National Research Center on Seed Spices

Ajmer, India

National Research Center on Seed Spices

Ajmer, India
SEARCH FILTERS
Time filter
Source Type

Prasad L.,Indian Agricultural Research Institute | Kamil D.,Indian Agricultural Research Institute | Solanki R.K.,National Research Center on Seed Spices | Singh B.,National Research Center on Seed Spices
Plant Disease | Year: 2017

Cumin is an important seed spice crop grown in tropical and subtropical parts of the world including India, Egypt, Iran, Libya, Pakistan, and Mexico. In 2010 to 2011, India produced 300,120 tons of cumin on 500,008 ha, primarily in Rajasthan and Gujarat. During January 2016, cumin plants (cvs. GC-4 and RZ-209) exhibiting symptoms of Sclerotinia blight were collected from the National Research Centre on Seed Spices in Ajmer, Rajasthan, India. Disease incidence ranged between 5 and 20% on cv. GC-4 and up to 75% on cvs. RZ-209 and RZ-223 being grown on ∼300 ha. White mycelia containing sclerotia was observed on outer surfaces of the lower stems and sclerotia were also found inside bleached stems. Symptomatic stem sections and sclerotia from two plants were surface disinfested in 0.5% sodium hypochlorite for 1 min, air dried, and placed in Petri dishes containing water agar. Hyphae were subsequently transferred to Petri dishes containing potato dextrose agar (PDA) after 3 days of incubation at room temperature (25°C). Pure cultures formed abundant, aerial, white mycelia, and after 4 days, a light pigmentation was observed. Both fungal cultures also developed sclerotia that were dark black and ranged in size from 2.6 to 5.0 mm in length and 1.5 to 2.4 mm in width. Sclerotia formed on the peripheral edges in culture. The pathogen was identified as Sclerotinia sclerotiorum (Lib.) de Bary based on morphology (Kohn 1979). Genomic DNA was extracted from the mycelia of S. sclerotiorum using ZR fungal/bacterial DNA miniprep kit (Irvine, CA). A nested-PCR amplification was performed using S. sclerotiorum specific-primers (XJJ21′ GTTGCTTTGGCGTGCTGCTC and XJJ222′ CTGACATGGACTCAATACCAATCTG) (Qin et al. 2011). An amplified PCR product of 292 bp was obtained as expected. The PCR product was sequenced and subjected to an NCBI BLAST search of highly similar sequences. A PCR product of 264 bp (GenBank accession no. KX610847) was sequenced and showed 98% sequence homology with accession nos. CP017820 and KP340989. Pathogenicity was confirmed by inoculating 23-day-old C. cyminum plants cvs. GC-4 and RZ-209, five plants each, which were grown in 12-cm diameter pots filled with sterilized soil in a greenhouse. Mycelia plugs (6 mm in diameter) were excised from the margin of 5-day-old colonies grown on PDA, placed on stems at the soil line, and wrapped with moistened sterilized cotton. Pots were covered individually with plastic bags and kept in the greenhouse at room temperature (∼25°C) for one week. To serve as the control, five plants of each cultivar were inoculated with noncolonized PDA plugs (Woodward et al. 2006). The symptoms that developed on the S. sclerotiorum-inoculated plants that were similar to those observed in the field and S. sclerotiorum was reisolated from the inoculated plants and its identity was confirmed based on morphology, size, and color of colony and sclerotia. No symptoms were observed on control plants and subsequently no fungus could be isolated from these plants. The established culture was deposited (ITCC no. 7889) in the Indian Type Culture Collection, Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi, India. This disease is an emerging and serious problem in cumin cultivation, which can directly reduce the seed yield and export of cumin. To our knowledge, this is the first report of Sclerotinia blight of cumin in India. © 2017, American Phytopathological Society. All rights reserved.


Godara A.S.,National Research Center on Seed Spices | Godara A.S.,Adoptive Trail Center | Singh R.,National Research Center on Seed Spices | Chauhan G.S.,National Research Center on Seed Spices
Indian Journal of Agricultural Sciences | Year: 2017

A field study was conducted during rabi seasons of 2012-13 and 2013-14 to assess the effect of different fertility treatments and brassinosteroid on productivity and quality of fenugreek (Trigonella foenum-graecum L.). Results revealed that the significantly higher values of yield attributes, seed yield (2 245 kg/ha), haulm yield (5 236 kg/ha) and quality parameters (protein, sapogenin, diosgenin and galactomannan) were recorded with application of 100 % RDF over lower fertility levels. Dual inoculation of seed with Rhizobium + PSB gave significantly higher yield attributes, seed yield (2 085 kg/ha), contents and yields of protein (450.33 kg/ha), sapogenin (26.87 kg/ha), diosgenin (11.76 kg/ha) and galactomannan (593.69 kg/ha) over their sole application. Interaction of fertility levels and biofertilizers was also found significant in yield attributes and consequently in seed yield and yields of quality parameters. Application of 100 % RDF + dual inoculation, being on a par with 80 % RDF + dual inoculation, gave the highest seed yield (2 287 kg/ha), protein yield (513.52 kg/ha), sapogenin yield (30.32 kg/ha), diosgenin yield (13.21 kg/ha) and galactomannan yield (677.44 kg/ha). Foliar spray of brassinosteroid 0.50 ppm brought about significantly higher yield attributes, seed yield and quality parameters over water spray and BR 0.25 ppm, respectively. Thus, integration of 80 % RDF with dual inoculation and supplemented with foliar spray of brassinosteroid 0.50 ppm at 50 and 70 DAS is better for realizing higher yield and quality in fenugreek. © 2017, Indian Council of Agricultural Research. All rights reserved.


Kakani R.K.,National Research Center on Seed Spices | Singh S.K.,Indian Central Arid Zone Research Institute | Pancholy A.,Indian Central Arid Zone Research Institute | Meena R.S.,National Research Center on Seed Spices | And 2 more authors.
Plant Molecular Biology Reporter | Year: 2011

Fenugreek (Trigonella foenum-graecum) is receiving global attention due to rare medicinal properties of significance to human health. Gene banks possess scanty germplasm and very little background information regarding its genetic variability that has hampered its improvement. We investigated the extent of variability among 17 Indian varieties of fenugreek using phenotypic and genetic markers. Multilocus genotyping by ten random amplified polymorphic DNA (RAPD) primers detected an average of intraspecific variations amounting to 64.7% polymorphism in banding patterns. Analysis of molecular variance indicated that a greater proportion of total genetic variation exists within population (91%) rather than among populations. Higher values of Nei's gene diversity (h) and Shannon Information Index (i) and genetic distance analysis validate higher genetic diversity among Indian fenugreek varieties. SNPs at 14 sites of rDNA region revealed further lineages of distinct varieties with main RAPD clusters. The representative sequences of each subgroup and all distinct varieties have been submitted to NCBI database and assigned Gen Accession numbers HM 176640-176649. The measures of relative genetic distances among varieties of fenugreek did not completely correlate with the geographical distances of places of their development. The homogeneous phenotypic markers proved insufficient in exhibiting genetic divergence among fenugreek varieties studied. Eventually, the knowledge of their genetic relationships, DNA bar coding and phylogenies might contribute for the designing of intraspecific crosses between cultivars of this fenugreek collection with potential interest in seed spices breeding programme. © 2010 Springer-Verlag.


Mishra B.K.,National Research Center on Seed Spices | Nain L.,Indian Agricultural Research Institute
International Journal of ChemTech Research | Year: 2013

Rice straw, amended with poultry manure or urea was composted with a co-inoculum of fungi and bacteria in perforated cemented pits. Microbial activity in terms of FDA hydrolysis, alkaline phosphatase and dehydrogenase was measured at monthly intervals. Microbial activity was highest at 2nd month. Carbon content was lowest at 3rd month while nitrogen was higher at 3rd month. pH and electrical conductivity of the compost was found to be within the desirable limits for its use in crop production at the end of 3rd month of composting.


Kakani R.K.,National Research Center on Seed Spices | Sharma Y.,Rajasthan Agricultural University
Sabrao Journal of Breeding and Genetics | Year: 2010

The genetics of yield and related traits was studied in barley (Hordeum vulgare L.) by means of 9 x 9 half diallel (F1 and F2) progenies under four diverse environments. Additive-dominance model was fitted only for days to heading, plant height, flag leaf area, spike length, number of grains per spike, test weight and grain yield per plant for different environments and generations. Both additive (D) and dominance (H1 and H2s) components were significant for all the traits studied. However, the relative magnitude of dominance components was observed to be higher than additive components, which indicated the preponderance of dominance components in controlling the inheritance of characters under study. The (H1/D)1/2 values revealed the existence of over dominance for flag leaf area, number of grains per spike and test weight in F1 generation only, indicating the existence of over dominance. The values of 'F' exhibited an excess of dominant alleles in the parents for days to heading, flag leaf area, spike length, number of grains per spike and test weight. The environmental component 'E' was significant for most of the traits. The average degree of dominance (H1/D)1/2 was in range of over dominance. The ratio of H2/4H1 indicated symmetrically distribution of the genes for flag leaf area, spike length, number of grains per spike, test weight and grain yield per plant in some generations and environments. The value of h2/ H2 was observed less than one in days to heading, plant height, flag leaf area, number of grains per spike, test weight and grain yield per plant in different environments and traits, suggesting the role of dominant genes in controlling the inheritance of these traits, whereas, one gene or group of genes was controlled the inheritance of the remaining characters. The heritability estimates were relatively low to moderately high magnitude for different characters. Heritability estimates were high in F1 in comparison to F2, indicating the degree of heritability was influenced by the environment and generations. Thus, non-conventional breeding methods like recurrent selection by way of inter-mating most desirable segregants followed by selection or diallel selective mating or bi-parental mating in early segregating generations may be followed for improvement in barley.


Liu Y.,Michigan State University | Liu Y.,King Saud University | Kakani R.,National Research Center on Seed Spices | Nair M.G.,Michigan State University | Nair M.G.,King Saud University
Food Chemistry | Year: 2012

The seeds of fenugreek plant (Trigonella foenum-graecum) are widely used in the preparation of seasonings, pickles, curry powders and dietary supplements. The fenugreek seeds are also used in traditional medicine to relieve the common cold, arthritic pain and high blood sugar. Therefore, we have investigated the functional food quality of fenugreek seeds by determining the lipid peroxidation (LPO) and cyclooxyganase enzyme (COX) inhibitory activities of their hexane, ethyl acetate, methanolic and water extracts using MTT, LPO, COX-1 and -2 enzyme inhibitory assays. The extracts inhibited LPO by 55-95%, COX-1 by 6-87% and COX-2 by 36-70%, respectively, at 250 μg/ml. Bioassay-guided purification of these extracts yielded triglycerides (1-3), fatty acids (4-5), saccharides (6-8) and flavonoid-C-glycosides (9-11). The isolates, excluding the saccharides, inhibited LPO and COX-1 and -2 enzymes between the ranges of 8-89%, 4-51% and 15-70%, respectively, at 25 μg/ml. This is the first report of compounds 1-8 from fenugreek seeds and the biological activities described herein. © 2011 Elsevier Ltd. All rights reserved.


Meena S.S.,National Research Center on Seed Spices | Mehta R.S.,National Research Center on Seed Spices | Lal G.,National Research Center on Seed Spices | Anwer M.M.,National Research Center on Seed Spices
Indian Journal of Horticulture | Year: 2013

A field experiment on economic feasibility of weed management practices in fenugreek was conducted during rabi season of 2007-08 and 2008-09 at National Research Centre on Seed Spices, Ajmer (Rajasthan) for finding suitable method of weed control. The experiment was laid in randomised block design with three replications. Results revealed that besides weed free treatment significantly higher plant height, number of branches per plant, number of nodules per plant, dry weight of nodules per plant and dry matter accumulation per plant at (60 DAS, 90 DAS and at harvest) were recorded with the pre-emergence application of oxadiargyl @ 75 g/ha + 1 hand weeding at 45 days after sowing (DAS) but pre-emergence application of pendimethalin @ 1 kg/ha + 1 hand weeding at 45 DAS was at par with it. Similarly, yield attributes like number of pods per plant, length of pod, pod weight, number of seeds per pod and test weight as well as seed and straw yields of fenugreek were higher with pre-emergence (PE) application of oxadiargyl @ 75 g/ha + 1 hand weeding at 45 DAS. Besides weed-free treatment, the lowest dry weight of weed at harvest, weed index and the highest weed control efficiency was obtained under pre-emergence application of oxadiargyl @ 75 g/ha + 1 hand weeding at 45 DAS. The highest gross and net returns were obtained in weed free treatment followed by pre-emergence application of oxadiargyl @ 75 g /ha + 1 hand weeding at 45 days after sowing but highest B: C ratio (4.38) was recorded with pre-emergence application of oxadiargyl @ 75 g/ha + 1 hand weeding at 45 DAS.


Singh B.,National Research Center on Seed Spices | Solanki R.K.,National Research Center on Seed Spices
Indian Journal of Agricultural Sciences | Year: 2015

The present paper reviews the research and development status of seed spices in India in the last seven decades. Seed spices are one of the important group of spice crops being cultivated in the arid and semi-arid region of the country. These crops are attaining importance day by day due to its aromatic and medicinal values, the present era is reflecting high International demand of Indian seed spices. The research achievements till date have been very concise for developing, numerous high yielding disease resistant or tolerant varieties, efficient production and protection technologies have also been developed during the period. Since 1930, we have gone long way in understanding the basic problems of these crops. The area of research have been focused mainly on designing packages to harvest more, production of better quality and consumer safe produce is yet to come. The ongoing compilation is a brief information of the milestones that has been bagged by the country's scientific and developmental team to sustain these crops. The problems and challenges in the cultivation of seed spices are enormous and each has to be answered with the changing climatic scenario in the time to come. New problems are also coming up in many of the seed spice crops. Cumin and coriander being the pre-dominant seed spice of the group needs more of the attention. The ongoing paper reflects the synchronized events that have happened in the country for seed spices research and development and also mentioning the significant achievements made and technologies which have shown considerable impact in sustaining these high value low volume crops under the hands of seed spice growers.


Lal G.,National Research Center on Seed Spices | Singh R.,National Research Center on Seed Spices
Indian Journal of Agricultural Sciences | Year: 2016

An experiment was conducted for the evaluation of coriander (Coriandrum sativum L.) varieties under different organic modules for sustainable production during rabi season of 2009-10 to 2012-13 (four years) at ICAR-National Research Center on Seed Spices, Tabiji, Ajmer, Rajasthan. The experiment was laid out in Factorial Randomized Block Design consisting of three organic modules (M1, M2 and M3) and two varieties Ajmer Coriander-1 (ACr-1, V1) and Rajasthan Coriander-41 (RCr-41, V2) with four replications. Findings of this study showed significant differences among the performance of different organic modules tested for two coriander varieties. Organic module M1 [comprising soil application of vermicompost (5 tonnes/ha), foliar spray of garlic extract (5% @ 2.0 kg/ha) + neem oil (2% @ 5 l/ha, soil application of neem cake (150 kg/ha) and Trichoderma (2.5 kg/ha), seed treatment with Rhizobium (100 ml/kg seed), PSB (100 ml/kg seed) and Trichoderma (10 g/kg seed)] exhibited maximum number of primary branches (8.05/plant), secondary branches (21.88/plant), number of umbels (32.22/plant), number of seeds (8.81/umbellate) and highest seed yield (1323.90 kg/ha) in coriander crop. Similarly, significant differences were recorded in the performance of coriander varieties under different organic modules and the maximum number of primary branches (7.87/plant), secondary branches (21.55/plant), number of umbels (29.20/plant), number of umbellates (5.81/plant) and number of seeds (8.40/umbellate) with earliest flowering (66.05 days after sowing-DAS), and highest seed yield (1296.31 kg/ha) were recorded in coriander variety ACr-1 than that of variety RCr-41. Cultivation of coriander variety ACr-1 with the application of Module-1 exhibited maximum values for all the growth parameters, yield attributing characters with maximum seed yield. Hence, variety ACr-1 is suggested to grow organically with the application of Module-1 (M1) under semi-arid environmental conditions.


Meena S.S.,National Research Center on Seed Spices | Mehta R.S.,National Research Center on Seed Spices
Indian Journal of Horticulture | Year: 2010

A field experiment was conducted to find out the economic feasibility of weed management practices in terms of weed dynamics, weed control efficiency and performance of cumin (Cuminum cyminum). The experiment comprised of nine treatments. The experiment was laid out in randomized block design with three replications. Major weed flora observed in the experimental field were Plantago pumila, Chenopodium murale, Chenopodium album, Amaranthus viridis, Cyperus rotandus and Phalaris minor. The results revealed that weed free treatments resulted in significantly maximum vegetative growth and seed yield (6.0 q ha-1) of cumin followed by pre emergence application of oxadiargyl @ 75 g ha-1 + one hand weeding at 45 DAS. Among the weed management practices, weed free treatment was most effective in reducing the dry weight of weeds and recorded the highest weed control efficiency (85.94%) followed by preemergence application of oxadiargyl @ 75 g ha-1 + one hand weeding at 45 DAS (78.31%). However, the maximum net returns (46,364.80 Rs.ha -1) and highest benefit: cost ratio of 3.48:1 was obtained in pre-emergence application of oxadiargyl @75 g ha-1 + one hand weeding at 45 DAS among all the treatments including weed free treatment. Thus pre emergence application of oxadiargyl @75 g/ha. + one hand weeding at 45 DAS was found as the best economically feasible practice to keep weed infestation at minimum level and to ensure higher economic yield (5.91 q ha1) in cumin.

Loading National Research Center on Seed Spices collaborators
Loading National Research Center on Seed Spices collaborators