Entity

Time filter

Source Type

Vienna, Austria

News Article
Site: http://www.nature.com/nature/current_issue/

No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. IMR90, mouse embryonic fibroblasts, and HEK293T were described previously16, 31. Primary BJ fibroblasts were purchased from ATCC. Cell line identities were not further authenticated. The cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), 100 U ml−1 penicillin, and 100 μg ml−1 streptomycin (Invitrogen), and were intermittently tested for mycoplasma. IMR90 and BJ were cultured under physiological oxygen (3%), except for the H O treatment, in which cells were cultured in an incubator with 20% oxygen, and the experiments involved in live-cell imaging. For primary cell cultures, cells were briefly washed with PBS, trypsinized at 37 °C for 2–4 min, and passaged at no more than 1:4 dilutions. Cells were counted with a Countess automated cell counter (Life Technologies), and the numbers were recorded where growth curves were generated. HEK293T cells were transfected using Lipofectamine 2000 (Invitrogen). For amino-acid starvation, cells were incubated in Hank’s buffer (with calcium and glucose) supplemented with 10% dialysed FBS and 1% HEPES (Invitrogen). For amino-acid and serum deprivation, cells were cultured in Hank’s buffer plus 1% HEPES. Stable cell lines were made by retrovirus or lentivirus infection, as previously described31, with slight modifications. Retroviral constructs were transfected to Phoenix packaging cell line. Lentiviral pLKO constructs were transfected with packaging plasmids to HEK293T cells. Viral supernatant was filtered through a 0.45-μm filter, supplemented with 8 μg ml−1 polybrene, and mixed with trypsinized recipient cells. pLNCX-ER:HRasV12, WZL-hygro, and WZL-HRasV12-hygro viral constructs were described elsewhere20, 22. sh-Atg7 hairpin sequence GGAGTCACAGCTCTTCCTTAC was from ref. 22, and cloned into Tet-pLKO-puro ‘all-in-one’ tetracycline-inducible vector32. Doxycyclin 100 ng ml−1 was added to IMR90 to induce knockdown of Atg7. Another pLKO-shAtg7 construct (TRCN0000007587) was purchased from Sigma-Aldrich and used in BJ fibroblasts. The infected cells were selected with puromycin, neomycin, or hygromycin for about 1 week. Rapamycin was purchased from Millipore. H O was from Fisher Scientific. 4-Hydroxytamoxifen and etoposide was from Sigma-Aldrich. The following antibodies were used: LC3 (MBL PM036 for WB of mouse embryonic fibroblasts; Cell Signaling Technology 3868 for immunoprecipitation, ChIP, IF, WB; Cell Signaling Technology 2775 for WB), β-tubulin (Sigma-Aldrich T4026), calreticulin (Cell Signaling Technology 12238), COX IV (Cell Signaling Technology 4850), Atg5 (Cell Signaling Technology 8540), Atg7 (Cell Signaling Technology 8558), lamin B1 (Abcam ab16048), lamin B2 (Abcam ab8983), lamins A/C (Millipore MAB3211), GFP (Roche 11 814 460 001 and Abcam ab290), p62 (Abnova H00008878-M01), GAPDH (Fitzgerald Industries 10R-G109A), p16 (Abcam ab16123), Ras (Millipore 05-516), HA (Sigma-Aldrich H3663), H3K27me3 (Active Motif 39538), H3K9me3 (Abcam ab8898), LAMP1 (Iowa Hybridoma Bank H4a3-s), and Flag (Sigma-Aldrich F1804). GST, GST–LC3A, B, C, and GST–LC3B mutants/truncations were described elsewhere33. GFP, HA/Flag/GFP–LC3 WT and mutants, GFP–Beclin 1, GFP–ULK1, GFP–lamin B1, and split Venus constructs were described previously17, 31, 34, 35. pBabe–mCherry–GFP–LC3 (ref. 36) was purchased from Addgene, and LC3 was truncated to make pBabe–mCherry–GFP, and then lamin B1 sequences were cloned. Lamin B1 truncations/mutations were made from pEGFP–lamin B1 for direct transfection, pBabe–mCherry–GFP–lamin B1 for retrovirus, or pT7-NHA-lamin B1 for in vitro translation. Tet-inducible lentiviral GFP–lamin B1 was made by cloning the GFP–lamin B1 fragment into pTRIPZ. All new constructs in this study were verified by DNA sequencing. Cells were lysed in buffer containing 50 mM Tris pH 7.5, 0.5 mM EDTA, 150 mM NaCl, 1% NP40, 1% SDS, supplemented with 1:100 Halt Protease inhibitor cocktail (Thermo Scientific). The lysates were briefly sonicated, and supernatants were subjected to electrophoresis using NuPAGE Bis-Tris precast gels (Life Technologies). After transferring to nitrocellulose membrane, 5% milk in TBS supplemented with 0.1% Tween 20 (TBST) was used to block the membrane at room temperature (~25 °C) for 1 h. Primary antibodies were diluted in 5% BSA in TBST, and incubated at 4 °C overnight. The membrane was washed three times with TBST, each for 10 min, followed by incubation of HRP-conjugated secondary antibodies at room temperature for 1 h, in 5% milk/TBST. The membrane was washed again three times, and imaged by a Fujifilm LAS-4000 imager. Cells were lysed in immunoprecipitation buffer containing 20 mM Tris, pH 7.5, 137 mM NaCl, 1 mM MgCl , 1 mM CaCl , 1% NP-40, 10% glycerol, supplemented with 1:100 Halt protease and phosphatase inhibitor cocktail (Thermo Scientific) and benzonase (Novagen) at 12.5 U ml−1. Benzonase is essential to release chromatin-bound proteins to supernatant, and MgCl is critical for its activity. The lysates were rotated at 4 °C for 30–60 min. The supernatant was incubated with antibody-conjugated Dynabeads (Life Technologies), and rotated at 4 °C overnight. The immunoprecipitation was washed and collected by magnet, for five times with immunoprecipitation buffer, and boiled with NuPAGE loading dye. Samples were analysed by western blotting. Cell-free in vitro translation was performed using the 1-Step In Vitro Translation Kit (Thermo Scientific), following the manufacturer’s guidance. Target proteins were cloned into pT7CFE1-NHA vector (with N-terminal HA tag) and translated in vitro at 30 °C. GST-tagged constructs were transformed into BL21-CodonPlus Escherichia coli and purified with glutathione beads (Life Technologies). Lamin B1 370–458 and 390–438 fragments were cloned into GST construct with a TEV protease recognition site between GST and the cloned sequences. The expressed proteins were loaded and purified with glutathione agarose beads, and digested with His-tagged TEV protease. The resulting supernatant was further purified with Ni-NTA beads (Qiagen) to remove His-tagged TEV protease. For GST pull-down, bacterial lysates were incubated with glutathione beads at 4 °C for 2 h and washed four times with buffer containing 50 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, 1 mM DTT, supplemented with 100 μM PMSF. The purified proteins or in vitro translated proteins were diluted in binding buffer (20 mM Tris, pH 7.5, 137 mM NaCl, 1 mM MgCl , 1 mM CaCl , 1% NP-40, supplemented with 1:1,000 Halt Protease inhibitor cocktail) and then pre-cleared with GST at 4 °C for 1 h. The resulting supernatant was then subjected to GST pull-down with GST or GST fusion proteins. The product was washed four times with binding buffer and boiled with NuPAGE loading dye for immunoblotting analysis. Purified lamin B1 protein was purchased from Origene. For immunofluorescence, cells were fixed in 4% paraformaldehyde in PBS for 30 min at room temperature. Cells were washed twice with PBS, and permeabilized with 0.5% Triton X-100 in PBS for 10 min. After washing two times, cells were blocked in 10% BSA in PBS for 1 h at room temperature. Cells were incubated with primary antibodies in 5% BSA in PBS supplemented with 0.1% Tween 20 (PBST) overnight at 4 °C. The next day, cells were washed four times with PBST, each for 10 min, followed by incubation with Alexa Fluor-conjugated secondary antibody (Life Technologies) in 5% BSA/PBST for 1 h at room temperature. Cells were then washed four times in PBST, incubated with 1 μg ml−1 DAPI in PBS for 5 min, and washed twice with PBS. The slides were then mounted with ProLong Gold (Life Technologies) and imaged with a Leica TCS SP8 fluorescent confocal microscope. The slides were mounted with ProLong Diamond (Life Technologies) for 5 days at room temperature for super-resolution microscopy. Three-dimensional structural illumination microscopy was performed using N-SIM Super-resolution Microscope System (Nikon) with an oil immersion objective lens CFI SR (Apochromat TIRF ×100, 1.49 numerical aperture; Nikon). Twenty to forty-one optical sections were collected with a 200 nm interval between neighbouring sections. For live-cell imaging, mCherry–GFP–lamin B1 HRasV12 cells were plated onto a 35 mM glass bottom dish (MatTek P35G-0-14-C) pre-coated with poly-l-lysine (Sigma-Aldrich). The dish was imaged with a spinning disk fluorescent confocal microscope (Olympus IX71 and IX81 Inverted System, coupled with an Andor iXon3 EMCCD camera, with motorized x–y stage, Okolab stagetop incubation chamber, and MetaMorph acquisition software). Cells were imaged overnight every 15 min. Twelve z-sections were acquired covering the entire individual cell. Images were viewed and presented as the maximum projection from all z-sections. For immuno-gold TEM, GFP–lamin B1 expressing IMR90 cells were subjected to high-pressure freezing. The samples were then dehydrated by freeze substitution methods for 72 h at −90 °C in 0.1% uranyl acetate/acetone followed by embedding in Lowicryl HM20 at −50 °C with 360 nm light polymerization of the resin for 48 h. Resin-embedded cells were sectioned at 70 nm thickness. GFP–lamin B1 was detected with a GFP antibody35 diluted 1:50 in 5% BSA, 0.1% fish gelatin, in PBS. Gold colloids (10 nm) conjugated to goat anti-rabbit (Electron Microscopy Sciences) at 1:200 was used for secondary detection of GFP–antigen conjugates followed by a 0.2% gluteraldehyde post-fix to stabilize the immuno-protein complexes. Imaging was performed at 80 keV on a JEOL 1010 at indicated magnifications and collected digitally on an AMT side-entry CCD (charge-coupled device) without post-labelling heavy-metal staining. For TEM analysis of ultrastructures of control and HRasV12 IMR90, cells were subjected to high-pressure freezing, followed by standard TEM procedures. These assays were performed as described previously16 with slight modification. In brief, cells were crosslinked with 1% formaldehyde diluted in PBS, without the addition of other co-crosslinkers, for 5 min at room temperature. After glycin quenching, the cell pellets were lysed in buffer containing 50 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.1% Na-deoxycholate, 0.1% SDS, supplemented with complete protease inhibitor cocktail (Thermo Scientific), and sonicated with a Covaris sonicator, resulting in chromatin fragments with an average size of 250 base pairs. The supernatant was diluted ten times with the above buffer without SDS, and subjected to immunoprecipitations with 2 μg of antibody or control IgG conjugated with Dynabeads Protein A or G (Invitrogen) at 4 °C overnight. The beads were then washed five times with buffer containing 50 mM Tris, pH 7.5, 150 mM NaCl, 1% Triton X-100, and once with final wash buffer (50 mM Tris, pH 8.0, 10 mM EDTA, 50 mM NaCl), followed by elution with incubation of elution buffer (final wash buffer plus 1% SDS) at 65 °C for 30 min with agitation in a thermomixer. The ChIP and input were then purified and used for qPCR analysis or for constructing sequencing libraries with a NEBNext Ultra kit (New England Biolabs). For ChIP-sequencing, the libraries were quantified (Kapa Biosystems) and were single-end sequenced on an Illumina NextSeq 2000. The following primers were used for qPCR analyses of LADs. LAD1: forward, AGAGACGTGGCGTGTGTCC; reverse, GGCACTGAAGCCACCTCTGT (chromosome 4: 190524973–190525023). LAD2: forward, ATTTGCACAATCTGAGGGCG; reverse, CTGGGCAATTCCCTTGGTAGT (chromosome 7: 35434121–35434171). LAD3: forward, GCATCCATTTCACATCCTTGG; reverse, CCCATTGCCTCTGAAGTTTTGT (chromosome 8: 130184820–130184870). This was performed with the subcellular fractionation kit for cultured cell (Thermo Scientific 78840) according to the manufacturer instructions, with slight modification. Benzonase (Novagen) was used to digest chromatin-bound proteins in the nuclear fraction, in the buffer supplemented with 5 mM MgCl . β-Galactosidase assays were performed using a cellular senescence assay kit (Chemicon KAA002), according to the manufacturer’s protocol. Cells were incubated with β-gal detection solution at 37 °C overnight, and quantified under regular light microscopy. At least 200 cells were scored for β-gal positivity with over four different fields. Alignment of vertebrate lamin B1 proteins was done using ClustalX 2.1 (ref. 37). Computational analysis of ChIP-seq was performed as previously described and as follows. Data source: H3 (GEO accession number GSM897555), H3K4me3 (GEO GSM897556). H3K9me3 ChIP-seq data (GEO GSM942075 and GSM942119) were published elsewhere15, 38. LC3 and lamin B1 ChIP-seq data in this study have been deposited in the GEO (http://www.ncbi.nlm.nih.gov/geo) under accession number GSE63440. Alignment of lamin B1, LC3, and input: all ChIP-seq data were aligned to the GRCh37 (hg19) assembly of the human genome using bowtie2 with command-line parameters -k1 -N1 —local (allowing and reporting a single alignment per read with one or zero mismatch permitted in the seed region). Track generation: ChIP-seq visualization tracks were created in the following way. Aligned sequence tags were subjected to BEDTools’ genomeCoverageBed tool, making bedGraphs that were multiplied by the RPM coefficient. A similarly normalized input bedGraph was then subtracted from lamins B1 and LC3, and bedGraphs were made into bigWigs using the University of California Santa Cruz Genome Browser’s bedGraphToBigWig utility. Box plot: aligned tag counts were assessed for each LAD for all marks under study, as well as the corresponding input and H3. The distribution of ChIP enrichment (ChIP-background) was computed over all LADs or over an equal number of size-matched background regions, sampled from all genomic positions that did not overlap with LADs. Hypothesis testing was done by Mann–Whitney/Wilcoxon tests. Overlap permutation test: to determine whether LADs were significantly associated with LC3ADs, the number of base pairs in common between LADs and other domains was tabulated using BEDTools intersect (default two-set comparison). In each of 1,000 iterations, LAD coordinates were randomly shuffled using BEDTools, creating 1,000 sets of equal-sized control regions. Each control set was scored for the number of base pairs in common with LC3ADs, and the frequency with which control sets shared more genomic space with other domains than LADs was taken to be an estimate of the probability that a LAD–LC3AD association was not due to chance. Area under the curve permutation test: for Fig. 2e, a permutation test for LC3, H3K9me3, and H3K4me3 over LADs was performed. In each of 100 iterations, LADs coordinates were randomly shuffled using BEDTools, creating 100 sets of equal-sized non-LADs control regions. LADs as well as each of the 100 non-LAD control sets were scored for LC3, H3K9me3, and H3K4me3 enrichment, and the number of control sets in which the median score was greater than or equal to the median value of the LAD distribution was tabulated. That frequency was taken to be an estimate of the probability that enrichment over LADs was not due to chance; that is, the probability of the null hypothesis that LADs and non-LADs had the same median enrichment. The P-value for H3K9me3 was less than 0.01, and the P-value for H3K4me3 was 1. This test was repeated using the 75th percentile value as the test statistic and with the 90th percentile value, with the same result in both cases. Domain detection: enriched domains for lamin B1 and LC3 were called using EDD14 with default bin size estimation and gap penalty estimation, and unalignable regions (the hg19 assembly gap track from Genome Reference Consortium) masked. The false discovery rate was controlled at the default value of 5%. Student’s t-test was used for comparison between two groups. One-way ANOVA coupled with Tukey’s post hoc test was used for comparisons over two groups. Significance was considered when the P-value was less than 0.05.


Stepan H.,Okolab | Pani J.,Okolab | Pummer S.,Okolab | Weber M.-T.,Okolab | And 4 more authors.
Chromatographia | Year: 2015

Ethyl carbamate occurs not only in a wide range of alcoholic beverages and fermented foods such as bread, yoghurt, or soy sauce but also in fruit and vegetable juices. Apart from that, traces of ethyl carbamate have been found in tobacco smoke and smokeless tobacco products such as moist snuff or snus. A highly efficient purification technique was established for ethyl carbamate from smokeless tobacco products and tobacco mainstream smoke. After extraction using an aqueous buffer, a polymeric-reversed phase material is used to purify the extracts. Aqueous buffer with 10 % methanol is sufficient to elute the highly polar analyte from the column while matrix components remain on the column. Final determination of ethyl carbamate is performed using HPLC–APCI–MS/MS. Ethyl carbamate-d5 is used as internal standard to correct the peak areas before quantification via external standard calibration. A comparison of ionization techniques, APCI and ESI, showed that APCI gives a significantly improved sensitivity. Reference cigarettes (tobacco mainstream smoke) as well as reference smokeless tobacco products (CRP1–4) were analyzed, but only CRP2 showed detectable levels of 38 µg kg−1. Recoveries ranged from 80 % in CRP2 to 45 % in CRP3. Furthermore, extensive validation data are presented. © 2015, Springer-Verlag Berlin Heidelberg. Source

Discover hidden collaborations