA, 3-OMG (an agonist of TXNIP), d-allose (an agonist of TXNIP) and recombinant insulin (Sigma-Aldrich) were prepared for each experiment. DMS was obtained from Acros Organics, and fresh solutions (pH-adjusted) were prepared before each experiment. For competitive-growth assays, 5 mmol/l methyl pyruvate, 5 mmol/l dimethyl succinate (DMS) and 5 mmol/l OAA were used. The CNR2 agonist HU308 was obtained from Cayman Chemical. To avoid inflammation-related effects in mice, bone marrow cells were extracted from mice (Supplementary Table 4) younger than 6 weeks of age without signs of inflammation. All mouse experiments were conducted in compliance with institutional approval by the University of California, San Francisco Institutional Animal Care and Use Committee. Bone marrow cells were obtained by flushing cavities of femur and tibia with PBS. After filtration through a 70-μm filter and depletion of erythrocytes using a lysis buffer (BD PharmLyse, BD Biosciences), washed cells were either frozen for storage or subjected to further experiments. Bone marrow cells were cultured in IMDM (Invitrogen) with GlutaMAX containing 20% fetal bovine serum, 100 IU/ml penicillin, 100 μg/ml streptomycin and 50 μM β-mercaptoethanol. To generate pre-B ALL (Ph+ ALL-like) cells, bone marrow cells were cultured in 10 ng/ml recombinant mouse IL-7 (PeproTech) and retrovirally transformed by BCR–ABL1. BCR–ABL1-transformed pre-B ALL cells were propagated only for short periods of time and usually not for longer than 2 months to avoid acquisition of additional genetic lesions during long-term cell culture. To generate myeloid leukaemia (CML-like) cells, the myeloid-restricted protocol described previously30 was used. Bone marrow cells were cultured in 10 ng/ml recombinant mouse IL-3, 25 ng/ml recombinant mouse IL-6, and 50 ng/ml recombinant mouse SCF (PeproTech) and retrovirally transformed by BCR–ABL1. Immunophenotypic characterization was performed by flow cytometry. For conditional deletion, a 4-OHT-inducible, Cre-mediated deletion system was used. For retroviral constructs used, see Supplementary Table 5. Transfection of retroviral constructs (Supplementary Table 5) was performed using Lipofectamine 2000 (Invitrogen) with Opti-MEM medium (Invitrogen). Retroviral supernatant was produced by co-transfecting HEK 293FT cells with the plasmids pHIT60 (gag-pol) and pHIT123 (ecotropic env). Lentiviral supernatant was produced by co-transfecting HEK 293FT cells with the plasmids pCDNL-BH and VSV-G or EM140. 293FT cells were cultured in high glucose Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen) with GlutaMAX containing 10% fetal bovine serum, 100 IU/ml penicillin, 100 μg/ml streptomycin, 25 mmol/l HEPES, 1 mmol/l sodium pyruvate and 0.1 mmol/l non-essential amino acids. Regular medium was replaced after 16 h by growth medium containing 10 mmol /l sodium butyrate. After incubation for 8 h, the medium was changed back to regular growth medium. After 24 h, retroviral supernatant was collected, filtered through a 0.45-μm filter and loaded by centrifugation (2,000g, 90 min at 32 °C) onto 50 μg/ml RetroNectin- (Takara) coated non-tissue 6-well plates. Lentiviral supernatant produced with VSV-G was concentrated using Lenti-X Concentrator (Clontech), loaded onto RetroNectin-coated plates and incubated for 15 min at room temperature. Lentiviral supernatant produced with EM140 was collected, loaded onto RetroNectin-coated plates and incubated for 30 min at room temperature. Per well, 2–3 × 106 cells were transduced by centrifugation at 600g for 30 min and maintained for 48 h at 37 °C with 5% CO before transferring into culture flasks. For cells transduced with lentiviral supernatant produced with EM140, supernatant was removed the day after transduction and replaced with fresh culture medium. Cells transduced with oestrogen-receptor fusion proteins were induced with 4-OHT (1 μmol/l). Cells transduced with constructs carrying an antibiotic-resistance marker were selected with its respective antibiotic. For loss-of-function studies, dominant-negative variants of IKZF1 (DN-IKZF1, lacking the IKZF1 zinc fingers 1–4) and PAX5 (DN-PAX5; PAX5–ETV6 fusion) were cloned from patient samples. Expression of DN-IKZF1 was induced by doxycycline (1 μg/ml), while activation of DN-PAX5 was induced by 4-OHT (1 μg/ml) in patient-derived pre-B ALL cells carrying IKZF1 and PAX5 wild-type alleles, respectively. Inducible reconstitution of wild-type IKZF1 and PAX5 in haploinsufficient pre-B ALL cells carrying deletions of either IKZF1 (IKZF1∆) or PAX5 (PAX5∆) were also studied. Lentiviral constructs used are listed in Supplementary Table 5. A doxycycline-inducible TetOn vector system was used for inducible expression of PAX5 in mouse BCR–ABL1 pre-B ALL. The retroviral constructs used are listed in Supplementary Table 5. To study the effects of B-cell- versus myeloid-lineage identity in genetically identical mouse leukaemia cells, a doxycycline-inducible TetOn-CEBPα vector system31 was used to reprogram B cells. Mouse BCR–ABL1 pre-B ALL cells expressing doxycycline-inducible CEBPα or an empty vector were induced with doxycycline (1 μg/ml). Conversion from the B-cell lineage (CD19+Mac1−) to the myeloid lineage (CD19−Mac1+) was monitored by flow cytometry. For western blots, B-lineage cells (CD19+Mac1−) and CEBPα-reprogrammed cells (CD19−Mac1+) were sorted from cells expressing an empty vector or CEBPα, respectively, following doxycycline induction. For metabolic assays, sorted B-lineage cells and CEBPα-reprogrammed cells were cultured (with doxycycline) for 2 days following sorting, and were then seeded in fresh medium for measurement of glucose consumption (normalized to cell numbers) and total ATP levels (normalized to total protein). To study Lkb1 deletion in the context of CEBPα-mediated reprogramming, BCR–ABL1-transformed Lkb1fl/fl pre-B ALL cells expressing doxycycline-inducible CEBPα were transduced with 4-OHT(1 μg/ml) inducible Cre-GFP (Cre-ERT2-GFP). Without sorting for GFP+ cells, cells were induced with doxycycline and 4-OHT. Viability (expressed as relative change of GFP+ cells) was measured separately in B-lineage (gated on CD19+ Mac1−) and myeloid lineage (gated on CD19− Mac1+) populations. To study whether Lkb1 deletion causes CEBPα-dependent effects on metabolism and signalling, Lkb1fl/fl BCR–ABL1 B-lineage ALL cells expressing doxycycline-inducible CEBPα or an empty vector were transduced with 4-OHT-inducible Cre-GFP. After sorting for GFP+ populations, cells were induced with doxycycline. B-lineage cells (CD19+ Mac1−) and CEBPα-reprogrammed cells (CD19− Mac1+) were sorted from cells expressing an empty vector or CEBPα, respectively. Sorted cells were cultured with doxycycline and induced with 4-OHT. Protein lysates were collected on day 2 following 4-OHT induction. For metabolomics, sorted cells were re-seeded in fresh medium on day 2 following 4-OHT induction and collected for metabolite extraction. For CRISPR/Cas9-mediated deletion of target genes, all constructs including lentiviral vectors expressing gRNA and Cas9 nuclease were purchased from Transomic Technologies (Supplementary Table 5; see Supplementary Table 6 for gRNA sequences). In brief, patient-derived pre-B ALL cells transduced with GFP-tagged, 4-OHT-inducible PAX5 or an empty vector were transduced with pCLIP-hCMV-Cas9-Nuclease-Blast. Blasticidin-resistant cells were subsequently transduced with pCLIP-hCMV-gRNA-RFP. Non-targeting gRNA was used as control. Constructs including lentiviral vectors expressing gRNA and dCas9-VPR used for CRISPR/dCas9-mediated activation of gene expression are listed in Supplementary Table 5. Nuclease-null Cas9 (dCas9) fused with VP64-p65-Rta (VPR) was cloned from SP-dCas9-VPR (a gift from G. Church; Addgene plasmid #63798) and then subcloned into pCL6 vector with a blasticidin-resistant marker. gRNA sequences (Supplementary Table 6) targeting the transcriptional start site of each specific gene were obtained from public databases (http://sam.genome-engineering.org/ and http://www.genscript.com/gRNA-database.html)32. gBlocks Gene Fragments were used to generate single-guide RNAs (sgRNAs) and were purchased from Integrated DNA Technologies, Inc. Each gRNA was subcloned into pCL6 vector with a dsRed reporter. Patient-derived pre-B ALL cells transduced with either GFP-tagged inducible PAX5 or an empty vector were transduced with pCL6-hCMV-dCas9-VPR-Blast. Blasticidin-resistant cells were used for subsequent transduction with pCL6-hCMV-gRNA-dsRed, and dsRed+ cells were further analysed by flow cytometry. For each target gene, 2–3 sgRNA clones were pooled together to generate lentiviruses. Non-targeting gRNA was used as control. To elucidate the mechanistic contribution of PAX5 targets, the percentage of GFP+ cells carrying gRNA(s) for each target gene was monitored by flow cytometry upon inducible activation of GFP-tagged PAX5 or an empty vector in patient-derived pre-B ALL cells in competitive-growth assays. Cells were lysed in CelLytic buffer (Sigma-Aldrich) supplemented with a 1% protease inhibitor cocktail (Thermo Fisher Scientific). A total of 20 μg of protein mixture per sample was separated on NuPAGE (Invitrogen) 4–12% Bis-Tris gradient gels or 4–20% Mini-PROTEAN TGX precast gels, and transferred onto nitrocellulose membranes (Bio-Rad). The primary antibodies used are listed in Supplementary Table 7. For protein detection, the WesternBreeze Immunodetection System (Invitrogen) was used, and light emission was detected by either film exposure or the BioSpectrum Imaging system (UPV). Approximately 106 cells per sample were resuspended in PBS blocked using Fc blocker for 10 min on ice, followed by staining with the appropriate dilution of the antibodies or their respective isotype controls for 15 min on ice. Cells were washed and resuspended in PBS with propidium iodide (0.2 μg/ml) or DAPI (0.75 μg/ml) as a dead-cell marker. The antibodies used for flow cytometry are listed in Supplementary Table 7. For competitive-growth assays, the percentage of GFP+ cells was monitored by flow cytometry. For annexin V staining, annexin V binding buffer (BD Bioscience) was used instead of PBS and 7-aminoactinomycin D (7AAD; BD Bioscience) instead of propidium iodide. Phycoerythrin-labelled annexin V was purchased from BD Bioscience. For BrdU staining, the BrdU Flow Kit was purchased from BD Bioscience and used according to the manufacturer’s protocol. Methylcellulose colony-forming assays were performed with 10,000 BCR–ABL1 pre-B ALL cells. Cells were resuspended in mouse MethoCult medium (StemCell Technologies) and cultured on 3-cm dishes, with an extra water supply dish to prevent evaporation. Images were taken and colony numbers were counted after 14 days. Cell viability upon the genetic loss of function of target genes and/or inducible expression of PAX5 was monitored by flow cytometry using propidium iodide (0.2 μg/ml) as a dead-cell marker. To study the effects of an AMPK inhibitor (BML275), glucocorticoids (dexamethasone and prednisolone), CNR2 agonist (HU308), or TXNIP agonists (3-OMG and d-allose), 40,000 human or mouse leukaemia cells were seeded in a volume of 80 μl in complete growth medium on opaque-walled, white 96-well plates (BD Biosciences). Compounds were added at the indicated concentrations giving a total volume of 100 μl per well. After culturing for 3 days, cells were subjected to CellTiter-Glo Luminescent Cell Viability Assay (Promega). Relative viability was calculated using baseline values of cells treated with vehicle control as a reference. Combination index (CI) was calculated using the CalcuSyn software to determine interaction (synergistic, CI < 1; additive, CI = 1; or antagonistic, CI > 1) between the two agents. Constant ratio combination design was used. Concentrations of BML275, d-allose, 3-OMG and HU308 used are indicated in the figures. Concentrations of Dex used were tenfold lower than those of BML275. Concentrations of prednisolone used were twofold lower than those of BML275. To determine the number of viable cells, the trypan blue exclusion method was applied, using the Vi-CELL Cell Counter (Beckman Coulter). ChIP was performed as described previously33. Chromatin from fixed patient-derived Ph+ ALL cells (ICN1) was isolated and sonicated to 100–500-bp DNA fragments. Chromatin fragments were immunoprecipitated with either IgG (as a control) or anti-Pax5 antibody (see Supplementary Table 7). Following reversal of crosslinking by formaldehyde, specific DNA sequences were analysed by quantitative real-time PCR (see Supplementary Table 8 for primers). Primers were designed according to ChIP–seq tracks for PAX5 antibodies in B lymphocytes (ENCODE, Encyclopedia of DNA Elements, GM12878). ChIP–seq tracks for PAX5, IKZF1, EBF1 and TCF3 antibodies in a normal B-cell sample (ENCODE GM12878, UCSC genome browser) on INSR, GLUT1, GLUT3, GLUT6, HK2, G6PD, NR3C1, TXNIP, CNR2 and LKB1 gene promoter regions are shown. CD19 and ACTA1 served as a positive and a negative control gene, respectively. The y axis represents the normalized number of reads per million reads for peak summit for each track. The ChIP–seq peaks were called by the MACS peak-caller by comparing read density in the ChIP experiment relative to the input chromatin control reads, and are shown as bars under each wiggle track. Gene models are shown in UCSC genome browser hg19. Extracellular glucose levels were measured using the Amplex Red Glucose/Glucose Oxidase Assay Kit (Invitrogen), according to the manufacturer’s protocol. Glucose concentrations were measured in fresh and spent medium. Total ATP levels were measured using the ATP Bioluminescence Assay Kit CLS II (Roche) according to the manufacturer’s protocol. In fresh medium, 1 × 106 cells per ml were seeded and treated as indicated in the figure legends. Relative levels of glucose consumed and total ATP are shown. All values were normalized to cell numbers (Figs 1b, c, 2c (glucose uptake), 3a and Extended Data Figs 2c, 4f, 6d) or total protein (Fig. 2c, ATP levels). Numbers of viable cells were determined by applying trypan blue dye exclusion, using the Vi-CELL Cell Counter (Beckman Coulter). Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using a Seahorse XFe24 Flux Analyzer with an XF Cell Mito Stress Test Kit and XF Glycolysis Stress Test Kit (Seahorse Bioscience) according to the manufacturer’s instructions. All compounds and materials were obtained from Seahorse Bioscience. In brief, 1.5 × 105 cells per well were plated using Cell-Tak (BD Biosciences). Following incubation in XF-Base medium supplemented with glucose and GlutaMAX for 1 h at 37 °C (non-CO incubator) for pH stabilization, OCR was measured at the resting stage (basal respiration in XF Base medium supplemented with GlutaMax and glucose) and in response to oligomycin (1 μmol/l; mitochondrial ATP production), mitochondrial uncoupler FCCP (5 μmol/l; maximal respiration), and respiratory chain inhibitor antimycin and rotenone (1 μmol/l). Spare respiratory capacity is the difference between maximal respiration and basal respiration. ECAR was measured under specific conditions to generate glycolytic profiles. Following incubation in glucose-free XF Base medium supplemented with GlutaMAX for 1 h at 37 °C (non-CO incubator) for pH stabilization, basal ECAR was measured. Following measurement of the glucose-deprived, basal ECAR, changes in ECAR upon the sequential addition of glucose (10 mmol/l; glycolysis), oligomycin (1 μmol/l; glycolytic capacity), and 2-deoxyglucose (0.1 mol/l) were measured. Glycolytic reserve was determined as the difference between oligomycin-stimulated glycolytic capacity and glucose-stimulated glycolysis. All values were normalized to cell numbers (Extended Data Fig. 2c) or total protein (Extended Data Figs 3a, 7a, b 8f) and are shown as the fold change relative to basal ECAR or OCR. Metabolite extraction and mass-spectrometry-based analysis were performed as described previously34. Metabolites were extracted from 2 × 105 cells per sample using the methanol/water/chloroform method. After incubation at 37 °C for the indicated time, cells were rinsed with 150 mM ammonium acetate (pH 7.3), and 400 μl cold 100% methanol (Optima* LC/MS, Fisher) and then 400 μl cold water (HPLC-Grade, Fisher) was added to cells. A total of 10 nmol norvaline (Sigma) was added as internal control, followed by 400 μl cold chloroform (HPLC-Grade, Fisher). Samples were vortexed three times over 15 min and spun down at top speed for 5 min at 4 °C. The top layer (aqueous phase) was transferred to a new Eppendorf tube, and samples were dried on Vacufuge Plus (Eppendorf) at 30 °C. Extracted metabolites were stored at −80 °C. For mass spectrometry-based analysis, the metabolites were resuspended in 70% acetonitrile and 5 μl used for analysis with a mass spectrometer. The mass spectrometer (Q Exactive, Thermo Scientific) was coupled to an UltiMate3000 RSLCnano HPLC. The chromatography was performed with 5 mM NH AcO (pH 9.9) and acetonitrile at a flow rate of 300 μl/min starting at 85% acetonitrile, going to 5% acetonitrile at 18 min, followed by an isocratic step to 27 min and re-equilibration to 34 min. The separation was achieved on a Luna 3u NH2 100A (150 × 2 mm) (Phenomenex). The Q Exactive was run in polarity switching mode (+3 kV/−2.25 kV). Metabolites were detected based on retention time (t ) and on accurate mass (± 3 p.p.m.). Metabolite quantification was performed as area-under-the-curve (AUC) with TraceFinder 3.1 (Thermo Scientific). Data analysis was performed in R (https://www.r-project.org/), and data were normalized to the number of cells. Relative amounts were log -transformed, median-centred and are shown as a heat map. To generate a model for pre-leukaemic B cell precursors expressing BCR–ABL1, BCR–ABL1 knock-in mice were crossed with Mb1-Cre deleter strain (Mb1-Cre; Bcr+/LSL-BCR/ABL) for excision of a stop-cassette in early pre-B cells. Bone marrow cells collected from Mb1-Cre; Bcr+/LSL-BCR/ABL mice cultured in the presence of IL-7 were primed with vehicle control or a combination of OAA (8 mmol/l), DMS (8 mmol/l) and insulin (210 pmol/l). Following a week of priming, cells were maintained and expanded in the presence of IL-7, supplemented with vehicle control or a combination of OAA (0.8 mmol/l) and DMS (0.8 mmol/l) for 4 weeks. Pre-B cells from Mb1-Cre; Bcr+/LSL-BCR/ABL mice expressed low levels of BCR–ABL1 tagged to GFP, and were analysed by flow cytometry for surface expression of GFP and CD19. The methylcellulose colony-forming assays were performed with 10,000 cells treated with vehicle control or metabolites. Cells were resuspended in mouse MethoCult medium (StemCell Technologies) and cultured on 3-cm diameter dishes, with an extra water supply dish to prevent evaporation. Images were taken and colony numbers counted after 14 days. For in vivo transplantation experiments, cells were treated with vehicle control or metabolites (OAA/DMS) for 6 weeks. One million cells were intravenously injected into sublethally irradiated (250 cGy) 6–8-week-old female NSG mice (n = 7 per group). Mice were randomly allocated into each group, and the minimal number of mice in each group was calculated by using the ‘cpower’ function in R/Hmisc package. No blinding was used. Each mouse was killed when it became terminally sick and showed signs of leukaemia burden (hunched back, weight loss and inability to move). The bone marrow and spleen were collected for flow cytometry analyses for leukaemia infiltration (CD19, B220). After 63 days, all remaining mice were killed and bone marrow and spleens from all mice were analysed by flow cytometry. Statistical analysis was performed using the Mantel–Cox log-rank test. All mouse experiments were in compliance with institutional approval by the University of California, San Francisco Institutional Animal Care and Use Committee. Following cytokine-independent proliferation, BCR–ABL1-transformed Lkb1fl/fl or AMPKa2fl/fl pre-B ALL cells were transduced with 4-OHT-inducible Cre or an empty vector control. For ex vivo deletion, deletion was induced 24 h before injection. For in vivo deletion, deletion was induced by 4-OHT (0.4 mg per mouse; intraperitoneal injection). Approximately 106 cells were injected into each sublethally irradiated (250 cGy) NOD/SCID mouse. Seven mice per group were injected via the tail vein. We randomly allocated 6–8-week-old female NOD/SCID or NSG mice into each group. The minimal number of mice in each group was calculated using the ‘cpower’ function in R/Hmisc package. No blinding was used. When a mouse became terminally sick and showed signs of leukaemia burden (hunched back, weight loss and inability to move), it was killed and the bone marrow and/or spleen were collected for flow cytometry analyses for leukaemia infiltration. Statistical analysis was performed by Mantel–Cox log-rank test. In vivo expansion and leukaemia burden were monitored by luciferase bioimaging. Bioimaging of leukaemia progression in mice was performed at the indicated time points using an in vivo IVIS 100 bioluminescence/optical imaging system (Xenogen). d-luciferin (Promega) dissolved in PBS was injected intraperitoneally at a dose of 2.5 mg per mouse 15 min before measuring the luminescence signal. General anaesthesia was induced with 5% isoflurane and continued during the procedure with 2% isoflurane introduced through a nose cone. All mouse experiments were in compliance with institutional approval by the University of California, San Francisco Institutional Animal Care and Use Committee. Data are shown as mean ± s.d. unless stated. Statistical significance was analysed by using Grahpad Prism software or R software (https://www.r-project.org/) by using two-tailed t-test, two-way ANOVA, or log-rank test as indicated in figure legends. Significance was considered at P < 0.05. For in vitro experiments, no statistical methods were used to predetermine the sample size. For in vivo transplantation experiments, the minimal number of mice in each group was calculated through use of the ‘cpower’ function in the R/Hmisc package. No animals were excluded. Overall survival and relapse-free survival data were obtained from GEO accession number GSE11877 (refs 35, 36) and TCGA. Kaplan–Meier survival analysis was used to estimate overall survival and relapse-free survival. Patients with high risk pre-B ALL (COG clinical trial, P9906, n = 207; Supplementary Table 10) were segregated into two groups on the basis of high or low mRNA levels with respect to the median mRNA values of the probe sets for the gene of interest. A log-rank test was used to compare survival differences between patient groups. R package ‘survival’ Version 2.35-8 was used for the survival analysis and Cox proportional hazards regression model in R package for the multivariate analysis (https://www.r-project.org/). The investigators were not blinded to allocation during experiments and outcome assessment. Experiments were repeated to ensure reproducibility of the observations. Gel scans are provided in Supplementary Fig. 1. Gene expression data were obtained from the GEO database accession numbers GSE32330 (ref. 12), GSE52870 (ref. 37), and GSE38463 (ref. 38). Patient-outcome data were derived from the National Cancer Institute TARGET Data Matrix of the Children’s Oncology Group (COG) Clinical Trial P9906 (GSE11877)35, 36 and from TCGA (the Cancer Genome Atlas). GEO accession details are provided in Supplementary Tables 9 and 10. ChIP–seq tracks for PAX5, IKZF1, EBF1 and TCF3 antibodies in a normal B-cell sample (ENCODE GM12878, UCSC genome browser) on INSR, GLUT1, GLUT3, GLUT6, HK2, G6PD, NR3C1, TXNIP, CNR2 and LKB1 gene promoter regions are shown in UCSC genome browser hg19. All other data are available from the corresponding author upon reasonable request.


No statistical methods were used to predetermine sample size for biochemical or cell-based assays, or for pharmacokinetic studies. Investigators were not blinded to outcome assessment during these investigations. For GS-5734 efficacy assessments in nonhuman primates, statistical power analysis was used to predetermine sample size, and subjects were randomly assigned to experimental group, stratified by sex and balanced by body weight. Study personnel responsible for assessing animal health (including euthanasia assessment) and administering treatments were experimentally blinded to group assignment of animals and outcome. GS-5734, Nuc, and NTP were synthesized at Gilead Sciences, Inc., and chemical identity and sample purity were established using NMR, HRMS, and HPLC analysis (Supplementary Information). The radiolabelled analogue [14C]GS-5734 (specific activity, 58.0 mCi mmol−1) was obtained from Moravek Biochemicals (Brea, California) and was prepared in a similar manner described for GS-5734 using [14C]trimethylsilylcyanide (Supplementary Information). Small molecule X-ray crystallographic coordinates and structure factor files have been deposited in the Cambridge Structural Database (http://www.ccdc.cam.ac.uk/) and accession numbers are supplied in the Supplementary Information. RSV A2 was purchased from Advanced Biotechnologies, Inc. EBOV (Kikwit and Makona variants), Sudan virus (SUDV, Gulu), Marburg virus (MARV, Ci67), Junín virus (JUNV, Romero), Lassa virus (LASV, Josiah), Middle East respiratory syndrome virus (MERS, Jordan N3), Chikungunya virus (CHIV, AF 15561), and Venezuelan equine encephalitis virus (VEEV, SH3) were all prepared and characterized at the United States Army Medical Research Institute for infectious diseases (USAMRIID). EBOV containing a GFP reporter gene (EBOV–GFP), EBOV Makona (Liberia, 2014), and MARV containing a GFP reporter gene (MARV–GFP) were prepared and characterized at the Centers for Disease Control and Prevention26, 27. HEp-2 (CCL-23), PC-3 (CCL-1435), HeLa (CCL-2), U2OS (HTB-96), Vero (CCL-81), HFF-1 (SCRC-1041), and HepG2 (HB-8065) cell lines were purchased from the American Type Culture Collection. Cell lines were not authenticated and were not tested for mycoplasma as part of routine use in assays. HEp-2 cells were cultured in Eagle’s Minimum Essential Media (MEM) with GlutaMAX supplemented with 10% fetal bovine serum (FBS) and 100 U ml−1 penicillin and streptomycin. PC-3 cells were cultured in Kaighn’s F12 media supplemented with 10% FBS and 100 U ml−1 penicillin and streptomycin. HeLa, U2OS, and Vero cells were cultured in MEM supplemented with 10% FBS, 1% l-glutamine, 10 mM HEPES, 1% non-essential amino acids, and 1% penicillin/streptomycin. HFF-1 cells were cultured in MEM supplemented with 10% FBS and 0.5 mM sodium pyruvate. HepG2 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) with GlutaMAX supplemented with 10% FBS, 100 U ml−1 penicillin and streptomycin, and 0.1 mM non-essential amino acids. The MT-4 cell line was obtained from the NIH AIDS Research and Reference Reagent Program and cultured in RPMI-1640 medium supplemented with 10% FBS, 100 U ml−1 penicillin and streptomycin, and 2 mM l-glutamine. The Huh-7 cell line was obtained from C. M. Rice (Rockefeller University) and cultured in DMEM supplemented with 10% FBS, 100 U ml−1 penicillin and streptomycin, and non-essential amino acids. Primary human hepatocytes were purchased from Invitrogen and cultured in William’s Medium E medium containing cell maintenance supplement. Donor profiles were limited to 18- to 65-year-old nonsmokers with limited alcohol consumption. Upon delivery, the cells were allowed to recover for 24 h in complete medium with supplement provided by the vendor at 37 °C. Human PBMCs were isolated from human buffy coats obtained from healthy volunteers (Stanford Medical School Blood Center, Palo Alto, California) and maintained in RPMI-1640 with GlutaMAX supplemented with 10% FBS, 100 U ml−1 penicillin and streptomycin. Rhesus fresh whole blood was obtained from Valley Biosystems. PBMCs were isolated from whole blood by Ficoll-Hypaque density gradient centrifugation. Briefly, blood was overlaid on 15 ml Ficoll-Paque (GE Healthcare Bio-Sciences AB), and centrifuged at 500g for 20 min. The top layer containing platelets and plasma was removed, and the middle layer containing PBMCs was transferred to a fresh tube, diluted with Tris buffered saline up to 50 ml, and centrifuged at 500g for 5 min. The supernatant was removed and the cell pellet was resuspended in 5 ml red blood cell lysis buffer (155 mM ammonium chloride, 10 mM potassium bicarbonate, 0.1 mM EDTA, pH 7.5). To generate stimulated PBMCs, freshly isolated quiescent PBMCs were seeded into a T-150 (150 cm2) tissue culture flask containing fresh medium supplemented with 10 U ml−1 of recombinant human interleukin-2 (IL-2) and 1 μg ml−1 phytohaemagglutinin-P at a density of 2 × 106 cells ml−1 and incubated for 72 h at 37 °C. Human macrophage cultures were isolated from PBMCs that were purified by Ficoll gradient centrifugation from 50 ml of blood from healthy human volunteers. PBMCs were cultured for 7 to 8 days in in RPMI cell culture media supplemented with 10% FBS, 5 to 50 ng ml−1 granulocyte-macrophage colony-stimulating factor and 50 μM β-mercaptoethanol to induce macrophage differentiation. The cryopreserved human primary renal proximal tubule epithelial cells were obtained from LifeLine Cell Technology and isolated from the tissue of human kidney. The cells were cultured at 90% confluency with RenaLife complete medium in a T-75 flask for 3 to 4 days before seeding into 96-well assay plates. Immortalized human microvascular endothelial cells (HMVEC-TERT) were obtained from R. Shao at the Pioneer Valley Life Sciences Institute28. HMVEC-TERT cells were cultured in endothelial basal media supplemented with 10% FBS, 5 μg of epithelial growth factor, 0.5 mg hydrocortisone, and gentamycin/amphotericin-B. RNA POLII was purchased as part of the HeLaScribe Nuclear Extract in vitro Transcription System kit from Promega. The recombinant human POLRMT and transcription factors mitochondrial transcription factors A (mtTFA or TFAM) and B2 (mtTFB2 or TFB2M) were purchased from Enzymax. RSV ribonucleoprotein (RNP) complexes were prepared according to a method modified from ref. 29. The intracellular metabolism of GS-5734 was assessed in different cell types (HMVEC and HeLa cell lines, and primary human and rhesus PBMCs, monocytes and monocyte-derived macrophages) following 2-h pulse or 72-h continuous incubations with 10 μM GS-5734. For comparison, intracellular metabolism during a 72-h incubation with 10 μM of Nuc was completed in human monocyte-derived macrophages. For pulse incubations, monocyte-derived macrophages isolated from rhesus monkeys or humans were incubated for 2 h in compound-containing media followed by removal, washing with 37 °C drug-free media, and incubated for an additional 22 h in media which did not contain GS-5734. Human monocyte-derived macrophages, HeLa and HMVEC were grown to confluence (approximately 0.5, 0.2, and 1.2 × 106 cells per well, respectively) in 500 μl of media in 12-well tissue culture plates. Monocyte and PBMCs were incubated in suspension (approximately 1 × 106 cells ml−1) in 1 ml of media in micro centrifuge tubes. For adherent cells (HMVEC, HeLa, and monocyte-derived macrophages), media was removed at select time points from duplicate wells, cells washed twice with 2 ml of ice-cold 0.9% normal saline. For non-adherent cells (monocytes and PBMCs), duplicate incubations were centrifuged at 2,500g for 30 s to remove media. The cell pellets were re-suspended with 500 μl cell culture media (RPMI with 10% FBS) and layered on top of a 500 μl oil layer (Nyosil M25; Nye Lubricants) in a microcentrifuge tube. Samples were then centrifuged at room temperature at 13,000 r.p.m. for 45 s. The media layer was removed and the oil layer was washed twice with 500 μl water. The oil layer was then carefully removed using a Pasteur pipet attached to vacuum. A volume of 0.5 ml of 70% methanol containing 100 nM of the analytical internal standard 2-chloro-adenosine-5′-triphosphate (Sigma-Aldrich) was added to isolated cells. Samples were stored overnight at −20 °C to facilitate extraction, centrifuged at 15,000g for 15 min and then supernatant was transferred to clean tubes for drying in a MiVac Duo concentrator (Genevac). Dried samples were then reconstituted in mobile phase A containing 3 mM ammonium formate (pH 5.0) with 10 mM dimethylhexylamine (DMH) in water for analysis by liquid chromatography coupled to triple quadrupole mass spectrometry (LC-MS/MS). LC-MS/MS was performed using low-flow ion-pairing chromatography, similar to methods described previously30. Briefly, analytes were separated using a 50 × 2 mm × 2.5 μm Luna C18(2) HST column (Phenomenex) connected to a LC-20ADXR (Shimadzu) ternary pump system and HTS PAL autosampler (LEAP Technologies). A multi-stage linear gradient from 10% to 50% acetonitrile in a mobile phase containing 3 mM ammonium formate (pH 5.0) with 10 mM dimethylhexylamine over 8 min at a flow rate of 150 μl min−1 was used to separate analytes. Detection was performed on an API 4000 (Applied Biosystems) MS/MS operating in positive ion and multiple reaction monitoring modes. Intracellular metabolites alanine metabolite, Nuc, nucleoside monophosphate, nucleoside diphosphate, and nucleoside triphosphate were quantified using 7-point standard curves ranging from 0.274 to 200 pmol (approximately 0.5 to 400 μM) prepared in cell extract from untreated cells. Levels of adenosine nucleotides were also quantified to assure dephosphorylation had not taken place during sample collection and preparation. In order to calculate intracellular concentration of metabolites, the total number of cells per sample were counted using a Countess automated cell counter (Invitrogen). Antiviral assays were conducted in biosafety level 4 containment (BSL-4) at the Centers for Disease Control and Prevention. EBOV antiviral assays were conducted in primary HMVEC-TERT and in Huh-7 cells. Huh-7 cells were not authenticated and were not tested for mycoplasma. Ten concentrations of compound were diluted in fourfold serial dilution increments in media, and 100 μl per well of each dilution was transferred in duplicate (Huh-7) or quadruplicate (HMVEC-TERT) onto 96-well assay plates containing cell monolayers. The plates were transferred to BSL-4 containment, and the appropriate dilution of virus stock was added to test plates containing cells and serially diluted compounds. Each plate included four wells of infected untreated cells and four wells of uninfected cells that served as 0% and 100% virus inhibition controls, respectively. After the infection, assay plates were incubated for 3 days (Huh-7) or 5 days (HMVEC-TERT) in a tissue culture incubator. Virus replication was measured by direct fluorescence using a Biotek HTSynergy plate reader. For virus yield assays, Huh-7 cells were infected with wild-type EBOV for 1 h at 0.1 plaque-forming units (PFU) per cell. The virus inoculum was removed and replaced with 100 μl per well of media containing the appropriate dilution of compound. At 3 days post-infection, supernatants were collected, and the amount of virus was quantified by endpoint dilution assay. The endpoint dilution assay was conducted by preparing serial dilutions of the assay media and adding these dilutions to fresh Vero cell monolayers in 96-well plates to determine the tissue culture infectious dose that caused 50% cytopathic effects (TCID ). To measure levels of viral RNA from infected cells, total RNA was extracted using the MagMAX-96 Total RNA Isolation Kit and quantified using a quantitative reverse transcription polymerase chain reaction (qRT–PCR) assay with primers and probes specific for the EBOV nucleoprotein gene. Antiviral assays were conducted in BSL-4 at USAMRIID. HeLa or HFF-1 cells were seeded at 2,000 cells per well in 384-well plates. Ten serial dilutions of compound in triplicate were added directly to the cell cultures using the HP D300 digital dispenser (Hewlett Packard) in twofold dilution increments starting at 10 μM at 2 h before infection. The DMSO concentration in each well was normalized to 1% using an HP D300 digital dispenser. The assay plates were transferred to the BSL-4 suite and infected with EBOV Kikwit at a multiplicity of infection of 0.5 PFU per cell for HeLa cells and with EBOV Makona at a multiplicity of infection of 5 PFU per cell for HFF-1 cells. The assay plates were incubated in a tissue culture incubator for 48 h. Infection was terminated by fixing the samples in 10% formalin solution for an additional 48 h before immune-staining, as described in Supplementary Table 1. Antiviral assays were conducted in BSL-4 at USAMRIID. Primary human macrophage cells were seeded in a 96-well plate at 40,000 cells per well. Eight to ten serial dilutions of compound in triplicate were added directly to the cell cultures using an HP D300 digital dispenser in threefold dilution increments 2 h before infection. The concentration of DMSO was normalized to 1% in all wells. The plates were transferred into the BSL-4 suite, and the cells were infected with 1 PFU per cell of EBOV in 100 μl of media and incubated for 1 h. The inoculum was removed, and the media was replaced with fresh media containing diluted compounds. At 48 h post-infection, virus replication was quantified by immuno-staining as described in Supplementary Table 1. For antiviral tests, compounds were threefold serially diluted in source plates from which 100 nl of diluted compound was transferred to a 384-well cell culture plate using an Echo acoustic transfer apparatus. HEp-2 cells were added at a density of 5 × 105 cells per ml, then infected by adding RSV A2 at a titer of 1 × 104.5 tissue culture infectious doses (TCID ) per ml. Immediately following virus addition, 20 μl of the virus and cells mixture was added to the 384-well cell culture plates using a μFlow liquid dispenser and cultured for 4 days at 37 °C. After incubation, the cells were allowed to equilibrate to 25 °C for 30 min. The RSV-induced cytopathic effect was determined by adding 20 μl of CellTiter-Glo Viability Reagent. After a 10-min incubation at 25 °C, cell viability was determined by measuring luminescence using an Envision plate reader. Antiviral assays were conducted in 384-or 96-well plates in BSL-4 at USAMRIID using a high-content imaging system to quantify virus antigen production as a measure of virus infection. A ‘no virus’ control and a ‘1% DMSO’ control were included to determine the 0% and 100% virus infection, respectively. The primary and secondary antibodies and dyes used for nuclear and cytoplasmic staining are listed in Supplementary Table 1. The primary antibody specific for a particular viral protein was diluted 1,000-fold in blocking buffer (1 × PBS with 3% BSA) and added to each well of the assay plate. The assay plates were incubated for 60 min at room temperature. The primary antibody was removed, and the cells were washed three times with 1 × PBS. The secondary detection antibody was an anti-mouse (or rabbit) IgG conjugated with Dylight488 (Thermo Fisher Scientific, catalogue number 405310). The secondary antibody was diluted 1,000-fold in blocking buffer and was added to each well in the assay plate. Assay plates were incubated for 60 min at room temperature. Nuclei were stained using Draq5 (Biostatus) or 33342 Hoechst (ThermoFisher Scientific) for Vero and HFF-1 cell lines. Both dyes were diluted in 1× PBS. The cytoplasm of HFF-1 (EBOV assay) and Vero E6 (MERS assay) cells were counter-stained with CellMask Deep Red (Thermo Fisher Scientific). Cell images were acquired using a Perkin Elmer Opera confocal plate reader (Perkin Elmer) using a ×10 air objective to collect five images per well. Virus-specific antigen was quantified by measuring fluorescence emission at a 488 nm wavelength and the stained nuclei were quantified by measuring fluorescence emission at a 640 nm wavelength. Acquired images were analysed using Harmony and Acapella PE software. The Draq5 signal was used to generate a nuclei mask to define each nuclei in the image for quantification of cell number. The CellMask Deep Red dye was used to demarcate the Vero and HFF-1 cell borders for cell-number quantitation. The viral-antigen signal was compartmentalized within the cell mask. Cells that exhibited antigen signal higher than the selected threshold were counted as positive for viral infection. The ratio of virus-positive cells to total number of analysed cells was used to determine the percentage of infection for each well on the assay plates. The effect of compounds on the viral infection was assessed as percentage of inhibition of infection in comparison to control wells. The resultant cell number and percentage of infection were normalized for each assay plate. Analysis of dose–response curve was performed using GeneData Screener software applying Levenberg–Marquardt algorithm for curve-fitting strategy. The curve-fitting process, including individual data point exclusion, was pre-specified by default software settings. R2 value quantified goodness of fit and fitting strategy was considered acceptable at R2 > 0.8. All virus infections were quantified by immuno-staining using antibodies that recognized the relevant viral glycoproteins, as described in Supplementary Table 1. HeLa cells were seeded at 2,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 1 PFU per cell MARV, which resulted in 50% to 70% of the cells expressing virus antigen in a 48-h period. HeLa cells were seeded at 2,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.08 PFU SUDV per cell, which resulted in 50% to 70% of the cells expressing virus antigen in a 48-h period. HeLa cells were seeded at 2,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.3 PFU per cell JUNV, which resulted in ~50% of the cells expressing virus antigen in a 48-h period. HeLa cells were seeded at 2,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.1 PFU per cell LASV, which resulted in >60% of the cells expressing virus antigen in a 48-h period. African green monkey (Chlorocebus sp.) kidney epithelial cells (Vero E6) were seeded at 4,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.5 PFU per cell of MERS virus, which resulted in >70% of the cells expressing virus antigen in a 48-h period. U2OS cells were seeded at 3,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.5 PFU per cell of CHIK, which resulted in >80% of the cells expressing virus antigen in a 48-h period. HeLa cells were seeded at 4,000 cells per well in a 384-well plate, and compounds were added to the assay plates. Assay plates were transferred to the BSL-4 suite and infected with 0.1 PFU per cell VEEV, which resulted in >60% of the cells expressing virus antigen in a 20-h period. HEp-2 (1.5 × 103 cells per well) and MT-4 (2 × 103 cells per well) cells were plated in 384-well plates and incubated with the appropriate medium containing threefold serially diluted compound ranging from 15 nM to 100,000 nM. PC-3 cells (2.5 × 103 cells per well), HepG2 cells (4 × 103 cells per well), hepatocytes (1 × 106 cells per well), quiescent PBMCs (1 × 106 cells per well), stimulated PBMCs (2 × 105 cells per well), and RPTEC cells (1 × 103 cells per well) were plated in 96-well plates and incubated with the appropriate medium containing threefold serially diluted compound ranging from 15 nM to 100,000 nM. Cells were cultured for 4–5 days at 37 °C. Following the incubation, the cells were allowed to equilibrate to 25 °C, and cell viability was determined by adding Cell-Titer Glo viability reagent. The mixture was incubated for 10 min, and the luminescence signal was quantified using an Envision plate reader. Cell lines were not authenticated and were not tested for mycoplasma as part of routine use in cytotoxicity assays. RNA synthesis by the RSV polymerase was reconstituted in vitro using purified RSV L/P complexes and an RNA oligonucleotide template (Dharmacon), representing nucleotides 1–14 of the RSV leader promoter31, 32, 33 (3′-UGCGCUUUUUUACG-5′). RNA synthesis reactions were performed as described previously, except that the reaction mixture contained 250 μM guanosine triphosphate (GTP), 10 μM uridine triphosphate (UTP), 10 μM cytidine triphosphate (CTP), supplemented with 10 μCi [α-32P]CTP, and either included 10 μM adenosine triphosphate (ATP) or no ATP. Under these conditions, the polymerase is able to initiate synthesis from the position 3 site of the promoter, but not the position 1 site. The NTP metabolite of GS-5734 was serially diluted in DMSO and included in each reaction mixture at concentrations of 10, 30, or 100 μM as specified in Fig. 1f. RNA products were analysed by electrophoresis on a 25% polyacrylamide gel, containing 7 M urea, in Tris–taurine–EDTA buffer, and radiolabelled RNA products were detected by autoradiography. Transcription reactions contained 25 μg of crude RSV RNP complexes in 30 μL of reaction buffer (50 mM Tris-acetate (pH 8.0), 120 mM potassium acetate, 5% glycerol, 4.5 mM MgCl , 3 mM DTT, 2 mM EGTA, 50 μg ml−1 BSA, 2.5 U RNasin, 20 μM ATP, 100 μM GTP, 100 μM UTP, 100 μM CTP, and 1.5 μCi [α-32P]ATP (3,000 Ci mmol−1)). The radiolabelled nucleotide used in the transcription assay was selected to match the nucleotide analogue being evaluated for inhibition of RSV RNP transcription. To determine whether nucleotide analogues inhibited RSV RNP transcription, compounds were added using a six-step serial dilution in fivefold increments. After a 90-min incubation at 30 °C, the RNP reactions were stopped with 350 μl of Qiagen RLT lysis buffer, and the RNA was purified using a Qiagen RNeasy 96 kit. Purified RNA was denatured in RNA sample loading buffer at 65 °C for 10 min and run on a 1.2% agarose/MOPS gel containing 2 M formaldehyde. The agarose gel was dried, exposed to a Storm phosphorimaging screen, and developed using a Storm phosphorimager. For a 25 μl reaction mixture, 7.5 μl 1 × transcription buffer (20 mM HEPES (pH 7.2–7.5), 100 mM KCl, 0.2 mM EDTA, 0.5 mM DTT, 20% glycerol), 3 mM MgCl , 100 ng CMV positive or negative control DNA, and a mixture of ATP, GTP, CTP and UTP was pre-incubated with various concentrations (0–500 μM) of the inhibitor at 30 °C for 5 min. The mixture contained 5–25 μM (equal to K ) of the competing 33P-labelled ATP and 400 μM of GTP, UTP, and CTP. The reaction was started by addition of 3.5 μl of HeLa and extract. After 1 h of incubation at 30 °C, the polymerase reaction was stopped by addition of 10.6 μl proteinase K mixture that contained final concentrations of 2.5 μg μl−1 proteinase K, 5% SDS, and 25 mM EDTA. After incubation at 37 °C for 3–12 h, 10 μl of the reaction mixture was mixed with 10 μl of the loading dye (98% formamide, 0.1% xylene cyanol and 0.1% bromophenol blue), heated at 75 °C for 5 min, and loaded onto a 6% polyacrylamide gel (8 M urea). The gel was dried for 45 min at 70 °C and exposed to a phosphorimager screen. The full length product, 363 nucleotide runoff RNA, was quantified using a Typhoon Trio Imager and Image Quant TL Software. Twenty nanomolar POLRMT was incubated with 20 nM template plasmid (pUC18-LSP) containing POLRMT light-strand promoter region and mitochondrial (mt) transcription factors TFA (100 nM) and mtTFB2 (20 nM) in buffer containing 10 mM HEPES (pH 7.5), 20 mM NaCl, 10 mM DTT, 0.1 mg ml−1 BSA, and 10 mM MgCl 34. The reaction mixture was pre-incubated to 32 °C, and the reactions were initiated by addition of 2.5 μM of each of the natural NTPs and 1.5 μCi of [32P]GTP. After incubation for 30 min at 32 °C, reactions were spotted on DE81 paper and quantified. A homology model of RSV A2 and EBOV polymerases were built using the HIV reverse transcriptase X-ray crystal structure (PDB:1RTD). Schrödinger Release 2015-1: Prime, version 3.9 (Schrödinger, LLC), default settings with subsequent rigid body minimization and side-chain optimization. Loop insertions not in 1RTD of greater than 10 amino acids were not built. For quantitative assessment of viral RNA nonhuman primate plasma samples, whole blood was collected using a K3 EDTA Greiner Vacuette tube (or equivalent) and sample centrifuged at 2500 (± 200) relative centrifugal force for 10 ± 2 min. To inactivate virus, plasma was treated with 3 parts (300 μl) TriReagent LS and samples were transferred to frozen storage (−60 °C to −90 °C), until removal for RNA extraction. Carrier RNA and QuantiFast High Concentration Internal Control (Qiagen) were spiked into the sample before extraction, conducted according to manufacturer’s instructions. The viral RNA was eluted in AVE buffer. Each extracted RNA sample was tested with the QuantiFast Internal Control RT–PCR RNA Assay (Qiagen) to evaluate the yield of the spiked-in QuantiFast High Concentration Internal Control. If the internal control amplified within manufacturer-designated ranges, further quantitative analysis of the viral target was performed. RT–PCR was conducted using an ABI 7500 Fast Dx using primers specific to EBOV glycoprotein. Samples were run in triplicate using a 5 μl template volume. For quantitative assessments, the average of the triplicate genomic equivalents (GE) per reaction were determined and multiplied by 800 to obtain GE ml−1 plasma. Standard curves were generated using synthetic RNA. The limits of quantification for this assay are 8.0 × 104 − 8.0 × 1010 GE ml−1 of plasma. Acceptance criteria for positive template control (PTC), negative template control (NTC), negative extraction control (NEC), and positive extraction control (PEC) are specified by standard operating procedure. For qualitative assessments, the limit of detection (LOD) was defined as C 38.07, based on method validation testing. An animal was considered to have tested positive for detection of EBOV RNA when a minimum of 2 of 3 replicates were designated as ‘positive’ and PTC, NTC, and NEC controls met specified method-acceptance criteria. A sample was designated as ‘positive’ when the C value was


Animal experiments were performed according to procedures approved by the Institutional Animal Care and Use Committee of the Beth Israel Deaconess Medical Center. Unless otherwise stated, mice used were male C57BL/6J (8–12 weeks of age; Jackson Laboratories), and housed in a temperature-controlled (20–22 °C) room on a 12 h light/dark cycle. All compounds administered to mice in vivo were injected at the stated dose i.p. 10 min before subsequent interventions unless otherwise stated. Body temperature and cold exposure experiments were assessed using a mouse rectal probe (World Precision Instruments). When studying acute activation of thermogenesis, mice were housed from birth at 20–22 °C to allow for recruitment of thermogenic adipose tissue7. Before individual housing at 4 °C, mice were placed at thermoneutrality (30 °C) for 3 days which allows both for maintenance BAT UCP1 protein content31 and for measurement of acute induction of BAT thermogenesis upon cold exposure. Upon exposure to 4 °C, temperature was measured every 30 min. When studying body temperature after 4 °C acclimation, WT and Ucp1−/− mice (equal numbers of male and female mice in each group) were acclimated using established protocols: mice were individually housed for 1 week at 15 °C, 1 week at 10 °C, and 24 h at 4 °C before the experiment. Mice were individually restrained to limit non-shivering muscle activity and two EMG needle electrodes were inserted subcutaneously above the nuchal muscles in the back of the neck. EMG leads were connected to a computerized data acquisition system via a communicator. EMG was recorded at thermoneutrality to determine non-shivering basal nuchal muscle activity, before placement of mice at 4 °C. EMG data were collected and burst activity was determined as described previously32. Briefly, EMG data were collected from the implanted electrodes at a sampling rate of 2 kHz using LabChart 8 Pro Software (ADInstruments). The raw signal was converted to root mean square activity. Root mean square activity was analysed for shivering bursts in 10 s windows. Whole-body energy metabolism was evaluated using a Comprehensive Lab Animal Monitoring System (CLAMS, Columbia Instruments). For 6 h measurements, mice were acclimated in the metabolic chambers for 48 h before experiments to minimize stress from the housing change. CO and O levels were collected every 12 or 32 min for each mouse over the period of the experiment. For acute measurements, CO and O levels were collected every 10 s. CL 316,243 (Sigma-Aldrich; 1 mg kg−1) was injected i.p. into mice at the indicated times. Aconitase activity was measured as described previously33. In brief, after the relevant in vivo intervention mouse BAT was rapidly excised and homogenized in mitochondrial isolation buffer (250 mM sucrose, 2 mM EDTA, 10 mM sodium citrate, 0.6 mM MnCl , 100 mM Tris-HCl, pH 7.4) followed by mitochondrial isolation by differential centrifugation. Samples (1–2 mg mitochondrial protein) were added to a 96-well plate and 190 ml assay buffer (50 mM Tris-HCl (pH 7.4), 0.6 mM MnCl , 5 mM sodium citrate, 0.2 mM NADP+, 0.1% (v/v) Triton X-100, 0.4 U ml−1 ICDH). Absorbance was measured at 340 nm for 7 min at 37 °C. To control for mitochondrial content aconitase activity was normalized to citrate synthase activity34 and expressed the result as a percentage of control levels. Lipid hydroperoxide content in mouse BAT was estimated by rapid snap freezing of BAT tissue followed by lipid extraction and assessment using a modified ferric thiocyanate assay (Cayman Chemical Lipid Hyroperoxide Assay Kit) according to the manufacturer’s instructions. Cysteine redox status of Prx3 and UCP1 was measured as described previously16, 35. After the relevant in vivo intervention, mouse BAT was rapidly excised and homogenized in 100 mM NEM, 1 mM EGTA, 50 mM Tris-HCl, pH 7.4. Samples were incubated at 37 °C for 5 min before the addition of SDS (2% final) and further incubation at 37 °C for 10 min. Incubations at 37 °C proceeded in a thermomixer at 1,300 r.p.m. Samples were then precipitated in five volumes of ice-cold acetone to remove excess NEM before resuspension in 1 mM EGTA, 2% SDS, 10 mM TCEP, 50 mM Tris-HCl, pH 7.4 containing a polyelthylene glycol polymer conjugated to maleimide (50 mM PEG-Mal). Resuspended samples were incubated for 30 min at 37 °C before a second acetone precipitation to remove excess PEG-Mal before sample resuspension and immunoblot detection by standard methods described below. For UCP1 experiments, to ensure gel shift signals were specific to reversible cysteine oxidation, oxidized samples were separately treated with TCEP before differential labelling as described above. Calibrating the number of UCP1 cysteines oxidized was achieved by treating TCEP-reduced samples with increasing proportions of Peg-Mal:NEM to generate a cysteine-dependent ladder35. In addition, to ensure higher molecular mass signals were specific to UCP1, UCP1 antibody specificity was tested in BAT. It should be noted that while the UCP1 antibody used here is highly specific for UCP1 in BAT (Extended Data Fig. 4c), the same antibody applied to cultured brown adipocyte samples can generate non-specific signals at molecular mass >35 kDa. So, the UCP1 gel shift assay as described here is only compatible with in vivo tissue experiments. Reduced and oxidized glutathione were profiled in negative ionization mode by liquid chromatography tandem mass spectrometry (LC–MS) methods as described previously36. Data were acquired using an ACQUITY UPLC (Waters) coupled to a 5500 QTRAP triple quadrupole mass spectrometer (AB SCIEX). Tissue homogenates (30 μl) were extracted using 120 μl of 80% methanol containing 0.05 ng μl−1 inosine-15N , 0.05 ng μl−1 thymine-d , and 0.1 ng μl−1 glycocholate-d as internal standards (Cambridge Isotope Laboratories). The samples were centrifuged (10 min, 9,000g, 4 °C) and the supernatants (10 μl) were injected directly onto a 150 mm × 2.0 mm Luna NH2 column (Phenomenex). The column was eluted at a flow rate of 400 μl min−1 with initial conditions of 10% mobile phase A (20 mM ammonium acetate and 20 mM ammonium hydroxide (Sigma-Aldrich) in water (VWR)) and 90% mobile phase B (10 mM ammonium hydroxide in 75:25 v/v acetonitrile/methanol (VWR)) followed by a 10 min linear gradient to 100% mobile phase A. The ion spray voltage was −4.5 kV and the source temperature was 500 °C. Raw data were processed using MultiQuant 2.1 software (AB SCIEX) for automated peak integration. LC–MS data were processed and visually inspected using TraceFinder 3.1 software (Thermo Fisher Scientific). After the relevant in vivo intervention, mouse BAT was rapidly excised and homogenized in 20% (w/v) TCA to stabilize thiols. The homogenate was incubated on ice for 30 min and then pelleted for 30 min at 16,000g at 4 °C. The pellet was washed with 10% and 5% (w/v) TCA and then resuspended in 80 μl denaturing alkylating buffer (DAB; 6 M urea, 2% (w/v) SDS, 200 mM Tris-HCl, 10 mM EDTA, 100 μM DTPA, 10 μM neocuproine). The contents of one vial of iodoTMT reagent (Thermo Scientific) was added to each of three biological replicate samples to label reduced cysteine residues at 37 °C and 1,300 r.p.m. for 1 h. Sample protein was precipitated with five volumes of ice-cold acetone, incubated at −20 °C for 2 h, and pelleted at 4 °C and 16,000g for 30 min. The amount of protein to be processed was optimized to ensure saturation of thiol labelling by the iodoTMT reagent as per the manufacturer’s instructions. The pellet was washed twice with ice-cold acetone and then re-solubilized in 80 μl DAB containing 1 mM tris(2- carboxyethyl)phosphine (TCEP), reducing previously reversibly oxidised cysteine residues in the presence of a second, distinct iodoTMT reagent. Proteins were incubated at 37 °C and 1,400 r.p.m. for 1 h, precipitated and resuspended for protease digestion. After digestion, iodoTMT-labelled cysteine-containing peptides were enriched using the anti-TMT resin as per the manufacturer’s instructions. Proteins with cysteine thiols exhibiting differential redox status (defined as >10% shift in cysteine oxidation status upon cold exposure) were assessed for Gene Ontology (GO) term enrichment37. The total identified population of cysteine thiol containing proteins was used as the reference background. Enriched GO terms were filtered after benjamini-hochberg correction at an adjusted P value <0.1. All data analysis used R (R Core Team, Vienna, Austria, http://www.R-project.org). Tissue or cellular samples were prepared adapting a protocol used previously to stabilize endogenous protein sulfenic acids38. Briefly, samples were homogenized in 50 mM Tris base, containing 100 mM NaCl, 100 μM DTPA, 0.1% SDS, 0.5% sodium deoxycholate, 0.5% Triton-X 100, 5 mM dimedone. To minimize lysis-dependent oxidation, buffers were bubbled with argon before use. Samples were incubated for 15 min at room temperature, at which point SDS was added to a final concentration of 1% and samples were incubated for a further 15 min. After dimedone treatment, 10 mM TCEP and 50 mM NEM were added and samples were incubated for a further 15 min at 37 °C to reduce and alkylate all non-sulfenic acid protein cysteine residues. Protein sulfenic acids were then assessed by immunoblotting against dimedone (1:1,000 antibody dilution). After dimedone and NEM labelling of samples as described above, samples were resolved by SDS–PAGE and bands in the UCP1 containing region of the gel (30–35 kDa) were excised, destained with acetonitrile and subjected to dehydration by a speed vacuum concentrator. Gel bands were rehydrated with digestion buffer (75 μl of 50 mM HEPES and 500 ng of trypsin (Promega) and subjected to 12 h of digestion at 37 °C. Peptides were extracted and labelled with TMT 10 reagents (Thermo Fisher) as previously described39. Protein pellets were dried and resuspended in 8 M urea containing 50 mM HEPES (pH 8.5). Protein concentrations were measured by BCA assay (Thermo Scientific) before protease digestion. Protein lysates were diluted to 4 M urea and digested with LysC (Wako, Japan) in a 1/100 enzyme/protein ratio overnight. Protein extracts were diluted further to a 1.0 M urea concentration, and trypsin (Promega) was added to a final 1/200 enzyme/protein ratio for 6 h at 37 °C. Digests were acidified with 20 μl of 20% formic acid (FA) to a pH ~2, and subjected to C18 solid-phase extraction (Sep-Pak, Waters). All spectra were acquired using an Orbitrap Fusion mass spectrometer (Thermo Fisher) in line with an Easy-nLC 1000 (Thermo Fisher Scientific) ultra-high pressure liquid chromatography pump. Peptides were separated onto a 100 μM inner diameter column containing 1 cm of Magic C4 resin (5 μm, 100 Å, Michrom Bioresources) followed by 30 cm of Sepax Technologies GP-C18 resin (1.8 μm, 120 Å) with a gradient consisting of 9–30% (ACN, 0.125% FA) over 180 min at ~250 nl min−1. For all LC–MS/MS experiments, the mass spectrometer was operated in the data-dependent mode. We collected MS1 spectra at a resolution of 120,000, with an AGC target of 150,000 and a maximum injection time of 100 ms. The ten most intense ions were selected for MS2 (excluding 1 Z-ions). MS1 precursor ions were excluded using a dynamic window (75 s ± 10 ppm). The MS2 precursors were isolated with a quadrupole mass filter set to a width of 0.5Th. For the MS3 based TMT quantitation, MS2 spectra were collected at an AGC of 4,000, maximum injection time of 150 ms, and CID collision energy of 35%. MS3 spectra were acquired with the same Orbitrap parameters as the MS2 method except HCD collision energy was increased to 55%. Synchronous-precursor-selection was enabled to include up to six MS2 fragment ions for the MS3 spectrum. A compilation of in-house software was used to convert .raw files to mzXML format, as well as to adjust monoisotopic m/z measurements and erroneous peptide charge state assignments. Assignment of MS2 spectra was performed using the SEQUEST algorithm40. All experiments used the Mouse UniProt database (downloaded 10 April 2014) where reversed protein sequences and known contaminants such as human keratins were appended. SEQUEST searches were performed using a 20 ppm precursor ion tolerance, while requiring each peptide’s amino/carboxy (N/C) terminus to have trypsin protease specificity and allowing up to two missed cleavages. IodoTMT tags on cysteine residues residues (+329.226595 Da) was set as static modifications, while methionine oxidation (+15.99492 Da) was set as variable modifications. For targeted assessment of UCP1 cysteine sulfenylation, TMT tags on lysine residues and peptide N termini (+229.16293 Da), NEM on cysteine residues (+125.047679 Da) were set as static modifications and oxidation of methionine residues (+15.99492 Da) and dimedone on cysteine residues (+13.020401 Da versus NEM) as variable modifications. Determination of sulfenylation status of the Cys253 peptide was determined by comparing TMT reporter ion abundance of the dimedone-alkylated and NEM-alkylated peptides as a proportion of total precursor ion intensity. An MS2 spectra assignment false discovery rate of less than 1% was achieved by applying the target-decoy database search strategy41. Protein filtering was performed using an in-house linear discrimination analysis algorithm to create one combined filter parameter from the following peptide ion and MS2 spectra metrics: XCorr, ΔCn score, peptide ion mass accuracy, peptide length and missed-cleavages42. Linear discrimination scores were used to assign probabilities to each MS2 spectrum for being assigned correctly, and these probabilities were further used to filter the data set to a 1% protein-level false discovery rate. For quantification, a 0.03m/z window centred on the theoretical Th value of each reporter ion was used for the nearest signal intensity. Reporter ion intensities were adjusted to correct for the isotopic impurities from the different TMT reagents (manufacturer specifications). The signal to noise values for all peptides were summed within each TMT channel. For each peptide, a total minimum sum signal to noise value of 200 and an isolation purity greater than 70% was required43. Percentage cysteine oxidation status of protein thiols was calculated as the percentage of the cysteine containing peptide (total or mitochondrial) labelled with iodoTMT (129, 130, 131) for each condition over the sum of the reduced peptide labelled with iodoTMT (126, 127, 128) plus reversibly oxidized labelled peptide (129, 130, 131): (oxidized peptide 129, 130, 131)/(reduced peptide 126, 127, 128 + oxidized peptide 129, 130, 131) × 100. Interscapular brown adipose stromal vascular fraction was obtained from 2- to 6-day-old pups as described previously44. Interscapular brown adipose was dissected, washed in PBS, minced, and digested for 45 min at 37 °C in PBS containing 1.5 mg ml−1 collagenase B, 123 mM NaCl, 5 mM KCl, 1.3 mM CaCl , 5 mM glucose, 100 mM HEPES, and 4% essentially fatty-acid-free BSA. Tissue suspension was filtered through a 40 μm cell strainer and centrifuged at 600g for 5 min to pellet the SVF. The cell pellet was resuspended in adipocyte culture medium and plated. Primary brown pre-adipocytes were counted and plated in the evening, 12 h before differentiation at 15,000 cells per well of a seahorse plate. Pre-adipocyte plating was scaled according to surface area. The following morning, brown pre-adipocytes were induced to differentiate for 2 days with an adipogenic cocktail (1 μM rosiglitazone, 0.5 mM IBMX, 5 μM dexamethasone, 0.114 μg ml−1 insulin, 1 nM T3, and 125 μM Indomethacin) in adipocyte culture medium. Two days after induction, cells were re-fed every 48 h with adipocyte culture medium containing 1 μM rosiglitazone and 0.5 μg ml−1 insulin. Cells were fully differentiated by day 5 after induction. Cellular OCR of primary brown adipocytes was determined using a Seahorse XF24 Extracellular Flux Analyzer. Adipocytes were plated and differentiated in XF24 V7 cell culture microplates. Before analysis adipocyte culture medium was changed to DMEM respiration medium lacking NaHCO (Sigma), and including 1.85 g l−1 NaCl, 3 mg l−1 phenol red, 2% fatty-acid-free BSA, 1 mM sodium pyruvate, pH 7.4. Basal respiration was determined to be the OCR in the presence of substrate alone. ATP-synthase-independent respiration was determined after addition of 2.5 μM oligomycin. Unless otherwise stated, leak respiration was determined after addition of 2.5 μM oligomycin and 100 nM noradrenaline. Maximal respiration was determined after addition of 2 μM FCCP. To determine OCR after plasma membrane permeabilization, cells were treated with 50 μg ml−1 saponin, and sequestration of free fatty acids after permeabilization was achieved through addition of 2% fatty-acid-free BSA. RNA from murine BAT was reverse-transcribed and used as template for PCR of Ucp1. Sequences for Ucp1 amplification were as follows: sense, CAC CAT GGT GAA CCC GAC AAC TTC C; antisense, TTA TGT GGT ACA ATC CAC TG. PCR fragments were gel-purified and cloned into the pENTR/D-TOPO entry vector according to the manufacturer’s instructions (Invitrogen; K2400). Cloned Ucp1 was shuttled into the pAd/CMV/V5-DEST Gateway vector, and confirmed by sequencing. Cysteine mutants were generated using the Quik-Change site-directed mutagenesis kit (Stratagene). Primers for generating mutants were as follows: Ucp1 C24A forward 5′-AGCCGGAGTTTCAGCTGCCCTGGCAGATATCATC-3′, reverse 5′-GATGATATCTGCCAGGGCAGCTGAAACTCCGGCT-3′; Ucp1 C188A forward 5′-TGAGAAATGTCATCATCAATGCTACAGAGCTGGTAACATATG-3′, reverse 5′-CATATGTTACCAGCTCTGTAGCATTGATGATGACATTTCTCA-3′; UCP1 C213A forward 5′-TGGCAGATGACGTCCCCGCCCATTTACT GTCAGCTC-3′, reverse 5′-GAGCTGACAGTAAATGGGCGGGGACG TCATCTGCCA-3′; Ucp1 C224A forward 5′-TCTTGTTGCCGGGTT TGCCACCACACTCCTGGCC-3′, reverse 5′-GGCCAGGAGTGTGGTG GCAAACCCGGCAACAAGA-3′; Ucp1 C253A forward 5′-CCCAAGC GTACCAAGCGCTGCGATGTCCATGTAC-3′, reverse 5′-GTACATGGAC ATCGCAGCGCTTGGTACGCTTGGG-3′; Ucp1 C287A forward 5′-GGAAC GTCATCATGTTTGTGGCCTTTGAACAGCTGAAAAAAG-3′, reverse 5′-CTTTTTTCAGCTGTTCAAAGGCCACAAACATGATGACGTTCC-3′; Ucp1 C304A forward 5′-CAGACAGACAGTGGATGCTACCACATAAGGATCC-3′, reverse 5′-GGATCCTTATGTGGTAGCATCCACTGTCTGTCTG-3′. pAd/CMV/V5-DEST/Ucp1 was linearized with PacI and transfected (3 μg) into 293A cells with lipofectamine 2000 (Invitrogen). Crude adenovirus was generated according to the manufacturer’s instructions (Invitrogen; V493-20). Crude adenovirus was amplified by infecting 293A cells, and purified using the Fast Trap Adenovirus Purification and Concentration Kit (EMD Millipore). Virus was quantified by examining viral DNA. Briefly, viral particles were treated with Proteinase K and DNA was isolated with phenol and chloroform/isoamylalcohol (24:1). Preliminary experiments with titrations of viral transductions in Ucp1−/− adipocytes were used to determine the amount of virus yielding a Ucp1 messenger RNA (mRNA) and protein level similar to the level detected from Ucp1+/+ adipocytes. For subsequent experiments, primary brown adipocytes were transduced with purified adenovirus in the evening of day 3 after differentiation with medium replacement the following morning. Adipocytes were used for experiments on day 5 after differentiation. A comparative model of UCP1 was built by using the structure of the bovine AAC19. This structure corresponds to the ‘c-state’ of the carrier—open to the mitochondrial inner membrane. The protein sequence of human UCP1 was taken from UniProt. To align the AAC and UCP1 sequences, MUSCLE45 and manual editing in Jalview46 were used. To improve the quality of the comparative models, the alignments were edited to remove the N- and C-terminal residues of the UCP1 sequences that did not align with resolved residues in the AAC structure, and to place gaps in the UCP1 sequences so as to minimize the distance between these residues in the initial target structure. Fifty comparative models of human UCP1 were built from the AAC structure and the sequence alignment by using MODELLER. The structure with the lowest MODELLER energy score was taken as the best representative structure. The cardiolipin molecules of the AAC were added to the modelled UCP1 structure by aligning the two structures, and copying the lipid molecules21, 22, 47. This structure was examined and figures produced by using the PyMOL molecular visualization system (PyMOL Molecular Graphics System, version 1.4.1, Schrödinger). ROS production was estimated by oxidation of DHE and ratiometric assessment as described previously33. Cells were plated and differentiated onto 96-well plates suitable for fluorescence analysis. Before imaging, cell media was removed and replaced with imaging buffer (156 mM NaCl, 1.25 mM KH PO , 3 mM KCl, 2 mM MgCl , 10 mM HEPES, pH 7.4) supplemented with 1 mM sodium pyruvate. Cells were loaded with 5 μM DHE (Invitrogen), which remained present throughout the time course. DHE was excited at 355 nm and the emitted signal was acquired at 460 nm. Oxidized DHE was excited at 544 nm and emission was acquired at 590 nm. Mitochondrial membrane potential was measured in permeabilized cells using TMRM (Life Technologies) in dequench mode. In this mode, mitochondrial depolarization causes redistribution of a high concentration of signal quenched TMRM from mitochondria to the cytosol, such that the lower concentration results in dequenching and an increase in fluorescence48. Cells were pre-loaded at room temperature with imaging buffer containing 1 μM TMRM. TMRM fluorescence was excited at 544 nm and emission was collected at 590 nm. Total RNA was extracted from frozen tissue using TRIzol (Invitrogen), purified with RNeasy Mini spin columns (QIAGEN) and reverse transcribed using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). The resultant complementary DNA (cDNA) was analysed by quantitative PCR with reverse transcription (qRT–PCR). Briefly, 20 ng cDNA and 150 nmol of each primer were mixed with SYBR GreenER qPCR SuperMix (Applied Biosystems). Reactions were performed in a 384-well format using an ABI PRISM 7900HT real time PCR system (Applied Biosystems). Relative mRNA levels were calculated using the comparative CT method and normalized to cyclophilin mRNA. The following primers were used in these studies: Cyclophilin forward 5′-GGAGATGGCACAGGAGGAA-3′, reverse 5′-GCCCGTAGTGCTTCAGCTT-3′; Ucp1 forward 5′-ACTGCCACACCTCCAGTCATT-3′, reverse 5′-CTTTGCCTCACTCAG GATTGG-3′; Dio2 forward 5′-CAGTGTGGTGCACGTCTCCAATC-3′, reverse 5′-TGAACCAAAGTTGACCACCAG-3′; Pgc1α forward 5′-CCCTGCCATTGTTAAGACC-3′, reverse 5′-TGCTGCTGTTCCTGTTTTC-3′; PPAR-γ forward 5′-TGAAAGAAGCGGTGAACCACTG-3′, reverse 5′-TGGCATCTCTGTGTCAACCATG-3′; Pgc1β forward 5′-CTGACGT GGACGAGCTTTCA-3′, reverse 5′-CGTCCTTCAGAGCGTCAGAG-3′; Nrf2 forward 5′-CCAGCTACTCCCAGGTTGCC-3′, reverse 5′-GGGA TATCCAGGGCAAGCGA-3′; Ap2 5′-AAGGTGAAGAGCATCATAACCCT-3′, reverse 5′-TCACGCCTTTCATAACACATTCC-3′. Adipocytes were incubated in respiration medium absent BSA and treated with indicated concentrations of noradrenaline for 2 h before collection of medium and quantification of glycerol using free glycerol reagent (Sigma-Aldrich) relative to glycerol standard and normalized to protein content. Immunodetection after SDS–PAGE used the following antibodies: UCP1 (Abcam ab10983), Prx3 (Abcam ab16751), Dimedone (Millipore 07-2139), Vinculin (Sigma V9264), ATP5A and NDUFB8 (Abcam ab110413), ATGL (CST 2138), ATGL pS406 (Abcam ab135093), HSL (CST 4107), HSL pS660 (CST 4126), pPKA substrate (CST 9624 s), PPAR-γ (CST 2435S). Data were expressed as mean ± s.e.m. and P values were calculated using two-tailed Student’s t-test for pairwise comparisons, one-way ANOVA for multiple comparisons, and two-way ANOVA for multiple comparisons involving two independent variables. ANOVA analyses were subjected to Bonferroni’s post hoc test. Sample sizes were determined on the basis of previous experiments using similar methodologies. For in vivo studies, mice were randomly assigned to treatment groups. Mass spectrometric analyses were blinded to experimental conditions.


News Article | December 7, 2016
Site: www.nature.com

Drosophila melanogaster w1118, Canton-S and Oregon-R were used as wild-type controls. Other fly stocks used were tub-GAL4, elavC155-GAL4, how24B-GAL4, Df(3R)Exel6197, Df(2L)BSC200/Cyo, Df(3L)Exel6094 (Bloomington Drosophila Stock Center). UAS-Ime4-HA/Cyo flies were generated by injection of UAS Ime4–HA vector at Bestgene. Mutant alleles for Ime4, dMettl14, fl(2)d and YT521-B were generated using the CRISPR–Cas9 system following the previously described procedure41. Two independent guide RNAs (gRNAs) per gene were designed using the gRNA design tool: http://www.crisprflydesign.org/ (Supplementary Table 9). Oligonucleotides were annealed and cloned into pBFv-U6.2 vector (National Institute of Genetics, Japan). Vectors were injected into embryos of y2 cho2 v1; attP40(U6.2-w-ex3-2) flies. Positive recombinant males were further crossed with y2 cho2 v1; attP40(nos-Cas9)/CyO females. Males carrying nos-Cas9 and U6-gRNA transgenes were screened for the expected deletion and further crossed with the balancer strain AptXa/CyoGFP-TM6c. Ime4∆cat allele was obtained using gRNA sequences (GGACTCTTTCCGCGCTACAG and GGCTCACACGGACGAATCTC). A deletion of 569 bp (607–1,175 bp in the genome region chr3R:24032157..24034257, genome assembly BDGP release 6) was produced. Ime4null allele was obtained using gRNA sequences (GGCCCTTTTAACGTTCTTGA and GGCTCACACGGACGAATCTC) and produced a deletion of 1,291 bp (1,876–3,166 bp in the genome region chr3R:24030157..24034257). dMettl14fs allele was obtained using gRNA sequences (GGTTCCCTTCAGGAAGGTCG and GGACCAACATTAACAAGCCC) and produced a 2-nucleotide frame shift at position 227 of the coding sequence, leading to a premature stop codon at amino acid position 89. YT521-BΔN allele was obtained using gRNA sequences (GGCATTAATTGTGTGGACAC and GGCTGTCGATCCTCGGTATC) and produced a deletion of 602 bp (133–734 bp in the genome region chr3L:3370451..3374170 (reverse complemented)). The phylogenetic trees were constructed with ClustalX42 from multiple sequence alignments generated with MUSCLE43 of the Drosophila sequences with homologues from representative species. Drosophila S2R+ are embryonic-derived cells obtained from Drosophila Genomics Resource Center (DGRC; FlyBase accession FBtc0000150). The presence of Mycoplasma contamination was not tested. The plasmids used for immunohistochemistry and co-immunoprecipitation assays in Drosophila S2R+ cells were constructed by cloning the corresponding cDNA in the pPAC vector44 with N-terminal Myc tag and the Gateway-based vectors with N-terminal Flag–Myc tag (pPFMW) as well as C-terminal HA tag (pPWH) (obtained from Drosophila Genomics Resource Center at Indiana University). Two-to-three-day-old flies were gender-separated and placed into measuring cylinders to assess their locomotion using the climbing assay reported previously45. Flies were tapped to the bottom and the number of flies that climb over the 10 cm threshold in 10 s interval were counted. Ten female flies were used per experiment and six independent measurements were performed. Staging experiment was performed using Drosophila melanogaster w1118 flies that were kept in a small fly cage at 25 °C. Flies laid embryos on big apple juice plates that were exchanged every 2 h. Before each start of collection, 1 h pre-laid embryos were discarded to remove all retained eggs and embryos from the collection. All the resultant plates with embryos of 1 h or 2 h lay were further incubated at 25 °C between 0 h and 20 h, with 2 h increments, to get all embryonic stages. For the collection of larval stages, L1 larvae (~30 larvae/stage) were transferred onto a new apple juice plate and were further incubated at 25 °C till they reached a defined age (24 to 110 h, 2 h intervals). Similarly, pupal stages were obtained by the transfer of L3 larvae (~30/stage) in a fresh vial, that were kept at 25 °C and left to develop into defined stage between 144 and 192 h in 2 h increments. One-to-three-day-old adults were collected and gender separated. Heads and ovaries from 50 females were also collected. A total of three independent samples were collected for each Drosophila stage as well as for heads and ovaries. Samples from the staging experiment were used for RNA extraction to analyse m6A abundance in mRNA and expression levels of different transcripts during Drosophila development. Total RNA from S2R+ cells was isolated using Trizol reagent (Invitrogen) and DNA was removed with DNase-I treatment (NEB). mRNA was purified with Oligotex mRNA Kit (Qiagen) or by using two rounds of purification with Dynabeads Oligo (dT)25 (Invitrogen). cDNA for RT–qPCR was prepared using M-MLV Reverse Transcriptase (Promega) and transcript levels were quantified using Power SYBR Green PCR Master Mix (Invitrogen) and the oligonucleotides indicated in Supplementary Table 9. For RNA isolation from fly heads, 20 female flies were collected in 1.5 ml Eppendorf tubes and flash frozen in liquid nitrogen. Heads were first removed from the body by spinning the flies on vortex and then collected via the 0.63 mm sieve at 4 °C. Fly heads were homogenized using a pestle and total RNA was isolated with Trizol reagent. DNA was removed by DNase-I treatment and RNA was further purified using RNeasy Kit (Qiagen). RNA from adult flies and dissected ovaries was prepared as described earlier by skipping the head separation step. Two-to-three-day-old flies were collected and their RNA isolated as described earlier. Following cDNA synthesis PCR was performed using the oligonucleotides described in Supplementary Table 9 to analyse Sxl, tra and msl-2 splicing. For in situ hybridization Drosophila melanogaster w1118 flies were kept at 25 °C in conical flasks with apple juice agar plates and embryos were collected every 24 h. Embryos were transferred in a sieve and dechorionated for 2 min in 50% sodium hypochloride. After 5 min wash in water, embryos were permeabilized with PBST (0.1% Tween X-100 in PBS) for 5 min. Embryos were transferred in 1:1 mixture of heptane (Sigma) and 8% formaldehyde (Sigma) and fixed for 20 min with constant shaking at room temperature. After fixation the lower organic phase was removed and 1 volume of MeOH was added to the aqueous phase containing fixed embryos. Following 5 min of extensive shaking all liquid was removed and embryos were washed 3 times with 100% MeOH. At this point embryos were stored at −20 °C or used for further analysis. For in situ hybridization MeOH was gradually replaced with PBST with 10 min washes and with three final washes in PBST. Embryos were further washed for 10 min at room temperature with 50% HB4 solution (50% formamide, 5× SSC, 50 μg/ml heparin, 0,1% Tween, 5 mg/ml torula yeast extract) diluted in PBST. Blocking was performed with HB4 solution, first for 1 h at room temperature and next for 1 h at 65 °C. In situ probes were prepared with DIG RNA labelling Kit (Roche) following the manufacturer’s protocol. Two microlitres of the probe were diluted in 200 μl of HB4 solution, heated up to 65 °C to denature the RNA secondary structure and added to blocked embryos for further overnight incubation at 65 °C. The next day, embryos were washed 2 times for 30 min at 65 °C with formamide solution (50% formamide, 1× SSC in PBST) and further 3 times for 20 min at room temperature with PBST. Embryos were then incubated with anti-DIG primary antibody (Roche) diluted in PBST (1:2,000) for 2 h at room temperature and later washed 5 times for 30 min with PBST. In order to develop the staining, embryos were rinsed with AP buffer (100 mM Tris pH 9.5, 50 mM MgCl , 100 mM NaCl, 0.1% Tween) and incubated with NBT/BCIP solution in AP buffer (1:100 dilution) until the intense staining was observed. Reaction was stopped with several 15 min PBST washes. Prior to mounting, embryos were incubated in 20% glycerol and later visualized on Leica M205-FA stereomicroscope. S2R+ cells were depleted for the indicated proteins with two treatments of double-stranded RNA (dsRNA). Four days after treatment Myc-tagged YT521-B was transfected along with the control Myc construct. Seventy-two hours after transfection, cells were fixed with 1% formaldehyde at room temperature for 10 min and harvested as described previously46. Extracted nuclei were subjected to 13 cycles of sonication on a bioruptor (Diagnode), with 30 s “ON”/“OFF” at high settings. Nuclear extracts were incubated overnight with 4 μg of anti-Myc 9E10 antibody (Enzo Life Sciences). Immunoprecipitation was performed as described previously46 except that samples were DNase-treated (NEB) instead of RNase-treated and subjected to proteinase K treatment for reversal of crosslinks, 1 h at 65 °C. RNase inhibitors (Murine RNase Inhibitor, NEB) were used in all steps of the protocol at a concentration of 40 U/ml. Antibodies against Ime4 and dMettl14 were generated at Eurogentec. For anti-Ime4 sera guinea pig was immunized with a 14 amino-acid-long peptide (163–177 amino acids (AA)); for anti-dMettl14 sera rabbit was immunized with a 14 amino acid-long peptide (240–254 AA). Both serums were affinity-purified using peptide antigens crosslinked to sepharose columns. For ovary immunostaining, ovaries from 3–5-day-old females were dissected in ice-cold PBS and fixed in 5% formaldehyde for 20 min at room temperature. After a 10 min wash in PBT1% (1% Triton X-100 in PBS), ovaries were further incubated in PBT1% for 1 h at room temperature. Ovaries were then blocked with PBTB (0.2% Triton, 1% BSA in PBS) for 1 h at room temperature and later incubated with the primary antibodies in PBTB overnight at 4 °C: rabbit anti-Vasa, 1:250 (gift from Lehmann laboratory), mouse anti-ORB 1:30 (#6H4 DSHB). The following day, ovaries were washed 2 times for 30 min in PBTB and blocked with PBTB containing 5% donkey serum (Abcam) for 1 h at room temperature. Secondary antibody was added later in PBTB with donkey serum and ovaries were incubated for 2 h at room temperature. Five washing steps of 30 min were performed with 0.2% Triton in PBT and ovaries were mounted onto slides in Vectashield (Vector Labs). For NMJ staining, third instar larvae were dissected in calcium free HL-3 saline and fixed in 4% paraformaldehyde in PBT (PBS + 0.05% Triton X-100). Larvae were then washed briefly in 0.05% PBT for 30 min and incubated overnight at 4 °C with the following primary antibodies: rabbit anti-synaptotagmin, 1:2,000 (ref. 47); mouse anti-DLG, 1:100 (#4F3, DSHB); TRITC-conjugated anti-HRP, 1:200 (Jackson ImmunoResearch). Secondary antibodies conjugated to Alexa-488 (goat anti-rabbit, Jackson ImmunoResearch) and Alexa-647 (goat anti-mouse, Jackson ImmunoResearch) were used at a concentration of 1:200 and incubated at room temperature for 2 h. Larvae were finally mounted in Vectashield. For staining of Drosophila S2R+ cells, cells were transferred to the poly-lysine pre-treated 8-well chambers (Ibidi) at the density of 2 × 105 cells/well. After 30 min, cells were washed with 1× DPBS (Gibco), fixed with 4% formaldehyde for 10 min and permeabilized with PBST (0.2% Triton X-100 in PBS) for 15 min. Cells were incubated with mouse anti-Myc (1:2000; #9E10, Enzo) in PBST supplemented with 10% of donkey serum at 4 °C, overnight. Cells were washed 3× for 15 min in PBST and then incubated with secondary antibody and 1× DAPI solution in PBST supplemented with 10% of donkey serum for 2 h at 4 °C. After three 15 min washes in PBST, cells were imaged with Leica SP5 confocal microscope using ×63 oil immersion objective. Images from muscles 6–7 (segment A3) were acquired with a Leica Confocal Microscope SP5. Serial optical sections at 512 × 512 or 1,024 × 1,024 pixels were obtained at 0.38 μm with the ×63 objective. Different genotypes were processed simultaneously and imaged using identical confocal acquisition parameters for comparison. Bouton number was quantified in larval abdominal segment A3, muscles 6 and 7, of wandering third instar larvae. ImageJ software (version 1.49) was used to measure the area of the synaptotagmin-positive area. Drosophila S2R+ cells were grown in Schneider`s medium (Gibco) supplemented with 10% FBS (Sigma) and 1% penicillin–streptomycin (Sigma). For RNA interference (RNAi) experiments, PCR templates for the dsRNA were prepared using T7 megascript Kit (NEB). dsRNA against bacterial β-galactosidase gene (lacZ) was used as a control for all RNA interference (RNAi) experiments. S2R+ cells were seeded at the density of 106 cells/ml in serum-free medium and 7.5 μg of dsRNA was added to 106 cells. After 6 h of cell starvation, serum supplemented medium was added to the cells. dsRNA treatment was repeated after 48 and 96 h and cells were collected 24 h after the last treatment. Effectene (Qiagen) was used to transfect vector constructs in all overexpression experiments following the manufacturer`s protocol. For the co-immunoprecipitation assay, different combinations of vectors with indicated tags were co-transfected in S2R+ cells seeded in a 10 cm cell culture dish as described earlier. Forty-eight hours after transfection cells were collected, washed with DPBS and pelleted by 10 min centrifugation at 400g. The cell pellet was lysed in 1 ml of lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% NP-40) supplemented with protease inhibitors (1 μg/ml leupeptin, 1 μg/ml pepstatin, 1 μg/ml aprotinin and 1 mM PMSF) and rotated head-over-tail for 30 min at 4 °C. Nuclei were collected by 10 min centrifugation at 1,000g at 4 °C re-suspended in 300 μl of lysis buffer and sonicated with 5 cycles of 30 s ON, 30 s OFF low power setting. Cytoplasmic and nuclear fractions were joined and centrifuged at 18,000g for 10 min at 4 °C to remove the remaining cell debris. Protein concentrations were determined using Bradford reagent (BioRad). For immunoprecipitation, 2 mg of proteins were incubated with 7 μl of anti-Myc antibody coupled to magnetic beads (Cell Signaling) in lysis buffer and rotated head-over-tail overnight at 4 °C. The beads were washed 3 times for 15 min with lysis buffer and immunoprecipitated proteins were eluted by incubation in 1× NuPAGE LDS buffer (ThermoFischer) at 70 °C for 10 min. Eluted immunoprecipitated proteins were removed from the beads and DTT was added to 10% final volume. Immunoprecipitated proteins and input samples were analysed by western blot after incubation at 70 °C for additional 10 min. For western blot analysis, proteins were separated on 7% SDS–PAGE gel and transferred on Nitrocellulose membrane (BioRad). After blocking with 5% milk in PBST (0.05% Tween in PBS) for 1 h at room temperature, the membrane was incubated with primary antibody in blocking solution overnight at 4 °C. Primary antibodies used were: mouse anti-Myc 1:2,000 (#9E10, Enzo); mouse anti-HA 1:1,000 (#16B12, COVANCE); mouse anti-Tubulin 1:2,000 (#903401, Biolegend); guinea pig anti-Ime4 1:500 and rabbit anti-dMettl14 1:250. The membrane was washed 3 times in PBST for 15 min and incubated 1 h at room temperature with secondary antibody in blocking solution. Protein bands were detected using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). S2R+ cells were transfected with either Myc–YT521-B of Myc–GFP constructs. Forty-eight hours after transfection cells were collected, washed with PBS and pelleted by centrifugation at 400g for 10 min. The cell pellet was lysed and processed in 1 ml of pull-down lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.5% Triton-X100, 0.5 mM DTT). For individual pull-down, 1.5 mg of protein were incubated with either 3 μg of biotinylated RNA probe of bPRL containing m6A or not, or without probe, as a control in 0.5 ml of pull-down buffer supplemented with protease inhibitor mix and 10 U of Murine RNase Inhibitor (NEB) and incubated for 2 h at 4 °C. Five microlitres of Streptavidin beads (M-280, Invitrogen) were added and pull-down samples were incubated for an additional 1 h at 4 °C. After 3 washes of 15 min with pull-down buffer, beads were re-suspended in 400 μl of pull-down buffer. One-hundred microlitres was were used for RNA isolation and dot blot analysis of recovered RNA probes with anti Strep-HRP. The remaining 300 μl of the beads was collected on the magnetic rack and immunoprecipitated proteins were eluted by incubation in 1× SDS buffer (ThermoFischer) at 95 °C for 10 min. Immunoprecipitated proteins as well as input samples were analysed by western blot. Serial dilutions of biotinylated RNA probe of bPRL containing m6A or A were spotted and crosslinked on nitrocellulose membrane (Biorad) with ultraviolet 245 light (3 × 150 mJ/cm2). RNA loading was validated with methylene blue staining. Membranes were blocked with 5% milk in PBST for 1 h at room temperature and washed in PBST before incubation with the proteins of interest. S2R+ cells were transfected with either Myc–YT521-B or Myc–GFP constructs. Forty-eight hours after transfection cells were collected, washed with PBS and pelleted by centrifugation at 400g for 10 min. The cell pellet was lysed in 1 ml of lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% NP-40). Three milligrams of the protein lysate were mixed with 2% BSA in lysis buffer and incubated with the membrane overnight at 4 °C. For control dot-blot rabbit anti-m6A antibody (Synaptic Systems) was used. The next day membranes were washed 3 times in lysis buffer. Membranes with bound proteins were further crosslinked with ultraviolet 245 light (3 × 150 mJ/cm2) and analysed using anti-Myc antibody. For SILAC experiments, S2R+ cells were grown in Schneider medium (Dundee Cell) supplemented with either heavy (Arg8, Lys8) or light amino acids (Arg0, Lys0) (Sigma). For the forward experiment, Myc–YT521-B was transfected in heavy-labelled cells and Myc-alone in light-labelled cells. The reverse experiment was performed vice versa. The co-immunoprecipitation experiment was done as described earlier. Before elution, beads of the heavy and light lysates were combined in 1:1 ratio and eluted with 1× NuPAGE LDS buffer that was subject to MS analysis as described previously48. Raw files were processed with MaxQuant (version 1.5.2.8) and searched against the Uniprot database of annotated Drosophila proteins (Drosophila melanogaster: 41,850 entries, downloaded 8 January 2015). mRNA samples from S2R+ cells depleted for the indicated proteins or from Drosophila staging experiments were prepared following the aforementioned procedure. Three-hundred nanograms of purified mRNA was further digested using 0.3 U Nuclease P1 from Penicillum citrinum (Sigma-Aldrich, Steinheim, Germany) and 0.1 U Snake venom phosphodiesterase from Crotalus adamanteus (Worthington, Lakewood, USA). RNA and enzymes were incubated in 25 mM ammonium acetate, pH 5, supplemented with 20 μM zinc chloride for 2 h at 37 °C. Remaining phosphates were removed by 1 U FastAP (Thermo Scientific, St Leon-Roth, Germany) in a 1 h incubation at 37 °C in the manufacturer supplied buffer. The resulting nucleoside mix was then spiked with 13C stable isotope labelled nucleoside mix from Escherichia coli RNA as an internal standard (SIL-IS) to a final concentration of 6 ng/μl for the sample RNA and 10 ng/μl for the SIL-IS. For analysis, 10 μl of the before mentioned mixture were injected into the LC–MS/MS machine. Generation of technical triplicates was obligatory. All mRNA samples were analysed in biological triplicates, except for the ctr, nito, vir, hrb27C and qkr58E-1 knockdown samples, which were measured as biological duplicates. LC separation was performed on an Agilent 1200 series instrument, using 5 mM ammonium acetate buffer as solvent A and acetonitrile as buffer B. Each run started with 100% buffer A, which was decreased to 92% within 10 min. Solvent A was further reduced to 60% within another 10 min. Until minute 23 of the run, solvent A was increased to 100% again and kept at 100% for 7 min to re-equilibrate the column (Synergi Fusion, 4 μM particle size, 80 Å pore size, 250 × 2.0 mm, Phenomenex, Aschaffenburg, Germany). The ultraviolet signal at 254 nm was recorded via a DAD detector to monitor the main nucleosides. MS/MS was then conducted on the coupled Agilent 6460 Triple Quadrupole (QQQ) mass spectrometer equipped with an Agilent JetStream ESI source which was set to the following parameters: gas temperature, 350 °C; gas flow, 8 l/min; nebulizer pressure, 50 psi; sheath gas temperature, 350 °C; sheath gas flow, 12 l/min; and capillary voltage, 3,000 V. To analyse the mass transitions of the unlabelled m6A and all 13C m6A simultaneously, we used the dynamic multiple reaction monitoring mode. Mass transitions, retention times and QQQ parameters are listed in Supplementary Table 10. The quantification was conducted as described previously49. Briefly, the amount of adenosine was evaluated by the external linear calibration of the area under the curve (AUC) of the ultraviolet signal. The amount of modification was calculated by linear calibration of the SIL-IS in relation to m6A nucleoside. The R2 of both calibrations was at least 0.998 (see Extended Data Fig. 1a, b). Knowing both amounts, the percentage of m6A/A could be determined. MeRIP was performed using the previously described protocol50 with the following modifications. Eight micrograms of purified mRNA from Drosophila S2R+ cells was incubated with 5 μg of anti-m6A antibody (Synaptic Systems) in MeRIP buffer (150 mM NaCl, 10 mM Tris-HCl pH 7.4, 0.1% NP-40) supplemented with 5 U/ml of Murine RNase inhibitor (NEB) for 2 h at 4 °C. In control MeRIP experiment, no antibody was used in the reaction mixture. Five microlitres of A+G magnetic beads were added to all MeRIP samples for 1 h at 4 °C. On bead digestion with RNase T1 (Thermo Fisher) at final concentration 0.1 U/ml was performed for 15 min at room temperature. Beads with captured RNA fragments were then immediately washed 3 times with 500 μl of ice-cold MeRIP buffer and further eluted with 100 μl of elution buffer (0.02 M DTT, 150 mM NaCl, 50 mM Tris-HCl pH 7.4, 1 mM EDTA, 0.1% SDS, 5 U/ml Proteinase K) at 42 °C for 5 min. Elution step was repeated 4 times and 500 μl of acidic phenol/chloroform pH 4.5 (Ambion) was added to 400 μl of the combined eluate per sample to extract captured RNA fragments. Samples were mixed and transferred to Phase Lock Gel Heavy tubes (5Prime) and centrifuged for 5 min at 12,000g. Aqueous phase was precipitated overnight, −80 °C. On the following day, samples were centrifuged, washed twice with 80% EtOH and re-suspended in 10 μl of RNase-free H O (Ambion). Recovered RNA was analysed on RNA Pico Chip (Agilent) and concentrations were determined with RNA HS Qubit reagents. Since no RNA was recovered in the MeRIP control samples, libraries were prepared with 30 ng of duplicate MeRIPs and duplicate input mRNA samples. MeRIP-qPCR was performed on the fraction of eluted immunoprecipitated RNA and an equal amount of input mRNA. cDNA for RT–qPCR was prepared using M-MLV Reverse Transcriptase (Promega) and transcript levels were quantified using Power SYBR Green PCR Master Mix (Invitrogen) using oligonucleotides indicated in Supplementary Table 9. For lifespan assay, 2–3-day-old flies were gender-separated and kept at 25 °C in flasks with apple juice medium (<20 flies/tube). Number of flies tested: females (37, Ime4Δcat/Ime4Δcat; 57, Tubulin-GAL4/UAS-Ime4); males (33, Ime4Δcat/Ime4Δcat; 41, Tubulin-GAL4/UAS-Ime4). To monitor their survival rate over time, flies were counted and transferred into a new tube every 2 days. Behavioural tests were performed on 2–5-day-old females with Canton-S as wild-type control. Wings were cut under cold anaesthesia to one-third of their length on the evening before the experiment. Walking and orientation behaviour was analysed using Buridan’s paradigm as described36. Dark vertical stripes of 12° horizontal viewing angle were shown on opposite sides of an 85-mm diameter platform surrounded by water. The following parameters were extracted by a video-tracking system (5 Hz sampling rate): total fraction of time spent walking (activity), mean walking speed taken from all transitions of a fly between the visual objects, and number of transitions between the two stripes. The visual orientation capacity (mean angular deviation) of the flies was assessed by comparing all 0.2-s path increments per fly (4,500 values in 15 min) to the respective direct path towards the angular-wise closer of the two dark stripes. All statistical groups were tested for normal distribution with the Shapiro–Wilk test. Multiple comparisons were performed using the Kruskal–Wallis ANOVA or one-way ANOVA with a post-hoc Bonferroni correction. n = 15 for all genotypes. The sample size was chosen based on a previous study51 and its power was validated with result analysis. Blinding was applied during the experiment. For samples from S2R+ cells and for full fly RNA samples, Ilumina TruSeq Sequencing Kit (Illumina) was used. For Drosophila head samples, NEBNext Ultra Directional RNA Kit (NEB) was used. Libraries were prepared following the manufacturer`s protocol and sequenced on Illumina HiSeq 2500. The read-length was 71 bp paired end. For MeRIP, NEBNext Ultra Directional Kit was used omitting the RNA fragmentation step for recovered MeRIP samples and following the manufacturer’s protocol for input samples. Libraries were sequenced on an Illumina MiSeq as 68 bp single read in one pool on two flow cells. The RNA-seq data was mapped against the Drosophila genome assembly BDGP6 (Ensembl release 79) using STAR52 (version 2.4.0). After mapping, the bam files were filtered for secondary alignments using samtools (version 1.2). Reads on genes were counted using htseq-count (version 0.6.1p1). After read counting, differential expression analysis was done between conditions using DESeq2 (version 1.6.3) and filtered for a false discovery rate (FDR) < 5%. Differential splicing analysis was performed using rMATS (3.0.9) and filtered for FDR < 10%. The data from fly heads were treated as above but cleaned for mitochondrial and rRNA reads after mapping before further processing. The sample Ime4hom_3 was excluded as an outlier from differential expression analysis. The MeRIP-seq data were processed following the same protocol as the RNA samples for mapping and filtering of the mapped reads. After mapping, peaks were called using MACS (version 1.4.1)53. The genome size used for the MACS was adjusted to reflect the mappable transcriptome size based on Ensembl-annotated genes (Ensembl release 79). After peak calling, peaks were split into subpeaks using PeakSplitter (version 1.0, http://www.ebi.ac.uk/research/bertone/software). Consensus peaks were obtained by intersecting subpeaks of both replicates (using BEDTools, version 2.25.0). For each consensus peak, the coverage was calculated as counts per million (CPM) for each of the samples and averaged for input and MeRIP samples. Fold changes for MeRIP over input were calculated based on these. Peaks were filtered for a minimal fold change of 1.3 and a minimal coverage of 3 CPM in at least one of the samples. Peaks were annotated using the ChIPseeker and the GenomicFeatures package (based on R/Bioconductor)54. In the Buridan paradigm, normality was tested for every dataset; different tests were used depending on the outcome. For not normally distributed data, Kruskal–Wallis test and Wilcoxon test were used. For normally distributed data, Bartlett test was applied to check for homogeneity of variances. ANOVA and t-test were used. Bonferroni corrections were applied. For climbing assays, normality was tested for every dataset. Homogeneity of variances were analysed with Levene’s test. One-way ANOVA test with Tukey’s post-hoc test was performed for multiple comparisons and Student’s t-test when two data sets were compared. For m6A level measurement, normality was tested for every dataset. Homogeneity of variances were analysed with Levene’s test. One-way ANOVA test with Tukey’s post-hoc test was performed for multiple comparisons. Randomization was used for selection of female flies of chosen genotype for climbing tests, Buridan paradigm and RNA sequencing experiments. Randomized complete block design was applied to ensure the equal number of flies per test group. Complete randomization was applied for selection of larvae or flies of the chosen genotype for lifespan assay and NMJ staining experiment. The data that support the findings of this study have been deposited in the NCBI Gene Expression Omnibus (GEO) under accession number GSE79297. All other relevant data are available from the corresponding author.


News Article | January 13, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment. A constitutively stabilized mutant of HIF2α (HIF2α-TM) was obtained from Christina Warnecke20. The HIF2α-TM (triple mutant) construct harbours the following mutations in the prolyl and asparagyl hydroxylation sites: P405A, P530G and N851A. Polypeptide fragments of DYRK1B were cloned into pcDNA3-HA and include DYRK1B N terminus, N-Ter (amino acids 1–110), DYRK1B kinase domain, KD (amino acids 111–431), and DYRK1B C terminus, C-Ter (amino acids 432–629). cDNAs for RBX1, Elongin B and Elongin C were kindly provided from Michele Pagano (New York University) and cloned into the pcDNA vector by PCR. HA-tagged HIF1α and HIF2α were obtained from Addgene. GFP-tagged DYRK1A and DYRK1B were cloned into pcDNA vector. pcDNA-HA-VHL was provided by Kook Hwan Kim (Sungkyunkwan University School of Medicine, Korea). Site-directed mutagenesis was performed using QuickChange or QuickChange Multi Site-Directed mutagenesis kit (Agilent) and resulting plasmids were sequence verified. Lentivirus was generated by co-transfection of the lentiviral vectors with pCMV-ΔR8.1 and pMD2.G plasmids into HEK293T cells as previously described9, 42. ShRNA sequences are: ID2-1: GCCTACTGAATGCTGTGTATACTCGAGTATACACAGCATTCAGTAGGC; ID2-2: CCCACTATTGTCAGCCTGCATCTCGAGATGCAGGCTGACAATAGTGGG; DYRK1A: CAGGTTGTAAAGGCATATGATCTCGAGATCATATGCCTTTACAACCTG; DYRK1B: GACCTACAAGCACATCAATGACTCGAGTCATTGATGTGCTTGTAGGTC. IMR-32 (ATCC CCL-127), SK-N-SH (ATCC HTB-11), U87 (ATCC HTB-14), NCI-H1299 (ATCC CRL-5803), HRT18 (ATCC CCL-244), and HEK293T (ATCC CRL-11268) cell lines were acquired through American Type Culture Collection. U251 (Sigma, catalogue number 09063001) cell line was obtained through Sigma. Cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (FBS, Sigma). Cells were routinely tested for mycoplasma contamination using Mycoplasma Plus PCR Primer Set (Agilent, Santa Clara, CA) and were found to be negative. Cells were transfected with Lipofectamine 2000 (Invitrogen) or calcium phosphate. Mouse NSCs were grown in Neurocult medium (StemCell Technologies) containing 1× proliferation supplements (StemCell Technologies), and recombinant FGF-2 and EGF (20 ng ml−1 each; Peprotech). GBM-derived glioma stem cells were obtained by de-identified brain tumour specimens from excess material collected for clinical purposes at New York Presbyterian-Columbia University Medical Center. Donors (patients diagnosed with glioblastoma) were anonymous. Progressive numbers were used to label specimens coded in order to preserve the confidentiality of the subjects. Work with these materials was designated as IRB exempt under paragraph 4 and it is covered under IRB protocol #IRB-AAAI7305. GBM-derived GSCs were grown in DMEM:F12 containing 1× N2 and B27 supplements (Invitrogen) and human recombinant FGF-2 and EGF (20 ng ml−1 each; Peprotech). Cells at passage (P) 4 were transduced using lentiviral particle in medium containing 4 μg ml−1 of polybrene (Sigma). Cells were cultured in hypoxic chamber with 1% O (O Control Glove Box, Coy Laboratory Products, MI) for the indicated times or treated with a final concentration of 100–300 μM CoCl (Sigma) as specified in figure legends. Mouse neurosphere assay was performed by plating 2,000 cells in 35 mm dishes in collagen containing NSC medium to ensure that distinct colonies were derived from single cells and therefore clonal in origin43. We determined neurosphere formation over serial clonal passages in limiting dilution semi-solid cultures and the cell expansion rate over passages, which is considered a direct indication of self-renewing symmetric cell divisions44. For serial sub-culturing we mechanically dissociated neurospheres into single cells in bulk and re-cultured them under the same conditions for six passages. The number of spheres was scored after 14 days. Only colonies >100 μm in diameter were counted as spheres. Neurosphere size was determined by measuring the diameters of individual neurospheres under light microscopy. Data are presented as percent of neurospheres obtained at each passage (number of neurospheres scored/number of NSCs plated × 100) in three independent experiments. P value was calculated using a multiple t-test with Holm–Sidak correction for multiple comparisons. To determine the expansion rate, we plated 10,000 cells from 3 independent P1 clonal assays in 35 mm dishes and scored the number of viable cells after 7 days by Trypan Blue exclusion. Expansion rate of NSCs was determined using a linear regression model and difference in the slopes (P value) was determined by the analysis of covariance (ANCOVA) using Prism 6.0 (GraphPad). Limiting dilution assay (LDA) for human GSCs was performed as described previously45. Briefly, spheres were dissociated into single cells and plated into 96-well plates in 0.2 ml of medium containing growth factors at increasing densities (1–100 cells per well) in triplicate. Cultures were left undisturbed for 14 days, and then the percent of wells not containing spheres for each cell dilution was calculated and plotted against the number of cells per well. Linear regression lines were plotted, and we estimated the minimal frequency of glioma cells endowed with stem cell capacity (the number of cells required to generate at least one sphere in every well = the stem cell frequency) based on the Poisson distribution and the intersection at the 37% level using Prism 6.0 software. Data represent the means of three independent experiments performed in different days for the evaluation of the effects of ID2, ID2(T27A) in the presence or in the absence of DYRK1B. LDA for the undegradable HIF2α rescue experiment was performed by using three cultures transduced independently on the same day. To identify the sites of ID2 phosphorylation from IMR32 human neuroblastoma cells, the immunoprecipitated ID2 protein was excised, digested with trypsin, chymotrypsin and Lys-C and the peptides extracted from the polyacrylamide in two 30 μl aliquots of 50% acetonitrile/5% formic acid. These extracts were combined and evaporated to 25 μl for MS analysis. The LC–MS system consisted of a state-of-the-art Finnigan LTQ-FT mass spectrometer system with a Protana nanospray ion source interfaced to a self-packed 8 cm × 75 μm id Phenomenex Jupiter 10 μm C18 reversed-phase capillary column. 0.5–5 μl volumes of the extract were injected and the peptides eluted from the column by an acetonitrile/0.1 M acetic acid gradient at a flow rate of 0.25 μl min−1. The nanospray ion source was operated at 2.8 kV. The digest was analysed using the double play capability of the instrument acquiring full scan mass spectra to determine peptide molecular weights and product ion spectra to determine amino acid sequence in sequential scans. This mode of analysis produces approximately 1200 CAD spectra of ions ranging in abundance over several orders of magnitude. Tandem MS/MS experiments were performed on each candidate phosphopeptide to verify its sequence and locate the phosphorylation site. A signature of a phosphopeptide is the detection of loss of 98 daltons (the mass of phosphoric acid) in the MS/MS spectrum. With this method, three phosphopeptides were found to carry phosphorylations at residues Ser5, Ser14 and Thr27 of the ID2 protein. The anti-phospho-T27-ID2 antibody was generated by immunizing rabbits with a short synthetic peptide containing the phosphorylated T27 (CGISRSK-pT-PVDDPMS) (Yenzym Antibodies, LLC). A two-step purification process was applied. First, antiserum was cross-absorbed against the phospho-peptide matrix to purify antibodies that recognize the phosphorylated peptide. Then, the anti-serum was purified against the un-phosphorylated peptide matrix to remove non-specific antibodies. Cells were lysed in NP40 lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)) or RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 0.5% sodium dexoycholate, 0.1% sodium dodecyl sulphate, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)). Lysates were cleared by centrifugation at 15,000 r.p.m. for 15 min at 4 °C. For immunoprecipitation, cell lysates were incubated with primary antibody (hydroxyproline, Abcam, ab37067; VHL, BD, 556347; DYRK1A, Cell Signaling Technology, 2771; DYRK1B, Cell Signaling Technology, 5672) and protein G/A beads (Santa Cruz, sc-2003) or phospho-Tyrosine (P-Tyr-100) Sepharose beads (Cell Signaling Technology, 9419), HA affinity matrix (Roche, 11815016001), Flag M2 affinity gel (Sigma, F2426) at 4 °C overnight. Beads were washed with lysis buffer four times and eluted in 2× SDS sample buffer. Protein samples were separated by SDS–PAGE and transferred to polyvinyl difluoride (PVDF) or nitrocellulose (NC) membrane. Membranes were blocked in TBS with 5% non-fat milk and 0.1% Tween20, and probed with primary antibodies. Antibodies and working concentrations are: ID2 1:500 (C-20, sc-489), GFP 1:1,000 (B-2, sc-9996), HIF2α/EPAS-1 1:250 (190b, sc-13596), c-MYC (9E10, sc-40), and Elongin B 1:1,000 (FL-118, sc-11447), obtained from Santa Cruz Biotechnology; phospho-Tyrosine 1:1,000 (P-Tyr-100, 9411), HA 1:1,000 (C29F4, 3724), VHL 1:500 (2738), DYRK1A 1:1,000, 2771; DYRK1B 1:1,000, 5672) and RBX1 1:2,000 (D3J5I, 11922), obtained from Cell Signaling Technology; VHL 1:500 (GeneTex, GTX101087); β-actin 1:8000 (A5441), α-tubulin 1:8,000 (T5168), and Flag M2 1:500 (F1804) obtained from Sigma; HIF1α 1:500 (H1alpha67, NB100-105) and Elongin C 1:1,000 (NB100-78353) obtained from Novus Biologicals; HA 1:1000 (3F10, 12158167001) obtained from Roche. Secondary antibodies horseradish-peroxidase-conjugated were purchased from Pierce and ECL solution (Amersham) was used for detection. For in vitro binding assays, HA-tagged RBX1, Elongin B, Elongin C and VHL were in vitro translated using TNT quick coupled transcription/translation system (Promega). Active VHL protein complex was purchased from EMD Millipore. Purified His-VHL protein was purchased from ProteinOne (Rockville, MD). GST, GST–ID2 and Flag–ID2 proteins were bacterial expressed and purified using glutathione sepharose beads (GE healthcare life science). Active DYRK1B (Invitrogen) was used for in vitro phosphorylation of Flag-ID2 proteins. Biotinylated wild-type and modified (pT27 and T27W) ID2 peptides (amino acids 14–34) were synthesized by LifeTein (Somerset, NJ). In vitro binding experiments between ID2 and VCB–Cul2 were performed using 500 ng of Flag-ID2 and 500 ng of VCB–Cul2 complex or 500 ng VHL protein in binding buffer (50 mM Tris-Cl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1.5 mM Na VO , 0.2% NP40, 10% glycerol, 0.1 mg ml−1 BSA and EDTA-free protease inhibitor cocktail (Roche)) at 4 °C for 3 h. In vitro binding between ID2 peptides and purified proteins was performed using 2 μg of ID2 peptides and 200 ng of recombinant VCB–Cul2 complex or 200 ng recombinant VHL in binding buffer (50 mM Tris-Cl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1.5 mM Na VO , 0.4% NP40, 10% glycerol, 0.1 mg ml−1 BSA and EDTA-free protease inhibitor cocktail (Roche)) at 4 °C for 3 h or overnight. Protein complexes were pulled down using glutathione sepharose beads (GE Healthcare Life Science) or streptavidin conjugated beads (Thermo Fisher Scientific) and analysed by immunoblot. Cdk1, Cdk5, DYRK1A, DYRK1B, ERK, GSK3, PKA, CaMKII, Chk1, Chk2, RSK-1, RSK-2, aurora-A, aurora-B, PLK-1, PLK-2, and NEK2 were all purchased from Life Technology and ATM from EMD Millipore. The 18 protein kinases tested in the survey were selected because they are proline-directed S/T kinases (Cdk1, Cdk5, DYRK1A, DYRK1B, ERK) and/or because they were considered to be candidate kinases for Thr27, Ser14 or Ser5 from kinase consensus prediction algorithms (NetPhosK1.0, http://www.cbs.dtu.dk/services/NetPhosK/; GPS Version 3.0 http://gps.biocuckoo.org/#) or visual inspection of the flanking regions and review of the literature for consensus kinase phosphorylation motifs. 1 μg of bacterially purified GST-ID substrates were incubated with 10–20 ng each of the recombinant active kinases. The reaction mixture included 10 μCi of [γ-32P]ATP (PerkinElmer Life Sciences) in 50 μl of kinase buffer (25 mM Tris-HCl, pH 7.5, 5 mM β-glycerophosphate, 2 mM dithiothreitol (DTT), 0.1 mM Na VO , 10 mM MgCl , and 0.2 mM ATP). Reactions were incubated at 30 °C for 30 min. Reactions were terminated by addition of Laemmli SDS sample buffer and boiling on 95 °C for 5 min. Proteins were separated on SDS–PAGE gel and phosphorylation of proteins was visualized by autoradiography. Coomassie staining was used to document the amount of substrates included in the kinase reaction. In vitro phosphorylation of Flag– ID2 proteins by DYRK1B (Invitrogen) was performed using 500 ng of GST–DYRK1B and 200 ng of bacterially expressed purified Flag–ID2 protein. In vivo kinase assay in GSCs and glioma cells was performed using endogenous or exogenously expressed DYRK1A and DYRK1B. Cell lysates were prepared in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)). DYRK1 kinases were immunoprecipitated using DYRK1A and DYRK1B antibodies (for endogenous DYRK1 proteins) or GFP antibody (for exogenous GFP–DYRK1 proteins) from 1 mg cellular lysates at 4 °C. Immunoprecipitates were washed with lysis buffer four times followed by two washes in kinase buffer as described above and incubated with 200 ng purified Flag–ID2 protein in kinase buffer for 30 min at 30 °C. Kinase reactions were separated by SDS–PAGE and analysed by western blot using p-T27-ID2 antibody. HIF2α half-life was quantified using ImageJ processing software (NIH). Densitometry values were analysed by Prism 6.0 using the linear regression function. Stoichiometric quantification of ID2 and VHL in U87 cells was obtained using recombinant Flag–ID2 and His-tagged-VHL as references. The chemiluminescent signal of serial dilutions of the recombinant proteins was quantified using ImageJ, plotted to generate a linear standard curve against which the densitometric signal generated by serial dilutions of cellular lysates (1 × 106 U87 cells) was calculated. Triplicate values ± s.e.m. were used to estimate the ID2:VHL ratio per cell. The stoichiometry of pT27-ID2 phosphorylation was determined as described46. Briefly, SK-N-SH cells were plated at density of 1 × 106 in 100 mm dishes. Forty-eight hours later 1.5 mg of cellular lysates from cells untreated or treated with CoCl during the previous 24 h were prepared in RIPA buffer and immunoprecipitated using 4 μg of pT27-ID2 antibody or rabbit IgG overnight at 4 °C. Immune complexes were collected with TrueBlot anti-rabbit IgG beads (Rockland), washed 5 times in lysis buffer, and eluted in SDS sample buffer. Serial dilutions of cellular lysates, IgG and pT27-ID2 immunoprecipitates were loaded as duplicate series for SDS–PAGE and western blot analysis using ID2 or p-T27-ID2 antibodies. Densitometry quantification of the chemiluminescent signals was used to determine (1) the efficiency of the immunoprecipitation using the antibody against p-ID2-T27 and (2) the ratio between efficiency of the immunoprecipitation evaluated by western blot for p-T27-ID2 and total ID2 antibodies. This represents the percent of phosphorylated Thr27 of ID2 present in the cell preparation. Cellular ID2 complexes were purified from the cell line NCI-H1299 stably engineered to express Flag-HA–ID2. Cellular lysates were prepared in 50 mM Tris-HCl, 250 mM NaCl, 0.2% NP40, 1 mM EDTA, 10% glycerol, protease and phosphatase inhibitors. Flag-HA–ID2 immunoprecipitates were recovered first with anti-Flag antibody-conjugated M2 agarose (Sigma) and washed with lysis buffer containing 300 mM NaCl and 0.3% NP40. Bound polypeptides were eluted with Flag peptide and further affinity purified by anti-HA antibody-conjugated agarose (Roche). The eluates from the HA beads were analysed directly on long gradient reverse phase LC–MS/MS. A specificity score of proteins interacting with ID2 was computed for each polypeptide by comparing the number of peptides identified from mass spectrometry analysis to those reported in the CRAPome database that includes a list of potential contaminants from affinity purification-mass spectrometry experiments (http://www.crapome.org). The specificity score is computed as [(#peptide*#xcorr)/(AveSC*MaxSC* # of Expt.)], #peptide, identified peptide count; #xcorr, the cross-correlation score for all candidate peptides queried from the database; AveSC, averaged spectral counts from CRAPome; MaxSC, maximal spectral counts from CRAPome; and # of Expt., the total found number of experiments from CRAPome. U87 cells were transfected with pcDNA3-HA-HIFα (HIF1α or HIF2α), pcDNA3-Flag–ID2 (WT or T27A), pEGFP-DYRK1B and pcDNA3-Myc-Ubiquitin. 36 h after transfection, cells were treated with 20 μM MG132 (EMD Millipore) for 6 h. After washing with ice-cold PBS twice, cells were lysed in 100 μl of 50 mM Tris-HCl pH 8.0, 150 mM NaCl (TBS) containing 2% SDS and boiled at 100 °C for 10 min. Lysates were diluted with 900 μl of TBS containing 1% NP40. Immunoprecipitation was performed using 1 mg of cellular lysates. Ubiquitylated proteins were immunoprecipitated using anti-Myc antibody and analysed by western blot using HA antibody. A previously described47, highly accurate flexible peptide docking method implemented in ICM software (Molsoft LLC, La Jolla CA) was used to dock ID2 peptides to VCB or components thereof. A series of overlapping peptides of varying lengths were docked to the complex of VHL and Elongin C (EloC), or VHL or EloC alone, from the recent crystallographic structure22 of the VHL-CRL ligase. Briefly, an all-atom model of the peptide was docked into grid potentials derived from the X-ray structure using a stochastic global optimization in internal coordinates with pseudo-Brownian and collective ‘probability-biased’ random moves as implemented in the ICM program. Five types of potentials for the peptide-receptor interaction energy — hydrogen van der Waals, non-hydrogen van der Waals, hydrogen bonding, hydrophobicity and electrostatics — were precomputed on a rectilinear grid with 0.5 Å spacing that fills a 34 Å × 34 Å × 25 Å box containing the VHL-EloC (V-C) complex, to which the peptide was docked by searching its full conformational space within the space of the grid potentials. The preferred docking conformation was identified by the lowest energy conformation in the search. The preferred peptide was identified by its maximal contact surface area with the respective receptor. ab initio folding and analysis of the peptides was performed as previously described48, 49. ab initio folding of the ID2 peptide and its phospho-T27 mutant showed that both strongly prefer an α-helical conformation free (unbound) in solution, with the phospho-T27 mutant having a calculated free energy almost 50 kcal-equivalent units lower than the unmodified peptide. Total RNA was prepared with Trizol reagent (Invitrogen) and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen) as described42, 50. Semi-quantitative RT–PCR was performed using AccuPrime Taq DNA polymerase (Invitrogen) and the following primers: for HIF2A Fw 5′_GTGCTCCCACGGCCTGTA_3′ and Rv 5′_TTGTCACACCTATGGCATATCACA_3′; GAPDH Fw 5′_AGAAGGCTGGGGCTCATTTG_3′ and Rv 5′_AGGGGCCATCCACAGTCTTC_3′. The quantitative RT–PCR was performed with a Roche480 thermal cycler, using SYBR Green PCR Master Mix from Applied Biosystem. Primers used in qRT–PCR are: SOX2 Fw 5′_TTGCTGCCTCTTTAAGACTAGGA_3′ and Rv 5′_CTGGGGCTCAAACTTCTCTC_3′; NANOG Fw 5′_ATGCCTCACACGGAGACTGT_3′ and Rv 5′_AAGTGGGTTGTTTGCCTTTG_3′; POU5F1 Fw 5′_GTGGAGGAAGCTGACAACAA_3′ and Rv 5′_ATTCTCCAGGTTGCCTCTCA_3′; FLT1 Fw 5′_AGCCCATAAATGGTCTTTGC_3′ and Rv 5′_GTGGTTTGCTTGAGCTGTGT_3′; PIK3CA Fw 5′_TGCAAAGAATCAGAACAATGCC_3′ and 5′_CACGGAGGCATTCTAAAGTCA_3′; BMI1 Fw 5′_AATCCCCACCTGATGTGTGT_3′ and Rv 5′_GCTGGTCTCCAGGTAACGAA_3′; GAPDH Fw 5′_GAAGGTGAAGGTCGGAGTCAAC_3′ and Rv 5′_CAGAGTTAAAAGCAGCCCTGGT_3′; 18S Fw 5′_CGCCGCTAGAGGTGAAATTC_3′ and Rv 5′_CTTTCGCTCTGGTCCGTCTT_3′. The relative amount of specific mRNA was normalized to 18S or GAPDH. Results are presented as the mean ± s.d. of three independent experiments each performed in triplicate (n = 9). Statistical significance was determined by Student’s t-test (two-tailed) using GraphPad Prism 6.0 software. Mice were housed in pathogen-free animal facility. All animal studies were approved by the IACUC at Columbia University (numbers AAAE9252; AAAE9956). Mice were 4–6-week-old male athymic nude (Nu/Nu, Charles River Laboratories). No statistical method was used to pre-determine sample size. No method of randomization was used to allocate animals to experimental groups. Mice in the same cage were generally part of the same treatment. The investigators were not blinded during outcome assessment. In none of the experiments did tumours exceed the maximum volume allowed according to our IACUC protocol, specifically 20 mm in the maximum diameter. 2 × 105 U87 cells stably expressing a doxycycline inducible lentiviral vector coding for DYRK1B or the empty vector were injected subcutaneously in the right flank in 100 μl volume of saline solution (7 mice per each group). Mice carrying 150–220 mm3 subcutaneous tumours (21 days after injection) generated by cells transduced with DYRK1B were treated with vehicle or doxycycline by oral gavage (Vibramycin, Pfizer Labs; 8 mg ml−1, 0.2 ml per day)51; mice carrying tumours generated by cells transduced with the empty vector were also fed with doxycycline. Tumour diameters were measured daily with a caliper and tumour volumes estimated using the formula: width2 × length/2 = V (mm3). Mice were euthanized after 5 days of doxycycline treatment. Tumours were dissected and fixed in formalin for immunohistochemical analysis. Data are means ± s.d. of  7 mice in each group. Statistical significance was determined by ANCOVA using GraphPad Prism 6.0 software package (GraphPad). Orthotopic implantation of glioma cells was performed as described previously using 5 × 104 U87 cells transduced with pLOC-vector, pLOC-DYRK1B (WT) or pLOC-DYRK1B-K140R mutant in 2 μl phosphate buffer42. In brief, 5 days after lentiviral infection, cells were injected 2 mm lateral and 0.5 mm anterior to the bregma, 2.5 mm below the skull of 4–6-week-old athymic nude (Nu/Nu, Charles River Laboratories) mice. Mice were monitored daily for abnormal ill effects according to AAALAS guidelines and euthanized when neurological symptoms were observed. Tumours were dissected and fixed in formalin for immunohistochemical analysis and immunofluorescence using V5 antibody (Life technologies, 46-0705) to identify exogenous DYRK1B and an antibody against human vimentin (Sigma, V6630) to identify human glioma cells. A Kaplan–Meier survival curve was generated using the GraphPad Prism 6.0 software package (GraphPad). Points on the curves indicate glioma related deaths (n = 7 animals for each group, p was determined by log rank analysis). We did not observe non-glioma related deaths. Mice injected with U87 cells transduced with pLOC-DYRK1B(WT) that did not show neurological signs on day 70 were euthanized for histological evaluation and shown as tumour-free mice in Fig. 5g. Intracranial injection of H-Ras-V12-IRES-Cre-ER-shp53 lentivirus was performed in 4-week-old Id1Flox/Flox, Id2Flox/Flox, Id3−/− mice (C57Bl6/SV129). Briefly, 1.3 µl of purified lentiviral particles in PBS were injected 1.45 mm lateral and 1.6 mm anterior to the bregma and 2.3 mm below the skull using a stereotaxic frame. Tamoxifen was administered for 5 days at 9 mg per 40 g of mouse weight by oral gavage starting 30 days after surgery. Mice were killed 2 days later and brains dissected and fixed for histological analysis. Tissue preparation and immunohistochemistry on tumour xenografts were performed as previously described42, 50, 52. Antibodies used in immunostaining are: HIF2α, mouse monoclonal, 1:200 (Novus Biological, NB100-132); Olig2, rabbit polyclonal, 1:200 (IBL International, JP18953); human Vimentin 1:50 (Sigma, V6630), Bromodeoxyuridine, mouse monoclonal 1:500 (Roche, 11170376001), V5 1:500 (Life technologies, 46-0705). Sections were permeabilized in 0.2% tritonX-100 for 10 min, blocked with 1% BSA-5% goat serum in PBS for 1 h. Primary antibodies were incubated at 4 °C overnight. Secondary antibodies biotinylated (Vector Laboratories) or conjugated with Alexa594 (1:500, Molecular Probes) were used. Slides were counterstained with haematoxylin for immunohistochemistry and DNA was counterstained with DAPI (Sigma) for immunofluorescence. Images were acquired using an Olympus 1X70 microscope equipped with digital camera and processed using Adobe Photoshop CS6 software. BrdU-positive cells were quantified by scoring the number of positive cells in five 4 × 10−3 mm2 images from 5 different mice from each group. Blinding was applied during histological analysis. Data are presented as means of five different mice ± standard deviation (s.d.) (two-tailed Student’s t-test, unequal variance). To infer if ID2 modulates the interactions between HIF2α and its transcriptional targets we used a modified version of MINDy53 algorithm, called CINDy25. CINDy uses adaptive partitioning method to accurately estimate the full conditional mutual information between a transcription factor and a target gene given the expression or activity of a signalling protein. Briefly, for every pair of transcription factor and target gene of interest, it estimates the mutual information that is, how much information can be inferred about the target gene when the expression of the transcription factor is known, conditioned on the expression/activity of the signalling protein. It estimates this conditional mutual information by estimating the multi-dimensional probability densities after partitioning the sample distribution using adaptive partitioning method. We applied CINDy algorithm on gene expression data for 548 samples obtained from The Cancer Genome Atlas (TCGA). Since the activity level and not the gene expression of ID2 is the determinant of its modulatory function that is, the extent to which it modulates the transcriptional network of HIF2α, we used an algorithm called Virtual Inference of Protein-activity by Enriched Regulon analysis (VIPER) to infer the activity of ID2 protein from its gene expression profile26. VIPER method allows the computational inference of protein activity, on an individual sample basis, from gene expression profile data. It uses the expression of genes that are most directly regulated by a given protein, such as the targets of a transcription factor (TF), as an accurate reporter of its activity. We defined the targets of ID2 by running ARACNe algorithm on 548 gene expression profiles and use the inferred 106 targets to determine its activity (Supplementary Table 3). We applied CINDy on 277 targets of HIF2α represented in Ingenuity pathway analysis (IPA) and for which gene expression data was available (Supplementary Table 4). Of these 277 targets, 77 are significantly modulated by ID2 activity (P value ≤ 0.05). Among the set of target genes whose expression was significantly positively correlated (P value ≤ 0.05) with the expression of HIF2α irrespective of the activity of ID2, that is, correlation was significant for samples with both high and low activity of ID2, the average expression of target genes for a given expression of HIF2α was higher when the activity of ID2 was high. The same set of target gene were more correlated in high ID2 activity samples compared to any set of random genes of same size (Fig. 5a), whereas they were not in ID2 low activity samples (Fig. 5b). We selected 25% of all samples with the highest/lowest ID2 activity to calculate the correlation between HIF2α and its targets. To determine whether regulation of ID2 by hypoxia might impact the correlation between high ID2 activity and HIF2α shown in Fig. 5a, b we compared the effects of ID2 activity versus ID2 expression for the transcriptional connection between HIF2α and its targets. We selected 25% of all patients (n = 548) in TCGA with high ID2 activity and 25% of patients with low ID2 activity and tested the enrichment of significantly positively correlated targets of HIF2α in each of the groups. This resulted in significant enrichment (P value < 0.001) in high ID2 activity but showed no significant enrichment (P value = 0.093) in low ID2 activity samples. Moreover, the difference in the enrichment score (∆ES) in these two groups was statistically significant (P value < 0.05). This significance is calculated by randomly selecting the same number of genes as the positively correlated targets of HIF2α, and calculating the ∆ES for these randomly selected genes, giving ∆ES . We repeated this step 1,000 times to obtain 1,000 ∆ES that are used to build the null distribution (Extended Data Fig. 9b). We used the null distribution to estimate P value calculated as (number of ∆ES > ∆ES )/1,000. Enrichment was observed only when ID2 activity was high but not when ID2 activity was low, thus suggesting that ID2 activity directionally impacts the regulation of targets of HIF2α by HIF2α. Consistently, the significant ∆ES using ID2 activity suggests that ID2 activity is determinant of correlation between HIF2α and its targets. Conversely, when we performed similar analysis using ID2 expression instead of ID2 activity, we found significant enrichment of positively correlated targets of HIF2α both in samples with high expression (P value = 0.025) and low expression of ID2 (P value = 0.048). Given the significant enrichment in both groups, we did not observe any significant difference in the enrichment score in the two groups (P value of ∆ES = 0.338). Thus, while the determination of the ID2 activity and its effects upon the HIF2α-targets connection by VIPER and CINDy allowed us to determine the unidirectional positive link between high ID2 activity and HIF2α transcription, a similar analysis performed using ID2 expression contemplates the dual connection between ID2 and HIF2α. To test if expression of DYRK1A and DYRK1B is a predictor of prognosis, we divided the patients into two cohorts based on their relative expression compared to the mean expression of all patients in GBM. First cohort contained the patients with high expression of both DYRK1A and DYRK1B (n = 101) and the other cohort contained patients with low expression (n = 128). We used average expression for both DYRK1A and DYRK1B, which individually divide the patient cohort into half and half. However, when we use the condition that patients should display higher or lower average expression of both these genes, then we select approximately 19% for high expression and 24% for low expression. Selection of these patients was entirely dependent on the overall expression of these genes in the entire cohort rather than a predefined cutoff. Kaplan–Meier survival analysis showed the significant survival benefit for the patients having the high expression of both DYRK1A and DYRK1B (P value = 0.004) compared to the patients with low expression. When similar analysis was performed using only the expression of DYRK1A or DYRK1B alone, the prediction was either non-significant (DYRK1A) or less significant (DYRK1B, P value = 0.008) when compared to the predictions using the expression of both genes. Results in graphs are expressed as means ± s.d. or means ± s.e.m., as indicated in figure legends, for the indicated number of observations. Statistical significance was determined by the Student’s t-test (two-tailed, unequal variance). P value < 0.05 is considered significant and is indicated in figure legends.


News Article | March 1, 2017
Site: www.chromatographytechniques.com

Phenomenex’s two additions to its BioSolutions portfolio offer high-efficiency reversed-phase characterization of synthetic DNA and RNA. The Clarity Oligo-XT C18 columns feature novel and robust core-shell media and increased sensitivity that improves quantitation by mass spectrometry. The core-shell particles deliver the separation power necessary to accurately resolve closely related synthetic oligonucleotide sequences. The columns are available in directly scalable 1.7, 2.6 and 5µm particle sizes that enable easy method transfer between analytical HPLC/UHPLC instrumentation and preparative purifications systems. The Clarity Oligo-SAX columns feature an entirely new, rugged non-porous particle that retains synthetic oligonucleotides through strong ion exchange mechanisms, adding a robust strong anion exchanger choice with improved column lifetimes to the Clarity family. These quaternary amine functionalized, nonporous particles are engineered for performance at high pH (2.5 to 12.5) and temperatures up to 85C and are provided in 5µm particle size for analytical characterization. Phenomenex, Inc. www.phenomenex.com, 310-212-0555


— Segments The market for Liquid chromatography Instruments is segmented in mainly two parts i.e. by Type, by end users and its various sub-segments; by type include High pressure liquid chromatography (HPLC), Ultra high pressure liquid chromatography (UHPLC), Low pressure liquid chromatography (LPLC), Liquid-solid chromatography, Normal phase chromatography, Reverse phase chromatography, Flash chromatography, Partition chromatography, Ion chromatography, Size exclusion chromatography, Affinity chromatography and Chiral chromatography. by End Users include Biotechnology and pharmaceuticals industries, Hospitals, research laboratories, Agriculture industries and others. Market Synopsis of Liquid chromatography Instruments Market Scenario Globally the market for Liquid chromatography Instruments is increasing rapidly the main reason for this is the growth in pharmaceutical industry. The factors that influence the growth of Liquid chromatography Instruments market are the increasing development in pharmaceutical industry for understanding appropriate chemical for introducing new medicine and maintain pharmaceutical quality. The market is also growing due to usage of Liquid chromatography Instruments in industries such as Biotechnology and pharmaceuticals industries, Hospitals, research laboratories, Agriculture industries and others. Globally the market for Liquid chromatography Instruments is expected to grow at the rate of about XX% CAGR from 2016 to 2027. Ask for your specific company profile and country level customization on reports Key Players The key players that are involved in Global Liquid chromatography Instruments market are • AC Analytical Controls BV (Netherlands), • Thermo Fisher Scientific, Inc. (U.S.), • Phenomenex, Inc. (U.S.)., • Agilent Technologies (U.S.), • PerkinElmer, Inc. (U.S.), • Shimadzu Corporation (Japan), • Waters Corporation (U.S.), • JASCO, Inc. (U.S.), • Novasep Holding S.A.S. (France), • Pall Corporation (U.S.), • GL Sciences, Inc. (Japan). Study Objectives of Liquid chromatography Instruments • To provide detailed analysis of the market structure along with forecast for the next 10 years of the various segments and sub-segments of the global Liquid chromatography Instruments market • To provide insights about factors affecting the market growth • To Analyze the Liquid chromatography Instruments market based on various factors- price analysis, supply chain analysis, porters five force analysis etc. • To provide historical and forecast revenue of the market segments and sub-segments with respect to four main geographies and their countries- Americas, Europe, Asia, and Rest of the World (ROW) • To provide country level analysis of the market with respect to the current market size and future prospective • To provide country level analysis of the market for segment by Type, End Users and its sub-segments. • To provide strategic profiling of key players in the market, comprehensively analyzing their core competencies, and drawing a competitive landscape for the market Regional Analysis of Liquid chromatography Instruments North America dominated the Global Liquid chromatography Instruments market with the largest market share, accounting for $XX million and is expected to grow over $XX billion by 2027. The European market for Liquid chromatography Instruments is expected to grow at XX% GAGR (2016-2027). Asia-Pacific is expected to grow at CAGR of XX% from $ XX million in 2016 to $XX million by 2027. “Analysis also includes consumption. Import and export data for Regions North America, Europe, China, Japan, Southeast Asia, India.” The market is divided into the following segments based on geography: North America • US • Canada • Mexico Europe • Germany • France • Italy • U.K • Rest of Europe Asia– Pacific • China • India • Japan • Rest of Asia-Pacific RoW • Brazil • Argentina • Egypt • South Africa Others Reasons to Purchase this report: From an insight perspective, this research report has focused on various levels of analyses—industry analysis (industry trends), market share analysis of top players, supply chain analysis, and company profiles, which together comprise and discuss the basic views on the competitive landscape, emerging and high-growth segments of the Global Liquid chromatography Instruments Market. high-growth regions, and market drivers, restraints, and opportunities. Key questions answered in this report • What will the market size be in 2027 and what will the growth rate be? • What are the key market trends? • What is driving this market? • What are the challenges to market growth? • Who are the key vendors in this market space? • What are the market opportunities and threats faced by the key vendors? • What are the strengths and weaknesses of the key vendors? Related Report North America Drug Screening Market Research Report- Forecast To 2027 North America Drug Screening market Information, by products (rapid testing devices, breath analyzers, consumables) by samples, by end-users - Forecast to 2027 Know more about this report @ https://www.marketresearchfuture.com/reports/north-america-drug-screening-market-research-report-forecast-to-2027 About Market Research Future: At Market Research Future (MRFR), we enable our customers to unravel the complexity of various industries through our Cooked Research Report (CRR), Half-Cooked Research Reports (HCRR), Raw Research Reports (3R), Continuous-Feed Research (CFR), and Market Research & Consulting Services. MRFR team have supreme objective to provide the optimum quality market research and intelligence services to our clients. Our market research studies by products, services, technologies, applications, end users, and market players for global, regional, and country level market segments, enable our clients to see more, know more, and do more, which help to answer all their most important questions. For more information, please visit https://www.marketresearchfuture.com


News Article | November 16, 2016
Site: www.newsmaker.com.au

MarketStudyReport.com adds “Global Chromatography Market 2016-2020” new report to its research database. The report spread across 81 pages with table and figures in it. The research analysts forecast the global chromatography market to grow at a CAGR of 5.42% during the period 2016-2020. About Chromatography Chromatography is a technique in which a mixture is passed into solution or suspension through a path in which the components move at different rates. It is used to separate the components of a liquid with great accuracy. There are several types of separation techniques such as liquid chromatography, gas chromatography, and electrophoresis. The technique used depends on the solvent conditions such as pressure and temperature. Covered in this report The report covers the present scenario and the growth prospects of the global chromatography market for 2016-2020. To calculate the market size, the report considers the revenue generated from the sale of chromatography systems. The market is divided into the following segments based on geography: Americas APAC EMEA Research report, Global Chromatography Market 2016-2020, has been prepared based on an in-depth market analysis with inputs from industry experts. The report covers the market landscape and its growth prospects over the coming years. The report also includes a discussion of the key vendors operating in this market. Browse full table of contents and data tables at https://www.marketstudyreport.com/reports/global-chromatography-market-2016-2020/        Key vendors Agilent Technologies Bio-Rad Laboratories Shimadzu Corporation Thermo Fisher Scientific Other prominent vendors Becton, Dickinson and Company Helena Laboratories Pall Corporation Perkin Elmer Phenomenex Regis Technologies Repligen Tosoh Corporation VWR International Waters Corporation W.R Grace and Co. ZirChrom Separations Market driver Automation of sample handling process. For a full, detailed list, view our report Market challenge Requirement for high purification standards. For a full, detailed list, view our report Market trend Encouragement for green chromatography. For a full, detailed list, view our report Key questions answered in this report What will the market size be in 2020 and what will the growth rate be? What are the key market trends? What is driving this market? What are the challenges to market growth? Who are the key vendors in this market space? What are the market opportunities and threats faced by the key vendors? What are the strengths and weaknesses of the key vendors? To receive personalized assistance, write to us @ [email protected] with the report title in the subject line along with your questions or call us at +1 866-764-2150


News Article | February 24, 2017
Site: www.prnewswire.co.uk

According to a new market research report "High-performance Liquid Chromatography (HPLC) Market by Product (Instruments (Systems, Detectors), Consumables (Columns, Filters), and Accessories), Application (Clinical Research, Diagnostics, Forensics) - Analysis & Global Forecast to 2021", published by MarketsandMarkets, This report studies the global HPLC Market for the forecast period of 2016 to 2021. This market is expected to reach 4.13 Billion by 2021 from USD 3.23 Billion in 2016, growing at a CAGR of 5.1%. Browse 112 market data Tables and 42 Figures spread through 182 Pages and in-depth TOC on "High-performance Liquid Chromatography (HPLC) Market" Early buyers will receive 10% customization on this report. The global HPLC Market is segmented on the basis of product, application, and region. On the basis application, the HPLC is segmented into clinical research, diagnostics, forensics, and other applications (including food & environmental analysis and academic research). In 2016, the clinical research segment is expected to account for the largest share of the global HPLC Market. On the basis of product, the HPLC Market is categorized into instruments, consumables, and accessories. The instruments segment is estimated to account for the largest share of the global HPLC Market, by product. The consumables segment is projected to grow at the highest CAGR between 2016 and 2021, primarily due to the recurring requirement of consumables. The instruments segment is further categorized into systems, detectors, pumps, and fraction collectors. In 2016, the systems segment is expected to command the largest share and the highest growth of the instruments market. The consumables segment is further categorized into columns, filters, vials, and tubes. The columns segment is estimated to grow at the highest CAGR during the forecast period. This segment is further categorized into reverse-phase HPLC columns, normal-phase/hydrophobic interaction HPLC columns, ion exchange HPLC columns, and other columns. Based on region, the HPLC Market is divided into North America, Europe, Asia-Pacific, and the Rest of the World (RoW). The RoW region comprises Latin America, the Middle East, and Africa. In 2016, North America is projected to account for the largest share of the HPLC Market, followed by Europe and Asia-Pacific. Increasing funding for R&D, preclinical activities by CROs and pharmaceutical companies, and the growing food industry in Ontario are propelling the growth of the North American HPLC Market. The major players in the global HPLC Market are Waters Corporation (U.S.), Agilent Technologies (U.S.), and Shimadzu Corporation (Japan). These companies are dominant in the HPLC Market mainly due to their well-established presence in the field of chromatography, presence in over 50 countries, high R&D investments, and strong sales and distribution force. The other players in the market include Thermo Fisher Scientific Inc. (U.S.), GE Healthcare (U.S.), PerkinElmer, Inc. (U.S.), Bio-Rad Laboratories, Inc. (U.S.), Gilson, Inc. (U.S.), Phenomenex, Inc. (U.S.), and JASCO, Inc. (U.S.). PREPARATIVE AND PROCESS CHROMATOGRAPHY MARKET By Type (Preparative, Process), Products (Systems, Columns, Empty, Glass, Resins, Protein A, Affinity, Ion exchange, Mixed mode, Services), End User (Biotechnology, Pharmaceutical) - Global Forecasts to 2021. CHROMATOGRAPHY INSTRUMENTS MARKET By System (LC (HPLC, UHPLC, Flash), GC, Other Components (Autosamplers, Detectors, Fraction Collectors), Consumable (Reverse Phase Columns, Syringe Filters, Vials) - Analysis & Global Forecasts to 2020. MarketsandMarkets is the largest market research firm worldwide in terms of annually published premium market research reports. Serving 1700 global fortune enterprises with more than 1200 premium studies in a year, M&M is catering to a multitude of clients across 8 different industrial verticals. We specialize in consulting assignments and business research across high growth markets, cutting edge technologies and newer applications. Our 850 fulltime analyst and SMEs at MarketsandMarkets are tracking global high growth markets following the "Growth Engagement Model - GEM". The GEM aims at proactive collaboration with the clients to identify new opportunities, identify most important customers, write "Attack, avoid and defend" strategies, identify sources of incremental revenues for both the company and its competitors. M&M's flagship competitive intelligence and market research platform, "RT" connects over 200,000 markets and entire value chains for deeper understanding of the unmet insights along with market sizing and forecasts of niche markets. The new included chapters on Methodology and Benchmarking presented with high quality analytical infographics in our reports gives complete visibility of how the numbers have been arrived and defend the accuracy of the numbers. We at MarketsandMarkets are inspired to help our clients grow by providing apt business insight with our huge market intelligence repository. Connect with us on LinkedIn @ http://www.linkedin.com/company/marketsandmarkets

Loading Phenomenex collaborators
Loading Phenomenex collaborators