Ljubljana, Slovenia
Ljubljana, Slovenia

Time filter

Source Type

News Article | May 9, 2017
Site: globenewswire.com

OTTAWA, May 09, 2017 (GLOBE NEWSWIRE) -- ABcann Global Corporation (TSX-V:ABCN) (the “Company”) is pleased to announce that  Raphael Mechoulam has agreed to extend his role as an advisor to the Company. Mechoulam is an Israeli Organic Chemist, and a  professor at the Hebrew University of Jerusalem’s Medical Faculty, Institute for Drug Research. Professor Mechoulam has been nominated for the Nobel Prize, and is often regarded as the "Father of Marijuana Research." Professor Mechoulam has been a pioneer in medicinal cannabis research for more than five decades. His most significant cannabis research accomplishments include determining the chemical structure of cannabidiol (CBD) in 1963 which led to isolating and synthesizing tetrahydrocannabinol (THC) in 1964 and isolating and elucidating the structure of the brain's first endogenous cannabinoid, Anandamide, in 1992. “Professor Mechoulam’s experience in medicinal cannabis is an invaluable resource for ABcann as we enter the most aggressive growth stage in the company’s history. The Company has invested heavily to build and extend its early leadership in advanced pharmaceutical-grade cannabis production. Professor Mechoulam’s advice, guidance, and unmatched expertise in the field has played a major role in achieving this, says Aaron Keay CEO and Director of ABcann. “I have followed the development of cannabis for medical use for many years. There is no doubt that it is very helpful in numerous diseases, however many physicians refrain from prescribing it. I believe that the route followed by ABcann for standardized cannabis grown under strict conditions, leading to reproducible contents, will not only satisfy physicians but will also make possible clinical trials which will develop the evidence to transform how cannabis is perceived by the pharmaceutical industry and the regulatory agencies” said Professor Mechoulam. “The Professor’s agreement to extend his relationship with ABcann is one of the strongest votes of confidence our company could ever receive,” says Ken Clement, Founder and Executive Chairman of ABcann. ON BEHALF OF THE BOARD OF DIRECTORS OF ABCANN GLOBAL CORPORATION For further information, please contact Aaron Keay by phone at (604) 323-6911 or by email at aaron@abcannglobal.com OR Leo Karabelas by phone (416) 543-3120 or by email at leo.k@abcannglobal.com. Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. Certain statements in this release are forward-looking statements, which reflect the expectations of management regarding the proposed Qualifying Transaction, the Concurrent Financings and ABcann’s future business plans. Forward-looking statements consist of statements that are not purely historical, including any statements regarding beliefs, plans, expectations or intentions regarding the future. Forward looking statements in this news release include statements relating to: the terms of the Transaction; the terms of the Concurrent Financings and the use of proceeds thereof; the consistency of ABcann’s product; and ABcann’s future site development and expansion plans. Such statements are subject to risks and uncertainties that may cause actual results, performance or developments to differ materially from those contained in the statements, including that: the TSXV may not approve the Transaction; the Transaction may not be completed for any other reason; the Concurrent Financings may not be completed on the terms contemplated or at all; the proceeds of the Concurrent Financings may not be allocated as currently contemplated; or factors may occur which cause ABcann’s currently contemplated expansion and development plans to cease or otherwise change. No assurance can be given that any of the events anticipated by the forward-looking statements will occur or, if they do occur, what benefits the Company or the Resulting Issuer will obtain from them. Readers are urged to consider these factors carefully in evaluating the forward-looking statements contained in this news release and are cautioned not to place undue reliance on such forward-looking statements, which are qualified in their entirety by these cautionary statements. These forward-looking statements are made as of the date hereof and the Company disclaims any intent or obligation to update publicly any forward-looking statements, whether as a result of new information, future events or results or otherwise, except as required by applicable securities laws.


News Article | May 9, 2017
Site: globenewswire.com

OTTAWA, May 09, 2017 (GLOBE NEWSWIRE) -- ABcann Global Corporation (TSX-V:ABCN) (the “Company”) is pleased to announce that  Raphael Mechoulam has agreed to extend his role as an advisor to the Company. Mechoulam is an Israeli Organic Chemist, and a  professor at the Hebrew University of Jerusalem’s Medical Faculty, Institute for Drug Research. Professor Mechoulam has been nominated for the Nobel Prize, and is often regarded as the "Father of Marijuana Research." Professor Mechoulam has been a pioneer in medicinal cannabis research for more than five decades. His most significant cannabis research accomplishments include determining the chemical structure of cannabidiol (CBD) in 1963 which led to isolating and synthesizing tetrahydrocannabinol (THC) in 1964 and isolating and elucidating the structure of the brain's first endogenous cannabinoid, Anandamide, in 1992. “Professor Mechoulam’s experience in medicinal cannabis is an invaluable resource for ABcann as we enter the most aggressive growth stage in the company’s history. The Company has invested heavily to build and extend its early leadership in advanced pharmaceutical-grade cannabis production. Professor Mechoulam’s advice, guidance, and unmatched expertise in the field has played a major role in achieving this, says Aaron Keay CEO and Director of ABcann. “I have followed the development of cannabis for medical use for many years. There is no doubt that it is very helpful in numerous diseases, however many physicians refrain from prescribing it. I believe that the route followed by ABcann for standardized cannabis grown under strict conditions, leading to reproducible contents, will not only satisfy physicians but will also make possible clinical trials which will develop the evidence to transform how cannabis is perceived by the pharmaceutical industry and the regulatory agencies” said Professor Mechoulam. “The Professor’s agreement to extend his relationship with ABcann is one of the strongest votes of confidence our company could ever receive,” says Ken Clement, Founder and Executive Chairman of ABcann. ON BEHALF OF THE BOARD OF DIRECTORS OF ABCANN GLOBAL CORPORATION For further information, please contact Aaron Keay by phone at (604) 323-6911 or by email at aaron@abcannglobal.com OR Leo Karabelas by phone (416) 543-3120 or by email at leo.k@abcannglobal.com. Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. Certain statements in this release are forward-looking statements, which reflect the expectations of management regarding the proposed Qualifying Transaction, the Concurrent Financings and ABcann’s future business plans. Forward-looking statements consist of statements that are not purely historical, including any statements regarding beliefs, plans, expectations or intentions regarding the future. Forward looking statements in this news release include statements relating to: the terms of the Transaction; the terms of the Concurrent Financings and the use of proceeds thereof; the consistency of ABcann’s product; and ABcann’s future site development and expansion plans. Such statements are subject to risks and uncertainties that may cause actual results, performance or developments to differ materially from those contained in the statements, including that: the TSXV may not approve the Transaction; the Transaction may not be completed for any other reason; the Concurrent Financings may not be completed on the terms contemplated or at all; the proceeds of the Concurrent Financings may not be allocated as currently contemplated; or factors may occur which cause ABcann’s currently contemplated expansion and development plans to cease or otherwise change. No assurance can be given that any of the events anticipated by the forward-looking statements will occur or, if they do occur, what benefits the Company or the Resulting Issuer will obtain from them. Readers are urged to consider these factors carefully in evaluating the forward-looking statements contained in this news release and are cautioned not to place undue reliance on such forward-looking statements, which are qualified in their entirety by these cautionary statements. These forward-looking statements are made as of the date hereof and the Company disclaims any intent or obligation to update publicly any forward-looking statements, whether as a result of new information, future events or results or otherwise, except as required by applicable securities laws.


News Article | May 9, 2017
Site: globenewswire.com

OTTAWA, May 09, 2017 (GLOBE NEWSWIRE) -- ABcann Global Corporation (TSX-V:ABCN) (the “Company”) is pleased to announce that  Raphael Mechoulam has agreed to extend his role as an advisor to the Company. Mechoulam is an Israeli Organic Chemist, and a  professor at the Hebrew University of Jerusalem’s Medical Faculty, Institute for Drug Research. Professor Mechoulam has been nominated for the Nobel Prize, and is often regarded as the "Father of Marijuana Research." Professor Mechoulam has been a pioneer in medicinal cannabis research for more than five decades. His most significant cannabis research accomplishments include determining the chemical structure of cannabidiol (CBD) in 1963 which led to isolating and synthesizing tetrahydrocannabinol (THC) in 1964 and isolating and elucidating the structure of the brain's first endogenous cannabinoid, Anandamide, in 1992. “Professor Mechoulam’s experience in medicinal cannabis is an invaluable resource for ABcann as we enter the most aggressive growth stage in the company’s history. The Company has invested heavily to build and extend its early leadership in advanced pharmaceutical-grade cannabis production. Professor Mechoulam’s advice, guidance, and unmatched expertise in the field has played a major role in achieving this, says Aaron Keay CEO and Director of ABcann. “I have followed the development of cannabis for medical use for many years. There is no doubt that it is very helpful in numerous diseases, however many physicians refrain from prescribing it. I believe that the route followed by ABcann for standardized cannabis grown under strict conditions, leading to reproducible contents, will not only satisfy physicians but will also make possible clinical trials which will develop the evidence to transform how cannabis is perceived by the pharmaceutical industry and the regulatory agencies” said Professor Mechoulam. “The Professor’s agreement to extend his relationship with ABcann is one of the strongest votes of confidence our company could ever receive,” says Ken Clement, Founder and Executive Chairman of ABcann. ON BEHALF OF THE BOARD OF DIRECTORS OF ABCANN GLOBAL CORPORATION For further information, please contact Aaron Keay by phone at (604) 323-6911 or by email at aaron@abcannglobal.com OR Leo Karabelas by phone (416) 543-3120 or by email at leo.k@abcannglobal.com. Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. Certain statements in this release are forward-looking statements, which reflect the expectations of management regarding the proposed Qualifying Transaction, the Concurrent Financings and ABcann’s future business plans. Forward-looking statements consist of statements that are not purely historical, including any statements regarding beliefs, plans, expectations or intentions regarding the future. Forward looking statements in this news release include statements relating to: the terms of the Transaction; the terms of the Concurrent Financings and the use of proceeds thereof; the consistency of ABcann’s product; and ABcann’s future site development and expansion plans. Such statements are subject to risks and uncertainties that may cause actual results, performance or developments to differ materially from those contained in the statements, including that: the TSXV may not approve the Transaction; the Transaction may not be completed for any other reason; the Concurrent Financings may not be completed on the terms contemplated or at all; the proceeds of the Concurrent Financings may not be allocated as currently contemplated; or factors may occur which cause ABcann’s currently contemplated expansion and development plans to cease or otherwise change. No assurance can be given that any of the events anticipated by the forward-looking statements will occur or, if they do occur, what benefits the Company or the Resulting Issuer will obtain from them. Readers are urged to consider these factors carefully in evaluating the forward-looking statements contained in this news release and are cautioned not to place undue reliance on such forward-looking statements, which are qualified in their entirety by these cautionary statements. These forward-looking statements are made as of the date hereof and the Company disclaims any intent or obligation to update publicly any forward-looking statements, whether as a result of new information, future events or results or otherwise, except as required by applicable securities laws.


News Article | May 9, 2017
Site: globenewswire.com

OTTAWA, May 09, 2017 (GLOBE NEWSWIRE) -- ABcann Global Corporation (TSX-V:ABCN) (the “Company”) is pleased to announce that  Raphael Mechoulam has agreed to extend his role as an advisor to the Company. Mechoulam is an Israeli Organic Chemist, and a  professor at the Hebrew University of Jerusalem’s Medical Faculty, Institute for Drug Research. Professor Mechoulam has been nominated for the Nobel Prize, and is often regarded as the "Father of Marijuana Research." Professor Mechoulam has been a pioneer in medicinal cannabis research for more than five decades. His most significant cannabis research accomplishments include determining the chemical structure of cannabidiol (CBD) in 1963 which led to isolating and synthesizing tetrahydrocannabinol (THC) in 1964 and isolating and elucidating the structure of the brain's first endogenous cannabinoid, Anandamide, in 1992. “Professor Mechoulam’s experience in medicinal cannabis is an invaluable resource for ABcann as we enter the most aggressive growth stage in the company’s history. The Company has invested heavily to build and extend its early leadership in advanced pharmaceutical-grade cannabis production. Professor Mechoulam’s advice, guidance, and unmatched expertise in the field has played a major role in achieving this, says Aaron Keay CEO and Director of ABcann. “I have followed the development of cannabis for medical use for many years. There is no doubt that it is very helpful in numerous diseases, however many physicians refrain from prescribing it. I believe that the route followed by ABcann for standardized cannabis grown under strict conditions, leading to reproducible contents, will not only satisfy physicians but will also make possible clinical trials which will develop the evidence to transform how cannabis is perceived by the pharmaceutical industry and the regulatory agencies” said Professor Mechoulam. “The Professor’s agreement to extend his relationship with ABcann is one of the strongest votes of confidence our company could ever receive,” says Ken Clement, Founder and Executive Chairman of ABcann. ON BEHALF OF THE BOARD OF DIRECTORS OF ABCANN GLOBAL CORPORATION For further information, please contact Aaron Keay by phone at (604) 323-6911 or by email at aaron@abcannglobal.com OR Leo Karabelas by phone (416) 543-3120 or by email at leo.k@abcannglobal.com. Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. Certain statements in this release are forward-looking statements, which reflect the expectations of management regarding the proposed Qualifying Transaction, the Concurrent Financings and ABcann’s future business plans. Forward-looking statements consist of statements that are not purely historical, including any statements regarding beliefs, plans, expectations or intentions regarding the future. Forward looking statements in this news release include statements relating to: the terms of the Transaction; the terms of the Concurrent Financings and the use of proceeds thereof; the consistency of ABcann’s product; and ABcann’s future site development and expansion plans. Such statements are subject to risks and uncertainties that may cause actual results, performance or developments to differ materially from those contained in the statements, including that: the TSXV may not approve the Transaction; the Transaction may not be completed for any other reason; the Concurrent Financings may not be completed on the terms contemplated or at all; the proceeds of the Concurrent Financings may not be allocated as currently contemplated; or factors may occur which cause ABcann’s currently contemplated expansion and development plans to cease or otherwise change. No assurance can be given that any of the events anticipated by the forward-looking statements will occur or, if they do occur, what benefits the Company or the Resulting Issuer will obtain from them. Readers are urged to consider these factors carefully in evaluating the forward-looking statements contained in this news release and are cautioned not to place undue reliance on such forward-looking statements, which are qualified in their entirety by these cautionary statements. These forward-looking statements are made as of the date hereof and the Company disclaims any intent or obligation to update publicly any forward-looking statements, whether as a result of new information, future events or results or otherwise, except as required by applicable securities laws.


News Article | May 9, 2017
Site: globenewswire.com

OTTAWA, May 09, 2017 (GLOBE NEWSWIRE) -- ABcann Global Corporation (TSX-V:ABCN) (the “Company”) is pleased to announce that  Raphael Mechoulam has agreed to extend his role as an advisor to the Company. Mechoulam is an Israeli Organic Chemist, and a  professor at the Hebrew University of Jerusalem’s Medical Faculty, Institute for Drug Research. Professor Mechoulam has been nominated for the Nobel Prize, and is often regarded as the "Father of Marijuana Research." Professor Mechoulam has been a pioneer in medicinal cannabis research for more than five decades. His most significant cannabis research accomplishments include determining the chemical structure of cannabidiol (CBD) in 1963 which led to isolating and synthesizing tetrahydrocannabinol (THC) in 1964 and isolating and elucidating the structure of the brain's first endogenous cannabinoid, Anandamide, in 1992. “Professor Mechoulam’s experience in medicinal cannabis is an invaluable resource for ABcann as we enter the most aggressive growth stage in the company’s history. The Company has invested heavily to build and extend its early leadership in advanced pharmaceutical-grade cannabis production. Professor Mechoulam’s advice, guidance, and unmatched expertise in the field has played a major role in achieving this, says Aaron Keay CEO and Director of ABcann. “I have followed the development of cannabis for medical use for many years. There is no doubt that it is very helpful in numerous diseases, however many physicians refrain from prescribing it. I believe that the route followed by ABcann for standardized cannabis grown under strict conditions, leading to reproducible contents, will not only satisfy physicians but will also make possible clinical trials which will develop the evidence to transform how cannabis is perceived by the pharmaceutical industry and the regulatory agencies” said Professor Mechoulam. “The Professor’s agreement to extend his relationship with ABcann is one of the strongest votes of confidence our company could ever receive,” says Ken Clement, Founder and Executive Chairman of ABcann. ON BEHALF OF THE BOARD OF DIRECTORS OF ABCANN GLOBAL CORPORATION For further information, please contact Aaron Keay by phone at (604) 323-6911 or by email at aaron@abcannglobal.com OR Leo Karabelas by phone (416) 543-3120 or by email at leo.k@abcannglobal.com. Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. Certain statements in this release are forward-looking statements, which reflect the expectations of management regarding the proposed Qualifying Transaction, the Concurrent Financings and ABcann’s future business plans. Forward-looking statements consist of statements that are not purely historical, including any statements regarding beliefs, plans, expectations or intentions regarding the future. Forward looking statements in this news release include statements relating to: the terms of the Transaction; the terms of the Concurrent Financings and the use of proceeds thereof; the consistency of ABcann’s product; and ABcann’s future site development and expansion plans. Such statements are subject to risks and uncertainties that may cause actual results, performance or developments to differ materially from those contained in the statements, including that: the TSXV may not approve the Transaction; the Transaction may not be completed for any other reason; the Concurrent Financings may not be completed on the terms contemplated or at all; the proceeds of the Concurrent Financings may not be allocated as currently contemplated; or factors may occur which cause ABcann’s currently contemplated expansion and development plans to cease or otherwise change. No assurance can be given that any of the events anticipated by the forward-looking statements will occur or, if they do occur, what benefits the Company or the Resulting Issuer will obtain from them. Readers are urged to consider these factors carefully in evaluating the forward-looking statements contained in this news release and are cautioned not to place undue reliance on such forward-looking statements, which are qualified in their entirety by these cautionary statements. These forward-looking statements are made as of the date hereof and the Company disclaims any intent or obligation to update publicly any forward-looking statements, whether as a result of new information, future events or results or otherwise, except as required by applicable securities laws.


NOXXON Pharma N.V. (Paris:ALNOX) (Alternext Paris: ALNOX), a biotechnology company whose core focus is on improving cancer treatment by targeting the tumor microenvironment, today announced the signing of an agreement with the National Center for Tumor Diseases (NCT) in Heidelberg under which the NCT will conduct a trial evaluating NOXXON’s lead product candidate NOX-A12 in combination with Keytruda® (pembrolizumab) in metastatic pancreatic and colorectal cancer. In some preclinical studies, NOX-A12 has shown an ability to make the immediate area surrounding a model tumor, the so-called tumor microenvironment, more accessible to the immune system. The ability of many tumors to use the tumor microenvironment to hide from the immune system is believed to contribute to the insensitivity of some tumors towards checkpoint inhibitors, such as Keytruda®. The NCT is a leading center for cancer research and treatment, located in Heidelberg, Germany. It was jointly founded by the German Cancer Research Center (DKFZ), Heidelberg University Hospital, Medical Faculty Heidelberg and German Cancer Aid (Deutsche Krebshilfe) in 2004 to conduct interdisciplinary research for preventing and treating cancer to ultimately benefit patients. The NCT investigators leading the clinical trial include Prof. Dr. Dirk Jäger, Managing Director, head of the clinical and tumor immunology research groups, and Dr. Niels Halama, Group Leader, both recognized leaders in clinical cancer research with significant experience in studying the tumor microenvironment in a clinical setting. Throughout his career, Prof. Dr. Jäger has focused on tumor and immunology as well as the interdisciplinary connections between both fields, both scientifically and clinically. NOXXON’s Chief Medical Officer, Dr. Jarl Ulf Jungnelius, commented: “Dr. Jäger and Dr. Halama are experts in the treatment of metastatic cancer patients as well as the tumor microenvironment. We are extremely pleased that they will be collaborating with NOXXON on this groundbreaking study.” Prof. Dr. Jäger, Managing Director of the NCT Heidelberg, commented: “This trial will enable us to explore the potential of NOX-A12 in combination with Keytruda® to benefit patients with few viable treatment options. Importantly, the trial will help us to better understand the ability of NOX-A12 to modify the tumor microenvironment and make it more accessible to the immune system to facilitate tumor destruction.” NOXXON Pharma N.V. is a clinical-stage biopharmaceutical company focused on cancer treatment. NOXXON’s goal is to significantly enhance the effectiveness of cancer treatments including immuno-oncology approaches (such as immune checkpoint inhibitors) and current standards of care (such as chemotherapy and radiotherapy). NOXXON’s Spiegelmer® platform has generated a proprietary pipeline of clinical-stage product candidates including its lead cancer drug candidate NOX-A12, which is the subject of a clinical immuno-oncology collaboration agreement with Merck & Co. / MSD (NYSE: MRK) to study NOX-A12 combined with Keytruda® (pembrolizumab) in pancreatic and colorectal cancer. NOXXON is supported by a strong group of leading international investors, including TVM Capital, Sofinnova Partners, Edmond de Rothschild Investment Partners, DEWB, NGN and Seventure. NOXXON has its statutory seat in Amsterdam, The Netherlands and its office in Berlin, Germany. Further information can be found at: www.noxxon.com About the National Center for Tumor Diseases (NCT) Heidelberg The NCT Heidelberg is a joint institution of the German Cancer Research Center, Heidelberg University Hospital and German Cancer Aid. The NCT's goal is to link promising approaches from cancer research with patient care from diagnosis to treatment, aftercare and prevention. The interdisciplinary tumor outpatient clinic is the central element of the NCT. Here the patients benefit from an individual treatment plan prepared in a timely manner in interdisciplinary expert rounds, the so-called tumor boards. Participation in clinical studies provides access to innovative therapies. The NCT thereby acts as a pioneering platform that translates novel research results from the laboratory into clinical practice. The NCT cooperates with self-help groups and supports them in their work. Since 2015, a second site for the NCT beside Heidelberg has been under development in Dresden. Certain statements in this communication contain formulations or terms referring to the future or future developments, as well as negations of such formulations or terms, or similar terminology. These are described as forward-looking statements. In addition, all information in this communication regarding planned or future results of business segments, financial indicators, developments of the financial situation or other financial or statistical data contains such forward-looking statements. The company cautions prospective investors not to rely on such forward-looking statements as certain prognoses of actual future events and developments. The company is neither responsible nor liable for updating such information, which only represents the state of affairs on the day of publication.


News Article | May 3, 2017
Site: www.eurekalert.org

Phthalates, which are used as plasticizers in plastics, can considerably increase the risk of allergies among children. This was demonstrated by UFZ researchers in conjunction with scientists from the University of Leipzig and the German Cancer Research Center (DKFZ) in a current study published in the Journal of Allergy and Clinical Immunology. According to this study, an increased risk of children developing allergic asthma exists if the mother has been particularly heavily exposed to phthalates during pregnancy and breastfeeding. The mother-child cohort from the LINA study was the starting and end point of this translational study. In our day-to-day lives, we come into contact with countless plastics containing plasticizers. These plasticizers, which also include the aforementioned phthalates, are used when processing plastics in order to make the products more flexible. Phthalates can enter our bodies through the skin, foodstuffs or respiration. "It is a well-known fact that phthalates affect our hormone system and can thereby have an adverse effect on our metabolism or fertility. But that's not the end of it," says UFZ environmental immunologist Dr Tobias Polte. "The results of our current study demonstrate that phthalates also interfere with the immune system and can significantly increase the risk of developing allergies." At the outset of the study, the team of UFZ researchers examined the urine of pregnant women from the LINA (lifestyle and environmental factors and their influence on the newborn-allergy-risk) mother-child cohort study and searched for metabolites of phthalates. The concentration level determined in each case was found to correlate with the occurrence of allergic asthma among the children. "There was a clearly discernible relationship between higher concentrations of the metabolite of benzylbutylphthalate (BBP) in the mother's urine and the presence of allergic asthma in their children", explains Dr Irina Lehmann, who heads the LINA study. Researchers were able to confirm the results from the mother-child cohort in the mouse model in collaboration with colleagues from the Medical Faculty at the University of Leipzig. In this process, mice were exposed to a certain phthalate concentration during pregnancy and the lactation period, which led to comparable concentrations of the BBP metabolite in urine to those observed in heavily exposed mothers from the LINA cohort. The offspring demonstrated a clear tendency to develop allergic asthma; even the third generation continued to be affected. Among the adult mice, on the other hand, there were no increased allergic symptoms. "The time factor is therefore decisive: if the organism is exposed to phthalates during the early stages of development, this may have effects on the risk of illness for the two subsequent generations," explains Polte. "The prenatal development process is thus clearly altered by the phthalate exposure." In order to establish precisely what may have been modified, Polte and his team, in collaboration with colleagues from the German Cancer Research Center (DKFZ), took a close look at the genes of the young mice born to exposed mothers. So-called methyl groups were found in the DNA of these genes - and to a greater extent than is usually the case. In the course of this so-called epigenetic modification of the DNA, methyl groups attach themselves to a gene like a kind of padlock and thus prevent its code from being read, meaning that the associated protein cannot be produced. After the researchers treated the mice with a special substance intended to crack the methyl "locks" on the affected genes, the mice demonstrated fewer signs of allergic asthma than before. Dr Polte concludes the following: "Phthalates apparently switch off decisive genes by means of DNA methylation, causing the activity of these genes to be reduced in the young mice." But which genes cause allergic asthma if they cannot be read? So-called T-helper 2 cells play a central part in the development of allergies. These are kept in check by special opponents (repressors). If a repressor gene cannot be read as a result of being blocked by methyl groups, the T-helper 2 cells that are conducive to the development of allergies are no longer sufficiently inhibited, meaning that an allergy is likely to develop. "We surmise that this connection is decisive for the development of allergic asthma caused by phthalates," says Polte. "Furthermore, in the cell experiment, we were able to demonstrate that there is an increased formation of T-helper 2 cells from the immune cells of the offspring of exposed mother mice than is the case for the offspring of non-exposed animals. This enabled us to establish an increased tendency towards allergies once again." In mice, the researchers were able to prove that a repressor gene that has been switched off due to DNA methylation is responsible for the development of allergic asthma. But does this mechanism also play a part in humans? In order to answer this question, the researchers consulted the LINA cohort once more. They searched for the corresponding gene among the children with allergic asthma and studied the degree of methylation and gene activity. Here, too, it became apparent that the gene was blocked by methyl groups and thus could not be read. "Thanks to our translational study approach - which led from humans via the mouse model and cellular culture back to humans again - we have been able to demonstrate that epigenetic modifications are apparently responsible for the fact that children of mothers who had a high exposure to phthalates during pregnancy and breastfeeding have an increased risk of developing allergic asthma," says Polte. "The objective of our further research will be to understand exactly how specific phthalates give rise to the methylation of genes which are relevant for the development of allergies." Susanne Jahreis, Saskia Trump, Mario Bauer, Tobias Bauer, Loreen Thu?rmann, Ralph Feltens, Qi Wang, Lei Gu, Konrad Gru?tzmann, Stefan Röder, Marco Averbeck, Dieter Weichenhan, Christoph Plass, Ulrich Sack, Michael Borte, Virginie Dubourg, Gerrit, Schu?u?rmann, Jan C. Simon, Martin von Bergen, Jörg Hackermu?ller, Roland Eils, Irina Lehmann, Tobias Polte (2017): Maternal phthalate exposure promotes allergic airway inflammation over two generations via epigenetic modifications, Journal of Allergy and Clinical Immunology; doi: 10.1016/j.jaci.2017.03.017; http://doi. PD Dr Tobias Polte Head of the Helmholtz University Research Group "Experimental Allergology and Immunology" Tel.: +49 341 235-1545 E-mail: tobias.polte@ufz.de https:/ Dr Irina Lehmann Head of the UFZ Department of Environmental Immunology Tel.: +49 341 235-1216 Email: irina.lehmann@ufz.de http://www.


News Article | February 3, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. We sought to identify candidate Group 3 and Group 4 super-enhancer constituents for validation by reporter assays. We identified candidate Group 3 and Group 4 super-enhancer constituents by first locating nucleosome free “valleys” in the H3K27ac data using an algorithm adapted from ref. 35. Valleys that showed strong evidence of TF ChIP-seq binding for respective Group 3 (HLX and LHX2) and Group 4 (LHX2 and LMX1A) TFs were selected and manually curated for validation in reporter assays. Based on restrictions for DNA synthesis and cloning, candidate reporter regions of roughly ±1 kb flanking the valley centre were used (Fig. 4 and Extended Data Fig. 5). All experiments involving zebrafish (Danio rerio, AB strain) were approved by the Vanderbilt Institutional Animal Care and Use Committee. For in vivo zebrafish reporter assays, a minimum, ~150–200 embryos (male and female) were injected per reporter construct and assays were repeated 2–3 times per construct to confirm reproducibility. No randomization of enhancer assays was performed. The scientist who performed the injections had no prior knowledge related to the enhancer constructs and was therefore blinded to the experiment. Microinjection was done as described previously36. In brief, a mixture of individual enhancer-containing vector DNA (25 μg ml−1) and transposase RNA (25 μg ml−1) was injected into zebrafish zygotes (1 nl per zygote). The injected embryos were cultured in 0.3× Danieau’s solution at 28.5 °C. After 24 hours, the embryos were examined for eGFP expression under a fluorescent dissecting microscope (Zeiss Discovery V12) to determine the stereotypic expression pattern conferred by the enhancer. The total number of embryos injected with the construct and the number of embryos with the stereotypical eGFP pattern were determined to calculate the frequency of the pattern. Embryos were dechorionated and imaged using a Zeiss AxioCam HRc digital camera. Spatial protein expression of medulloblastoma -specific transcription factors in e13.5 cerebella was determined by IHC. PFA-fixed frozen tissues were sectioned (12 μm thickness) and processed without antigen retrieval steps. The antibodies used here are Tbr2 (1:100, Abcam, ab23345), Lmx1a (1:100, Novus Biologicals, NBP1-81303), Atoh1 (1:500, Abcam, ab105497) and appropriate secondary antibodies conjugated with Alexa fluorophores (1:400, Invitrogen). The images were captured by an epifluorescence microscopy. Endogenous expression of candidate TFs was determined by querying the Allen Brain Atlas Data Portal (http://developingmouse.brain-map.org) at various developmental time points. The molecular subgroup of 49 medulloblastoma samples on tissue microarrays were determined as previously described37. Immunohistochemistry was performed using clone ALK01 (#790-2918, Ventana) with appropriate secondary reagents. Individual tumours were scored positive in the presence of cytoplasmic immunoreactivity for ALK1, whereas the tumour was considered negative in the absence of immunoreactivity. All mouse (Mus musculus, B6C3HFe background) experiments were done in accordance with the guidelines laid down by the Institutional Animal Care and Use Committee (IACUC), of Seattle Children’s Research Institute. No randomization or experimental blinding related to mouse experiments was performed. Lmx1a+/− mice were crossed and the day of plug was taken as e0.5. WT and Lmx1a−/− embryos (male and female) were dissected out between e12.5 and e17.5 and subsequently fixed in 4% paraformaldehyde (PFA) for 2–6 hours. The fixed embryos were washed in PBS and incubated in 30% sucrose overnight. The following day, embryos were frozen in optimum cutting temperature (OCT) compound. Mid-sagittal cryo-sections of the cerebellum at 11 μm were taken. Haematoxylin and eosin staining and immunohistochemistry were performed as described previously38. Briefly, cryosections were incubated at room temperature for 1 hour after which they were subjected to heat-mediated antigen retrieval. All sections were blocked using 5% serum containing 0.35% Triton X, and then incubated with the primary antibody (Eomes (Tbr2); #14-4875, ebioscience, mouse, 1:200), overnight. The following day fluorescent-dye-labelled secondary antibodies (Alexa Fluor 488, 1:1000, Molecular Probes) were used. Sections were counter stained using DAPI (4′,6-diamidino-2-phenylindole) (Vector Laboratories). All images were captured at room temperature. Haematoxylin and eosin-stained sections were imaged a using Hamamatsu Nanozoomer whole slide scanner. All confocal images were captured using Zeiss LSM Meta and Zen 2009 software. An Institutional Review Board ethical vote (Ethics Committee of the Medical Faculty of Heidelberg) was obtained according to ICGC guidelines (http://www.icgc.org), along with informed consent for all participants. No patient underwent chemotherapy or radiotherapy before surgical removal of the primary tumour. Tumour tissues were subjected to neuropathological review for confirmation of histology and for tumour cell content >80%. The ChIP-seq cohort was established based on tissue availability and availability of orthogonal data types (for example, WGS, RNA-seq) and patient metadata (for example, molecular subgroup). Subgroup assignments were made using the Illumina 450K DNA methylation array as described39. Medulloblastoma cell lines were cultured at 37 °C with 5% CO . D425_Med (D425; a gift from D. D. Bigner) and MED8A cells (from the authors’ own stocks; T. Pietsch) were cultured in DMEM with 10% FCS (Life Technologies). HD-MB03 cells20 were grown in RPMI-1640 with 10% FCS (Life Technologies). All cells were regularly authenticated and tested for mycoplasma (Multiplexion, Heidelberg, Germany). H3K27ac, BRD4, H3K27me3, H3K4me1, LMX1A, LHX2, and HLX ChIP was performed at ActiveMotif (Carlsbad, CA) using antibodies against H3K27ac (AM#39133, Active Motif), BRD4 (#A301-985A, Bethyl Laboratories), H3K27me3 (#07-449, Millipore), H3K4me1 (AM#39298, ActiveMotif), LMX1A (#AB10533, Millipore), LHX2 (#sc-19344, Santa Cruz), and HLX (#HPA005968, Sigma). Fresh-frozen medulloblastoma tissues (or cell lines) were submersed in PBS + 1% formaldehyde, cut into small pieces and incubated at room temperature for 15 min. Fixation was stopped by the addition of 0.125 M glycine (final concentration). The tissue pieces were then treated with a TissueTearer and finally spun down and washed 2× in PBS. Chromatin was isolated by the addition of lysis buffer, followed by disruption with a Dounce homogenizer. Lysates were sonicated and the DNA sheared to an average length of ~300–500 bp. Genomic DNA (input) was prepared by treating aliquots of chromatin with RNase, proteinase K and heat for de-crosslinking, followed by ethanol precipitation. Pellets were resuspended and the resulting DNA was quantified on a NanoDrop spectrophotometer. Extrapolation to the original chromatin volume allowed quantitation of the total chromatin yield. An aliquot of chromatin (30 μg) was precleared with protein A (G – for goat pc or monoclonal antibodies) agarose beads (Invitrogen). Genomic DNA regions of interest were isolated using 4 μg of antibody. ChIP complexes were washed, eluted from the beads with SDS buffer, and subjected to RNase and proteinase K treatment. Crosslinks were reversed by incubation overnight at 65 °C, and ChIP DNA was purified by phenol-chloroform extraction and ethanol precipitation. Quantitative PCR (qPCR) reactions were carried out in triplicate on specific genomic regions using SYBR Green Supermix (Bio-Rad). The resulting signals were normalized for primer efficiency by carrying out qPCR for each primer pair using Input DNA. Illumina sequencing libraries were prepared from the ChIP and Input DNAs by the standard consecutive enzymatic steps of end-polishing, dA-addition, and adaptor ligation. After a final PCR amplification step, the resulting DNA libraries were quantified and sequenced on the Illumina HiSeq 2000 platform using 2 × 101 cycles according to the manufacturer’s instructions. Alignment, and downstream processing of ChIP-seq data was performed as described6. RNA was extracted from fresh frozen tissue samples using the AllPrep DNA/RNA/Protein Mini kit (Qiagen) including DNase I treatment on column. All samples were subjected to quality control on a Bioanalyzer instrument. RNA sequencing libraries were prepared from 10 μg of total RNA. Strand-specific RNA sequencing was performed following a protocol described previously40, 41. Sequencing was carried out with 2×51 cycles on a HiSeq 2000 instrument (Illumina). All reads were aligned to the human reference genome (1000 genomes version of human reference genome hg19/GRCh37) using BWA (v 0.5.9-r16). Aligned reads were converted to the SAM/BAM format using SAMtools. Gene annotation was based on Ensembl v70 (Homo sapiens). 4C samples were prepared from Group 3 medulloblastoma cell line HD-MB03 using the method as described19, 42. DpnII was used as the primary restriction enzyme and Csp6I as the secondary restriction enzyme in template generation. Sample libraries for SMAD9 and TGFBR1 were amplified using the primers, SMAD9_F: TTATCCAGGCAAGGAAGATC, SMAD9_R: ATTACCTCATCTGCAAAACC, TGFBR1_F: CATTCTTTCTCCCCATGATC, and TGFBR1_R: ACACAATCTTGGGTGTTTTT, respectively. Amplified libraries were multiplexed, spiked with 40% PhiX viral genome and sequenced on Hiseq 2000. Reads were mapped to human genome (hg19) using Bowtie (v 1.0.0)43. Forward and reverse RNA transcription based on directional RNA sequencing data was quantified in 3 kb windows upstream and downstream of enhancer peaks that were based on H3K27ac ChIP-seq data, resulting in four RNA expression values for each enhancer region: (L_fwd) forward transcription left of enhancer peak, (R_fwd) forward transcription right of enhancer peak, (L_rev) reverse transcription left of enhancer peak, and (R_rev) reverse transcription right of enhancer peak. We calculated the “directionality index” D, a measure of the directionality of transcription inside an enhancer region, with D ranging from 0 to 1, by D = |R_fwd – L_rev|/(R_fwd + L_rev) as described before14, with low D values representing bidirectional eRNA transcription. For correlation of eRNA transcription values with corresponding gene expression values, we calculated eRNA transcription values in 3 kb windows upstream and downstream of enhancer peaks by eRNA_transcription = (R_fwd + L_rev)/2. All coordinates in this study were based on human reference genome assembly hg19, GRCh37 (http://www.ncbi.nlm.nih.gov/assembly/2758/). Gene annotations were based on gencode annotation release 19 (http://www.gencodegenes.org/releases/19.html). We calculated the normalized read density of a ChIP-seq data set in any genomic region using the Bamliquidator (version 1.0) read density calculator (https://github.com/BradnerLab/pipeline/wiki/bamliquidator). Briefly, ChIP-seq reads aligning to the region were extended by 200 bp and the density of reads per base pair (bp) was calculated. The density of reads in each region was normalized to the total number of million mapped reads producing read density in units of reads per million mapped reads per bp (rpm per bp). To compactly display medulloblastoma H3K27ac ChIP-seq signal at individual genomic loci and across subgroups, we developed a simple meta representation (Fig. 1d and others). For all samples within a group, ChIP-seq signal is smoothed using a simple spline function and plotted as a translucent shape in units of rpm per bp. Darker regions indicate regions with signal in more samples. An opaque line is plotted and gives the average signal across all samples in a group. H3K27ac peak finding was performed using MACS12 with a P-value threshold of 1 × 10−9, and with other settings as default parameters. Peak finding for each medulloblastoma was performed separately and as a control background for each H3K27ac ChIP-seq sample, its matched genomic DNA was used. The SPOT statistic44, a measure of read fraction found in enriched regions developed by the ENCODE consortium, was used to quantify H3K27ac enrichment quality. Primary medulloblastoma data sets had a median SPOT score of 0.62 which was equivalent to cell line data and on par with primary human data generated in the Epigenome ROADMAP. Afterwards, H3K27ac peaks were merged into a single coordinate file. Peaks which can not be identified in at least two primary medulloblastomas and contained completely within the region surrounding ±1 kb TSS were excluded from any further analysis. This resulted in final combined and filtered peak set (n = 78516). H3K27ac enrichments were calculated on the final peak set using the following formula: log2(((Cnt /LSize *min(LSize , LSize ))+pscnt)/ ((Cnt /LSize *min(LSize , LSize ))+pscnt)), where Cnt denotes the total number of reads mapping to the enhancer coordinate in ChIP sample, LSize is the total library size for the ChIP sample, Cnt is the total number of reads mapping to the enhancer coordinate in the control genomic DNA, LSize is the total library size for the control sample, and pscnt is a constant number (pscnt = 8), which was used to stabilize enrichments based on low read counts. (Peaks showing statistically significant differential H3K27ac enrichment across medulloblastoma subgroups were determined using ANOVA and the ones with FDR < 0.01 were preserved after multiple testing correction. From the resulting peak-set, peaks having 1.5 (log ) fold change difference across any medulloblastoma subgroup comparison were called as “subgroup specific” enhancers (n = 20,406). Peaks that do not fulfil these criteria were referred as “common” enhancers (n = 58,110). Subgroup-specific enhancers were further clustered using k means, with k = 6 into 6 groups as “SHH”, “WNT”, “Group4”, “WNT-SHH”, “Group3-Group4”, and “Group3” (Fig. 2). Genome was classified into regions as exon, intron, intergenic and promoter (region surrounding ± 1 kb transcriptional start sites) by following the hierarchy promoter > exon > intron > intergenic. Then, medulloblastoma enhancers were intersected with these defined elements and fraction covered by each element was calculated. To better understand whether our enhancer profiling adequately captured the primary medulloblastoma enhancer landscape, we performed a saturation analysis. We measured the total number of discreet regions and the fraction of novel regions gained by increasing sample number. This was performed across 1,000 permutations of the 28 medulloblastoma samples to establish 95% confidence intervals (Extended Data Fig. 1d). Enrichment values for H3K27ac at enhancers were calculated as the ratio between library size normalized read counts for H3K27ac ChIP and its sample matched genomic DNA control. The formula used for the enrichment calculation is as follows: log2(((Cnt /LSize *min(LSize , LSize ))+pscnt)/ ((Cnt /LSize *min(LSize , LSize ))+pscnt)), where Cnt denotes the total number of reads mapping to the enhancer coordinate in ChIP sample, LSize is the total library size for the ChIP sample, Cnt is the total number of reads mapping to the enhancer coordinate in the control genomic DNA, LSize is the total library size for the control sample, and pscnt is a constant number (pscnt = 8), which was used to stabilize enrichments based on low read counts. To compare BRD4 enrichment with H3K27ac enrichment at the enhancers, BRD4 enrichments were calculated in the same way as H3K27ac enrichments. DNA methylation values at enhancers were determined by calculating the average DNA methylation of all medulloblastoma samples where DNA methylation data are available6. We generated ChIP-seq data for H3K4me1 and H3K27me3 for only three Group 3 medulloblastomas (MB-1M21,MB-4M23, and MB-4M26).Therefore, comparison of H3K27ac occupancy with H3K4me1, H3K27me3 and BRD4 (Extended Data Fig. 1f) was done using the data from only these three Group 3 samples. To analyse the occupancy of the marks at H3K27me3 enriched regions, we called H3K27me3 peaks using MACS. ChIP-seq reads covering each base pair either in the region ± 5 kb around Group 3-specific enhancer midpoints (Extended Data Fig. 1f top panel) or in the region ± 5 kb around H3K27me3 peak midpoints (Extended Data Fig. 1f bottom panel) were quantified. Read coverage was averaged in 100-bp windows along the regions and the values were scaled to arrange between 0–1. Resulting values were represented as heat maps. We repeated H3K27ac peak finding (running MACS with a P-value threshold of 1 × 10−9, and with other settings as default parameters) for the two medulloblastomas (MB12 and MB200) using their input chromatin as the backgrounds instead of using their matched whole genome sequencing. Resulting set of peaks identified using whole chromatin extract were compared to the ones identified using whole genome sequencing in scatter plots in Extended Data Fig. 1c. ENCODE8 H3K27ac peaks were downloaded from http://ftp.ebi.ac.uk/pub/databases/ensembl/encode/integration_data_jan2011/byDataType/peaks/jan2011/histone_macs/optimal/hub/ and all peaks were merged into a single coordinate file. Regarding ROADMAP data45, 46, all available H3K27ac alignment files were downloaded and peak finding on individual samples was performed using MACS12. All ROADMAP H3K27ac peaks were as well merged into a single coordinate file. Resulting peaks from both ENCODE and ROADMAP were intersected with medulloblastoma H3K27ac peaks (with a minimum 50% overlap criteria; Fig. 1e, f). To determine the overlap of enhancer loci with CNVs, medulloblastoma enhancer loci were intersected with focal amplifications and deletions obtained from4. To determine the statistical significance of the overlap, we performed 10,000 random simulations whereby CNV locations were randomly permuted across the genome without overlap using the bedtools shuffle utility (http://bedtools.readthedocs.org) and excluding regions found in the ENCODE8 blacklist (https://sites.google.com/site/anshulkundaje/projects/blacklists). This distribution of random overlaps was used to calculate an empirical P-value of the observed overlap significance (Extended Data Fig. 1g). Expression values in RPKM were calculated using “qCount” function of Bioconductor package “quasR” (http://www.bioconductor.org/packages/release/bioc/html/QuasR.html). Genes showing differential gene expression across four medulloblastoma subgroups were determined using ANOVA (FDR less than 1%). Then, subgroup specific assignment of gene expression was done by performing a post-hoc test (using “glht” function of R package “multicomp”56. Target gene identification of enhancers was performed as described47. For each enhancer, topology-associated domain (TAD)18 which it belongs to was identified. Then, genes with transcriptional start sites falling into the same TAD were determined. We filtered nearby genes for protein coding status, as eRNAs and other enhancer associated ncRNAs are likely to emanate from enhancers and obfuscate distal target genes. Correlation tests (Spearman’s rank correlation coefficient) for H3K27ac enrichment of the enhancer and expression level of genes which are in the same TAD were performed. After repeating this procedure for each enhancer, all P-values obtained via correlation tests were combined and corrected for multiple testing globally using Bioconductor package “qvalue” (http://www.bioconductor.org/packages/release/bioc/html/qvalue.html). Correlations with a FDR less than 5% were preserved. For each enhancer, gene whose expression best correlates with the H3K27ac enrichment of the enhancer was selected as the potential target gene. For the cases where the difference between spearman correlation coefficients for the best and second best correlating genes were less than 0.1, the second best correlating gene was also selected as another potential target gene. Identification of enhancer target genes was performed for subgroup specific and common enhancers separately. After getting final gene lists for targets of subgroup specific and common enhancers, genes which are identified as targets both for subgroup specific and common enhancers were removed from common enhancer target gene list. Genes regulated by differential enhancers were classified into categories depending on the number of differential enhancers they are targeted by (Fig. 2d). As mentioned in “identification of enhancer targets” part, to assign the enhancers to their targets with highest probability, in the final list of enhancer target genes, number of genes per enhancer was restricted to 2 genes having the highest correlation coefficient. However, to evaluate the number of genes targeted by each enhancer overall, enhancers were classified into categories depending on the number of genes they target by including all the genes targeted by enhancers (satisfying FDR < 0.05 criteria) (Fig. 2e). Medulloblastoma signature genes were defined to be the genes regulated differentially in 4 medulloblastoma subgroups16. To be conservative on the signature genes, for each medulloblastoma subgroup, top 100 genes differentially regulated in the respective subgroups were included in the analysis. Resulting gene list were compared to the genes regulated by medulloblastoma subgroup specific enhancers and super-enhancers. Comparison to cancer genes was performed using the gene list provide in cancer gene census (http://cancer.sanger.ac.uk/cancergenome/projects/census). Target genes were overlapped with consensus TFs provided48. Inference whether the target genes we identified was druggable was done by intersecting target genes with the genes provided in the drug gene interaction database (http://dgidb.genome.wustl.edu/) by using “Expert curated” option in the source trust level category of the interactions. All information showing the overlap of target genes with gene lists from literature can be found in Supplementary Table 3. Functional characterization of enhancer/gene assignments was conducted using the ClueGO plugin for cytoscape49. Subgroup-specific enhancer gene targets or SE-regulated TFs were queried against a compendium of gene sets from GO (Biological Process), KEGG, and REACTOME to identify processes/pathways that were significantly enriched in tested gene lists from our data set. Analyses were performed using the GO Term Fusion option in ClueGO and only processes/pathways with a P-value < 0.05 (right-sided hypergeometric test) following P-value correction (Bonferroni step down) were visualized. Manual trimming of ClueGO output was performed to remove processes/pathways affiliated with only a single gene set. To identify subgroup specific enhancers and their associated functional pathways, we performed a differential enhancer analysis50 on Group 3 and Group 4 enhancers. We first took the union of the top 1,000 enhancer in Group 3 and Group 4 as defined by total H3K27ac signal (area under the curve). We next ranked all enhancer regions by the log fold change in H3K27ac (Extended Data Fig. 3b). Differential enhancer target genes as previously defined were depicted under associated enhancers. Visual inspection revealed a number of TGF-β pathway components associated with Group 3 specific enhancers. We visualized this by identifying all enhancer regulated TGF-β pathway components (obtained from KEGG, REACTOME, and GO Biological Process databases) and depicting their specific regulation by Group 3, Group 4, or Group 3-4 differential enhancers (Extended Data Fig. 3c). We identified a focal amplification of the TGF-β pathway receptor gene ACVR2A in the Group 3 medulloblastoma sample MB-4M23. Whole genome sequencing log read depth ratio is plotted in Extended Data Fig. 3d. We hypothesized that in MB-4M23, amplification of ACVR2A leads to increased TGF-β pathway activity, including the increased H3K27ac at enhancers regulating TGF-β pathway components. We identified all Group 3 enhancers regulating TGF-β pathway components and compared the median enhancer normalized H3K27ac signal in MB-4M23 vs all other Group 3 medulloblastomas. Extended Data Fig. 3e shows all enhancers ranked by their log fold change in H3K27ac for MB-4M23 vs other Group 3 samples. The standard error of the mean was calculated for the fold change and is displayed as error bars in Extended Data Fig. 3e. H3K27ac data for the samples within the same subgroup was combined. Nucleosome free regions per subgroup were identified by feeding these combine data sets to HOMER software (http://homer.salk.edu/homer/ngs/index.html) using “findPeaks” function with the option “-nfr”. TF binding sites obtained from TRANSFAC51 and detected at NFRs using FIMO52 were overlapped with NFRs located within each class of differentially regulated enhancers. For each TF, contingency tables showing the number of NFRs overlapping and non-overlapping with the respective TF were constructed. Significance of enrichment of TFs in NFRs of differentially regulated enhancers was determined using Chi-squared test. Resulting P-values were corrected for multiple testing (FDR < 0.01). TF enrichments were calculated as the ratio between observed counts over expected counts. To represent TF enrichments as a heat map (Extended Data Fig. 6b), for each class of enhancers, 4–5 TFs showing the highest enrichments were selected. For each of differentially regulated enhancers in the classes of WNT, SHH, Group 3 and Group 4, NFRs belonging to each subgroup were overlapped with the respective subgroup-specific enhancers targeting at least one gene. Overlapping NFRs were intersected with TF binding sites having top 20th percentile enrichment scores in the respective subgroup-specific enhancers and differentially expressed in the same subgroup. For each TF, NFRs having the top 10th percentile number of binding sites were identified as sites occupied by the respective TF. Then, resulting NFRs were linked back to enhancers they are located, which enabled the linking of TFs having binding sites in the respective enhancers with the target genes of the enhancers. TF regulatory networks for each subgroup (Extended Data Fig. 7), where TFs represented as “sources” and enhancer target genes represented as “targets” were constructed using visualization platform Gephi (http://gephi.github.io/). To connect LMX1A, LHX2 and EOMES with their targets (Extended Data Fig. 9b), same strategy was applied by restricting the initial set of TFs to only those three. Aligned 4C data was further processed, filtered and visualized using Bioconductor package “Basic4Cseq”53. H3K27ac super-enhancers (SEs) and typical enhancers (TEs) in individual medulloblastoma samples were mapped using the ROSE2 software package described13, 23 and available at https://github.com/BradnerLab/pipeline. A 12.5 kb stitching window was used to connect proximal clusters of H3K27ac peaks into contiguous enhancer regions. These mappings identified on average ~600 SEs per sample. Relationships between SE landscapes between samples were determined as in ref. 11. First, we defined the union of all regions considered to be an SE in any individual primary sample and in three Group 3 cell lines. Next H3K27ac signal was calculated at each region and median normalized for each sample. Samples were hierarchically clustered based on similarity of patterns of median normalized H3K27ac enhancer signal as determined using pairwise Pearson correlations. In order to map and quantify enhancer regions for each medulloblastoma subgroup, we first mapped all enhancers in each individual sample within the group. Across a group, we used the union of all enhancer regions within group samples as the landscape of enhancers. Within this landscape, enhancers were ranked by average H3K27ac signal (area under curve) and classified as SEs or TEs as previously described. This produced SE and TE meta enhancer landscapes for WNT, SHH, Group 3, and Group 4 medulloblastoma with between 558 and 1,110 SEs called per group (Fig. 3a). Locations for all SEs and TEs in each subgroup are provided in Supplementary Table 4. To compare the dynamic range of SEs and TEs defined in each medulloblastoma subgroup, we quantified H3K27ac signal variance across samples. For SE and TE enhancer constituents (individual peaks of H3K27ac enrichment within broader enhancer domains) defined in each group, H3K27ac signal variance across samples as a fraction of the mean sample was calculated. The average H3K27ac signal variance across all SEs or TEs within a group is plotted in Extended Data Fig. 4f. We sought to examine trends in H3K27ac signal across medulloblastoma samples at regions defined as SEs or TEs in each group. First we mapped H3K27ac across all samples to enhancer constituents defined in each group. For each medulloblastoma sample, the average median normalized H3K27ac signal was plotted for SE and TE constituents respectively. For SEs and TEs defined in each group, the average sample H3K27ac signal is plotted with the mean and standard deviation shown as lines. This visualization enables a rapid assessment of H3K27ac variance within a group and of trends in H3K27ac signal for SEs and TEs defined in each group (Extended Data Fig. 4h). For instance, enhancer constituents in Group 3 SEs tend to have high signal in Group 4. SEs have been shown to have higher H3K27ac and BRD4 signal density at constituents when compared to typical enhancers13, 23. To determine if these trends were observed at medulloblastoma enhancers, we calculated H3K27ac and BRD4 ChIP-seq signal density across all samples at all regions defined as enhancers across groups (meta enhancers). In order to properly compare ChIP-seq signal density between SEs and TEs, for each enhancer constituent, we first determined if it was considered part of an SE in one or more groups, and if so, these groups defined the “active group context” for that particular enhancer constituent. Groups in which the enhancer constituent showed no evidence of enhancer activity (SE or TE) were considered the inactive group context. For enhancer constituents considered only part of a TE in one or more groups, groups in which the enhancer constituent was classified as a TE were considered the active group context and all other groups were considered the inactive group context. For each SE or TE constituent, average H3K27ac or BRD4 signal density was calculated at all samples in the active group context or in the inactive group context. The distributions of H3K27ac or BRD4 signal for enhancer constituents classified by SE or TE status were plotted and the statistical significance of the difference in the mean was tested in the active or inactive group context using a Welch’s two-tailed t-test (Extended Data Fig. 4g). We developed a method to identify SEs that were conserved across all medulloblastoma subgroups as well as SEs that showed highly group specific patterns of enhancer activity. We first took as the SE landscape all regions identified as SEs in the meta subgroup enhancer mapping. To account for sample-to-sample variability in H3K27ac ChIP-seq dynamic range, H3K27ac signal at enhancers in each medulloblastoma sample was rank transformed (Fig. 3b). As each medulloblastoma sample contained on average ~600 SEs, enhancer regions with an average rank of 600 or better in each subgroup were considered conserved. To identify enhancers with group specific patterns of activity, we calculated a “group rank Z-score” that compared average signal in one group to average signal in other groups. Here we considered whether enhancers might show group specific patterns for WNT, SHH, Group 3, Group 4, and as well for groupings of WNT/SHH, and Group 3/4. For each enhancer, this group rank Z-score was calculated for each group vs other combination. Enhancers with a group rank Z-score >1 (that is, those whose mean rank within a group was >1 standard deviation above the mean rank of all other samples) were considered group specific. To account for variability in enhancer ranks, only enhancers with a statistically significant difference in ranks (within group vs all other samples, Welch’s two-tailed t test, P-value <0.01) were considered. Supplementary Table 4 contains all SE regions identified in medulloblastoma subgroups and their corresponding max group rank Z-score, P-value, and classification. To provide a developmental context for medulloblastoma MYC SEs, we mapped H3K27ac enrichment at the MYC locus. H3K27ac data was obtained from the Epigenome ROADMAP as in Fig. 1e. The 500 kb region flanking the MYC SE No. 2 was divided into 5 kb bins and each bin was tested for overlap with a H3K27ac peak in each ROADMAP sample. ROADMAP samples were hierarchically clustered by similarity of H3K27ac peak pattern at the MYC locus (Extended Data Fig. 5m). Overlap with MYC SE No. 2 was found in 4/77 ROADMAP samples. Medulloblastoma core regulatory circuitry analysis was performed using the COLTRON (https://pypi.python.org/pypi/coltron) that calculated inward and outward degree regulation of SE-regulated TFs. To quantify the interaction network of TF regulation, we calculated the IN and OUT degree of all SE associated TFs. The 92 SE associated TFs were those defined as either proximal to an SE (within 50 kb) or the target of a differential SE enhancer element. For any given TF (TF ), the IN degree was defined as the number of TFs with an enriched binding motif at the proximal SE of TF (Fig. 5a). The OUT degree was defined as the number of TF associated SEs containing an enriched binding site for TF . Within any given SE, enriched TF binding sites were determined at putative nucleosome free regions (valleys) flanked by high levels of H3K27ac. Valleys were calculated using an algorithm adapted from ref. 35. In these regions, we searched for enriched TF binding sites using the FIMO52 algorithm with TF position weight matrices defined in the TRANSFAC database51. An FDR cutoff of 0.01 was used to identify enriched TF binding sites. Using this approach, we calculated IN and OUT degree for all SE associated TFs within the meta H3K27ac landscape (average of all samples) of each medulloblastoma subgroup. This approach resulted in an IN and OUT degree estimate for each SE associated TF in each medulloblastoma subgroup (Extended Data Fig. 8a–d). We sought to identify TF binding motifs for each TF in each subgroup. For each TF, we defined binding regions as the ±1,000 bp flanking the enriched region summit (as defined using MACS 1.4.2 with a P-value cutoff of 1 × 10−9). We took the union of all regions bound in a given subgroup (for example, HLX bound regions in Group 3 samples) that overlapped an enhancer in that subgroup and did not overlap any ENCODE8 blacklist regions. We next took the top 10,000 discreet regions as ranked by average TF ChIP-seq signal and used the ±100 bp region flanking the region centre as the input for de novo motif finding. De novo motif finding was performed using the MEME54 suite using a 1st order background model and searching for motifs between 6 and 30 bp in length. The top motif for each TF is displayed as a position weight matrix in Extended Data Fig. 8i–l. To visualize SE associated TF interactions in each subgroup, we ranked all SE associated TF by TOTAL degree (IN + OUT). We visualized the top 50% of SE associated TFs in each subgroup as a network diagram with each node representing a SE associated TF, and with nodes coloured and ordered by increasing TOTAL degree (Extended Data Fig. 8e–h). Interactions between SE associated TF nodes were defined as a TF motif identified in the SE of a TF and are depicted as edges. For Group 3 and Group 4, edges validated by the presence of a TF ChIP-seq peak are coloured. To identify SE associated TFs with similar regulatory patterns likely to influence subgroup identity, we first normalized the TOTAL degree for each SE associated TF in each subgroup from 0 to 1. We then calculated the normalized TOTAL degree for each SE associated TF in each subgroup. We filtered out all TFs with a max TOTAL degree across medulloblastomas of less than 0.7. We next clustered all remaining TFs by their TOTAL degree pattern. Hierarchical clustering was performed using a Euclidian distance metric and the resulting clustergram tree was cut at a distance of 0.5 to produce 26 individual clusters. Of these 26 clusters, 12 showed a median TOTAL degree >0.7 in 1, 2, or all 4 subgroups. Clusters with >0.7 TOTAL degree in 3 subgroups were omitted for simplicity. TOTAL degree patterns of TFs in these 12 clusters are shown in Extended Data Fig. 9a. This filtering produced a list of 102 SE associated TFs, of which 71 had predicted interactions with one another. These 71 TFs fall into either conserved, subgroup specific, or dual subgroup clusters and together they comprise the inferred core regulatory circuitry of medulloblastoma subgroups. As in Extended Data Fig. 8e–h, regulatory interactions between these core regulatory circuitry TFs are depicted in Extended Data Fig. 9a with Group 3 and Group 4 validated edges coloured. A subset of this larger network containing the TFs HLX, LHX2, EOMES, and LMX1A is depicted in Fig. 5c with ChIP-seq validated edges drawn as solid lines and motif prediction edges drawn in dotted lines. We used the STRING interaction database55 to quantify protein–protein interaction frequencies of SE associated TFs with similar regulatory patterns. TF pairs were considered co-regulatory if they shared 50% of the same OUT degree edges. Interaction frequencies for co-regulatory pairs were compared to those from 10,000 randomly assigned pairs of TFs expressed in that subgroup (Extended Data Fig. 8o). To determine the fraction of motif predicted edges with evidence of actual TF ChIP-seq binding, we first took all predicted edges for HLX, LHX2, and LMX1A interacting SE associated with other TFs in Group 3 and Group 4. We validated all edges that contained a ChIP-seq peak within the same enhancer as the predicted TF motif. The fraction of validated edges for each TF in each subgroup is shown in Extended Data Fig. 8g, h, m. To determine how Group 3 and Group 4 TF ChIP-seq levels varied at Group 3 and Group 4 specific enhancers, we quantified TF ChIP-seq signal at Group 3 and Group 4 enhancers. We first took the union of the top 1,000 enhancer regions as defined by H3K27ac signal in Group 3 and Group 4 (as in Extended Data Fig. 3b). We identified as Group 3 and Group 4 specific enhancer regions with a >1.0 log absolute fold change between Group 3 and Group 4. We identified as conserved enhancer regions with a <0.05 log absolute fold change between Group 3 and Group 4. We next identified all enhancer regions bound by LHX2 and HLX in Group 3 (G3 HLX and LHX2) or by LHX2 and LMX1A in Group 4 (G4 LMX1A and LHX2). TF ChIP-seq occupancy in units of average area under the curve (AUC) were quantified at TF bound regions overlapping Group 3 specific, Group 4 specific, and conserved enhancer region (Extended Data Fig. 8n). Statistical differences in the means of the distributions of TF ChIP-seq signal at different enhancer populations was determined using a Welch’s two tailed t-test (Extended Data Fig. 8n). To identify genes transcriptionally regulated by Lmx1a in the developing cerebellum, we isolated cerebellar uRL from WT and Lmx1a−/− embryos by laser capture microdissection. uRL was isolated from WT (n = 3) and Lmx1a−/− (n = 3) embryos (~3,000 cells per embryo) at e13.5, just before abnormal RL regression in Lmx1a−/− embryos. RNA was extracted using PicoPure RNA Isolation Kit (Arcturus) and hybridized to Illumina MouseRef8 v2 Expression BeadChips at the Johns Hopkins Array Core Facility. Next we identified all human TF genes with unambiguous mouse homologues that were detectably expressed in the WT mouse cerebellum (cut off of 100 arbitrary units). We subsequently quantified median normalized expression in WT or Lmx1a−/− samples and calculated the log fold-change for all TFs. We ranked the expression fold-change of all SE-associated TFs in medulloblastoma and plotted their log fold change in Lmx1a−/− vs WT (Fig. 6d). SE-associated TFs present in the Group 4 TF network (Extended Data Fig. 8h) were coloured in green.

Loading Medical Faculty collaborators
Loading Medical Faculty collaborators