Göttingen, Germany
Göttingen, Germany

Time filter

Source Type

MoBiTec to Offer the First Commercially Available Bacillus Subtilis Food Grade Expression System The Bacillus Food Grade Expression System was created to make the advantages of a Bacillus expression system also accessible to areas where antibiotic resistance gene markers are prohibited (e.g., food and feed industry). Goettingen, Germany, May 11, 2017 --( - It is non-pathogenic and is considered as a GRAS organism (generally regarded as safe) - It has no significant bias in codon usage - It is capable of secreting functional extracellular proteins directly into the culture medium - At present, about 60% of the commercially available enzymes are produced by Bacillus species - A large body of information concerning transcription, translation, protein folding and secretion mechanisms, genetic manipulation and large-scale fermentation has been acquired The Bacillus Food Grade Expression System was created to make the advantages of a Bacillus expression system also accessible to areas where antibiotic resistance gene markers are prohibited (e.g., food and feed industry). It enables stable vector-based large scale heterologous protein production by an alternative selection, without antibiotics. The Bacillus Food Grade Selection System is based on the interplay of an endogenous Bacillus toxin EndoA (expressed from vector) and its antitoxin EndoB (expressed from genome). EndoA is an endoribonuclease that specifically cleaves mRNA at a five Base U↓ACAU sequence. During normal growth conditions EndoA is inactivated by forming a heterohexameric complex with its cognate antitoxin EndoB. Since the antitoxin is relatively unstable, it is essential for the cell to continuously produce sufficient amounts of EndoB to inactivate the more stable toxin. These characteristics are utilized for retaining the vector within the cell. Features: - Stable high- or low-level expression without addition of any antibiotics - All DNA contained in the final expression system is derived from Bacillus subtilis - No endotoxins are produced - No inclusion bodies are formed - Protease-deficient strain for producing secretory enzymes is available - Shuttle vectors: Cloning can be done with E. coli For details please visit: www.mobitec.com About MoBiTec GmbH MoBiTec GmbH (Goettingen, Germany) is a privately held company (founded in 1987) that offers research tools for molecular and cell biology. Products include DNA vectors for cloning and expression, cell transfection reagents and cell culture tools, immobilized and soluble enzymes, products for genomics and proteomics research, numerous antibodies and recombinant proteins, superior fluorescence reagents and kits, affinity chromatography products, as well as general laboratory equipment. In parallel to its own product lines, MoBiTec distributes products from international companies in Germany. MoBiTec products are distributed worldwide, in Germany from their home office, in other countries by distributors. http://www.mobitec.com Goettingen, Germany, May 11, 2017 --( PR.com )-- Gram-positive bacteria are well-known for their contributions to agricultural, medical, and food biotechnology, and for the production of recombinant proteins. Among them, Bacillus subtilis has been developed as an attractive host due to the following facts:- It is non-pathogenic and is considered as a GRAS organism (generally regarded as safe)- It has no significant bias in codon usage- It is capable of secreting functional extracellular proteins directly into the culture medium- At present, about 60% of the commercially available enzymes are produced by Bacillus species- A large body of information concerning transcription, translation, protein folding and secretion mechanisms, genetic manipulation and large-scale fermentation has been acquiredThe Bacillus Food Grade Expression System was created to make the advantages of a Bacillus expression system also accessible to areas where antibiotic resistance gene markers are prohibited (e.g., food and feed industry). It enables stable vector-based large scale heterologous protein production by an alternative selection, without antibiotics.The Bacillus Food Grade Selection System is based on the interplay of an endogenous Bacillus toxin EndoA (expressed from vector) and its antitoxin EndoB (expressed from genome). EndoA is an endoribonuclease that specifically cleaves mRNA at a five Base U↓ACAU sequence. During normal growth conditions EndoA is inactivated by forming a heterohexameric complex with its cognate antitoxin EndoB. Since the antitoxin is relatively unstable, it is essential for the cell to continuously produce sufficient amounts of EndoB to inactivate the more stable toxin. These characteristics are utilized for retaining the vector within the cell.Features:- Stable high- or low-level expression without addition of any antibiotics- All DNA contained in the final expression system is derived from Bacillus subtilis- No endotoxins are produced- No inclusion bodies are formed- Protease-deficient strain for producing secretory enzymes is available- Shuttle vectors: Cloning can be done with E. coliFor details please visit: www.mobitec.comAbout MoBiTec GmbHMoBiTec GmbH (Goettingen, Germany) is a privately held company (founded in 1987) that offers research tools for molecular and cell biology. Products include DNA vectors for cloning and expression, cell transfection reagents and cell culture tools, immobilized and soluble enzymes, products for genomics and proteomics research, numerous antibodies and recombinant proteins, superior fluorescence reagents and kits, affinity chromatography products, as well as general laboratory equipment.In parallel to its own product lines, MoBiTec distributes products from international companies in Germany. MoBiTec products are distributed worldwide, in Germany from their home office, in other countries by distributors.http://www.mobitec.com Click here to view the company profile of MoBiTec GmbH Click here to view the list of recent Press Releases from MoBiTec GmbH

MoBiTec provides a wide range of useful vectors for the Bacillus megaterium system, including a vector with two ribosome binding sites (2RBS) for simultaneous dual expression.

Optimized high performance (hp) vectors for Bacillus megaterium - MoBiTec provides a wide range of useful vectors for the Bacillus megaterium system, including a vector with two ribosome binding sites (2RBS) for simultaneous dual expression. Goettingen, Germany, May 05, 2017 --( With the hp-vector family yields up to 10-fold higher compared to the basic plasmids are possible. All plasmids have established multiple cloning sites (MCS) for versatile cloning. Furthermore, MoBiTec offers vectors encoding C- or N-terminal His-tags for easy purification. The protein secretion with LipA or YocH signal peptides is up to 9-fold increased. Induction of protein expression of all vectors is achieved by the tightly regulated and efficiently inducible xylose operon. Versatile system with a wide range of vectors The B. megaterium expression system provides a versatile and easy-to-handle tool for stable and high-yield protein production, both small- and large-scale. B. megaterium has proven to be an excellent alternative host to E. coli for heterologous gene expression. Unlike other bacilli strains, proteolytic degradation by external alkaline proteases is avoided. In addition, there are no endotoxins found in the cell wall. Features • Vector p3STOP1623-2RBShp with two ribosome binding sites (2RBS) for simultaneous dual expression available • High performance vectors with optimized sequences • Protein yield up to 10 times enhanced compared to protein expression with basic plasmid • Plasmids with established MCS • Encoding C- or N-terminal His-tag for versatile purification (native, 6xHis-tag) • Secretion with LipA or YocH signal peptide up to 9-fold increased • Selection of select host strains available • Vectors and strains licensable for commercial usage About MoBiTec GmbH MoBiTec GmbH (Goettingen, Germany) is a privately held company (founded in 1987) that offers research tools for molecular and cell biology. Products include DNA vectors for cloning and expression, cell transfection reagents and cell culture tools, immobilized and soluble enzymes, products for genomics and proteomics research, numerous antibodies and recombinant proteins, superior fluorescence reagents and kits, affinity chromatography products, as well as general laboratory equipment. In parallel to its own product lines, MoBiTec distributes products from international companies in Germany. MoBiTec products are distributed worldwide, in Germany from their home office, in other countries by distributors. Goettingen, Germany, May 05, 2017 --( PR.com )-- The E. coli/Bacillus megaterium shuttle vector p3STOP1623-2RBShp is the only vector worldwide suitable for simultaneous dual expression of heterologous genes in B. megaterium.With the hp-vector family yields up to 10-fold higher compared to the basic plasmids are possible. All plasmids have established multiple cloning sites (MCS) for versatile cloning. Furthermore, MoBiTec offers vectors encoding C- or N-terminal His-tags for easy purification. The protein secretion with LipA or YocH signal peptides is up to 9-fold increased. Induction of protein expression of all vectors is achieved by the tightly regulated and efficiently inducible xylose operon.Versatile system with a wide range of vectorsThe B. megaterium expression system provides a versatile and easy-to-handle tool for stable and high-yield protein production, both small- and large-scale. B. megaterium has proven to be an excellent alternative host to E. coli for heterologous gene expression. Unlike other bacilli strains, proteolytic degradation by external alkaline proteases is avoided. In addition, there are no endotoxins found in the cell wall.Features• Vector p3STOP1623-2RBShp with two ribosome binding sites (2RBS) for simultaneous dual expression available• High performance vectors with optimized sequences• Protein yield up to 10 times enhanced compared to protein expression with basic plasmid• Plasmids with established MCS• Encoding C- or N-terminal His-tag for versatile purification (native, 6xHis-tag)• Secretion with LipA or YocH signal peptide up to 9-fold increased• Selection of select host strains available• Vectors and strains licensable for commercial usageAbout MoBiTec GmbHMoBiTec GmbH (Goettingen, Germany) is a privately held company (founded in 1987) that offers research tools for molecular and cell biology. Products include DNA vectors for cloning and expression, cell transfection reagents and cell culture tools, immobilized and soluble enzymes, products for genomics and proteomics research, numerous antibodies and recombinant proteins, superior fluorescence reagents and kits, affinity chromatography products, as well as general laboratory equipment.In parallel to its own product lines, MoBiTec distributes products from international companies in Germany. MoBiTec products are distributed worldwide, in Germany from their home office, in other countries by distributors. Click here to view the company profile of MoBiTec GmbH Click here to view the list of recent Press Releases from MoBiTec GmbH

News Article | September 7, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. Chemicals and reagents used in this study were purchased from commercial sources (Sigma, Tocris, Fisher scientific, ZINC database suppliers) or synthesized as outlined in the Supplementary Information. HEK293 (ATCC CRL-1573; 60113019; certified mycoplasma free and authentic by ATCC) and HEK293-T (HEK293T; ATCC CRL-11268; 59587035; certified mycoplasma free and authentic by ATCC) cells were from the ATCC and are well validated for signalling studies. Cells were also validated by analysis of short tandem repeat (STR) DNA profiles and these profiles showed 100% match at the STR database from ATCC. U2OS cells expressing human μOR were obtained as cryopreserved stocks from DiscoverX and were not further authenticated. The inactive-state μ-opioid receptor structure (PDB: 4DKL) was used as input for receptor preparation with DOCK Blaster (http://blaster.docking.org)44. Forty-five matching spheres were used based on a truncated version of the crystallized ligand. The covalent bond and linker region of the antagonist β-funaltrexamine were removed for sphere generation. The ligand sampling parameters were set with bin size, bin size overlap, and distance tolerances of 0.4 Å, 0.1 Å, and 1.5 Å, respectively, for both the matching spheres and for the docked molecules. Ligand poses were scored by summing the receptor-ligand electrostatics and van der Waals interaction energy corrected for ligand desolvation. Receptor atom partial chargers were used from the united atom AMBER force field except for Lys233 and Tyr326, where the dipole moment was increased as previously described43. Over 3 million commercially available molecules from the ZINC20 (http://zinc.docking.org) lead-like set were docked into the receptor using DOCK3.621 (http://dock.compbio.ucsf.edu). Among the top ranking 0.08% of molecules were inspected and 23 were selected for experimental testing in the primary screen. A resource to perform these docking studies is publicly available (http://blaster.docking.org). For a secondary screen, analogues of the top three hits from the primary screen (compounds 4, 5 and 7) with a similarity of greater than 0.7 (as defined in the ZINC search facility) were identified in the ZINC database. Additionally, substructure searches were performed using the scaffolds of each of these three compounds. The searches yielded 500 purchasable compounds, which were then docked as in the primary screen. Analogues were manually inspected for interactions and selected for further experimental testing. For a primary screen of selected molecules, binding to μOR was assessed by measuring competition against the radioligand 3H-diprenorphine (3H-DPN). Each compound was initially tested at 20 μM and was incubated with 3H-DPN at a concentration equal to the K (0.4 nM) of the radioligand in μOR containing Sf9 insect cell membranes. The reaction contained 40 fmol of μOR and was incubated in a buffer of 20 mM HEPES pH 7.5, 100 mM sodium chloride, and 0.1% bovine serum albumin for 1 h at 25 °C. To separate free from bound radioligand, reactions were rapidly filtered over Whatman GF/B filters with the aid of a Brandel harvester and 3H-DPN counts were measured by liquid scintillation. Compounds with more than 25% of 3H-DPN radioactivity were further tested in full dose–response to determine the affinity (K ) in HEK293 membranes. Subsequently, the 15 analogues were tested in full dose–response for affinity at the μOR and the κOR by the National Institutes of Mental Health Psychoactive Drug Screen Program (PDSP)45, as were the affinities of compounds 12, PZM21, and their stereoisomers at the μOR, δOR, κOR and nociception receptor. Radioligand depletion assays to test the irreversible binding of compound PZM29 were performed as described previously46. Human embryonic kidney 293 (HEK 293) cells were transiently transfected with μOR or the cysteine mutant μOR:N127C using the Mirus TransIT-293 transfection reagent (MoBiTec, Goettingen, Germany), grown for 48 h, harvested, and homogenates were prepared as described47. For radioligand depletion experiments, homogenates were preincubated in TRIS buffer (50 mM Tris at pH 7.4) at a protein concentration of 50–100 μg/ml or 70–120 μg/ml for μOR and μOR:N127C, respectively and the covalent ligand (at 5 μM) for different time intervals. Incubation was stopped by centrifugation and reversibly bound ligand was washed three times (resuspension in buffer for 30 min and subsequent centrifugation). Membranes were then used for radioligand binding experiments with 3H-diprenorphine (final concentration: 0.7 nM, specific activity: 30 Ci/mmol, purchased from Biotrend, Cologne, Germany) to determine specific binding at the μOR (B  = 4,000–6,500 fmol/mg protein, K  = 0.25–0.45 nM) and the μOR:N127C receptor (B  = 1,300–6,000 fmol/mg protein, K  = 0.18–0.25 nM), respectively as described48. Non-specific binding was determined in the presence of 10 μM naloxone. For data analysis, the radioactivity counts were normalized to values where 100% represents effect of buffer and 0% represents non-specific binding. Five independent experiments, each done in quadruplicate, were performed and the resulting values were calculated and pooled to a mean curve which is displayed. The [35S]-GTPγS binding assay was performed with membrane preparations from HEK 293 cells coexpressing the human μOR and the PTX insensitive G-protein subunits G or G 49. Cells were transiently transfected using the Mirus TransIT-293 transfection reagent (MoBiTec, Goettingen, Germany), grown for 48 h, harvested and homogenates were prepared as described47. The receptor expression level (B ) and K values were determined in saturation experiments with 3H-diprenorphine (specific activity: 30 Ci/mmol, purchased from Biotrend, Cologne, Germany) (B  = 3,700 ± 980 fmol/mg protein, K  = 0.30 ± 0.093 nM for μOR+G or B  = 5,800 ± 2,000 fmol/mg, K  = 0.46 ± 0.095 nM for μOR+G , respectively). The assay was carried out in 96-well plates with a final volume of 200 μl. In each well, 10 μM GDP, the compounds (0.1 pM to 100 μM final concentration) and the membranes (30 μg/ml final protein concentration) were incubated for 30 min at 37 °C in incubation buffer containing 20 mM HEPES, 10 mM MgCl • 6 H O and 70 mg/l saponin. After the addition of 0.1 nM [35S]-GTPγS (specific activity 1,250 Ci/mmol, PerkinElmer, Rodgau, Germany) incubation was continued at 37 °C for further 30 min or 75 min for μOR+G or μOR+G , respectively. Incubation was stopped by filtration through Whatman GF/B filters soaked with ice cold PBS. Bound radioactivity was measured by scintillation measurement as described previously48. Data analysis was performed by normalizing the radioactivity counts (ccpms) to values when 0% represents the non-stimulated receptor and 100% the maximum effect of morphine or DAMGO. Dose–response curves were calculated by nonlinear regression in GraphPad Prism 6.0. Mean values ± s.e.m. for EC and E values were derived from 3–12 individual experiments each done in triplicate. To measure μOR G -mediated cAMP inhibition, HEK-293T cells were co-transfected using calcium phosphate in a 1:1 ratio with human μOR and a split-luciferase based cAMP biosensor (pGloSensorTM-22F; Promega). For experiments including GRK2 co-expression, cells were transfected with 1 μg/15-cm dish of GRK2. After at least 24 h, transfected cells were washed with phosphate buffered saline (PBS) and trypsin was used to dissociate the cells. Cells were centrifuged, resuspended in plating media (1% dialysed FBS in DMEM), plated at a density of 15,000–20,000 cells per 40 μl per well in poly-lysine coated 384-well white clear bottom cell culture plates, and incubated at 37 °C with 5% CO overnight. For inactivation of pertussis-toxin (PTX) G experiments, cells were plated with 100 ng/ml final concentration PTX. The next day, drug dilutions were prepared in fresh assay buffer (20 mM HEPES, 1× HBSS, 0.1% bovine serum album (BSA), and 0.01% ascorbic acid, pH 7.4) at 3× drug concentration. Plates were decanted and 20 μl per well of drug buffer (20 mM HEPES, 1× HBSS, pH 7.4) was added to each well. Drug addition to 384-well plates was performed by FLIPR adding 10 μl of drug per well for a total volume of 30 μl. Plates were allowed to incubate for exactly 15 min in the dark at room temperature. To stimulate endogenous cAMP via β adrenergic-G activation, 10 μl of 4× isoproterenol (200 nM final concentration) diluted in drug buffer supplemented with GloSensor assay substrate was added per well. Cells were again incubated in the dark at room temperature for 15 min, and luminescence intensity was quantified using a Wallac TriLux microbeta (Perkin Elmer) luminescence counter. Data were normalized to DAMGO-induced cAMP inhibition and analysed using nonlinear regression in GraphPad Prism 6.0 (Graphpad Software Inc., San Diego, CA). Determination of functional activity of PZM21-29 for SAR studies was performed using a BRET-based cAMP accumulation assay50. HEK-293T cells were transiently co-transfected with pcDNA3L-His-CAMYEL42 (purchased from ATCC via LCG Standards, Wesel, Germany) and human μOR, achieving a cDNA ratio of 2:2 using Mirus TransIT-293 transfection reagent. 24 h post-transfection, cells were seeded into white half-area 96-well plates at 20 × 104 cells/well and grown overnight. On the following day, phenol-red-free medium was removed and replaced by PBS and cells were serum starved for 1 h before treatment. The assay was started by adding 10 μl coelenterazine h (Progmega, Mannheim, Germany) to each well to yield a final concentration of 5 μM. After 5 min incubation, compounds were added in PBS containing forskolin (final concentration 10 μM). Reads of the plates started 15 min after agonist addition. BRET readings were collected using a CLARIOstar plate reader (BMG LabTech, Ortenberg, Germany). Emission signals from Renilla Luciferase and YFP were measured simultaneously using a BRET1 filter set (475-30 nm/535-30 nm). BRET ratios (emission at 535-30 nm/emission at 475-30 nm) were calculated and dose–response curves were fitted by nonlinear regression using GraphPad Prism 6.0. Curves were normalized to basal BRET ratio obtained from dPBS and the maximum effect of morphine and DAMGO. Each curve is derived from three to five independent experiments each done in duplicate. Calcium release was measured using a FLIPRTETRA fluorescence imaging plate reader (Molecular Devices). Calcium release experiments were run in parallel to G Glosensor experiments with the same HEK-293T cells transfected with μOR, except cells for FLIPR were plated in poly-lysine coated 384-well black clear bottom cell culture plates. Cells were incubated at 37 °C with 5% CO overnight and next day media was decanted and replaced with Fluo-4 direct calcium dye (Life Technologies) made up in HBSS with 20 mM HEPES, pH 7.4. Dye was incubated for 1 h at 37 °C. Afterwards, cells were equilibrated to room temperature, and fluorescence in each well was read for the initial 10 s to establish a baseline. Afterwards,10 μl of drug (3×) was added per well and the maximum-fold increase in fluorescence was determined as fold-over-baseline. Drug solutions used for the FLIPR assay were exactly the same as used for G Glosensor experiments. To activate endogenous G -coupled receptors as a positive control for calcium release, TFLLR-NH (10 μM, PAR-1 selective agonist) was used. Internalization was measured using the eXpress DiscoveRx PathHunter GPCR internalization assay using split β-galactosidase complementation. In brief, cryopreserved U2OS cells expressing the human μOR were thawed rapidly and plated in supplied medium and 96-well culture plates. Next day, cells were stimulated with drugs (10×) and allowed to incubate for 90 min at 37 °C with 5% CO . Afterwards, substrate was added to cells and chemiluminescence was measured on a TriLux (Perkin Elmer) plate counter. Data were normalized to DAMGO and analysed using Graphpad Prism 6.0. β-Arrestin recruitment was measured by either the PathHunter enzyme complementation assay (DiscoveRx) or by previously described bioluminescence resonance energy transfer (BRET) methods51. Assays using DiscoveRx PathHunter eXpress OPRM1 CHO-K1 β-Arrestin GPCR Assays were conducted exactly as instructed by the manufacturer. Briefly, supplied cryopreserved cells were thawed and resuspended in the supplied medium, and plated in the furnished 96-well plates. Next day, 10× dilutions of agonist (prepared in HBSS and 20 mM HEPES, pH 7.4) were added to the cells and incubated for 90 min. Next, the detection reagents were reconstituted, mixed at the appropriate ratio, and added to the cells. After 60 min, luminescence per well was measured on a TriLux (Perkin-Elmer) plate counter. Data were normalized to DAMGO and analysed using the sigmoidal dose–response function built into GraphPad Prism 6.0. To measure μOR mediated β-arrestin recruitment by BRET in the presence or absence of GRK2 co-expression, HEK-293T cells were co-transfected in a 1:1:15 ratio with human μOR containing C-terminal renilla luciferase (RLuc8), GRK2, and venus-tagged N-terminal β-arrestin-2, respectively. In the case of experiments where GRK2 expression was varied, pcDNA3.1 was substituted for GRK2 to maintain the same concentration of DNA transfected. After at least 24 h, transfected cells were plated in poly-lysine coated 96-well white clear bottom cell culture plates in plating media at a density of 125,000–250,000 cells per 200 μl per well and incubated overnight. The next day, media was decanted and cells were washed twice with 60 μl of drug buffer and incubated at room temperature for at least 10 min before drug stimulation. 30 μl of drug (3×) was added per well and incubated for at least 30 min in the dark. Then, 10 μl of the RLuc substrate, coelenterazine H (Promega, 5 μM final concentration) was added per well, and plates were read for both luminescence at 485 nm and fluorescent eYFP emission at 530 nm for 1 s per well using a Mithras LB940 microplate reader. The ratio of eYFP/RLuc was calculated per well and the net BRET ratio was calculated by substracting the eYFP/RLuc per well from the eYFP/RLuc ratio without venus–arrestin present. Data were normalized to DAMGO-induced stimulation and analysed using nonlinear regression in GraphPad Prism 6.0. Multiple approaches have been described to quantitate ligand bias, including operational models, intrinsic relative activity models, and allosteric models31, 52. In the absence of GRK2, we observe no β-arrestin-2 recruitment for PZM21 and TRV130. This prevents a quantitative assessment of bias by the operational model. In the case where GRK2 is overexpressed, we observe arrestin recruitment for PZM21 and TRV130. In this case, we utilize the operational model to calculate ligand bias and display equiactive bias plots for comparison of ligand efficacy for distinct signalling pathways31, 53. The Glosensor G , DiscoverX PathHunter β-arrestin, or net BRET concentration response curves were fit to the Black-Leff operational model to determine transduction coefficients (τ/K ). Compound bias factors are expressed after normalization against the prototypical opioid agonist DAMGO used as a reference. Bias factors are expressed as the value of ΔΔlog[τ/K ]. To identify potential off-target activity of PZM21, we used the National Institutes of Mental Health Psychoactive Drug Screen Program. Compound PZM21 was first tested for activity against 320 non-olfactory GPCRs using the PRESTO-Tango GPCRome screening β-arrestin recruitment assay30. We used 10 μM PZM21 and activity at each receptor was measured in quadruplicate. Potential positive receptor hits were defined as those that increase the relative luminescence value twofold. Positive hits were subsequently re-tested in full dose–response mode to determine whether the luminescence signal titrates with increasing concentrations of PZM21. A number of false-positive hits were discounted by this approach. PZM21 inhibition of hERG channel was performed as described previously54 and neurotransmitter transporter assays were determined used the Molecular Devices Neurotransmitter Assay Kit (Molecular Devices). Adult male C57BL/6J (aged 3–5 months) obtained from Jackson Laboratories (Bar Harbour, Maine) were used to investigate behavioural responses, respiratory effects, and hyperlocomotion induced by PZM21 and compared with morphine or vehicle (0.9% sodium chloride). For μOR knockout animals, Oprm1−/− mice (B6.129S2-Oprm1tm1Kff/J) were obtained from Jackson Laboratories. All drugs were dissolved in vehicle and injected subcutaneously. Behavioural studies were conducted at the University of North Carolina and Stanford University following the National Institutes of Health’s guidelines for care and use of animals and with approved mouse protocols from the institutional animal care and use committees. Sample sizes (number of animals) were not predetermined by a statistical method and animals were assigned to groups randomly. Drug treatment groups were only blinded for measurement of affective versus reflexive analgesia; other experiments were not blinded to investigators. Predefined exclusion criteria were set for analgesia and conditioned preference experiments. No animals were excluded from statistical analysis. Statistical analyses were performed after first assessing the normality of distributions of data sets and Leven’s test was used to assess equality of variances. Analgesia-like responses in were measured as previously described55 using a hotplate analgesia meter with dimensions of 29.2 × 26.7 cm with mice restricted to a cylinder 8.9 cm in diameter and 15.2 cm high (IITC Life Sciences, Woodland Hills, California). Response was measured by recording the latency to lick, flutter, or splay hind paw(s), or an attempt to jump out of the apparatus at 55 °C, with a maximum cut-off time of 30 s. Once a response was observed or the cut-off time had elapsed, the subject was immediately removed from the hotplate and placed back in its home cage. The animals were acclimated to the hotplate, while cool, and a baseline analgesic response time was acquired several hours before drug treatment and testing. Mice were injected with either vehicle (n = 8), morphine (5 mg/kg, n = 8 or 10 mg/kg, n = 8), TRV130 (1.2 mg/kg, n = 9) or PZM21 (10 mg/kg, n = 8; 20 mg/kg, n = 11; or 40 mg/kg, n = 8). After injection of drug, the analgesic effect expressed as percentage maximum possible effect (%MPE) was measured at 15, 30, 60, 90 and 120 min after drug treatment. If animals did not display hind paw lick, splay, or flutter, they were removed from the trial. Additionally, if animals attempted to jump out of the plate or urinated on the hotplate they were removed from the trial. To assess analgesia by the tail-flick assay, a tail-flick analgesia meter (Columbus Instruments, Columbus, Ohio). Mice were gently immobilized with a cotton towel and the tail base was placed on a radiant light source emitting a constant temperature of 56 °C. The tail withdrawal latency was measured at similar time points as the hotplate assay after administration of vehicle (n = 8), morphine (5 mg/kg, n = 4; 10 mg/kg, n = 8) or PZM21 (10 mg/kg, n = 8; 20 mg/kg; n = 14). The cut-off time for the heat source was set at 10 s to avoid tissue damage. Analgesic response times were measured similar to the hotplate assay. Oprm1−/− and wild-type C57Bl/6J mice (male; 8–11 weeks) were acclimated to the testing environment and thermal-plate equipment for three non-consecutive days between 11:00 and 13:00 before any pharmacological studies. Acclimation was achieved by individually confining mice within an enclosed semi-transparent red plastic cylinder (10 cm depth × 15 cm height) on a raised metal-mesh rack (61 cm height) for 30 min, and then exposing each mouse to the thermal-plate equipment (non-heated; floor dimensions, 16.5 × 16.5 cm; Bioseb), while confined within a clear plastic chamber (16 cm length × 16 cm width × 30 cm height). Acclimation exposure to the thermal plate lasted for 30 s, and exposure was repeated after 30 min to mimic the test day conditions. The testing environment had an average ambient temperature of 22.6 °C and illumination of 309 lx from overhead fluorescence lighting. The same male experimenter (G.C.) was present throughout the entire duration of habituation and testing to exclude possible olfaction-induced alterations in sensory thresholds56. Cutaneous application of a noxious stimulus, or time spent on a hotplate apparatus can broadly elicit several distinct behavioural responses: 1) withdrawal reflexes: rapid reflexive retraction or digit splaying of the paw; 2) affective-motivational responses: directed licking and biting of the paw, and/or a motivational response characterized by jumping away from the heated floor plate. Paw withdrawal reflexes are classically measured in studies of hypersensitivity, and involve simple spinal cord and brainstem circuits57. In contrast, affective responses are complex, non-stereotyped behaviours requiring processing by limbic and cortical circuits in the brain, the appearance of which indicates the subject’s motivation and arousal to make the unpleasant sensation cease by licking the affected tissue, or seeking an escape route36, 57, 58, 59, 60, 61, 62, 63, 64. To distinguish between potential differential analgesic effects of PZM21, mice were placed on the heated apparatus (52.5 °C), and the latency to exhibition of the first sign of a hindpaw reflexive withdraw, and the first sign of an affective response was recorded. A maximum exposure cut-off of 30 s was set to reduce tissue damage. Mice were injected with either vehicle (n = 6), morphine (10 mg/kg, n = 10), or PZM21 (20 mg/kg, n = 13). After injection of drug, the analgesic effect on either reflex or attending responses was expressed as percentage maximum possible effect (%MPE), and was measured at −30 (baseline), 15, 30, 60, 90, 120, and 180 min relative to drug treatment. For studies comparing Oprm1−/− and wild-type C57Bl/6J mice, the analgesic response in the hotplate assay was measured 30 min after injection of vehicle (n = 5 for both genotypes), morphine (10 mg/kg, n = 5 for both genotypes) or PZM21 (20 mg/kg, n = 6 for Oprm1−/− and n = 5 for wild-type). Analgesia to formalin injection was carried out as described previously65. Mice were first habituated for 20 min to the testing environment which included a home cage without bedding, food, and water. After habituation, vehicle (n = 6), morphine (10 mg/kg, n = 7), or PZM21 (40 mg/kg, n = 7) was injected subcutaneously. This was followed by injection of 20 μl of 1% formalin in 0.9% saline under the skin of the dorsal surface of the right hindpaw. Animals were returned to their home cage and behavioural responses were recorded for one hour. Nociception was estimated by measuring the cumulative time spent by animals licking the formalin-injected paw. As opioids classically display two phases of analgesic action, nociceptive behaviour was measured during both the early phase (0 to 5 min) and the late phase (20 to 30 min). In Fig. 4, an asterisk indicates a significant difference between drug and vehicle (P < 0.05 calculated using a one-way ANOVA with Bonferroni correction). Respiration data was collected using a whole body plethysmography system (Buxco Electronics Inc., Wilmington, North Carolina) as described66. This method measures respiratory frequency, tidal volume, peak flows, inspiratory time, and expiratory time in conscious and unrestrained mice. Briefly, Buxco airflow transducers were attached to each plethysmography chamber and a constant flow rate was maintained for all chambers. Each chamber was calibrated to its attached transducer before the experiment. Animals were first habituated to the clear plexiglass chambers for 10 min. Respiratory parameters were recorded for 10 min to establish a baseline before injection of vehicle (n = 8), morphine (10 mg/kg, n = 8), TRV130 (1.2 mg/kg, n = 8) or PZM21 (40 mg/kg, n = 8). Respiratory parameters were then collected on unrestrained mice for 100 min post drug injection. To decrease respiratory variability induced by anxiety, mice were shielded from view of other animals and experimenter. In Fig. 4, an asterisk indicates a significant difference between drug and vehicle (P < 0.05 calculated using a repeated measures ANOVA with Bonferroni correction). To measure constipatory effects of morphine and PZM21, we assessed the total accumulated faecal boli as described6. Briefly, mice were injected with vehicle (n = 10), morphine (10 mg/kg, n = 16) or PZM21 (20 mg/kg, n = 16) and placed within a plexiglass chamber (5 cm × 8 cm × 8 cm) positioned on a mesh screen. Mice were maintained without food or water for 6 h. Faecal boli were collected underneath the mesh on a paper towel and the cumulative mass was measured every hour for six hours. In Fig. 4, an asterisk indicates a significant difference between drug and vehicle (P < 0.05 calculated using a repeated measures ANOVA with Bonferroni correction). A photocell-equipped automated open field chamber (40 cm × 40 cm × 30 cm; Versamax system, Accuscan Instruments) contained inside sound-attenuating boxes was used to assess locomotor activity. Baseline ambulation of freely moving mice was monitored over 30 min, followed by injection with vehicle (n = 7), morphine (10 mg/kg, n = 5) or PZM21 (20 mg/kg, n = 6). Locomotor activity was monitored for another 150 min. In Fig. 4, an asterisk indicates a significant difference between drug and vehicle (P < 0.05 calculated using a repeated measures ANOVA with Bonferroni correction). A three-chambered conditioned place preference apparatus (Med-Associates, St. Albans, Vermont) consisting of white or black chambers (16.8 × 12.7 × 12.7 cm each) with uniquely textured white mesh or black rod floors and separated by a neutral central chamber (7.2 × 12.7 × 12.7 cm) was used for conditioned place preference testing. On day 1 (preconditioning day), mice were placed in the central chamber and allowed to explore freely for 30 min. Time spent in each compartment was used to estimate baseline chamber preferences and mice showing specific chamber bias more than 70% were not studied further. On days 2–9 (conditioning days) mice were injected with either vehicle or drug and paired with either the white mesh or the black rod chambers. All mice received vehicle on days 2, 4, 6, 8 and drug on days 3, 5, 7, 9. On day 10 (test day), mice were again placed in the central chamber as on day 1 and allowed to explore freely for 30 min. Time spent in each chamber was expressed as percentage preference. Place preference was tested with morphine (10 mg/kg, n = 16), PZM21 (20 mg/kg, n = 8), or TRV130 (1.2 mg/kg, n = 7). In Fig. 4, an asterisk indicates a significant difference between vehicle and drug chambers (P < 0.05 by one-sample t-test with hypothetical value of 50) while NS indicates non-significance (P > 0.05). Drug induced catalepsy was measured in mice using the bar test67, which includes a horizontally placed 3-mm diameter wooden bar fixed 4 cm above the floor. Mice were habituated with the bar and the environment for 20 min before subcutaneous injection of either haloperidol (2 mg/kg, n = 8), morphine (10 mg/kg, n = 8), or PZM21 (20 mg/kg, n = 8). To measure catalepsy, both forepaws were gently placed on the bar and the length of time during which each mouse remained in the initial position was measured. The effect was measured at 15, 30 and 90 min after drug injection. Maximum cut-off time for each challenge was 90 s. Studies were performed by the Preclinical Therapeutics Core and the Drug Studies Unit at the University of California San Francisco. Ten mice were injected subcutaneously with 20 mg/kg of PZM21. At each time point, 1 ml of blood was collected from three mice and the serum concentration of PZM21 determined by liquid chromatography–mass spectrometry (LC/MS). Mice were subsequently sacrificed and entire brains were homogenized for determination of PZM21 concentrations by LC/MS. All studies were performed with approved mouse protocols from the institutional animal care and use committees. Metabolism experiments were performed as described previously68. In brief, pooled microsomes from male mouse liver (CD-1) were purchased (Sigma Aldrich) and stored at −75 °C until required. NADPH was purchased (Carl Roth) and stored at −8 °C. The incubation reactions were carried out in polyethylene caps (Eppendorf, 1.5 ml) at 37 °C. The incubation mixture contained PZM21 (80 μM) or positive controls (imipramine and rotigotine), pooled liver microsomes (0.5 mg of microsomal protein/ml of incubation mixture) and Tris-MgCl buffer (48 mM Tris, 4.8 mM MgCl , pH 7.4). The final incubation volume was 0.5 ml. Microsomal reactions were initiated by addition of 50 μl of enzyme cofactor solution NADPH (final concentration of 1 mM). At 0, 15, 30 and 60 min the enzymatic reactions were terminated by addition of 500 μl of ice-cold acetonitrile (containing 8 μM internal standard), and precipitated protein was removed by centrifugation (15,000 rcf for 3 min). The supernatant was analysed by HPLC/MS (binary solvent system, eluent acetonitrile in 0.1% aqueous formic acid, 10−40% acetonitrile in 8 min, 40−95% acetonitrile in 1 min, 95% acetonitrile for 1 min, flow rate of 0.3 ml/min). The experiments were repeated in three independent experiments. Parallel control incubations were conducted in the absence of cofactor solution to determine unspecific binding to matrix. Substrate remaining and metabolite formation was calculated as a mean value ± s.e.m. of three independent experiments by comparing AUC of metabolites and substrate after predetermined incubation time to AUC of substrate at time 0, estimating a similar ionization rate, corrected by a factor calculated from the AUC of internal standard at each time point. The stereochemically pure isomers of 12 and PZM21 were synthesized from corresponding (R)- and (S)-amino acid amides, which were either commercially available or readily prepared from the corresponding acid or ester (see Supplementary Information). The primary amino group was dimethylated using an excess of aqueous formaldehyde and sodium triacetoxyborohydride in aqueous acetonitrile. The carboxamides 16a,b were converted to primary amines by treatment with borane-tetrahydrofurane complex under reflux yielding the diamines 17a,b. Henry reaction of thiophene-3-carbaldehyde with nitroethane afforded the nitropropene derivative 18, which was converted into the racemic alkylamine 19. Activation with 4-nitrophenyl chloroformate yielded the carbamates 20, which were coupled with the enantiopure primary amines 17a,b to achieve diastereomeric mixtures of the corresponding ureas 12 and 21. HPLC separation using a semi-preparative Chiralpak AS-H column gave the overall eight pure stereoisomers of 12 and 21 including PZM21. To determine the absolute configuration of the final products and efficiently prepare PZM21, we synthesized enantiomerically enriched carbamate 20, coupled it with the corresponding primary amines. For enantiomeric enrichment, we performed chiral resolution of the racemic primary amine 19 via repetitive crystallization with di-p-anisoyl-(S)-tartaric acid. After triple crystallization, we obtained 19 enriched in dextrorotatory enantiomer ([α] 25 = +20.5°). The corresponding (R)-acetamide has been previously characterized as dextrorotatory ([α] 20 = +49.8°), so enantiomerically enriched 19 was treated with acetic anhydride and triethylamine, and the specific rotation of the product was measured. Based on the value of specific rotation of the resulting acetamide ([α] 21 = −46.6°), we assigned the absolute configuration of the major isomer to be (S). (S)-enriched 20 was used for synthesis of the final urea derivatives and absolute configuration of diastereomers in pairs was assigned based on the equality of retention time in chiral HPLC. A full description of the synthetic routes and analytical data of the compounds 12, PZM21 and its analogues PZM22-29 are presented in the Supplementary Information. PZM21 was docked to the inactive state μOR structure using DOCK3.6 (ref. 21) as described for the primary screen, with the exception that the 45 matching spheres used were generated based on the docked pose of compound 12. The resulting ligand-receptor complex was further optimized through minimization with the AMBER protein force field69 and the GAFF ligand force field supplemented with AM1-BCC charges. Docking of PZM21 and TRV130 to the active state μOR structure (PDB: 5C1M) was also performed with DOCK3.6 with parameters as described above. The amino terminus of the active state μOR, which forms a lid over the orthosteric binding site (residues Gly52–Met65) was removed before receptor preparation. Matching spheres were generated based on the pose of PZM21 in the inactive state. The resulting complexes were then minimized with AMBER. The pose of PZM21 in the active state μOR structure was further refined using Glide (Schrödinger) in XP mode. Molecular dynamics simulations were based on crystal structures of μOR in the inactive- and active-state conformation (PDB: 4DKL and 5CM1, respectively). In both cases, all non-receptor residues (T4 lysozyme in the inactive state and Nb39 in the active state) were removed. For the active state, amino-terminal residues were removed as in the docking studies. Initial coordinates of PZM21 were generated by molecular docking as described above. The receptor was simulated with two tautomers of His2976.52, either in the neutral Nδ or the Nε state. The μOR-PZM21 complex was embedded in a lipid bilayer consisting of dioleoylphosphatidylcholine (DOPC) molecules as described previously47. The charges of the inactive- and active-state simulation systems were neutralized by adding 11 and 14 chloride ions, respectively. To carry out MD simulations, the GROMACS package was used as described previously70. Briefly, the general AMBER force field (GAFF)71 was used for PZM21 and the lipids and the AMBER force field ff99SB72 for the receptor. Parameters for PZM21 were assigned using antechamber, and charges were calculated using Gaussian09 (Gaussian, Inc.) at the HF/6-31(d,p) level and the RESP procedure according to the literature73. During the simulations, PZM21 was protonated at its tertiary amine and simulated as a cation. The SPC/E water model74 was used, and the simulations were carried out at 310 K. Analysis of the trajectories was performed using GROMACS. Each simulation in a given condition was initiated from identical coordinates, but with initial atom velocities assigned independently and randomly. An overview of the simulation systems and their simulation times is shown in the Supplementary Information. Other than the in vivo studies, no statistical analysis was applied to in vitro or cell-based signalling assays. Sample size (number of assays for each compound or receptor) was predetermined to be in triplicate or quadruplicate for primary screening assays at a single concentration. For concentration–response assays, the sample size (number of assays for each compound at selected receptors) was also predetermined to be tested for a minimum of three assays, each in triplicate or quadruplicate. None of the functional assays were blinded to investigators.

News Article | October 25, 2016
Site: www.nature.com

HeLa (H1, #CRL-1958), CHO (K1, #CCL-61), HT-29 (#HTB-38), Caco-2 (#HTB-37) and 293T (#CRL-3216) cells were originally obtained from ATCC. They tested negative for mycoplasma contamination, but have not been authenticated. The following mouse monoclonal antibodies were purchased from the indicated vendors: RAC1 (23A8, Abcam), non-glucosylated RAC1 (Clone 102, BD Biosciences), 1D4 tag (MA1-722, ThermoFisher Scientific), HA tag (16B12, Covance), β-actin (AC-15, Sigma), ZO-1 (339100, Life technology). Rabbit monoclonal IgG against human CSPG4 (ab139406) and rabbit polyclonal antibodies against FZD1 (ab150553), FZD2 (ab150477), FZD7 (ab51049), PVRL3 (ab63931) and claudin-3 (ab15102) were all purchased from Abcam. Rabbit monoclonal antibodies against DVL2 (30D2) and LRP6 (C5C7), and a rabbit polyclonal antibody against phosphorylated LRP6 (Ser1490) were all purchased from Cell Signaling. Chicken polyclonal IgY (#754A) against TcdB was purchased from List Biological Labs. Antibody validation is available on the manufacturers’ websites. A rabbit polyclonal antibody against rodent CSPG4 and a construct expressing full-length rat CSPG4 (in pcDNA vector) were both generated in W. Stallcup’s laboratory. 1D4-tagged full-length FZD1–10 constructs (in pRK5 vector) were originally generated in J. Nathans’ laboratory (Baltimore, MD) and were obtained from Addgene. FZD7 and FZD8-CRD–Myc–GPI constructs were generously provided by J. Nathans and have been described previously47. Constructs expressing full-length human IL1RAPL2 and full-length PVRL3 were purchased from Vigene Biosciences. A construct expressing full-length mouse Syt II was described previously48. Recombinant TcdB (from C. difficile strain VPI 10463) and TcdA were expressed in Bacillus megaterium as previously described49 and purified as His6-tagged proteins. TcdB was cloned into pHis1522 vector (MoBiTec) and expressed in B. megaterium. TcdB , TcdB and TcdB were cloned into pGEX-6P-1 or pET28a vectors and purified as GST-tagged or His6-tagged proteins in Escherichia coli. Rat CSPG4-EC (pool (P)1 and P2) was expressed in HEK293 cells, purified from medium with DEAE-Sepharose columns, and eluted with a gradient buffer (NaCl from 0.2 to 0.8 M, 50 mM Tris-Cl, pH 8.6) as previously described50. Recombinant human proteins were purchased from ACRO Biosystems (IgG1 Fc and FZD2-CRD–Fc), R&D Systems (FZD1-CRD–Fc, FZD5-CRD–Fc and FZD7-CRD–Fc), Sino Biologics (PVRL3-EC), and StemRD (WNT3A). The human codon-optimized sequence of S. pyogenes Cas9 was subcloned from plasmid lentiCas9-Blast (Addgene #52962) into the pQCXIH retroviral vector (Clontech), which was used to generate retroviruses to transduce HeLa cells. Mixed stable cells were selected in the presence of hygromycin B (200 μg/ml, Life Technologies). Lentivirus sgRNA libraries were generated following published protocols using the human GeCKO v.2 sgRNA library (Addgene #1000000049)19. The GeCKO v.2 library is composed of two half-libraries (library A and library B). Each half-library contains three unique sgRNA per gene and was independently screened with toxins. Cells were transduced with lentivirus-packaged sgRNA library at a MOI of 0.2. For each CRISPR half-library of cells, 4 × 107 cells were plated onto two 15-cm culture dishes to ensure sufficient coverage of sgRNAs, with each sgRNA on average being represented about 650 times (that is, there are on average 650 cells transduced with the same sgRNA). This over-representation rate was calculated from titration plates that were set up in parallel with the library. These cells were exposed to either TcdB or TcdB for 48 h. Cells were then washed three times with PBS to remove loosely attached round-shaped cells. The remaining cells were re-seeded and cultured with normal medium without toxins until ~70% confluence. Cells were then subjected to the next round of screening with increased concentrations of toxins. Four rounds of screenings were carried out with TcdB (0.05, 0.1, 0.2 and 0.5 pM) and TcdB (5, 10, 20 and 50 pM). The remaining cells were harvested and their genomic DNA extracted using the Blood and Cell Culture DNA mini kit (Qiagen). DNA fragments containing the sgRNA sequences were amplified by PCR using primers lentiGP-1_F (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) and lentiGP-3_R (ATGAATACTGCCATTTGTCTCAAGATCTAGTTACGC). NGS (Illumina MiSeq) was performed by a commercial vendor (Genewiz). The following sgRNA sequences were cloned into LentiGuide-Puro vectors (Addgene) to target the indicated genes: CCGGAGACACGGAGCAGTGG (CSPG4), GCGCTGCTGGGACATCGCCT (EMC4), ACCTTATACCACACAACATC (IL1RAPL2), TGCGAGCACTTCCCGCGCCA (FZD2), AGCGCATGACCACTACACTG (SGMS1), ACAGGCAGAAAACGGCTCCT (UGP2), GTGTAATGACAAGTTCGCCG (FZD1), and GAGAACGGTAAAGAGCGTCG (FZD7). HeLa-Cas9 cells were transduced with lentiviruses that express these sgRNAs. Mixed populations of stable cells were selected with puromycin (2.5 μg/ml) and hygromycin B (200 μg/ml). FZD1/2/7–/– cells were created by sequentially transducing FZD1 and FZD7 sgRNA lentiviruses into FZD2–/– cells and further selected in the presence of 100 pM TcdB . The mutagenesis rate in these mixed stable cells was determined by NGS (Supplementary Table 1). The cytopathic effect (cell rounding) of TcdA and TcdB was analysed using standard cell-rounding assay as previously described1. Briefly, cells were exposed to a gradient of TcdB and TcdB for 24 h. Phase-contrast images of cells were taken (Olympus IX51, ×10–20 objectives). The numbers of round-shaped and normal shaped cells were counted manually. The percentage of round-shaped cells was plotted and fitted using the Origin software. Recombinant proteins used for cell protection assays were pre-filtered (0.22 μm, Millipore). Toxins were pre-incubated with FZD2-CRD–Fc and/or CSPG4-EC (P1) for 30 min on ice with a toxin/protein ratio of 1:400 (except when specifically noted in the figure legend). The mixtures were added into cell culture medium and cells were analysed by the cytopathic assay. Transient transfection of HeLa cells was carried out using PolyJet (SignaGen). Binding of TcdB to cells was analysed by exposing cells to TcdB or truncated TcdB fragments for 10 min at room temperature. Cells were washed three times with PBS and then either fixed for immunostaining analysis or harvested with RIPA buffer (50 mM Tris, 1% NP40, 150 mM NaCl, 0.5% sodium deoxycholate, 0.1% SDS, plus a protease inhibitor cocktail (Sigma-Aldrich)). Cell lysates were centrifuged and supernatants were subjected to SDS–PAGE and immunoblot analysis using the enhanced chemiluminescence method (Pierce). The full blot images are shown in Supplementary Fig. 1. Pulldown assays were carried out using glutathione Sepharose 4B as previously described48. Briefly, 5 μg of GST-tagged TcdB and TcdB were immobilized on glutathione beads and incubated with FZD2-CRD–Fc (10 nM) for 1 h at 4 °C. Beads were then washed, pelleted, boiled in SDS sample buffer, and subjected to immunoblot analysis. The binding affinities between TcdB and FZD-CRDs were measured by BLI assay using the Blitz system (ForteBio). Briefly, the CRDs-Fc of FZD1, 2, 5, 7 or human IgG1 Fc (20 μg/ml) were immobilized onto capture biosensors (Dip and Read Anti-hIgG-Fc, ForteBio) and balanced with PBS. The biosensors were then exposed to TcdB or TcdB , followed by washing with PBS. Binding affinities (K ) were calculated using the Blitz system software (ForteBio). The TOPFLASH/TK-Renilla dual luciferase reporter assay was used to detect Wnt signalling activities as previously described51. Briefly, 293T cells in 24-well plates were co-transfected with TOPFLASH (50 ng/well), TK-Renilla (internal control, 10 ng/well), and pcDNA3 (200 ng/well). After 24 h, cells were exposed to WNT3A (50 ng/ml) and TcdB (1:8, 1:40, and 1:200 to WNT3A) in culture medium for 6 h. Cell lysates were harvested and subjected to either firefly/Renilla dual luciferase assay or immunoblot analysis for detecting phosphorylated DVL2 and LRP6. Wnt signalling activates expression of TOPFLASH luciferase reporter (firefly luciferase). Co-transfected Renilla luciferase serves as an internal control. Binding assays were performed on 96-well plates (EIA/RIA plate, Corning Costar) as described previously50. Briefly, microtiter plates were coated with 10 μg/ml rat CSPG4-EC proteins in coating buffer (0.1 M NaHCO , pH 8.3) at 4 °C overnight, and then blocked with 1% bovine serum albumin in PBS for 1 h. Plates were then incubated with the indicated proteins for 1 h in PBS. Wells were washed three times with PBS plus 0.05% Tween-20 at room temperature. One-step Turbo TMB (ThermoFisher Scientific) was used as the substrate, and absorbance at 450 nm was measured with a microplate reader. Crypt isolation from wild-type or FZD7–/– mouse colon was carried out as previously described, and organoids were expanded as spheroid cultures using conditioned medium52. Except for wild-type organoids used for Wnt signalling inhibition assay, CHIR99021 (3 μM) was also added to the medium39. Five days after passaging, organoids were re-suspended with Cell Recovery Solution (ThermoFisher Scientific) and mechanically fragmented. Fragments were transduced with adenoviruses expressing shRNA for FZD1, FZD2, or a control shRNA sequence using medium supplemented with Nicotinamide (10 mM, Sigma), Polybrene (8 μg/ml, Sigma), and Y-27632 (10 μM, Sigma), washed, and plated in growth factor-reduced Matrigel (Corning)53. Three days following viral transduction, organoids were challenged with TcdB by adding the toxin into the medium. Viability of organoids was quantified after 72 h. TcdB was added into the culture medium of wild-type colon organoids. For rescue experiments, 5 μM CHIR99021 was also added to the medium. The medium was changed every 48 h with the constant presence of TcdB and/or CHIR99021. Viability of cells was analysed after 6 days. All shRNAs were purchased from Sigma (MISSION shRNA library). The knockdown efficiency was validated as described in Extended Data Fig. 8c, d. shRNA sequences showing the highest efficiency were selected to generate adenoviruses. Adenoviruses expressing a control shRNA (5′-CTGGACTTCCAGAAGAACA-3′), shRNAs against mouse FZD1 (shRNA#2: 5′-TGGTGTGCAACGACAAGTTTG-3′), or FZD2 (shRNA#5: 5′-CGCTTCTCAGAGGACGGTTAT-3′) were constructed using the Block-it U6 adenoviral RNAi system (Life Technologies), followed by viral packaging and multiple rounds of amplification in 293A cells (Life Technologies). The viability of colonic organoids was assessed using the MTT assay as previously described54. Briefly, the MTT solution was added to the organoid culture (500 μg/ml). After incubation at 37 °C for 2 h, the medium was discarded. For each well (containing 20 μl of Matrigel, in a 48-well plate), 60 μl of 2% SDS solution was added to solubilize the Matrigel (1 h, 37 °C), followed by the addition of 300 μl of dimethylsulfoxide (DMSO) to solubilize reduced MTT (2 h, 37 °C). The absorbance at 562 nm was measured on a microplate reader. Twenty microlitres of Matrigel without organoids was used as blank control. Normal organoids without exposure to toxins were considered as 100% viable. Colons from adult mice (C57BL/6 strain (purchased from The Jackson Laboratory, #000664), 10–12 weeks old, both male and female mice were used and randomly distributed into experimental groups) were dissected out and subjected to cryosectioning into sections 8–10 μm thick. Colonic sections were fixed in cold acetone for 5 min and then washed three times with PBS. The colonic sections were then blocked with 5% goat serum in PBS for 30 min at room temperature and incubated with primary antibodies overnight (anti-TcdB: 1:600; anti-FZDs: 1:250; rabbit anti-CSPG4: 1:250), followed with biotinylated goat anti-chicken or rabbit IgG secondary antibodies (1:200, Vector Laboratory) for 1 h at room temperature. The sections were then incubated with horseradish peroxidase (HRP)-conjugated streptavidin (1:500, DAKO) for 30 min. Immunoreactivity was visualized as red colour with 3-amino-9-thyl carbazole (DAKO). Cell nuclei were labelled blue with Gill’s haematoxylin (1:3.5, Sigma). Frozen human colon tissue slides were purchased from BioChain Institute and subjected to IHC analysis. Immunofluorescence analysis of claudin-3 and ZO-1 was carried out using mouse colon tissues fixed in 10% formalin and embedded in paraffin (anti-claudin-3: 1:100; anti-ZO-1: 1:100). Confocal images were captured with the Ultraview Vox Spinning Disk Confocal System. Histology analysis was carried out with H&E staining of paraffin-embedded sections. Stained sections were coded and scored by observers blinded to experimental groups, based on disruption of the colonic epithelium, inflammatory cell infiltration and oedema, on a scale of 0 to 3 (mild to severe). No statistical methods were used to predetermine sample size. All procedures were conducted in accordance with the guidelines approved by the Boston Children’s Hospital Institutional Animal Care and Use Committee (IACUC) (#3028). TcdB (40 nM) was pre-incubated with either human IgG1-Fc or FZD2-Fc (2.4 μM) for 30 min on ice. To generate the ex vivo colon segments, mice (C57BL/6, 6–8 weeks, both male and female mice were used, repeated three times, each time four mice per group, the experiments were not randomized or blinded) were euthanized and the colon exposed via laparotomy. A segment in the ascending colon (~2 cm long) was sealed by tying both ends with silk ligatures. The toxin samples (40 μl) were injected through an intravenous catheter into the sealed colon segment. The injection site was then sealed with a haemostat. The colon was covered with PBS-soaked gauze for 2 h, then excised and its lumen flushed with PBS three times, and subjected to IHC analysis. All procedures were conducted in accordance with the guidelines approved by the Boston Children’s Hospital IACUC (#3028). Wild-type or FZD7–/– mice (The Jackson Laboratory, #012825, strain B6;129-Fzd7tm1.1Nat/J, 6–8 weeks old, sample size indicated in Fig. 5f, g, both male and female mice were used, the experiments were not randomized or blinded) were anaesthetized following overnight fasting. A midline laparotomy was performed to locate the ascending colon and seal a ~2 cm loop with silk ligatures. Two micrograms of TcdB in 80 μl of normal saline or 80 μl of normal saline were injected through an intravenous catheter into the sealed colon segment, followed by closing the wounds with stitches. Mice were allowed to recover. After 8 h, mice were euthanized and the ligated colon segments were excised, weighed, and measured. The colon segments were fixed, paraffin-embedded, sectioned, and subjected to either H&E staining for histological score analysis or immunofluorescent staining for claudin-3 and ZO-1.

Bunk B.,TU Braunschweig | Schulz A.,MoBiTec GmbH | Stammen S.,TU Braunschweig | Munch R.,TU Braunschweig | And 4 more authors.
Bioengineered Bugs | Year: 2010

Bacillus megaterium, the "big beast," is a Gram-positive bacterium with a size of 4 x 1.5 μm. During the last years, it became more and more popular in the field of biotechnology for its recombinant protein production capacity. For the purpose of intra- as well as extracellular protein synthesis several vectors were constructed and commercialized (MoBiTec GmbH, Germany). On the basis of two compatible vectors, a T7 RNA polymerase driven protein production system was established. Vectors for chromosomal integration enable the direct manipulation of the genome. The vitamin B 12 biosynthesis of B. megaterium served as a model for the systematic development of a production strain using these tools. For this purpose, the overexpression of chromosomal and plasmid encoded genes and operons, the synthesis of anti-sense RNA for gene silencing, the removal of inhibitory regulatory elements in combination with the utilization of strong promoters, directed protein design, and the recombinant production of B 12 binding proteins to overcome feedback inhibition were successfully employed. For further system biotechnology based optimization strategies the genome sequence will provide a closer look into genomic capacities of B. megaterium. DNA arrays are available. Proteome, fluxome and metabolome analyses are possible. All data can be integrated by using a novel bioinformatics platform. Finally, the size of the "big beast" B. megaterium invites for cell biology research projects. All these features provide a solid basis for challenging biotechnological approaches. © 2010 Landes Bioscience.

Schulz A.,MoBiTec GmbH | Frager M.,MoBiTec GmbH | Holtkamp L.,MoBiTec GmbH | Ronnenberg J.,MoBiTec GmbH | Biedendieck R.,TU Braunschweig
BioSpektrum | Year: 2014

During the past years plasmid systems for recombinant protein production using Bacillus megaterium were developed. These systems are based on multicopy plasmids with functional elements for cloning in Escherichia coli and induced gene expression in B. megaterium. Different promoters, signals for protein secretion and affinity tags for purification arranged in a high variety of combinations are available. By using these systems, recombinant proteins can be produced and secreted in the grams per litre scale. © Springer-Verlag 2014.

Loading MoBiTec GmbH collaborators
Loading MoBiTec GmbH collaborators