Uppsala, Sweden
Uppsala, Sweden

Time filter

Source Type

The generation and characterization of Ercc1∆/+ and Ercc1+/−mice have been previously described16. Ercc1∆/− mice were obtained by crossing Ercc1∆/+ (in a pure C57BL6J or FVB background) with Ercc1+/− mice (in a pure FVB or C57BL6J background respectively) to yield Ercc1∆/− offspring with a genetically uniform F1 C57BL6J/FVB hybrid background (see ref. 6 for motivation). Wild-type F1 littermates were used as controls. Xpg−/− mice have been characterized previously6 and were generated by crossing Xpg+/− (in a pure C57BL6J background) with Xpg+/− mice (in a pure FVB background). Hence, all animals used in the studies described here were of the same F1 C57BL6J/FVB hybrid background. Typical unfavourable characteristics, such as blindness in an FVB background or deafness in a C57BL6J background, do not occur in this hybrid background. Mice were weighed, visually inspected weekly, and scored in a blinded fashion for gross morphological and motor abnormalities. Since the Ercc1∆/− and Xpg−/− mice were smaller, food was administered within the cages and water bottles with long nozzles were used from around two weeks of age. Animals were maintained in a controlled environment (20–22 °C, 12 h light:12 h dark cycle) and were housed in individual ventilated cages under specific pathogen free conditions. Animals were individually housed at the EMC location and group housed at the RIVM location. Experiments were performed in accordance with the Principles of Laboratory Animal Care and with the guidelines approved by the Dutch Ethical Committee in full accordance with European legislation. For the lifespan studies the indicated number of mice per group for ad libitum and 30% dietary restriction were generated. Additionally, several cross-sectional cohorts were generated. For Ercc1∆/− mice we generated groups which were killed at 7, 11, 16 or 30 weeks of age. The 7-week group consisted only of ad libitum-fed animals while the 30-week group consisted only of dietary restriction-treated mice. For wild-type mice, ad libitum-fed and dietary restriction-treated groups were sacrificed at 11, 16 or 20 weeks. Sample size of the lifespan cohorts were based on power analysis. No statistical methods were used to predetermine sample size of cross-sectional cohorts. Animals were divided randomly over all groups to prevent selection bias. All mice were clinically diagnosed daily in a blinded manner and, when moribund, killed, after which necropsy was performed. Animals from cross-sectional cohorts were killed when necropsy age was reached. Organs were stored at −80°C for molecular analysis or (perfusion) fixated in (para)formaldehyde for pathological examinations. Statistics was performed with survival curve analysis using the product-limit method of Kaplan and Meier in GraphPad Prism. All animals were bred and maintained on AIN93G synthetic pellets (Research Diet Services B.V.; gross energy content 4.9 kcal/g dry mass, digestible energy 3.97 kcal/g). The initial lifespan cohort, shown in Fig. 1a, were fed standard AIN93G pellets containing 2.5 g/kg choline bitartrate. To avoid potential formation of bladder and kidney stones, we replaced choline bitartrate with choline chloride in all subsequent experiments. The amount of dietary restriction was determined in a prior pilot study and food intake of the ad libitum-fed mice was continuously monitored. On average, Ercc1∆/− and Xpg−/− mice ate 2.3 g food per day. Dietary restriction was initiated at 7 weeks of age with 10% food reduction (2.1 g/day), when animals reached almost-maximum bodyweight and development was completed. Dietary restriction was increased weekly by 10%, until it reached 30% dietary restriction (1.6 g/day) from 9 weeks of age onward. Temporary dietary restriction was initiated directly with 30% food reduction at 6 weeks of age. These mice received ad libitum food again from 12 weeks onward. Wild-type mice ate on average 3.0 g food per day, resulting in 2.1 g/day for 30% dietary restriction. Food was given to the animals just before the start of the dark (active) period to avoid alteration of the biological clock. Representative sections from the liver, kidneys, sciatic nerve, testes and femur were processed, stained with haematoxylin and eosin, and microscopically examined in a blinded manner by two board-certified pathologists (SAY, AdB) for the presence of histopathologic lesions. The severity score of lesions was semi-quantitatively assessed. Scores were given as absent (0), subtle (1), mild (2), moderate (3), severe (4), and massive (5). Digital images from the kidneys and femur cortical bone at mid-shaft area were taken for morphometric analysis using Labsense image analysis software (Olympus). Ageing characteristics were assessed in >5 animals per group per sex. Groups were compared with nonparametric Mann–Whitney U and Kruskal–Wallis tests. Polyploidy levels were assessed based on propidium iodide (PI) fluorescence using FACS analysis31, 32. A small part of the left lobe (approximately 5 mm3) was dissected from ad libitum- and dietary restriction-treated Ercc1∆/− mice (7, 11, 16 and 30 weeks, n = 5) and wild-type mice (11 weeks, n = 5), cut into small fragments and suspended in 800 μl PBS using a syringe (21G). 300 μl homogenate was added to 300 μl 100% ethanol for fixation. Samples were stored for at least 24 h before further processing. After fixation the liver homogenate was washed with ice-cold PBS and subsequently incubated with a pepsin solution for 20 min. After washing in PBS/Tween-20, cells were collected in 500 μl PBS supplemented with 5 μg/ml PI and 250 μg/ml RNase and samples were measured using the FACS (FACSCalibur, Becton Dickinson). Differences between groups were assessed with a two-way ANOVA, with age and diet as fixed factors. Ad libitum- and diet-restricted mice were killed by cervical dislocation at scheduled ages, femora were excised and non-osseous tissue was removed. Two days after fixation in 4% formalin, the right femora were scanned using Skyscan 1076 in vivo X-Ray computed tomography (Bruker microCT) with a voxel size of 8.88 μm. Osseous tissue was distinguished from non-osseous tissue by segmenting the reconstructed grayscale images with an automated algorithm using local thresholds33. The region of interest (ROI) (the distal metaphysis of the femora) was selected using 3D data analysis software. To compensate for bone length differences, the length of each ROI was determined relative to the largest specimen femur of the cohort. The cortex and trabeculae of the metaphysis were separated using automated software developed in-house. The thickness of the trabeculae and cortices were assessed using 3D analysis software as described34 using the CT analyser software package (Bruker microCT). A bone specimen with known bone morphometrics was included within each scan as a quantitative control. Statistical significance was calculated using one-way Anova with Bonferroni’s multiple comparison test. The responses of isolated aortic tissue were ex vivo measured in small-wire myograph organ baths containing oxygenated Krebs-Henseleit buffer at 37 °C. After preconstriction with 30 nmol/l U46619, relaxation concentration–response curves to acetylcholine were constructed35. Single-cell suspensions were prepared from spleen by passing the cells through a cell strainer with HEPES-buffered saline solution (HBSS) supplemented with 2% FBS and washed. Erythrocytes were eliminated with ACK buffer. For CD4+CD25+Foxp3+ staining, cells were first stained for the expression of cell surface markers and then fixed, permeabilised, and stained using the Foxp3 kit (eBiosciences) according to the manufacturer’s instructions. FACS analysis was performed using FACS (Becton Dickinson) and analysed with FlowJo Software (TreeStar). Mice were killed by CO asphyxiation and blood was immediately collected from the heart. Glucose levels were measured using a Freestyle mini blood glucose metre. Insulin and albumin levels were measured in blood plasma using an ultrasensitive mouse insulin Elisa (Mercodia AB) or mouse albumin ELISA kit (Immunology Consultants Laboratory, Inc.), respectively. Insulin levels were determined after overnight fasting. Glucose levels were determined after feeding, at the beginning of the dark period. Euthanasia of moribund or cross-sectional animals was performed by intramuscular injection of a ketamine–rompun mixture, followed by exsanguination3. IgA immunoglobulin was measured in blood serum using the commercially available bead-based multiplexed panel Mouse Immunoglobulin Isotyping (Millipore Corporation). Standard analysis protocols were followed and all samples were analysed at least in duplo. The mice were weighed and visually inspected weekly, and were scored in a blinded manner by two experienced research technicians (R.M.C.B. and S.B.) for the onset of various phenotypical parameters. Clasping was measured by suspending mice by their tails for 20 s. A clasping event was scored when retraction of both hind limbs towards the body was observed for at least 5 s. Whole-body tremor was scored if mice were trembling for a combined total of at least 10 s when put on a flat surface for 20 s. Impaired balance was determined by observing the mice walking on a flat surface for 20 s. Mice that had difficulties in maintaining an upright orientation during this period were scored as having imbalance. If mice showed a partial loss of function of the hind limbs, they were scored as having paresis. Statistics were performed with survival-curve analysis using the product-limit method of Kaplan and Meier in GraphPad Prism. Rotarod performance was assessed by measuring the average time spent on an accelerating rotarod (Ugo Basile). All animals were given four consecutive trials of a maximum of 5 min with inter-trial intervals of 1 h. For weekly monitoring, the motor coordination performance was measured with two consecutive trials of a maximum of 5 min. Grip strength was determined by placing mice with forelimbs or all limbs on a grid attached to a force gauge, and steadily pulling the mice by their tail. Grip strength is defined as the maximum strength produced by the mouse before releasing the grid. For each value the test was performed in triplicate. To quantify apoptotic cells in the retina, eyes were fixed overnight in 10% phosphate-buffered formalin (JT Baker), paraffin-embedded, sectioned at 5 mm, and mounted on Superfrost Plus slides. Paraffin sections were employed for TdT-mediated dUTP nick-end labelling (TUNEL) assay using an Apoptag Plus Peroxidase in situ apoptosis detection kit (Millipore). Sections were deparaffinised and incubated as described by the manufacturer. Statistical differences were calculated with a t-test. Primary antibodies (supplier; catalogue number; dilutions) used in this study were as follows: rabbit anti-ATF3 (Santa Cruz; sc-188; 1:2,000), goat anti-ChAT (Millipore; AB144P; 1:500); rabbit anti-GFAP (DAKO; Z0334; 1:8,000); mouse anti-GM130 (BD Transduction; 610823; 1:100); rabbit anti-Iba-1 (Wako; 019-19741; 1:5,000); rat anti-Mac2 (Cedarlane; CL8942AP; 1:2,000); mouse anti-NeuN (Millipore; MAB377; 1:1,000); rabbit anti-p53 (Leica; NCL-p53-CM5p; 1:1,000); mouse anti-γH2AX (Millipore; 05-636; 1:4,000). For avidin-biotin-peroxidase immunocytochemistry biotinylated secondary antibodies from Vector Laboratories, diluted 1:200 were used. Alexa488-, Cy3-, and Cy5-conjugated secondary antibodies raised in donkey (Jackson ImmunoResearch) diluted at 1:200 were used for confocal immunofluorescence. Mice were anaesthetized with pentobarbital and perfused transcardially with 4% paraformaldehyde. The brain and spinal cord were carefully dissected out, post-fixed for 1 h in 4% paraformaldehyde, cryoprotected, embedded in 12% gelatin, rapidly frozen, and sectioned at 40 μm using a freezing microtome or stored at −80 °C until use. Frozen sections were processed free floating using the ABC method (ABC, Vector Laboratories) or single-, double-, and triple-labelling immunofluorescence. Immunoperoxidase-stained sections were analysed and photographed using an Olympus BX40 microscope. Immunofluorescence sections were analysed using a Zeiss LSM700 confocal microscope. Mean intensities were quantified using Fiji. Statistical differences were calculated with a t-test. Total RNA was extracted using QIAzol lysis Reagent from mouse tissue specimens. For increased purity, miRNAeasy Mini Kits (QIAGEN) were used. Addition of wash buffers RPE and RWT (QIAGEN) was done mechanically by using the QIAcube (QIAGEN) via the miRNeasy program and tissue was stored at −80 °C. The concentration of RNA was measured by Nanodrop (Thermo Fisher Scientific). Gene expression analyses were performed with gene-specific real-time PCR primers (see below) using SYBR Green (Sigma-Aldrich) and Platinum Taq polymerase (Life Technologies) on a Bio-Rad CFX96 thermocycler or with pre-designed TaqMan Gene Expression Assays (given below) with a 7500 Fast Real-Time PCR System (Applied Biosystems). Relative gene expressions were calculated as previously described6. For SYBR Green method the following primers were used (forward primer 5′ to 3′; reverse primer 5′ to 3′): Gsta1 (CTTCTGACCCCTTTCCCTCT; ATCCATGGGAGGCTTTCTCT), Nqo1 (GGTAGCGGCTCCATGTACTC; GAGTGTGGCCAATGCTGTAA), Nfe2l2 (AGGACATGGAGCAAGTTTGG; TCTGTCAGTGTGGCTTCTGG), Gstt2 (CGAGCAATTCTCCCAGGTGA; TATTCGTGGACTTGGGCACG), Fkbp5 (TGTTCAAGAAGTTCGCAGAGC; CCTTCTTGCTCCCAGCTTT), Srxn1 (TGAGCAGCTCCTCTGATGTG; GCTGAGGTGACAATTGACTATGG), Gsta4 (TCGATGGGATGATGCTGAC; CATCTGCATACATGTCAATCCTG), Gclm (TGGAGCAGCTGTATCAGTGG; CAAAGGCAGTCAAATCTGGTG), Hmox1 (CAGGTGATGCTGACAGAGGA; ATGGCATAAATTCCCACTGC), Gclc (AGATGATAGAACACGGGAGGAG; TGATCCTAAAGCGATTGTTCTTC), Ephx1 (GAGTGGAGGAACTGCACACC; AGCACAGAAGCCAGGATGA), Mgst1 (CTCGGCAGGACAACTTGC; CCATGCTTCCAATCTTGGTC), TubG2 (CAGACCAACCACTGCTACAT; AGGGAATGAAGTTGGCCAGT), Hprt (TGATAGATCCATTCCTATGACTGTAGA; AAGACATTCTTTCCAGTTAAAGTTGAG), Rps9 (ATCCGCCAACGTCACATTA; TCTTCACTCGGCCTGGAC). As pre-designed TaqMan assays we used (order number; sequence 5′ to 3′): Ghr (Mm00439093_m1; GACAAGCTGCAAGAATTGCTCATGA), Igf1r (Mm00802831_m1; GGCCAGAAGTGGAGCAGAATAATCT), HPRT-E2_3 (HPRT-E2_3_F; GCCGAGGATTTGGAAAAAGTGTTTA, HPRT-E2_3_R; TTCATGACATCTCGAGCAAGTCTTT, HPRT-E2_3_M; CAGTCCTGTCCATAATCA), POLR2A-E2_3 (POLR2A-E2_3F; GCAGTTCGGAGTCCTGAGT, POLR2A-E2_3R; CCCTCTGTTGTTTCTGGGTATTTGA, POLR2A-E2_3M2; CATCCGCTTCAATTCAT). RNA quality was assessed using the 2100 Bio-Analyzer (Agilent Technologies) following the manufacturer’s instructions. The quality of the RNA is expressed as the RNA integrity number (RIN, range 0–10). Samples with a RIN below 8 were excluded from analysis. Hybridization to Affymetrix HT MG-430 p.m. Array Plates was performed at the Microarray Department of the University of Amsterdam according to Affymetrix protocols. Quality control and normalization were performed using the pipeline at the www.arrayanalysis.org website (Maastricht University). The same total RNA extracts were used as extracted for mRNA analysis (above). miRNA expression levels were assessed using a miRNA micro-array (miRCURY LNA microRNA Array (7th Gen.), Exiqon). All probes with more than three calls were selected for assessing differential expression between groups. Differences in mean expression were compared using a one-way ANOVA. Probes with a FDR of 5% were considered as significantly differentially expressed. RNA expression analysis was also performed with the next-generation sequencing approach on one animal per treatment as described in ref. 36. Raw data (CEL files) were normalized by robust multichip average (RMA) in the oligo BioConductor package, which summarizes perfect matches through median polish and collapses probes into core transcripts based on.CDF annotation file provided by Affymetrix using the R open statistical package (http://www.r-project.org/). All data files have been submitted to the NCBI gene expression omnibus under accession number GSE77495. Principal component analysis (PCA) was performed using all the probe sets in the array. A graphical representation was generated to show the relationship among the different samples. PCA is a linear projection method that defines a new dimensional space to capture the maximum information present in the initial data set. It is an unsupervised exploratory technique used to remove noise, reduce dimensionality and identify common/dominant signals oriented to try to find biological meaning37. The two principal components with the highest amount of variance were plotted. PCA was performed using the prcomp package and the plot was drawn with gplots, both from the Bioconductor project (https://www.bioconductor.org/). The linear model from Limma38 implemented in R was used to identify the DEGs. Pairwise comparisons for each genotype between ad libitum and dietary restriction samples were applied to calculate the fold change (FC), P value and false discovery rate (FDR) for each probe in the microarray. Cut-off values for a DEG were put at FDR < 5% with FC ≥ |1.5|. For all mouse analyses, differentially expressed probes were considered as DEGs. Overlap between lists of DEGs was identified looking by the intersection between pair of lists. To determine if the overlap was higher than expected by chance the hypergeometric distribution was used as is implemented in phyper function in R. Additionally the factor of enrichment was calculated with the formula: EF = nAB/((nA × nB)/nC). Where: nA = Number of DEG in experimental group A; nB = Number of DEG in experimental group B; nC = Number of total genes in the microarray; nAB = Number of common DEG between A and B. Pathway enrichment analysis was conducted via overrepresentation analysis (ORA). ORA was performed in the Interactive pathway analysis (IPA) of complex genomics data software (Ingenuity Systems, Qiagen) by employing a pre-filtered list of differentially expressed genes. Genes were selected as differentially expressed if they had a fold change ≥ 1.5 and an FDR lower than 0.05. The over-represented canonical pathways were generated based on information in the Ingenuity Pathways Knowledge Base. A pathway was selected as deregulated when the P value in the Fisher test was lower than 0.01. Additionally, IPA transcription factor (TF) analysis was performed to identify the cascade of upstream transcriptional regulators that can explain the observed gene expression changes in the different lists of DEGs. To do this, data stored in the Ingenuity Knowledge Base, with prior information on the expected effects between TF and their target genes, were used. The analysis examines how many known targets of each TF are present in the list of DEGs, and also compares their direction of change to what is expected from the literature, in order to predict likely relevant transcriptional regulators. If the observed direction of change is mostly consistent with a particular activation state of the transcriptional regulator (‘activated’ or ‘inhibited’), then a prediction is made about that activation state. For each TF two statistical measures are computed (overlap P value and activation z-score). The overlap P value labels upstream regulators based on significant overlap between data set genes and known targets regulated by a TF. The activation z-score is used to infer the likely activation states of upstream regulators based on comparison with a model that assigns random regulation directions. Overlap P value lower than 0.05 and z-score higher than |2| were selected as thresholds to identify a TF as relevant. Limma was used to identify the DEGs among ALWT samples compared with the other experimental conditions (DRWT, ALErcc1 and DRErcc1). Next, probe-sets in the Affymetrix array with multiple gene annotation were filtered out. BiomaRt39 was used to retrieve the gene length for the remaining probe sets (32,930 probe-sets from 45,142 probe-sets in the original microarray). Differentially expressed genes were selected using an FDR of <0.05 and a linear fold change of ±1.5. The Shapiro–Wilk test was applied to contrast the normality of the distribution of gene length in the different lists of DEGs. Because most of the distributions were not normal, a Mann–Whitney test for non-paired samples test was used to evaluate whether the distributions of DEGs were different between the different comparisons. Finally, a relative frequency (kernel density) plot of gene length and probability density for DEG in each comparison was drawn using the density function implemented in R. Kernel density estimates are related to histograms, but with the possibility to smooth and continuity by using a kernel function. The y axis represents the density probability for a specific range of values in the x axis. Liver extracts from ad libitum- and dietary restriction-treated Ercc1∆/− and wild type mice (n = 6, 11 weeks) were prepared by mechanical disruption in lysis buffer (150 mM NaCl, 1% Triton X-100, 50 mM Tris), which was supplemented with mini complete protease inhibitor (Roche Diagnostics) and phosphate inhibitors (5 mM NaF, 1 mM Na-orthovanadate). After mechanical disruption, lysates were incubated on ice for 1 h and subsequently centrifuged at 4 °C for 20 min. Lysate (25–50 μg) was loaded on a 10% SDS–PAGE gel (Life Technologies LTD) and transferred to a PVDF transfer membrane (GE-Healthcare Life Sciences). Levels of S6 (#2217S Lot5; 1:2,000), S6(Ser240/244; #2215 Lot14; 1:500), Akt (#9272 Lot25; 1:500), Akt(Ser473; #9271S Lot13; 1:250) and Akt(Thr308; #9275S Lot19; 1:500) were detected (Cell Signaling Technology), semi-quantified using the ImageJ software package (http://rsb.info.nih.gov/ij/index.html) and phosphorylated:total ratios relative to ad libitum samples were calculated. Differences between groups were assessed with a t-test. β-Actin was used as loading control (Sigma; A5441 Lot064M4789V; 1:25,000).


Hayes R.,MPI Research | LeLacheur R.,Agilux Laboratories | Dumont I.,Algorithme Pharma Inc. | Couerbe P.,Atlanbio | And 59 more authors.
Bioanalysis | Year: 2016

The 9th GCCClosed Forum was held just prior to the 2015 Workshop on Recent Issues in Bioanalysis (WRIB) in Miami, FL, USA on 13 April 2015. In attendance were 58 senior-level participants, from eight countries, representing 38 CRO companies offering bioanalytical services. The objective of this meeting was for CRO bioanalytical representatives to meet and discuss scientific and regulatory issues specific to bioanalysis. The issues selected at this year's closed forum include CAPA, biosimilars, preclinical method validation, endogenous biomarkers, whole blood stability, and ELNs. A summary of the industry's best practices and the conclusions from the discussion of these topics is included in this meeting report. © 2016 Future Science Ltd.


The 9th GCCClosed Forum was held just prior to the 2015 Workshop on Recent Issues in Bioanalysis (WRIB) in Miami, FL, USA on 13 April 2015. In attendance were 58 senior-level participants, from eight countries, representing 38 CRO companies offering bioanalytical services. The objective of this meeting was for CRO bioanalytical representatives to meet and discuss scientific and regulatory issues specific to bioanalysis. The issues selected at this years closed forum include CAPA, biosimilars, preclinical method validation, endogenous biomarkers, whole blood stability, and ELNs. A summary of the industrys best practices and the conclusions from the discussion of these topics is included in this meeting report.


Martin R.M.,University of Bristol | Patel R.,University of Bristol | Zinovik A.,National Research and Applied Medicine | Kramer M.S.,McGill University | And 8 more authors.
PLoS ONE | Year: 2012

Background: In large-scale epidemiology, bloodspot sampling by fingerstick onto filter paper has many advantages, including ease and low costs of collection, processing and transport. We describe the development of an enzyme-linked immunoassay (ELISA) for quantifying insulin from dried blood spots and demonstrate its application in a large trial. Methods: We adapted an existing commercial kit (Mercodia Human Insulin ELISA, 10-1113-01) to quantify insulin from two 3-mm diameter discs (≈6 μL of blood) punched from whole blood standards and from trial samples. Paediatricians collected dried blood spots in a follow-up of 13,879 fasted children aged 11.5 years (interquartile range 11.3-11.8 years) from 31 trial sites across Belarus. We quantified bloodspot insulin levels and examined their distribution by demography and anthropometry. Results: Mean intra-assay (n = 157) coefficients of variation were 15% and 6% for 'low' (6.7 mU/L) and 'high' (23.1 mU/L) values, respectively; the respective inter-assay values (n = 33) were 23% and 11%. The intraclass correlation coefficient between 50 paired whole bloodspot versus serum samples, collected simultaneously, was 0.90 (95% confidence interval 0.85 to 0.95). Bloodspot insulin was stable for at least 31 months at -80°C, for one week at +30°C and following four freeze-thaw cycles. Paediatricians collected a median of 8 blood spots from 13,487 (97%) children. The geometric mean insulin (log standard deviation) concentrations amongst 12,812 children were 3.0 mU/L (1.1) in boys and 4.0 mU/L (1.0) in girls and were positively associated with pubertal stage, measures of central and peripheral adiposity, height and fasting glucose. Conclusions: Our simple and convenient bloodspot assay is suitable for the measurement of insulin in very small volumes of blood collected on filter paper cards and can be applied to large-scale epidemiology studies of the early-life determinants of circulating insulin. © 2012 Martin et al.


A 465 kHz sinusoidal signal was provided by a signal generator and applied through an amplifier (both Ultraflex) to a 2-turn solenoid coil with a radius of 2.5 cm to produce an electromagnetic field. The field strengths tested were 31 mT, 27 mT and 23 mT. Samples were placed within the solenoid. A static magnetic field for imaging experiments was produced using a neodymium-iron-boron permanent magnet (0.25 × 1 inch, axially magnetized, K&J Magnetics). This was able to produce a magnetic flux density of over 5 kilogauss at the magnet surface. Field strengths of 280 mT and 130 mT were generated by increasing the distance from the cells to the magnet surface (2 mm and 5 mm, respectively). A N52 grade neodymium magnet (0.06 × 0.25 inch, axially magnetized, K&J Magnetics) was used for electrophysiological studies. The magnetic field for in vivo studies was generated by the superconducting electromagnetic MRI field from a GE 3.0 Tesla Excite HDx MRI Scanner (GE Healthcare). The field strength was measured and regions with strengths of 0.5–1 T or 0.2–0.5 T were used for in vivo studies. Anti-GFP nanobody-TRPV1–2A–GFP ferritin in pEGFPN1 and MSCV-hygro were generated as previously described1. Mutation of residue I679K in TRPV1 was performed by site-directed mutagenesis using QuikChange XL Site-Directed Mutagenesis Kit (Agilent). These sequences were cloned into pVQ Ad CMV KNpA for generation of replication deficient adenovirus. To construct Cre- activated recombinant adenovirus vectors, a DNA construct with two pairs of incompatible lox sites, loxN and lox2722, was synthesized and Anti-GFP nanobody-TRPV1–2A–GFP ferritin was cloned between the two pairs in the antisense orientation. The floxed inverted Anti-GFP nanobody-TRPV1–2A–GFP ferritin cassette was then cloned into pVQ Ad CMV KNpA for generation of replication deficient adenovirus. The fidelity of PCR products and cloning was confirmed by DNA sequencing. The recombinant adenoviruses (Ad-CMV-GFP, Ad-CMV-anti-GFP-TRPV1/GFP-ferritin, Ad-FLEX-anti-GFP-TRPV1/GFP-ferritin and Ad-FLEX-anti-GFP-TRPV1mutant/GFP-ferritin were packaged by Viraquest. The final titre was 4 × 1010 plaque-forming units (p.f.u.) per ml. AAV-EF1a-DIO-hChR2(H134R)-eYFP was purchased from UNC Viral Core. Human embryonic kidney (HEK 293T) cells (ATCC CRL-3216), mycoplasma testing and STR profiling for authentication performed by ATCC) were cultured in DMEM with 10% fetal bovine serum (FBS; Gibco) at 37 °C and 5% CO . HEK cells have been reported to be among cell lines that are commonly misidentified. We used HEK 293T cells obtained from and authenticated by ATCC. HEK 293T cells are readily transfected and express transgene products at high levels. Transfected cells were used to examine the sites of TRPV1 and GFP-tagged ferritin expression, to generate stable cells to determine calcium responses to RF and magnetic stimulation and for electrophysiology studies. These studies were also performed in additional cell lines such as N38 (calcium responses), examined in vivo (protein expression) or in ex vivo slices (electrophysiology). Phoenix ecotropic packaging cells (Stanford University, no authentication or mycoplasma testing) were grown in DMEM with 10% FBS (Gibco) at 37 °C and 5% CO . Embryonic mouse hypothalamic N38 cells (Cellutions Biosystems Inc., no authentication, mycoplasma testing performed by Cellultions Biosystems Inc.) were grown in DMEM with 10% FBS at 37 °C and 5% CO . Stable cell lines were produced by retroviral infection of N38 cells using the Phoenix system. Briefly, Phoenix eco cells (2 × 106 cells per 6-cm dish) were transfected with MSCV-hygro anti-GFP-TRPV1/GFP-ferritin or MSCV-hygro anti-GFP-TRPV1mutant/GFP-ferritin. After 24 h, the medium was replaced and the cells placed at 32 °C. Medium was aspirated after a further 24 h and spun to remove cell debris. The Phoenix cell supernatant was added to N38 cells (plated at 1 × 106 cells per 6-cm dish) using a 1:2 dilution in DMEM/10% FBS with polybrene (4 μg ml−1, Sigma-Aldrich). Cells were incubated at 32 °C for a further 24 h before replacing the medium with DMEM/10% FBS. Selection medium was added 48 h after infection. Stably transfected N38 cells were maintained at 32 °C. For immunocytochemistry, electrophysiology, RF and magnet studies, stably transfected N38 cells or HEK cells were cultured on 12-mm cover glass (Fisher Scientific) coated with fibronectin (10 mg ml−1, Sigma). HEK cells were transfected with appropriate constructs 24 h after plating using lipofectamine 2000 (Invitrogen). Culture medium was replaced 18 h after transfection and holotransferrin (2 mg ml−1, Sigma) was added to the cells. Cells were studied 72–96 h after transfection or subculture. Effect of RF or magnet on pCREB and c-Fos. 24 h before the study, cells were placed in 1% FBS in optimem medium at 32 °C to ensure minimal activation of TRPV1 and calcium-dependent pathways. On the day of study, cells were incubated in 500 μl of calcium imaging buffer at room temperature (control) or in a RF field (31 mT) at room temperature. For magnet treatment, cells were treated with a static magnetic field (280 mT) for 5 s every 2 min for 1 h at room temperature. After 60 min, the cells were placed on ice, the supernatant removed and cells lysed with RIPA buffer (40 µl for western blot) or lysis buffer (100 µl Agilent Absolutely RNA microprep kit) and frozen at −80 °C until assay or RNA purification. Each study was repeated on three occasions each with four replicates. Control studies with N38 cells alone were performed on two occasions with four replicates. TRPV1 is a non-selective cation channel with relatively high permeability to divalent cations, particularly calcium (Ca2+ > Mg2+ > Na+ ≈ K+ ≈ Cs+)27. For studies examining the effects of RF (31 mT) or magnet (280 mT) with and without ruthenium red, stably transfected cells were washed three times in PBS then loaded with Fluo-4 3 μM (Invitrogen) in the presence of sulfinpyrazone 500 μM (Sigma) for 45–60 min at room temperature. Cells were washed again in PBS then incubated for 15–30 min in sulfinpyrazone in PBS. Cells were washed and then imaged in calcium imaging buffer. Imaging was performed using a Deltavision personal DV imaging system (Applied Precision) equipped with a custom-made ceramic lens. Images were acquired every 3 s for 3 min. Cells were imaged without treatment (eight occasions), before and during RF treatment (nine occasions), before and during application of a neodymium magnet (for 45 s, three occasions) or before and after treatment with 200 μM 2-APB (two occasions). Imaging was repeated in the presence of ruthenium red (100 μM) (two occasions for each condition). Images were analysed using ImageJ software. For studies to examine the effects of increasing RF or magnet field strength, to assess the effects of short RF treatment (10 s) on calcium responses and to examine the kinetics of the calcium response, cells were loaded with FluoForte 20 μM (Enzo Life Sciences) in the presence of Pluronic F-127 (0.02% vol/vol) and sulfinpyrazone 500 μM. Cells were washed and then imaged in calcium imaging buffer. Imaging was performed as above with images acquired every second for 1 min. Cells were imaged without treatment (four occasions), before and during RF treatment at 31, 27 and 23 mT (four occasions each), before and during application of a neodymium magnet at 280 or 130mT (magnet 2 mm or 5 mm from the cells, respectively, four occasions each) and before, during and after 10 s treatment with RF (31 mT) (four occasions). Images were analysed using ImageJ software. Stably transfected cells were washed with Krebs-HEPES buffer three times then loaded with MQAE (5 mM, Invitrogen) for 60 min at room temperature. The cells were washed with Krebs-HEPES buffer and then incubated in buffer for 15 min before imaging. Imaging was performed using LSM 510 NLO inverted multiphoton and confocal system (Zeiss) using a 40× objective with two photon excitation at 750 nm. Cells were imaged without treatment (four occasions), before and during application of a neodymium magnet (280 mT) for 20 s (on six occasions), before and after treatment with 200 μM 2-APB (two occasions). Imaging was repeated in the presence of ruthenium red (100 μM) (two occasions for each condition). Images were analysed using ImageJ software. Immunocytochemistry (ICC) and immunohistochemistry (IHC) were used to detect expression of TRPV1, GFP and Flag-tagged ferritin, to localize c-Fos expression and to quantify apoptosis in cells and tissue. Cells were washed twice in PBS and then fixed for 15 min in 2% paraformaldehyde (Electron Microscopy Services). Tissue was fixed in 10% formalin (Sigma) at 4 °C overnight and 40-μm sections cut on a vibrating microtome. Fixed cells or tissue sections were washed then incubated for 1 h in blocking buffer (3% BSA (Sigma) and 2% goat serum (Sigma) in PBS with 0.1% Triton-X (Sigma)). Cells and tissues were then incubated in primary antibody (rabbit anti-TRPV1 1:500 (AB95541, Chemicon), mouse anti-Flag 1:1,000 (Flag-tag mouse monoclonal antibody #F3165, Sigma28), chicken anti-GFP 1:1,000 (ab139701, Abcam), rabbit anti-activated-caspase-3 1:250 (G7481, Promega1) or rabbit anti-c-Fos 1:5,000 (PC38, Calbiochem2)) diluted in blocking buffer overnight at 4 °C. Cells or tissue were washed three times in PBS/0.1% Triton-X before incubation in secondary antibody (goat anti-rabbit 594 (A1012) or goat anti-rabbit 488 (A11008), goat anti-chicken 488 (A11039), goat anti-mouse 350 (A11045), all 1:1,000) diluted in blocking buffer for 2 h. To stain for cell membrane, Alexa 594 conjugated to wheat germ agglutinin (Invitrogen, 5 µg ml−1) was included in the blocking buffer with secondary antibodies. The cells or tissue were washed a further three times in PBS/0.1% Triton-X before mounting using Fluoromount (Southern Biotech). Images were acquired using confocal microscopy (LSM 510 laser scanning confocal microscope; Carl Zeiss MicroImaging, Inc.). Confocal fluorescence images were acquired on a scanning laser microscope using a 20×/0.70 NA objective or 100×/1.4 NA objective. To quantify GFP-positive and activated-caspase-3-positive cells, a 1,280 µm section of the brain with the injection site taken as the centre was imaged by taking tiled, serial stack images covering a depth of 40 µm every 320 µm. Quantification of GFP and activated-caspase-3 immunostaining was performed by an investigator blinded to the treatment group using Imaris 3D quantification software. The image analysis software calculated the number of GFP- or activated-caspase-3-positive cells per volume by thresholding immunoreactivity above background levels. Confocal images to examine co-localization of TRPV1, GFP and Flag-tagged ferritin were acquired with a 40× objective. Mouse brains were perfused by 4% PFA and sectioned at 50 μm by vibratome (Leica VT 100S). The sections were blocked by 4% BSA and 0.15% saponin in 20 mM Tris buffer (pH 7.4) for 2 h at room temperature, then incubated with anti-GFP (1:1,000) (#1020, Aves Lab Inc.29) overnight at 4 °C, followed by biotinylated anti-chicken incubation (1:1,000, Vector Laboratories, Inc.), with Nanogold streptavidin (1:100, Nanoprobes), and treated with GoldEhance EM (#2114 Nanoprobes). Negative control was done with the same procedure, except for omitting the primary antibody incubation. The tissue sections underwent fixation with 2% glutaraldehyde in sodium cacodylate buffer, light osmication (0.5% osmium tetroxide) for 15 min and en bloc staining with 1% uranium acetate for 30 min. Subsequently tissues were dehydrated through an ethanol series followed by incubation with Eponate12 (Ted Pella Inc.) The samples were embedded in the resin and polymerized at 60 °C for 48 h. Ultrathin (70 nm) sections were cut and examined under a JEOL JEM 100CX transmission electron microscope in the electron microscopy centre in The Rockefeller University. For double immuno-electron microscopy studies, HEK cells with stable expression of TRPV1 without fixation were subjected to high-pressure freezing (Leica EMPAC2) and freeze substitution in 0.2% uranyl acetate in 95% acetone and 5% water. Subsequently they were embedded in Lowicryl HM20 at −40 °C and cut into ultrathin sections. They were incubated with 4% BSA and 0.15% saponin, 0.15% cold fish skin gelatin in 20 mM TBS (pH 7.4) for 2 h at room temperature, a mixture of anti-GFP raised in chicken (1:300) (Aves Lab Inc.) and anti-TRPV1 raised in rabbit (1:300) (EMD Millipore Corp) overnight at 4 °C. Antigen–antibody complexes were recognized by biotinylated anti-chicken antibody and streptavidin tagged with 5 nm colloidal gold (1:20, Nanoprobes), or anti-rabbit tagged with 12 nm colloidal gold (Jackson Immuno Research Lab Inc.) for 2 h at room temperature. Electron microscopy was used to demonstrate ferritin in transfected HEK cells. Cells were fixed in 2% paraformaldehyde/2.5% glutaraldehyde/0.1 M cacodylate buffer, pH 7.4, for 15 min before pelleting and further fixation for 1 h. Cells were then treated with 1% osmium tetroxide (1 h, on ice) and 0.5% uranyl acetate (1 h) before dehydration with graded ethanol and treatment with propylene oxide (2 × 15 min). The cells were infiltrated with 50% EPON epoxy resin (Miller-Stephenson) and 50% propylene oxide overnight then 100% EPON (2 × 2 h) before curing at 60 °C for 2 days. Blocks were cut with a diamond knife on a Leica UltracutE and ultrathin (~70 nm) sections were collected on uncoated 200-mesh grids and stained with uranium and lead. Grids were viewed with a Tecnai SpiritBT Transmission Electron Microscope (FEI) at 80 kV and pictures were taken with Gatan 895 ULTRASCAN Digital Camera in the electron microscopy centre in The Rockefeller University. Cell culture. Whole-cell voltage clamp recordings were made at room temperature at −60 mV from cultured HEK cells and N38 cells expressing anti-GFP–TRPV1/GFP–ferritin or anti-GFP–TRPV1mutant/GFP–ferritin construct. Neurons expressing GFP were visualized using epifluorescence on an upright Zeiss Axioskop 2FS Plus microscope equipped with a Hamamatsu CCD camera. External solution contained (in mM): 140 NaCl, 2.8 KCl, 2 CaCl , 1 MgCl , 1 HEPES, 10 glucose, pH 7.4. Patch pipettes pulled from borosilicate glass (World Precision Instruments) had tip resistances of 5–10 MΩ and were filled with K-gluconate internal containing (in mM): 135 potassium gluconate, 4 KCl, 0.05 EGTA, 10 HEPES, 4 MgATP, 10 Na-phosphocreatine, pH adjusted to 7.3 with KOH, 290 OSM unless otherwise stated, in which case a CsCl internal solution was used containing (in mM):125 CsCl, 10 HEPES, 10 EGTA, 4 MgATP, 0.5 CaCl , 2-APB (200 µM) was prepared from a 10 mM DMSO stock and was perfused though the bath when stated. I–V relationships were obtained by measuring current responses to increasing 5-mV steps in the presence of 200 µM 2-APB. Cells were held at −60 mV. Magnetic activation was applied by bringing a permanent magnet within 500 μm of the recorded cell for 5 s with a micromanipulator. Recordings were acquired with an Axopatch 200B amplifier, filtered to 2 kHz and digitized at 10 kHz (pClamp10 software, Molecular Devices). Data were analysed using IGOR Pro (Wavemetrics) and NeuroMatic (http://www.neuromatic.thinkrandom.com/). Series resistance was monitored and not compensated for. If there was more than a 20% change in series resistance the recording was excluded. Slice electrophysiology. Glucokinase–Cre Rosa–tdTomato, injected with Ad-anti-GFP-TRPV1/GFP-ferritin or Ad-anti-GFP-TRPV1mutant/GFP-ferritin in the VMH were deeply anaesthetized with isoflurane before decapitation and removal of the entire brain to be immediately submerged in ice-cold ‘slicing’ solution containing (in mM): 85 NaCl, 2.5 KCl, 0.5 CaCl , 4 MgCl , 25 NaHCO , 1.25 NaH PO , 64 sucrose, 25 glucose and 0.02 d-2-amino-5-phosphonopentanoic acid (d-AP5, Tocris Bioscience). This was bubbled with 95% O and 5% CO , pH 7.4. Coronal hypothalamic slices (200 µm) were made with a moving blade microtome (VT1000S, Leica). The slices were kept at 32 °C for 40 min in recording solution containing (in mM) 125 NaCl, 2.5 KCl, 1.25 NaH PO , 26 NaHCO , 10 glucose, 2 CaCl and 1 MgCl , pH 7.4 when bubbled with 95% O and 5% CO . Whole-cell current-clamp patch-clamp recordings were made at room temperature from neurons in the VMH expressing both tdTomato indicating GK–Cre expression and GFP indicating expression of the anti-GFP–TRPV1/GFP–ferritin or anti-GFP–TRPV1mutant/GFP–ferritin construct. Neurons were visualized and recorded from as described above. In order to observe neuronal activation, neurons were hyperpolarized to below threshold. Baseline characteristic for hypothalamic neurons are as follows. Mean series resistance for neurons expressing the construct was 18.4 ± 1.1 MΩ (n = 37) and did not differ significantly from hypothalamic neurons that did not express the construct (18.0 ± 1, n = 7). The mean capacitance was 5.1 ± 0.55 pF and did not differ significantly from neurons not expressing the channel (6.7 ± 0.8) The mean resting membrane potential in naive hypothalamic neurons was −48.21 ± 4.7 mV (n = 15) and in cells expressing the construct before manipulation was −52 ± 1.9 mV (n = 37), P > 0.5. Input resistances did not significantly differ in hypothalamic neurons; control neuron (without construct expression) = 703 ± 128 MΩ (n = 13), wild-type channel neuron = 555 ± 110 MΩ (n = 7), mutant neuron = 866 ± 220 MΩ (n = 14). Male and female C57Bl6 mice (8–9-weeks-old, Jackson Laboratories), Nestin cre (8–9-weeks-old, Jackson Labs), Rosa lox-stop-lox tdTomato (8–10-weeks-old, Jackson Labs) and GK-cre (8–16-weeks-old) mice were used and housed under controlled light conditions (12 h light/12 h dark) and temperature (22 °C), single-caged, and fed ad libitum on standard mouse chow. Animal care and experimental procedures were performed with the approval of the Animal Care and Use Committee of Rockefeller University (protocols 12561 and 14712) under established guidelines. In all cases, mice were randomized according to body weight. The investigator was not blinded to the treatment group. The sample size required was estimated to be n = 8–10 per group on the basis of previous studies examining the effects of RF treatment on gene expression and protein release. No statistical methods were used to predetermine sample size. All surgeries were performed under aseptic conditions. Mice were anaesthetized using 1.5% isoflurane and the top of the head was shaved then cleaned with 70% ethanol. An incision was made in the midline and small craniotomies were made using a dental drill. Study 1. Wild-type mice underwent stereotacic injection into the striatum (coordinates: +1 mm AP, +2.3 mm ML, −3.3 mm DV) with Ad-CMV-GFP or Ad-CMV-anti-GFP-TRPV1/GFP-ferritin (4 × 108 p.f.u. per injection) over 10 min. The needle remained in position for a further 5 min before being withdrawn. Mice also received a lateral ventricle injection of iron dextran (4 μl, coordinates: −0.4 mm AP, +1.2 mm ML, −2.0 mm DV). After 1 week or 4 weeks, mice injected with Ad-CMV-anti-GFP-TRPV1/GFP-ferritin were randomized to RF or no RF treatment (n = 4 per time point and per treatment group). All mice treated with Ad-CMV-GFP were treated with RF (n = 4 per time point). Mice were anaesthetized with tribromoethanol (200 mg kg−1) and after 15 min mice were treated with RF (Ad-GFP and Ad-CMV-anti-GFP-TRPV1/GFP-ferritin, RF-treated group) for 30 min by placing in the RF solenoid. Ad-CMV-anti-GFP-TRPV1/GFP-ferritin, untreated group were anaesthetized and 15 min after the induction of anaesthesia were placed in the RF solenoid without power for 30 min. One hour after the being placed in the solenoid, mice were perfused, brains removed and tissue processed for GFP and activated-caspase-3 immunostaining as described above. Unilateral striatal injections were used to test our construct primarily because we thought that either basal activity in the absence of RF or significant toxicity and apoptosis would result in motor changes that are readily detectable. In addition, striatum does not express TRPV1 and we wanted to ensure any effect was the result of expressing our construct rather than a result of an effect of endogenous TRPV1. Finally, for RF treatment the mice needed to be anaesthetized and in pilot studies we found that anaesthetics often led to high levels of c-Fos activation in many central nervous system regions but not in the striatum. Thus, to minimize the possibility that the anaesthetic was contributing to either toxicity or non-specific staining, we used striatal injections in addition to assessing the VMH. Study 2. Nestin–Cre or wild-type mice received striatal injections of Ad-FLEX-anti-GFP-TRPV1/GFP-ferritin (4 × 108 p.f.u. per injection) and ICV iron dextran as described above. After 1 week, mice were anaesthetized, treated with RF for 30 min and perfused after 1 h as described above. Tissue was processed for GFP and c-Fos immunostaining as described above. Study 3. Glucokinase–Cre or wild-type mice were anaesthetized with isofluorane and underwent stereotactic injection of iron dextran into the lateral ventricle (as above) and unilateral injection of Ad-FLEX-anti-GFP-TRPV1/GFP-ferritin (4 × 108 p.f.u. per injection) into the VMH (coordinates: −0.9 mm AP, +0.32 mm ML and −5.48 mm DV). We performed unilateral injections of Cre-dependent adenovirus into the dorsomedial VMH of glucokinase–Cre mice. Construct expression was seen in this subdivision and in additional subdivisions of the VMH on the injected side. Virus expression is Cre-dependent as we did not see GFP expression in wild-type mice. After 1 week, half the mice in each group were studied using RF stimulation (31 mT) and half remained untreated. One week later, the previously treated mice were assessed without RF treatment and the previously untreated mice were treated with RF. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of RF treatment. After an additional week, mice were treated as described above but at 60 min after the onset of RF treatment, mice were killed and blood taken by cardiac puncture for hormone assessment and hepatic tissue was harvested and snap-frozen in liquid nitrogen for later assessment of gluconeogenic enzyme expression. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 4. GK–Cre mice were anaesthetized and injected with AAV-EF1a-DIO-hChR2(H134R)-EYFP (1 μl) into the VMH using the coordinates above. An optic fibre was then placed 200 nm above the injection site and fixed with adhesive cement followed by dental cement then the scalp was sealed back using tissue adhesive. After 4 weeks, half the mice were treated with 473 nm laser stimulation (5 Hz, 15 ms pulse width) for 30 min and half were attached to the optical cable but without light stimulation. One week later, the previously treated mice were assessed without light treatment and the previously untreated mice were treated with light. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of light treatment. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 5. GK–Cre or wild-type mice were anaesthetized with isofluorane and underwent stereotactic injection of iron dextran into the lateral ventricle (as above) and Ad-FLEX-anti-GFP-TRPV1mutant/GFP-ferritin (4 × 108 p.f.u. per injection) into the VMH. After one week, half the mice in each group were studied using RF stimulation (31 mT) and half remained untreated. One week later, the previously treated mice were assessed without RF treatment and the previously untreated mice were treated with RF. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of RF treatment. After a further 3 days, mice were anaesthetized and at time 0 were treated with 2-deoxyglucose (400 mg kg−1, intraperitoneal) then treated with RF for 45 min. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of RF treatment. One week later, mice were anaesthetized and RF treated (31 mT) and at 60 min after the onset of RF treatment, they were killed and blood taken by cardiac puncture for hormone assessment and hepatic tissue was harvested and snap frozen in liquid nitrogen for later assessment of gluconeogenic enzyme expression. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 6. GK–Cre or wild-type mice were anaesthetized with isofluorane and underwent stereotactic injection of iron dextran into the lateral ventricle and Ad-FLEX-anti-GFP-TRPV1/GFP-ferritin (4 × 108 p.f.u. per injection) into the VMH (as above). After one week, mice were placed in a plastic chamber in a low-strength magnetic field (<0.005 T) for a 15 min acclimation period, then half the mice were moved to a high-strength magnetic field (>0.5 T) for 30 min and half remained in the low-strength field. After 30 min, all mice were placed in a low-strength field for a further 30 min. Tail vein samples for blood glucose were taken at −5, 0, 15, 30, 45 and 60 min after the acclimation period. One week later, groups were crossed so the mice previously treated with high-strength magnetic field were treated with low-strength field and mice previously treated with low-strength field were treated with high-strength magnetic field. At the end of the study, mice were sacrificed and perfused. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 7. GK–Cre or wild-type mice were injected and recovered as in study 6. After one week, the effect of magnetic field stimulation on food intake was examined. After a 4-h fast, mice were acclimated to their chamber for 20 min then food intake was assessed after 20 min at low-strength magnetic field. Food intake was then measured for 20 min with half the mice in high-strength magnetic field (0.5–1 T) and half at low-strength magnetic field. Food intake was measure for a final 20 min period at low-strength magnetic field. One week later, the groups were crossed so mice previously treated with high-strength magnetic field were treated with low-strength field and mice previously treated with low-strength field were treated with high-strength magnetic field. At the end of the study, mice were sacrificed and perfused. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 8. GK–Cre mice underwent stereotactic injection as described in study 3. After one week, mice were anaesthetized and 15 min after the induction of anaesthesia were placed in the RF solenoid without power for 30 min (no RF treatment). After 3 days, the mice were divided into two equal groups, one group was treated with a field strength of 27 mT for 30 min and the other group with a field strength of 23 mT for 30 min. After a further 4 days, the treatment groups were reversed. A week later, the first group of mice were treated with RF (31 mT) for 20 min and the second group of mice with RF (31 mT) for 10 min. After a further 3 days, the treatment groups were reversed. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of RF treatment for all studies. After an additional week, half the mice were treated with RF (31 mT) for 30 min and half the mice remained untreated. At 60 min after the onset of RF treatment, mice were sacrificed and brains were fixed, sectioned and stained for GFP and activated-caspase-3 to assess apoptosis in the VMH. Study 9. GK–Cre mice underwent stereotactic injection as described in study 3. After 2 weeks, the effects of lower magnetic strength (0.2–0.5 mT) on food intake were assessed. After a 4-h fast, mice were acclimated to their chamber for 20 min and then food intake was assessed after 20 min at low-strength magnetic field followed by food intake measurement after 20 min treatment with a 0.2–0.5 T magnetic field. Food intake was measure for a final 20 min period at low-strength magnetic field. At the end of the study, mice were sacrificed and perfused. Brains were fixed, sectioned and stained with GFP to check injection placement. Study 10. GK–Cre mice underwent stereotactic injection as described in study 5 but with bilateral injection of Ad-FLEX-anti-GFP-TRPV1mutant/GFP-ferritin into the VMH. After a week, food intake was assessed in response to low-strength magnetic field treatment. After a 4-h fast, mice were acclimated to their chamber for 20 min and then food intake was measured for three periods of 20 min at low field strength. One week later, the study was repeated with a 20 min acclimation period then food intake was measured for mice were treated with high strength magnetic field (0.5–1 T) for 20 min. Food intake was measured for a further two 20-min periods at low magnetic field strength. At the end of the study, mice were sacrificed and perfused. Brains were fixed, sectioned and stained with GFP to check injection placement. Study 11. GK–Cre/Rosa–tdTomato mice underwent stereotactic surgery as described in study 3. After one week, three mice were anaesthetized and 15 min after the induction of anaesthesia were treated with RF (31 mT) for 30 min. At 60 min after the onset of RF treatment, mice were sacrificed. Brains from three mice were fixed, sectioned and stained for GFP and c-Fos. The fourth mouse was perfused without RF treatment and the brain was used for immune-electron microscopy. Study 12. GK–Cre (n = 4) underwent stereotactic surgery as described in study 3. After one week, the mice were anaesthetized and perfused. Brains were fixed, sectioned and stained for GFP. Tiled z-stack images were taken using confocal microscopy (20× objective) and images analysed using Imaris 3D quantification software. The image analysis software calculated the number of GFP-positive cells per volume by thresholding immunoreactivity above background levels. Using this method the average number of GFP-positive cells was 2,436 ± 841 cells per brain. Blood glucose was determined using a Breeze 2 glucometer (Bayer). Blood was spun for 10 min and plasma was collected. Plasma levels of insulin (Mercodia) and glucagon (Mercodia) were determined by ELISA. Protein was isolated by lysis in RIPA buffer and centrifugation at 16,000 r.p.m., 4 °C for 5 min before addition of 4× Laemelli buffer. Samples were denatured for 5 min at 95 °C and frozen at −20 °C before assay. Samples (15 μl) were run on a 4–15% gel then transferred to PVDF membrane. Membranes were blocked (3% dried milk in TBST buffer) for 1 h at room temperature then incubated in primary antibody (pCREB (Ser133) (87G3) rabbit monoclonal antibody (1:1,000) or β-actin rabbit antibody (1:1,000), Cell Signaling) in TBST overnight at 4 °C. Membranes were washed three times in TBST then incubated in secondary antibody (goat anti-rabbit IgG-HRP, 1:5,000, Santa Cruz) in TBST for 2 h at room temperature. The membrane was washed a further five times then developed in substrate for 5 min (Supersignal West Femto maximum sensitivity substrate, Life Technologies) and imaged (C-DiGit blot scanner, Licor). The pCREB density signal was corrected for any variation in protein loading by dividing by the density signal for the housekeeping gene, actin. Total RNA was isolated by homogenizing tissue in TRIzol reagent (Invitrogen) or cells in buffer RLT and purifying the RNA using Absolutely RNA microprep kit (Agilent). Complimentary DNA was synthesized using QIAGEN omniscript RT kit. Real-time PCR was performed using the TaqMan system (Applied Biosystems) according to the manufacturer’s protocol. Data over 2 s.d. outside the mean were excluded from further analysis as determined before the studies. All data were tested for Gaussian distribution and variance. Data with normal distribution and similar variance were analysed for statistical significance using two-tailed, unpaired Student’s t-tests unless otherwise indicated. Data with normal variation and unequal variance were analysed by two-tailed Welch’s t-tests. Paired data were analysed by paired t-tests. Data with more than two groups were analysed by one-way ANOVA with post-hoc Tukey’s analysis for parametric data. Data which were not normally distributed were analysed by two-tailed Mann–Whitney U-tests or Kruskal–Wallis tests with post-hoc Dunn’s correction. P values are as indicated. Time course data were analysed by two-way ANOVA with Sidak’s multiple comparisons or repeated measures two-way ANOVA with Sidak’s multiple comparisons for paired data. Data are shown as mean ± s.e.m. unless otherwise stated.


Rydgren T.,Uppsala University | Borjesson A.,Uppsala University | Carlsson A.,Mercodia AB | Sandler S.,Uppsala University
Biochemical and Biophysical Research Communications | Year: 2012

The incretin glucagon-like peptide-1 (GLP-1) and other GLP-1 receptor agonists have been shown to cause both antiapoptotic as well as regenerative effects on beta-cells in different animal models for diabetes. Our aim of this study was to test the hypothesis that spontaneously diabetic non obese diabetic (NOD) mice show an altered expression of GLP-1 compared to normoglycemic age-matched controls as a consequence of a diabetic state. To do this we used an ELISA prototype for mouse GLP-1 to measure plasma total GLP-1 from recently diabetic NOD mice as well as from age-matched normoglycemic NOD mice (controls). We also stained sections of pancreatic glands for GLP-1 from diabetic NOD mice and controls. We found increased levels of plasma total GLP-1 in diabetic NOD mice, when compared to control mice, both from non-fasted mice and from mice fasted for 2. h. Furthermore, diabetic NOD mice displayed a higher GLP-1 response to an oral glucose tolerance test, compared to control mice. We also found that sections of pancreatic glands from diabetic NOD mice had an increased GLP-1 positive islet area in regard to relative islet area (i.e. total islet area/total pancreas area of the sections) compared to control mice. To our knowledge, this study is the first to show increased levels of GLP-1 in plasma in spontaneously diabetic NOD mice. We suggest that these results might represent a compensatory mechanism of the diabetic NOD mice to counteract beta-cell loss and hyperglycemia. © 2012 Elsevier Inc.


Carlsson A.,Mercodia AB | Carlsson A.,Uppsala University | Hallgren I.-B.,Uppsala University | Johansson H.,Mercodia AB | Sandler S.,Uppsala University
Endocrinology | Year: 2010

Until now, there have been few assays to measure C-peptide and proinsulin in the rat. We used a well-established rat insulin ELISA and validated two novel ELISAs for rat C-peptide and rat/mouse proinsulin to examine secretion and content of insulin, proinsulin, and C-peptide from rat islets cultured for 72 h at different glucose concentrations in culture medium. To examine long-term effects in vitro rather than short-term effects of exposure to low, normal, and high glucose, the exposure time to the different glucose concentrations was set to 72 h. The measurement uncertainty of the values obtainable from the ELISAs was determined by calculation of the variation pattern from the intraassay variation generated by unknown samples, and repeatability was determined by analysis of controls. The precision study and the analysis of controls confirm that the validated ELISAs for rat C-peptide and proinsulin would be useful for further studies on the effects of preculture in different glucose concentrations. The higher the glucose concentration used during the 72-h culture period of rat islets, the higher insulin, C-peptide and proinsulin values were obtained in a subsequent short-term glucose-challenge experiment. The proportion of proinsulin to insulin secreted increased, as did islet content, with increasing glucose concentration during preculture. We also observed a nonequimolar, glucose-dependent secretion and content of rat insulin over rat C-peptide after culture at 11.1 and 28 mM glucose. Copyright © 2010 by The Endocrine Society.


Until now, there have been few assays to measure C-peptide and proinsulin in the rat. We used a well-established rat insulin ELISA and validated two novel ELISAs for rat C-peptide and rat/mouse proinsulin to examine secretion and content of insulin, proinsulin, and C-peptide from rat islets cultured for 72 h at different glucose concentrations in culture medium. To examine long-term effects in vitro rather than short-term effects of exposure to low, normal, and high glucose, the exposure time to the different glucose concentrations was set to 72 h. The measurement uncertainty of the values obtainable from the ELISAs was determined by calculation of the variation pattern from the intraassay variation generated by unknown samples, and repeatability was determined by analysis of controls. The precision study and the analysis of controls confirm that the validated ELISAs for rat C-peptide and proinsulin would be useful for further studies on the effects of preculture in different glucose concentrations. The higher the glucose concentration used during the 72-h culture period of rat islets, the higher insulin, C-peptide and proinsulin values were obtained in a subsequent short-term glucose-challenge experiment. The proportion of proinsulin to insulin secreted increased, as did islet content, with increasing glucose concentration during preculture. We also observed a nonequimolar, glucose-dependent secretion and content of rat insulin over rat C-peptide after culture at 11.1 and 28 mM glucose.

Loading Mercodia AB collaborators
Loading Mercodia AB collaborators