Time filter

Source Type

San Carlos, CA, United States

Beane J.,Boston University | Vick J.,Boston University | Schembri F.,Boston University | Anderlind C.,Boston University | And 11 more authors.
Cancer Prevention Research

Cigarette smoke creates a molecular field of injury in epithelial cells that line the respiratory tract. We hypothesized that transcriptome sequencing (RNA-Seq) will enhance our understanding of the field of molecular injury in response to tobacco smoke exposure and lung cancer pathogenesis by identifying gene expression differences not interrogated or accurately measured by microarrays. We sequenced the highmolecular-weight fraction of total RNA (>200 nt) from pooled bronchial airway epithelial cell brushings (n = 3 patients per pool) obtained during bronchoscopy from healthy never smoker (NS) and current smoker (S) volunteers and smokers with (C) and without (NC) lung cancer undergoing lung nodule resection surgery. RNA-Seq libraries were prepared using 2 distinct approaches, one capable of capturing non-polyadenylated RNA (the prototype NuGEN Ovation RNA-Seq protocol) and the other designed to measure only polyadenylated RNA (the standard Illumina mRNA-Seq protocol) followed by sequencing generating approximately 29 million 36 nt reads per pool and approximately 22 million 75 nt paired-end reads per pool, respectively. The NuGEN protocol captured additional transcripts not detected by the Illumina protocol at the expense of reduced coverage of polyadenylated transcripts, while longer read lengths and a paired-end sequencing strategy significantly improved the number of reads that could be aligned to the genome. The aligned reads derived from the two complementary protocols were used to define the compendium of genes expressed in the airway epithelium (n = 20,573 genes). Pathways related to the metabolism of xenobiotics by cytochrome P450, retinol metabolism, and oxidoreductase activity were enriched among genes differentially expressed in smokers, whereas chemokine signaling pathways, cytokine-cytokine receptor interactions, and cell adhesion molecules were enriched among genes differentially expressed in smokers with lung cancer. There was a significant correlation between the RNA-Seq gene expression data and Affymetrix microarray data generated from the same samples (P < 0.001); however, the RNA-Seq data detected additional smoking- and cancer-related transcripts whose expression was were either not interrogated by or was not found to be significantly altered when using microarrays, including smokingrelated changes in the inflammatory genes S100A8 and S100A9 and cancer-related changes in MUC5AC and secretoglobin (SCGB3A1). Quantitative real-time PCR confirmed differential expression of select genes and non-coding RNAs within individual samples. These results demonstrate that transcriptome sequencing has the potential to provide new insights into the biology of the airway field of injury associated with smoking and lung cancer. The measurement of both coding and non-coding transcripts by RNA-Seq has the potential to help elucidate mechanisms of response to tobacco smoke and to identify additional biomarkers of lung cancer risk and novel targets for chemoprevention. ©2011 AACR. Source

Majerczyk C.,University of Washington | Brittnacher M.,University of Washington | Jacobs M.,University of Washington | Armour C.D.,NuGEN | And 5 more authors.
Journal of Bacteriology

Burkholderia thailandensis contains three acyl-homoserine lactone quorum sensing circuits and has two additional LuxR homologs. To identify B. thailandensis quorum sensing-controlled genes, we carried out transcriptome sequencing (RNA-seq) analyses of quorum sensing mutants and their parent. The analyses were grounded in the fact that we identified genes coding for factors shown previously to be regulated by quorum sensing among a larger set of quorum-controlled genes. We also found that genes coding for contact-dependent inhibition were induced by quorum sensing and confirmed that specific quorum sensing mutants had a contact-dependent inhibition defect. Additional quorum-controlled genes included those for the production of numerous secondary metabolites, an uncharacterized exopolysaccharide, and a predicted chitin-binding protein. This study provides insights into the roles of the three quorum sensing circuits in the saprophytic lifestyle of B. thailandensis, and it provides a foundation on which to build an understanding of the roles of quorum sensing in the biology of B. thailandensis and the closely related pathogenic Burkholderia pseudomallei and Burkholderia mallei. © 2014, American Society for Microbiology. Source

Majerczyk C.D.,University of Washington | Brittnacher M.J.,University of Washington | Jacobs M.A.,University of Washington | Armour C.D.,NuGEN | And 5 more authors.
Journal of Bacteriology

Burkholderia pseudomallei, Burkholderia thailandensis, and Burkholderia mallei (the Bptm group) are close relatives with very different lifestyles: B. pseudomallei is an opportunistic pathogen, B. thailandensis is a nonpathogenic saprophyte, and B. mallei is a host-restricted pathogen. The acyl-homoserine lactone quorum-sensing (QS) systems of these three species show a high level of conservation. We used transcriptome sequencing (RNA-seq) to define the quorum-sensing regulon in each species, and we performed a cross-species analysis of the QS-controlled orthologs. Our analysis revealed a core set of QS-regulated genes in all three species, as well as QS-controlled factors shared by only two species or unique to a given species. This global survey of the QS regulons of B. pseudomallei, B. thailandensis, and B. mallei serves as a platform for predicting which QS-controlled processes might be important in different bacterial niches and contribute to the pathogenesis of B. pseudomallei and B. mallei. © 2014, American Society for Microbiology. Source

Crawled News Article
Site: http://www.nature.com/nature/current_issue/

All mice were maintained on a C57BL/6 background, including ScfGFP (ref. 19), Scffl/+ (ref. 19), Cxcl12DsRed (ref. 18), Cxcl12fl/+ (ref. 18), R26tdTomato (ref. 26), Vav1-cre (ref. 24), Leprcre (ref. 27), Tcf21cre/ER (ref. 21) and α-catulinGFP. To induce Cre/ER activity in Tcf21cre/ER mice, 4–6-week-old mice were administered 2 mg tamoxifen (Sigma) daily by oral gavage for 12 consecutive days. For induction of EMH, mice were injected at day 0 with a single dose of 4 mg cyclophosphamide followed by daily injections of 5 μg G-CSF for 4–21 days. Both male and female mice were used. All mice were housed in the Animal Resource Center at the University of Texas Southwestern Medical Center (UTSW). All procedures were approved by the UTSW Institutional Animal Care and Use Committee. Bone marrow cells were isolated by flushing the femur or tibia with Ca2+- and Mg2+-free HBSS with 2% heat-inactivated bovine serum using a 3 ml syringe fitted with a 25-gauge needle. Spleen cells were obtained by crushing the spleen between two frosted slides. The cells were dissociated to a single-cell suspension by gently passing through the needle several times and then filtering through a 40-μm nylon mesh. Blood was collected by cardiac puncture, and white blood cells were isolated by ficoll centrifugation according to the manufacturer’s instructions (GE Healthcare). The following antibodies were used to isolate HSCs: anti-CD150 (TC15-12F12.2), anti-CD48 (HM48-1), anti-Sca-1 (E13-161.7), anti-c-kit (2B8) and the following antibodies against lineage markers (anti-Ter119, anti-B220 (6B2), anti-Gr-1 (8C5), anti-CD2 (RM2-5), anti-CD3 (17A2), anti-CD5 (53-7.3) and anti-CD8 (53-6.7)). Haematopoietic progenitors were identified by flow cytometry using the following antibodies: anti-Sca-1 (E13-161.7), anti-c-Kit (2B8) and the following antibodies against lineage markers (anti-Ter119, anti-B220 (6B2), anti-Gr-1 (8C5), anti-CD2 (RM2-5), anti-CD3 (17A2), anti-CD5 (53-7.3) and anti-CD8 (53-6.7)), anti-CD34 (RAM34), anti-CD135 (Flt3) (A2F10), anti-CD16/32 (FcγR) (93), anti-CD127 (IL7Rα) (A7R34), anti-CD24 (M1/69), anti-CD43 (1B11), anti-B220 (6B2), anti-IgM (II/41), anti-CD3 (17A2), anti-Gr-1 (8C5), anti-Mac-1 (M1/70), anti-CD41 (MWReg30), anti-CD71 (C2) and anti-Ter119. 4′,6-Diamidino-2-phenylindole (DAPI) was used to exclude dead cells. Antibodies were obtained from eBioscience or BD Bioscience. To isolate bone marrow stromal cells the marrow was gently flushed out of the bone marrow cavity with a 3-ml syringe fitted with a 23-guage needle and then transferred into 1 ml pre-warmed bone marrow digestion solution (200 U ml−1 DNase I (Sigma), 250 μg ml−1 LiberaseDL (Roche) in HBSS plus Ca2+ and Mg2+) and incubated at 37 °C for 30 min with gentle shaking. To isolate splenic stromal cells, the spleen capsule was cut into ~1 mm3 fragments using scissors and then digested as described earlier in spleen digestion solution (200 U ml−1 DNase I, 250 μg ml−1 LiberaseDL, 1 mg ml−1 collagenase, type 4 (Roche) and 500 μg ml−1 collagenase D (Roche) in HBSS plus Ca2+ and Mg2+). After a brief vortex, the spleen fragments were allowed to sediment for ~3 min and the supernatant was transferred to another tube on ice. The sedimented (undigested) spleen fragments were subjected to a second round of digestion. The two fractions of digested cells were pooled and filtered through a 100-μm nylon mesh. Anti-PDGFR-α (APA5), anti-PDGFR-β (APB5), anti-LepR (R&D), anti-CD45 (30F-11) and anti-Ter119 antibodies were used to isolate stromal cells. For analysis of endothelial cells, mice were injected intravenously into the retro-orbital venous sinus with 10 μg Alexa-Fluor-660-conjugated anti-VE-cadherin antibody (BV13) 10 min before being killed. Samples were analysed using a FACSAria or FACSCanto II flow cytometer (BD Biosciences). To assess BrdU incorporation into spleen cells after EMH induction, mice were intraperitoneally injected with a single dose of BrdU (2 mg BrdU per mouse) then maintained on 0.5 mg BrdU per ml drinking water for 7 days. Endothelial cells were labelled by intravenous injection of an anti-VE-cadherin antibody (eBioscience). Enzymatically dissociated spleen cells were stained with antibodies against surface markers and the target cell populations were sorted then resorted to ensure purity. The sorted cells were then fixed, and stained with an anti-BrdU antibody using the BrdU APC Flow Kit (BD Biosciences) according to the manufacturer’s instructions. Adult recipient mice were irradiated using an XRAD 320 X-ray irradiator (Precision X-Ray) with two doses of 540 rad (total 1,080 rad) delivered at least 2 h apart. Cells were injected into the retro-orbital venous sinus of anaesthetized mice. Sorted doses of splenocytes from donor mice with EMH were transplanted along with 3 × 105 recipient bone marrow cells. Recipient mice were bled every 4 weeks to assess the level of donor-derived blood cells, including myeloid, B and T cells for at least 16 weeks. Blood was subjected to ammonium chloride/potassium red cell lysis before antibody staining. Antibodies including anti-CD45.2 (104), anti-CD45.1 (A20), anti-Gr1 (8C5), anti-Mac-1 (M1/70), anti-B220 (6B2) and anti-CD3 (KT31.1) were used for flow cytometric analysis. For bone marrow sections, freshly dissected bones were fixed in 4% paraformaldehyde overnight followed by 3 days of decalcification in 10% EDTA dissolved in PBS. Bones were sectioned using the CryoJane tape-transfer system (Instrumedics). For spleen sections, freshly dissected spleens were fixed in 4% paraformaldehyde for 1 h followed by 1 day incubation in 10% sucrose in PBS. Frozen spleens were sectioned with a cryostat (Leica). For whole mount imaging, spleens were sectioned into ~2 mm pieces. Spleen sections were blocked in PBS with 10% horse serum for 1 h and then stained overnight with chicken-anti-GFP (Aves) and/or rabbit-anti-laminin (Abcam) antibodies. Donkey-anti-chicken Alexa Fluor 488 and/or donkey-anti-rabbit Alexa Fluor 647 were used as secondary antibodies (Invitrogen). Specimens were mounted with anti-fade prolong gold (Invitrogen) and images were acquired with either a Zeiss LSM780 confocal microscope or a Leica SP8 confocal microscope equipped with a resonant scanner. Three-dimensional images were achieved using Bitplane Imaris v.7.7.1 software. Spleens were harvested and fixed for 4 h in 4% PFA at 4 °C. Since the spleen capsule is highly autofluorescent, spleens were sectioned perpendicular to the long axis into 300-μm-thick sections using a Leica VT100S vibrotome. These 300-μm sections were fixed for an additional 2 h in 4% PFA and blocked overnight in staining solution (10% dimethylsulfoxide (DMSO), 0.5% IgePal630 (Sigma) and 5% donkey serum (Jackson Immunoresearch) in PBS). All staining steps were performed in staining solution on a rotator at room temperature. Spleen sections were stained for 3 days in primary antibodies, washed overnight in several changes of PBS then stained for 3 days in secondary antibodies. The stained sections were dehydrated in a methanol dehydration series then incubated for 3 h in 100% methanol with several changes. The methanol was then exchanged with benzyl alcohol:benzyl benzoate 1:2 mix (BABB clearing28). The tissues were incubated in BABB for 3 h to overnight with several exchanges of fresh BABB. Spleen sections were mounted in BABB between two coverslips and sealed with silicone (Premium waterproof silicone II clear; General Electric). We found it necessary to clean the BABB of peroxides (which can accumulate as a result of exposure to air and light) by adding 10 g of activated aluminium oxide (Sigma) to 40 ml of BABB and rotating for at least 1 h, then centrifuging at 2,000 g for 10 min to remove the suspended aluminium oxide particles. Images were acquired using a Zeiss LSM780 confocal microscope with a Zeiss LD LCI Plan-Apo ×25/0.8 multi-immersion objective lens, which has a 570 μm working distance. Images were taken at 512 × 512 pixel resolution with 2 μm Z-steps, pinhole for the internal detector at 47.7 μm. Random spots were inserted into images by generating randomized X, Y, and Z coordinates using the random integer generator at http:// www.random.org. After mouse anaesthesia by ketamine/xylazine, a ventral midline incision was made and the peritoneum was breached. The splenic blood vessels were ligated with an absorbable suture (4-0 vicryl). The splenic vessels were cut distal to the suture and the spleen was removed. The vessels were cauterized and the abdomen was sutured with non-absorbable sutures (3-0 Tevdek III). Buprenorphine was administered every 12 h for 3 days to minimize postoperative pain and mice were maintained with ampicillin-containing water to avoid infection. Complete blood counts were measured one month after the survival surgery. EMH was induced by repeated bleeding over a 2-week period according to a published protocol2. Briefly, 4–6 month-old mice were bled via the tail vein five times, every 3 days, removing approximately 250 μl of blood each time, then the mice were killed for analysis 2 days after the last bleed. Approximately 30,000 CD45−Ter119−VE-cadherin+ splenic endothelial cells were flow cytometrically sorted into 50 μl of 66% trichoracetic acid (TCA) in water. Extracts were incubated on ice for at least 15 min and centrifuged at 16,100 g at 4 °C for 10 min. Precipitates were washed in acetone twice and the dried pellets were solubilized in 9 M urea, 2% Triton X-100, and 1% dithiothreitol (DTT). Samples were separated on 4–12% Bis-Tris polyacrylamide gels (Invitrogen) and transferred to PVDF membrane (Millipore). The blots were incubated with primary antibodies overnight at 4 °C and then with secondary antibodies. Blots were developed with the SuperSignal West Femtochemiluminescence kit (Thermo Scientific). Primary antibodies used: rabbit-anti-SCF (Abcam, 1:1,000) and mouse-anti-actin (Santa Cruz, clone AC-15, 1:20,000). Cells were sorted directly into Trizol (Life Technologies). Total RNA was extracted according to the manufacturer’s instructions. Total RNA was reverse transcribed using SuperScript III Reverse Transcriptase (Life Technologies). Quantitative real-time PCR was performed using SYBR green on a LightCycler 480 (Roche). β-Actin was used to normalize the RNA content of samples. Primers used in this study were Scf: 5′-GCCAGAAACTAGATCCTTTACTCCTGA-3′ and 5′-CATAAATGGTTTTGTGACACTGACTCTG-3′; β-actin: 5′-GCTCTTTTCCAGCCTTCCTT-3′ and 5′-CTTCTGCATCCTGTCAGCAA-3′. Three independent samples of 5,000 spleen Scf-GFP+VE-cadherin− spleen stromal cells and two independent samples of 5,000 unfractionated spleen cells were flow cytometrically sorted into Trizol. Total RNA was extracted, amplified, and sense strand cDNA was generated using the Ovation Pico WTA System V2 (NuGEN) according to the manufacturer’s instructions. cDNA was fragmented and biotinylated using the Encore Biotin Module (NuGEN) according to the manufacturer’s instructions. Labelled cDNA was hybridized to Affymetrix Mouse Gene ST 1.0 chips according to the manufacturer’s instructions. Expression values for all probes were normalized and determined using the robust multi-array average (RMA) method29. Panels in all figures represented multiple independent experiments performed on different days with different mice. Sample sizes were not based on power calculations. No randomization or blinding was performed. No animals were excluded from analysis. Variation is always indicated using standard deviation. For analysis of the statistical significance of differences between two groups we generally performed two-tailed Student’s t-tests. For analysis of the statistical significance of differences among more than two groups, we performed repeated measures one-way analysis of variance (ANOVA) tests with Greenhouse–Geisser correction (variances between groups were not equal) and Tukey’s multiple comparison tests with individual variances computed for each comparison. To assess the statistical significance of differences in fetal mass between paired control and mutant mice (Fig. 5j and Extended Data Fig. 8v), we performed a two-way ANOVA.

Crawled News Article
Site: http://www.nature.com/nature/current_issue/

No statistical methods were used to predetermine sample size. For calibrating the duration of the dark housing period before light exposure, C57Bl6 wild-type mice were housed in a standard light cycle until they were placed in constant darkness for varying amounts of time before analysis at postnatal day 56. At P56, all mice were either sacrificed in the dark (dark-housed condition) or light-exposed for 1, 3, or 7.5 h before being sacrificed. The eyes of all animals were enucleated (for the dark-housed condition, enucleation was performed in the dark) before dissection of the visual cortex in the light. For RiboTag-experiments, mice were reared in a standard light cycle and then housed in constant darkness for two weeks starting from P42; at P56, all mice were either sacrificed in the dark (dark-housed condition) or light-exposed for 1, 3, or 7.5 h before being sacrificed. Additional cohorts of mice for the ‘standard’ condition were housed in a standard light cycle until P56 when they were euthanized. The eyes of all animals were enucleated (for the dark-housed condition, enucleation was performed in the dark) before dissection of the visual cortex in the light. Total RNA was extracted with TRIzol reagent (Sigma) according to the manufacturer’s instructions, and RNA quality was assessed on a 2100 BioAnalyzer (Agilent); all RNAs were treated with DNaseI (Invitrogen) before reverse transcription. For the cloning of riboprobes, total RNA was extracted from whole adult C57Bl6 wild-type mouse brains and cDNA was prepared using SuperScript II kit (Life Technologies). For real-time quantitative PCR experiments aimed at calibrating the duration of the dark housing period, total RNA was extracted for each sample from the visual cortices of one animal. For real-time quantitative PCR experiments aimed at testing the efficacy of shRNA constructs directed against Igf1, total RNA was isolated from two pooled 24 wells of cultured cortical neurons for each condition. For qPCR experiments, RNA was reverse-transcribed with the High Capacity cDNA Reverse Transcription kit (Life Technologies). Real-time quantitative PCR reactions were performed on the LightCycler 480 system (Roche) with LightCycler 480 SYBR Green I Master. Reactions were run in duplicates, triplicates or quadruplicates, and β-actin (Actb) or β3-tubulin (Tubb3) levels were used as an endogenous control for normalization using the ΔΔC method24. Real-time PCR primers were designed using the Universal ProbeLibrary (Roche) as exon-spanning whenever possible and answered the following criteria: linear amplification over three orders of magnitude of target concentration, no amplification product in control samples that were not reverse-transcribed (that is, control for contamination with genomic DNA), no amplification product in control samples where no template was added (that is, control for primer dimers), amplification of one singular product as determined by melt-curve analysis and analysis of the product in agarose gel electrophoresis and sequencing of the PCR product. The qPCR primers used in this study are listed in Supplementary Table 6. For analysis of light-induced gene expression in wild-type mice, the gene expression levels were analysed in four mice (two males and two females) at each time point. The data were calculated as fold change relative to the average of the overnight dark-housed condition and normalized to the average of the maximally induced time point. Data in figures represent the mean and s.e.m. of four mice. For assessing Igf1 levels in cortical cultures infected with shRNA-expressing lentiviral constructs, qPCRs were performed in quadruplicates for each condition and fold changes were calculated relative to the non-infected non-stimulated cultures. Data were normalized to the maximally induced condition in each biological replicate, and data in figures represent the mean and s.e.m. of three biological replicates. Immunoprecipitation and purification of ribosome associated RNA was performed essentially as described6, 8, with minor modifications: lysis of the samples was performed in the presence 10 mM Ribonucleoside Vanadyl Complex (NEB, Ipswich, MA), and immunoprecipitation was performed with a different anti-HA antibody (HA-7, 12 μg per immunoprecipitation, Sigma). In brief, the visual cortices were dissected, flash frozen in liquid nitrogen and then kept at −80 °C until further processing. Visual cortices from three individual animals (each sample contained both male and female animals) were pooled for each biological replicate, and three biological replicates were performed. After lysis of the tissues and before immunopurification, a small fraction of lysate of each sample (that is, ‘input’) was set aside and total RNA was extracted with TRIzol reagent followed by the RNEasy Micro Kit’s procedure (Qiagen, Valencia, California). After immunopurification of the ribosome-associated RNAs, RNA quality was assessed on a 2100 BioAnalyzer (Agilent, Palo Alto, California) and RNA amounts were quantified using the Qubit 2.0 Fluorometer (Life Technologies). Only samples with RIN numbers above 8.0 were considered for analysis by qPCR and RNA-seq. For all RNA samples of sufficient integrity, 5–10 ng of RNA were SPIA-amplified with the Ovation RNA Amplification System V2 (NuGEN, San Carlos, California), yielding typically 5–8 μg of cDNA per sample. Quantitative RT–PCR was performed as described above and relative expression levels were determined in every experiment by normalizing the Ct-values to those of beta-Actin (ActB) from the 0 h input using the ΔΔC method24. To determine the fold-enrichment (IP/Input), the actin-normalized expression levels for every time point of every biological replicate were averaged, and the grand averages from the IP and Input were divided to find the IP/Input ratio. To calculate fold-induction for each biological replicate, each time point was divided by the maximal value occurring in that biological replicate, such that the maximal value was set to 1 in each biological replicate. The mean and standard error were calculated at each time point from these normalized values. All samples were analysed by qPCR for purity and light-induced gene expression before analysis by high throughput sequencing. SPIA-amplified samples from RiboTag-immunoprecipitated fractions for each of the five stimulus conditions and each of the five Cre lines were prepared as described above and processed in triplicate (75 samples total). For preparing sequencing libraries, 2 μg of each amplified cDNA were fragmented to a length of 200–400 bp using a Covaris S2 sonicator (Acoustic Wave Instruments) using the following parameters: duty cycle: 10%, intensity: 5, cycles per burst: 200, time: 60 s, total time: 5 min. After validating the fragment length of the sonicated cDNA using a 2100 BioAnalyzer (Agilent, Palo Alto, California), 2 μg of the fragmented cDNA were used for sequencing library preparation using the PrepX DNA kit on an Apollo 324 robot (IntegenX). The quality of completed sequencing libraries was assessed using a 2100 BioAnalyzer (Agilent, Palo Alto, California) and the completed libraries were sequenced on an Illumina HiSeq 2000 instrument, following the manufacturer’s standard protocols for single-end 50 bp sequencing with single index reads. Sequencing typically yielded 30–80 million usable non-strand-specific reads per IP sample. Reads were mapped to the mm9 genome using TopHat (v.2.0.13) and Bowtie ( On average, ~70% of mapped IP reads were uniquely mapped to the mm9 genome allowing for 0 mismatches and were therefore assignable to genic features (one RiboTag-seq library (Sst-cre, standard-housing, biological replicate 2) was excluded from analysis due to low mappability). Values from all IP libraries were normalized using Cufform (v.2.2.1), and values from the Cuffnorm output file ‘genes-Count_Table’ (normalized reads) were taken as a proxy for gene expression. P values were generated for each Cre line for each dark–light conditions using Cuffdiff (v.2.2.1) using the time series (-T) flag based on three biological replicates. To identify transcripts regulated by visual experience, for each biological replicate of each Cre line, the fold change in normalized reads was calculated for each gene at every time point (dark-housed/standard-housed, 1 h light/dark-housed, 3 h light/dark-housed; 7.5 h light/dark-housed). Genes were flagged as experience-regulated in a given Cre line if they met the following conditions in at least one sample: (1) P value <0.005, (2) mean fold change of twofold or greater, (3) fold changes of 2 or higher in 2 of 3 biological replicates, (4) the mean expression value in at least one sample must be above absolute expression threshold (set at the 40th percentile of all observed values). To determine in which Cre lines genes were regulated by experience, genes were simply classified according to the above criteria. However, for this analysis we excluded the Gad2-cre line, since Pv-, Sst- and Vip-cre all label subsets of the neurons labelled by Gad2-cre. However, we did detect genes regulated solely in Gad2-cre, but no other Cre lines; we reasoned that these genes are probably regulated by experience in a population of 5HT3aR+/VIP− neurons that are contained in Gad2-cre but none of the other Cre lines. We classified the set of experience-regulated genes into categories ‘early’, ‘late’, and ‘long-term’ based on the fastest kinetics observed. When genes were found to be elevated and/or suppressed at multiple time points, we assigned them to the categories based on the most rapid observed change. For example, while Fos levels are elevated over dark housing at 1, 3 and 7.5 h of light exposure and suppressed after two weeks of dark housing, Fos is classified as ‘early-up’ because it is elevated at 1 h after light exposure. All linkage analysis was performed using the ‘single’ method and ‘Cityblock’ metric using Matlab’s linkage function. To determine the branch-order significance of the cladogram resulting from clustering of the 602 experience-regulated genes, we generated 1,000 cladograms from 602 sets of random expressed genes (including experience-regulated genes, with replacement) and asked how often we generated a cladogram with an identical branch order at the level of the Cre lines. Only 11 sets of 1,000 random genes sets generated an identical tree. For the purposes of this analysis, we only compared the branches above the level of the individual Cre line. To identify cell-type-enriched transcripts, an enrichment score was calculated for every transcript in every Cre line for each biological replicate. This enrichment score was calculated by dividing the maximum expression value observed in a given Cre line by the maximum expression value observed across all conditions for all other Cre lines (GABAergic subtypes were not required to be enriched above Gad2-cre). The enrichment scores for a set of known cell-type-specific genes were evaluated (Vglut1, Tbr1, Pvalb, Sst, Vip), and our threshold was set at the enrichment score of the cell-type-specific gene with the lowest score (Slc17a7/Vglut1, at 5.5-fold-enriched in Emx1-cre). Transcripts were considered to be expressed in a cell-type-specific manner (or ‘highly enriched’) in a given Cre line if their mean enrichment score was above this threshold and if the enrichment score exceeded this threshold in 2 out of 3 biological replicates. Cloning of all constructs was done using standard cloning techniques, and the integrity of all cloned constructs was validated by DNA sequencing. Templates for the riboprobes for Igf1, Gad1, Pvalb, Sst and Vip were prepared by PCR-amplification of cDNA fragments generated from total RNA isolated from adult C57Bl6 mouse brains (see Supplementary Table 7 for primer sequences) and cloning of the respective PCR fragments into the pBlueScript II vector (Agilent Technologies). Lentiviral shRNA constructs were generated by cloning shRNA stem loop sequences against Igf1 (Igf1 shRNA 1: GGTGGATGCTCTTCAGTTC; Igf1 shRNA 2: TGAGGAGACTGGAGATGTA) and Luciferase (Luc, control: ACTTACGCTGAGTACTTCG) into a modified version of pLentiLox3.726 in which the CMV promoter driving the expression of eGFP was replaced with an hUbc promoter and in which the loxP sites surrounding the hUbc-eGFP cassette were removed. The loop sequence used in these shRNA constructs is based on miR-25 (CCTCTCAACACTGG)27. shRNA-expressing AAV-constructs (pAAV-U6-shRNA-hUbc-Flex-eGFP) were made by first replacing the Flex-GFP-Gephyrin cassette in pAAV-Flex-GFP-Gephyrin22 with a Flex-eGFP cassette (resulting in pAAV-hUbc-Flex-eGFP) and then transferring the U6-shRNA cassettes from the pLentiLox constructs to pAAV-hUbc-Flex-eGFP. AAV constructs for the Cre-conditional co-expression of epitope-tagged IGF1.4 and eGFP or of eGFP alone were cloned by synthesizing the gBlocks (Integrated DNA Technologies) and using the gBlocks as templates for PCR amplification; the respective PCR products were then cloned into the pAAV-hUbc-Flex-eGFP (see above) by replacing the EGFP with the respective insert. This strategy yielded plasmids termed pAAV-hUbc-Flex-SSHA-IGF1.4-Myc-F2A-eGFP and pAAV-hUbc-Flex-F2A-eGFP, whereby the Cre-dependent inserts were driven by a human ubiquitin promoter (hUbc). The sequence for Igf1.4 was based on NM_001111275 (base pairs 277–752) and was modified in the following way: an HA epitope (TATCCtTATGATGTTCCAGATTATGCT) was inserted in frame between the Igf1.4 signal sequence and the beginning of the coding sequencing (cds) of Igf1.4, Igf1.4 was rendered resistant to the shRNA against Igf1 by introducing silent mutations into the target sequences specified above (sh1: TGTTGACGCGCTCCAATTT; sh2: TACGCCGGTTAGAAATGTA) and the followings tags were inserted in frame 3′ to the Igf1.4 coding sequencing: Myc epitope (GAACAAAAACTCATCTCAGAAGAGGATCTG), Furin cleavage site (CGGGCCAAGCGG) and a 2A peptide (GGCAGTGGAGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT). The sequence for eGFP was based of the published sequence of eGFP. For pAAV-hUbc-Flex-F2A-eGFP a gBlock was synthesized containing the Furin cleavage site followed by the 2A site and eGFP. Detailed sequences are available upon request. For double-fluorescent in situ hybridization (FISH), wild-type C57Bl6 mice were dark-housed and light-exposed for 7.5 h as described above. After light exposure, the brains were dissected and fresh frozen in Tissue-Tek Cryo-OCT compound (Fisher Scientific) on dry ice and stored at −80 °C until use. FISH for Igf1 was essentially done as described28, 29: riboprobes were prepared by in vitro transcription of linearized plasmids containing the template of the respective probe. Riboprobes for Igf1 were labelled with UTP-11-Digoxigenin, while the riboprobes for the subtype markers (Gad1, Pvalb, Sst, Vip) were labelled with UTP-12-Fluorescein (Roche); all riboprobes were hydrolyzed to lengths of 200–400 bp after synthesis and validated for labelling with Dioxigenin or Fluorescein. For in situ hybridization, coronal sections (20 μm thick) of the visual cortex were cut on a cryostat and fixed in 4% paraformaldehyde for 10 min. Endogenous peroxidases were inactivated by treating the sections for 15 min in 0.3% H O in PBS, and acetylation was performed as described. Pre-hybridization was done overnight at room temperature, and hybridization was performed under stringent conditions at 71.5 °C. Following hybridization, stringency washes in SSC were performed as described at 65 °C. For immunological detection of the first probe (Igf1), the tissue was first treated with a blocking step for 1 h in blocking buffer (B2) at room temperature before the anti-Digoxigenin-POD antibody (Roche) was applied at a concentration of 1:1000 in blocking buffer for 1 h at room temperature. Following three washes in buffer B1 and an additional wash in buffer TNT (0.1 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.05% Tween20), the Igf1 probe was detected by exposing the sections at room temperature in the dark for 20 min to TSA Plus Cy3 reagent (Perkin Elmer) diluted 1:100 in TSA working solution, after which the sections were washed three times in TNT buffer. Before the immunological detection of the second probe, the peroxidases for detecting the first probe were inactivated by treating the sections for 30 min with 3% H O , followed by three washes in PBS. After an additional blocking step in blocking buffer for 1 h at room temperature, the anti-fluorescein-POD antibody (Roche) was applied at a concentration of 1:1000 in blocking buffer overnight at 4 °C. Following three washes in buffer B1 and an additional wash in buffer TNT, the probes of the subtype markers were detected by exposing the sections at room temperature in the dark for 15 min to TSA Plus Cy5 reagent (Perkin Elmer) diluted 1:100 in TSA working solution, after which the sections were washed three times in TNT buffer. Finally, the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole, Molecular Probes) and mounted using Fluoromount-G (Southern Biotech). In each experiment, controls for hybridization specificity were included (sense probe for Igf1) as well as controls for ensuring the specificity of the immunological detection of the digoxigenin- and fluorescein-labelled riboprobes. FISH for Crh, Prok2 and Fbln2 was done using the RNAscope system (Advanced Cell Diagnostic); this was necessary since no reliable signal could be detected with the method described above for Igf1 FISH using DIG-labelled riboprobes. RNAscope probes for all genes were synthesized by ACD and all experiments were done according to the ACD’s protocol for fresh frozen brain sections. For quantifying of the expression pattern of all genes of interest (GOI, that is, Igf1, Crh and Prok2; Fbln2 could not be detected reliably), the visual cortices in each section were imaged on a Zeiss Axio Imager microscope with a 10× objective and 3 × 5 fields-of-view were ‘stitched’ into one compound image; in all cases, image exposures were kept constant throughout a given experiment for each channel. Compound images of each visual cortex were then imported to Photoshop, and additional layers were created for each probe (that is, one layer for the GOI and one layer for the subtype marker in each compound image). The cells positive for each probe were then marked with a dot in the new respective layer by two independent investigators in a blinded manner (one investigator marking GOI-positive cells and the other investigator marking subtype-marker-positive cells). Finally, the layers containing the dots of the identified positive cells were compiled into a separate image file together with the DAPI-layer and imported into ImageJ. In ImageJ, the images were analysed in a blinded manner by defining the visual cortex and its layers as regions of interest (ROI) based on the DAPI staining and quantifying the number of cells positive for either one or both markers per ROI. For each combination of probes (GOI together with each of the subtype markers), two visual cortices from four animals were analysed (a total of eight visual cortices for each combination). Concentrated lentiviral stocks were prepared and titrated essentially as described30. AAV stocks were prepared at the University of North Carolina (UNC) Vector Core and at the Children’s Hospital Boston Vector Core; see also Supplementary Table 8 for further details on AAV stocks. Primary cultures of cortical neurons were prepared from E16.5 mouse embryos as described6. In brief, 3 × 105 neurons per well were plated in 24-well dishes coated with poly-d-lysine (20 μg ml−1) and laminin (3.4 μg ml−1). Cultures were maintained in neurobasal medium supplemented with B27 (Invitrogen), 1 mM l-glutamine, and 100 U ml−1 penicillin/streptomycin, and one-third of the media in each well was replaced every other day. For testing of viral shRNA constructs, the cultures were infected at DIV 3 with concentrated viral stocks for 5 h at an MOI of 6. After infection, the cultures were washed twice in plain neurobasal medium after which the conditioned medium was returned to the dish and the cultures were continued to be maintained as described. At DIV 7, neuronal cultures were treated overnight with 1 μM TTX and 100 μM AP-5 to silence spontaneous activity before the cultures were depolarized at DIV 8 with 55 mM extracellular KCl as described6 and lysed in TRIzol after 6 h of stimulation. HEK293T cells were used for testing the expression and the biological activity of the epitope-tagged IGF1.4 constructs. HEK293T cells were cultured in DMEM (Life Sciences) containing 10% FCS and penicillin/streptomycin. Cells were transfected using lipofectamine (Life Technologies) and 18 h post transfection, the medium was replaced with DMEM containing 0.1% FCS; 42 h post transfection, the conditioned media were collected, spun down to remove cell debris and used immediately for stimulating non-transfected HEK293T that were serum starved for 3 days in DMEM containing 0.1% FCS. The conditioned media were applied to the serum starved cells for 15 min at 37 °C after which the cells were lysed in boiling SDS sample buffer and subjected to Western blot analysis essentially as described6, 31. For detecting the (phosphorylated) IGF1-receptor, the following antibodies were used: anti-IGF1-receptor-β (D23H3) XP Rabbit mAb (#9750, Cell Signaling, 1:1000) and anti-phospho-IGF1-receptor-β (Tyr1135/1136)/Insulin Receptor β (Tyr1150/1151) (19H7) Rabbit mAb (#3024, Cell Signaling, 1:1000). For determining serum IGF1 levels, we used the IGF1 Quantikine ELISA kit (R&D Systems), following the manufacturer’s instructions (P3 Vip-cre heterozygous pups were injected intracortically with the respective AAV and bled at P20). Mice were anaesthetized with 10% ketamine and 1% xylazine in PBS by intraperitoneal injection. When fully anaesthetized, the animals were transcardially perfused with ice-cold PBS for 5 minutes followed by 15 minutes of cold 4% PFA in PBS. Brains were dissected and post-fixed for one hour at 4 °C in 4% PFA, followed by three washes (each for 30 min) in cold PBS, and cryoprotection overnight in 20% sucrose in PBS at 4 °C. The following day, brains were placed in Tissue-Tek Cryo-OCT compound (Fisher Scientific), frozen on dry ice and stored at −80 °C. Coronal sections (20 μm thick) of the visual cortices were subsequently cut using a Leica CM1950 cryostat and used for subsequent experiments. For immunolabelling, the slides were blocked for 1 h with PBS containing 5% normal goat serum and 0.1% Triton X-100 (blocking solution). The samples were incubated overnight with different primary antibodies diluted in blocking solution, washed three times with PBS and then incubated for 45 min at room temperature with secondary antibodies and/or Hoechst stain (ThermoFisher Scientific). Slides were mounted in FluoromountG (Southern Biotech) and imaged on a Zeiss Axio Imager microscope. The following antibodies were used: mouse anti-HA (HA-7, Sigma; 1:1000), chicken anti-GFP (GFP-1020, Aves labs ; 1:1500), goat anti-mouse IgG (H+L) Alexa Fluor 488 (Highly Cross-Adsorbed, Life Technologies; 1:1,000), goat anti-chicken IgY (H+L) Alexa Fluor 488 (Life Technologies; 1:1,000). For analysing the brains of Igf1 Vip-cre WT and cKO mice, brains of three-week-old WT and cKO littermates were placed on the same slide to minimize variation. After cryosectioning, the slides were either counterstained immediately or stored at −20 °C before they were counterstained and imaged. Counterstaining was done with DAPI (4′,6-diamidino-2-phenylindole, Molecular Probes) in PBS for 15–30 min at room temperature, after which the sections were washed once in PBS and mounted in Fluoromount-G (SouthernBiotech). For cell counting experiments, coronal visual cortex sections were imaged using a Zeiss Axio Imager microscope with a 10× objective and typically, 3 × 5 fields-of-view were ‘stitched’ into one compound image. In all cases, image exposures were kept constant throughout a given experiment for each channel. Custom ImageJ and MATLAB macros were used to quantify the area of each cortical layer, the number tdTomato-positive cells per layer, and the size of tdTomato-postive cells. Briefly, regions of interest (ROI) encompassing the visual cortex and its layers were defined based on the DAPI counterstaining. While the width of these ROIs was kept constant throughout the analysis of all sections, the height of the ROIs was adjusted in each image according to the DAPI counterstaining in each section and the areas of each layer in each section were recorded. For analysing the number and soma size of tdTomato-postive cells in each layer, a threshold for each channel was determined based on multiple user-defined negative regions. Channels were thresholded and binarized, and a mask of each channel was created. The number of tdTomato- positive cells was determined by taking the logical AND of the DAPI and tdTomato channel masks and counting the number of components greater than 4 pixels in size in the double overlap of the masks of the two channels in each layer ROI. The soma size was calculated as the area of these double-overlapping components. Three animals per genotype and 4–6 visual cortex sections per animal were analysed, and these data were used to determine the mean and s.e.m. of the values reported for each genotype. All surgeries were performed according to protocols approved by the Harvard University Standing Committee on Animal Care and were in accordance with federal guidelines. Surgeries were performed on mice between P14 and P15. Animals were deeply anaesthetized by inhalation of isoflurane (initially 3–5% in O , maintained with 1–2%) and secured in the stereotaxic apparatus (Kopf). Animal temperature was maintained at 37 °C. The fur was shaved and scalp cleaned with betadine and 100% ethanol three times before an incision was made to expose the skull. Injections into the visual cortex were made by drilling a ~0.5 mm burr hole (approximately 2.7 mm lateral, 0.5 mm anterior to lambda) through the skull, inserting a glass pipette to a depth of 200–400 μm and injecting 250 nl of the respective AAV construct at a rate of 100 nl min−1. Five minutes post-injection, the glass pipette was retracted, the scalp sutured and the mouse returned to its home cage. All animals were monitored for at least one hour post-surgery and at 12 h intervals for the next 5 days. Post-operatively, analgesic (flunixin, 2.5 mg per kg) was administered at 12 h intervals for 72 h. For neonatal injections, pups post-natal day 3–5 were anaesthetized on ice for 2–3 min, and secured to a stage where their head was supported using a clay mould using standard lab tape. A bevelled glass pipette was lowered into visual cortex (approximately 2 mm lateral, 0.2 mm anterior to lambda), and 50 nl of the respective AAV virus was injected at a rate of 23 nl sec−1. Injections were made into eight sites (four on each hemisphere), and the mouse was then allowed to recover on a 37 °C warm plate before being returned to the home cage. For bilateral stereotaxic intra-cortical injections of AAV constructs for visual plasticity experiments, surgeries were performed on mice between P18 and P20. Animals were anaesthetized with isofluorane gas (1–2% in O ), and body temperature was maintained at around 37 °C with a heating pad during surgery. The head was held in place by standard mouse stereotaxic frame. The fur was shaved and scalp cleaned with betadine and 100% ethanol three times before an incision was made to expose the skull. Burr holes were drilled into the skull at the point of injection guided by stereotaxic coordinates and blood vessel patterns (approximately 2 mm and 2.7 mm lateral, 0.5 mm anterior to lamba) on both hemispheres. A 28-gauge Hamilton syringe (701RN) was inserted to a depth of 200–300 μm and 250 nl of the respective AAV construct was injected at the rate of 50 ml min−1. Five minutes post-injection, the Hamilton syringe was retracted, the scalp sutured and the mouse returned to its home cage. All animals were monitored for at least one hour post-surgery. Post-operatively, analgesic (meloxicam, 5–10 mg kg−1) was administered every 24 h for 2 days. Coronal sections (300 μm thick) containing the primary visual cortex were cut from P19-P21 mice using a Leica VT1000S vibratome in ice-cold choline dissection media (25 mM NaHCO , 1.25 mM NaH PO , 2.5 mM KCl, 7 mM MgCl , 25 mM glucose, 0.5 mM CaCl , 110 mM choline chloride, 11.6 mM ascorbic acid, 3.1 mM pyruvic acid). Slices were incubated in artificial cerebral spinal fluid (ACSF, contains 127 mM NaCl, 25 mM NaHCO , 1.25 mM NaH PO , 2.5 mM KCl, 2.5 mM CaCl , 1 mM MgCl , 25 mM glucose) at 32 °C for 30 min immediately after cutting, and subsequently at room temperature. All solutions were saturated with 95% O /5% CO , and slices were used within 6 h of preparation. Whole-cell voltage-clamp recordings were performed in ACSF at room temperature from neurons in primary visual cortex that were identified under fluorescent and DIC optics. Recording pipettes were pulled from borosilicate glass capillary tubing with filaments using a P-1000 micropipette puller (Sutter Instruments) and yielded tips of 2–5.5 MΩ resistance. All experiments were recorded with pipettes filled with 135 mM caesium methanesulfonate, 15 mM HEPES, 0.5 mM EGTA, 5 mM TEA-Cl, 1 mM MgCl , 0.16 mM CaCl , 2 mM Mg-ATP, 0.3 mM Na-GTP, 10 mM phosphocreatine (Tris), and 2 mM QX-314-Cl. Osmolarity and pH were adjusted to 310 mOsm and 7.3 with Millipore water and CsOH, respectively. Recordings were sampled at 20 kHz and filtered at 2 kHz. mEPSCs were isolated by holding neurons at −70 mV and exposing them to 0.5 μM tetrodotoxin, 50 μM picrotoxin and 25 μM cyclothiazide and were blocked by application of 25 μM NBQX and 50 μM CPP. mIPSCs were isolated by holding neurons at 0 mV and exposing them to 0.5 μM tetrodotoxin, 25 μM NBQX, and 50 μM CPP and were blocked by 50 μM picrotoxin. Data were acquired using either Clampex10 or custom MATLAB software, using either an Axopatch 200B or Multiclamp 700B amplifier, and digitized with a DigiData 1440 data acquisition board (Axon Instruments) or a PCIe-6323 (National Instruments). For measuring miniature postsynaptic currents (minis), cells were allowed to stabilize for at least two minutes. For paired pulse experiments, no drugs were used in the ACSF. A stimulating electrode (ISO-Flex, A.M.P.I.) was positioned approximately 100 μm below the cell, and 0.1 ms electrical pulses were given while adjusting the stimulus intensity and electrode position until the first pulse was between 100 and 500 pA. Inter-stimulus interval was varied and 10 s elapsed between each sweep. Pulse amplitudes were obtained from average sweeps of at least ten trials. Cells were held at 0 mV to record IPSCs and −70 mV to record EPSCs. For evoked IPSCs, no drugs were used in the ACSF. Simultaneous paired whole-cell recordings were obtained from an eGFP-expressing VIP neuron and a morphologically identified pyramidal neuron located not more than five cell bodies away from the VIP neuron. Both cells were held at 0 mV, and a 5 ms light pulse from a blue LED (Thorlabs) was used to evoke IPSCs. Light intensity and the objective position were varied until the VIP neuron IPSC amplitude was between 200 and 500 pA. Average light power at 470 nm varied from between 0.3 and 0.7 mW over the course of the experiment. Reported ratios were obtained by dividing IPSC amplitudes obtained from an average trace of at least ten trials. For electrophysiology experiments, n was set to min n = 10 to detect 20% effect size with power 0.95. For experiments to determine average firing rate of VIP neurons, a modified ACSF that promotes increased action potential firing was used containing, 3.5 mM KCl and 0.8 mM CaCl . Cell-attached patch recordings were obtained from eGFP-positive cells. Cells that did not fire an action potential in the first 30 s of recording were discarded, and recordings were maintained for at least 30 ten-second sweeps. Average firing rate was determined from the first sweep to the last recorded sweep in which an action potential occurred. Miniature IPSC and EPSC data were analysed using Axograph X. Events were identified using a variable amplitude template-based strategy. Templates for each event type were defined as follows: mEPSC: 0.25 ms rise time, 3 ms decay τ, amplitude threshold of −3 × s.d. local noise; mIPSC: 1 ms rise time, 50 ms decay τ, amplitude threshold of 2.5 × s.d. local noise. Local noise was determined by calculating the standard deviation of the current in a 5 ms window before event rise onset. Templates lengths extended 25 ms after rise onset in the case of mEPSCs and 50 ms after rise onset in the case of mIPSCs. Events were discarded if they had a rise time outside the range of 0–3 ms. Statistical significance for all recorded parameters between genotypes was evaluated using a Mann–Whitney U-test on the mean values from individual neurons in a given experiment. Minis were additionally evaluated for significance using both a Kolmogorov–Smirnov test (KS test) and Monte Carlo test. For these tests, 50 random minis were sampled from each neuron in each condition to obtain a continuous distribution for each condition that equally weighted each cell in that condition: these distributions are the data shown in the cumulative distribution graphs. One hundred random events were randomly sampled from these distributions for a KS test; and for Monte Carlo tests, 100 random events were randomly sampled from each distribution 1,000 times (with replacement), and the means were compared. All significant differences in mini amplitude and frequency were found to be significant by Monte Carlo test, KS test, and Mann–Whitney U-test of cell means. Since the Mann–Whitney test was found to be the most stringent test, the P values from Mann–Whitney tests are reported. All data was analysed blind to genotype or experimental condition. In all conditions, series resistance, holding potential, cell capacitance, and input resistance were recorded and were not found to be significantly different except where noted. Statistical tests were performed using Graphpad Prism and MATLAB. VIP neurons were filled with a patch pipette containing 1% Alexa 647 Hydrazide and the internal solution was allowed to dialyze for at least 30 min before slices were fixed in 4% paraformaldehyde for 1 h at room temperature. Slices were then washed three times for 30 min in PBS before slices were mounted in Fluormount-G (Southern Biotech). Images were acquired using a Zeiss Axio Imager microscope with a 20× objective with the use of an Apotome (Zeiss). Neurons were reconstructed using NeuronJ (ImageJ), and Sholl analysis was performed using a custom script in MATLAB. Eyelids were trimmed and sutured under isoflurane anaesthesia (1–2% in O ) as previously described31. The integrity of the suture was checked daily and mice were used only if the eyelids remained closed throughout the duration of the deprivation period. One eye was closed for 4 days starting between P26 to P28. The eyelids were reopened immediately before recording, and the pupil was checked for clarity. VEPs were recorded from anaesthetized mice (50 mg kg−1 Nembutal and 0.12 mg chlorprothixene) using standard techniques described previously32. The contra- and the ipsilateral eye of the mouse were presented with horizontal black and white sinusoidal bars that alternated contrast (100%) at 2 Hz. A tungsten electrode was inserted into the binocular visual cortex at 2.8 mm from the midline where the visual receptive field was approximately 20° from the vertical meridian. VEPs were recorded by filtering the signal from 0.1–100 Hz and amplifying 10,000 times. VEPs were measured at the cortical depth where the largest amplitude signal was obtained in response to a 0.05 c.p.d. stimulus (400–600 μm); 3–4 repetitions of 20 trials each were averaged in synchrony with the abrupt contrast reversal. The signal was baseline corrected to the mean voltage of the first 50 ms post-stimulus-onset. VEP amplitude was calculated by finding the minimum voltage (negative peak) within a 50–150 ms post-stimulus-onset time window. Acuity was calculated only from the deprived eye. For each different spatial frequency, 3–4 repetitions of 20 trials each were averaged in synchrony with the abrupt contrast reversal. VEP amplitude was plotted against the log of the different spatial frequency, and the threshold of visual acuity was determined by linear extrapolation to 0 μV. Igf1 conditional knockout mice15, Ai9 tdTomato reporter mice33, Emx1-cre34, Pv-cre35, Gad2-cre, Sst-cre, Vip-cre36 and RiboTag mice8 are available from The Jackson Laboratory. For routine experimentation, animals were genotyped using a PCR-based strategy; PCR primer sequences are available at the The Jackson Laboratory’s website. For RiboTag experiments, mice homozygous for the RiboTag allele were crossed to mice homozygous for the cre allele and all experiments were performed with mice double heterozygous for both the RiboTag and the cre alleles. For Igf1 cKO experiments, mice heterozygous for the Igf1 conditional allele (Igf1fl/WT) and homozygous for the Vip-cre allele were crossed to mice heterozygous for the Igf1 conditional allele and homozygous for the tdTomato reporter allele. Resulting littermates all had one copy of the Vip-cre transgene and the tdTomato Cre reporter and yielded Igf1WT/WT and Igf1fl/fl littermates for experimentation. For injections of AAV constructs in the visual cortices of Cre mice (Vip-, Pv-, Sst-, or Emx1-cre), mice homozygous for the cre allele were crossed to wild-type C57Bl6 mice and offspring heterozygous for the cre allele were used for experiments. The use of animals was approved by the Animal Care and Use Committee of Harvard Medical School and/or the University of California Berkeley.

Discover hidden collaborations