San Carlos, CA, United States
San Carlos, CA, United States

Time filter

Source Type

Plasmids containing the 9-kb mouse villin promoter (pBS-Villin)26, 27 and simian diphtheria toxin receptor (HBEGF (‘DTR’)) with the enhanced green fluorescent protein (pDTR–eGFP) fusion gene28 have been previously described. The pDTR–eGFP was PCR amplified with primers harbouring a 5′ BsiWI site and a 3′ MluI site and cloned into pBS-Villin. The pBS-Villin/DTR–eGFP plasmid was verified by sequencing and the transgene was isolated from the plasmid by restriction enzyme digestion and gel purification. The transgene was microinjected into fertilized eggs from C57BL/6J mice (Jackson Laboratory) and transferred into oviducts of ICR foster mothers as previously described26. Identification of the transgenic mice was performed by PCR amplification using the following primers: 5′-ACTGCTCTCACATGCCTTCT-3′ and 5′-CTTCTTCCCTAGTCCCTTGC-3′. For diphtheria toxin administration, mice were injected intraperitoneally with 2 or 10 ng g−1 diphtheria toxin (EMD Chemicals) and humanely killed 1–24 h later29. Control mice were injected with PBS. For dextran sulphate solution (DSS) (MP Biomedicals) studies, mice were supplemented with 3% DSS in the drinking water for five days. On day three, water bottles were refilled with 3% DSS solution and on day five, replaced with fresh drinking water. Mice were weighed and monitored daily for signs of distress, morbidity or mortality during the course of the experiment until they were killed on day 7. Both male and female mice ages 6–8 weeks were used for all studies. All experiments were approved by the institutional animal care and use committee and carried out in accordance with the ‘Guide for the Care and Use of Laboratory Animals’ (NIH publication 86–23, revised 1985). Before isolating professional phagocytes (‘phagocytes’), VDTR and VDTR negative littermate controls were intraperitoneally injected with PBS (vehicle) or diphtheria toxin (EMD Chemicals) at a low (2 ng g−1) or high (10 ng g−1) dose per body weight. Mice were then killed 1–24 h later and phagocytes were isolated from the SILP as previously described with some modifications30. In brief, the small intestine, including the duodenum, jejunum and ileum, was excised and Peyer’s patches removed. Next, the small intestine was opened longitudinally with surgical scissors and flushed with ice-cold PBS to remove the faecal content. Intestines were then cut into 0.5-cm pieces and transferred into 50-ml conical tubes containing 20 ml of PBS. Samples were then vigorously shaken for 30 s using the vortex genie (Scientific Industries) and passed over 100-μm nylon cell strainers (BD Falcon). Fresh PBS was added to the tissue samples and the shaking and filtering process was repeated a total of eight times. To isolate and remove the intestinal epithelial cell layer, samples were washed with 20 ml of warm PBS containing 3 mM EDTA and passed over cell strainers. This was repeated three times. Flow-through was kept as purified for IECs, whereas whole tissues were further processed to isolate dendritic cell and macrophage subsets. Next, samples were washed with ice-cold PBS followed by RPMI 1640 (Sigma) containing 5% FBS to remove the EDTA. Samples were then re-suspended with RPMI 1640 containing 5% FBS, 1 mg ml−1 collagenase D (Roche), and 1 mg ml−1 DNase I (Roche) and incubated in a 37 °C water bath for 60 min. Samples were shaken every 20 min during this time. At the completion of the incubation, samples were washed with FACS buffer to remove the collagenase and then passed through an 18-gauge needle followed by a 21-gauge needle to create a single-cell suspension. Phagocytes were then enriched from samples by using a 1.065 g ml−1 OptiPrep (Sigma) density gradient according to the manufacturer’s protocol. Following centrifugation, phagocytes were isolated from both low- and mid-density bands and finally re-suspended in FACS buffer for flow cytometric analyses. Mouse spleen was digested in parallel with small intestine samples and used for single-colour compensation controls. All samples were pretreated with Fc block for 10 min at 4 °C followed by fluorescently conjugated antibody labelling at 4 °C for 60 min. The following antibodies were used for these studies: Antibodies from BioLegend including Alexa Fluor 647- or 700-conjugated anti-CD11c (clone N418), PerCP/Cy5.5-conjugated anti-CD24 (clone M1/69), APC/Cy7-conjugated anti-CD45 (clone 30-F11), APC-conjugated anti-CD64 (clone X54-5/7.1), APC-conjugated anti-CD274 (clone 10F.9G2), PerCP/Cy5.5-conjugated anti-F4/80 (clone BM8), Alexa Fluor 700-conjugated anti-Ly-6c (clone HK1.4), and Phycoerythrin (PE) or Brilliant Violet 421-conjugated anti-MHCII I-A/I-E (clone M5/114.15.2); antibodies from eBioscience including FITC-conjugated anti-CD4 (clone RM4-5), PE/Cy7-conjugated anti-CD11b (clone M1/70) and PE-conjugated anti-CD103 (clone 2E7); and TxRed-conjugated anti-CD45 (clone 30-F11) from Invitrogen. Live/Dead Aqua (Life Technologies) was used to discriminate viable cells. Phagocytes isolated from the SILP were surface stained for: APC/Cy7-conjugated anti-CD45, Alexa Fluor 700-conjugated anti-CD11c, Brilliant Violet 421-conjugated anti-MHCII I-A/I-E, PE/Cy7-conjugated anti-CD11b, PE-conjugated anti-CD103, PerCP/Cy5.5-conjugated anti-CD24, and APC-conjugated anti-CD64. The identification of phagocytes from VDTR mice with IEC cargo was determined by the presence of eGFP and this gate was defined on the basis of C57BL/6J and VDTR− littermate controls that were eGFP−. Sample acquisition was performed using the LSRFortessa (BD Biosciences) and data analyses were performed using the FlowJo analytical software (Tree Star). To sort phagocytes with and without apoptotic IEC cargo, the following surface markers were used: APC/Cy7-conjugated anti-CD45, Alexa Fluor 700-conjugated anti-CD11c, Brilliant Violet 421-conjugated anti-MHCII I-A/I-E, PE/Cy7-conjugated anti-CD11b, PE-conjugated anti-CD103, PerCP/Cy5.5-conjugated anti-CD24, and APC-conjugated anti-CD64. The identification of phagocytes from VDTR mice with IEC cargo was determined by the presence of eGFP and this gate was defined on the basis of C57BL/6J and VDTR− littermate controls that were eGFP−. Sorted populations were live, CD45+MHCII+CD11c+ phagocytes that were either eGFP− or eGFP+ including (i) CD103+CD11b−CD24+CD64− (hereafter CD103), (ii) CD103+CD11b+ CD24−CD64+ (hereafter CD103 CD11b), and (iii) CD103−CD11b+CD24− CD64+ (hereafter CD11b) for a total of six populations. Owing to the four-sample sort-maximum of the instrument, the three eGFP+ populations were collected first and then fresh collection tubes were added for the three eGFP− populations. Cells were sorted directly into 0.5 ml TRIzol LS reagent (Life Technologies) for microarray processing (see below). Each sort was performed at 4 h following diphtheria toxin administration and consisted of 3–4 pooled VDTR mice. The following are the cell yield ranges for each subset: 1,000–5,000 eGFP+CD103+; 3,000–9,000 eGFP+CD103+CD11b+; 10,000–40,000 eGFP+CD11b+; 4,500–10,000 eGFP−CD103+; 40,000–80,000 eGFP−CD103+CD11b+; and 30,000–100,000 eGFP−CD11b+. FACS was conducted on the FACSAria IIu SORP (BD Biosciences). The following are the RNA yield ranges for each subset: 200–2,400 pg eGFP+CD103+; 200–3,000 pg eGFP+CD103+CD11b+; 600–3,000 pg eGFP+CD11b+; 200–4,600 pg eGFP−CD103+; 600–5000 pg eGFP−CD103+CD11b+; and 450–4,000 pg eGFP−CD11b+. The purity and identity of each subset was validated as indicated in Extended Data Fig. 5 and according to markers as previously reported31. For analysis of IEC engulfment by CD11c+ phagocytes, single-cell suspensions were prepared as described for flow cytometric analyses and acquired using the IS 100 Imaging flow cytometer (Amnis Corp). Phagocytes with eGFP+ cargo were identified as those that contained single nuclei and were CD45+, CD11c+ and MHCII+. Data were analysed using IDEAS software (Amnis Corp) and spectrally compensated using a compensation matrix generated from the following single-colour controls; FITC-conjugated CD4, PE-conjugated MHCII, Alexa Fluor647-conjugated CD11c, TxRed-conjugated CD45, and Hoechst stain. Total RNA was isolated from mouse small intestine using RNeasy mini-kit (Qiagen) and quantified by a spectrophotometer. Reverse transcription was performed with Superscript III (Invitrogen) and cDNA was synthesized using the Mastercycler ep (Eppendorf). Real-time quantitative RT–PCR was conducted in duplicate on a ViiA 7 Real-time PCR System (Life Technologies) using TaqMan quantitative PCR Master Mix at a concentration of 1× (Applied Biosystems) or SYBR Green Real-Time PCR Master Mixes for the eGFP and HBEGF (‘DTR’) transgenes. Samples were normalized to β-actin and relative expression was determined by 2-ΔΔC method. Forward (FW) and reverse (RV) primers for SYBR Green include: All probe sequences are in the format: 5′ FAM-sequence-BHQ-1 3′ and together with forward (FW) and reverse (RV) primer pairs were synthesized by Biosearch Technologies. 5′-AGCCACCCCCACTCCTAAGAGGAGG-3′ Actb probe, 5′-GAAGTCCCTCACCCTCCCAA-3′ Actb FW, 5′-GGCATGGACGCGACCA-3′ Actb RV; 5′-AAATCGGTGATCCAGGGATTGTTCCA-3′ Acadsb probe, 5′-CCTCTGGTTTCCTCTATGGATGA-3′, Acadsb FW, 5′-TCCCTCCATATTGTGCTTCAAC-3′ Acadsb RV; 5′-CGGGACAGGGCAACTCTTGCAA-3′ Aldh1a2 probe, 5′-GCTTGCAGACTTGGTGGAA-3′ Aldh1a2 FW, 5′-GCTTGCAGGAATGGCTTACC-3′ Aldh1a2 RV; 5′-CCCACTTTCCTTGTGGTACTCTGGAC-3′ Alox5ap probe, 5′-CAACCAGAACTGCGTAGATGC-3′ Alox5ap FW, 5′-GAAGGCGGCAGGGACTTG-3′ Alox5ap RV; 5′-TGCCTTTAGTGGCCTCATTGTTCC-3′ Atrn probe, 5′-GGACTCAATCTACGCACCTCTGAT-3′ Atrn FW, 5′-GCCGTCTCATTGCCATCTCTT-3′ Atrn RV; 5′-TTGGCATCAATCTGAGCTGTTGGTG-3′ Axl probe, 5′-GCCCATCAACTTCGGAAGAAAG-3′ Axl FW, 5′-CCTCTGGCACCTGTGATATTCC-3′ Axl RV; 5′-AGTGAAGGAGTTCTTCTGGACCTCAA-3′ Ccl22 probe, 5′-CACCCTCTGCCATCACGTT-3′ Ccl22 FW, 5′-ATCTCGGTTCTTGACGGTTATCA-3′ Ccl22 RV; 5′-CCACTGCTCATGGATATGTTGAACAATAGAGACC-3′ Ccr2 probe, 5′-AGGGTCACAGGATTAGGAAGGTT-3′ Ccr2 FW, 5′-CGTTCTGGGCACCTGATTTAA-3′ Ccr2 RV; 5′-CAGTGCCCAAGTGGAGGCCTTGATC-3′ Ccr7 probe, 5′-CACGCTGAGATGCTCACTGG-3′ Ccr7 FW, 5′-ATCTGGGCCACTTGGATGG-3′ Ccr7 RV; 5′-AGATTCGCTGTCACCAGCACAGACA-3′ Cd40 probe, 5′-TCTCAGCCCAGTGGAACA-3′ Cd40 FW, 5′-CGGTGCCCTCCTTCTTAACC-3′ Cd40 RV; 5′-CGAATCACGCTGAAAGTCAATGCCC-3′ Cd274 probe, 5′-CGGTGGTGCGGACTACAAG-3′ Cd274 FW, 5′-CCCTCGGCCTGACATATTAGTTC-3′ Cd274 RV; 5′-TTCCCAGGGCTTGAGGCTCCC-3′ Cd300a probe, 5′-GGCCACCGTGAACATGACTA-3′ Cd300a FW, 5′-GCAGGAGAGCTAACACAGACAAC-3′ Cd300a RV; 5′-ATGGAAAATGGGTGGCGTCTAACCCA-3′ Cfh probe, 5′-CCGAACACTTGGCACTATTGTAA-3′ Cfh FW, 5′-CTCCGGGATGCCCACAAG-3′ Cfh RV; 5′-CCCTGAACAACCAACAGATGACACTGG-3′ Elf3 probe, 5′-GGCACTGAAGACTTGGTGTTG-3′ Elf3 FW, 5′-CCCTGAACAACCAACAGATGACACTGG-3′ Elf3 RV; 5′-AGCTGACAGATACACTCCAAGCGGA-3′ Fos probe, 5′-AGTGCCGGAATCGGAGGA-3′ Fos FW, 5′-TGCAACGCAGACTTCTCATC-3′ Fos RV; 5′-CTGCTCCTGCTGGCTTCCGAGT-3′ Gas6 probe, 5′-CTGGGCACTGCGCTTCTG-3′ Gas6 FW, 5′-CGCAACAGCACAGTGTGA-3′ Gas6 RV; 5′-TCTTATGCAGACTGTGTCCTGGCA-3′ Ido1 probe, 5′-GGGCCTGCCTCCTATTCTG-3′ Ido1 FW, 5′-CCCACCAGGAAATGAGAACAGA-3′ Ido1 RV; 5′-TCACAAGCAGAGCACAAGCCTGTC-3′ Il1b probe, 5′-AAAGACGGCACACCCACCCTGC-3′ Il1b FW, 5′-TGTCCTGACCACTGTTGTTTCCCAG-3′ Il1b RV; 5′-TCTGCAAGAGACTTCCATCCAGTTGCCT-3′ Il6 probe, 5′-CCAGAAACCGCTATGAAGTTCC-3′ Il6 FW, 5′-TCACCAGCATCAGTCCCAAG-3′ Il6 RV; 5′-TTCAAACAAAGGACCAGCTGGACA-3′ Il10 probe, 5′-TCAGCCAGGTGAAGACTTTC-3′ Il10 FW, 5′-GGCAACCCAAGTAACCCTTA-3′ Il10 RV; 5′-TAACTGGGATCCAGGCACGCC-3′ Ly75 probe, 5′-GTCAGACTTCAGGCCACTCAA-3′ Ly75 FW, 5′-TGACCCACCAATCACAGGT-3′ Ly75 RV; 5′-TCCCTTACTTTATTAAGCAGCCTGAGAGTG-3′ Mertk probe, 5′-TGATCCCATATACGTGGAAGTTCA-3′ Mertk FW, 5′-CCTGGCAGGTGAGGTTGAAG-3′ Mertk RV; 5′-TTTGCGTCTGACTGCCGAGACTC-3′ Muc2 probe, 5′-CCTGGCCTCTGTGATTACAAC-3′ Muc2 FW, 5′-GGTGCACAGCAAATTCCTTGTAG-3′ Muc2 RV; 5′-TCGCAACCAGATCGGAGATGTGG-3′ Nlrc5 probe, 5′-CCAGAACTCAGGAAATTTGACTTGA-3′ Nlrc5 FW, 5′-TTTGGCAAGATGGCAGCTAA-3′ Nlrc5 RV; 5′-CTGCTGCCTCACTTCTAGCTTCTGC-3′ Nlrp3 probe, 5′-GTTGCCTGTTCTTCCAGACT-3′ Nlrp3 FW, 5′-GGCTCCGGTTGGTGCTTAG-3′ Nlrp3 RV; 5′-TAGGCTGCTTTGGGAATGGCACC-3′ Oasl1 probe, 5′-CGCGTGCTCAAGGTACTCAAG-3′ Oasl1 FW, 5′-GACCAGCTCCACGTCTGTAG-3′ Oasl1 RV; 5′-TTGTGATGACTACATGGTCACACTCTTC-3′ Plac8 probe, 5′-GAACCCGATACGGCATTCCT-3′ Plac8 FW, 5′-TCTTGCCATCCAGCTCCTTAG-3′ Plac8 RV; 5′-ACCAACACATCGGAGCTGCGGA-3′ Relb probe, 5′-GAGCCTGTCTACGACAAGAAGTC-3′ Relb FW, 5′-GCCCGCTCTCCTTGTTGATTC-3′ Relb RV; 5′-AGTTATGCACGAGTGCGAGCTGT-3′ Spred1 probe, 5′-CGGCGACTTCTGACAACGATA-3′ Spred1 FW, 5′-GGTAGCCATCCACCACTTGAG-3′ Spred1 RV; 5′-AGAGGTCACCCGCGTGCTAATGGTG-3′ Tgfb1 probe, 5′-CCCGAAGCGGACTACTATGC-3′ Tgfb1 FW, 5′-ATAGATGGCGTTGTTGCGGT-3′ Tgfb1 RV; 5′-CTCTGCCTGCATCCAATCACTCTCA-3′ Timd4 probe, 5′-GGTCCGCCTTCACTACAGAATC-3′ Timd4 FW, 5′-GGCCTGAGTACGGCTATGTC-3′ Timd4 RV; 5′-TGGGCTTTCCGAATTCACTGGAGC-3′ Tnf probe, 5′-ATGCACCACCATCAAGGACTCAA-3′ Tnf FW, 5′-ACCACTCTCCCTTTGCAGAACTC-3′ Tnf RV; 5′-TCAACTGGTGTCGTGAAGTCAGGA-3′ Tnfaip3 probe, 5′-TCCCTGGAAAGCCAGAAGAAG-3′ Tnfaip3 FW, 5′-GAGGCAGTTTCCATCACCATTG-3′ Tnfaip3 RV; 5′-TCCGGAGCTACTTCAAGCAAGGC-3′ Vil1 probe, 5′-GGCAACGAGAGCGAGACTT-3′ Vil1 FW, 5′-CGCTGGACATCACAGGAGTT-3′ Vil1 RW. A total of five sorting experiments with a pool of 3–4 mice were performed for the cDNA microarrays. Following cell sorting into TRIzol LS reagent, samples were shipped on dry ice to the Center for Functional Genomics and the Microarray & HT Sequencing Core Facility at the University at Albany (Rensselaer). A sample clean-up step was performed using RNeasy columns (Qiagen) that included DNase treatment. The isolated RNA was checked for quality using NanoDrop (Thermo Scientific) and Bioanalyzer (Agilent), following which 1 ng of total RNA was processed using WT-Ovation Pico RNA Amplification System (NuGEN). A total of three biological replicates were used for the microarray. When required, RNA was pooled from additional sorts to achieve the 1 ng of total RNA needed for the amplification system. The following are the sort experiments used for each sample: (2, 2 and 5, 2 and 5) eGFP+CD103+; (2, 3, 2 and 5) eGFP+CD103+CD11b+; (2, 4, 5) eGFP+CD11b+; (3, 2 and 4 and 5, 2 and 4 and 5) eGFP−CD103+; (2, 3, 4) eGFP−CD103+CD11b+; and (2, 3, 5) eGFP−CD11b+. RNA was reverse-transcribed and sense-target cDNAs were targeted using the standard NuGEN protocol and hybridized to Affymetrix mouse Gene 2.0 ST arrays. These arrays were then washed, stained on a FS 450 station, and scanned on a GeneChip 3000 7G scanner using Affymetric GeneChip Command Console Software (AGCC). The Affymetrix microarray data discussed in this publication have been deposited in NCBI’s Gene Expression Omnibus (GEO)32 and are accessible with the GEO series accession number GSE85682. Fold changes and statistical significance were identified as those genes that were differentially expressed between eGFP+ and eGFP− subsets by at least 1.2 fold (ANOVA (Benjamini–Hochberg false discovery rate correction Q < 0.05) and Tukey’s HSD post-hoc test (P < 0.05; -1.2> fold >1.2) and determined using R software (version 3.2.0). Hierarchical clustering of differentially expressed genes meeting the aforementioned criteria were Z-scored and plotted with heatmap.2 (gplots version 2.17.0, CRAN/R). Principal component analyses of the 1,534 genes (ANOVA (Benjamini–Hochberg false discovery rate correction Q < 0.05); 4.8% of total) with the most variable expression in each CD11c+ subset with and without eGFP cargo were generated using R software which are freely available online. Small and large intestine were dissected and fixed in 10% formalin (Fisher Scientific) for 24 h and then processed for paraffin embedding. Tissue blocks were then cut into 5-mm sections, de-paraffinized by xylene immersion, and hydrated by serial immersion in 100%, 90%, 80%, 70% ethanol and PBS. Antigen retrieval was performed by heating samples in a pressure cooker (Cuisinart) in citrate buffer solution (10 mM citric acid monohydrate, 0.05% Tween 20 and PBS). Sections were then washed twice in PBS, blocked for 30 min in blocking buffer (10% BSA, 0.3% Triton X-100 (Sigma) and TBS), and prepared for labelling. TdT-mediated dUTP nick end labelling (TUNEL) was performed using the in situ cell-death detection kit, TMR red (Roche), per the manufacturer’s instructions, stained with DAPI, and mounted using Fluoromount-G (Southern Biotech). For cleaved caspase-3 (Cell Signaling), samples were labelled for 60 min at room temperature, stained with DAPI, and mounted using Fluoromount-G. For paraffin images, eGFP signal was not present owing to sample quenching following paraffin embedding and processing. Small and large intestine were dissected and fixed overnight in 1.6% paraformaldehyde (Thermo Scientific) containing 20% sucrose at 4 °C. Samples were then placed in OCT (Tissue-Tek) and snap-frozen over dry ice. Tissue sections of 8-mm thickness were cut, air-dried and blocked using blocking solution. Tissues were then labelled using an Alexa Fluor 594-conjugated phalloidin (Invitrogen) or a primary mouse anti-mouse pan-cytokeratin antibody (clone PCK-26) (Abcam) for 60 min in a humidified atmosphere followed by a secondary goat anti-mouse Alexa Fluor 594 (Thermo Fisher Scientific) for 30 min, then stained with DAPI, and mounted using Fluoromount-G. For fluorescent in situ hybridization, small intestine and large intestine were dissected and prepared as described for frozen sections33. Following tissue blocking, sections were incubated with 0.45 pmol μl−1 eubacterial oligonucleotide probe (AminoC6 + Alexa Fluor 594) 5′-GCTGCCTCCCGTAGGAGT-3′; (Operon)33 in a pre-chilled hybridization buffer (Sigma) overnight at 4 °C. Sections were counterstained with DAPI and mounted with Fluoromount-G. To label small intestine tissues, the whole-mount histology protocol was modified from previously described methods34. In brief, small intestine samples were excised, opened longitudinally, and washed in ice-cold PBS. Samples were then cut to 1 cm in length and placed in 6-ml polypropylene tubes (BD Biosciences). Next, samples were incubated with Fc block at 10 μg ml−1 in 200 μl of 2% paraformaldehyde with 1% FBS, 0.3% Triton X-100 in PBS for 3 h at 4 °C with gentle rocking. After blocking and fixing, samples were put into new polypropylene tubes and labelled using 3 μg ml−1 of the following antibodies: PE-conjugated anti-CD11c (clone N418) (eBioscience), APC-conjugated anti-CD31 (clone 390) (eBioscience) and anti-cleaved caspase-3 at 1:100. All labelling was conducted in the dark at 4 °C with gentle rocking for 3 h. Finally, samples were washed for 30 min in the dark at 4 °C with fresh PBS and mounted for imaging. Conventional microscopy was performed using the Eclipse Ni-E motorized upright microscope (Nikon) and images were acquired from paraffin, frozen, and whole mount tissue sections using a Nikon DS-Qi1 Mc camera. Cell quantification was calculated using NIS Elements imaging software (Nikon) and the object count application including intensity of stain thresholds and area restriction filters. Confocal microscopy was performed at the Microscope CORE at the Icahn School of Medicine at Mount Sinai using the Leica SP5 DM upright microscope and Leica LAS AF software. Naive mouse splenic CD4+ T cells were isolated by sorting with MACS CD4+ beads (Miltenyi Biotech) according to the manufacturer’s instructions and then by FACS using the FACSAria IIu SORP. T cells were sorted on the basis of the following criteria: live, CD45+CD3+CD4+ CD25−CD44−/lowCD62L+/high. Surface antibodies for sorting included: APC/Cy7-conjugated anti-CD45, eFluor 450-conjugated anti-CD3 (clone 145-2c11), PE-conjugated anti-CD4, APC-conjugated anti-CD25 (clone PC61.5), FITC-conjugated CD62L (clone MEL-14), and Alexa 700-conjugated anti-CD44 (clone IM7) (all eBiosciences). 1 × 105 T cells were then cultured with 1 × 104 eGFP+ or eGFP− CD103 dendritic cells sorted from the MLN which were identified as: live, CD45+MHCIIhiCD11c+, eGFP+ or eGFP−, CD103+CD11b− using the aforementioned antibodies for flow cytometry. These cells were cultured in round-bottom 96-well plates (Falcon) with complete IMDM (Gibco) supplemented with 10% FBS, 100 μg ml−1 penicillin, 100 μg ml−1 streptomycin, 2 mM l-glutamine, 10 mM HEPES and 1 nM sodium pyruvate for 5 days. Additionally, all cultures were supplemented with 1 μg ml−1 of soluble anti-CD3 (clone 2C11) as well as 5 ng ml−1 of recombinant human anti-IL-2 (Pepro Tech) on days 2 and 4. A total of 2 ng ml−1 of recombinant human anti-TGFβ1 (clone 1D11 R&D systems) was added to culture wells where indicated on days 1 and 4. On day 5, cells were first surface stained with FITC-conjugated anti-CD25, PE/Cy7-conjugated anti-CD4, Alexa Fluor 700-conjugated anti-CD3, and APC/Cy7-conjugated anti-CD45, followed by fixation and permeabilization (using the concentrate and diluent provided by eBioscience), and finally intracellular staining for eFluor 450-conjugated anti-FOXP3 (clone FJK-16 s), PE-conjugated anti-RORγ(t) (clone B2D), PerCP-eFluor 710-conjugated anti-GATA-3 (clone TWAJ), and APC-conjugated anti-T-bet (clone eBio4B10) (all eBioscience). Data are presented as mean ± s.e.m. Statistical significances were determined by a one-way ANOVA with Dunnett’s and Newman–Keuls post-tests or unpaired two-tailed t-test with Welch correction where specified. ***P < 0.001, **P < 0.01, *P < 0.05. NS, not statistically significant (P > 0.05). No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. The Affymetrix microarray data have been deposited in the NCBI Gene Expression Omnibus (GEO) under GEO series accession number GSE85682.


No statistical methods were used to predetermine sample size. For calibrating the duration of the dark housing period before light exposure, C57Bl6 wild-type mice were housed in a standard light cycle until they were placed in constant darkness for varying amounts of time before analysis at postnatal day 56. At P56, all mice were either sacrificed in the dark (dark-housed condition) or light-exposed for 1, 3, or 7.5 h before being sacrificed. The eyes of all animals were enucleated (for the dark-housed condition, enucleation was performed in the dark) before dissection of the visual cortex in the light. For RiboTag-experiments, mice were reared in a standard light cycle and then housed in constant darkness for two weeks starting from P42; at P56, all mice were either sacrificed in the dark (dark-housed condition) or light-exposed for 1, 3, or 7.5 h before being sacrificed. Additional cohorts of mice for the ‘standard’ condition were housed in a standard light cycle until P56 when they were euthanized. The eyes of all animals were enucleated (for the dark-housed condition, enucleation was performed in the dark) before dissection of the visual cortex in the light. Total RNA was extracted with TRIzol reagent (Sigma) according to the manufacturer’s instructions, and RNA quality was assessed on a 2100 BioAnalyzer (Agilent); all RNAs were treated with DNaseI (Invitrogen) before reverse transcription. For the cloning of riboprobes, total RNA was extracted from whole adult C57Bl6 wild-type mouse brains and cDNA was prepared using SuperScript II kit (Life Technologies). For real-time quantitative PCR experiments aimed at calibrating the duration of the dark housing period, total RNA was extracted for each sample from the visual cortices of one animal. For real-time quantitative PCR experiments aimed at testing the efficacy of shRNA constructs directed against Igf1, total RNA was isolated from two pooled 24 wells of cultured cortical neurons for each condition. For qPCR experiments, RNA was reverse-transcribed with the High Capacity cDNA Reverse Transcription kit (Life Technologies). Real-time quantitative PCR reactions were performed on the LightCycler 480 system (Roche) with LightCycler 480 SYBR Green I Master. Reactions were run in duplicates, triplicates or quadruplicates, and β-actin (Actb) or β3-tubulin (Tubb3) levels were used as an endogenous control for normalization using the ΔΔC method24. Real-time PCR primers were designed using the Universal ProbeLibrary (Roche) as exon-spanning whenever possible and answered the following criteria: linear amplification over three orders of magnitude of target concentration, no amplification product in control samples that were not reverse-transcribed (that is, control for contamination with genomic DNA), no amplification product in control samples where no template was added (that is, control for primer dimers), amplification of one singular product as determined by melt-curve analysis and analysis of the product in agarose gel electrophoresis and sequencing of the PCR product. The qPCR primers used in this study are listed in Supplementary Table 6. For analysis of light-induced gene expression in wild-type mice, the gene expression levels were analysed in four mice (two males and two females) at each time point. The data were calculated as fold change relative to the average of the overnight dark-housed condition and normalized to the average of the maximally induced time point. Data in figures represent the mean and s.e.m. of four mice. For assessing Igf1 levels in cortical cultures infected with shRNA-expressing lentiviral constructs, qPCRs were performed in quadruplicates for each condition and fold changes were calculated relative to the non-infected non-stimulated cultures. Data were normalized to the maximally induced condition in each biological replicate, and data in figures represent the mean and s.e.m. of three biological replicates. Immunoprecipitation and purification of ribosome associated RNA was performed essentially as described6, 8, with minor modifications: lysis of the samples was performed in the presence 10 mM Ribonucleoside Vanadyl Complex (NEB, Ipswich, MA), and immunoprecipitation was performed with a different anti-HA antibody (HA-7, 12 μg per immunoprecipitation, Sigma). In brief, the visual cortices were dissected, flash frozen in liquid nitrogen and then kept at −80 °C until further processing. Visual cortices from three individual animals (each sample contained both male and female animals) were pooled for each biological replicate, and three biological replicates were performed. After lysis of the tissues and before immunopurification, a small fraction of lysate of each sample (that is, ‘input’) was set aside and total RNA was extracted with TRIzol reagent followed by the RNEasy Micro Kit’s procedure (Qiagen, Valencia, California). After immunopurification of the ribosome-associated RNAs, RNA quality was assessed on a 2100 BioAnalyzer (Agilent, Palo Alto, California) and RNA amounts were quantified using the Qubit 2.0 Fluorometer (Life Technologies). Only samples with RIN numbers above 8.0 were considered for analysis by qPCR and RNA-seq. For all RNA samples of sufficient integrity, 5–10 ng of RNA were SPIA-amplified with the Ovation RNA Amplification System V2 (NuGEN, San Carlos, California), yielding typically 5–8 μg of cDNA per sample. Quantitative RT–PCR was performed as described above and relative expression levels were determined in every experiment by normalizing the Ct-values to those of beta-Actin (ActB) from the 0 h input using the ΔΔC method24. To determine the fold-enrichment (IP/Input), the actin-normalized expression levels for every time point of every biological replicate were averaged, and the grand averages from the IP and Input were divided to find the IP/Input ratio. To calculate fold-induction for each biological replicate, each time point was divided by the maximal value occurring in that biological replicate, such that the maximal value was set to 1 in each biological replicate. The mean and standard error were calculated at each time point from these normalized values. All samples were analysed by qPCR for purity and light-induced gene expression before analysis by high throughput sequencing. SPIA-amplified samples from RiboTag-immunoprecipitated fractions for each of the five stimulus conditions and each of the five Cre lines were prepared as described above and processed in triplicate (75 samples total). For preparing sequencing libraries, 2 μg of each amplified cDNA were fragmented to a length of 200–400 bp using a Covaris S2 sonicator (Acoustic Wave Instruments) using the following parameters: duty cycle: 10%, intensity: 5, cycles per burst: 200, time: 60 s, total time: 5 min. After validating the fragment length of the sonicated cDNA using a 2100 BioAnalyzer (Agilent, Palo Alto, California), 2 μg of the fragmented cDNA were used for sequencing library preparation using the PrepX DNA kit on an Apollo 324 robot (IntegenX). The quality of completed sequencing libraries was assessed using a 2100 BioAnalyzer (Agilent, Palo Alto, California) and the completed libraries were sequenced on an Illumina HiSeq 2000 instrument, following the manufacturer’s standard protocols for single-end 50 bp sequencing with single index reads. Sequencing typically yielded 30–80 million usable non-strand-specific reads per IP sample. Reads were mapped to the mm9 genome using TopHat (v.2.0.13) and Bowtie (2.1.0.0)25. On average, ~70% of mapped IP reads were uniquely mapped to the mm9 genome allowing for 0 mismatches and were therefore assignable to genic features (one RiboTag-seq library (Sst-cre, standard-housing, biological replicate 2) was excluded from analysis due to low mappability). Values from all IP libraries were normalized using Cufform (v.2.2.1), and values from the Cuffnorm output file ‘genes-Count_Table’ (normalized reads) were taken as a proxy for gene expression. P values were generated for each Cre line for each dark–light conditions using Cuffdiff (v.2.2.1) using the time series (-T) flag based on three biological replicates. To identify transcripts regulated by visual experience, for each biological replicate of each Cre line, the fold change in normalized reads was calculated for each gene at every time point (dark-housed/standard-housed, 1 h light/dark-housed, 3 h light/dark-housed; 7.5 h light/dark-housed). Genes were flagged as experience-regulated in a given Cre line if they met the following conditions in at least one sample: (1) P value <0.005, (2) mean fold change of twofold or greater, (3) fold changes of 2 or higher in 2 of 3 biological replicates, (4) the mean expression value in at least one sample must be above absolute expression threshold (set at the 40th percentile of all observed values). To determine in which Cre lines genes were regulated by experience, genes were simply classified according to the above criteria. However, for this analysis we excluded the Gad2-cre line, since Pv-, Sst- and Vip-cre all label subsets of the neurons labelled by Gad2-cre. However, we did detect genes regulated solely in Gad2-cre, but no other Cre lines; we reasoned that these genes are probably regulated by experience in a population of 5HT3aR+/VIP− neurons that are contained in Gad2-cre but none of the other Cre lines. We classified the set of experience-regulated genes into categories ‘early’, ‘late’, and ‘long-term’ based on the fastest kinetics observed. When genes were found to be elevated and/or suppressed at multiple time points, we assigned them to the categories based on the most rapid observed change. For example, while Fos levels are elevated over dark housing at 1, 3 and 7.5 h of light exposure and suppressed after two weeks of dark housing, Fos is classified as ‘early-up’ because it is elevated at 1 h after light exposure. All linkage analysis was performed using the ‘single’ method and ‘Cityblock’ metric using Matlab’s linkage function. To determine the branch-order significance of the cladogram resulting from clustering of the 602 experience-regulated genes, we generated 1,000 cladograms from 602 sets of random expressed genes (including experience-regulated genes, with replacement) and asked how often we generated a cladogram with an identical branch order at the level of the Cre lines. Only 11 sets of 1,000 random genes sets generated an identical tree. For the purposes of this analysis, we only compared the branches above the level of the individual Cre line. To identify cell-type-enriched transcripts, an enrichment score was calculated for every transcript in every Cre line for each biological replicate. This enrichment score was calculated by dividing the maximum expression value observed in a given Cre line by the maximum expression value observed across all conditions for all other Cre lines (GABAergic subtypes were not required to be enriched above Gad2-cre). The enrichment scores for a set of known cell-type-specific genes were evaluated (Vglut1, Tbr1, Pvalb, Sst, Vip), and our threshold was set at the enrichment score of the cell-type-specific gene with the lowest score (Slc17a7/Vglut1, at 5.5-fold-enriched in Emx1-cre). Transcripts were considered to be expressed in a cell-type-specific manner (or ‘highly enriched’) in a given Cre line if their mean enrichment score was above this threshold and if the enrichment score exceeded this threshold in 2 out of 3 biological replicates. Cloning of all constructs was done using standard cloning techniques, and the integrity of all cloned constructs was validated by DNA sequencing. Templates for the riboprobes for Igf1, Gad1, Pvalb, Sst and Vip were prepared by PCR-amplification of cDNA fragments generated from total RNA isolated from adult C57Bl6 mouse brains (see Supplementary Table 7 for primer sequences) and cloning of the respective PCR fragments into the pBlueScript II vector (Agilent Technologies). Lentiviral shRNA constructs were generated by cloning shRNA stem loop sequences against Igf1 (Igf1 shRNA 1: GGTGGATGCTCTTCAGTTC; Igf1 shRNA 2: TGAGGAGACTGGAGATGTA) and Luciferase (Luc, control: ACTTACGCTGAGTACTTCG) into a modified version of pLentiLox3.726 in which the CMV promoter driving the expression of eGFP was replaced with an hUbc promoter and in which the loxP sites surrounding the hUbc-eGFP cassette were removed. The loop sequence used in these shRNA constructs is based on miR-25 (CCTCTCAACACTGG)27. shRNA-expressing AAV-constructs (pAAV-U6-shRNA-hUbc-Flex-eGFP) were made by first replacing the Flex-GFP-Gephyrin cassette in pAAV-Flex-GFP-Gephyrin22 with a Flex-eGFP cassette (resulting in pAAV-hUbc-Flex-eGFP) and then transferring the U6-shRNA cassettes from the pLentiLox constructs to pAAV-hUbc-Flex-eGFP. AAV constructs for the Cre-conditional co-expression of epitope-tagged IGF1.4 and eGFP or of eGFP alone were cloned by synthesizing the gBlocks (Integrated DNA Technologies) and using the gBlocks as templates for PCR amplification; the respective PCR products were then cloned into the pAAV-hUbc-Flex-eGFP (see above) by replacing the EGFP with the respective insert. This strategy yielded plasmids termed pAAV-hUbc-Flex-SSHA-IGF1.4-Myc-F2A-eGFP and pAAV-hUbc-Flex-F2A-eGFP, whereby the Cre-dependent inserts were driven by a human ubiquitin promoter (hUbc). The sequence for Igf1.4 was based on NM_001111275 (base pairs 277–752) and was modified in the following way: an HA epitope (TATCCtTATGATGTTCCAGATTATGCT) was inserted in frame between the Igf1.4 signal sequence and the beginning of the coding sequencing (cds) of Igf1.4, Igf1.4 was rendered resistant to the shRNA against Igf1 by introducing silent mutations into the target sequences specified above (sh1: TGTTGACGCGCTCCAATTT; sh2: TACGCCGGTTAGAAATGTA) and the followings tags were inserted in frame 3′ to the Igf1.4 coding sequencing: Myc epitope (GAACAAAAACTCATCTCAGAAGAGGATCTG), Furin cleavage site (CGGGCCAAGCGG) and a 2A peptide (GGCAGTGGAGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT). The sequence for eGFP was based of the published sequence of eGFP. For pAAV-hUbc-Flex-F2A-eGFP a gBlock was synthesized containing the Furin cleavage site followed by the 2A site and eGFP. Detailed sequences are available upon request. For double-fluorescent in situ hybridization (FISH), wild-type C57Bl6 mice were dark-housed and light-exposed for 7.5 h as described above. After light exposure, the brains were dissected and fresh frozen in Tissue-Tek Cryo-OCT compound (Fisher Scientific) on dry ice and stored at −80 °C until use. FISH for Igf1 was essentially done as described28, 29: riboprobes were prepared by in vitro transcription of linearized plasmids containing the template of the respective probe. Riboprobes for Igf1 were labelled with UTP-11-Digoxigenin, while the riboprobes for the subtype markers (Gad1, Pvalb, Sst, Vip) were labelled with UTP-12-Fluorescein (Roche); all riboprobes were hydrolyzed to lengths of 200–400 bp after synthesis and validated for labelling with Dioxigenin or Fluorescein. For in situ hybridization, coronal sections (20 μm thick) of the visual cortex were cut on a cryostat and fixed in 4% paraformaldehyde for 10 min. Endogenous peroxidases were inactivated by treating the sections for 15 min in 0.3% H O in PBS, and acetylation was performed as described. Pre-hybridization was done overnight at room temperature, and hybridization was performed under stringent conditions at 71.5 °C. Following hybridization, stringency washes in SSC were performed as described at 65 °C. For immunological detection of the first probe (Igf1), the tissue was first treated with a blocking step for 1 h in blocking buffer (B2) at room temperature before the anti-Digoxigenin-POD antibody (Roche) was applied at a concentration of 1:1000 in blocking buffer for 1 h at room temperature. Following three washes in buffer B1 and an additional wash in buffer TNT (0.1 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.05% Tween20), the Igf1 probe was detected by exposing the sections at room temperature in the dark for 20 min to TSA Plus Cy3 reagent (Perkin Elmer) diluted 1:100 in TSA working solution, after which the sections were washed three times in TNT buffer. Before the immunological detection of the second probe, the peroxidases for detecting the first probe were inactivated by treating the sections for 30 min with 3% H O , followed by three washes in PBS. After an additional blocking step in blocking buffer for 1 h at room temperature, the anti-fluorescein-POD antibody (Roche) was applied at a concentration of 1:1000 in blocking buffer overnight at 4 °C. Following three washes in buffer B1 and an additional wash in buffer TNT, the probes of the subtype markers were detected by exposing the sections at room temperature in the dark for 15 min to TSA Plus Cy5 reagent (Perkin Elmer) diluted 1:100 in TSA working solution, after which the sections were washed three times in TNT buffer. Finally, the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole, Molecular Probes) and mounted using Fluoromount-G (Southern Biotech). In each experiment, controls for hybridization specificity were included (sense probe for Igf1) as well as controls for ensuring the specificity of the immunological detection of the digoxigenin- and fluorescein-labelled riboprobes. FISH for Crh, Prok2 and Fbln2 was done using the RNAscope system (Advanced Cell Diagnostic); this was necessary since no reliable signal could be detected with the method described above for Igf1 FISH using DIG-labelled riboprobes. RNAscope probes for all genes were synthesized by ACD and all experiments were done according to the ACD’s protocol for fresh frozen brain sections. For quantifying of the expression pattern of all genes of interest (GOI, that is, Igf1, Crh and Prok2; Fbln2 could not be detected reliably), the visual cortices in each section were imaged on a Zeiss Axio Imager microscope with a 10× objective and 3 × 5 fields-of-view were ‘stitched’ into one compound image; in all cases, image exposures were kept constant throughout a given experiment for each channel. Compound images of each visual cortex were then imported to Photoshop, and additional layers were created for each probe (that is, one layer for the GOI and one layer for the subtype marker in each compound image). The cells positive for each probe were then marked with a dot in the new respective layer by two independent investigators in a blinded manner (one investigator marking GOI-positive cells and the other investigator marking subtype-marker-positive cells). Finally, the layers containing the dots of the identified positive cells were compiled into a separate image file together with the DAPI-layer and imported into ImageJ. In ImageJ, the images were analysed in a blinded manner by defining the visual cortex and its layers as regions of interest (ROI) based on the DAPI staining and quantifying the number of cells positive for either one or both markers per ROI. For each combination of probes (GOI together with each of the subtype markers), two visual cortices from four animals were analysed (a total of eight visual cortices for each combination). Concentrated lentiviral stocks were prepared and titrated essentially as described30. AAV stocks were prepared at the University of North Carolina (UNC) Vector Core and at the Children’s Hospital Boston Vector Core; see also Supplementary Table 8 for further details on AAV stocks. Primary cultures of cortical neurons were prepared from E16.5 mouse embryos as described6. In brief, 3 × 105 neurons per well were plated in 24-well dishes coated with poly-d-lysine (20 μg ml−1) and laminin (3.4 μg ml−1). Cultures were maintained in neurobasal medium supplemented with B27 (Invitrogen), 1 mM l-glutamine, and 100 U ml−1 penicillin/streptomycin, and one-third of the media in each well was replaced every other day. For testing of viral shRNA constructs, the cultures were infected at DIV 3 with concentrated viral stocks for 5 h at an MOI of 6. After infection, the cultures were washed twice in plain neurobasal medium after which the conditioned medium was returned to the dish and the cultures were continued to be maintained as described. At DIV 7, neuronal cultures were treated overnight with 1 μM TTX and 100 μM AP-5 to silence spontaneous activity before the cultures were depolarized at DIV 8 with 55 mM extracellular KCl as described6 and lysed in TRIzol after 6 h of stimulation. HEK293T cells were used for testing the expression and the biological activity of the epitope-tagged IGF1.4 constructs. HEK293T cells were cultured in DMEM (Life Sciences) containing 10% FCS and penicillin/streptomycin. Cells were transfected using lipofectamine (Life Technologies) and 18 h post transfection, the medium was replaced with DMEM containing 0.1% FCS; 42 h post transfection, the conditioned media were collected, spun down to remove cell debris and used immediately for stimulating non-transfected HEK293T that were serum starved for 3 days in DMEM containing 0.1% FCS. The conditioned media were applied to the serum starved cells for 15 min at 37 °C after which the cells were lysed in boiling SDS sample buffer and subjected to Western blot analysis essentially as described6, 31. For detecting the (phosphorylated) IGF1-receptor, the following antibodies were used: anti-IGF1-receptor-β (D23H3) XP Rabbit mAb (#9750, Cell Signaling, 1:1000) and anti-phospho-IGF1-receptor-β (Tyr1135/1136)/Insulin Receptor β (Tyr1150/1151) (19H7) Rabbit mAb (#3024, Cell Signaling, 1:1000). For determining serum IGF1 levels, we used the IGF1 Quantikine ELISA kit (R&D Systems), following the manufacturer’s instructions (P3 Vip-cre heterozygous pups were injected intracortically with the respective AAV and bled at P20). Mice were anaesthetized with 10% ketamine and 1% xylazine in PBS by intraperitoneal injection. When fully anaesthetized, the animals were transcardially perfused with ice-cold PBS for 5 minutes followed by 15 minutes of cold 4% PFA in PBS. Brains were dissected and post-fixed for one hour at 4 °C in 4% PFA, followed by three washes (each for 30 min) in cold PBS, and cryoprotection overnight in 20% sucrose in PBS at 4 °C. The following day, brains were placed in Tissue-Tek Cryo-OCT compound (Fisher Scientific), frozen on dry ice and stored at −80 °C. Coronal sections (20 μm thick) of the visual cortices were subsequently cut using a Leica CM1950 cryostat and used for subsequent experiments. For immunolabelling, the slides were blocked for 1 h with PBS containing 5% normal goat serum and 0.1% Triton X-100 (blocking solution). The samples were incubated overnight with different primary antibodies diluted in blocking solution, washed three times with PBS and then incubated for 45 min at room temperature with secondary antibodies and/or Hoechst stain (ThermoFisher Scientific). Slides were mounted in FluoromountG (Southern Biotech) and imaged on a Zeiss Axio Imager microscope. The following antibodies were used: mouse anti-HA (HA-7, Sigma; 1:1000), chicken anti-GFP (GFP-1020, Aves labs ; 1:1500), goat anti-mouse IgG (H+L) Alexa Fluor 488 (Highly Cross-Adsorbed, Life Technologies; 1:1,000), goat anti-chicken IgY (H+L) Alexa Fluor 488 (Life Technologies; 1:1,000). For analysing the brains of Igf1 Vip-cre WT and cKO mice, brains of three-week-old WT and cKO littermates were placed on the same slide to minimize variation. After cryosectioning, the slides were either counterstained immediately or stored at −20 °C before they were counterstained and imaged. Counterstaining was done with DAPI (4′,6-diamidino-2-phenylindole, Molecular Probes) in PBS for 15–30 min at room temperature, after which the sections were washed once in PBS and mounted in Fluoromount-G (SouthernBiotech). For cell counting experiments, coronal visual cortex sections were imaged using a Zeiss Axio Imager microscope with a 10× objective and typically, 3 × 5 fields-of-view were ‘stitched’ into one compound image. In all cases, image exposures were kept constant throughout a given experiment for each channel. Custom ImageJ and MATLAB macros were used to quantify the area of each cortical layer, the number tdTomato-positive cells per layer, and the size of tdTomato-postive cells. Briefly, regions of interest (ROI) encompassing the visual cortex and its layers were defined based on the DAPI counterstaining. While the width of these ROIs was kept constant throughout the analysis of all sections, the height of the ROIs was adjusted in each image according to the DAPI counterstaining in each section and the areas of each layer in each section were recorded. For analysing the number and soma size of tdTomato-postive cells in each layer, a threshold for each channel was determined based on multiple user-defined negative regions. Channels were thresholded and binarized, and a mask of each channel was created. The number of tdTomato- positive cells was determined by taking the logical AND of the DAPI and tdTomato channel masks and counting the number of components greater than 4 pixels in size in the double overlap of the masks of the two channels in each layer ROI. The soma size was calculated as the area of these double-overlapping components. Three animals per genotype and 4–6 visual cortex sections per animal were analysed, and these data were used to determine the mean and s.e.m. of the values reported for each genotype. All surgeries were performed according to protocols approved by the Harvard University Standing Committee on Animal Care and were in accordance with federal guidelines. Surgeries were performed on mice between P14 and P15. Animals were deeply anaesthetized by inhalation of isoflurane (initially 3–5% in O , maintained with 1–2%) and secured in the stereotaxic apparatus (Kopf). Animal temperature was maintained at 37 °C. The fur was shaved and scalp cleaned with betadine and 100% ethanol three times before an incision was made to expose the skull. Injections into the visual cortex were made by drilling a ~0.5 mm burr hole (approximately 2.7 mm lateral, 0.5 mm anterior to lambda) through the skull, inserting a glass pipette to a depth of 200–400 μm and injecting 250 nl of the respective AAV construct at a rate of 100 nl min−1. Five minutes post-injection, the glass pipette was retracted, the scalp sutured and the mouse returned to its home cage. All animals were monitored for at least one hour post-surgery and at 12 h intervals for the next 5 days. Post-operatively, analgesic (flunixin, 2.5 mg per kg) was administered at 12 h intervals for 72 h. For neonatal injections, pups post-natal day 3–5 were anaesthetized on ice for 2–3 min, and secured to a stage where their head was supported using a clay mould using standard lab tape. A bevelled glass pipette was lowered into visual cortex (approximately 2 mm lateral, 0.2 mm anterior to lambda), and 50 nl of the respective AAV virus was injected at a rate of 23 nl sec−1. Injections were made into eight sites (four on each hemisphere), and the mouse was then allowed to recover on a 37 °C warm plate before being returned to the home cage. For bilateral stereotaxic intra-cortical injections of AAV constructs for visual plasticity experiments, surgeries were performed on mice between P18 and P20. Animals were anaesthetized with isofluorane gas (1–2% in O ), and body temperature was maintained at around 37 °C with a heating pad during surgery. The head was held in place by standard mouse stereotaxic frame. The fur was shaved and scalp cleaned with betadine and 100% ethanol three times before an incision was made to expose the skull. Burr holes were drilled into the skull at the point of injection guided by stereotaxic coordinates and blood vessel patterns (approximately 2 mm and 2.7 mm lateral, 0.5 mm anterior to lamba) on both hemispheres. A 28-gauge Hamilton syringe (701RN) was inserted to a depth of 200–300 μm and 250 nl of the respective AAV construct was injected at the rate of 50 ml min−1. Five minutes post-injection, the Hamilton syringe was retracted, the scalp sutured and the mouse returned to its home cage. All animals were monitored for at least one hour post-surgery. Post-operatively, analgesic (meloxicam, 5–10 mg kg−1) was administered every 24 h for 2 days. Coronal sections (300 μm thick) containing the primary visual cortex were cut from P19-P21 mice using a Leica VT1000S vibratome in ice-cold choline dissection media (25 mM NaHCO , 1.25 mM NaH PO , 2.5 mM KCl, 7 mM MgCl , 25 mM glucose, 0.5 mM CaCl , 110 mM choline chloride, 11.6 mM ascorbic acid, 3.1 mM pyruvic acid). Slices were incubated in artificial cerebral spinal fluid (ACSF, contains 127 mM NaCl, 25 mM NaHCO , 1.25 mM NaH PO , 2.5 mM KCl, 2.5 mM CaCl , 1 mM MgCl , 25 mM glucose) at 32 °C for 30 min immediately after cutting, and subsequently at room temperature. All solutions were saturated with 95% O /5% CO , and slices were used within 6 h of preparation. Whole-cell voltage-clamp recordings were performed in ACSF at room temperature from neurons in primary visual cortex that were identified under fluorescent and DIC optics. Recording pipettes were pulled from borosilicate glass capillary tubing with filaments using a P-1000 micropipette puller (Sutter Instruments) and yielded tips of 2–5.5 MΩ resistance. All experiments were recorded with pipettes filled with 135 mM caesium methanesulfonate, 15 mM HEPES, 0.5 mM EGTA, 5 mM TEA-Cl, 1 mM MgCl , 0.16 mM CaCl , 2 mM Mg-ATP, 0.3 mM Na-GTP, 10 mM phosphocreatine (Tris), and 2 mM QX-314-Cl. Osmolarity and pH were adjusted to 310 mOsm and 7.3 with Millipore water and CsOH, respectively. Recordings were sampled at 20 kHz and filtered at 2 kHz. mEPSCs were isolated by holding neurons at −70 mV and exposing them to 0.5 μM tetrodotoxin, 50 μM picrotoxin and 25 μM cyclothiazide and were blocked by application of 25 μM NBQX and 50 μM CPP. mIPSCs were isolated by holding neurons at 0 mV and exposing them to 0.5 μM tetrodotoxin, 25 μM NBQX, and 50 μM CPP and were blocked by 50 μM picrotoxin. Data were acquired using either Clampex10 or custom MATLAB software, using either an Axopatch 200B or Multiclamp 700B amplifier, and digitized with a DigiData 1440 data acquisition board (Axon Instruments) or a PCIe-6323 (National Instruments). For measuring miniature postsynaptic currents (minis), cells were allowed to stabilize for at least two minutes. For paired pulse experiments, no drugs were used in the ACSF. A stimulating electrode (ISO-Flex, A.M.P.I.) was positioned approximately 100 μm below the cell, and 0.1 ms electrical pulses were given while adjusting the stimulus intensity and electrode position until the first pulse was between 100 and 500 pA. Inter-stimulus interval was varied and 10 s elapsed between each sweep. Pulse amplitudes were obtained from average sweeps of at least ten trials. Cells were held at 0 mV to record IPSCs and −70 mV to record EPSCs. For evoked IPSCs, no drugs were used in the ACSF. Simultaneous paired whole-cell recordings were obtained from an eGFP-expressing VIP neuron and a morphologically identified pyramidal neuron located not more than five cell bodies away from the VIP neuron. Both cells were held at 0 mV, and a 5 ms light pulse from a blue LED (Thorlabs) was used to evoke IPSCs. Light intensity and the objective position were varied until the VIP neuron IPSC amplitude was between 200 and 500 pA. Average light power at 470 nm varied from between 0.3 and 0.7 mW over the course of the experiment. Reported ratios were obtained by dividing IPSC amplitudes obtained from an average trace of at least ten trials. For electrophysiology experiments, n was set to min n = 10 to detect 20% effect size with power 0.95. For experiments to determine average firing rate of VIP neurons, a modified ACSF that promotes increased action potential firing was used containing, 3.5 mM KCl and 0.8 mM CaCl . Cell-attached patch recordings were obtained from eGFP-positive cells. Cells that did not fire an action potential in the first 30 s of recording were discarded, and recordings were maintained for at least 30 ten-second sweeps. Average firing rate was determined from the first sweep to the last recorded sweep in which an action potential occurred. Miniature IPSC and EPSC data were analysed using Axograph X. Events were identified using a variable amplitude template-based strategy. Templates for each event type were defined as follows: mEPSC: 0.25 ms rise time, 3 ms decay τ, amplitude threshold of −3 × s.d. local noise; mIPSC: 1 ms rise time, 50 ms decay τ, amplitude threshold of 2.5 × s.d. local noise. Local noise was determined by calculating the standard deviation of the current in a 5 ms window before event rise onset. Templates lengths extended 25 ms after rise onset in the case of mEPSCs and 50 ms after rise onset in the case of mIPSCs. Events were discarded if they had a rise time outside the range of 0–3 ms. Statistical significance for all recorded parameters between genotypes was evaluated using a Mann–Whitney U-test on the mean values from individual neurons in a given experiment. Minis were additionally evaluated for significance using both a Kolmogorov–Smirnov test (KS test) and Monte Carlo test. For these tests, 50 random minis were sampled from each neuron in each condition to obtain a continuous distribution for each condition that equally weighted each cell in that condition: these distributions are the data shown in the cumulative distribution graphs. One hundred random events were randomly sampled from these distributions for a KS test; and for Monte Carlo tests, 100 random events were randomly sampled from each distribution 1,000 times (with replacement), and the means were compared. All significant differences in mini amplitude and frequency were found to be significant by Monte Carlo test, KS test, and Mann–Whitney U-test of cell means. Since the Mann–Whitney test was found to be the most stringent test, the P values from Mann–Whitney tests are reported. All data was analysed blind to genotype or experimental condition. In all conditions, series resistance, holding potential, cell capacitance, and input resistance were recorded and were not found to be significantly different except where noted. Statistical tests were performed using Graphpad Prism and MATLAB. VIP neurons were filled with a patch pipette containing 1% Alexa 647 Hydrazide and the internal solution was allowed to dialyze for at least 30 min before slices were fixed in 4% paraformaldehyde for 1 h at room temperature. Slices were then washed three times for 30 min in PBS before slices were mounted in Fluormount-G (Southern Biotech). Images were acquired using a Zeiss Axio Imager microscope with a 20× objective with the use of an Apotome (Zeiss). Neurons were reconstructed using NeuronJ (ImageJ), and Sholl analysis was performed using a custom script in MATLAB. Eyelids were trimmed and sutured under isoflurane anaesthesia (1–2% in O ) as previously described31. The integrity of the suture was checked daily and mice were used only if the eyelids remained closed throughout the duration of the deprivation period. One eye was closed for 4 days starting between P26 to P28. The eyelids were reopened immediately before recording, and the pupil was checked for clarity. VEPs were recorded from anaesthetized mice (50 mg kg−1 Nembutal and 0.12 mg chlorprothixene) using standard techniques described previously32. The contra- and the ipsilateral eye of the mouse were presented with horizontal black and white sinusoidal bars that alternated contrast (100%) at 2 Hz. A tungsten electrode was inserted into the binocular visual cortex at 2.8 mm from the midline where the visual receptive field was approximately 20° from the vertical meridian. VEPs were recorded by filtering the signal from 0.1–100 Hz and amplifying 10,000 times. VEPs were measured at the cortical depth where the largest amplitude signal was obtained in response to a 0.05 c.p.d. stimulus (400–600 μm); 3–4 repetitions of 20 trials each were averaged in synchrony with the abrupt contrast reversal. The signal was baseline corrected to the mean voltage of the first 50 ms post-stimulus-onset. VEP amplitude was calculated by finding the minimum voltage (negative peak) within a 50–150 ms post-stimulus-onset time window. Acuity was calculated only from the deprived eye. For each different spatial frequency, 3–4 repetitions of 20 trials each were averaged in synchrony with the abrupt contrast reversal. VEP amplitude was plotted against the log of the different spatial frequency, and the threshold of visual acuity was determined by linear extrapolation to 0 μV. Igf1 conditional knockout mice15, Ai9 tdTomato reporter mice33, Emx1-cre34, Pv-cre35, Gad2-cre, Sst-cre, Vip-cre36 and RiboTag mice8 are available from The Jackson Laboratory. For routine experimentation, animals were genotyped using a PCR-based strategy; PCR primer sequences are available at the The Jackson Laboratory’s website. For RiboTag experiments, mice homozygous for the RiboTag allele were crossed to mice homozygous for the cre allele and all experiments were performed with mice double heterozygous for both the RiboTag and the cre alleles. For Igf1 cKO experiments, mice heterozygous for the Igf1 conditional allele (Igf1fl/WT) and homozygous for the Vip-cre allele were crossed to mice heterozygous for the Igf1 conditional allele and homozygous for the tdTomato reporter allele. Resulting littermates all had one copy of the Vip-cre transgene and the tdTomato Cre reporter and yielded Igf1WT/WT and Igf1fl/fl littermates for experimentation. For injections of AAV constructs in the visual cortices of Cre mice (Vip-, Pv-, Sst-, or Emx1-cre), mice homozygous for the cre allele were crossed to wild-type C57Bl6 mice and offspring heterozygous for the cre allele were used for experiments. The use of animals was approved by the Animal Care and Use Committee of Harvard Medical School and/or the University of California Berkeley.


News Article | November 10, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were blinded to sample identity during imaging and quantification for Sholl analysis. Initial research performed on samples of human origin was conducted with the approval of the Beth Israel Deaconess Medical Center Committee on Clinical Investigations (IRB#2001P000527). Fetal brain tissue was received after release from clinical pathology, with a maximum post-mortem interval of 4 h. Cases with known pathology were excluded. Tissue was transported in HBSS medium (Life Technologies, Carlsbad, CA) on ice to the laboratory for processing. For the initial fetal brain culture (hFBC) experiments, obtained fetal tissue was dissected and trypsinized. The resulting cell suspensions were gradient purified to remove cell debris using OptiPrep (Sigma; St. Louis, MO) density gradients, adapting the published protocol36. Subsequent studies used primary human neuronal cells purchased from ScienCell (Carlsbad, CA). For acute KCl depolarization of neurons, neuronal cultures were first silenced overnight in culture medium with 1 μM tetrodotoxin (TTX) and 100 μM d-APV (both Tocris). The next day, samples were incubated for 0, 1 or 6 h in 55 mM KCl before collection (3 × KCl solution: 170 mM KCl, 10 mM HEPES, 2 mM CaCl , 1 mM MgCl , pH 7.4). All cultures were monitored during treatment and no adverse effects to cell health were observed. Additionally, we did not observe upregulation of the excitotoxicity-induced gene Clca1 (data not shown). Samples in Fig. 1b were harvested without stimulation as well as 6 h after KCl (55 mM) depolarization or glutamate receptor agonist (NMDA, 20 μM) treatment. Prior to stimulation, samples were treated with the calcium chelator EGTA (5 mM), the L-type channel blocker nimodopine (Nimod, 5 μM), or the NMDA antagonist APV (100 μM) as indicated. Previous studies detected robust changes in expression of activity-dependent genes within KCl membrane-depolarized neuronal cultures using three or fewer biological replicates7, 8. For RNA-seq experiments, hFBCs from 5 different individuals (ScienCell) were grown according to the supplier’s instructions. At DIV15, neurons were silenced overnight and then KCl depolarized (see above) for 0, 1 or 6 h before collection. Total RNA was isolated from cultures using Trizol (Invitrogen). After DNase treatment and rRNA depletion, strand-specific and paired-end cDNA libraries were generated using the PE RNA-seq library kit (Illumina). Ribosomal RNA depletion was performed using the RiboMinus Eukaryote Kit for RNA-seq (ThermoFisher) and verified using a Bioanalyzer RNA Nano kit (Agilent). Fragment ends were sequenced to produce strand-specific paired-end reads of at least 76 base pairs (bp) in length. RNA-seq was performed using HiSeq 2000 at the Broad Institute and BGI. For each sample at each stimulation time point, both sets of single-end reads were separately aligned to the human genome (hg19 assembly) using the Burrows-Wheeler Aligner (bwa) program, allowing for up to five mismatches. In addition to the usual 24 chromosomal targets, a set of ~7 million short splice-junction sequences (see below) were also provided as targets and incorporated into the BWA index. Each sequenced library comprised 47–240 million reads, of which 55–95% were mappable. Of those reads that did map at all, typically ~90% were aligned uniquely. We found that for our purposes (expression levels and UCSC Genome Browser tracks) full RNA fragment reconstruction was not necessary, so going forward our data sets comprised just the uniquely mapped single-end reads from ‘end #1’. The splice-junction target sequences were based on the NCBI RefSeq database for human 37.1 (hg19). For each annotated transcript, we noted all subsets of two or more exons, not necessarily adjacent, that could be spliced together to produce a sequence at least as long as the read length (76 bp). Each of these sequences was then trimmed to the maximum number of bases such that a read mapping to the sequence would have to cross only these ordered exons’ splice junction(s). This procedure produced a library of all unique sets of exons whose intragenic splice junctions could possibly be covered by a read of the given length, based on the RefSeq annotation of exonic loci. Aligned reads thus had the opportunity to align either to genomic (chromosomal) sequences or to exon-junction-crossing sequences found only in mature mRNA. Multiple reads whose 5′ ends were assigned to the same locus on the same strand were not flattened to a single count. An in-house software tool, MAPtoFeatures37, was used to quantify expression levels for individual genes as follows. A database of genic features (coding sequences (CDSs) and untranslated regions) was constructed from all 29,149 transcripts annotated in RefSeq (human 37.1, 12 March 2009). Merged genes were constructed by combining all exons in all transcripts assigned to each distinct gene; the resulting segments defined the gene’s exonic coordinates used here (with the gaps between them defining introns). Genes with zero CDS exons were labelled ‘noncoding’. These 20,066 genes were supplemented with 1,723 additional noncoding genes specified by the loci of all ribosomal RNA genes obtained from RepeatMasker (where the options Variations and Repeats, rmsk.repFamily = “rRNA” yielded 391 LSU-rRNA_Hsa; 71 SSU-rRNA_Hsa; 1,261 5S). The purpose of this step was to filter out reads stemming from transcription of repeats and rRNA genes, which tend to get populated to inconsistent degrees from sample to sample depending on the variable quality of rRNA depletion. Reads that aligned uniquely were then queried for their intersection with the exonic ranges of any of the above 21,789 genes, including exon–exon splice junctions. The total number of read bases that overlapped an exonic range in the sense direction was divided by the range’s length to give an average exonic read density (that is, coverage). All reads were assigned to genes or to intergenic regions. However, only those reads not assigned to noncoding genes counted towards the total normalization count N, which ultimately afforded a more stable comparison of expression levels between samples than simply using the total number of reads. All read densities were normalized to a reference total of 10 million reads and a reference read length of 35 bp through multiplication by the factor (107/N) × (35 bp/76 bp). Division of these normalized densities by 0.35 yielded expression levels in alternative units of reads per kilobase of transcript per million mapped reads (RPKM). Differential expression analyses aimed to produce fold change ratios (between 0 and 1 h or 0 and 6 h time points) and their statistical significance for every expressed gene. For this purpose read counts were preferable to read densities for two reasons: sample-independent parameters such as a gene’s exonic length cancel out of such ratios, and a null model of low read counts would in any case require discrete data. Whole-read counts were monitored for each sample for reads that fell entirely within single exons as well as for those that crossed exon–exon splice-junction boundaries captured by the aforementioned splice library, a not insubstantial fraction (10–30%) of all exonic reads. Relatively few reads (<1–3%) crossed exon–intron boundaries; nevertheless, the exonic fraction of such reads was counted towards a gene’s total ‘fractional read counts’ (frds), rounded up to the nearest integer. Genes were further processed for differential expression between 0 h and 1 h (or 6 h) depolarization only if they passed a minimal read counts filter and an expression level background filter. All five replicates needed to have a total of at least three fractional reads per gene at each time point. Furthermore, the geometric mean density over all non-zero density values (up to five replicates) needed to be at least 0.20 (RPKM ≥ 0.5714) at either 0 h or the later time point. The filtered tables of frds (~12,000 genes over 5 samples per time point) was then taken as input to the R Bioconductor package edgeR38. This tool was appropriate for our samples because it is able to model low counts subject to biological variability via negative binomial distributions. Normalization factors were calculated using the default TMM method; dispersion was estimated ‘tagwise’. In order to control the false discovery rate (FDR), P values were adjusted via the usual Benjamini–Hochberg (BH) procedure39. RNA-seq was performed on cultured mouse and rat cortical cells from E16.5 C57BL/6 wild-type mice and E17 Long-Evans rats as described7, 8. Three biological replicates of mouse and rat cultured neurons were KCl depolarized (see above) for 1 or 6 h at DIV7. Paired-end reads of length 76 bp were sequenced on an Illumina platform and aligned to the mouse genome (GRCm38/mm10 assembly, Dec. 2011) as described above for the human samples. For mouse, the 95,023 transcripts annotated in RefSeq and assigned to 33,102 genes in mm10 were supplemented with 1,563 additional rRNA genes from RepeatMasker; a library of splice-junction target sequences was constructed; and normalized RPKM expression levels were assigned to merged genes as described above. Similarly for rat, 58,438 transcripts annotated in RefSeq (RGSC 6.0/rn6, July 2014) and assigned to 28,022 genes were supplemented with 1,641 rRNA genes from RepeatMasker; a splice library was constructed; and normalized RPKM levels were assigned to merged genes. The RiboTag-Seq experiments were performed as described34, 40. Briefly, double-heterozygous mice (Cre/+, RiboTag/+) were reared under a standard light cycle and then housed in constant darkness for two weeks starting from P42; at P56, all mice were either euthanized in the dark (dark-housed condition) or light-exposed for 1, 3, or 7.5 h before being euthanized. Visual cortices were dissected, and immunoprecipitation and purification of ribosome-associated RNA was performed as described34. Visual cortices from three individual animals (each sample contained both male and female animals) were pooled for each biological replicate, and three biological replicates were performed. For all RNA samples of sufficient integrity (RIN >8.0), 5–10 ng RNA was SPIA-amplified with the Ovation RNA Amplification System V2 (NuGEN). For RNA-seq analyses, 2 mg of each amplified cDNA was fragmented to a length of 200–400 bp and used for Seq library preparation using the PrepX DNA kit (IntegenX). The completed libraries were sequenced on an Illumina HiSeq 2000 instrument following the manufacturer’s standard protocols for single-end 50-bp sequencing with single index reads, and reads were mapped to the mouse genome (NCBI37/mm9 assembly, July 2007) using TopHat (v2.0.13) and Bowtie (2.1.0.0). The scatterplots in Extended Data Fig. 3a, b show expression levels of data for five samples versus five samples, for either 1 h or 6 h post-KCl-stimulation versus unstimulated (0 h). At each time point the five data sets were log-transformed and quantile normalized, with only non-zero data included. Each point shown in the figures represents a gene with at least one non-zero value at each of the two time points; at each time point error bars show ± 1 s.e. over log expression levels while their crossing point lies at the two-dimensional mean of the gene’s log values (that is, at the geometric mean). The log of the ratio of mean values (fold-change) is proportional to the distance from the main diagonal. Off-diagonal grey lines mark up or down ratios of 10 and 100. Genes with the most unusual fold-changes were filtered by magnitude, significance, and comparison to background expression levels. A background threshold was chosen at the density value 0.20 (that is, RPKM = 0.20/0.35 = 0.5714 ≡ B). Those genes with a mean density exceeding this threshold at either 0 h or the later time point were submitted to the R package edgeR, as described above, for evaluation of the signficance of their differential expression, including BH-adjusted P values to control FDR. Highlighted points have adjusted P consistent with an FDR threshold 15% or less and fold changes either ≥ 2.0 or ≤ 0.5. For 1 h versus 0 h, 9 of 17,323 genes shown passed all these filters (all upregulated); for 6 h vs. 0 h, 185 of 17,224 did (73 upregulated, 112 downregulated). The highest fold-change of 102.9× was ascribed to OSTN at 6 h of membrane depolarization; the greatest change at 1 h was 47.1× for NPAS4. Supplementary Table 1 contains the lists for early-response genes (ERGs) and late-response genes (LRGs). We categorized a gene as an ERG if the edgeR calculated fold-change (FC) at 1 h was greater than the FC at 6 h. If a gene had a greater FC at 6 h, it was categorized as an LRG. Note that fold changes inferred from Extended Data Fig. 3a, b, based on mean expression levels, may differ slightly from the fold change values cited here, which are taken from Supplementary Tables 1 and 4 and are instead based on read counts and their normalization as calculated by edgeR. The quantile distribution for the five unstimulated samples is plotted in Extended Data Fig. 2a against log -expression level (RPKM units) with a colour scale for the heatmaps. Spearman correlations (r ) in Extended Data Fig. 1f were calculated using gene expression levels from our five unstimulated hFBC replicates (H1–H5). Only those 11,711 RefSeq genes that were annotated in hg19 as coding genes and that had non-zero expression levels in all samples were included in this calculation. The dendogram in Extended Data Fig. 1g was based on the hierarchical clustering of the expression levels of these five samples plus ten previously sequenced human tissues37 (GEO accession number GSE48889), including whole brain, with distance measure 1–r . In order to emphasize informative genes for this comparison, a subset of ~3,000 coding genes was identified that had non-zero expression in at least 5 of the 10 tissues and could be loosely classified as expression outliers in any one of the 10 tissues (Grubbs’s test, α = 0.10, Bonferroni adjusted). The displayed horizontal ordering minimizes the total of the distance measures between adjacent samples. Brain clusters with H1–H5 while correlations among the remaining tissues are unstructured. Expression levels from the publicly available BrainSpan atlas (http://www.brainspan.org/) are derived from RNA-seq for 22,327 genes and 578 human samples, including 41 individuals, 30 different ages ranging from embryonic to adulthood and 26 specific brain regions. The data shown for OSTN and BDNF in Extended Data Fig. 6a–f cover five separate regions: amygdalaloid complex, AMY; cerebellar cortex, CBC; hippocampus, HIP; mediodorsal nucleus of thalamus, MD; and striatum, STR. We further combined the data for 11 cortical regions under ‘Neocortex’ (NCX): primary auditory cortex (core), A1C; dorsolateral prefrontal cortex, DFC; posteroventral (inferior) parietal cortex, IPC; inferolateral temporal cortex, ITC; primary motor cortex, M1C; anterior (rostral) cingulate (medial prefrontal) cortex, MFC; orbital frontal cortex, OFC; primary somatosensory cortex, S1C; posterior (caudal) superior temporal cortex, STC; primary visual cortex (striate cortex), V1C; and ventrolateral prefrontal cortex, VFC. OSTN expression data from these neocortical regions were also grouped into four anatomical categories and displayed in Extended Data Fig. 6g. For each gene, data for all samples at all available time points in each brain region were fit via a local polynomal regression (the Loess function in R version 3.0.2) and shown as mean Loess curves interpolated across the whole age range. The width of the one-standard-error side bands shown in Extended Data Fig. 6a–g were similarly calculated via a Loess fit to the standard errors deduced at whatever ages data were available in each region for each gene. Total RNA was isolated from human and mouse neuronal cultures using Trizol. Isolated RNA was treated with Amplification Grade DNaseI (Invitrogen), and cDNA libraries were synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The cDNA was the source of input for quantitative RT–PCR, using a Step One Plus Real-Time PCR Instrument and SYBR Green reagents (Applied Biosystems). The relative expression plot was constructed using concentration values that were normalized to corresponding GAPDH concentrations. The following primer sets were used for qPCR experiments: Human OSTN F-5′-CAGGAAAAGTCCTCTCAGTAGATG-3′, R-5′-GCAAGAGTTTTGCTGTCAGGTCA-3′; Mouse Ostn F-5′-CCATGGATCGGATTGGTAGA-3′, R-5′-GCCATCTCACACAAGTAAGTCG-3′; Human NPAS4 F-5′-TGGGTTTACTGATGAGTTGCAT-3′, R-5′-TCCCCTCCACTTCCATCTT-3′; Human GAPDH F-5′-GTCTCCTCTGACTTCAACAGCG-3′, R-5′-ACCACCCTGTTGCTGTAGCCAA-3′; Mouse Gapdh F-5′-CATCACTGCCACCCAGAAGACTG-3′, R-5′-ATGCCAGTGAGCTTCCCGTTCAG-3′; Human MEF2C F-5′-TCCACCAGGCAGCAAGAATACG-3′, R-5′-GGAGTTGCTACGGAAACCACTG-3′; Human BDNF_IV F-5′-GCTGCCTTGATGGTTACTTTG-3′, R-5′-AAGGATGGTCATCACTCTTCTCA-3′. FISH detection of transcripts was performed by RNAscope assay (Advanced Cell Diagnostics) per the manufacturer’s instructions. Target probes were either custom-synthesized or purchased from the available probe catalogue. Manufacturer’s standard single red chromogenic/fluorescent (with the Fast Red fluorescent label) or multiplex fluorescent protocols were used for cultured human cells and fresh frozen human and macaque sections. Coverslips or sections were mounted with DAPI Fluoromount-G (Southern Biotech) for the visualization of nuclei. For negative controls, the probe against the bacterial gene dihydrodipicolinate reductase (dapB) was used, and no signal was detected in any of the experiments. Neuronal cultures grown on glass coverslips were fixed with a solution of 4% paraformaldehyde and 4% sucrose in 1× PBS pH 7.4 for 8 min at 27 °C, blocked for 1 h at 4 °C with 0.1% (w/v) gelatin and 0.3% (v/v) Triton X-100 in 1× PBS pH 7.4 (GDB), and incubated overnight at 4 °C with the following primary antibodies diluted in GDB: anti-GFP (rabbit, 1:500, Life Technologies, A21311), anti-MAP2 (chicken, 1:1,000, Lifespan Biosciences, LS-C61805) and anti-MAP2 (chicken, 1:1,000, Abcam AB5392), anti-GFAP (rabbit, 1:500, Dako, Z033429-2), anti-SATB2 (mouse, 1:500, Abcam AB51502), anti-CTIP2 (rat, 1:300, Abcam, AB18465), anti-TBR1 (rabbit, 1:300, Abcam, AB31940). The OSTN antibody (rabbit, 1:500) was raised against a C-terminal region of OSTN (NP_937827.1, amino acids 112–127, PKRRFGIPMDRIGRNR), then affinity-purified. All secondary antibodies were AlexaFluor-conjugated (Life Technologies). Coverslips were mounted with DAPI Fluoromount G (SouthernBiotech). In situ and immunofluorescence experiments were imaged on either an AxioVision Imager Z1 or an LSM 5 Pascal (Zeiss). The individual GFP-positive neurons used for Sholl analyses were selected and imaged using an LSM 5 Pascal with a 40× objective in a blinded manner. The neurons were traced using an ImageJ (NIH) plugin NeuronJ41, and Sholl analysis was performed by a blinded investigator using Sholl tool of Fiji42, quantifying the number of dendritic intersections at 10-μm intervals from the cell body. The −2kbhOSTN:GFP construct was transfected into DIV15 hFBCs using Lipofectamine 2000 reagent (Invitrogen) per the manufacturer’s instructions. For RNA knockdown, we used a pool of four synthetic chemically modified ACCELL siRNAs (GE Dharmacon) to target OSTN and MEF2C. The pooled siRNAs, including a control pool consisting of scrambled sequences, were added to the medium for the last 3 days of culture (DIV27–DIV30, final concentration 1 μM) along with 20 mM KCl CAP treatment. The following siRNAs were used in the experiments: scrambled siRNA pool, UGGUUUACAUGUCGACUAA, UGGUUUACAUGUUUUCUGA, UGGUUUACAUGUUUUCCUA, UGGUUUACAUGUUGUGUGA; OSTN siRNA#1 pool, CUGUAGAUCACAAAGGUAA, GCUUCUUGAUGAUGAAUUGGUG, GGAUCGGAUUGGUAGAAAC, CCUUUGAUUCUGGAGUCAU; OSTN siRNA#2 pool, ACAGCAAUAUGGAAGA, GCCUUCUGUAUGGAUU, UCUUUGGCUUCAAUUG, CUCAGGAGUUGAAAGA; MEF2C siRNA pool, GGAUUAUGGAUGAACGUAA, CUCUUGUCUAAUAUUCGUC, GCACUAGCACUCAUUUAUC, CUGCCUUGUACUAAUGUUU. The 2-kb cis-regulatory regions directly upstream of the human OSTN (hg19 chr3:190,914,914–190,917,032) and mouse Ostn (mm10 chr16:27,305,609–27,307,640) transcription start sites were PCR amplified from genomic DNA using primers that incorporated SacI (5′) and XhoI (3′) nuclease recognition sequences. Luciferase constructs were cloned using the Firefly luciferase reporter plasmid pGL4.11 (Promega), which was linearized using SacI–XhoI digestion and then ligated with the mouse or human amplified DNA sequences. Further mutagenesis of pGL4.11 −2kbhOSTN was performed using gBLOCKS (IDT) and Gibson Assembly Master Mix (New England Biolabs). The −2kbhOSTN:GFP reporter construct was generated by cloning −2kbhOSTN into pGL4.10[GFP] using SacI and XhoI restriction sites. pCAG-GFP (Addgene #11150) was used as a backbone for cloning the OSTN overexpression construct. pCAG-GFP was digested with the restriction enzymes EcoRI and PstI, while the PCR amplicon corresponding to the ‘full-length’ OSTN cDNA was cloned with EcoRI and SbfI. The predominant OSTN transcriptional variant sequence was determined by RNA-seq and 3′RACE analyses from depolarized hFBCs. The full-length OSTN cDNA is 3,219 bp long and consists of 5 exons. The first exon corresponds to the 5′UTR, the second exon starts with the initiation codon ATG (bold) and the last exon corresponds to the 3′UTR. The full-length OSTN cDNA sequence is as follows (alternating exons are underlined): AGGGCTGAGTTTTGGAGAAACTGCAGAGACAGTACTCTAAAGTTAGAATCTCCTGATCTTTCACGAG GCCTTTGATTCTGGAGTCATAGATGTGCAGTCAACACCCACAGTCAGGGAAGAGAAATCAGCCACTGACCTGACAGCAAAACTCTTGCTTCTTGATGAATTGGTGTCCCTAGAAAATGATGTGATTGAGACAAAGAAGAAAAGGAGTTTCTCTGGTTTTGGGTCTCCCCTTGACAGACTCTCAGCTGGCTCTGTAGATCACAAAGGTAAACAGAG ATGCAACTTCCTTGGGTGAAATGTCACAGCAATATGGAAGATGCTTCACTGAAGTTATTCACACTTCTTAATGATTAAACTTTTAAGGAACTGACCTTCTGCAAATCCTTTCCAAAGCTTGAACTTCAGTCCATCACATTACAGCATTGTTACAGCTTCAATTAAATTGTGTAAATCATTTTGATGCACGTACATTTTAA AATTATATATTTTAATTATTCAAGAATGGTTAACTTCCCCTTAAACCTTACTTTTAAAAATAATAATTAAATACACAATACAGTGAAATGCCTTC TGTATGGATTTACCATGCACATGTTTGTAGTCAAAGAATAATAACAAAAGACAGATTTGCTTCTGTAAAATTTAGTTATAATCTGTCCATTATTGGGGAATGAGGAAAGGCAATGCTGTGTATTTTCTGTTGAGTACTTTCACTTCCCTGTATTCCATTTTTCCAAGAGTCTGATCGGTAATAAT TATGAAATTA GGCTTCTCTTTTCATATTCAAGTTTCAGTCATGTTCAGAAAAATAAAACACAGCCCCAATGAGCCTATTGACTTAGAATTAAGAAAGTGAAGGACATTACTCATTTGTCAAACTTAGATATCACTTGTCCCCTAAAAACTTTCCATTTTTCTAAATTCTGACAGTTAAGAGCAGTAGTGTCTCATTAGGAGGGGAGTAAGCTCACACAGAGGTAAAAATGAAAGTAGGAGGGAAGTCAAAGAATTACCACCAGAACAGGTTAGGACCAGCTAAGCACACATCATTTTAGCTCAGTACACTTCAGCATAGTACAATGTGATCTTTTTGATATCTTGGATTAATCTAAGAAACTGTTTACTGTGTTTCACATATTGGCTTCTTTGGCTTCAATTGTCTTATTATCCTTAGTAAGCCAATTGAAGAGCATAATGATTTTGAGAATGATTTCTTAAAAATCATTCAGATTATTTTTGAATGACTTATTAAAACATAAGTTTTCGTATTGTAGAAAACTCAGTTCTCAGTAATAACTATGATGTTACTGTAGCTTGGACACATAGGTCCATTGTGCATTGGATATACTTTGAAAACACACAAAAAAAACTTTCTATGGAACAGAGATTCATCATAAGTTACTTAGCAGAAGTTTATAAAGCATCGAAAAACACTTC CTCTGTAAACCCTAAAAATCACTGTCTGATACGTGGGAGGAAAAAAGTTTTGTCCAGTAGAGCAAAGGCTTATTTCAGCATAAAAAGAGAGTGTTGTGAGTTGTGAGAAGGTGTCTTAATTTTAAAGGAAGAGGAGAGAAATGGGCAATTGCTAATCTTAACTAAAAATTAATGGACTTGTATGATCCAAAGAATAAAATAAACTCAAAGAAACATAACAAAAATATATTAGAAAAAGAGTTAAACTAAGAAATTGACCTTTATGAAGGACTAATTTTTCAGTTATCCAATGTGCTTTTTAA AGATAAAGTTTAAAAGAGGCAAAAAGAGGTGAAAGAAATGAACATGTGTACTTAGAATATATATATTGGTTTTGTATGTAACTTCTTAGTTTTTCTGGATATTTTTAAAATTGAAAGTCTTCAAAATTAATTTAGGAAAAATAGTAAATAATTTTTTTTCATTGTAGTAGAGGGCTGTAGCCAAGAGAAGTGAATTTTGGGAAATCTAACCAATTCTTTTTTTCATAAACTTGTGTTAGAAAGCTAGCAATAGCACATAGGGAAGTATCCTGGAGGACTCAGGAGTTGAAAGAATTATTTAAGAAGTTGTGATATCCTTGTCTGCCTTTCCCCAACCTTGTGATGAACTATAGAAATGTTTCCTATTGCTTAGAAGCTCTTTCTTTCCTTGTATGCACATTTGGGTATTTGTAAGCTTCTAATCCAATTGGGTTCTGCTTCATGCTTTGACAAAAGGTATTAAAACCTACTTTAGCCTAAAACTTTCTCAT GGTAAATATTGGAAGTTGGATTATGCAAATTGATTTCCTCCATTCTTTATTTTTTAATTCAAAATTAGACTATGACATCCAACTTAATTAAAATAAGAAGTCACAATATAGTGATTTATGCTATAGTTTCATGTGTAATGTATTTTCACCTAATATACACACAATTTCCATGAAGGGAAGAAAATGTTTTCTCCACTTATAACTCTATTTTATTTCATATTTTAATTTTTACCACTACTTCATTCAGAGTAGAAAATAAGTCAGCAATATACTAAATAATGGGGCTATTCTTTTAACATAGCAGTAAATTAAGACAGAATTTTTGTTAAGAATATGACAAGTCATCTCACTTATTTATCCAATGCATTAGGTATTACTAATCCAACTATATTTCAACTTGAAGGGACTTTTTTGTTTTGTTTCAAAATAATGCATTACTTTTTTCTCTTTGCTTCTGTATGAACCTTTATAGAGCAAATGAATATATGTATATGGAGTTCTGGGTTCTAGTGTCAATTACATAATCAAATTTCATAAAAGGATGTTAGTTACTGGCTATGTTGTCCTAAAATTTACACACACTAAAAAATGTCTGTCAAGTTGTACCTTTAACCTGTTCATAGCTTTAGGGAATTAAGTTTCTTAAACCAAATTATGAAAAAATAACTTAATGGAATCTTCTAAAAGGAAAAAGTATAAAAAGCTTTCTGAATGATATTACCCCTTATACCTAAAGGCTCAAGATGCTTGAATATG GTTCAACTTTTCCAAAGTTAATAAACAAGGGATGATGAAA. Further construct sequences are available upon request. Previously characterized healthy control hiPSC lines 20b and 18a (ref. 43) were maintained in mTEsR medium (StemCell Technolgies) on hESC-qualified matrigel (Corning)-coated tissue culture plates and passaged using Dispase (1 mg/ml, Life Technologies). Cell lines were mycoplasma-negative by PCR (LookOut Mycoplasma PCR Detection Kit, Sigma). hiPSCs were differentiated into dorsal telencephalic neural progenitors using a previously published protocol44 without inducing sonic hedgehog signalling (no SHH, see Extended Data Fig. 5). After 18 days, cultures were enzymatically dissociated to single cells using Accutase (StemPro Accutase, Life Technologies) and were replated on Growth Factor Reduced matrigel (1:30, Corning) at 10,000 cells/cm2 in human neurobasal (hNB) medium supplemented with 10 μM ROCK inhibitor (Y27632, Tocris). hNB media was replaced 24 h later and supplemented every 2–3 days thereafter. Dissociation and replating (100,000 cells/cm2) was repeated at day 40. Cultures were silenced on day 81 and then KCl-depolarized (see above) and harvested on day 82. hNB medium: neurobasal medium (no glutamine), with 1× penicillin/streptomycin, 1× GlutaMax, 1× MEM non-essential amino acids, 1× B27-supplement without vitamin A (all Life Technologies), 1× N2-B supplement (StemCell Technologies), 1 μM ascorbic acid (Sigma), 20 ng/ml rhBDNF and 10 ng/ml rhGDNF (Peprotech). Luciferase assays were performed using the Dual-Luciferase Reporter Assay System (Promega), and all constructs generated in this study were cloned using pGL4.11[Fluc] (firefly luciferase reporter construct – Fluc) and co-transfected with pGL4.74[Ren] (Renilla luciferase expression construct) as an internal transfection control. E16.5 C57BL/6 mouse embryonic cortical cultures were dissected and cultured as previously described45. Briefly, E16 mouse cortices were dissected, dissociated using a 1:100 dilution of papain suspension (Worthington, LS003126), rinsed with a 0.6% (w/v) solution of Ovomucoid Trypsin Inhibitor (Worthington) and BSA (Sigma) in HBSS and triturated briefly to dissociate cells, and single cells were plated at 150,000 cells/cm2 on poly-l-ornithine- (Sigma) and laminin (Life Technologies)-coated tissue culture plates in mouse neurobasal (mNB) medium. mNB medium: neurobasal medium (no glutamine), with 1× penicillin/streptomycin, 1× GlutaMax, 1× B27 supplement (all Life Technologies). At DIV5, control and experimental plasmids were transfected into the cultured cells using Lipofectamine 2000 (Life Technologies) following the manufacturer’s protocols. On DIV6 cultures were silenced, and on DIV7 cultures were KCl-depolarized (see above) for 6 h before washing once with cold 1× PBS and collecting cells in lysis buffer. For luciferase assays, hFBCs were transfected with plasmids on DIV25, silenced/treated on DIV27, and stimulated and harvested on DIV28. Protein lysates were analysed using Promega reagents according to Assay System instructions on a BioTek synergy 4 microplate reader, Gen5 1.11. Firefly luciferase activity readings were normalized for each experimental replicate using the Renilla luciferase activity reading from the same sample: Fluc/Ren. Two or three normalized Fluc values (experimental replicates) were averaged for each biological replicate value. The average normalized Fluc value of each condition treated with KCl was divided by the average normalized Fluc value of that same condition left untreated to obtain the fold-induction of the Fluc reporter for each condition in each biological replicate: avg. +KCl / avg. −KCl. Statistics were performed using a one-way ANOVA and Holm–Sidak test for multiple pair-wise comparisons. For CsA/FK506 treatment comparisons to DMSO treated controls, a one-way unpaired Student’s t-test was applied. All constructs were tested from at least two independent plasmid preparations. Control plasmids used: ‘3xMRE’ (generously contributed by the Eric Olson Laboratory) and ‘3xMREmut’, mutated to inactivate the MRE sites as previously described18. Calcineurin activity was inhibited by addition of DMSO solutions of cyclosporin A (10 mM) and FK506 monohydrate (1 mM) (both Sigma) at 10,000× dilutions in NB medium, for final concentrations of 1 μM and 0.1 μM in the culture medium, respectively. DMSO was used as the vehicle control. Cultures were treated at the same time as silencing treatment and were incubated for 18–20 h before KCl depolarization (see above). All procedures conformed to USDA and NIH guidelines and were approved by the Harvard Medical School Institutional Animal Care and Use Committee. Owing to the robust nature of this assay and scarcity of these specimens, we performed this experiment on two animals. One eye of each of the two adult male macaques (monkeys #1 and #2) was inactivated for 22 h by TTX injection as follows: the animal was anaesthetized with 10 mg/kg ketamine. Then 10 μl of sterile TTX solution (Tocris, 4.7 mM in sterile saline) was microinjected at a rate of 1 μl/min into the vitreous of the right eyeball using a sterilized Hamilton 0.5 inch 30 gauge 10 μl microsyringe inserted through the sclera and controlled by an automated syringe pump. The microsyringe was kept in place for an additional 5 min to allow the pressure to equalize before retraction. The pupil of the injected eye dilated after the injection, indicating appropriate TTX delivery. The animal was immediately brought back to its home cage, allowed to recover from anaesthesia, and monitored post-operatively. On the following day, to maximize visualization of possible OSTN transcripts, 6 h after the beginning of the facility’s normal light cycle (22 h after the TTX injection) the animal was anaesthetized with 15 mg/kg ketamine i.m. and then given a lethal dose of euthasol (pentobarbital + phenytoin) i.v. Immediately after death, brain tissue was removed and frozen on dry ice for cryosectioning into 15–25-μm slices. The human fetal tissue used for in situ hybridization was acquired from the laboratory of N. Sestan at Yale University. Tissue was fixed using TissueTek VIP fixative for 24 h, then cryoprotected by immersing it in first 15%, then 20%, and finally 30% sucrose in RNase-free PBS at 4 °C. Samples were kept in each sucrose solution until completely equilibrated, when they sank to the bottom of the incubating vessel. Following cryoprotection, tissue was frozen using isopentane and dry ice. Frozen tissue was cut by cryostat into 12-μm slices. The ChIP assay in Fig. 2e and Extended Data Fig. 7d was performed as described17 using hFBCs at DIV21 and mouse cortical cultures at DIV7 under CAP conditions. H3K27Ac (Abcam ab4729), pan-MEF2 (Santa Cruz Biotechnology (C-21) sc-313) and MEF2C (Proteintech 18290-1-AP) antibodies were used.


No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. All mouse experiments were approved by the Animal Research Committee, the Norwegian Food Safety Authority (NFDA), and conducted in accordance with the rules and regulations of the Federation of European Laboratory Animal Science Associations (FELASA). C57BL6/CBA mice were housed in IVC SealSafe Plus Greenline cages in an Aero IVC Greenline system at SPF status. They were maintained on a 12 h light, 12 h dark cycle with ad libitum access to food and water. Four- to eight-week-old donors were injected with 5 units of pregnant mare serum gonadotropin (for oocytes and 2-cells at 14:00; for 8-cells at 15:00, 100 μl of 50 I.U. (international units) ml−1 solution) followed by 5 units of human chorionic gonadotropin (hCG) (for oocytes and 2-cells at 11:00; for 8-cells, 15:00, 100 μl of 50 I.U. ml−1 solution) 45 h (for oocytes and 2-cells) or 48 h (for 8-cells) after injection of pregnant mare serum gonadotropin. For 2-cells and 8-cells collection, females were transferred to cages with males for breeding immediately after hCG injections. Donor mice were killed by cervical dislocation 18 h after hCG injection (no mating). Oviducts were transferred to a clean dish with M2 (Sigma) medium. The ampulla was identified under a stereomicroscope, and the oocytes released followed by removal of cumulus mass by room temperature incubation in M2 containing 0.3 mg ml−1 hyaluronidase. The oocytes were further washed in M2. Donor mice were killed by cervical dislocation 45 h after hCG injection. Oviducts were transferred to a clean dish with M2 medium. Infundibulum was identified and the 2-cells were released by placing a syringe containing M2 inside the infundibulum opening, followed by flushing the M2 through the whole oviduct. The 2-cells were further washed in M2 medium. Donor mice were killed by cervical dislocation 68 h after hCG injection/mating. Oviducts were transferred to a clean dish with M2 medium. Infundibulum was identified and the 8-cells were released by placing a syringe containing M2 inside the infundibulum opening, followed flushing the M2 through the whole oviduct. The 8-cells were further washed in M2 medium. The oocytes, 2-cells and 8-cells were transferred to a 150 μl drop of Acidic Tyrode’s solution (Sigma), and further transferred to a drop of M2 immediately after the zona had been removed. 5 steps of washing in M2 were carried out, and the oocytes, 2-cells and 8-cells were ready for fixation. Immature oocytes were isolated from 12-day-old and 15-day-old prepubertal CD-1 mice (RjOrl:SWISS) as follows. Ovaries were removed with fine scissors and carefully freed from surrounding tissues with a 25G needle. Batches of five ovaries were placed in 800 μl DPBS in a 60 mm culture dish, 400 μl of Trypsin-EDTA (0.05%) (Gibco) was added immediately before fine mincing of the ovaries with a scalpel. After mincing, 5 μl of DNase I (10 U μl−1) (Sigma, 04716728001) was added and the minced ovaries were incubated at 37 °C for 20 min. Next, 20 μl of Collagenase Type II (100 mg ml−1) (Sigma, C9407), 800 μl of DBPS and 400 μl of Trypsin-EDTA (0.05%) was added and the dish was incubated for 10 min at 37 °C. Mechanical dissociation with a pipette then resulted in denuded oocytes. To remove any possible traces of somatic contaminants, and to remove the zona, oocytes were washed four times in M2 medium, incubated in two consecutive drops of M2 containing 0.3 mg ml−1 hyaluronidase, washed two times in M2 medium, then in two drops of Acidic Thyrode’s solution (Sigma) and again washed four times in M2 medium. Batches of oocytes to be analysed for DNA methylation were washed once in WGBS lysis solution (20 mM Tris-HCl, 20 mM KCl, 2 mM EDTA), transferred in a volume of maximum 5 μl to a 1.5 ml tube, snap-frozen in liquid nitrogen and stored at −80 °C before further processing. Batches of oocytes for ChIP−seq were treated as described below. Mouse embryos were immunostained using an adapted protocol from ref. 31 in 96-well plates. Briefly, embryos were subjected to thinning of the zona pellucida using acidic DPBS (pH 2.5), and fixation in 2% paraformaldehyde for 30 min. Embryos were permeabilized in 0.3% BSA, 0.1% Triton X-100, 0.02% NaN PBS solution. Blocking was carried out in 0.3% BSA, 0.01% Tween-20, and 0.02% NaN in PBS. Embryos were incubated in blocking solution with 1:200 H3K4me3 antibody (Merck Millipore, 04-745) for 60 min at room temperature. After further blocking, embryos were finally incubated with goat anti-rabbit Alex Fluor 488 (Invitrogen, A-11008) or Alexa Fluor 568 for morpholino injected embryos (Invitrogen, A-21069) at 1:200 dilution and placed on a slide in SlowFade Gold with DAPI (Invitrogen). Quantitative measurements of H3K4me3 were obtained using a Zeiss Axio Observer epi-fluorescence microscope with a Coolsnap HQ2 camera. Confocal images were obtained with a Zeiss Axio Observer LSM 710 confocal microscope. Images were processed and quantified in Axiovision and ImageJ software. Isolated zygotes were injected at 0.5 dpc (days post coitum) with either fluorescein-tagged morpholino oligonucleotides (Gene-tools) targeted at Kdm5a (5'-TGACGGCCACCAAAGCCCTCTCA-3') and Kdm5b (5'-AGCACAGGGCAGGCTCCGCAACC-3') or five base mismatch control morpholinos for Kdm5a (5'-TGAaGGaCACaAAAcCCCTaTCA-3') and Kdm5b (5'-AcCAaAGGGaAGGaTCCGaAACC-3'). Embryos were cultured in G1 plus media (Vitrolife) until late 2-cell (35 h after hCG) and fixed in 2% PFA. Embryos were further treated as described above. Lysates from 132 two-cell embryos were prepared adding lysis buffer (20 mM Tris-HCl, pH 7.4, 20% glycerol, 0.5% NP40, 1 mM MgCl , 0.150 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 1 mM PMSF, 1× PIC, 1% SDS) to a final volume of 7 μl. Embryos were lysed on ice for 30 min with occasional vortexing and spinning. Embryos were vortexed and spun down at the end and were frozen on dry ice. Samples were subsequently thawed, sonicated on ultrasound bath for 1 min and centrifuged at 16,000g for 10 min followed by transfer of 5 μl supernatant to a new tube. The simple western immunoblots were performed on a PeggySue (ProteinSimple) using the Size Separation Master Kit with Split Buffer (12–230 kDa) according to the manufacturer’s standard instruction, using the following abtibodies: anti-Kdm5A (CellSignalling, 3876), anti-Kdm5b (Abcam, 181089) and anti-β-actin (Abcam, ab8227). The Compass software (ProteinSimple, version 2.7.1) was used to program the PeggySue-robot and for presentation (and quantification) of the western Immunoblots. Output data was displayed from the software-calculated average of seven exposures (5–480 s). Human NCCIT pluripotent embryonal carcinoma cell line was obtained from ATCC (CRL-2073), and cultured according to ATCC specifications. Mouse E14 ES cells were obtained from a stock at passage P2 equal to what was used for the mouse ENCODE project, and cultured according to that specified by the mouse ENCODE project (https://www.encodeproject.org/biosamples/ENCBS171HGC/). Cell lines were validated by ChIP–seq confirming species and a highly conserved profile. Cell lines were never passaged passed passage 15 for the work described here. Mycoplasma testing was carried out on a regular basis and both of the cell lines were free for Mycoplasma. Cross-linking of oocytes, 2-cell or 8-cell embryos. We added 50 μl M2 medium to a 0.6-ml tube. Embryos were then added and let settle to the bottom. Volume was controlled by eye by comparing to another 0.6-ml tube with 50 μl M2 medium and adjusted with mouth pipette to 50 μl. 50 μl of PBS with 2% formaldehyde was added to get a 1% final concentration and vortexed carefully, incubated at room temperature for 8 min, and vortexed once more. 12 μl of 1.25 M glycine stock (final concentration 125 mM) was added, mixed by gentle vortexing, incubated for 5 min at room temperature, and vortexed once during the incubation step. This was centrifuged at 700g for 10 min at 4 °C in a swinging-bucket rotor with soft deceleration settings and washed twice with 400 μl ice-cold PBS. A volume of 10 μl was left after the last wash, snap-frozen in liquid nitrogen and stored at −80 °C. Binding of antibodies to paramagnetic beads. The stock of paramagnetic Dynabeads Protein A was vortexed thoroughly to ensure the suspension was homogenous before pipetting. 100 μl of Dynabeads stock solution was transferred into a 1.5-ml tube, which was placed in a magnetic rack and the beads captured on the tube wall. The buffer was discarded, and the beads washed twice in 500 μl of RIPA buffer (10 mM Tris-HCl pH 8.0, 140 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% SDS, 0.1% Na-deoxycholate) and resuspended in RIPA buffer to a final volume of 100 μl. 96 μl of RIPA buffer was aliquoted into 200-μl PCR tubes on ice, the washed beads were vortexed thoroughly, and 2 μl of bead suspension and 2 μl of either antibody against H3K4me3 (Merck Millipore, 04-745) or to H3K27ac (Active Motif, catalogue number AM39133) was added to each of the 200 μl PCR tubes. This was then incubated at 40 r.p.m. on a ‘head-over-tail’ tube rotator for at least 4 h at 4 °C. Chromatin preparation. The desired number of cross-linked and frozen pools of embryos was removed from −80 °C storage and placed on dry ice in an insulated box (for example, four tubes with a total number of 1,000 2-cell embryos). 10 minutes of cross-linking was carried out during thawing as follows: one tube was moved at the time from dry-ice to ice for 5 s, and any frozen droplets quick pelleted by a brief spin in a mini-centrifuge. 100 μl of 1.1% formaldehyde solution was added (PBS with 1 mM EDTA, 1.1% formaldehyde, 20 mM sodium butyrate, 1 mM PMSF and protease inhibitor cocktail). The tubes were incubated for 10 min at room temperature and vortexed gently twice. 7 μl was added of 2.5 M glycine, vortexed gently and incubated for 5 min before the tube was moved to ice. Tubes were centrifuged at 750g for 10 min at 4 °C in a swinging-bucket rotor with soft deceleration settings, then washed twice with 400 μl PBS with 1 mM EDTA, 20 mM sodium butyrate, 1 mM PMSF and protease inhibitor cocktail. A volume of 10 μl was kept after the last wash. For four tubes, a total of 120 μl of 0.8% SDS lysis buffer with 20 mM sodium butyrate, 1 mM PMSF and protease inhibitor cocktail was used. First 60 μl, then 2 × 30 μl was used for two consecutive rounds of washing through the four tubes by pipetting. The same tip was used and the entire volume (160 μl) left in the last of the four tubes. The sample was sonicated for 5 × 30 s using a UP100H Ultrasonic Processor (Hielscher) fitted with a 2-mm probe. We allowed 30 s pauses on ice between each 30 s session, using pulse settings with 0.5 s cycles and 27% power. 170 μl RIPA Dilution buffer (10 mM Tris-HCl pH 8.0, 175 mM NaCl, 1 mM EDTA, 0.625 mM EGTA, 1.25% Triton X-100, 0.125% Na-deoxycholate, 20 mM sodium butyrate, 1 mM PMSF and protease inhibitor cocktail) was added. The sample was centrifuged at 12,000g in a swinging-bucket rotor for 10 min at 4 °C and the supernatant transferred to a 1.5-ml tube. 200 μl of RIPA Dilution buffer was added to the pellet and sonicated 3 × 30 s. The sample was centrifuged at 12,000g in a swinging-bucket rotor for 8 min, then the supernatant was removed and mixed well with the first supernatant, resulting in a total volume of about 530 μl of ChIP-ready chromatin. Immunoprecipitation and washes. Pre-incubated antibody–bead complexes were washed twice in 130 μl RIPA buffer by vortexing roughly. The tubes were centrifuged in a mini-centrifuge to bring down any solution trapped in the lid and antibody–bead complexes were captured in a magnetic rack cooled on ice. 250 μl of chromatin was added to each of anti H3K4me3 or H3K27ac reactions, and 25 μl kept for input control. 2 μl of cross-linked recombinant histone octameres and 1.25 μg of non-immunized rabbit IgG was immediately added to ChIP reactions, then incubated at 4 °C, 40 r.p.m. on a ‘head-over-tail’ rotator for 30 h. The chromatin–antibody–bead complexes were washed four times in 100 μl ice-cold RIPA buffer. The concentration of SDS and NaCl was titrated for each antibody to find optimal conditions for maximized signal-to-noise ratio. For H3K4me3, we washed 1× RIPA buffer with 0.2% SDS and 300 mM NaCl, 1× RIPA buffer with 0.23% SDS and 300 mM NaCl followed by 2× RIPA buffer with 0.2% SDS and 300 mM NaCl. For H3K27ac, we washed 4× RIPA buffer with 0.1% SDS and 140 mM NaCl. Each wash involved rough vortexing on full speed, repeated twice with pauses on ice in between. Next, a wash in 1 × 100 μl TE and tube shift was carried out as previously described32, 33. DNA isolation and purification. We removed TE and added 150 μl ChIP elution buffer (20 mM Tris-HCl pH 7.5, 50 mM NaCl, 5 mM EDTA. 1% SDS, 30 μg RNase A) and incubated at 37 °C, 1 h at 1,200 r.p.m. on a Thermomixer. 1 μl of Proteinase K (20 mg ml−1 stock) was added to each tube and incubated at 68 °C, 4 h at 1,250 r.p.m. Eluate was transferred to a 1.5-ml tube. A second elution with 150 μl was performed for 5 min and pooled with the first supernatant. ChIP DNA was purified by phenol-chloroform isoamylalcohol extraction, ethanol-precipitated with 10 μl acrylamide carrier as described previously32, 33 and dissolved in 10 μl EB (10 mM Tris-HCl). Library preparation and sequencing. ChIP and input library preparations were carried out according to the ThruPLEX (Rubicon Genomics) procedure with some modifications, including increased incubation times for the library purification and size selection. 12 ChIP libraries were pooled before AMPure XP purification and allowed to bind for 10 min after extensive mixing. Increased elution time, thorough mixing and the use of a strong neodymium bar magnet allowed for high recovery in elution volumes of 25 μl buffer EB. Sequencing procedures were carried out as described previously according to Illumina protocols with minor modifications (Illumina,). We sequenced all P12, P15, oocyte, 2-cell, and 8-cell ChIP–seq libraries as paired-end and all NCCIT ChIP–seq libraries as single-end. Mouse ES cell ChIP–seq libraries were sequenced as paired-end and single-end and the results were combined after mapping for analysis. Single-end and paired-end library information for all samples have been deposited in the GEO database (GSE72784). Sequence read alignment. We aligned single- and paired-end μChIP–seq reads from H3K27ac and H3K4me3 experiments to the mm10 reference genome by using BWA-mem34. For human ChIP–seq samples performed with human NCCIT cells, we aligned reads to the hg19 reference genome using BWA-mem. Unmapped and non-uniquely mapped reads were removed. We also removed PCR duplicate reads with Picard. H3K4me3 ChIP–seq data for heart, liver, and cerebellum were downloaded from the mouse ENCODE project26. H3K4me3 ChIP–seq data for sperm was downloaded from GEO database under accession number GSE42629 (ref. 23). Culture and collection of embryos. 2-cell stage embryos (2 × 25 embryos) were transferred to 350 μl of Buffer RLT (QIAgen RNaseay) (including β-Me according to manufacturer’s description) in a 1.5 ml low-binding tube and snap-frozen in liquid nitrogen and stored at −80 °C. Zygotes were cultured in M16 medium. For α-amanitin treatment the medium contained 10 μg ml−1 α-amanitin (Sigma, A2263). RNA extraction with QIAGEN RNeasy Micro Kit. RNAs were extracted by following QIAGEN RNeasy Micro handbook. Briefly, 25 embryos were disrupted by addition of buffer RLT followed by homogenization of the lysate. One volume of 70% EtOH was added to the lysate, transferred to an RNeasy MinElute spin column, and centrifuged for 15 s. Next, 350 μl of buffer RW1 from QIAGEN RNeasy Micro Kit was added to wash the RNeasy MinElute spin column by 15 s centrifugation. 10 μl DNase I mix was added to the RNeasy MinElute spin column membrane (10 μl DNase + 70 μl buffer RDD) and incubated at room temperature for 15 min. The spin column membrane was washed twice with 500 μl buffer RPE from the QIAGEN RNeasy Micro Kit followed by 500 μl of 80% EtOH. 14 μl RNase-free water was added directly to the centre of the spin column membrane and centrifuged to elute RNA. RNA amplification with NuGEN Ovation RNA-seq system V2. Extracted RNA was amplified by following the NuGEN ovation RNA-seq handbook. Briefly, step 1 was first-strand cDNA synthesis. 2 μl of First Strand Primer Mix from NuGEN Ovation RNA-seq system V2 was added to a PCR tube followed by addition of 5 μl of total RNA sample, and the thermal cycler for primer annealing was run (65 °C for 2 min, held at 4 °C). 3 μl of the First Strand Master Mix from NuGEN Ovation RNA-seq system V2 was added to each tube and thermal cycler for first strand synthesis was run (4 °C for 1 min; 25 °C for 10 min; 42 °C for 10 min, 70 °C for 15 min, held at 4 °C). Step 2 was second-strand cDNA synthesis. 10 μl of the second-strand mix from NuGEN Ovation RNA-seq system V2 was added to each first-strand reaction tube and the thermal cycler was run (4 °C for 1 min; 25 °C for 10 min; 50 °C for 30 min; 80 °C for 20 min; hold at 4 °C). Step 3 was purification of cDNA with Agencourt RNAClean XP beads. Step 4 was SPIA amplification. 40 μl of the SPIA master Mix from NuGEN Ovation RNA-seq system V2 was added to each tube containing the double-stranded cDNA bound to the Agencourt RNAClean XP beads, and the thermal cycler was run to amplify double-stranded cDNA (4 °C for 1 min; 47 °C for 60 min; 80 °C for 20 min, held at 4 °C). The tubes were transferred to the magnet and 40 μl of the supernatant containing the SPIA cDNA was transferred to a new tube, followed by SPIA cDNA purification with QIAGEN MinElute reaction cleanup kit. Library preparation and sequencing. The volume and concentration of purified SPIA cDNA to 500 ng in 100 μl and sonicated SPIA cDNA with Covaris M220 ultrasonicator was adjusted to 400 bp DNA fragment size. Library preparation was carried out according to TruSeq library preparation. Sequencing procedures were carried out as described previously according to Illumina HiSeq2500 protocols with minor modifications (Illumina). DNA methylation libraries of growing oocytes obtained from day 12 (P12) and day 15 (P15) mice were constructed with a modified library protocol from ref. 2. Briefly, 100-500 embryos were lysed in 5 μl lysis buffer (20 mM Tris, 2 mM EDTA, 20 mM KCl, 1 mg ml−1 proteinase K (QIAGEN)) for 1.5 h at 56 °C. followed by heat-inactivation for 30 min at 75 °C. 45 μl nuclease-free water and 0.5% Lamda DNA (Promega) spike-in was added into the lysate. DNA was fragmented with Covaris M220 ultrasonicator and incubated at 37 °C to reduce volume to 30 μl. The fragmented DNA was end-repaired by incubating with 5 μl end-repair enzyme mixture (3.5μl T4 DNA ligase buffer (NEB), 0.35 μl 10 mM dNTP, 1.15 μl NEBNext End Repair Enzyme Mix (NEB)) for 30 min at 20 °C, followed by heat-inactivation for 30 min at 75 °C. Then, 5 μl of dA-tailing mixture (0.5 μl T4 DNA ligase buffer, 1 μl Klenow exo- (NEB), 0.5 μl 100 mM dATP and 3 μl nuclease free water) was added and incubated for 30 min at 37 °C, followed by heat-inactivation for 30 min at 75 °C. Finally, 10 μl ligation mixture (1 μl T4 DNA ligase buffer, 0.5 μl 100 mM ATP, 1.5 μl 50 mM cytosine methylated Illumina adaptor, 2 μl T4 DNA ligase (NEB) and 5 μl nuclease-free water) was added and incubated at 16 °C overnight. 100 ng Carrier RNA (Ambion) was added into the tube. Bisulfite conversion reaction was performed with the EZ DNA methylation-Gold Kit (Zymo Research) according to the manufacturer’s instructions. The purified DNA was then amplified with 6 cycles PCR by using KAPA HiFi HotStart Uracil+ DNA polymerase (KAPA). Amplified DNA was purified with Ampure XP beads (Beckman) to discard the short fragments and adaptor-self ligations. Then, another round of 6–8 cycles of PCR was performed to obtain sufficient molecules for sequencing. Sequencing procedures were carried out as described previously according to Illumina HiSeq2500 protocols with minor modifications (Illumina). Reads were trimmed by Trimmomatic35 with default parameters to remove the reads containing adapters and showing low quality. Trimmed reads were aligned by using Bismark (V12.5)36 Bisulfite Mapper against the mouse reference genome mm10 with parameters: -N 1 –score_min L,0,-0.6. Duplicate reads were removed with Picard after splitting aligned reads into Watson and Crick strands. CpG methylation level was extracted with Samtools mpileup. Strands were merged to calculate the CpG methylation level per dinucleotide CpG site. Methylation level was calculated for each site spanned by at least 4 reads. During RNA-seq data analysis we used GENCODE gene annotation v3. We considered all level 1 and 2 genes and included level 3 protein-coding genes. To define gene expression levels, mouse oocytes, 2-cell, and 8-cell stage embryos RNA-seq data sets were downloaded from the GEO database with accession number GSE44183 (ref. 8). Mouse ES cell RNA-seq data were downloaded from GEO database with accession number GSE39619. RNA-seq reads were aligned to the mm10 reference genome using BWA-mem. Unmapped and non-uniquely mapped reads were removed. Gene expression values were obtained based on GENCODE annotation v3 and normalized to fragments per kilobase of transcript per million mapped (FPKM) values using Cufflinks37. Whole-genome bisulfite sequencing (WGBS) data from sperm was obtained from GEO database with accession number GSE56697 (ref. 2). Oocyte DNA methylation data was obtained from GEO database under accession number GSE56879 (ref. 19). We combined all data from 12 individual MII oocytes and the bulk oocyte sample. Deeply sequenced results were used for MII oocyte with number 2 and 5. WGBS data for GVO and NGO stage oocytes were obtained through personal communication with the authors22. We performed broad peak calling for H3Kme3 in oocytes based on MACS2 broad peak calling algorithm with default parameters (–format = BAM -g mm -m 5 50 -p 1e-5 –broad) followed by combining adjacent peaks within 5 kb. We determined the optimal distance to combine adjacent peaks on the basis of the number of broad H3K4me3 domains at varying distance thresholds. At 5 kb distance threshold, the number of broad domains became stable as shown in Extended Data Fig. 5b. On the basis of the location of transcription start sites (GENCODE v3), we classified broad H3K4me3 domains into two groups as TSS-containing and non-TSS-containing domains. The basic idea of RPKM values is to calculate relative ChIP signal enrichment for a given genomic region compared to the entire genome to normalize different sequencing depth between samples. This approach is reasonable when the total amount of ChIP DNA is similar between samples, and in general the fraction of genomic regions covered by each histone modification mark is similar between samples such as that H3K4me3 marks around 1–3% of the human genome in cells/tissues assessed to date. Therefore by using RPKM values, one can simply avoid a potential bias caused by different sequencing depth. However, if a sample shows an extraordinary ChIP signal distribution, the sample with much larger genomic regions covered with, for example, H3K4me3 tends to show relatively lower RPKM values owing to the large amount of total ChIP signal. In oocytes, we observed such notably broadly distributed H3K4me3 signals, resulting in lower RPKM values than other samples when we consider the top-ranked promoter regions in terms of H3K4me3 signal (Extended Data Fig. 5d). In this regard, to compare H3K4me3 signals fairly between samples, we need to adjust H3K4me3 RPKM values in each cell type. In order to adjust H3K4me3 RPKM values between samples, we used the top-5,000 ranked promoters in terms of H3K4me3 level as internal control regions during H3K4me3 normalization. We calculated H3K4me3-adjustment scaling factors on the basis of the H3K4me3 ChIP signals at the top 5,000 ranked promoters, with the assumption that the promoters with the highest H3K4me3 levels in each cell type represent fully H3K4me3-modified promoters and have similar H3K4me3 signal levels. In support of this assumption, all oocyte and embryo samples represent highly homogenous cell populations, thus it is plausible that most or all cells carry the H3K4me3 mark at the cell-type-specific top-ranked promoters. Furthermore, ChIP conditions were kept the same for all samples. As expected, we observed very similar H3K4me3 signals between samples exhibiting only canonical H3K4me3 patterns when we consider the same number of top-ranked promoters (Extended Data Fig. 5e). On the basis of this observation, we calculated H3K4me3 RPKM adjustment scaling factors for different numbers of the top-ranked promoters (Extended Data Fig. 5f). The scaling factors were calculated by dividing median H3K4me3 RPKM values at the top-ranked promoters in each sample by median H3K4me3 RPKM value at the top-ranked promoters in mES cells. Importantly, the scaling factors are very robust regardless of the number of promoters analysed, indicating that there is a systematic bias caused by different genomic coverage of H3K4me3. Indeed, the adjustment scaling factors are supported by the qPCR-quantified amount of ChIP DNA that is precipitated in each experiment (Supplementary Table 2). Therefore, in this study, we defined the scaling factors based on the top 5,000 most highly ranked promoters. We downloaded a list of maternally expressed genes from GEO database under accession number GSE45719 (ref. 7). We excluded all genes expressed in oocytes to allow us to distinguish maternally expressed genes in the early embryo. We considered genes with less than 0.3 FPKM values as not expressed. On the basis of the extracted genes, we tested whether maternally expressed genes are enriched within broad H3K4me3 domains. The number of genes expected by chance was calculated on the basis of the fraction of all genes located within broad H3K4me3 domains. The significance of enrichment of maternally expressed genes was calculated by Fisher-exact tests. P values were 1.9−8, 2.9−9, 1.6−4, 8.2−6, 2.8−4, 8.0−4 for zygote, early 2-cell-, mid 2-cell-, late 2-cell-, 4-cell-, and 8-cell-stage embryos, respectively. We used a predefined ZGA gene list obtained from a previous study5. The list of oocyte-specific genes (denoted as maternal RNA) was also obtained from the same study after excluding any genes showing less than 0.3 FPKM values in oocytes. Visualization and preceding analysis was done using EaSeq and its integrated tools38. Heat maps were generated using the ‘HeatMap’ tool, and superimposed tracks were generated using the ‘FillTrack’ tool. Data were imported using default settings and all values were normalized to FPKM and scaled as described above (see ‘An adjustment of H3K4me3 RPKM values’). Distances from and orientation of each TSS to the nearest domain centre were calculated using the ‘Colocalize’ tool, and the ‘Sort’ tool was used to order the TSS in the heat maps according to these distances or for ordering heat maps according to domain size. We only considered broad H3K4me3 domains that span more than 5 kbp DNA to avoid any overlapping information at domain boundaries between 5′ and 3′ends of domains. Clustering of domain boundaries was carried out by: (1) quantifying normalized and scaled H3K4me3 RPKM values for P12, P15, and oocyte samples at a set of regions corresponding to the most proximal 2 kbp within the boundary and average DNA methylation frequency for NGO, P12, P15, GVO and oocyte samples at a set of regions corresponding to the most proximal 2 kbp outside of the domain boundaries using the EaSeq (ref. 38) ‘Quantify’-tool (settings: ‘Start = Center, offset = -1000, Fixed width’, ‘End = Center, offset = 1000, Fixed width’, ‘Normalize to reads pr. million, checked’, ‘Normalize to signal size of, unchecked’, ‘Normalized counts to fragments, checked’, ‘Present values as Z-scores, unchecked’); then (2) clustering the boundaries based on this quantified signal using EaSeq’s ‘ClusterP’-tool (settings: ‘Log-Transform, unchecked’, ‘Normalize parameters to average signal’, ‘k-means clustering, checked’, ‘k = 10’, ‘g = 0’). The order of the clusters was changed manually. Distances from each boundary to nearest CGI were calculated using a set of CGIs downloaded from the UCSC table browser and ‘Colocalize’-tool. We predicted distal cis-regulatory elements on the basis of H3K27ac μChIP–seq results. We combined two biological replicates for each cell type and called H3K27ac peaks using MACS2 with the following parameters (–format = BAM -g mm -m 5 50 -p 1e-5). To directly compare the activity of distal cis-regulatory elements between cell types, we defined putative distal cis-regulatory elements by combining all H3K27ac peaks from oocytes, 2-cell and 8-cell embryos and ES cells after excluding chrY, chrM, and any peaks within 2.5 kb from known transcription start sites (GENCODE v3). The activity for each distal cis-regulatory element in each cell type was defined by taking the log ratio between H3K27ac ChIP–seq and input RPKM values. On the basis of the activity of distal cis-regulatory elements, we performed k-means clustering. 20 clusters were defined with Euclidian distance metric followed by reordering clusters manually. On the basis of the clustered patterns, we identified stage-restricted distal cis-regulatory elements. We defined nearby genes of each cRE when the distance between gene TSS and each distal cRE is less than 15 kb. Similarly, in order to define nearby distal cREs for ZGA genes, we combined all distal cREs within 15 kb from each ZGA gene TSS. We used HOMER to find enriched transcription factor motif sequences in distal cREs for each developmental stage. We also performed GREAT39 analysis for each class of stage-restricted distal cREs using the settings ‘single nearest gene’, ‘within 300 kb’ of the enriched H3K27ac region, and no curated regions. In order to identify genes with a certain transcription factors in nearby cREs, we carried out STORM40 motif search with –f –t 0.9 parameters for nearby cREs within 15 kb from each TSS. Each transcription factor motif position weight matrix was obtained from HOMER motif search41 results. The genes with a certain transcription factor in nearby cREs were called if any cREs within 15 kb from the TSS matched with the corresponding transcription factor motif sequence. We called downregulated genes between Kdm5a and Kdm5b MO injected and control MO injected 2-cell embryos when gene FPKM values were 1.5-fold or more reduced in both of the two biological replicates. Additionally, we called experimental stage specific ZGA genes when gene FPKM values were twofold or more reduced in α-amanitin treated embryos as compared to control MO injected embryos. The rational for identifying the experimental stage-specific ZGA genes comes from the observation that the composition of the transcriptome changes dramatically and rapidly during the 2-cell stage7. Although α-amanitin-treated embryos blocked polymerase II transcription from the early 1-cell stage onwards, de novo transcription-independent degradation of maternal RNA may still occur. Therefore, they provide a well-suited control for defining the experimental stage-specific ZGA genes when compared to the control morpholino-injected embryos. As a result, we identified 7,132 putative experimental stage-specific ZGA genes and these genes are significantly overlapped with the ZGA gene list obtained from a previous study5 (hypergeometric P value is 0). KDM5A- and KDM5B-depleted embryos showed that 1,303 ZGA genes are downregulated among 7,132 experimental stage-specific ZGA genes, whereas 980 non-ZGA genes are downregulated among 25,155 genes. We visualized ChIP–seq and RNA-seq data on the basis of raw read depth after converting aligned bam files to wig files using genomeCoverageBed and wigTobigWig utilities.


News Article | November 25, 2015
Site: www.nature.com

All mice were maintained on a C57BL/6 background, including ScfGFP (ref. 19), Scffl/+ (ref. 19), Cxcl12DsRed (ref. 18), Cxcl12fl/+ (ref. 18), R26tdTomato (ref. 26), Vav1-cre (ref. 24), Leprcre (ref. 27), Tcf21cre/ER (ref. 21) and α-catulinGFP. To induce Cre/ER activity in Tcf21cre/ER mice, 4–6-week-old mice were administered 2 mg tamoxifen (Sigma) daily by oral gavage for 12 consecutive days. For induction of EMH, mice were injected at day 0 with a single dose of 4 mg cyclophosphamide followed by daily injections of 5 μg G-CSF for 4–21 days. Both male and female mice were used. All mice were housed in the Animal Resource Center at the University of Texas Southwestern Medical Center (UTSW). All procedures were approved by the UTSW Institutional Animal Care and Use Committee. Bone marrow cells were isolated by flushing the femur or tibia with Ca2+- and Mg2+-free HBSS with 2% heat-inactivated bovine serum using a 3 ml syringe fitted with a 25-gauge needle. Spleen cells were obtained by crushing the spleen between two frosted slides. The cells were dissociated to a single-cell suspension by gently passing through the needle several times and then filtering through a 40-μm nylon mesh. Blood was collected by cardiac puncture, and white blood cells were isolated by ficoll centrifugation according to the manufacturer’s instructions (GE Healthcare). The following antibodies were used to isolate HSCs: anti-CD150 (TC15-12F12.2), anti-CD48 (HM48-1), anti-Sca-1 (E13-161.7), anti-c-kit (2B8) and the following antibodies against lineage markers (anti-Ter119, anti-B220 (6B2), anti-Gr-1 (8C5), anti-CD2 (RM2-5), anti-CD3 (17A2), anti-CD5 (53-7.3) and anti-CD8 (53-6.7)). Haematopoietic progenitors were identified by flow cytometry using the following antibodies: anti-Sca-1 (E13-161.7), anti-c-Kit (2B8) and the following antibodies against lineage markers (anti-Ter119, anti-B220 (6B2), anti-Gr-1 (8C5), anti-CD2 (RM2-5), anti-CD3 (17A2), anti-CD5 (53-7.3) and anti-CD8 (53-6.7)), anti-CD34 (RAM34), anti-CD135 (Flt3) (A2F10), anti-CD16/32 (FcγR) (93), anti-CD127 (IL7Rα) (A7R34), anti-CD24 (M1/69), anti-CD43 (1B11), anti-B220 (6B2), anti-IgM (II/41), anti-CD3 (17A2), anti-Gr-1 (8C5), anti-Mac-1 (M1/70), anti-CD41 (MWReg30), anti-CD71 (C2) and anti-Ter119. 4′,6-Diamidino-2-phenylindole (DAPI) was used to exclude dead cells. Antibodies were obtained from eBioscience or BD Bioscience. To isolate bone marrow stromal cells the marrow was gently flushed out of the bone marrow cavity with a 3-ml syringe fitted with a 23-guage needle and then transferred into 1 ml pre-warmed bone marrow digestion solution (200 U ml−1 DNase I (Sigma), 250 μg ml−1 LiberaseDL (Roche) in HBSS plus Ca2+ and Mg2+) and incubated at 37 °C for 30 min with gentle shaking. To isolate splenic stromal cells, the spleen capsule was cut into ~1 mm3 fragments using scissors and then digested as described earlier in spleen digestion solution (200 U ml−1 DNase I, 250 μg ml−1 LiberaseDL, 1 mg ml−1 collagenase, type 4 (Roche) and 500 μg ml−1 collagenase D (Roche) in HBSS plus Ca2+ and Mg2+). After a brief vortex, the spleen fragments were allowed to sediment for ~3 min and the supernatant was transferred to another tube on ice. The sedimented (undigested) spleen fragments were subjected to a second round of digestion. The two fractions of digested cells were pooled and filtered through a 100-μm nylon mesh. Anti-PDGFR-α (APA5), anti-PDGFR-β (APB5), anti-LepR (R&D), anti-CD45 (30F-11) and anti-Ter119 antibodies were used to isolate stromal cells. For analysis of endothelial cells, mice were injected intravenously into the retro-orbital venous sinus with 10 μg Alexa-Fluor-660-conjugated anti-VE-cadherin antibody (BV13) 10 min before being killed. Samples were analysed using a FACSAria or FACSCanto II flow cytometer (BD Biosciences). To assess BrdU incorporation into spleen cells after EMH induction, mice were intraperitoneally injected with a single dose of BrdU (2 mg BrdU per mouse) then maintained on 0.5 mg BrdU per ml drinking water for 7 days. Endothelial cells were labelled by intravenous injection of an anti-VE-cadherin antibody (eBioscience). Enzymatically dissociated spleen cells were stained with antibodies against surface markers and the target cell populations were sorted then resorted to ensure purity. The sorted cells were then fixed, and stained with an anti-BrdU antibody using the BrdU APC Flow Kit (BD Biosciences) according to the manufacturer’s instructions. Adult recipient mice were irradiated using an XRAD 320 X-ray irradiator (Precision X-Ray) with two doses of 540 rad (total 1,080 rad) delivered at least 2 h apart. Cells were injected into the retro-orbital venous sinus of anaesthetized mice. Sorted doses of splenocytes from donor mice with EMH were transplanted along with 3 × 105 recipient bone marrow cells. Recipient mice were bled every 4 weeks to assess the level of donor-derived blood cells, including myeloid, B and T cells for at least 16 weeks. Blood was subjected to ammonium chloride/potassium red cell lysis before antibody staining. Antibodies including anti-CD45.2 (104), anti-CD45.1 (A20), anti-Gr1 (8C5), anti-Mac-1 (M1/70), anti-B220 (6B2) and anti-CD3 (KT31.1) were used for flow cytometric analysis. For bone marrow sections, freshly dissected bones were fixed in 4% paraformaldehyde overnight followed by 3 days of decalcification in 10% EDTA dissolved in PBS. Bones were sectioned using the CryoJane tape-transfer system (Instrumedics). For spleen sections, freshly dissected spleens were fixed in 4% paraformaldehyde for 1 h followed by 1 day incubation in 10% sucrose in PBS. Frozen spleens were sectioned with a cryostat (Leica). For whole mount imaging, spleens were sectioned into ~2 mm pieces. Spleen sections were blocked in PBS with 10% horse serum for 1 h and then stained overnight with chicken-anti-GFP (Aves) and/or rabbit-anti-laminin (Abcam) antibodies. Donkey-anti-chicken Alexa Fluor 488 and/or donkey-anti-rabbit Alexa Fluor 647 were used as secondary antibodies (Invitrogen). Specimens were mounted with anti-fade prolong gold (Invitrogen) and images were acquired with either a Zeiss LSM780 confocal microscope or a Leica SP8 confocal microscope equipped with a resonant scanner. Three-dimensional images were achieved using Bitplane Imaris v.7.7.1 software. Spleens were harvested and fixed for 4 h in 4% PFA at 4 °C. Since the spleen capsule is highly autofluorescent, spleens were sectioned perpendicular to the long axis into 300-μm-thick sections using a Leica VT100S vibrotome. These 300-μm sections were fixed for an additional 2 h in 4% PFA and blocked overnight in staining solution (10% dimethylsulfoxide (DMSO), 0.5% IgePal630 (Sigma) and 5% donkey serum (Jackson Immunoresearch) in PBS). All staining steps were performed in staining solution on a rotator at room temperature. Spleen sections were stained for 3 days in primary antibodies, washed overnight in several changes of PBS then stained for 3 days in secondary antibodies. The stained sections were dehydrated in a methanol dehydration series then incubated for 3 h in 100% methanol with several changes. The methanol was then exchanged with benzyl alcohol:benzyl benzoate 1:2 mix (BABB clearing28). The tissues were incubated in BABB for 3 h to overnight with several exchanges of fresh BABB. Spleen sections were mounted in BABB between two coverslips and sealed with silicone (Premium waterproof silicone II clear; General Electric). We found it necessary to clean the BABB of peroxides (which can accumulate as a result of exposure to air and light) by adding 10 g of activated aluminium oxide (Sigma) to 40 ml of BABB and rotating for at least 1 h, then centrifuging at 2,000 g for 10 min to remove the suspended aluminium oxide particles. Images were acquired using a Zeiss LSM780 confocal microscope with a Zeiss LD LCI Plan-Apo ×25/0.8 multi-immersion objective lens, which has a 570 μm working distance. Images were taken at 512 × 512 pixel resolution with 2 μm Z-steps, pinhole for the internal detector at 47.7 μm. Random spots were inserted into images by generating randomized X, Y, and Z coordinates using the random integer generator at http:// www.random.org. After mouse anaesthesia by ketamine/xylazine, a ventral midline incision was made and the peritoneum was breached. The splenic blood vessels were ligated with an absorbable suture (4-0 vicryl). The splenic vessels were cut distal to the suture and the spleen was removed. The vessels were cauterized and the abdomen was sutured with non-absorbable sutures (3-0 Tevdek III). Buprenorphine was administered every 12 h for 3 days to minimize postoperative pain and mice were maintained with ampicillin-containing water to avoid infection. Complete blood counts were measured one month after the survival surgery. EMH was induced by repeated bleeding over a 2-week period according to a published protocol2. Briefly, 4–6 month-old mice were bled via the tail vein five times, every 3 days, removing approximately 250 μl of blood each time, then the mice were killed for analysis 2 days after the last bleed. Approximately 30,000 CD45−Ter119−VE-cadherin+ splenic endothelial cells were flow cytometrically sorted into 50 μl of 66% trichoracetic acid (TCA) in water. Extracts were incubated on ice for at least 15 min and centrifuged at 16,100 g at 4 °C for 10 min. Precipitates were washed in acetone twice and the dried pellets were solubilized in 9 M urea, 2% Triton X-100, and 1% dithiothreitol (DTT). Samples were separated on 4–12% Bis-Tris polyacrylamide gels (Invitrogen) and transferred to PVDF membrane (Millipore). The blots were incubated with primary antibodies overnight at 4 °C and then with secondary antibodies. Blots were developed with the SuperSignal West Femtochemiluminescence kit (Thermo Scientific). Primary antibodies used: rabbit-anti-SCF (Abcam, 1:1,000) and mouse-anti-actin (Santa Cruz, clone AC-15, 1:20,000). Cells were sorted directly into Trizol (Life Technologies). Total RNA was extracted according to the manufacturer’s instructions. Total RNA was reverse transcribed using SuperScript III Reverse Transcriptase (Life Technologies). Quantitative real-time PCR was performed using SYBR green on a LightCycler 480 (Roche). β-Actin was used to normalize the RNA content of samples. Primers used in this study were Scf: 5′-GCCAGAAACTAGATCCTTTACTCCTGA-3′ and 5′-CATAAATGGTTTTGTGACACTGACTCTG-3′; β-actin: 5′-GCTCTTTTCCAGCCTTCCTT-3′ and 5′-CTTCTGCATCCTGTCAGCAA-3′. Three independent samples of 5,000 spleen Scf-GFP+VE-cadherin− spleen stromal cells and two independent samples of 5,000 unfractionated spleen cells were flow cytometrically sorted into Trizol. Total RNA was extracted, amplified, and sense strand cDNA was generated using the Ovation Pico WTA System V2 (NuGEN) according to the manufacturer’s instructions. cDNA was fragmented and biotinylated using the Encore Biotin Module (NuGEN) according to the manufacturer’s instructions. Labelled cDNA was hybridized to Affymetrix Mouse Gene ST 1.0 chips according to the manufacturer’s instructions. Expression values for all probes were normalized and determined using the robust multi-array average (RMA) method29. Panels in all figures represented multiple independent experiments performed on different days with different mice. Sample sizes were not based on power calculations. No randomization or blinding was performed. No animals were excluded from analysis. Variation is always indicated using standard deviation. For analysis of the statistical significance of differences between two groups we generally performed two-tailed Student’s t-tests. For analysis of the statistical significance of differences among more than two groups, we performed repeated measures one-way analysis of variance (ANOVA) tests with Greenhouse–Geisser correction (variances between groups were not equal) and Tukey’s multiple comparison tests with individual variances computed for each comparison. To assess the statistical significance of differences in fetal mass between paired control and mutant mice (Fig. 5j and Extended Data Fig. 8v), we performed a two-way ANOVA.


Beane J.,Boston University | Vick J.,Boston University | Schembri F.,Boston University | Anderlind C.,Boston University | And 12 more authors.
Cancer Prevention Research | Year: 2011

Cigarette smoke creates a molecular field of injury in epithelial cells that line the respiratory tract. We hypothesized that transcriptome sequencing (RNA-Seq) will enhance our understanding of the field of molecular injury in response to tobacco smoke exposure and lung cancer pathogenesis by identifying gene expression differences not interrogated or accurately measured by microarrays. We sequenced the highmolecular-weight fraction of total RNA (>200 nt) from pooled bronchial airway epithelial cell brushings (n = 3 patients per pool) obtained during bronchoscopy from healthy never smoker (NS) and current smoker (S) volunteers and smokers with (C) and without (NC) lung cancer undergoing lung nodule resection surgery. RNA-Seq libraries were prepared using 2 distinct approaches, one capable of capturing non-polyadenylated RNA (the prototype NuGEN Ovation RNA-Seq protocol) and the other designed to measure only polyadenylated RNA (the standard Illumina mRNA-Seq protocol) followed by sequencing generating approximately 29 million 36 nt reads per pool and approximately 22 million 75 nt paired-end reads per pool, respectively. The NuGEN protocol captured additional transcripts not detected by the Illumina protocol at the expense of reduced coverage of polyadenylated transcripts, while longer read lengths and a paired-end sequencing strategy significantly improved the number of reads that could be aligned to the genome. The aligned reads derived from the two complementary protocols were used to define the compendium of genes expressed in the airway epithelium (n = 20,573 genes). Pathways related to the metabolism of xenobiotics by cytochrome P450, retinol metabolism, and oxidoreductase activity were enriched among genes differentially expressed in smokers, whereas chemokine signaling pathways, cytokine-cytokine receptor interactions, and cell adhesion molecules were enriched among genes differentially expressed in smokers with lung cancer. There was a significant correlation between the RNA-Seq gene expression data and Affymetrix microarray data generated from the same samples (P < 0.001); however, the RNA-Seq data detected additional smoking- and cancer-related transcripts whose expression was were either not interrogated by or was not found to be significantly altered when using microarrays, including smokingrelated changes in the inflammatory genes S100A8 and S100A9 and cancer-related changes in MUC5AC and secretoglobin (SCGB3A1). Quantitative real-time PCR confirmed differential expression of select genes and non-coding RNAs within individual samples. These results demonstrate that transcriptome sequencing has the potential to provide new insights into the biology of the airway field of injury associated with smoking and lung cancer. The measurement of both coding and non-coding transcripts by RNA-Seq has the potential to help elucidate mechanisms of response to tobacco smoke and to identify additional biomarkers of lung cancer risk and novel targets for chemoprevention. ©2011 AACR.

Loading NuGEN collaborators
Loading NuGEN collaborators