Hyderabad, India
Hyderabad, India

Neuros Technology is a Chicago, Illinois–based company that produces a number of audio and video devices with the brand name Neuros. Founded by Joe Born in 2001 as a division of Digital Innovations and previously operated under the name Neuros Audio. Like Digital Innovations, Neuros is distinguished by its use of open-innovation and crowdsourcing techniques in bringing products to market, as well as its prominent use of open-source software and open-source hardware. In its development model, end users are involved throughout the product development process from reviewing initial concepts to Beta testing initial product releases. Wikipedia.

SEARCH FILTERS
Time filter
Source Type

Animals were treated in strict accordance with the guidelines outlined by the Canadian Council on Animal Care (http://www.ccac.ca/), and experiments adhered to protocols approved by the Facility Animal Care Committee of McGill University (protocol no. 1190). Long–Evans rats (80−150 g) and C57/B6 mice (60−90 d) were obtained from Charles River Laboratories. VP-Cre (VP-IRES2-Cre-D) knock-in mice were bred in our colony with either ChETA (R26-CAG-LSL-2XChETA-tdTomato) or ArchT mice (Ai40D; obtained from Jackson Laboratories). V1aR knock-out (V1aR−/−) mice were bred in our colony (obtained from J. N. Crawley)27. All experiments were performed on male animals, except for one experiment (Extended Data Fig. 8) where a female was used. In vitro experiments were performed on mice aged 2−4 months, experiments on rats were done on animals weighing 80−150 g, and in vivo mouse experiments were done on animals aged 2−3 months. Animals were subjected to a strict 12 h:12 h light:dark cycle. C57/B6 mice were individually housed in computer-interfaced metabolic Oxylet cages from PanLab (Harvard Apparatus) to measure water intake. Animals were placed in cages and allowed to habituate to the cages for 4−6 days. To obtain the average circadian profile of water intake, we obtained hourly averages from each subject between ZT6.5 and ZT6.5 on the following day. Data files were analysed using Metabolism (version 2.1.04; PanLab) and Microsoft Excel. Statistical analysis was performed in Sigmaplot (Version 12.3, Systat Software). Since we cannot obtain serial measures of serum osmolality in individual C57/B6 mice, we used a group approach whereby data were collected from multiple (3−18) subjects that were killed at each time point tested. To this end, mice were anaesthetized with isoflurane and rapidly decapitated to obtain blood samples, core body temperature using a digital thermometer, and haematocrit using a ZipCombo Centrifuge from LW Scientific. Blood samples were placed on ice and allowed to clot at 2−4  C for 60 min, after which they were centrifuged for 5 min, and serum osmolality was measured in duplicate using a micro-osmometer (Advanced Instruments). The objective of this experiment (Fig. 1c, d), was to deny the surge in water intake, while preserving water intake levels during the AP equivalent to levels during the BP. Because water intake between ZT21.5 and ZT22.5 is equivalent to water intake between ZT19.5 and ZT21.5 (BP), we allowed water intake to proceed until ZT22.5 before removing access to water. Water was removed from C57/B6 mouse cages at either ZT22.5 (no AP surge allowed) or ZT23.5 (AP surge allowed). Access to water overnight was denied to prevent compensatory drinking and allow a specific evaluation of the impact of the AP surge alone. Animals were then killed at ZT10 and blood samples were collected to measure serum osmolality and haematocrit as explained above. Horizontal hypothalamic slices containing the OVLT and SCN were prepared from 2−4-month-old male ArchT or ChETA mice. These animals were not subjected to any behavioural or optogenetic experiments before slice preparation. Mice anaesthetized with isoflurane were killed by decapitation at ZT18–18.5. The brain was rapidly removed and immersed in near-freezing (0–4 °C) oxygenated (95% O , 5% CO ) artificial mouse cerebrospinal fluid (AMCSF) composed of the following (in mM): 128 NaCl, 3 KCl, 1.23 NaH PO , 1.48 MgCl , 2 CaCl , 25.95 NaHCO and 10 d-glucose (all obtained from Sigma except for NaCl and CaCl , which were purchased from Fisher Scientific). A trimmed block of brain was glued, cortex down with the rostral pole facing upwards, to a mounting block angled at 34° relative to the horizontal plane. A single 350-μm slice was then obtained (Extended Data Fig. 2) and transferred dorsal side up to a beaker containing warmed (32 °C) oxygenated AMCSF and allowed to incubate for 60 min. The slice was then transferred dorsal side up to a recording chamber where it was perfused with warmed (32 °C) oxygenated AMCSF at a rate of 2–3 ml min−1. Cells were observed on a black and white monitor using an Olympus BX51WI upright microscope coupled to a video camera. Electrodes were visually guided to the cell using a motorized micromanipulator (s.d. Instruments) and cell-attached recordings were made using a MultiClamp 700B amplifier (Molecular Devices). Membrane voltage was digitized via a Digidata 1440A interface coupled to a personal computer running Clampex 10.3 software (Molecular Devices). A band-pass filter was applied during cell-attached recordings (800 Hz–1.8 kHz). Patch pipettes were back-filled with AMCSF and their resistance in the bath was 5.5−7.5 MΩ. Cell-attached recordings for firing rates of OVLT neurons during the BP were performed from ZT19.5 to ZT21.5 and during the AP from ZT21.5 to ZT23.5. Cell-attached recordings from OVLT neurons were obtained by making a loose seal. If cells did not fire during the recording, a brief zap of 25 μs was delivered at the end of the recording to evoke firing in order to confirm they were indeed silent cells that were otherwise capable of firing detectable action potentials. The average firing rate was calculated by dividing the total number of spikes recorded by the duration of the recording period (60 s). One cell was excluded from this analysis because its firing rate was more than four times greater than the standard deviation of the group. Evans blue was used to evaluate the boundaries of the OVLT in mice as previously reported for rat28. Briefly, mice were anaesthetized with isoflurane and injected intravenously with 0.2 ml of 1% Evans blue dissolved in PBS. After 15 min, the animals were transcardially perfused with 20 ml PBS, and then the brain was extracted and fixed by immersion for at least 48 h in 4% paraformaldehyde (PFA) dissolved in PBS. Serial sections (50 μm thick) were cut and mounted onto slides, and Evans blue fluorescence was visualized using RS Image (version 1.9.2; Roper Scientific) using a 10× objective (na = 0.4) attached to an Olympus BX51WI upright microscope and a CoolSnap HQ camera (Photometrics). Fluorescence was observed at 700 nm and excited at 650 nm using an X-Cite XLED1 system (Lumen Dynamics, Excelitas Canada) and a BrightLine Pinkel filter set (DA/FI/TR/Cy5-4X-B-OMF; Semrock). C57/B6 mice (60 d) were anaesthetized with isoflurane and stereotaxically injected with FluoSpheres (0.04 μm, yellow-green fluorescent 488 nm, 5% solids, azide free; ThermoFisher Scientific) into the OVLT (100−200 nl; from Bregma with a 7° vertical angle, X: 1.2 mm, Y: 0 mm, Z: −4.6 or −4.7; Extended Data Fig. 3) with a Neuros syringe (0.5 μl, 32 gauge, Hamilton) over 5−10 min. The spheres were allowed to be retrogradely transported for 7 days, after which the animals were anaesthetized with isoflurane and perfused via the heart with 10 ml PBS followed by 300 ml PBS containing 4% PFA. The brains were extracted and postfixed by immersion for 48 h in 4% PFA in PBS. A vibratome was used to obtain serial coronal tissue sections (50 μm thick). Sections were blocked with 10% normal goat serum (in PBS containing 0.3% Triton-X100) and incubated overnight at 4 °C with primary antibodies. Following wash, sections were incubated for 1 h with fluorescently labelled secondary antibodies. Sections were then washed and mounted on coverslips using Prolong Gold Antifade reagent (Life Technologies). All images were acquired using a confocal microscope (FV1000, Olympus Canada). The following primary antibodies were used: PS41 anti-VP neurophysin mouse monoclonal antibody (1:50), and VA4 anti-VP neurophysin rabbit polyclonal antibody (1:1000) developed and contributed by H. Gainer (National Institutes of Health, Bethesda, MD). Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (568 nm and 647 nm; Life Technologies; 1:500). Brains were extracted from wild-type and V1aR−/− mice at ZT21.5–22 (for BP analysis) and ZT23.5–24 (for AP analysis) and immersion fixed in 4% PFA. Tissue sections (50 μm thick) from wild-type and V1aR−/− mice were processed using a rabbit polyclonal c-Fos antibody (EMD Millipore; 1:5,000) with a chicken anti-NeuN (Hexaribonucleotide Binding Protein-3a) polyclonal antibody (ABN91, 1:500; EMD Millipore; in OVLT), or with PS41 (as above) in the SCN. Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (488 nm, 568 nm, and 647 nm; Life Technologies; 1:500). Cells were considered c-Fos-positive if they were >100% above background. For OVLT analysis, cells were counted in a 200 × 200 μm field centred over the nucleus. For SCN, density was assessed over the entire nucleus. Sample size (n) refers to the number of sections analysed, which were obtained from 2 animals in each group. Coronal 300-μm slices were obtained from mouse brain as described above. These animals were not subjected to any behavioural or optogenetic experiments before slice preparation. Cell-attached recordings were obtained from visually identified fluorescent VP cells (see Extended Data Fig. 4). Green fluorescence in ArchT mice was detected using EN GFP 41017 filter cube (Chroma Technology) and red fluorescence in ChETA mice was detected using 49004 (Chroma Technology). Firing rate was assessed as described above. One cell was excluded from this analysis because its firing rate was more than four times greater than the standard deviation of the group. Horizontal hypothalamic slices were obtained from male rats as previously described29. Briefly, rats were killed by decapitation using a small rodent guillotine. The brain was rapidly removed and immersed in near-freezing (0–4 °C) oxygenated (95% O , 5% CO ) artificial rat cerebrospinal fluid (ARCSF) composed of the following (in mM) 120 NaCl, 3 KCl, 1.23 NaH PO , 1.48 MgCl , 2 CaCl , 25.95 NaHCO and 10 d-glucose. A trimmed block of brain was glued cortex-down with the rostral pole facing upwards to a mounting block angled at 38° relative to the horizontal plane. The assembly was then placed in a vibratome and a first cut was made to discard the tissue lying anterior and ventral to the optic tracts and most of the optic chiasma. A single 400-μm slice was then obtained and transferred dorsal side up to a beaker containing warmed (32 °C) oxygenated ARCSF and allowed to rest for 60 min. Slices were then placed in a warmed (32 °C) recording chamber perfused at a rate of 2–3 ml min−1. HEK293 cells (gift from Sal Carbonetto; not tested for mycoplasma) were kept in DMEM (Wysent) at 37 °C and 5% CO . The co-transfection of pGP-CMV-avp 6m (AddGene) and the human V1aR (provided by M. Bouvier, University of Montreal, QC) (2.5 μg each) was done using Lipofectamine 3000 (Invitrogen). 24 to 48 h after transfection the cultures were treated with trypsin and cells were lifted and plated over recently cut rat horizontal brain slices resting in beakers as explained above. Preparations were allowed to rest for 2 h, allowing cells to attach to the slice before starting the experiment. Experiments were completed during the subjective BP (ZT19.5−21.5) when VP release was low. Slices were carefully placed in the recording chamber, and a bipolar electrical stimulating electrode (pair of 65 μm o.d. platinum wires) was placed in the SCN. Electrical pulses (20–80 μA, 0.1−0.5 ms; 10 Hz, 40 s) were delivered via an isolated stimulator (DS2, Digitimer) triggered via a programmable digital timer (D4030, Digitimer). Fluorescence of GCaMP6m in HEK293 cells was observed using the EN GFP 41017 filter cube. Images were collected using Imaging Workbench 6.0 (INDEC BioSystems) at a rate of 1 image every 5 s (exposure 0.2 s). In control conditions, only pGP-CMV-GCaMP6m was transfected and not V1aR. Dose–response analysis and specificity were assessed on HEK293 cells plated on glass coverslips (Extended Data Fig. 5). VP dissolved in water (0.1 mM) was kept frozen until required. All images were analysed using Fiji30. Fluorescence in regions of interests (HEK cells) was corrected for bleaching determined by fitting a single exponential. Background fluorescence was subtracted from all values. Values of fluorescence at various time points were expressed relative to baseline. Changes in fluorescence relative to baseline (average of 30 s before stimulation) were determined from the average of values observed during a 30-s period following the onset of the response. Slices were obtained as mentioned above. Bicuculline was dissolved directly into the ARCSF at the required concentration (10 μM). Kynurenate was first dissolved into a small volume (<0.5 ml) of 1 N NaOH and subsequently diluted into a larger volume of ARCSF at the required concentration (3 mM). All whole-cell experiments were performed in the presence of kynurenate and bicuculline. All recordings were made during subjective night (ZT5−11). Whole-cell recordings from OVLT neurons were made using patch pipettes prepared from glass capillary tubes (1.2-mm outer diameter, A-M Systems) filled with the appropriate internal solution. Pipette resistance in the bath was 3.5−5.5 MΩ. Series resistance was 10−30 MΩ. A bipolar stimulating electrode was placed in the SCN at the beginning of each recording session. Electrical pulses (20–80 μA, 0.1−0.5 ms; 10Hz, 30 s) were delivered as described above. For gap-free whole-cell current clamp recordings, pipettes were back-filled with a solution containing the following (in mM): 140 K+-gluconate, 2 MgCl , 10 HEPES, 2 ATP(Na ), 0.4 GTP(Na ) (pH adjusted to 7.25 with NaOH). Baseline average firing rates were calculated over a window of 60 s immediately preceding SCN stimulation, and the corresponding voltage was obtained from the peak of an all-points voltage histogram. SCN stimulation evoked firing rates were calculated over a window of 60 s during the maximal firing response within 2 min of the end of stimulation. Post-stimulation voltage was obtained during the corresponding period. Current clamp analysis (Fig. 3f) was restricted to cells maintained by current injection between −35 and −50 mV (values not corrected for liquid junction). Aliquots of SR49059 dissolved in DMSO (10 mM) were diluted into ARCSF to achieve a final concentration of 10 μM. For whole-cell voltage clamp experiments, steady state current–voltage (I−V) relations were obtained from the current responses induced by slow voltage ramps (−110 to +10 mV; 2 s, V −50mV). Pipettes were backfilled with solutions corresponding to the experiment in question. K+ internal solutions were composed of the following (in mM): 140 K+-gluconate, 2 MgCl , 10 HEPES, 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Cs+ internal solutions were composed of the following (in mM): 140 CsMeS, 10 HEPES, 2 MgCl , 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Cl− internal solutions were composed of the following (in mM): 100 CsMeS, 40 CsCl, 10 HEPES, 2 MgCl , 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Currents induced in OVLT neurons induced by SCN stimulation were evaluated as the difference current obtained by subtracting the average of two I−V curves taken 1 min after SCN stimulation from the average of two I−V curves recorded preceding SCN stimulation. When required, a lowpass filter was applied to the difference current trace (lowpass 80−200 Hz). SCN-induced changes in membrane conductance were quantified as the slope of the difference current I−V curve, measured over a range of 20 mV below the reversal potential. In the analysis of Fig. 3i, j, two cells were excluded because SCN-induced currents did not show a reversal potential. VP release caused by light-induced depolarization of SCN VP axons was performed using co-transfected HEK293 cells prepared as described above, in horizontal slices prepared from ChETA mice. Blue light (473 nm DPSS Laser system, Laserglow Technologies) was delivered over the OVLT (50 ms, 22 mW, 5 Hz) for 30 s through a fibre-optic probe (slim titanium magnetic receptacle, 200 μm fibre optic diameter/240 μm diameter with coating/5.5 mm length numerical aperture 0.22, Doric Lenses), connected to a mono fibre-optic patchcord (2 m) via a fibre-optic rotary joint. Horizontal slices were prepared from either ChETA or ArchT mice. Cell-attached recordings were performed as previously described. Blue light was delivered over the OVLT as previously described (50 ms, 22 mW, 5 Hz) for 30−60 s in ChETA slices during the BP (ZT19.5−21.5). Additional light intensities were used to determine threshold sensitivity (Extended Data Fig. 9). Yellow light (589 nm, 13 mW, constant light, DPSS laser system, Laserglow Technologies) was delivered over the OVLT in ArchT slices during the AP (ZT21.5−23.5). SR49059 (10 μm) was bath-applied during experiments as noted. Firing rates were calculated by counting the number of spikes during 30−60 s. Firing rates were normalized to the average baseline firing of the time period in question. Coronal slices were prepared from ChETA or ArchT male or female mouse brains. Cell-attached recordings were performed on identified VP neurons as previously described. Once sufficient baseline was recorded (2–3 min), blue light (for ChETA) or yellow light (for ArchT) was delivered to the slice. Analysis of light-induced changes in firing rate was performed by comparing firing rates averaged during 30−60 s periods recorded before and during light stimulation. ChETA and ArchT male mice (60–90 d) were stereotaxically implanted with a slim magnetic receptacle fibre-optic cannulas (5.5 mm, Doric Lenses) above the OVLT (from bregma with a 7° vertical angle, X: 1.18 mm, Y: 0 mm, Z: –4.5; ref. 31). Cannulas were initially glued to the brain using Metabond (C&B Metabond, Parkell), allowed to dry, then covered with a generous coat of dental cement (Stoelting). Animals recovered for 7 days, after which they were handled for one week to allow habituation to handling and to the fibre-optic patchcord. For testing, animals were placed in metabolic cages on Thursday afternoons. On Mondays, the animals were trained by being connected to the patchcord during the appropriate test period (2.5 h), 1 h post-handling rest, 1 h baseline, 30 min test. Testing started on the following Tuesday. ChETA mice were tested from ZT18.5 to ZT21, and ArchT mice were tested from ZT20.5 to ZT23. During the test period they received either blue light (22 mW continuous or 50 ms, 22 mW, 5 Hz), or yellow light (13 mW continuous) on separate days. Water intake analysis was performed as described above. Following the last day of testing, animals were anaesthetized and decapitated. Optical implants were removed and brains were fixed by immersion for at least 48 h in 4% PFA dissolved in PBS. Serial coronal sections (50 μm thick) were cut to determine the position of the tip of the fibre-optic cannula. Experiments were rejected if the fibre-optic tip terminated rostral or caudal to the OVLT, or more than 200 μm dorsal from the dorsal surface of the OVLT. Serial coronal sections (50 μm thick) were cut from an ArchT mouse brain to analyse the expression of GFP in VP neurons. Sections were processed for immunohistochemistry as described above. A chicken anti-GFP primary antibody (1:1,000, AB13970, Abcam) was used to enhance detection of the fluorescence reporter and the PS41 mouse monoclonal anti-VP neurophysin antibody (1:50; H. Gainer, NIH32, 33) was used to detect VP. Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (568 nm, and 647 nm; Life Technologies; 1:500). Images were analysed using ImageJ 1.50a (NIH) to count the number of VP-labelled SCN neurons and anti-GFP-labelled SCN neurons. As previously described34, single OVLT neurons were aspirated from the slice using large autoclaved micropipettes (1−2 MΩ), which were backfilled with 1.5 μl of a solution containing RNaseIN (10 U μl−1; Life Technologies). Upon contact and gigaseal formation, cells that fired action potentials (neurons) were sucked by negative pressure to collect cytoplasm, then lifted and completely suctioned into the electrode. The contents were then expelled by positive pressure into a 250-μl microcentrifuge tube containing 0.5 μl DNase I (1 U μl−1; Fisher Scientific) and 1 × MgCl buffer and stored over dry ice. Tubes were incubated at 37 °C for 30 min, and the reaction was stopped by adding 1 μl EDTA (25 mM) and incubated at 65 °C for 10 min. The RT reaction was then performed by adding 1 μl 50 μM Random Hexamer primers (Life Technologies), 0.25 μl RNaseIN (10 U μl−1), 1 μl 0.1M DTT, 1 μl 50 mM MgCl2, 1 μl 10 mM (each) dNTPs mix (QIAGEN), 2 μl 5 × First Strand Buffer, and 0.25 μl SuperscriptIII (200 U μl−1; ThermoFisher). The mix was incubated at 50 °C for 2 h and then the cDNA was stored at −20 °C. Nested PCR and nested multiplex single-cell PCR were performed using the following primers: Avpr1a ForOUT3 5′ATCCCATCCAAAACCACTCTGAGCG3′; Avpr1a RevOUT3 5′GGTAACACTTGGAAGAAGGCGACCG3′; Avpr1a ForIN3 5′GAAGAGAGCGAGGTAAGGAAGGACGG3′; Avpr1a RevIN3 5′TGCGGGATGTCTTGCGTGGC3′; V1v ForOUT 5′ATGTGGTAGACATGAGGGAGCTAGAGGC3′; V1v RevOUT 5′AATCTTCCCACTGCTGGCAGCC3′; V1v ForIN 5′TCCAGGGACTAGCCTCATTGGTGGG3′; V1v RevIN 5′TGAGTTCTTCTAGCTTCAGTGTGGGGTG3′. All group data are reported or displayed as means ± s.e.m. and the exact sample size is provided for each experimental group or condition either in the text or as indicated within or below bar graphs. Information about sample collection is also provided where relevant (for example, number of trials per animals, or sections per brain). Differences between groups (two-sided) were compared using Sigmaplot 12.0 (Systat Software). The software first assessed normality of the data distribution. In all cases where the normality test failed, a suitable non-parametric test was performed. All tests used for comparisons are specified in the text. No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.


News Article | August 31, 2016
Site: www.nature.com

Based on power analyses that assumed a normal distribution, a 20% change in mean and 15% variation, we determined that at least 9 mice per group would be needed for behavioral experiments. This was adhered to as far as possible, except in cases where mice had to be removed owing to misplaced injections or lost headcaps. Mice were randomly assigned to groups and attempts were made to balance groups according to variables such as age and housing condition. The investigators were not blinded to allocation during experiments, but were blinded to outcome assessment for all behavioral experiments. Mice were used in all experiments. For experiments involving Cre lines, mice were crossed for several generations to C57 mice before using. All wild-type mice were C57BL/6 mice obtained from The Jackson Laboratory (Bar Harbour, ME). For all behavioural experiments except those involving Htr2cCre mice, male mice ranging in age from 8–16 weeks were used. Female Htr2cCre mice were used in chemogenetic manipulations. Both male and female mice aged 6–20 weeks were used for slice electrophysiology and anatomical tracing experiments. All behavioural studies or tissue collection for ex vivo slice electrophysiology were performed during the light cycle. All behavioural experiments in Htr2ccre mice were conducted at the University of Aberdeen and in accordance with the United Kingdom Animals (Scientific Procedures) Act of 1986. All in vivo electrophysiology experiments were conducted in accordance with all rules and regulations at the National Institute for Alcohol Abuse and Alcoholism at the National Institutes of Health. All other procedures were conducted in accordance with the National Institutes of Health guidelines for animal research and with the approval of the Institutional Animal Care and Use Committee at the University of North Carolina at Chapel Hill. All animals were group housed on a 12 h light cycle (lights on at 7 a.m.) with ad libitum access to rodent chow and water, unless described otherwise. CRF-ires-Cre (Crfcre) were provided by Bradford Lowell (Harvard University) and were previously described21. C57BL/6J mice were obtained from the Jackson Laboratory (Bar Harbour, ME). To visualize CRF-expressing neurons, CrfCre mice were crossed with either an Ai9 or a Cre-inducible L10-GFP reporter line (Jackson Laboratory)22 to produce CRF-Ai9 or CRF-L10GFP progeny, referred to throughout the manuscript as CRF-reporters. SertCre mice (from GENSAT) were a generous gift from Bryan Roth. Htr2cCre mice were supplied by Lora Heisler and are described in detail elsewhere7. Male mice were used for in vivo optogenetic behavioural experiments and for assessing the involvement of BNST CRF neurons on fluoxetine-induced enhancement of fear. Female 5-HT -Cre mice were used in chemogenetic manipulations. Both male and female mice were used for slice electrophysiology and anatomical tracing experiments. All behavioural studies or tissue collection for ex vivo slice electrophysiology were performed during the light cycle. All AAV viruses except INTRSECT constructs were produced by the Gene Therapy Center Vector Core at the University of North Carolina at Chapel Hill and had titres of >1012 genome copies per ml. For ex vivo and in vivo optical experiments, mice were injected with rAAV5-ef1α-DIO-hChR2(H134R)-eYFP or rAAV5-ef1α-DIO-eYFP as a control. Red IX retrobeads (Lumafluor) were used to fluorescently label LH- and VTA-projecting BNST neurons during ex vivo slice electrophysiology recordings. The retrograde tracer Fluoro-Gold (Fluorochrome) was used for anatomical mapping. Choleratoxin B (CTB) 555 and CTB 657 retrograde tracers (Invitrogen; C34776, and C34778, respectively) diluted to 0.5% (w/v) in sterile PBS were used per injection site for anatomical mapping of collateral projections from BNST to LH and VTA. For chemogenetic manipulations, mice were injected with 400 nl of rAAV8-hsyn-DIO-hM3D(Gq)-mCherry, rAAV8-hsyn-DIO-hM4D(Gi)-mCherry, or rAAV8-hsyn-DIO-mCherry bilaterally. HSV-hEF1α-mCherry, HSV-ef1α-LSL1-mCherry-IRES-flpo, and HSV-ef1α-IRES-Cre (supplied by Rachel Neve at the McGovern Institute for Brain Research at MIT) were injected bilaterally into the VTA and LH at a volume of 500 nl per site. The INTRSECT construct AAVdj-hSyn-Con/Foff-hChR2(H134R)-EYFP was infused at 500 nl per side into the BNST. All AAV constructs had viral titres >1012 genome particles per ml. All surgeries were conducted using aseptic technique. Adult mice (2–5 months) were deeply anaesthetized with 5% isoflurane (v/v) in oxygen and placed into a stereotactic frame (Kopf Instruments) while on a heated pad. Sedation was maintained at 1.5–2.5% isoflurane during surgery. An incision was made down the midline of the scalp and a craniotomy was performed above the target regions and viruses and fluorescent tracers were microinjected using a Neuros Hamilton syringe at a rate of 100 nl min−1. After infusion, the needle was left in place for 10 min to allow for diffusion of the virus before the needle was slowly withdrawn. Injection coordinates (in mm, midline, Bregma, dorsal surface): BNST (±1.00, 0.30, −4.35), LH (±0.9 to 1.10, −1.7, −5.00 to −5.2), VTA (−0.3, −2.9, −4.6), DR (0.0, −4.65, −3.2 with a 23° angle of approach). When using retrobeads, injection volumes into the LH and VTA were 300 nl and 400 nl, respectively. Fluoro-Gold injection volumes were 200 nl per target site. CTB volumes were 200  nl per target site. An optical fibre was implanted in the BNST (±1.00, 0.20, −4.15) at a 10° angle for in vivo photostimulation studies. After fibre implantation, dental cement was used to adhere the ferrule to the skull. Following surgery, all mice returned to group housing. Mice were allowed to recover for at least 3 weeks before being used for chemogenetic behavioural studies, or 6 weeks for in vivo optogenetic studies. RS-102221, 5-HT and mCPP were from Tocris (Bristol, UK). For electrophysiology experiments, RS-102221 was made up to 100 mM in DMSO and then diluted to a final concentration of 5 μM in aCSF. 5-HT and mCPP were stocked at 10 and 20 mM, respectively, in ddH O and diluted to their final concentations in aCSF. For electrophysiology experiments, clozapine-N-oxide (CNO; from Bryan Roth) was stocked at 100 mM in DMSO and diluted to 10 μM in aCSF. For behaviour experiments, CNO was dissolved in 0.5% DMSO (in 0.9% saline) to a concentration of 0.1 mg ml−1 or 0.3 mg ml−1 and injected at 10 ml per kg for a final concentration of 1 or 3 mg per kg, i.p. Fluoxetine (Sigma) was made up in 0.9% NaCl to a concentration of 1 mg ml−1 and then injected at 10 ml per kg for a final concentration of 10 mg per kg, i.p. Surgical procedures. Mice were anaesthetized with 2% isoflurane (Baxter Healthcare, Deerfield, IL) and implanted with 2 × 8 electrode (35 μm tungsten) micro-arrays (Innovative Neurophysiology, Durham, NC) targeted at the BNST (ML: 0.8 mm, AP: ± 0.5 mm, and DV: −4.15 mm relative to Bregma). Following surgery, mice were singly housed and allowed at least one week to recover before behavioural testing. Fear conditioning. Fear conditioning took place in 27 × 27 × 11 cm conditioning chambers (Med Associates, St. Albans, VT), with a metal-rod floor (context A) and scented with 1% vanilla. Mice received 5 parings of a pure tone CS with a 0.6 mA foot shock. 24 h following conditioning, mice underwent a CS recall test (10 presentations of the CS alone, 5 s ITI), which was conducted in a Plexiglas cylinder (20 cm diameter) and scented with 1% acetic acid (context B). Stimulus presentations for both tests were controlled by MedPC (Med Associates, St. Albans, VT). Cameras were mounted overhead for recording freezing behaviour, which was scored automatically using CinePlex Behavioural Research System software (Plexon, Dallas, TX). Electrophysiological recording and single unit analysis. Electrophysiological recording took place during both fear conditioning and CS recall tests. Individual units were identified and recorded using Omniplex Neural Data Acquisition System (Plexon, Dallas, TX). Neural data was sorted using Offline Sorter (Plexon, Dallas, TX). Waveforms were isolated manually, using principal component analysis. To be included in the analyses, spikes had to exhibit a refractory period of at least 1 ms. Autocorrelograms from simultaneously recorded units were examined to ensure that no cell was counted twice. Single units were analysed by generating perievent histograms (3 s bins) of firing rates from 30 s before CS onset until 30 s after CS offset (NeuroExplorer 5.0, Nex Technologies, Madison, AL). Firing rates were normalized to baseline (30 s before CS onset) using z-score transformation. Analysis included a total of 139 cells over three days of recording. Data reported for raw firing rates include only putative principal neurons (<10 Hz). The formula for computing the suppression ratio was (average freezing rate) / (average freezing rate + average movement rate). Each cell was calculated individually. A value of 0.5 = no change in rate). Ex vivo slice electrophysiology. Brains were sectioned at 0.07 (mm per s) on a Leica 1200S vibratome to obtain 300 μm coronal slices of the BNST, which were incubated in a heated holding chamber containing normal, oxygenated aCSF (in mM:124 NaCl, 4.4 KCl, 2 CaCl , 1.2 MgSO , 1 NaH PO , 10.0 glucose, and 26.0 NaHCO ) maintained at 30 ± 1 °C for at least 1 h before recording. Slices were transferred to a recording chamber (Warner Instruments) submerged in normal, oxygenated aCSF maintained at 28–30 °C at a flow rate of 2 ml min−1. Neurons of the BNST were visualized using infrared differential interference contrast (DIC) video-enhanced microscopy (Olympus). Borosilicate electrodes were pulled with a Flaming-Brown micropipette puller (Sutter Instruments) and had a pipette resistance between 3–6 MΩ. Signals were acquired via a Multiclamp 700B amplifier, digitized at 10 kHz and analysed with Clampfit 10.3 software (Molecular Devices, Sunnyvale, CA, USA). In SertCre or CrfCre mice, fluorescently labelled neurons expressing ChR2 were visualized and stimulated with a blue (470 nm) LED using a 1 Hz, 2 Hz, 5 Hz, 10 Hz, and 20 Hz stimulation protocol with a pulse width of 0.5 ms. Evoked action potentials were recorded in current clamp mode using a potassium gluconate based internal solution (in mM: 135 K+ gluconate, 5 NaCl, 2 MgCl , 10 HEPES, 0.6 EGTA, 4 Na ATP, 0.4 Na GTP, pH 7.3, 285–290 mOsmol). In CrfCre mice with ChR2 in the BNST and retrograde tracer beads in the VTA or LH, we visualized non-ChR2-expressing, beaded neurons using green (532 nm) LED. Recordings were conducted in voltage clamp mode using a caesium-methansulfonate (Cs-Meth) based internal solution (in mM: 135 caesium methanesulfonate, 10 KCl, 1 MgCl , 0.2 EGTA, 2 QX-314, 4 MgATP, 0.3 GTP, 20 phosphocreatine, pH 7.3, 285–290 mOsmol) so that we could detect EPSCs (−55 mV) and IPSCs (+10 mV) in the same neuron. After confirming the absence of a light-evoked EPSC signal, we measured light-evoked IPSCs during a single 5-ms light pulse of 470 nm. In a subset of these experiments, SR95531 (GABAzine, 10 μM) was bath applied for 10 min to block IPSCs. Crf-reporter mice were injected with retrograde tracer beads into the VTA (ML −0.5, AP −2.9, DV −4.6). We then recorded from beaded (VTA-projecting) and non-beaded (non-projecting) CRF neurons in the BNST. Acute drug effects were determined in current clamp mode in the presence of TTX using a potassium gluconate-based internal solution. After a 5-min stable baseline was established, 5-HT (10 μM) or mCPP (20 μM) was bath applied for 10 min while recording changes in membrane potential. The difference in membrane potential between baseline and drug application at peak effect (delta or Δ MP) was later determined. In a subset of mCPP experiments, slices were incubated with RS-102221 (5 μM) for at least 20 min before experiments began. Spontaneous inhibitory postsynaptic currents (sIPSCs) were assessed in voltage clamp using a potassium-chloride gluconate-based intracellular solution (in mM: 70 KCl, 65 K+-gluconate, 5 NaCl, 10 HEPES, 0.5 EGTA, 4 ATP, 0.4 GTP, pH 7.2, 285–290 mOsmol). IPSCs were pharmacologically isolated by adding kynurenic acid (3 mM) to the aCSF to block AMPA and NMDA receptor-dependent postsynaptic currents. The amplitude and frequency of sIPSCs were determined from 2 min recording episodes at −70 mV. The baseline was averaged from the 4 min preceding the application of 5-HT (10 μM) or mCPP (10 μM) for 10 min. In a subset of these experiments, RS-102221 (5 μM) was added to the aCSF and slices were incubated in this drug solution for at least 20 min before experiments began. For miniature IPSCs (mIPSCs), TTX was included in the aCSF to block network activity. In SertCre::ChR2BNST mice with retrograde tracer beads in the VTA, sIPSCs were recorded as described above. After achieving a stable baseline, a 10 s, 20 Hz photostimulation was applied. For assessment of spontaneous excitatory postsynaptic currents (sEPSCs), a caesium gluconate-based intracellular solution was used (in mM: 135 Cs+-gluconate, 5 NaCl, 10 HEPES, 0.6 EGTA, 4 ATP, 0.4 GTP, pH 7.2, 290–295 mOsmol). AMPA -mediated EPSCs were pharmacologically isolated by adding 25 μM picrotoxin to the aCSF. sEPSC recordings were acquired in 2 min recording blocks at −70 mV. Electrodes were fabricated as previously described and cut to 50–100 μm in length23. Animal and slice preparation were as described above for electrophysiology and slices were perfused on the rig in ACSF. Using a custom-built potentiostat (University of Washington Seattle), 5-HT recordings were made in the BNST using TarHeel CV written in laboratory view (National Instruments). Briefly a triangular waveform (−0.1 V to 1.3 V with a 10% phase shift at 1,000 V per s, versus Ag/AgCl) was applied to the carbon fibre electrode at a rate of 10 Hz. Slices were optically stimulated with 20 5-ms blue (490 nm) light pulses at a rate of 20 Hz down the submerged 40× objective. 10 cyclic voltammograms were averaged before optical stimulation for background subtraction. Voltammograms were digitally smoothed one time with a fast Fourier transform following data collection and analysed with HDCV (UNC Chapel Hill). Fluoxetine (10 μM) was bath applied following a stable baseline (20 min). For chemogenetic manipulations, mice were transported to a holding cabinet adjacent to the behavioural testing room to habituate for at least 30 min before being pretreated with CNO (3 mg per kg, i.p. for CrfCre mice and 1 mg per kg, i.p. for Htr Cre mice). All behavioural testing began 45 min following CNO treatment, with the exception of fear conditioning training, which occurred 30 min after a CNO injection. When assessing the effect of fluoxetine on fear conditioning, fluoxetine (10 mg per kg, i.p.), or vehicle, was administered 1 h before training (30 min before CNO treatment). For optogenetic manipulations, mice received bilateral stimulation (473 nm, ~10 mW, 5 ms pulses, 20 Hz) when specified. Unless specified, all equipment was cleaned with a damp cloth between mouse trials. All sessions were video recorded and analysed using EthoVision software (Noldus Information Technologies) except where noted. Mice were placed in the centre of an elevated plus maze and allowed to explore during a 5 min session. Light levels in the open arms were ~14 lux. During optogenetic manipulations mice received bilateral stimulation during the entire 5 min session. Mice that left the maze were excluded from analysis (n = 2 control, 1 ChR2 from optogenetic experiments). Mice were placed into the corner of a white Plexiglas open field arena (25 × 25 × 25 cm) and allowed to freely explore for 30 min. The centre of the open field was defined as the central 25% of the arena. For optogenetic studies the 30 min session was divided into three 10-min epochs consisting of stimulation off, stimulation on, and stimulation off periods. 48 h before testing, mice were provided with access to a single piece of Froot Loops cereal (Kellogg’s) in their home cage. 24 h before testing, home cage chow was removed and mouse body weights were recorded. Water remained available ad libitum. Beginning at least one hour before testing, mice transferred to new clean cages so they were singly housed for the test session and body weights were recorded. During the test session mice were placed into an arena (25 × 25 × 25 cm) that contained a single Froot Loop on top of a piece of circular filter paper. Mice were monitored by a live observer and the latency for the mouse to begin eating the pellet was measured, allowing up to 10 min. All mice began eating within this time. Following the initiation of feeding, mice were removed from the arena and placed back into their home cages. Mice were then provided with 10 min of access to a pre-weighed amount of Froot Loops for a post-test feeding session. After this 10 min post-test, the remaining Froot Loops were weighed and mice were returned to ad libitum home cage chow. Mice were returned to group housing at the end of this session. For optogenetic experiments, mice received constant 20 Hz optical stimulation during both the latency to feed assay and the 10 min post-test. During optogenetic experiments, one control mouse did not feed during the 10 min NSF session and was excluded from the results. SertCre mice were food deprived for 24 h. On the day of the experiment, mice were acclimated to the behaviour room for 1 h. A single pre-weighed food pellet was placed in the home cage and the mice were allowed to eat for 10 min during optogenetic stimulation. At the end of the experimental session, the pellet was removed and weighed and mice were given ad libitum access to food. Htr Cre mice were acclimated in metabolic chambers (TSE Systems, Germany) for 2 days before the start of the recordings. After acclimation, mice were food deprived for 24 h. Following fasting, mice received an i.p. injection of CNO 30 min before food presented again. Mice were recorded for 12 h with the following measurements being taken every 30 min: water intake, food intake, ambulatory activity (in x and z axes), and gas exchange (O and CO ) (using the TSE LabMaster system, Germany). Energy expenditure was calculated according to the manufacturer’s guidelines (PhenoMaster Software, TSE Systems). We used a three-day protocol to assess both cued and contextual fear recall. On the first day, mice were placed into a fear conditioning chamber (Med Associates) that contained a grid floor and was cleaned with a scented paper towel (19.5% ethanol, 79.5% H O, 1% vanilla). After a 3 min baseline period, mice were exposed to a 30 s tone (3 kHz, 80 dB) that co-terminated with a 2 s scrambled foot shock (0.6 mA). A total of 5 tone-shock pairings were delivered with a random inter-tone interval (ITI) of 60–120 s. For optogenetic studies, light stimulation occurred only during the 30-s tones of this session. Following delivery of the last foot shock, mice remained in the conditioning chamber for a 2-min consolidation period. 24 h later, mice were placed into a separate conditioning box (Med Associates) that contained a white Plexiglas floor, a striped pattern on the walls, and was cleaned and scented with a 70% ethanol solution. After a 3 min baseline period, mice were presented with 10 tones (30 s, 3 kHz, 80 dB) with a 5 s ITI. Mice remained in the chamber after the last tone for a two-minute consolidation period. 24 h later (48 h after training), mice were returned to the original training chamber for 5 min. For each session, freezing behaviour was hand-scored every 5 s by a trained observer blinded to experimental treatment as described previously24. Freezing was defined as a lack of movement except as required for respiration. All mice used for behavioural and anatomical tracing experiments were anesthetized with Avertin and transcardially perfused with 30 ml of ice-cold 0.01 M PBS followed by 30 ml of ice-cold 4% paraformaldehyde (PFA) in PBS. Brains were extracted and stored in 4% PFA for 24 h at 4 °C before being rinsed twice with PBS and stored in 30% sucrose and PBS until the brains sank. 45 μm slices were obtained on a Leica VT100S and stored in 50/50 PBS/Glycerol at −20 °C. DREADD or ChR2-containing sections were mounted on slides, allowed to dry, coverslipped with VectaShield (Vector Labs, Burlingame, CA), and stored in the dark at 4 °C. We stained free-floating dorsal raphe sections using indirect immunofluorescence sequentially for first tryptophan hydroxylase (TPH) and Fluoro-Gold (FG) and then c-fos. For TPH/FG, we washed sections 3× for 5 min with 0.01 M PBS, permeabilized them for 30 min in 0.5% Triton/0.01 M PBS, and washed the sections again 2× with 0.01 M PBS. We blocked the sections for 1 h in 0.1% Triton/0.01 M PBS containing 10% (v/v) normal donkey serum and 1% (w/v) bovine serum albumin (BSA). We then added primary antibodies (1:500 mouse anti-TPH (Sigma Aldrich T0678) and 1:3,000 guinea-pig anti-Fluoro-Gold (Protos Biotech NM101)) to blocking buffer and incubated the sections overnight at 4  °C. The next day, we washed the sections 3× for 5 min with 0.01 M PBS, then incubated them with 1:500 with Alexa Fluor 647-conjugated donkey anti-mouse and Alexa Fluor 488-conjugated donkey anti-guinea pig secondary antibodies for 2 h at room temperature, and washed the sections 4× for 5 min with 0.01 M PBS. We then proceeded directly to the c-fos tyramide signal amplification based immunofluorescent staining. We permeabilized the sections in 50% methanol for 30 min, then quenched endogenous peroxidase activity in 3% hydrogen peroxide for 5 min. Followed by two 10 min washes in 0.01 M PBS, we blocked the sections in PBS containing 0.3% Triton X-100 and 1.0% BSA for 1 h. c-fos primary antibody (Santa Cruz Biotechnology, -sc-52) was added to sections at 1:3,000 and sections were incubated for 48 h at 4 °C. On day 3, we washed the sections in TNT buffer (0.1 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.05% Tween-20) for 10 min, blocked in TNB buffer (0.1 M Tris-HCl pH 7.5, 0.15 M NaCl, 0.5% blocking reagent – PerkinElmer FP1020) buffer for 30 min. We then incubated the sections in secondary antibody (goat anti-rabbit HRP-conjugated PerkinElmer) 1:200 in TNB buffer for 30 min, washed the sections in TNT buffer 4× for 5 min, and then incubated the sections in Cy3 dye diluted in TSA amplification diluents for 10 min. We washed the sections 2× in TNT buffer, mounted them on microscope slides. We coverslipped the slides using Vectashield mounting medium. We acquired 4–5 of 2 × 4 tiled z-stack (5 optical slices comprising 7 μm total) images of the dorsal raphe from each naive and shock mouse on a Zeiss 800 upright confocal microscope. Scanning parameters and laser power were matched between groups. Images were preprocessed using stitching and maximum intensity projection and then analysed using an advanced processing module in Zeiss Zen Blue that allows nested analysis of multiple segmented fluorescent channels within parent classes. Double-labelled and triple-labelled cells were validated in a semi-automated fashion. At least 4 sections per mouse were counted in this way. One mouse was identified as a significant outlier in the shock group and was excluded from further analysis. To verify expression of ChR2-expressing fibres in the BNST originating from DRN serotonergic neurons, 300 μm slices used for ex vivo electrophysiological recordings containing the DRN and BNST were stored in 4% paraformaldehyde at 4 °C for 24 h before being rinsed with PBS, mounted, and coverslipped with Vectashield mounting medium. Images showing eYFP fluorescence from the DRN and BNST were obtained on a Zeiss 800 upright confocal microscope using a 10× objective and tiled z stacks. To validate the INTRSECT construct, mice received injections of HSV-hEF1α-mCherry or HSV-ef1α-LSL1-mCherry-IRES-flpo to both the LH and VTA bilaterally (n = 4 and 5, respectively). Both groups received AAVDJ-hSyn-Cre-on/Flp-off-hChR2(H134R)-EYFP to the BNST bilaterally. Six weeks following injection, mice were perfused and tissue was collected as described above. To visualize YFP expression in the BNST of CrfCre::IntrsectBNST mice, free-floating slices containing the BNST were rinsed three times with PBS for 5 min each. Slices were then incubated in 50% methanol for 30 min then incubated in 3% hydrogen peroxide for 5 min. Following three 10-min washes in PBS, slices were incubated in 0.5% Triton X-100 for 30 min followed by a 10 min PBS wash. Slices were blocked in 10% normal donkey serum/0.1% Triton X-100 for 1 h, and then they were incubated overnight at 4°C with a primary chicken anti-GFP antibody (GFP-1020, Aves) at 1:500 in blocking solution. Following primary incubation, slices were rinsed three times with 0.01M PBS for 10 min each and incubated with a fluorescent secondary antibody (AlexaFluor 488 donkey anti-chicken) at 1:200 in PBS for 2 h at room temperature. Slices were then rinsed with four 10-min PBS washes before being mounted onto glass slides and coverslipped with Vectashield with DAPI. A 3 × 4 tiled z stack (7 optical sections comprising 35 μm total) image from both the left and right hemispheres of the BNST was obtained at 20× magnification using a Zeiss 800 upright confocal microscope. Scanning parameters and laser power were matched between groups. Images were preprocessed using stitching and maximum-intensity projection. The number of fluorescent cells in the dorsal and ventral aspects of the BNST were counted by a blinded scorer using the cell counter plug-in in FIJI (ImageJ). Each hemisphere was considered independently per mouse. One mouse in the flp-expressing group was a significant outlier for number of cells expressed in a ventral BNST hemisphere (ROUT, Q = 0.1%) and all data from that mouse were excluded. 3 male CRF-L10a reporter mice were injected with 200 nl of CTB 555 and CTB 647 bilaterally to the LH and VTA, respectively, as described above. 5 days following injection, mice were perfused as described above, the brains were extracted, and were stored in 4% paraformaldehyde for 24 h at 4 °C before being rinsed with PBS and transferred to 30% sucrose until the brains sank. 45 μm sections containing the BNST were collected as described above. Sections containing the BNST were mounted on glass slides and coverslipped using Vectashield. An image from the left and right hemispheres of a medial section of the BNST was obtained on a Zeiss 800 upright microscope using a 20×objective and 3 × 5 tiled z stacks (5 optical slices comprising 7 μm total). Images were preprocessed using stitching and maximum intensity projection, and were then analysed using the cell counter function in FIJI (ImageJ). Only cells positive for GFP (putative CRF neurons) were considered. Cells were scored exclusively as either 555+ only (LH-projecting), 647+ only (VTA-projecting), 555+ and 647+ (projecting to both LH and VTA), or 555− and 647− (unlabelled; neither LH- nor VTA- projecting). The total number of CRF neurons scored was calculated as the sum of all four groups, and percentages of each type were calculated from this value. Each hemisphere was scored and plotted independently (n = 6 images from 3 mice), and the dorsal and ventral BNST were considered separately. The average values were plotted as pie charts (Extended Data Fig. 5). For validation of 2C-cre line and comparison of CRF/2C mRNA cellular co-localization, mice were anesthetized using isoflurane, rapidly decapitated, and brains rapidly extracted. Immediately after removal, the brains were placed on a square of aluminium foil on dry ice to freeze. Brains were then placed in a −80°C freezer for no more than 1 week before slicing. 12 μm slices were made of the BNST on a Leica CM3050S cryostat (Germany) and placed directly on coverslips. FISH was performed using the Affymetrix ViewRNA 2-Plex Tissue Assay Kit with custom probes for CRF, 5-HT , and Cre designed by Affymetrix (Santa Clara, CA). Slides were coverslipped with SouthernBiotech DAPI Fluoromount-G. (Birmingham, AL). 3 × 5 tiled z stack (15 optical sections comprising 14 μm total) images of the entire 12 μm slice were obtained on a Zeiss 780 confocal microscope for assessment of CRF/2C colocalization. A single-plane 40× tiled image of a CRF/2C slice was obtained on a Zeiss 800 upright confocal microscope for the magnified image shown in Extended Data 6b, right. 3 × 5 tiled z stack (7 optical sections comprising 18 μm) images of 2C/Cre slices were obtained on a Zeiss 800 upright confocal microscope for the 2C/Cre validation. All images were preprocessed with stitching and maximum intensity projection. An image of the BNST from 3 mice in each condition was hand counted for each study using the cell counter plugin in FIJI (ImageJ). Cells were classified into three groups: probe 1+, probe 2+, or probe 1 and 2+. Only cells positive for a probe were considered. Results are plotted as average classified percentages across the three images. No specific method of randomization was used to assign groups. Animals were assigned to experimental groups so as to minimize the influence of other variables such as age or sex on the outcome. Pre-established criteria for excluding mice from behavioural analysis included (1) missed injections, (2) anomalies during behavioural testing, such as mice falling off the elevated plus maze, (3) damage to or loss of optical fibres, (4) statistical outliers, as determined by the Grubb’s test. A power analysis was used to determine the ideal sample size for behaviour experiments. Assuming a normal distribution, a 20% change in mean and 15% variation, we determined that we would need 8 mice per group. In some cases, mice were excluded due to missed injections or lost optical fibres resulting in fewer than 8 mice per group. For electrophysiology experiments, we aimed for 5–7 cells from 3–4 mice. Data are presented as means ± s.e.m. For comparisons with only two groups, P values were calculated using paired or unpaired t-tests as described in the figure legends. Comparisons across more than two groups were made using a one-way ANOVA, and a two-way ANOVA was used when there was more than one independent variable. A Bonferroni post-test was used following significance with an ANOVA. In cases in which ANOVA was used, the data met the assumptions of equality of variance and independence of cases. If the condition of equal variances was not met, Welch’s correction was used. Some of the sample groups were too small to detect normality (<8 samples) but parametric tests were used because nonparametric tests lack sufficient power to detect differences in small samples (Graphpad Statistics Guide – http://www.graphpad.com). The standard error of the mean is indicated by error bars for each group of data. Differences were considered significant at P values below 0.05. All data were analysed with GraphPad Prism software.


Tan P.W.,Neuros | Juwaini N.A.B.,Neuros | Seayad J.,Neuros
Organic Letters | Year: 2013

A novel oxidative coupling of aldehydes to form C3-substituted phthalides facilitated by co-operative dual catalysis of a Rh(III) complex and an aryl amine is reported. The reaction involves a cascade ortho C-H activation-insertion-annulation sequence. This methodology is efficient and applicable for the homo- and heterocoupling of various functionalized aldehydes generating the corresponding phthalides in moderate to high yields. © 2013 American Chemical Society.


Lane D.P.,Neuros | Verma C.,Agency for Science, Technology and Research Singapore
Genes and Cancer | Year: 2012

While the presence, in the invertebrates, of genes related in sequence and function to the vertebrate p53 family has been known since the discovery of the fly Drosophila melanogaster Dmp53 and the worm Caenorhabditis elegans cep-1 gene, the failure to discover homologs of the essential vertebrate negative regulator of p53 Mdm2 in these species led to the false assumption that Mdm2 was only present in vertebrates. Very recently, clear homologs of Mdm2 have been discovered in a wide range of invertebrate species, raising a series of interesting questions about the evolution of the p53 pathway. Here, a personal account of the discovery of Mdm2-like genes in the Placozoa and Arthropoda is used to speculate on aspects of the evolution, structure, and function of the p53 pathway. © The Author(s) 2012.


A catalyst system comprising Fe2(OtBu)6 and an N-heterocyclic carbene ligand enables efficient syntheses of (hetero)biaryls from the reactions of aryl Grignard reagents with a diverse spectrum of (hetero)aryl chlorides. Amongst the alkoxide and amide counterions investigated, tert-butoxide was the most effective in inhibiting the homocoupling of arylmagnesiums. This journal is © the Partner Organisations 2014.


Patent
Neuros | Date: 2010-10-07

According to the present invention, a ramp 990 of a top foil 900 forms a curvature the center O of which is located in lower part and horizontally contacts with the first bump 81 of the bump foil 80.


Patent
Neuros and Hyundai Motor Company | Date: 2013-12-06

A bearing unit of a turbocharger may be disposed on an inner side of a space in a center housing and carry axial load of a rotary shaft connecting a turbine wheel, a compressor wheel, and an electric motor. The bearing unit may include a bearing body fastened to a side of the center housing and has a through-hole substantially at a center of the bearing body for fitting the rotary shaft fitted, and a coupling disposed on the through-hole and the rotary shaft, having a stepped portion in which the bearing body is inserted, and forming an oil chamber with the bearing body.


Patent
Neuros and Hyundai Motor Company | Date: 2013-12-06

A rotor assembling method for a turbo-charger may include washing and preparing components of a rotor having a connector, a permanent magnet, end caps, a retention ring, and a center pipe, inserting the connector into the permanent magnet, thermally inserting one or more end caps into the connector by cooling the connector and heating the one or more end caps under a first high-temperature condition for a first predetermined time to form a permanent magnet assembly, thermally inserting the permanent magnet assembly into the retention ring by cooling the permanent magnet assembly and heating the retention ring under a second high-temperature condition for a second predetermined time to form a rotor assembly, thermally inserting the center pipe into the rotor assembly by heating the rotor assembly under a third high-temperature condition for a third predetermined time to form a rotor assembling body, and post processing the rotor assembling body.


Patent
Neuros and Hyundai Motor Company | Date: 2013-12-06

A turbocharger system includes a compressor that is connected with a turbine operated by an exhaust gas by a rotary shaft and compresses and supplies external gas to a combustion chamber of an engine, an intercooler and a throttle valve disposed in an intake line connecting the compressor with the combustion chamber of the engine, a branch line connecting an intake line between the compressor and the intercooler with an intake line between the intercooler and the throttle valve, a shutoff valve disposed in the branch line to selectively open/close the branch line, and an engine control unit controlling the operation of the shutoff valve


Patent
Neuros | Date: 2012-08-15

According to the present invention, a ramp 990 of a top foil 900 forms a curvature the center O of which is located in lower part and horizontally contacts with the first bump 81 of the bump foil 80.

Loading Neuros collaborators
Loading Neuros collaborators