Entity

Time filter

Source Type

Torrance, CA, United States

News Article | August 23, 2016
Site: http://www.chromatographytechniques.com/rss-feeds/all/rss.xml/all

Phenomenex introduces Yarra 1.8µm SEC-X300 – a high-resolution gel filtration (GFC)/aqueous size-exclusion (SEC) column for the separation of high molecular weight (HMW) biomolecules on HPLC and UHPLC systems. With a wide separation range of 10K to 700KDa and high efficiency, the column is efficient for separating and characterizing monoclonal antibody (mAb) aggregates, antibody drug conjugates (ADCs) and biosimilars in drug discovery and development research. The HMW focus of the SEC-X300 complements the low molecular weight range (1K-450KDa) of the existing Yarra 1.8µm SEC-X150 column, providing two versatile separation tools for biopharmaceutical research. The proprietary Yarra surface chemistry, combined with bio-inert column hardware, reduces sample adsorption compared to other GFC/SEC columns currently on the market, providing improved recovery and more accurate quantitation of biomolecules at a lower price point. The SEC-X150 and -X300 media are both now available in 150 and 300 mm column lengths, for analytical flexibility to increase speed or further increase resolution.


News Article
Site: http://www.nature.com/nature/current_issue/

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment. A constitutively stabilized mutant of HIF2α (HIF2α-TM) was obtained from Christina Warnecke20. The HIF2α-TM (triple mutant) construct harbours the following mutations in the prolyl and asparagyl hydroxylation sites: P405A, P530G and N851A. Polypeptide fragments of DYRK1B were cloned into pcDNA3-HA and include DYRK1B N terminus, N-Ter (amino acids 1–110), DYRK1B kinase domain, KD (amino acids 111–431), and DYRK1B C terminus, C-Ter (amino acids 432–629). cDNAs for RBX1, Elongin B and Elongin C were kindly provided from Michele Pagano (New York University) and cloned into the pcDNA vector by PCR. HA-tagged HIF1α and HIF2α were obtained from Addgene. GFP-tagged DYRK1A and DYRK1B were cloned into pcDNA vector. pcDNA-HA-VHL was provided by Kook Hwan Kim (Sungkyunkwan University School of Medicine, Korea). Site-directed mutagenesis was performed using QuickChange or QuickChange Multi Site-Directed mutagenesis kit (Agilent) and resulting plasmids were sequence verified. Lentivirus was generated by co-transfection of the lentiviral vectors with pCMV-ΔR8.1 and pMD2.G plasmids into HEK293T cells as previously described9, 42. ShRNA sequences are: ID2-1: GCCTACTGAATGCTGTGTATACTCGAGTATACACAGCATTCAGTAGGC; ID2-2: CCCACTATTGTCAGCCTGCATCTCGAGATGCAGGCTGACAATAGTGGG; DYRK1A: CAGGTTGTAAAGGCATATGATCTCGAGATCATATGCCTTTACAACCTG; DYRK1B: GACCTACAAGCACATCAATGACTCGAGTCATTGATGTGCTTGTAGGTC. IMR-32 (ATCC CCL-127), SK-N-SH (ATCC HTB-11), U87 (ATCC HTB-14), NCI-H1299 (ATCC CRL-5803), HRT18 (ATCC CCL-244), and HEK293T (ATCC CRL-11268) cell lines were acquired through American Type Culture Collection. U251 (Sigma, catalogue number 09063001) cell line was obtained through Sigma. Cell lines were cultured in DMEM supplemented with 10% fetal bovine serum (FBS, Sigma). Cells were routinely tested for mycoplasma contamination using Mycoplasma Plus PCR Primer Set (Agilent, Santa Clara, CA) and were found to be negative. Cells were transfected with Lipofectamine 2000 (Invitrogen) or calcium phosphate. Mouse NSCs were grown in Neurocult medium (StemCell Technologies) containing 1× proliferation supplements (StemCell Technologies), and recombinant FGF-2 and EGF (20 ng ml−1 each; Peprotech). GBM-derived glioma stem cells were obtained by de-identified brain tumour specimens from excess material collected for clinical purposes at New York Presbyterian-Columbia University Medical Center. Donors (patients diagnosed with glioblastoma) were anonymous. Progressive numbers were used to label specimens coded in order to preserve the confidentiality of the subjects. Work with these materials was designated as IRB exempt under paragraph 4 and it is covered under IRB protocol #IRB-AAAI7305. GBM-derived GSCs were grown in DMEM:F12 containing 1× N2 and B27 supplements (Invitrogen) and human recombinant FGF-2 and EGF (20 ng ml−1 each; Peprotech). Cells at passage (P) 4 were transduced using lentiviral particle in medium containing 4 μg ml−1 of polybrene (Sigma). Cells were cultured in hypoxic chamber with 1% O (O Control Glove Box, Coy Laboratory Products, MI) for the indicated times or treated with a final concentration of 100–300 μM CoCl (Sigma) as specified in figure legends. Mouse neurosphere assay was performed by plating 2,000 cells in 35 mm dishes in collagen containing NSC medium to ensure that distinct colonies were derived from single cells and therefore clonal in origin43. We determined neurosphere formation over serial clonal passages in limiting dilution semi-solid cultures and the cell expansion rate over passages, which is considered a direct indication of self-renewing symmetric cell divisions44. For serial sub-culturing we mechanically dissociated neurospheres into single cells in bulk and re-cultured them under the same conditions for six passages. The number of spheres was scored after 14 days. Only colonies >100 μm in diameter were counted as spheres. Neurosphere size was determined by measuring the diameters of individual neurospheres under light microscopy. Data are presented as percent of neurospheres obtained at each passage (number of neurospheres scored/number of NSCs plated × 100) in three independent experiments. P value was calculated using a multiple t-test with Holm–Sidak correction for multiple comparisons. To determine the expansion rate, we plated 10,000 cells from 3 independent P1 clonal assays in 35 mm dishes and scored the number of viable cells after 7 days by Trypan Blue exclusion. Expansion rate of NSCs was determined using a linear regression model and difference in the slopes (P value) was determined by the analysis of covariance (ANCOVA) using Prism 6.0 (GraphPad). Limiting dilution assay (LDA) for human GSCs was performed as described previously45. Briefly, spheres were dissociated into single cells and plated into 96-well plates in 0.2 ml of medium containing growth factors at increasing densities (1–100 cells per well) in triplicate. Cultures were left undisturbed for 14 days, and then the percent of wells not containing spheres for each cell dilution was calculated and plotted against the number of cells per well. Linear regression lines were plotted, and we estimated the minimal frequency of glioma cells endowed with stem cell capacity (the number of cells required to generate at least one sphere in every well = the stem cell frequency) based on the Poisson distribution and the intersection at the 37% level using Prism 6.0 software. Data represent the means of three independent experiments performed in different days for the evaluation of the effects of ID2, ID2(T27A) in the presence or in the absence of DYRK1B. LDA for the undegradable HIF2α rescue experiment was performed by using three cultures transduced independently on the same day. To identify the sites of ID2 phosphorylation from IMR32 human neuroblastoma cells, the immunoprecipitated ID2 protein was excised, digested with trypsin, chymotrypsin and Lys-C and the peptides extracted from the polyacrylamide in two 30 μl aliquots of 50% acetonitrile/5% formic acid. These extracts were combined and evaporated to 25 μl for MS analysis. The LC–MS system consisted of a state-of-the-art Finnigan LTQ-FT mass spectrometer system with a Protana nanospray ion source interfaced to a self-packed 8 cm × 75 μm id Phenomenex Jupiter 10 μm C18 reversed-phase capillary column. 0.5–5 μl volumes of the extract were injected and the peptides eluted from the column by an acetonitrile/0.1 M acetic acid gradient at a flow rate of 0.25 μl min−1. The nanospray ion source was operated at 2.8 kV. The digest was analysed using the double play capability of the instrument acquiring full scan mass spectra to determine peptide molecular weights and product ion spectra to determine amino acid sequence in sequential scans. This mode of analysis produces approximately 1200 CAD spectra of ions ranging in abundance over several orders of magnitude. Tandem MS/MS experiments were performed on each candidate phosphopeptide to verify its sequence and locate the phosphorylation site. A signature of a phosphopeptide is the detection of loss of 98 daltons (the mass of phosphoric acid) in the MS/MS spectrum. With this method, three phosphopeptides were found to carry phosphorylations at residues Ser5, Ser14 and Thr27 of the ID2 protein. The anti-phospho-T27-ID2 antibody was generated by immunizing rabbits with a short synthetic peptide containing the phosphorylated T27 (CGISRSK-pT-PVDDPMS) (Yenzym Antibodies, LLC). A two-step purification process was applied. First, antiserum was cross-absorbed against the phospho-peptide matrix to purify antibodies that recognize the phosphorylated peptide. Then, the anti-serum was purified against the un-phosphorylated peptide matrix to remove non-specific antibodies. Cells were lysed in NP40 lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)) or RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 0.5% sodium dexoycholate, 0.1% sodium dodecyl sulphate, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)). Lysates were cleared by centrifugation at 15,000 r.p.m. for 15 min at 4 °C. For immunoprecipitation, cell lysates were incubated with primary antibody (hydroxyproline, Abcam, ab37067; VHL, BD, 556347; DYRK1A, Cell Signaling Technology, 2771; DYRK1B, Cell Signaling Technology, 5672) and protein G/A beads (Santa Cruz, sc-2003) or phospho-Tyrosine (P-Tyr-100) Sepharose beads (Cell Signaling Technology, 9419), HA affinity matrix (Roche, 11815016001), Flag M2 affinity gel (Sigma, F2426) at 4 °C overnight. Beads were washed with lysis buffer four times and eluted in 2× SDS sample buffer. Protein samples were separated by SDS–PAGE and transferred to polyvinyl difluoride (PVDF) or nitrocellulose (NC) membrane. Membranes were blocked in TBS with 5% non-fat milk and 0.1% Tween20, and probed with primary antibodies. Antibodies and working concentrations are: ID2 1:500 (C-20, sc-489), GFP 1:1,000 (B-2, sc-9996), HIF2α/EPAS-1 1:250 (190b, sc-13596), c-MYC (9E10, sc-40), and Elongin B 1:1,000 (FL-118, sc-11447), obtained from Santa Cruz Biotechnology; phospho-Tyrosine 1:1,000 (P-Tyr-100, 9411), HA 1:1,000 (C29F4, 3724), VHL 1:500 (2738), DYRK1A 1:1,000, 2771; DYRK1B 1:1,000, 5672) and RBX1 1:2,000 (D3J5I, 11922), obtained from Cell Signaling Technology; VHL 1:500 (GeneTex, GTX101087); β-actin 1:8000 (A5441), α-tubulin 1:8,000 (T5168), and Flag M2 1:500 (F1804) obtained from Sigma; HIF1α 1:500 (H1alpha67, NB100-105) and Elongin C 1:1,000 (NB100-78353) obtained from Novus Biologicals; HA 1:1000 (3F10, 12158167001) obtained from Roche. Secondary antibodies horseradish-peroxidase-conjugated were purchased from Pierce and ECL solution (Amersham) was used for detection. For in vitro binding assays, HA-tagged RBX1, Elongin B, Elongin C and VHL were in vitro translated using TNT quick coupled transcription/translation system (Promega). Active VHL protein complex was purchased from EMD Millipore. Purified His-VHL protein was purchased from ProteinOne (Rockville, MD). GST, GST–ID2 and Flag–ID2 proteins were bacterial expressed and purified using glutathione sepharose beads (GE healthcare life science). Active DYRK1B (Invitrogen) was used for in vitro phosphorylation of Flag-ID2 proteins. Biotinylated wild-type and modified (pT27 and T27W) ID2 peptides (amino acids 14–34) were synthesized by LifeTein (Somerset, NJ). In vitro binding experiments between ID2 and VCB–Cul2 were performed using 500 ng of Flag-ID2 and 500 ng of VCB–Cul2 complex or 500 ng VHL protein in binding buffer (50 mM Tris-Cl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1.5 mM Na VO , 0.2% NP40, 10% glycerol, 0.1 mg ml−1 BSA and EDTA-free protease inhibitor cocktail (Roche)) at 4 °C for 3 h. In vitro binding between ID2 peptides and purified proteins was performed using 2 μg of ID2 peptides and 200 ng of recombinant VCB–Cul2 complex or 200 ng recombinant VHL in binding buffer (50 mM Tris-Cl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10 mM β-glycerophosphate, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1.5 mM Na VO , 0.4% NP40, 10% glycerol, 0.1 mg ml−1 BSA and EDTA-free protease inhibitor cocktail (Roche)) at 4 °C for 3 h or overnight. Protein complexes were pulled down using glutathione sepharose beads (GE Healthcare Life Science) or streptavidin conjugated beads (Thermo Fisher Scientific) and analysed by immunoblot. Cdk1, Cdk5, DYRK1A, DYRK1B, ERK, GSK3, PKA, CaMKII, Chk1, Chk2, RSK-1, RSK-2, aurora-A, aurora-B, PLK-1, PLK-2, and NEK2 were all purchased from Life Technology and ATM from EMD Millipore. The 18 protein kinases tested in the survey were selected because they are proline-directed S/T kinases (Cdk1, Cdk5, DYRK1A, DYRK1B, ERK) and/or because they were considered to be candidate kinases for Thr27, Ser14 or Ser5 from kinase consensus prediction algorithms (NetPhosK1.0, http://www.cbs.dtu.dk/services/NetPhosK/; GPS Version 3.0 http://gps.biocuckoo.org/#) or visual inspection of the flanking regions and review of the literature for consensus kinase phosphorylation motifs. 1 μg of bacterially purified GST-ID substrates were incubated with 10–20 ng each of the recombinant active kinases. The reaction mixture included 10 μCi of [γ-32P]ATP (PerkinElmer Life Sciences) in 50 μl of kinase buffer (25 mM Tris-HCl, pH 7.5, 5 mM β-glycerophosphate, 2 mM dithiothreitol (DTT), 0.1 mM Na VO , 10 mM MgCl , and 0.2 mM ATP). Reactions were incubated at 30 °C for 30 min. Reactions were terminated by addition of Laemmli SDS sample buffer and boiling on 95 °C for 5 min. Proteins were separated on SDS–PAGE gel and phosphorylation of proteins was visualized by autoradiography. Coomassie staining was used to document the amount of substrates included in the kinase reaction. In vitro phosphorylation of Flag– ID2 proteins by DYRK1B (Invitrogen) was performed using 500 ng of GST–DYRK1B and 200 ng of bacterially expressed purified Flag–ID2 protein. In vivo kinase assay in GSCs and glioma cells was performed using endogenous or exogenously expressed DYRK1A and DYRK1B. Cell lysates were prepared in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% NP40, 1.5 mM Na VO , 50 mM sodium fluoride, 10 mM sodium pyrophosphate, 10 mM β-glycerolphosphate and EDTA-free protease inhibitor cocktail (Roche)). DYRK1 kinases were immunoprecipitated using DYRK1A and DYRK1B antibodies (for endogenous DYRK1 proteins) or GFP antibody (for exogenous GFP–DYRK1 proteins) from 1 mg cellular lysates at 4 °C. Immunoprecipitates were washed with lysis buffer four times followed by two washes in kinase buffer as described above and incubated with 200 ng purified Flag–ID2 protein in kinase buffer for 30 min at 30 °C. Kinase reactions were separated by SDS–PAGE and analysed by western blot using p-T27-ID2 antibody. HIF2α half-life was quantified using ImageJ processing software (NIH). Densitometry values were analysed by Prism 6.0 using the linear regression function. Stoichiometric quantification of ID2 and VHL in U87 cells was obtained using recombinant Flag–ID2 and His-tagged-VHL as references. The chemiluminescent signal of serial dilutions of the recombinant proteins was quantified using ImageJ, plotted to generate a linear standard curve against which the densitometric signal generated by serial dilutions of cellular lysates (1 × 106 U87 cells) was calculated. Triplicate values ± s.e.m. were used to estimate the ID2:VHL ratio per cell. The stoichiometry of pT27-ID2 phosphorylation was determined as described46. Briefly, SK-N-SH cells were plated at density of 1 × 106 in 100 mm dishes. Forty-eight hours later 1.5 mg of cellular lysates from cells untreated or treated with CoCl during the previous 24 h were prepared in RIPA buffer and immunoprecipitated using 4 μg of pT27-ID2 antibody or rabbit IgG overnight at 4 °C. Immune complexes were collected with TrueBlot anti-rabbit IgG beads (Rockland), washed 5 times in lysis buffer, and eluted in SDS sample buffer. Serial dilutions of cellular lysates, IgG and pT27-ID2 immunoprecipitates were loaded as duplicate series for SDS–PAGE and western blot analysis using ID2 or p-T27-ID2 antibodies. Densitometry quantification of the chemiluminescent signals was used to determine (1) the efficiency of the immunoprecipitation using the antibody against p-ID2-T27 and (2) the ratio between efficiency of the immunoprecipitation evaluated by western blot for p-T27-ID2 and total ID2 antibodies. This represents the percent of phosphorylated Thr27 of ID2 present in the cell preparation. Cellular ID2 complexes were purified from the cell line NCI-H1299 stably engineered to express Flag-HA–ID2. Cellular lysates were prepared in 50 mM Tris-HCl, 250 mM NaCl, 0.2% NP40, 1 mM EDTA, 10% glycerol, protease and phosphatase inhibitors. Flag-HA–ID2 immunoprecipitates were recovered first with anti-Flag antibody-conjugated M2 agarose (Sigma) and washed with lysis buffer containing 300 mM NaCl and 0.3% NP40. Bound polypeptides were eluted with Flag peptide and further affinity purified by anti-HA antibody-conjugated agarose (Roche). The eluates from the HA beads were analysed directly on long gradient reverse phase LC–MS/MS. A specificity score of proteins interacting with ID2 was computed for each polypeptide by comparing the number of peptides identified from mass spectrometry analysis to those reported in the CRAPome database that includes a list of potential contaminants from affinity purification-mass spectrometry experiments (http://www.crapome.org). The specificity score is computed as [(#peptide*#xcorr)/(AveSC*MaxSC* # of Expt.)], #peptide, identified peptide count; #xcorr, the cross-correlation score for all candidate peptides queried from the database; AveSC, averaged spectral counts from CRAPome; MaxSC, maximal spectral counts from CRAPome; and # of Expt., the total found number of experiments from CRAPome. U87 cells were transfected with pcDNA3-HA-HIFα (HIF1α or HIF2α), pcDNA3-Flag–ID2 (WT or T27A), pEGFP-DYRK1B and pcDNA3-Myc-Ubiquitin. 36 h after transfection, cells were treated with 20 μM MG132 (EMD Millipore) for 6 h. After washing with ice-cold PBS twice, cells were lysed in 100 μl of 50 mM Tris-HCl pH 8.0, 150 mM NaCl (TBS) containing 2% SDS and boiled at 100 °C for 10 min. Lysates were diluted with 900 μl of TBS containing 1% NP40. Immunoprecipitation was performed using 1 mg of cellular lysates. Ubiquitylated proteins were immunoprecipitated using anti-Myc antibody and analysed by western blot using HA antibody. A previously described47, highly accurate flexible peptide docking method implemented in ICM software (Molsoft LLC, La Jolla CA) was used to dock ID2 peptides to VCB or components thereof. A series of overlapping peptides of varying lengths were docked to the complex of VHL and Elongin C (EloC), or VHL or EloC alone, from the recent crystallographic structure22 of the VHL-CRL ligase. Briefly, an all-atom model of the peptide was docked into grid potentials derived from the X-ray structure using a stochastic global optimization in internal coordinates with pseudo-Brownian and collective ‘probability-biased’ random moves as implemented in the ICM program. Five types of potentials for the peptide-receptor interaction energy — hydrogen van der Waals, non-hydrogen van der Waals, hydrogen bonding, hydrophobicity and electrostatics — were precomputed on a rectilinear grid with 0.5 Å spacing that fills a 34 Å × 34 Å × 25 Å box containing the VHL-EloC (V-C) complex, to which the peptide was docked by searching its full conformational space within the space of the grid potentials. The preferred docking conformation was identified by the lowest energy conformation in the search. The preferred peptide was identified by its maximal contact surface area with the respective receptor. ab initio folding and analysis of the peptides was performed as previously described48, 49. ab initio folding of the ID2 peptide and its phospho-T27 mutant showed that both strongly prefer an α-helical conformation free (unbound) in solution, with the phospho-T27 mutant having a calculated free energy almost 50 kcal-equivalent units lower than the unmodified peptide. Total RNA was prepared with Trizol reagent (Invitrogen) and cDNA was synthesized using SuperScript II Reverse Transcriptase (Invitrogen) as described42, 50. Semi-quantitative RT–PCR was performed using AccuPrime Taq DNA polymerase (Invitrogen) and the following primers: for HIF2A Fw 5′_GTGCTCCCACGGCCTGTA_3′ and Rv 5′_TTGTCACACCTATGGCATATCACA_3′; GAPDH Fw 5′_AGAAGGCTGGGGCTCATTTG_3′ and Rv 5′_AGGGGCCATCCACAGTCTTC_3′. The quantitative RT–PCR was performed with a Roche480 thermal cycler, using SYBR Green PCR Master Mix from Applied Biosystem. Primers used in qRT–PCR are: SOX2 Fw 5′_TTGCTGCCTCTTTAAGACTAGGA_3′ and Rv 5′_CTGGGGCTCAAACTTCTCTC_3′; NANOG Fw 5′_ATGCCTCACACGGAGACTGT_3′ and Rv 5′_AAGTGGGTTGTTTGCCTTTG_3′; POU5F1 Fw 5′_GTGGAGGAAGCTGACAACAA_3′ and Rv 5′_ATTCTCCAGGTTGCCTCTCA_3′; FLT1 Fw 5′_AGCCCATAAATGGTCTTTGC_3′ and Rv 5′_GTGGTTTGCTTGAGCTGTGT_3′; PIK3CA Fw 5′_TGCAAAGAATCAGAACAATGCC_3′ and 5′_CACGGAGGCATTCTAAAGTCA_3′; BMI1 Fw 5′_AATCCCCACCTGATGTGTGT_3′ and Rv 5′_GCTGGTCTCCAGGTAACGAA_3′; GAPDH Fw 5′_GAAGGTGAAGGTCGGAGTCAAC_3′ and Rv 5′_CAGAGTTAAAAGCAGCCCTGGT_3′; 18S Fw 5′_CGCCGCTAGAGGTGAAATTC_3′ and Rv 5′_CTTTCGCTCTGGTCCGTCTT_3′. The relative amount of specific mRNA was normalized to 18S or GAPDH. Results are presented as the mean ± s.d. of three independent experiments each performed in triplicate (n = 9). Statistical significance was determined by Student’s t-test (two-tailed) using GraphPad Prism 6.0 software. Mice were housed in pathogen-free animal facility. All animal studies were approved by the IACUC at Columbia University (numbers AAAE9252; AAAE9956). Mice were 4–6-week-old male athymic nude (Nu/Nu, Charles River Laboratories). No statistical method was used to pre-determine sample size. No method of randomization was used to allocate animals to experimental groups. Mice in the same cage were generally part of the same treatment. The investigators were not blinded during outcome assessment. In none of the experiments did tumours exceed the maximum volume allowed according to our IACUC protocol, specifically 20 mm in the maximum diameter. 2 × 105 U87 cells stably expressing a doxycycline inducible lentiviral vector coding for DYRK1B or the empty vector were injected subcutaneously in the right flank in 100 μl volume of saline solution (7 mice per each group). Mice carrying 150–220 mm3 subcutaneous tumours (21 days after injection) generated by cells transduced with DYRK1B were treated with vehicle or doxycycline by oral gavage (Vibramycin, Pfizer Labs; 8 mg ml−1, 0.2 ml per day)51; mice carrying tumours generated by cells transduced with the empty vector were also fed with doxycycline. Tumour diameters were measured daily with a caliper and tumour volumes estimated using the formula: width2 × length/2 = V (mm3). Mice were euthanized after 5 days of doxycycline treatment. Tumours were dissected and fixed in formalin for immunohistochemical analysis. Data are means ± s.d. of  7 mice in each group. Statistical significance was determined by ANCOVA using GraphPad Prism 6.0 software package (GraphPad). Orthotopic implantation of glioma cells was performed as described previously using 5 × 104 U87 cells transduced with pLOC-vector, pLOC-DYRK1B (WT) or pLOC-DYRK1B-K140R mutant in 2 μl phosphate buffer42. In brief, 5 days after lentiviral infection, cells were injected 2 mm lateral and 0.5 mm anterior to the bregma, 2.5 mm below the skull of 4–6-week-old athymic nude (Nu/Nu, Charles River Laboratories) mice. Mice were monitored daily for abnormal ill effects according to AAALAS guidelines and euthanized when neurological symptoms were observed. Tumours were dissected and fixed in formalin for immunohistochemical analysis and immunofluorescence using V5 antibody (Life technologies, 46-0705) to identify exogenous DYRK1B and an antibody against human vimentin (Sigma, V6630) to identify human glioma cells. A Kaplan–Meier survival curve was generated using the GraphPad Prism 6.0 software package (GraphPad). Points on the curves indicate glioma related deaths (n = 7 animals for each group, p was determined by log rank analysis). We did not observe non-glioma related deaths. Mice injected with U87 cells transduced with pLOC-DYRK1B(WT) that did not show neurological signs on day 70 were euthanized for histological evaluation and shown as tumour-free mice in Fig. 5g. Intracranial injection of H-Ras-V12-IRES-Cre-ER-shp53 lentivirus was performed in 4-week-old Id1Flox/Flox, Id2Flox/Flox, Id3−/− mice (C57Bl6/SV129). Briefly, 1.3 µl of purified lentiviral particles in PBS were injected 1.45 mm lateral and 1.6 mm anterior to the bregma and 2.3 mm below the skull using a stereotaxic frame. Tamoxifen was administered for 5 days at 9 mg per 40 g of mouse weight by oral gavage starting 30 days after surgery. Mice were killed 2 days later and brains dissected and fixed for histological analysis. Tissue preparation and immunohistochemistry on tumour xenografts were performed as previously described42, 50, 52. Antibodies used in immunostaining are: HIF2α, mouse monoclonal, 1:200 (Novus Biological, NB100-132); Olig2, rabbit polyclonal, 1:200 (IBL International, JP18953); human Vimentin 1:50 (Sigma, V6630), Bromodeoxyuridine, mouse monoclonal 1:500 (Roche, 11170376001), V5 1:500 (Life technologies, 46-0705). Sections were permeabilized in 0.2% tritonX-100 for 10 min, blocked with 1% BSA-5% goat serum in PBS for 1 h. Primary antibodies were incubated at 4 °C overnight. Secondary antibodies biotinylated (Vector Laboratories) or conjugated with Alexa594 (1:500, Molecular Probes) were used. Slides were counterstained with haematoxylin for immunohistochemistry and DNA was counterstained with DAPI (Sigma) for immunofluorescence. Images were acquired using an Olympus 1X70 microscope equipped with digital camera and processed using Adobe Photoshop CS6 software. BrdU-positive cells were quantified by scoring the number of positive cells in five 4 × 10−3 mm2 images from 5 different mice from each group. Blinding was applied during histological analysis. Data are presented as means of five different mice ± standard deviation (s.d.) (two-tailed Student’s t-test, unequal variance). To infer if ID2 modulates the interactions between HIF2α and its transcriptional targets we used a modified version of MINDy53 algorithm, called CINDy25. CINDy uses adaptive partitioning method to accurately estimate the full conditional mutual information between a transcription factor and a target gene given the expression or activity of a signalling protein. Briefly, for every pair of transcription factor and target gene of interest, it estimates the mutual information that is, how much information can be inferred about the target gene when the expression of the transcription factor is known, conditioned on the expression/activity of the signalling protein. It estimates this conditional mutual information by estimating the multi-dimensional probability densities after partitioning the sample distribution using adaptive partitioning method. We applied CINDy algorithm on gene expression data for 548 samples obtained from The Cancer Genome Atlas (TCGA). Since the activity level and not the gene expression of ID2 is the determinant of its modulatory function that is, the extent to which it modulates the transcriptional network of HIF2α, we used an algorithm called Virtual Inference of Protein-activity by Enriched Regulon analysis (VIPER) to infer the activity of ID2 protein from its gene expression profile26. VIPER method allows the computational inference of protein activity, on an individual sample basis, from gene expression profile data. It uses the expression of genes that are most directly regulated by a given protein, such as the targets of a transcription factor (TF), as an accurate reporter of its activity. We defined the targets of ID2 by running ARACNe algorithm on 548 gene expression profiles and use the inferred 106 targets to determine its activity (Supplementary Table 3). We applied CINDy on 277 targets of HIF2α represented in Ingenuity pathway analysis (IPA) and for which gene expression data was available (Supplementary Table 4). Of these 277 targets, 77 are significantly modulated by ID2 activity (P value ≤ 0.05). Among the set of target genes whose expression was significantly positively correlated (P value ≤ 0.05) with the expression of HIF2α irrespective of the activity of ID2, that is, correlation was significant for samples with both high and low activity of ID2, the average expression of target genes for a given expression of HIF2α was higher when the activity of ID2 was high. The same set of target gene were more correlated in high ID2 activity samples compared to any set of random genes of same size (Fig. 5a), whereas they were not in ID2 low activity samples (Fig. 5b). We selected 25% of all samples with the highest/lowest ID2 activity to calculate the correlation between HIF2α and its targets. To determine whether regulation of ID2 by hypoxia might impact the correlation between high ID2 activity and HIF2α shown in Fig. 5a, b we compared the effects of ID2 activity versus ID2 expression for the transcriptional connection between HIF2α and its targets. We selected 25% of all patients (n = 548) in TCGA with high ID2 activity and 25% of patients with low ID2 activity and tested the enrichment of significantly positively correlated targets of HIF2α in each of the groups. This resulted in significant enrichment (P value < 0.001) in high ID2 activity but showed no significant enrichment (P value = 0.093) in low ID2 activity samples. Moreover, the difference in the enrichment score (∆ES) in these two groups was statistically significant (P value < 0.05). This significance is calculated by randomly selecting the same number of genes as the positively correlated targets of HIF2α, and calculating the ∆ES for these randomly selected genes, giving ∆ES . We repeated this step 1,000 times to obtain 1,000 ∆ES that are used to build the null distribution (Extended Data Fig. 9b). We used the null distribution to estimate P value calculated as (number of ∆ES > ∆ES )/1,000. Enrichment was observed only when ID2 activity was high but not when ID2 activity was low, thus suggesting that ID2 activity directionally impacts the regulation of targets of HIF2α by HIF2α. Consistently, the significant ∆ES using ID2 activity suggests that ID2 activity is determinant of correlation between HIF2α and its targets. Conversely, when we performed similar analysis using ID2 expression instead of ID2 activity, we found significant enrichment of positively correlated targets of HIF2α both in samples with high expression (P value = 0.025) and low expression of ID2 (P value = 0.048). Given the significant enrichment in both groups, we did not observe any significant difference in the enrichment score in the two groups (P value of ∆ES = 0.338). Thus, while the determination of the ID2 activity and its effects upon the HIF2α-targets connection by VIPER and CINDy allowed us to determine the unidirectional positive link between high ID2 activity and HIF2α transcription, a similar analysis performed using ID2 expression contemplates the dual connection between ID2 and HIF2α. To test if expression of DYRK1A and DYRK1B is a predictor of prognosis, we divided the patients into two cohorts based on their relative expression compared to the mean expression of all patients in GBM. First cohort contained the patients with high expression of both DYRK1A and DYRK1B (n = 101) and the other cohort contained patients with low expression (n = 128). We used average expression for both DYRK1A and DYRK1B, which individually divide the patient cohort into half and half. However, when we use the condition that patients should display higher or lower average expression of both these genes, then we select approximately 19% for high expression and 24% for low expression. Selection of these patients was entirely dependent on the overall expression of these genes in the entire cohort rather than a predefined cutoff. Kaplan–Meier survival analysis showed the significant survival benefit for the patients having the high expression of both DYRK1A and DYRK1B (P value = 0.004) compared to the patients with low expression. When similar analysis was performed using only the expression of DYRK1A or DYRK1B alone, the prediction was either non-significant (DYRK1A) or less significant (DYRK1B, P value = 0.008) when compared to the predictions using the expression of both genes. Results in graphs are expressed as means ± s.d. or means ± s.e.m., as indicated in figure legends, for the indicated number of observations. Statistical significance was determined by the Student’s t-test (two-tailed, unequal variance). P value < 0.05 is considered significant and is indicated in figure legends.


News Article
Site: http://www.nature.com/nature/current_issue/

All animal procedures were conducted under a protocol (#08–1990) approved by the Genentech Institutional Animal Care and Use Committee in an Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC)-accredited facility in accordance with the Guide for the Care and Use of Laboratory Animals and applicable laws and regulations. For cloning of antibodies from human B cells, informed written consent was obtained from all donors and was provided in accordance with the Declaration of Helsinki. Approval was obtained from the health research ethics committee of Denmark through the regional committee for the Capital Region of Denmark. All in vivo experiments were done with MRSA-USA300 NRS384 obtained from NARSA (https://www.beiresources.org) unless noted otherwise. The generation of protein-A-deficient strain Δmcr USA300 NRS384, as well as protein-A-deficient USA300 lacking tarM or tarS has been described previously38, 39. The protein-A-deficient strains were used only in some in vitro experiments to determine antibody specificity. The MIC for extracellular bacteria was determined by preparing serial twofold dilutions of the antibiotic in tryptic soy broth. Dilutions of the antibiotic were made in quadruplicate in 96-well culture dishes. MRSA (NRS384 strain of USA300) was taken from an exponentially growing culture and diluted to 1 × 104 c.f.u. ml−1. The bacteria were cultured in the presence of antibiotic for 18–24 h with shaking at 37 °C and bacterial growth was determined by reading the optical density (OD) at 630 nm. The MIC was determined to be the dose of antibiotic that inhibited bacterial growth by >90%. Intracellular MIC was determined on bacteria that were sequestered inside mouse peritoneal macrophages (see later for generation of murine peritoneal macrophages). Macrophages were plated at a density of 4 × 105 cells ml−1 and infected with MRSA at a ratio of 10–20 bacteria per macrophage. Macrophage cultures were maintained in growth media supplemented with 50 μg ml−1 of gentamycin to inhibit the growth of extracellular bacteria and test antibiotics were added to the growth media 1 day after infection. The survival of intracellular bacteria was assessed 24 h after addition of the antibiotics. Macrophages were lysed with Hanks buffered saline solution supplemented with 0.1% bovine serum albumin (BSA) and 0.1% Triton-X, and serial dilutions of the lysate were made in PBS solution containing 0.05% Tween-20. The number of surviving intracellular bacteria was determined by plating on tryptic soy agar plates with 5% defibrinated sheep blood. USA300 stocks were prepared for infection from actively growing cultures in tryptic soy broth. Bacteria were washed three times in PBS and aliquots were frozen at −80 °C in PBS 25% glycerol. Intracellular bacteria infections. Seven-week-old female A/J mice (Stock 000646) were obtained from Jackson Labs and infected by peritoneal injection with 5 × 107 c.f.u. of USA300. Mice were killed 1 day after infection and the peritoneum was flushed with 5 ml of cold PBS. Peritoneal washes were centrifuged for 5 min at 1,000 r.p.m. at 4 °C in a table-top centrifuge. The cell pellet containing peritoneal cells was collected and cells were treated with 50 μg ml−1 of lysostaphin (Cell Sciences, CRL 309C) for 20 min at 37 °C to kill contaminating extracellular bacteria. Peritoneal cells were washed three times in ice-cold PBS to remove the lysostaphin. Peritoneal cells from donor mice were pooled, and recipient mice were injected with cells derived from five donors per each recipient by intravenous injection into the tail vein. To determine the number of live intracellular colony-forming units, a sample of the peritoneal cells were lysed in HB (Hanks balanced salt solution supplemented with 10 mM HEPES and 0.1% BSA) with 0.1% Triton-X, and serial dilutions of the lysate were made in PBS with 0.05% Tween-20. Free bacteria infections. A/J mice were infected with various doses of free bacteria using a fresh aliquot of the glycerol stocks used for the peritoneal injections. Actual infection doses were confirmed by c.f.u. plating. For the data shown in Fig. 1a the actual infection dose for intracellular bacteria was 1.8 × 106 c.f.u. per mouse, and the actual infection dose for free bacteria was 2.9 × 106 c.f.u. per mouse. Selected mice were treated with a single dose of 110 mg kg−1 of vancomycin by intravenous injection immediately after infection. Generation of MRSA-infected peritoneal cells. Six-to-eight-week-old female A/J mice (see earlier) were infected with 1 × 108 c.f.u. of the NRS384 strain of USA300 by peritoneal injection. The peritoneal wash was harvested 1 day after infection, and the infected peritoneal cells were treated with 50 μg ml−1 of lysostaphin diluted in HEPES buffer supplemented with 0.1% BSA (HB buffer) for 20 min at 37 °C. Peritoneal cells were then washed twice in ice-cold HB buffer. The peritoneal cells were diluted to 1 × 106 cells ml−1 in RPMI 1640 tissue culture media supplemented with 10 mM HEPES and 10% fetal calf serum, and 5 μg ml−1 vancomycin. Free MRSA from the primary infection was stored overnight at 4 °C in PBS solution as a control for extracellular bacteria that were not subject to neutrophil killing. Infection of osteoblasts, HBMEC and A549 cells. MG63 cell line (CRL-1427) and A549 cells (CCL185) were obtained from ATCC and maintained in RPMI 1640 tissue culture media supplemented with 10 mM HEPES and 10% fetal calf serum (RPMI-10). HBMEC cells (catalogue #1000) and ECM media (catalogue #1001) were obtained from ScienceCell Research Labs. The cells were used without further authentication or testing for mycoplasma contamination. Cells were plated in 24-well tissue culture plates and cultured to obtain a confluent layer. On the day of the experiment, the cells were washed once in RPMI (without supplements). MRSA or infected peritoneal cells were diluted in complete RPMI-10 and vancomycin was added at 5 μg ml−1 immediately before infection. Peritoneal cells were added to the osteoblasts at 1 × 106 peritoneal cells per ml. A sample of the cells was lysed with 0.1% Triton-X to determine the actual concentration of live intracellular bacteria at the time of infection. The actual titre for all infections was determined by plating serial dilutions of the bacteria on tryptic soy agar with 5% defibrinated sheep blood. The human IgG antibodies against anti-β-GlcNAc WTA monoclonal antibody (mAb) and anti-α-GlcNAc WTA mAb were cloned from peripheral B cells from patients after S. aureus infection using a monoclonal antibody discovery technology that conserves the cognate pairing of antibody heavy and light chains40. Antibodies were expressed by transfection of mammalian cells41. Supernatants containing full-length IgG1 antibodies were harvested after 7 days and used to screen for antigen binding by enzyme-linked immunosorbent assay (ELISA). These antibodies were positive for binding to cell wall preparations from USA300. Antibodies were subsequently produced in 200-ml transient transfections and purified with protein A chromatography (MabSelect SuRe, GE Life Sciences) for further testing. Synthesis of the rifalogue linker drug was performed as follows. Protease cleavable linker MC-VC-PAB-OH23 (1.009 g, 1.762 mmol, 1.000, 1,009 mg) was taken up in N,N-dimethylformamide (6 ml, 77 mmol, 44, 5,700 mg). To this was added a solution of thionyl chloride (1.1 equiv., 1.938 mmol, 1.100, 231 mg) in dichloromethane (DCM) (1 ml, 15.44 mmol, 8.765, 1,325 mg) in portions dropwise (half was added over 1 h, stirred for 1 h at room temperature, then the other half was added over another hour). The solution remained a yellow colour. Another 0.6 equiv. of thionyl chloride was added as a solution in 0.5 ml DCM dropwise, carefully. The reaction remained yellow and was stirred sealed overnight at room temperature. The reaction was monitored by liquid chromatography mass spectrometry (LC/MS), indicating 88% conversion to benzyl chloride. Another 0.22 equiv. of thionyl chloride was added dropwise as a solution in 0.3 ml DCM. When the reaction approached 92% benzyl chloride, the reaction was bubbled with N . The concentration was increased from 0.3 M to 0.6 M. MC-VC-PAB-Cl (0.9 mmol) was cooled to 0 °C and rifalogue (dimethyl piperazinebenzoxazinorifamycin42 (0.75 g, 0.81 mmol, 0.46, 750 mg)) was added. The mixture was diluted with another 1.5 ml of DMF to reach 0.3 M. Stirred open to air for 30 min. N,N-diisopropylethylamine (3.5 mmol, 3.5 mmol, 2.0, 460 mg) was added and the reaction stirred overnight open to air. Over the course of 4 days, four additions of 0.2 equiv. N,N-diisopropylethylamine base were added while the reaction stirred open to air, until the reaction appeared to stop progressing. The reaction was diluted with DMF and purified on high-performance liquid chromatography (HPLC; 20–60% ACN/FA·H O) in several batches to give MC-VC-PAB-rifalogue (0.38 g, 32% yield) m/z = 1,482.8. The non-cleavable rifalogue linker drug was synthesized using the exact same method, but replacing MC-VC-PAB-OH with MC-V-D-Cit-PAB-OH. Construction and production of the THIOMAB variant of anti-WTA antibody was done as reported previously43. Briefly, a cysteine residue was engineered at the Val 205 position of the anti-WTA light chain to produce its THIOMAB variant. The thio anti-WTA was conjugated to MC-vc-PAB-rifalogue. The antibody was reduced in the presence of 50-fold molar excess dithiothreitol (DTT) overnight. The reducing agent and the cysteine and glutathione blocks were purified away using HiTrap SP-HP column (GE Healthcare). The antibody was re-oxidized in the presence of 15-fold molar excess dehydroascorbic acid (MP Biomedical) for 2.5 h. The formation of interchain disulfide bonds was monitored by LC/MS. A threefold molar excess of the linker drug (MC-VC-PAB-rifalogue) over protein was incubated with the THIOMAB for 1 h. The AAC was purified by filtration through a 0.2 μm SFCA filter (Millipore). Excess-free linker drug was removed by filtration. The conjugate was buffer exchanged into 20 mM histidine acetate pH 5.5/240 mM sucrose by dialysis. The number of conjugated MC-VC-PAB-rifalogue molecules per mAb was quantified by LC/MS analysis. Purity was also assessed by size-exclusion chromatography. LC/MS analysis was performed on a 6530 Accurate-Mass Quadrupole Time-of-Flight (Q-TOF) LC/MS (Agilent Technologies). Samples were chromatographed on a PRLP-S column, 1,000 Å, 8 μm (50 mm × 2.1 mm, Agilent Technologies) heated to 80 °C. A linear gradient from 30–60% B in 4.3 min (solvent A, 0.05% TFA in water; solvent B, 0.04% TFA in acetonitrile) was used and the eluent was directly ionized using the electrospray source. Data were collected and deconvoluted using the Agilent Mass Hunter qualitative analysis software. Before LC/MS analysis, AAC was treated with lysyl endopeptidase (Wako) for 30 min at 1:100 w/w enzyme to antibody ratio, pH 8.0, and 37 °C to produce the Fab and the Fc portion for ease of analysis. The drug-to-antibody ratio (DAR) was calculated using the abundance of Fab and Fab+1 calculated by the MassHunter software. Analysis of bacteria isolated from infected mice. Balb/c mice were infected with 1 × 107 c.f.u. of MRSA (USA300) by intravenous injection and kidneys were harvested on day 3 after infection. Kidneys were homogenized using a GentleMACS dissociator in 5 ml volume per two kidneys using M-Tubes and the program RNA01.01 (Miltenyi Biotec). Homogenization buffer was: PBS plus 0.1% Triton-X-100, 10 μg ml−1 DNAase (bovine pancreas grade II, Roche) and protease inhibitors (complete protease inhibitor cocktail, Roche 11-836-153001). After homogenization, the samples were incubated at room temperature for 10 min and then diluted with ice-cold PBS and filtered through a 40 μm cell strainer. Tissue homogenates were washed twice in ice-cold PBS and then suspended in a volume of 0.5 ml per two kidneys in HB buffer (Hanks balanced salt solution supplemented with 10 mM HEPES and 0.1% BSA). The cell suspension was filtered again and 25 μl of the bacterial suspension was taken for each staining reaction (Fig. 2c). Antibody staining for flow cytometry. Bacteria (1 × 107 of in vitro grown bacteria (Fig. 2d), or 25 μl of tissue homogenate described earlier (Fig. 2c) were suspended in HB buffer and blocked by incubation with 400 μg ml−1 of mouse IgG (Sigma, I5381) for 1 h. Fluorescently labelled antibodies were added directly to the blocking reaction and incubated at room temperature for an additional 10–20 min. Bacteria were washed three times in HB buffer and then fixed in PBS 2% paraformaldehyde before FACS analysis. Test antibodies (anti-β-WTA, anti-α-WTA or isotype control-anti CMV-gD) were conjugated with Alexa-488 using amine reactive reagents (Invitrogen, succinimidyl-ester of Alexa Fluor 488, NHS-A488). Antibodies in 50 mM sodium phosphate were reacted with a 5–10-fold molar excess of NHS-A488 in the dark for 2–3 h at room temperature. The labelling mixture was applied to a GE Sepharose S200 column equilibrated in PBS to remove excess reactants from the conjugated antibody. The number of A488 molecules per antibody was determined using the ultraviolet method as described by the manufacturer. For analysis of bacteria in tissue homogenates a non-competing anti-S. aureus antibody (rF1 (ref. 38)) was conjugated to Alexa-647 to distinguish S. aureus from similar sized particles. Test antibodies were examined at a range of doses from 80 ng ml−1 to 50 μg ml−1. Flow cytometry was performed using a Beckton Dickson FACS ARIA (BD Biosciences) and analysis was performed using FlowJo analysis software (Flow Jo LLC). The anti-β-WTA antibody Fab fragment was expressed in Escherichia coli and purified on Protein G Sepharose followed by SP sepharose cation exchange and size-exclusion chromatography. Antibody was concentrated to 30 mg ml−1 in MES buffer (20 mM MES pH 5.5, 150 mM NaCl) and mixed with a 2:1 mol/mol ratio of the WTA analogue (diluted in water) for crystallization trials. Sparse matrix crystallization screening provided initial hits in PEG-8000 based conditions, which were further optimized to provide diffraction quality crystals. Ultimately, data were collected on a crystal grown by the vapour diffusion method in a sitting drop containing 0.5 μl protein and 0.5 μl 0.08 M sodium cacodylate pH 6.5, 0.16 M calcium acetate, 14.4% PEG-8000, and 20% glycerol. Crystals were cryo-protected in mother liquor, flash frozen in liquid nitrogen, and stored for data collection at 100 K. Data were collected to 1.7 Å at beamline 22ID at the Advanced Photon Source (APS) under cryo-cooled conditions (100 K) at a wavelength of 1.0 Å. Data were reduced using HKL2000 and SCALEPACK in the space group P2 2 2 , with unit cell parameters of a = 63.7 Å, b = 111.4Å, c = 158.4 Å (see Extended Data Table 1 for processing statistics). The structure was solved by sequential molecular replacement searches using Fab constant and variable regions (Protein Data Bank accession 4177) as individual search models. Iterative rounds of manual model adjustment with COOT followed by simulated annealing, coordinate, and b-factor refinement with Phenix and BUSTER (Global Phasing) gave a final model with R/R values of 20.6% and 23.7% respectively. Ramachandran statistics calculated by MolProbity indicate that 97.2% of the model residues lie in favoured regions, with 0.5% outliers. Synthesis of dibenzyl phosphorochloridate. A mixture of NCS (3.5 g, 26.6 mmol) was suspended in toluene (80 ml). Then dibenzyl phosphonate (2.0 g, 7.6 mmol) was added. The mixture was stirred at room temperature overnight. The white solid was filtered off and the organic phase was evaporated to give dibenzyl phosphorochloridate (1; 2.1 g, 96%) as light yellow oil. 1H NMR (300 MHz, CDCl , 25 °C) δ 7.36 (s, 10H), 5.20 (m, 4H). Synthesis of 4-O-(2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-β-d-glucopyranosyl)-1-O-acetyl-d-ribitol-5-dibenzylphosphate. A mixture of 2 (described in ref. 44) (500 mg, 0.95 mmol) dissolved in pyridine (12 ml) was cooled to −30 °C and 1 (described ref. 44) (595 mg, 2.0 mmol) was added, stirring for 2 h at −30 °C and warmed to room temperature for 4 h. The mixture was added to H O, and concentrated in vacuo. The residue was purified by column chromatography (silica gel: 200 to ~300 mesh; dichloromethane: methanol in a 30:1 as eluent) to give 4-O-(2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-β-d-glucopyranosyl)-1-O-acetyl-d-ribitol-5-dibenzylphosphate (3; 190 mg, 24%) as light yellow solid. 1H NMR (300 MHz, Acetone-d , 25 °C) δ 7.29–7.23 (m, 10H), 7.08 (d, 1H), 5.08 (t, 1H), 4.99–4.78 (m, 6H), 4.31–3.97 (m, 8H), 3.82–3.63 (m, 3H), 1.88 (s, 3H), 1.86 (s, 6H), 1.79 (s, 3H), 1.69 (s, 3H). LC/MS (m/z) ES+ 784 [M+H]+. Synthesis of 4-O-(2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-β-d-glucopyranosyl)-1-O-acetyl-d-ribitol-5-phosphate. A mixture of 3 (150 mg, 0.19 mmol) dissolved in MeOH (6 ml) was hydrogenated over 10% Pd/C (20 mg) for 2 h at room temperature. Then the mixture was filtered, and the filtrate was evaporated to give 4-O-(2-acetamido-3,4,6-tri-O-acetyl-2-deoxy-β-d-glucopyranosyl)-1-O-acetyl-d-ribitol-5-phosphate (4; 100 mg) as light yellow oil. LC/MS (m/z) ES+ 604 [M+H]+. Synthesis of 4-O-(2-acetamido-2-deoxy-β-d-glucopyranosyl)-d-ribitol-5-phosphate (5). A mixture of 4 (80 mg, 0.16 mmol) dissolved in MeOH (10 ml) was cooled to 5 °C and K CO (30 mg, 0.21 mmol) was added and stirred at 5 °C for 3 h. The reaction was then quenched with 1 N HCl, and concentrated in vacuo. The crude product was purified by gel filtration (LH-20, MeOH) to give 4-O-(2-acetamido-2-deoxy-β-d-glucopyranosyl)-d-ribitol-5-phosphate (5; 13.3 mg, 23%) as a white solid 1H NMR (300 MHz, MeOH-d , 25 °C) δ 4.62 (d, 1H), 4.30–4.02 (m, 3H), 3.92–3.32 (m, 9H), 2.03 (s, 3H). LC/MS (m/z) ES+ 436 [M+H]+. S. aureus (USA300) was taken from an overnight stationary phase culture, washed once in PBS and suspended at 1 × 107 c.f.u. ml−1 in PBS with no antibiotic or with 1 × 10−6 M antibiotic in a 10 ml volume in 50 ml polypropylene centrifuge tubes. The bacteria were incubated at 37 °C overnight with shaking. At each time point, three 1 ml samples were removed from each culture and centrifuged to collect the bacteria. Bacteria were washed once with PBS to remove the antibiotic and the total number of surviving bacteria was determined by plating serial dilutions of the bacteria on agar plates. S. aureus (USA300) was taken from an overnight stationary phase culture, washed once in tryptic soy broth (TSB) and then adjusted to a final concentration of 1 × 107 c.f.u. ml−1 in a total volume of 10 ml of either TSB or TSB with ciprofloxicin (0.05 mM). Cultures were incubated with shaking at 37 °C for 6 h and then the second antibiotic, either rifampicin (1 μg ml−1) or the rifalogue (1 μg ml−1) was added. At the indicated times, samples were removed from each culture, washed once with PBS to remove the antibiotic and re-suspended in PBS. The total number of surviving bacteria was determined by plating serial dilutions of the bacteria on agar plates. At the final time point the remainder of each culture was collected and plated. To quantify the amount of active antibiotic released from AACs after treatment with cathepsin B, AACs were diluted to 200 μg ml−1 in cathepsin buffer (20 mM sodium acetate, 1 mM EDTA, 5 mM l-cysteine, pH 5). Cathepsin-B (from bovine spleen, Sigma C7800) was added at 10 μg ml−1 and the samples were incubated for 1 h at 37 °C. As a control, AACs were incubated in buffer alone. The reaction was stopped by addition of 9 volumes of bacterial growth media, TSB pH 7.4. To estimate the total release of active antibiotic, serial dilutions of the reaction mixture were made in quadruplicate in TSB in 96-well plates and MRSA (USA300) was added to each well at a final density of 2 × 103 c.f.u. ml−1. The cultures were incubated overnight at 37 °C with shaking and bacterial growth was measured by reading absorbance at 630 nM using a plate reader. We synthesized and conjugated a maleimide FRET peptide to the anti-β-WTA THIOMAB antibody. We used a FRET pair of tetramethylrhodamine (TAMRA) and fluorescein. The maleimide FRET peptide was synthesized by standard Fmoc solid-phase chemistry using a PS3 peptide synthesizer (Protein Technologies; B.-C.L., M.D. and R.V., manuscript in preparation)27. Briefly, 0.1 mmol of Rink amide resin was used to generate C-terminal carboxamide. We used a Fmoc-Lys(Mtt)-OH at the N- and C-terminal residues in order to remove the Mtt group on the resin and carry out additional side-chain chemistry to attach TAMRA and fluorescein. The sequence of Val-Cit-Leu was added between the FRET pair as a cathepsin-cleavable spacer. The crude maleimide FRET peptide or maleimidocarproyl-K(TAMRA)-G-V-Cit-L-K(fluorescein) cleaved off from the resin was subjected to further purification by reverse-phase HPLC with a Jupiter 5u C4 column (5 μm, 10 mm × 250 mm; Phenomenex). Our FRET probe allows monitoring not only of the intracelluar trafficking of the antibody conjugate, but also the processing of the linker in the phagolysosome. The intact antibody conjugate fluoresces only in red due to the fluorescence resonance energy transfer from the donor. However, upon the substrate cleavage of the FRET peptide in the phagolysosome, the green fluorescence from the donor is expected to appear. Murine peritoneal macrophages were plated on chamber slides (Ibidi, catalogue 80826) in complete media as described for the macrophage intracellular killing assay. USA300 was labelled with Cell Tracker Violet (Invitrogen C10094) at 100 μg ml−1 in PBS 0.1% BSA by incubation for 30 min at 37 °C. The labelled bacteria were opsonized with the anti-β-WTA-FRET probe by incubation for 1 h in HB buffer. Macrophages were washed once immediately before addition of the opsonized bacteria, and bacteria were added to cells at 1 × 107 bacteria per ml. For no-phagocytosis controls, the macrophages were pre-treated with 60 nM Latrunculin A (Calbiochem) for 30 min before and during phagocytosis. The slides were placed on the microscope immediately after addition of bacteria to the cells and movies were acquired with a Leica SP5 confocal microscope equipped with an environmental chamber with CO and temperature controllers from Ludin. The images were captured every minute for a total time of 30 min using a Plan APO CS ×40, N.A: 1.25, oil immersion lens, and the 488 nm and 543 nm laser lines to excite Alexa-488 and TAMRA, respectively. Phase images were also recorded using the 543 nm laser line. Primary murine peritoneal macrophages or RAW 264.7 cells (purchased from ATCC) were infected in 24-well tissue culture dishes as described later for the intracellular killing assay with MRSA opsonized with AAC at 100 μg ml−1 in HB. The RAW 264.7 cells were used without further authentication or testing for mycoplasma contamination. After phagocytosis was complete, the cells were washed and 250 μl of complete media plus gentamycin was added to wells and the cells were incubated for the indicated time points. At each time point, the supernatant and cellular fractions were collected followed by acetonitrile (ACN) addition to 75% final concentration and incubated for 30 min. Cell and supernatant extracts were lyophilized by evaporation under N2 (TurboVap; Biotage) and reconstituted in 100 μl of 50% ACN, filtered using a 0.45 glass fibre filter plate (Phenomenex) and analysed by LC/MS/MS as follows. The rifalogue was separated on an Acquity UPLC (Waters Corporation) under gradient elution using a Phenomenex Kinetex XB-C18 column (100 Å, 50 × 2.1 mm internal diameter, 2.6 μm particle size). The column was maintained at room temperature. The mobile phase was a mixture of 10 mM ammonium acetate in water containing 0.1% formic acid (A) and 90% acetonitrile (B) at a flow rate of 1 ml min−1. The rifalogue was eluted with a gradient of 3–98% B over 1 min, followed by 0.8 min at 98% B, then 0.7 min of 3% B to re-equilibrate the column. The injection volume was 10 μl. The Triple Quad 6500 mass spectrometer (Ab Sciex) was operated in a positive ion multiple reaction-monitoring (MRM) mode. The rifalogue precursor (Q1) ion monitored was 927.6 m/z and the product (Q3) ion monitored was 895.2 m/z with collision energy at 27 eV and declustering potential at 191 V. The MS/MS setting parameters were as follows: ion spray voltage, 5,500 V; curtain gas, 40 psi; nebulizer gas (GS1), 35 psi, (GS2), 50 psi; temperature, 600 °C; and dwell time, 150 ms. Linear calibration curves were obtained for 0.41–100 nM concentration range by spiking rifalogue into cell or supernatant fractions (lacking MRSA or AAC) that were treated similarly to samples. Concentrations of rifalogue were calculated with MultiQuant software (Ab Sciex). Non-phagocytic cell types. MG63 (CRL-1427) and A549 (CCL185) cell lines were obtained from ATCC and maintained in RPMI 1640 tissue culture media supplemented with 10 mM HEPES and 10% fetal calf serum (RPMI-10). HUVEC cells were obtained from Lonza and maintained in EGM endothelial cell complete media (Lonza). HBMEC cells (catalogue #1000) and ECM media (catalogue #1001) were obtained from ScienceCell Research Labs. The cells were used without further authentication or testing for mycoplasma contamination. Murine macrophages. Peritoneal macrophages were isolated from the peritoneum of 6–8-week-old Balb/c mice (Charles River Laboratories). To increase the yield of macrophages, mice were pre-treated by intraperitoneal injection with 1 ml of thioglycolate media (Becton Dickinson). The thioglycolate media was prepared at a concentration of 4% in water, sterilized by autoclaving, and aged for 20 days to 6 months before use. Peritoneal macrophages were harvested 4 days after treatment with thioglycolate by washing the peritoneal cavity with cold PBS. Macrophages were plated in DMEM supplemented with 10% fetal calf serum, and 10 mM HEPES, without antibiotics, at a density of 4 × 105 cells well−1 in 24-well culture dishes. Macrophages were cultured overnight to permit adherence to the plate. Human M2 macrophages. CD14+ monocytes were purified from normal human blood using a Monocyte Isolation Kit II (Miltenyi, catalogue 130-091-153) and plated at 1.5 × 105 cells cm−2 on tissue culture dishes pre-coated with fetal calf serum (FCS) and cultured in RPMI 1640 media with 20% FCS plus 100 ng ml−1 rhM-CSF. Media was refreshed on day 1 and on day 7, the media was changed to 5% serum plus 20 ng ml−1 IL-4. Macrophages were used 18 h later. Assay protocol. In all experiments bacteria were cultured in TSB. To assess intracellular killing with AACs, USA300 was taken from an exponentially growing culture and washed in HB. AACs or antibodies were diluted in HB (Hanks balanced salt solution supplemented with 10 mM HEPES and 0.1% BSA) and incubated with the bacteria for 1 h to permit antibody binding to the bacteria (opsonization), and the opsonized bacteria were used to infect macrophages at a ratio of 10–20 bacteria per macrophage (4 × 106 bacteria in 250 μl of HB per well). Macrophages were pre-washed with serum-free DMEM media immediately before infection, and infected by incubation at 37 °C in a humidified tissue culture incubator with 5% CO to permit phagocytosis of the bacteria. After 2 h, the infection mix was removed and replaced with normal growth media (DMEM supplemented with 10% FCS, 10 mM HEPES) and gentamycin was added at 50 μg ml−1 to prevent growth of extracellular bacteria45. At the end of the incubation period, the macrophages were washed with serum-free media, and the cells were lysed in HB supplemented with 0.1% Triton-X (lyses the macrophages without damaging the intracellular bacteria). Serial dilutions of the lysate were made in PBS solution supplemented with 0.05% Tween-20 (to disrupt aggregates of bacteria) and the total number of surviving intracellular bacteria was determined by plating on tryptic soy agar with 5% defibrinated sheep blood. Cell wall preparations (CWPs) were generated from protein-A-deficient S. aureus by incubating 40 mg of pelleted bacteria per ml of 10 mM Tris-HCl (pH 7.4) supplemented with 30% raffinose, 100 μg ml−1 of lysostaphin (Cell Sciences), and EDTA-free protease inhibitor cocktail (Roche), for 30 min at 37 °C. The lysates were centrifuged at 11,600g for 5 min, and the supernatants containing cell wall components were collected. ELISA experiments were performed using standard protocols. Briefly, plates were pre-coated with CWP and then incubated with human IgG preparations: purified human IGIV Immune Globulin (ASD Healthcare), pooled serum from healthy donors or from MRSA patients. The concentrations of anti-staphylococcal IgG present in the serum or purified IgG were calculated by using a calibration curve that was generated with known concentrations of anti-peptidoglycan mAb (4479) against peptidoglycan. Seven-week-old female mice, Balb/c, were obtained from Jackson West, or SCID mice were obtained from Charles River Laboratories. Infections were carried out by intravenous injection into the tail vein. SCID-huIgG model: CB17.SCID mice were reconstituted with IGIV Immune Globulin (ASD Healthcare) using a dosing regimen optimized to achieve constant serum levels of >10 mg ml−1 of human IgG. IGIV was administered with an initial intravenous dose of 30 mg per mouse followed by a second dose of 15 mg per mouse by intraperitoneal injection after 6 h, and subsequent daily dosings of 15 mg per mouse by intraperitoneal injection for 3 consecutive days. Mice were infected 4 h after the first dose of IGIV with 2 × 107 c.f.u. of MRSA diluted in PBS by intravenous injection. The wild-type USA300, protein-A-sufficient strain was used for all in vivo experiments. Mice that received vancomycin were treated with twice daily intraperitoneal injections of 110 mg kg−1 of vancomycin starting between 6 and 24 h after infection for the duration of the study. Experimental therapeutics (AAC, anti-MRSA antibodies or free rifalogue antibiotic) were diluted in PBS and administered with a single intravenous injection 30 min to 24 h after infection. All mice were killed on day 4 after infection, and kidneys were harvested in 5 ml of PBS. The tissue samples were homogenized using a GentleMACS dissociator (Miltenyi Biotec). The total number of bacteria recovered per mouse (two kidneys) was determined by plating serial dilutions of the tissue homogenate in PBS 0.05% Tween on tryptic soy agar with 5% defibrinated sheep blood. All experiments were performed on biological replicates. Sample size for each experimental group per condition is reported in appropriate figure legends and Methods. For cell culture experiments, sample size was not predetermined, and all samples were included in the analysis. In animal experiments no statistical methods were used to predetermine sample size (n = number of mice per group), and all animals were used for analysis unless the mice died or had to be euthanized when found moribund. These cases are annotated in the figures. The mice were not randomized after infection, and the investigators were not blinded to outcome assessment. When appropriate, statistically significant differences between control and experimental groups were determined using Mann–Whitney tests.


News Article
Site: http://www.nature.com/nature/current_issue/

Melanoma specimens were obtained with informed consent from all patients according to protocols approved by the Institutional Review Boards of the University of Michigan Medical School (IRBMED approvals HUM00050754 and HUM00050085; see ref. 27) and the University of Texas Southwestern Medical Center. Tumours were dissociated in Sterile Closed System Tissue Grinders (SKS Science) in enzymatic digestion medium containing 200 U ml−1 collagenase IV (Worthington) for 20 min at 37 °C. DNase (50–100 U ml−1) was added to reduce clumping of cells during digestion. Cells were filtered with a 40- μm cell strainer to obtain a single-cell suspensions. All melanomas used in this study stably expressed DsRed and luciferase so that the melanoma cells could be unambiguously distinguished from mouse cells by flow cytometry and by bioluminescence imaging. When isolated by flow cytometry, cells were also stained with antibodies against mouse CD45 (30-F11-APC, eBiosciences), mouse CD31 (390-APC, Biolegend), Ter119 (TER-119-APC, eBiosciences) and human HLA-A, -B, -C (G46-2.6-FITC, BD Biosciences) to select live human melanoma cells and to exclude contaminating mouse endothelial and haematopoietic cells. Live human melanoma cells were thus isolated by flow cytometry by sorting cells that were positive for DsRed and HLA and negative for mouse CD45, Ter119 and CD31. All antibody labelling was performed for 20 min on ice, followed by washing and centrifugation. Before flow cytometric analysis, cells were re-suspended in staining medium (L15 medium containing bovine serum albumin (1 mg ml−1), 1% penicillin/streptomycin, and 10 mM HEPES, pH 7.4) containing 4′,6-diamidino-2-phenylindole (DAPI; 5 μg ml−1; Sigma) to eliminate dead cells from sorts and analyses. Sorts and analyses were performed using a FACSAria flow cytometer (Becton Dickinson). After sorting, an aliquot of sorted melanoma cells was always reanalysed to check for purity, which was usually greater than 95%. For analysis of circulating melanoma cells, blood was collected from each mouse by cardiac puncture with a syringe pretreated with citrate-dextrose solution (Sigma). Red blood cells were precipitated by Ficoll sedimentation according to the manufacturer’s instructions (Ficoll Paque Plus, GE Healthcare). Remaining cells were washed with Hanks’ balanced salt solution (Invitrogen) before antibody staining and flow cytometric analysis. For limiting dilution analysis, cells for each mouse were sorted into individual wells of 96-well V-bottomed plates containing staining medium and loaded into syringes directly from the well (one well into one syringe into one mouse). After sorting, cells were counted and resuspended in staining medium with 25% high-protein Matrigel (product 354248; BD Biosciences). Subcutaneous injections were performed into the right flank of NOD.CB17-Prkdcscid Il2rgtm1Wjl/SzJ (NSG) mice (Jackson Laboratory) in a final volume of 50 μl. Each mouse was transplanted with 100 melanoma cells unless otherwise specified. Tumour formation was evaluated regularly by palpation of the injection site, and the subcutaneous tumours were measured every 10 days until any tumour in the mouse cohort reached 2.5 cm in its largest diameter. Mice were monitored daily for signs of distress and euthanized when they exhibited distress according to a standard body condition score or within 24 h of their tumours reaching 2.5 cm in largest diameter, whichever came first. We adhered to this limit in all experiments. Organs were analysed visually and by bioluminescence imaging (see details below) for presence of macrometastases and micrometastases. These experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee at the University of Texas Southwestern Medical Center (protocol 2011-0118). Intravenous injections were done by injecting cells into the tail vein of NSG mice in 100 μl of staining medium. For intrasplenic injections the mice were anaesthetized with isoflourane, then the left flank was shaved and disinfected with an ethanol wipe and iodine swab. An incision was made into the intraperitoneal cavity. The spleen was exposed with forceps and cells were injected slowly in a 40 μl volume of staining medium. The peritoneum was then sutured and skin was closed with clips. Mice were injected with buprenex before surgery and then again 12 h after surgery. A bicistronic lentiviral construct carrying dsRed2 and luciferase (dsRed2-P2A-Luc) was generated (for bioluminescence imaging) and cloned into the FUW lentivrial expression construct. The primers that were used for generating this construct were: dsRed2 forward, 5′-CGACTCTAGAGGATCCatggatagcactgagaacgtc-3′ (capital letters indicate homology to FUW backbone); dsRed2 reverse, 5′-TCCACGTCTCCAGC CTGCTTCAGCAGGCTGAAGTTAGTAGCTCCGCTTCCctggaacaggtggtggc-3′ (capital letters indicate P2A sequences); luciferase forward, 5′-GCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCTGGATCCatggaagacgccaaaaacataaag-3′ (capital letters indicate P2A sequences) and luciferase reverse, 5′-GCTTGATATCGAATTCttacacggcgatctttccgc-3′ (capital letters indicate homology to FUW backbone). All constructs were generated using the In-Fusion HD cloning system (Clontech) and sequence verified. For virus production, 0.9 μg of the appropriate plasmid and 1 μg of helper plasmids (0.4 μg pMD2G and 0.6 μg of psPAX2) were transfected into 293T cells using polyjet (Signagen) according to the manufacturer’s instructions. Replication incompetent viral supernatants were collected 48 h after transfection and filtered through a 0.45- μm filter. Approximately 300,000 freshly dissociated melanoma cells were infected with viral supernatants supplemented with 10 μg ml−1 poybrene (Sigma) for 4 h. Cells were then washed twice with staining medium, and about 25,000 cells (a mixture of infected and non-infected cells) were suspended in staining medium with 25% high-protein Matrigel (product 354248; BD Biosciences) then injected subcutaneously into NSG mice. After growing to 1–2 cm in diameter, tumours were excised and dissociated into single-cell suspensions, and luciferase-dsRed+ or green fluorescent protein (GFP)+ cells were collected by flow cytometry for injection into secondary recipients. Metastasis was monitored by bioluminescence imaging in secondary recipients. All shRNAs were expressed from a pGIPZ miRNA-based construct with TurboGFP from GE Dharmacon. For ALDH1L2, the following GE Dharmacon shRNA clones were used: V2LHS_30207, V2LHS_30209. For MTHFD1 the following GE Dharmacon shRNA clones were used: V2LHS_216208 and V2LHS_196832. Mice were injected with 100 luciferase-dsRed+ cells on the right flank and monitored until tumour diameters approached 2.5 cm, at which point they were imaged along with an uninjected control mouse using an IVIS Imaging System 200 Series (Caliper Life Sciences) with Living Image software. Mice were injected intraperitoneally with 100 μl of PBS containing d-luciferin monopotassium salt (40 μg ml−1) (Biosynth) 5 min before imaging, followed by general anaesthesia 2 min before imaging. After imaging of the whole mouse, the mice were euthanized and individual organs were surgically removed and quickly imaged. The exposure time of images ranged from 10 to 60 s depending on signal intensity. The bioluminescence signal was quantified with ‘region of interest’ measurement tools in Living Image (Perkin Elmer) software. After imaging, tumours and organs were fixed in 10% neutral-buffered formalin for histopathology. For live imaging, mice were imaged once a month, and whole body bioluminescence was quantified using Living Image Software (Perkin Elmer). Mice were euthanized by cervical dislocation. Subcutaneous tumours and metastatic nodules were dissected, immediately homogenized in 80% methanol chilled with dry ice (Honeywell), vortexed vigorously, and metabolites were extracted overnight at −80 °C. The following day, samples were centrifuged at 13,000g for 15 min at 4 °C, the supernatant was collected, and metabolites from the pellet were re-extracted with 80% methanol at −80 °C for 4 h. After centrifugation, both supernatants were pooled and lyophilized using a SpeedVac (Thermo). To inhibit spontaneous oxidation, samples were extracted with 80% methanol containing 0.1% formic acid in some experiments47. Dried metabolites were reconstituted in 0.03% formic acid in water, vortexed and centrifuged, then the supernatant was analysed using liquid chromatography-tandem mass spectrometry (LC–MS/MS). A Nexera Ultra High Performance Liquid Chromatograph (UHPLC) system (Shimadzu) was used for liquid chromatography, with a Polar-RP HPLC column (150 × 2 mm, 4 μm, 80 Å, Phenomenex) and the following gradient: 0–3 min 100% mobile phase A; 3–15 min 100–0% A; 15–17 min 0% A; 17–18 min 0–100% A; 18–23 min 100% A. Mobile phase A was 0.03% formic acid in water. Mobile phase B was 0.03% formic acid in acetonitrile. The flow rate was 0.5 ml min−1 and the column temperature was 35 °C. A triple quadrupole mass spectrometer (AB Sciex QTRAP 5500) was used for metabolite detection as previously described48. Chromatogram peak areas were integrated using Multiquant (AB Sciex). To measure GSH and GSSG levels, some metabolite extractions were performed with 0.1% formic acid in 80% methanol, to inhibit spontaneous GSH oxidation. To calculate GSH and GSSG amounts, a standard curve was prepared by adding known quantities of GSH and GSSG to tumour metabolite extracts. Mice were injected intraperitoneally with 2 g kg−1 body mass of uniformly 13C-labelled glucose (Cambridge Isotopes) and were analysed 15, 30 and 60 min later. Mice were fasted for 14 h before the injection. In most experiments, subcutaneous tumours and metastatic nodules were surgically excised and homogenized in ice cold 50% methanol for GC–MS and in 80% dry ice-cold methanol for LC–MS analysis. Metabolites were extracted with three freeze-thaw cycles in liquid nitrogen. Supernatant was collected after a 15 min centrifugation at 13,000g at 4 °C and lyophilized. Metabolites were derivatized with trimethylsilyl (TMS) at 42 °C for 30 min for GC–MS analysis. 13C-enrichment analysis was performed by GC–MS as previously described48. For LC–MS analysis, lyophilized samples were resuspended in either 0.03% formic acid in water or in 5 mM ammonium acetate in water depending on the method of analysis. For 13C-enrichment analysis of lactate, serine and glycine by LC–MS/MS, we used the liquid chromatography procedure described above for LC–MS/MS metabolomics analysis with the following modifications: the liquid chromatography gradient was 0–3 min 100% mobile phase A; 3–15 min 100–0% A; 15–17 min 0% A; 17–17.5 min 0–100% A; 17.5–20 min 100% A. For analysis of 3-PG, the liquid chromatography conditions were: mobile phase A, 5 mM ammonium acetate in water and mobile phase B, 5 mM ammonium acetate in acetonitrile, and a Fusion-RP HPLC column (150 × 2 mm, 4 μm, 80 Å, Phenomenex). The liquid chromatography gradient was: 0–3 min 100% mobile phase A; 3–9 min 100–0% A; 9–11 min 0% A; 11–12 min 0–100% A; 12–15 min 100% A. For metabolite detection a triple quadrupole mass spectrometer (AB Sciex QTRAP 5500) was used on multiple reaction monitoring mode as previously described, with some modifications48. The following transitions were used: positive mode: serine 106.1/60 (M + 1: 107.1/60 and 107.1/61, M + 2: 108.1/61 and 108.1/62, M + 3: 109.1/62), glycine 76/30 (M + 1 77/30 and 77/31, M + 2 78/31); negative mode: lactate 89/43 (M + 1 90/43 and 90/44, M + 2 91/44 and 91/45, M + 3 92/45), 3-PG 185/79 (M + 1 186/79, M + 2 187/79, M + 3 188/79) and 185/97 (M + 1 186/97, M + 2 187/97, M + 3 188/97). Unlabelled tissue was used as a negative control to confirm isotopic labelling in specific transitions. Melanomas were generally dissociated enzymatically as described above. Equal numbers of dissociated cells (500,000–2,000,000) from subcutaneous tumours, Ficoll-depleted blood, or metastatic nodules were loaded with dyes to assess mitochondrial mass, mitochondrial membrane potential, and ROS levels. The dyes that were used to assess these parameters were all obtained from Life Technologies. We stained the dissociated cells for 20–45 min at 37 °C with 5 μM Mitotracker Green, Mitotracker DeepRed, CellROX Green, or CellROX DeepRed in HBSS-free (Ca2+- and Mg2+-free) to assess mitochondrial mass, mitochondrial membrane potential, mitochondrial and cytoplasmic ROS, respectively. For each indicator, staining intensity per cell was assessed by flow cytometry in live human melanoma cells (positive for human HLA and dsRed and negative for DAPI and mouse CD45/CD31/Ter119). All animal experiments were performed according to protocols approved by the Institutional Animal Care and Use Committee at the University of Texas Southwestern Medical Center (protocol 2011-0118). Unless otherwise stated, 100 freshly dissociated melanoma cells were injected subcutaneously into the right flanks of NSG mice. When tumours became palpable, in some experiments mice were injected subcutaneously with NAC (Sigma, 200 mg kg−1 day−1 in 200 μl PBS, pH 7.4) or PBS as a control. Mice were injected with their last NAC dose 10 min before being euthanized for end-point analysis. In experiments where mice received NAC via the drinking water, NAC was dissolved in PBS at 1 mg ml−1 and the water was changed every 2 days. In other experiments methotrexate (Tocris, 1.25 mg kg−1 day−1 in 100 μl PBS) was injected intraperitoneally 5 days per week. Mice that received methotrexate were simultaneously administered thymidine (Sigma, 3 mg per mouse per day in 100 μl PBS) and hypoxanthine (Sigma, 750 μg per mouse per day in 100 μl PBS) to prevent suppression of nucleotide biosynthesis. Tumour growth was monitored weekly with a caliper. Experiments were terminated when any tumour in the cohort reached 2.5 cm in size. At the end of experiments, blood was collected by cardiac puncture. Organs were analysed for micrometastases and macrometastases by bioluminescence imaging and visual inspection. Subcutaneous tumours or metastatic nodules were surgically excised as quickly as possible after euthanizing the mice then melanoma cells were mechanically dissociated and NADPH and NADP+ were measured using NADPH/NADP Glo-Assay (Promega) following the manufactures instructions. Luminescence was measured using a using a FLUOstar Omega plate reader (BMG Labtech). Values were normalized to protein concentration, measured using a bicinchoninic acid (BCA) protein assay (Thermo). Tissue lysates were prepared in Kontes tubes with disposable pestles using RIPA Buffer (Cell Signaling Technology) supplemented with phenylmethylsulfonyl fluoride (Sigma), and protease and phosphatase inhibitor cocktails (Roche). The BCA protein assay (Thermo) was used to quantify protein concentrations. Equal amounts of protein (15–30 μg) were separated on 4–20% Tris Glycine SDS gels (BioRad) and transferred to polyvinylidene difluoride membranes (BioRad). Membranes were blocked for 30 min at room temperature with 5% milk in TBS supplemented with 0.1% Tween20 (TBST) then incubated with primary antibodies overnight at 4 °C. After incubating with horseradish peroxidase conjugated secondary antibodies (Cell Signaling Technology), membranes were developed using SuperSignal West Pico or Femto chemiluminescence reagents (Thermo). Blots were stripped with 1% SDS, 25 mM glycine, pH 2, before re-probing. The following primary antibodies were used for western blot analyses: ALDH1L2 (LifeSpan Bio; LS-C178510), DHFR (LifeSpan Bio; LS-C138829), MTHFR (LifeSpan Bio; LS-C157974), SHMT1 (Cell Signaling; 12612S), SHMT2 (Cell Signaling; 12762S), MTHFD1 (ProteinTech; 10794-1-AP), MTHFD2 (ProtenTech; 12270-1-AP) and aActin (Abcam, ab8227). Tissues were fixed in 4% paraformaldehyde for 12 h at 4 °C, and then transferred to 30% sucrose for 24 h for cryoprotection. Tissues were then frozen in OCT. Sections (10 μm) were permeabilized in PBS with 0.2% Triton (PBT), three times for 5 min each, and blocked in 5% goat serum in PBT for 30 min at room temperature. Sections were then stained with primary antibodies overnight: ALDH1L2 (LS-C178510, LifeSpan Bio; 1:50) and S100 (Z0311, Dako, 1:500). The next day, sections were washed in PBS with 0.2% Triton and stained with secondary goat anti-rabbit antibody (Invitrogen) at 1:500 for 30 min in the dark at room temperature. Sections were washed with PBT with DAPI (1:1,000) and mounted for imaging. No statistical methods were used to predetermine sample size. The data in most figure panels reflect several independent experiments performed on different days using melanomas derived from several patients. Variation is always indicated using standard deviation. For analysis of statistical significance, we first tested whether there was homogeneity of variation across treatments (as required for ANOVA) using Levene’s test, or when only two conditions were compared, using the F-test. In cases where the variation significantly differed among treatments, the data were log -transformed. If the data contained zero values, 1/2 of the smallest non-zero value was added to all measurements before log transformation. If the data contained negative values, all measurements were log-modulus transformed (L(x) = sign(x) × log(|x| + 1)). In the rare cases when the transformed data continued to exhibit variation that significantly differed among treatments, we used a non-parametric Kruskal–Wallis test or a non-parametric Mann–Whitney test to assess the significance of differences among populations and treatments. Usually, variation did not significantly differ among treatments. Under those circumstances, two-tailed Student’s t-tests were used to test the significance of differences between two treatments. When more than two treatments were compared, a one-way ANOVA followed by Dunnett’s multiple comparisons tests were performed. A two-way ANOVA followed by Dunnett’s multiple comparisons tests were used in cases where more than two groups were compared with repeated measures. Hierarchical clustering was performed using Euclidean distance in Metaboanalyst49. Mouse cages were randomized between treatments in all in vivo experiments (mice within the same cage had to be part of the same treatment). No blinding was used in any experiment. In all xenograft assays we injected 4–8-week-old NSG mice, 5 mice per treatment. Both male and female mice were used. For long-term assays, we injected 10 mice per treatment to account for non-melanoma related deaths (NSG mice are susceptible to death from opportunistic infections). When mice died before the end of experiments due to opportunistic infections the data from those mice were excluded. There were only two experiments in which this occurred. In Fig. 1c, d, 0–4 mice per melanoma line were found dead owing to an opportunistic bacterial infection before termination of the experiment and were excluded from the reported results. In Fig. 2b, 0–3 mice per melanoma line were found dead owing to opportunistic infections, before the first imaging time point after transplantation. These mice were excluded from the reported results.


News Article
Site: http://www.nature.com/nature/current_issue/

No statistical methods were used to predetermine sample size. The experiments were not randomized, and investigators were not blinded to allocation during experiments and outcome assessment. Arabidopsis thaliana accession Columbia (Col-0) was used as the wild type. Seeds of T-DNA insertion lines were obtained from ABRC and NASC, and T-DNA insertions were confirmed by genomic PCR (Extended Data Table 1). The insert sites were determined by sequencing of the PCR products, as described in Extended Data Fig. 1c. Plant growth conditions and transformation methods were described previously6. C. rubella seeds were obtained from ABRC (accession CS22697; ref. 29), and C. rubella plants in the rosette stage were subjected to vernalising cold treatment (8-h photoperiod at 4 °C for about 1 month) for flowering induction. To investigate candidate RLKs responsible for AtLURE1 signalling, RLK genes encoding proteins with extracellular domains and displaying notable and specific expression in the pollen tube were selected as follows. Whether the more than 80 genes expressed in dry pollen or pollen tubes13 were expressed predominantly in the mature pollen was determined using the Arabidopsis eFP Browser (http://bar.utoronto.ca/efp/cgi-bin/efpWeb.cgi)30. Twenty-three pollen-dominant genes and their related genes were selected: PRK1–8 (see Extended Data Table 1), AT2G18470 (PROLINE-RICH EXTENSIN-LIKE RECEPTOR KINASE 4, PERK4), AT4G34440 (PERK5), AT3G18810 (PERK6), At1g49270 (PERK7), AT1G10620 (PERK11), AT1G23540 (PERK12), AT4G29450, AT3G13065 (STRUBBELIG-RECEPTOR FAMILY 4, SRF4), AT1G78980 (SRF5), AT4G18640 (MORPHOGENESIS OF ROOT HAIR 1, MRH1), AT5G45840, AT1G29750 (RECEPTOR-LIKE KINASE IN FLOWERS 1, RKF1), AT3G23750 (BAK1-ASSOCIATING RECEPTOR-LIKE KINASE 1, BARK1; or TMK4), AT1G19090 (CYSTEINE-RICH RLK 1, CRK1) and AT4G28670. A further five RLK genes of a subclass of the CrRLK1L family (AT3G04690 (ANXUR1), AT5G28680 (ANXUR2), AT4G39110, AT2G21480 and AT5G61350) were also pollen-dominant but were not examined in this study. T-DNA insertions in the coding or promoter regions of these selected 23 genes were identified by genomic PCR and sequencing of the PCR products. Semi-in-vivo pollen tubes from one or more lines for each gene were assessed by an attraction assay using the AtLURE1.2 peptide, as described below. Recombinant His-tagged AtLURE1.2 peptide was expressed in Escherichia coli, purified and refolded, as described previously6. The refolded His–AtLURE1.2 peptide was suggested to be a conformational isomer by reverse-phase high-pressure liquid chromatography (HPLC) using a Phenomenex Jupiter C18 column and a Jasco analytical instrument equipped with a UV-2077 plus detector and PU-2080 plus pumps. A construct for His–AtLURE1.2(GGGG) was generated from pET-28a-AtLURE1.2 by site-directed mutagenesis using the primers 5′-GTATGgGAgGGGGTggGTATATTC-3′ and 5′-cACCCCcTCcCATACAAGCTC-3′ (lowercase bases denote mutated bases from the original AtLURE1.2). No aggregation due to inappropriate folding was observed during refolding or concentration of the His–AtLURE1.2(GGGG) peptide. Alexa488-labelled His–AtLURE1.2 was produced using the refolded His–AtLURE1.2 peptide and the Alexa Fluor 488 Protein Labelling Kit (Thermo Fisher Scientific), according to the manufacturer’s protocol. For the semi-in-vivo attraction assay, pollen tubes were grown through cut styles of A. thaliana on solid pollen germination medium poured into a mould made with 2-mm thick silicone rubber and cover glasses31. About 4–5 h after hand-pollination, the topside cover glass was removed and the medium was covered with hydrated silicone oil (KF-96-100CS; Shin-Etsu). The assay for T hemizygous C. rubella plants was performed similarly using A. thaliana or C. rubella pistils as pollen acceptors. Attraction of pollen tubes towards the peptide was evaluated using gelatine beads (5% (w/v) gelatine (Nacalai) in the pollen medium without agar) containing 5 μM His-tagged AtLURE1.2 peptide under an inverted microscope (IX71, Olympus) equipped with a micro-manipulator (Narishige), as described previously6. The percentages of attracted pollen tubes are shown for the total number of pollen tubes in at least two assays. In the assay using hemizygous plants, the presence of the transgene in the pollen tube containing the transgene was confirmed by fluorescence observations after assessment of pollen tube responsiveness as a simple blind test. For the AtLURE1-responsive wavy assay, the purified AtLURE1.2 peptide was added to solid pollen germination medium, which was melted at 70 °C and then cooled to a certain degree. The mixture was mixed by vortexing and poured into the mould. Pollen tubes of each genotype were grown through cut styles, as described earlier. Plasmids encoding green and red fluorescent proteins, pcDNA3-Clover and pcDNA3-mRuby2 (gifts from M. Lin, Addgene plasmids 40259 and 40260)32, respectively, were used as templates to prepare binary vectors as follows. The original Clover was converted to A206K mutant form to prevent potential dimerization, and a restriction site KpnI in the nucleotide sequence was eliminated by a silent mutation, designated as monomeric Clover (mClover). Modified binary vectors pPZP211, pPZP221 (ref. 33) and pMDC99 (ref. 34) derivatives, pPZP211G (ref. 35), pPZP221G, and pMDC99G, were used for cloning of the mClover and mRuby2. pPZP221G was produced by the same procedure as that used for pPZP211G (ref. 35), and pMDC99G was produced by removal of ccdB by EcoRI digestion and self-ligation31 and by inserting multiple cloning sites, green fluorescent protein (GFP), and the NosT cassette of pPZP211G via HindIII and EcoRI sites. To add linkers to both the amino-terminal and carboxy-terminal of mClover and mRuby2, three rounds of PCR were performed with DNA templates for mClover and mRuby2, respectively, using three sets of primers: (5′-aggtggaggtggaATGGTGAGCAAGGGCGA-3′ and 5′-tccacctccacctgaCTTGTACAGCTCGTCCA-3′; 5′-tctggaggtggaggttcAGGTGGAGGTGGA-3′ and 5′-cggggtacccactagtttaattaagaattcTCCACCTCCACCTG-3′; 5′-aggcgcgccTCTGGAGGTGGAG-3′ and 5′-cggggtacccactagtttaattaagaattcTCCACCTCCACCTG-3′) (lowercase bases denote additional nucleotides for template DNAs). The PCR fragments were digested with AscI and KpnI and ligated into pPZP211G, pPZP221G and pMDC99G by replacing the GFP sequence, resulting in pPZP211Clo, pPZP221Clo, pPZP211Ru, pPZP221Ru, pMDC99Clo and pMDC99Ru vectors. For the expression of full-length PRK6, kinase domain-deleted PRK6 (K-del), cytosolic domain-deleted PRK6 (cyto-del-2) and PRK6 orthologue of C. rubella (CrPRK6) as mRuby2-fusion protein under the control of their own promoter, genomic sequences of PRK6 or CrPRK6 containing promoter and coding regions were amplified and were cloned into the pPZP221Ru using SalI and AscI sites, resulting in pPZP221-pPRK6::PRK6-mRuby2, -pPRK6::PRK6 (K-del)-mRuby2, -pPRK6::PRK6 (cyto-del-2)-mRuby2, and -pCrPRK6::CrPRK6-mRuby2 vectors. These constructs were introduced into prk6-1, prk3-1 prk6-1, prk3-1 prk6-1 prk8-2 and prk1-2 prk3-1 prk6-1 plants by the floral dip method. For the heterologous expression of PRK6 in C. rubella, the pPZP221-pPRK6::PRK6-mRuby2 vector was used for C. rubella transformation by the floral dip method after flowering induction. Genomic sequences of PRK6 or PRK3 containing promoter and coding regions were also cloned into pMDC99Clo using SalI and AscI sites, and these constructs were introduced into prk3-1 prk6-1. Primers used for these constructs are listed in Supplementary Table 1. For all transgenic lines expressing PRK proteins, T transformants were screened by moderate or weak fluorescence intensity in approximately half of the pollen grains, implying single insertion. Note, when pollen grains showing mid to strong fluorescence intensity were used for the semi-in-vivo pollen tube growth assay, few or no fluorescent pollen tubes emerged from the cut end, probably owing to the growth defect caused by excess PRK expression. T homozygous plants obtained from several selected T lines were used for the semi-in-vivo AtLURE1-responsive wavy assay. To prepare constructs for the BiFC assay in the leaf epidermal cells of Nicotiana benthamiana, cauliflower mosaic virus 35S promoter was introduced to the binary vector pPZP211G (ref. 35) using HindIII and PstI sites. Then, the GFP sequence was replaced by nucleotide sequences encoding each of amino acids 1–174 and 175–239 of enhanced yellow fluorescent protein (nYFP and cYFP, respectively) with the same linkers as the mClover and mRuby2 constructs, described above, resulting in pPZP211-p35SnY and pPZP211-p35ScY vectors. Genomic PRK2 and PRK6 were amplified and connected upstream of the cYFP sequence of pPZP211-p35ScY. The genomic sequences of PRK6, PRK3, LIP1 and LIP2 were connected upstream of the nYFP sequence of pPZP211-p35SnY. Genomic ROPGEF8, ROPGEF9, ROPGEF12, ROPGEF13 and ROPGEF12ΔC (encoding amino acids 1–443 of ROPGEF12 (ref. 8)) were amplified and connected downstream of the nYFP sequence in pPZP211-p35SnY. Primers used for these constructs are listed in Supplementary Table 1. Transient expression in N. benthamiana leaves was performed by agro-infiltration according to a method described previously20. In brief, Agrobacterium tumefaciens strains GV3101 (pMP90) containing each expression vector were cultured overnight in LB media. Equal amounts of Agrobacterium cultures for nYFP and cYFP constructs and the p19 silencing suppressor were mixed to a final A of 1.0 and collected and resuspended in infiltration buffer (10 mM MES, pH 5.6, 10 mM MgCl and 150 μM acetosyringone). The mixed suspensions were incubated at room temperature for ~3 h and infiltrated into leaves of N. benthamiana grown at 25 °C. Two to three days after infiltration, the leaves were cut into pieces for confocal microscope observation. To analyse pollen tube growth and guidance in the pistil, Col-0 pistils emasculated 1 day before were abundantly hand-pollinated with two or three fully dehiscent anthers from each genotype. Two types of aniline blue staining were performed 12 or 24 h after pollination as follows. For measurement of pollen tube growth inside the transmitting tract, aniline blue staining was performed, as described previously36. Pollinated pistils were dissected to remove a pair of ovary walls and then fixed in a 9:1 mixture of ethanol and acetic acid for more than 2 h. They were washed with 70% ethanol for ~30 min, treated with 1 N NaOH overnight, and stained with aniline blue solution (0.1% (w/v) aniline blue, 0.1 M K PO ) for more than several hours. The pistils were observed under ultraviolet illumination using an upright microscope (DP71, Olympus). Multiple images for each pistil were combined using Adobe Photoshop CS4 (Adobe Systems), and lengths from the top of the stigma to the tip of the longest pollen tube were measured for maximum pollen tube length using the MacBiophotonics ImageJ software (http://www.macbiophotonics.ca/). To evaluate pollen tube guidance after emergence on the septum surface of the pistil, dissected pistils were stained directly with modified aniline blue solution (5:8:7 (v/v) mixture of 2% aniline blue, 1 M glycerol, pH 9.5, and water), as described previously37, and observed under ultraviolet illumination using an upright microscope (DP71, Olympus). Quantitative analysis was performed by evaluating pollen tube growth on 10 upper ovules of both sides (total, 20 ovules per pistil) to eliminate bias in ovule number in a pistil. Confocal images were acquired using an inverted microscope (IX81, Olympus) equipped with a spinning disk confocal scanner (CSU-X1, Yokogawa Electric Corporation), 488 nm and 561 nm LD lasers (Sapphire, Coherent), and an EM-CCD camera (Evolve 512, Photometrics). For A. thaliana pollen tubes, a 60× silicone immersion objective lens (UPLSAPO60XS, Olympus) and a 1.6× intermediate magnification changer were used. For time-lapse imaging of PRK6–mRuby2 during pollen tube attraction towards a gelatine bead containing 5 μM Alexa488-labelled His-AtLURE1.2, sequential images using 488 nm and 561 nm lasers were acquired every 5 s. For the BiFC assay in N. benthamiana leaves, a 20× objective lens (UPLFLN20X, Olympus) was used. The confocal microscope system was controlled and time-lapse images were processed by MetaMorph (Universal Imaging). Images were edited with MacBiophotonics ImageJ. To prepare transient expression vectors in N. benthamiana leaf cells, the cauliflower mosaic virus 35S promoter was introduced into the binary vector pPZP211Clo via HindIII and PstI sites, resulting in the pPZP211-p35SClo vector. The 3× Flag tag sequence was introduced into pPZP211-p35S using the AscI and SacI sites, resulting in the pPZP211-p35SFlag vector. For co-immunoprecipitation of PRK-mClover and ROPGEF12-3 × Flag proteins, genomic sequences of full-length PRK3, full-length PRK6, PRK6 (K-del), PRK6 (cyto-del-1), and ROPGEF12 were inserted into the pPZP211-p35SClo or pPZP211-p35SFlag vectors. One of the PRK-mClover or mClover proteins plus the p19 silencing suppressor and ROPGEF12-3 × Flag were co-expressed in N. benthamiana leaves as described for the BiFC assay. The leaves were ground in mortars with liquid nitrogen and suspended in 3–3.5 × (w/v) extraction buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 10% glycerol, protease inhibitor cocktail (cOmplete EDTA-free, Roche)). The extracts were centrifuged twice at 10,000g for 10 min at 4 °C to remove precipitates. The supernatants, with the exception of the mClover sample, were ultracentrifuged at 100,000g for 30 min at 4 °C, and the pellets were solubilized in extraction buffer containing 0.5% Triton X-100. The solubilised membrane fraction samples and mClover sample plus 0.5% Triton X-100 were incubated with GFP-trap agarose beads (ChromoTek, gta-20) with rotation for 2 h at 4 °C. The beads were washed with buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl) four times. Then, the bound proteins were eluted with SDS sample buffer by heating at 70 °C for 5 min. The protein samples were separated on SDS–PAGE and subjected to immunoblot analysis. The immunoblot analysis was conducted on PVDF membranes (Immobilon-P, Millipore) using primary antibodies (anti-GFP (ab290, Abcam), or monoclonal anti-DYKDDDDK tag (Wako) for Flag tag) and secondary antibodies (goat anti-rabbit IgG peroxidase-labelled antibody or goat anti-mouse IgG peroxidase-labelled antibody (KPL)). Signals were visualized using Immobilon Western Chemiluminescent HRP Substrate (Millipore), detected with Light-Capture (ATTO).

Discover hidden collaborations