Hamilton, Canada
Hamilton, Canada

McMaster University is a public research university located in Hamilton, Ontario, Canada. The main campus is located on 121 hectares of land in the residential neighbourhood of Westdale, adjacent to Hamilton's Royal Botanical Gardens. The university operates six academic faculties: the DeGroote School of Business, Engineering, Health science, Humanities, Social Science, and Science. It is a member of the U15, a group of research-intensive universities in Canada.The university bears the name of Honourable William McMaster, a prominent Canadian Senator and banker who bequeathed C$900,000 to the founding of the university. McMaster University was incorporated under the terms of an act of the Legislative Assembly of Ontario in 1887, merging the Toronto Baptist College with Woodstock College. It opened in Toronto in 1890. Inadequate facilities and the gift of land in Hamilton prompted the institution to relocate in 1930. McMaster was controlled by the Baptist Convention of Ontario and Quebec until it became a privately chartered, publicly funded non-denominational institution in 1957.The university is co-educational, and has over 24,500 undergraduate and nearly 4,000 post-graduate students. Alumni and former students of the university can be found all across Canada and in 140 countries around the world. Notable alumni include government officials, academics, business leaders and two Nobel laureates. The university ranked 4th among Canadian universities and 92nd in the world according to the 2013-2014 Times Higher Education World University Rankings, 4th among Canadian universities and 90th in the world according to the 2014 Academic Ranking of World Universities, and 6th among Canadian universities and 113th in the world according to the 2014 QS World University Rankings. In addition, the McMaster University Medical School was ranked 1st in Canada and 14th in the world for clinical medicine by Times Higher Education in 2013. The McMaster athletic teams are known as the Marauders, and are members of the Canadian Interuniversity Sport. Wikipedia.


Time filter

Source Type

Patent
McMaster University | Date: 2016-11-04

Described are methods and compositions for treating cancer that include a dopamine receptor (DR) antagonist such as thioridazine and a chemotherapeutic agent. Optionally, the chemotherapeutic agent is a DNA synthesis inhibitor such as cytarabine or a microtubule inhibitor such as paclitaxel or docetaxel. The methods and compositions are useful for the treatment of cancers such as acute myeloid leukemia.


Patent
McMaster University | Date: 2015-04-07

A display illumination module for the illumination of a rear-projection screen is provided in which a first array of light sources is positioned adjacent to a first face of an optical modulating array layer for modulating the transmission of light emitted by the first array light sources. The first array light sources emit light within a defined angular range, and the optical modulating array layer is positioned relative to the first array of light sources so that light from adjacent light sources does not overlap at the optical modulating array layer. A second array of light sources is positioned adjacent to a second side of the optical modulation array layer and is arranged such that light from the second array of light sources does not pass through said optical modulation array layer and said second array of light sources does not substantially block light from the first array of light sources passing through the optical modulating array layer. One or more display modules may be incorporated into a display system that includes a rear projection screen that is spatially offset from the optical modulating array layer so that light emitted from adjacent light sources in either the first or the second array of light sources overlaps on the screen.


Anglin R.E.S.,McMaster University | Samaan Z.,St Josephs Hospital | Walter S.D.,McMaster University | Sarah D. McDonald,McMaster University
British Journal of Psychiatry | Year: 2013

Background: There is conflicting evidence about the relationship between vitamin D deficiency and depression, and a systematic assessment of the literature has not been available. Aims: To determine the relationship, if any, between vitamin D deficiency and depression. Method: A systematic review and meta-analysis of observational studies and randomised controlled trials was conducted. Results: One case-control study, ten cross-sectional studies and three cohort studies with a total of 31424 participants were analysed. Lower vitamin D levels were found in people with depression compared with controls (SMD = 0.60, 95% CI 0.23-0.97) and there was an increased odds ratio of depression for the lowest v. highest vitamin D categories in the cross-sectional studies (OR = 1.31, 95% CI 1.0-1.71). The cohort studies showed a significantly increased hazard ratio of depression for the lowest v. highest vitamin D categories (HR = 2.21, 95% CI 1.40-3.49). Conclusions: Our analyses are consistent with the hypothesis that low vitamin D concentration is associated with depression, and highlight the need for randomised controlled trials of vitamin D for the prevention and treatment of depression to determine whether this association is causal. © The British Journal of Psychiatry 2013.


Johnson N.J.J.,University of Victoria | Korinek A.,McMaster University | Dong C.,University of Victoria | Van Veggel F.C.J.M.,University of Victoria
Journal of the American Chemical Society | Year: 2012

We demonstrate a novel epitaxial layer-by-layer growth on upconverting NaYF 4 nanocrystals (NCs) utilizing Ostwald ripening dynamics tunable both in thickness and composition. Injection of small sacrificial NCs (SNCs) as shell precursors into larger core NCs results in the rapid dissolution of the SNCs and their deposition onto the larger core NCs to yield core-shell structured NCs. Exploiting this NC size dependent dissolution/growth, the shell thickness can be controlled either by manipulating the number of SNCs injected or by successive injection of SNCs. In either of these approaches, the NCs self-focus from an initial bimodal distribution to a unimodal distribution (σ <5%) of core-shell NCs. The successive injection approach facilitates layer-by-layer epitaxial growth without the need for tedious multiple reactions for generating tunable shell thickness, and does not require any control over the injection rate of the SNCs, as is the case for shell growth by precursor injection. © 2012 American Chemical Society.


Hutchison B.,McMaster University | Glazier R.,Institute for Clinical Evaluative science
Health Affairs | Year: 2013

Primary care in Ontario, Canada, has undergone a series of reforms designed to improve access to care, patient and provider satisfaction, care quality, and health system efficiency and sustainability. We highlight key features of the reforms, which included patient enrollment with a primary care provider; funding for interprofessional primary care organizations; and physician reimbursement based on varying blends of fee-for-service, capitation, and pay-for-performance. With nearly 75 percent of Ontario's population now enrolled in these new models, total payments to primary care physicians increased by 32 percent between 2006 and 2010, and the proportion of Ontario primary care physicians who reported overall satisfaction with the practice of medicine rose from 76 percent in 2009 to 84 percent in 2012. However, primary care in Ontario also faces challenges. There is no meaningful performance measurement system that tracks the impact of these innovations, for example. A better system of risk adjustment is also needed in capitated plans so that groups have the incentive to take on high-need patients. Ongoing investment in these models is required despite fiscal constraints. We recommend a clearly articulated policy road map to continue the transformation. © 2013 Project HOPE-The People-to-People Health Foundation, Inc.


Agnelli G.,University of Perugia | Cohen A.,King's College | Curto M.,Pfizer | Gallus A.S.,Flinders University | And 4 more authors.
New England Journal of Medicine | Year: 2013

BACKGROUND: Apixaban, an oral factor Xa inhibitor that can be administered in a simple, fixed-dose regimen, may be an option for the extended treatment of venous thromboembolism. METHODS: In this randomized, double-blind study, we compared two doses of apixaban (2.5 mg and 5 mg, twice daily) with placebo in patients with venous thromboembolism who had completed 6 to 12 months of anticoagulation therapy and for whom there was clinical equipoise regarding the continuation or cessation of anticoagulation therapy. The study drugs were administered for 12 months. RESULTS: A total of 2486 patients underwent randomization, of whom 2482 were included in the intention-to-treat analyses. Symptomatic recurrent venous thromboembolism or death from venous thromboembolism occurred in 73 of the 829 patients (8.8%) who were receiving placebo, as compared with 14 of the 840 patients (1.7%) who were receiving 2.5 mg of apixaban (a difference of 7.2 percentage points; 95% confidence interval [CI], 5.0 to 9.3) and 14 of the 813 patients (1.7%) who were receiving 5 mg of apixaban (a difference of 7.0 percentage points; 95% CI, 4.9 to 9.1) (P<0.001 for both comparisons). The rates of major bleeding were 0.5% in the placebo group, 0.2% in the 2.5-mg apixaban group, and 0.1% in the 5-mg apixaban group. The rates of clinically relevant nonmajor bleeding were 2.3% in the placebo group, 3.0% in the 2.5-mg apixaban group, and 4.2% in the 5-mg apixaban group. The rate of death from any cause was 1.7% in the placebo group, as compared with 0.8% in the 2.5-mg apixaban group and 0.5% in the 5-mg apixaban group. CONCLUSIONS: Extended anticoagulation with apixaban at either a treatment dose (5 mg) or a thromboprophylactic dose (2.5 mg) reduced the risk of recurrent venous thromboembolism without increasing the rate of major bleeding. (Funded by Bristol-Myers Squibb and Pfizer; AMPLIFY-EXT ClinicalTrials.gov number, NCT00633893.) Copyright © 2012 Massachusetts Medical Society.


Hassini E.,McMaster University | Surti C.,University of Ontario Institute of Technology | Searcy C.,Ryerson University
International Journal of Production Economics | Year: 2012

We review the literature on sustainable supply chains during the last decade; 2000-2010. We analyze the literature from different perspectives. We then provide frameworks for sustainable supply chain management and performance measures. We also provide a case study to illustrate the experience of a utility supply chain in setting performance indicators. © 2012 Elsevier B.V. All rights reserved.


In the last 4 years, 6 phase 3 trials including a total of 27 023 patients with venous thromboembolism (VTE) compared a direct oral anticoagulant (DOAC) with vitamin K antagonists (VKAs). To aid the clinician in assessing the amount of information, we address frequently raised clinical questions in a review of combined trial results. We included the phase 3 trials that compared dabigatran etexilate, rivaroxaban, apixaban, or edoxaban with VKA therapy inpatients with acute symptomatic VTE. Recurrent VTE occurredin2.0% of DOAC recipients compared with 2.2% in VKA recipients (relative risk [RR] 0.90, 95% confidence interval [CI] 0.77-1.06). Treatment with a DOAC significantly reduced the risk of major bleeding (RR 0.61, 95% CI 0.45-0.83). In parallel, intracranial bleeding, fatal bleeding, and clinically relevant nonmajor bleeding occurred significantly less in DOAC recipients. The efficacy and safety of DOACs were consistent in patients with pulmonary embolism, deep venous thrombosis, a body weight ≥100kg, moderate renal in sufficiency, an age ≥75 years, and cancer. In conclusion, DOACs and VKAs have similar efficacy in the treatment of acute symptomatic VTE, a finding that is consistent in key clinical subgroups. Treatment with a DOAC significantly reduces the risks of major bleeding. © 2014 by The American Society of Hematology.


Zhang D.,Shijiazhuang University | Pelton R.,McMaster University
Langmuir | Year: 2012

Self-assembly from mixed dispersions of three sizes of monodisperse polystyrene nanoparticles, large (L), medium (M), and small (S), was controlled by coating each particle type with either a monofunctional or bifunctional polymer capable of participating in specific complexation reactions. The complexation reactions were (1) complexation between phenolic polymers and polyethylene glycol (PEG) containing polymers and (2) condensation of phenylboronic acid containing polymers with polyols. These complexation reactions function independently and can be "turned off" independently; phenylboronic acid complexation was reversed by lowering the pH, whereas the interactions of phenolic copolymers with PEG copolymers could be reversed by adding excess PEG homopolymer. The specificity and reversibility of the interactions was demonstrated by the formation of simple binary aggregates from mixtures. The bifunctional copolymers were poly(vinyl phenol-co- diallyldimethyl ammonium chloride), Ph-DADMAC, and poly(3-acrylamide phenylboronic acid-co-PEG methacrylate), PBA-PEG. The monofunctional polymer was polyvinylalcohol, PVA. Ph-DADMAC forms complexes with PBA-PEG (H-bonding) and with anionic surfaces or polymers (electrostatic/polyelectrolyte complexation). PBA-PEG complexes with Ph-DADMAC (H-bonding) and with PVA (boronate ester formation). PVA does not interact with Ph-DADMAC; therefore, PVA coated particles do not deposit onto Ph-DADMAC coated particles. © 2012 American Chemical Society.


Epstein J.I.,Johns Hopkins Medical Institutions | Egevad L.,Karolinska Institutet | Delahunt B.,University of Otago | Srigley J.R.,McMaster University | Humphrey P.A.,Yale University
American Journal of Surgical Pathology | Year: 2016

In November, 2014, 65 prostate cancer pathology experts, along with 17 clinicians including urologists, radiation oncologists, and medical oncologists from 19 different countries gathered in a consensus conference to update the grading of prostate cancer, last revised in 2005. The major conclusions were: (1) Cribriform glands should be assigned a Gleason pattern 4, regardless of morphology; (2) Glomeruloid glands should be assigned a Gleason pattern 4, regardless of morphology; (3) Grading of mucinous carcinoma of the prostate should be based on its underlying growth pattern rather than grading them all as pattern 4; and (4) Intraductal carcinoma of the prostate without invasive carcinoma should not be assigned a Gleason grade and a comment as to its invariable association with aggressive prostate cancer should be made. Regarding morphologies of Gleason patterns, there was clear consensus on: (1) Gleason pattern 4 includes cribriform, fused, and poorly formed glands; (2) The term hypernephromatoid cancer should not be used; (3) For a diagnosis of Gleason pattern 4, it needs to be seen at 10x lens magnification; (4) Occasional/seemingly poorly formed or fused glands between well-formed glands is insufficient for a diagnosis of pattern 4; (5) In cases with borderline morphology between Gleason pattern 3 and pattern 4 and crush artifacts, the lower grade should be favored; (6) Branched glands are allowed in Gleason pattern 3; (7) Small solid cylinders represent Gleason pattern 5; (8) Solid medium to large nests with rosette-like spaces should be considered to represent Gleason pattern 5; and (9) Presence of unequivocal comedonecrosis, even if focal is indicative of Gleason pattern 5. It was recognized by both pathologists and clinicians that despite the above changes, there were deficiencies with the Gleason system. The Gleason grading system ranges from 2 to 10, yet 6 is the lowest score currently assigned. When patients are told that they have a Gleason score 6 out of 10, it implies that their prognosis is intermediate and contributes to their fear of having a more aggressive cancer. Also, in the literature and for therapeutic purposes, various scores have been incorrectly grouped together with the assumption that they have a similar prognosis. For example, many classification systems consider Gleason score 7 as a single score without distinguishing 3+4 versus 4+3, despite studies showing significantly worse prognosis for the latter. The basis for a new grading system was proposed in 2013 by one of the authors (J.I.E.) based on data from Johns Hopkins Hospital resulting in 5 prognostically distinct Grade Groups. This new system was validated in a multi-institutional study of over 20,000 radical prostatectomy specimens, over 16,000 needle biopsy specimens, and over 5,000 biopsies followed by radiation therapy. There was broad (90%) consensus for the adoption of this new prostate cancer Grading system in the 2014 consensus conference based on: (1) the new classification provided more accurate stratification of tumors than the current system; (2) the classi-fication simplified the number of grading categories from Gleason scores 2 to 10, with even more permutations based on different pattern combinations, to Grade Groups 1 to 5; (3) the lowest grade is 1 not 6 as in Gleason, with the potential to reduce overtreatment of indolent cancer; and (4) the current modified Gleason grading, which forms the basis for the new grade groups, bears little resemblance to the original Gleason system. The new grades would, for the foreseeable future, be used in conjunction with the Gleason system [ie. Gleason score 3+3=6 (Grade Group 1)]. The new grading system and the terminology Grade Groups 1-5 have also been accepted by the World Health Organization for the 2016 edition of Pathology and Genetics: Tumours of the Urinary System and Male Genital Organs. © 2015 Wolters Kluwer Health, Inc. All rights reserved.


Grant
Agency: Cordis | Branch: H2020 | Program: RIA | Phase: PHC-22-2015 | Award Amount: 5.74M | Year: 2016

Major depressive disorder, dementia, anxiety disorders, and substance abuse affect a substantial part of the European older population. Over 70% of Europeans reside in cities, and this percentage will increase in the next decades. Urbanization and ageing have enormous implications for public mental health. Cities pose major challenges for older citizens, but also offer opportunities for the design of policies, clinical and public health interventions that promote mental health. The overall aim of the MINDMAP project is to identify the opportunities offered by the urban environment for the promotion of mental wellbeing and cognitive function of older individuals in Europe. The project will advance understanding by bringing together longitudinal studies across cities in Europe, the US and Canada to unravel the causal pathways and multi-level interactions between the urban environment and the social, behavioural, psychosocial and biological determinants of mental health and cognitive function in older adults. Specifically, the project will (a) assess the impact of the urban environment on the mental wellbeing and disorders associated with ageing, and estimate the extent to which exposure to specific urban environmental factors and policies explain differences in ageing-related mental and cognitive disorders both within as well as between European cities, (b) assess the causal pathways and interactions between the urban environment and the individual determinants of mental health and cognitive ageing in older adults, (c) use agent-based modelling to simulate the effect of urban environmental, prevention and care policies on the trajectories of mental health and cognitive ageing across cities in Europe. Knowledge will significantly contribute to future-proof preventive strategies in urban settings favouring the mental dimension of healthy ageing, the reduction of the negative impact of mental disorders on co-morbidities, and maintaining cognitive ability in old age.


The current political rhetoric between India and Pakistan underlines the risk of failing to manage correctly and cooperatively vital water resources shared between nations. India's suspension of the Indus Water Commission meeting on 26 September 2016, and its convening of a meeting to review India's options for modifying or walking away from the Indus Water Treaty, was immediately met with sharp retorts from political leaders in Pakistan, who suggested that any Indian attempt to renege from the Treaty would be deemed an act of war. This potential global catastrophe looms in Asia as rapidly rising water demand collides with a diminishing resource on which at least 300 million people depend directly, warns a new book from United Nations University's Canada-based Institute for Water, Environment and Health (UNU-INWEH). The book, "Imagining Industan," appeals to the three nuclear armed powers sharing the Indus River basin -- India, Pakistan and China -- and Afghanistan to begin working together as never before to manage the precious resource. Its editors describe the book as an effort "to kindle serious discussion of the trans-boundary cooperation needed to confront what more and more water experts believe is developing into one of the planet's most gravely threatened river basins." The book's 14 contributing experts acknowledge the immensity of the challenges in a region prone to political and military conflict but say "much greater collective planning is essential...if the Indus basin is to escape the likely disastrous consequences of continued failure to collaborate." Published by Springer, the 216-page work is the culmination of a project supported by UNU-INWEH and proposes a new course for the 1,120,000 km2 basin drained by the Indus River, six major tributaries and connected waterways covering over 65% of Pakistan, a significant part of India (14%) and smaller areas of Afghanistan (11%) and China (1%). Zafar Adeel, Executive Director of the Pacific Water Research Centre at Simon Fraser University, Canada, co-edited the work with Robert G. Wirsing, recently retired Professor of Government at Georgetown University's School of Foreign Service in Doha, Qatar. Most of the Indus waters flow from glaciers and melting snow high in the Himalayan Mountains and the Tibetan Plateau. Pakistan and India have, until now, been by far its biggest consumers -- mainly for irrigation and generating hydroelectric energy -- through one of the most extensive system of dams and canals that originated with British engineers during the colonial period. Mushrooming water demand has led to pollution, shortages and conflict in those countries, and rapid population and economic growth adds to these problems. Disputes over water have fuelled conflicts within and between the riparian nations, and that history of conflict, in turn, increases the difficulty of achieving amicable and sustainable solutions. The situation will only worsen as climate change threatens the resource and China and Afghanistan divert more of it for their own uses. Numerous new dams are planned or under construction in all four countries. "Industan" is a play on words to emphasize the need to think of the basin as a single, integrated resource. The basin "lies in a part of the world where intense distrust, chronic conflict, and bitterly contentious water policies have a long history," the editors say, and Dr. Wirsing admits that "the subject of this book might seem imprudently optimistic." However, "it was not really optimism that drove the project to completion but a combination of the available opportunities and what might happen if they are not availed." The consensus of all the book's contributors: "Further delay in tackling collectively the region's widely shared and massive problem of water insecurity probably risked intensifying already considerable tensions among the four states sharing the basin." Water shortages could lead to economic distress and internal political instability, particularly in Pakistan, whose freshwater withdrawal at 183 billion m3 per year is the world's fourth highest rate of water use behind India, China, and the United States. Making matters worse, the Indus basin is widely expected to be among the world's worst-affected from climate change, leading to drought, desertification, less predictable monsoon rains, weather turbulence, flooding, sea level rise, and glacial retreat -- all with "potentially harmful collective economic and political consequences." Co-operation could start with sharing data, which would not only increase understanding of the resource but raise the level of trust among the four nations. Cooperation is possible also on specific areas of concern, such as dealing with the impacts of climate change, the sharing of hydropower energy, and collective responses to water-related natural disasters. Says UNU-INWEH Director Vladimir Smakhtin: "The book is an important contribution to creating the awareness of the existing and emerging water-related conflicts in the world, and a loud call for immediate strengthening of transboundary cooperation - to increase both water security and overall regional security. The Indus river basin may be seen as a water time bomb, which may go off any time with increasing water scarcity, variability and progressively changing climate. There are similar water-related accumulating tensions and issues in other major river basins and UNU-INWEH has embarked on the scrupulous analysis of those to ensure peaceful and sustainable trajectory of river basin developments." Views of the authors do not necessarily reflect those of the University. The UNU Institute for Water, Environment and Health is a member of the United Nations University family of organizations. It is a UN Think Tank on Water and its mission is to help resolve pressing water challenges of concern to the UN Member States through science synthesis, cutting edge research, application of on-the-ground science-based scalable solutions and targeted public outreach. It is supported by the Government of Canada and hosted by McMaster University.


News Article | December 8, 2016
Site: www.marketwired.com

Leaders in Mineral Exploration and Mine Development to be Recognized at January 25 Gala VANCOUVER, BC--(Marketwired - December 07, 2016) - The Association for Mineral Exploration ("AME") is pleased to announce its 2016 award recipients. AME will salute its leaders at the AME Awards Celebration of Excellence Gala on January 25 during the AME Roundup 2017 conference. Tickets are available through registration at www.amebc.ca/roundup. "It is our honor to recognize with these awards those in our industry who through their leadership, resilience and innovation have contributed at the highest standards of excellence in exploration and mineral development," says Diane Nicolson, Chair of the Board of Directors of AME. "What they have attained is an inspiration to all and we look forward to celebrating their achievements with you at the Awards Gala at AME Roundup." Chris Rockingham, Carl Edmunds and Wade Barnes, recognized with the H.H. "Spud" Huestis Award for excellence in prospecting and mineral exploration for their discovery and resource definition of AuRico Metals Inc.'s Kemess East deposit in British Columbia. Don Parsons and Steve Robertson, recipients of the E.A. Scholz Award for excellence in mine development in British Columbia and Yukon. They are honoured for their pivotal role in advancing Imperial Metals Corporation's Red Chris copper-gold project in British Columbia from development to commercial production. Terry Salman, recipient of the 2016 Murray Pezim Award recognizing perseverance and success in financing mining exploration. Terry has been a leader in junior company exploration financing for the past 40 years through his career at Nesbitt Thomson, Salman Partners and Salman Capital Inc. William Lamb and Lukas Lundin, recognized with the Hugo Dummett Diamond Award for excellence in diamond exploration and development in recognition of their roles in developing Lucara Diamond Corporation's Karowe Mine in Botswana. Dr. David Broughton and Sello Kekana, recipients of the Colin Spence Award for excellence in global mineral exploration. They are recognized for their work that led to the discovery of the Tier One Flatreef underground deposit at Ivanhoe Mines' Platreef platinum group metals-nickel-copper-gold project in the heart of South Africa's Bushveld Complex. Jim Cooney, recipient of the Robert R. Hedley Award for excellence in social and environmental responsibility as a leader and mentor who has led and shaped the integration of environmental and social values into the mining industry. The late Graham Ennis, honoured with the David Barr Award for excellence in leadership and innovation in mineral exploration health and safety for passion and dedication to the well-being and safety of employees in the diamond drilling industry. JoAnne Nelson, a 30-year veteran of the British Columbia Geological Survey, the recipient of a Special Tribute in recognition of her distinguished career in geoscience work focused on the tectonics, structural geology and metallogeny of the Northern Cordillera spanning British Columbia, Yukon and Alaska. Susan Craig, recognized with the Gold Pan Award for her exceptional meritorious service to the mineral exploration community through AME. Barb Caelles, Alex Christopher and Diane Gregory, honoured with the Frank Woodside Past Presidents and Past Chairs Award for their distinguished service to the association and/or contribution to the mineral industry. The two recipients of AME's Outreach Education Fund are Britannia Mine Museum for its education programs and MineralsEd for its Kids & Rocks program. AME is the lead association for the mineral exploration and development industry based in British Columbia. Established in 1912, AME represents, advocates, protects and promotes the interests of thousands of members who are engaged in mineral exploration and development in British Columbia and throughout the world. AME encourages a safe, economically strong and environmentally responsible industry by providing clear initiatives, policies, events and tools to support its membership. Leaders in Mineral Exploration and Mine Development to be Recognized at January 25 Gala Vancouver, B.C. - December 7, 2016 - The Association for Mineral Exploration (AME) is pleased to announce its 2016 award recipients. AME will salute its leaders at the AME Awards Celebration of Excellence Gala on January 25 during the AME Roundup 2017 conference. Tickets are available through registration at www.amebc.ca/roundup. Chris Rockingham, Carl Edmunds and Wade Barnes are the recipients of the 2016 H.H. "Spud" Huestis Award for Excellence in Prospecting and Mineral Exploration. It is often said that patience and perseverance surmount every difficulty. The discovery of the Kemess East deposit epitomizes this. Under the leadership of Chris Rockingham, the geological insight of Carl Edmunds and execution of Wade Barnes, a blind porphyry gold copper deposit was discovered and delineated. The recognition that the Kemess North deposit was terminated on its northern and eastern edges by faults led the team to search for the offset under deep post-mineral cover. The first indications of a blind mineralized system were encountered in 2002. By the following year, with a large area of phyllic alteration and some low-grade mineralization, Chris, Carl and Wade were confident that they were vectoring towards better mineralization. This was apparent in 2007 when their fourth hole intersected the longest mineralized intercept in the entire Kemess database to that point, but perhaps more importantly, hole 24 intersected 162 m of 0.62 g/t gold and 0.53% copper in potassic altered intrusive. At this point, however, all exploration stopped as the Kemess North open pit proposal was rejected by the federal government. By 2010, commodity price changes made the concept of block caving appear viable, and Kemess North studies were reinitiated. Nonetheless, exploration did not resume again at Kemess East until 2013 and by January 2015, the first resource estimate was released. The most recent drilling has confirmed and upgraded the initial resources estimation, with spectacular drill intercepts such as 628 m of 0.53 g/t gold with 0.41% copper and the deposit remains open in some areas. Chris has a Master of Science in Geology from the University of Western Ontario and an MBA from the Richard Ivey School of Business. Chris's current role is Vice President, Development at AuRico Metals Inc. While Chris's unwavering belief in the project has been critical, perhaps the key role that he has brought to this project has been his thoughtful commitment to aboriginal engagement. Carl graduated from Queen's University with a Master of Science in Mineral Exploration and currently holds the position of Chief Geologist at Silver Standard Resources Inc. Carl was Exploration Manager at Kemess from 2003 to 2012 and along with Wade made the seemingly bold projections on the potential grade and tonnage at Kemess East. Wade is a geology graduate of Simon Fraser University and has been with the project almost since its inception. As Project Geologist, Wade was instrumental in designing and overseeing the 2013-2015 drilling campaigns with his interpretations being the basis for the resource estimates. Don Parsons and Steve Robertson are the recipients of the 2016 E.A. Scholz Award for Excellence in Mine Development in British Columbia and/or Yukon. They are being honoured for their pivotal role in advancing the Red Chris copper-gold project in northwestern British Columbia from development to commercial production between 2007 and 2015. Exploration at the Red Chris deposit was first reported in 1956 but its development began in earnest after the project was acquired in February 2007 by Imperial Metals Corporation, where Don was Chief Operating Officer (as he is today) and Steve was Exploration Manager. Following the acquisition of Red Chris, Imperial's engineering and development team under the leadership of Don re-appraised the existing engineering and feasibility studies and incorporated updated financial, political and technical data into their mine plan. Concurrently, Imperial began a deep drilling campaign under Steve's direction to ascertain the ultimate size of the project. The results of this program exceeded all expectations for tonnage and grade and helped facilitate financing and a positive construction decision for the mine. The Mines Act Permit application was submitted in 2010 and was shepherded through the process over the next two years under the direction of Don and Steve, with its successful completion allowing the start of mine construction at Red Chris in the summer of 2012. Concurrently with mine construction, a 93-kilometre extension of the 287 kilovolt Northwest Transmission Line power line to the mine site was permitted and built. While Don was overseeing the construction and commissioning of the mine, Steve continued to work in his new role as Vice President Corporate Affairs on all the social and political aspects of the project. This included ongoing permitting issues and working with the Tahltan Nation to ultimately complete an Impact, Benefit and Co-Management Agreement which provides the basis for partnership between the Tahltan people and Red Chris for the life of the mine. The Red Chris mine, treating 30,000 tonnes of copper-gold ore per day and employing 350 workers including 120 Tahltan from local communities, commenced commercial production on July 1, 2015 and has operated since then without significant issues. Currently, it has a mine life of another 26 years. Developing, permitting and constructing a project of the magnitude of Red Chris requires many dedicated and hard-working people with talents and abilities in a variety of fields. Don and Steve were able to coordinate and direct those people so as to achieve a common goal: the successful construction of a new mine. For their skill, dedication and perseverance, Don Parsons and Steve Robertson are worthy recipients of the E. A. Scholz Award for 2016. The Murray Pezim Award was created to recognize perseverance and success in financing mining exploration in British Columbia and Yukon. Terry Salman is the 2016 recipient of this award in recognition of his remarkable career in Canadian mining finance. Terry has been a leader in financing junior exploration and mid-cap to large mining companies over the past 35 years. He began his career at Nesbitt Thomson in 1973, rising from a Research Analyst to Executive Vice-President and Director. He is a highly respected investment banker with a focus on natural resources. At Nesbitt Thomson, Terry helped create the first mining team and in the early 1990s established Nesbitt Thomson's first gold conference in Whistler, which ultimately became BMO's Global Metals & Mining Conference. He left Nesbitt Thomson in 1994 to form Salman Partners where he was President, Chief Executive Officer and Co-Director of Research. For 22 years, Salman Partners was a leading resource based investment dealer known for its high-quality research and integrity. Salman Partners participated in syndicates that helped raise $20 billion for more than 400 companies. Salman Partners provided investment analysis across a wide range of sectors, but over the years carved out a specialty in the Vancouver-based resource industry. In 2016, Salman Partners voluntarily resigned from the Investment Industry Regulatory Organization of Canada due to a dramatically changing investment climate for independent investment dealers. Currently, Terry is President and CEO of Salman Capital Inc., an investment advisory and merchant banking firm, capitalizing on his extensive network and relationships he has built in the mining and investment business. In addition to his highly successful work career, Terry has tirelessly devoted his services to many industry and community non-profit organizations, including an important role in initial fundraising for the Britannia Mine Museum. In 2008, Terry was appointed to the Government of Canada's Expert Panel on Securities Regulations. He is a Past-Chair of the Investment Dealers Association of Canada. In 2009, he was awarded a Doctor of Technology honoris causa by the British Columbia Institute of Technology. Terry also served as Chair of the Vancouver Public Library Foundation for sixteen years and is currently Chair Emeritus. Terry has also served as Chair of St. Paul's Hospital Foundation and has been a director of the Prostate Cancer Research Foundation of Canada and the Canadian Stem Cell Network. Currently, he serves on the advisory boards of the Investment Industry Association of Canada and Pathfinder Asset Management Limited and is a member of the Campaign Executive Committee of St. Paul's Hospital Foundation. In recognition of his outstanding volunteer contributions, Terry was awarded the Queen Elizabeth II Diamond Jubilee Medal in 2012. Because of his outstanding career in financing the junior exploration industry, as well as his commitment to volunteer community stewardship, Terry Salman is a deserving recipient of the 2016 Murray Pezim Award. The Hugo Dummett Diamond Award was created to honour those who have made a significant contribution to diamond exploration, discovery or diamond mine development. William Lamb and Lukas Lundin, President, CEO & Director and Chairman & Director respectively, of Lucara Diamond Corp. are the 2016 recipients of the Hugo Dummett Award in recognition of their roles in developing the Karowe Mine in Botswana. William has a Diploma in Extraction Metallurgy, an MBA in Finance and over 23 years of experience in operational and project management in the precious metals, coal, chrome and diamond sectors in South Africa and Canada. Prior to joining Lucara in 2008, he spent 13 years with De Beers working across their operations in southern Africa and at the Victor Mine in Canada, focusing on heavy mineral concentration, project development and operational readiness. Lukas has an engineering degree and he is well known for recognizing value and superior global investment opportunities in the natural resource sector. His uninhibited pursuit of highly prospective properties around the world has resulted in numerous resource discoveries in addition to Karowe including the multi-million ounce Veladero gold discovery. Lucara is a member of the Lundin Group of Companies and was founded, with Lukas's backing, as a diamond company in 2007. The AK6 kimberlite pipe, now known as Karowe, was discovered almost 50 years ago. It was deemed uneconomic at the time, and there was limited exploration on the property until around 12 years ago. William, who had been given the mandate by Lukas and the Lucara Board of Directors to find the best undeveloped diamond project in the world and bring it into production, was aware of Karowe and believed the original assessment was not correct. He and his technical team determined that the value of the project had been underestimated due to diamond breakage. Lukas provided the financial backing to initially acquire a 70% interest in the project, and then a full 100% interest in the project in 2010. Lukas brought it into production in 2012 by way of a personal loan facility, a guarantee for the original purchase price and the financial support to raise funds to finance development of the mine. Further analysis confirmed that Karowe had the potential for the recovery of large, high value Type IIA diamonds, which could also positively impact the commercial diamond value. William recognized the importance of applying and installing new, cutting-edge X-ray technology in tandem with high capacity bulk sorting to facilitate recovery of these large stones. The potential for large, high-value diamonds at Karowe has been validated by the recovery of over 100 diamonds of greater than 100 carats each since the mine opened, including the 813-ct Constellation and the 1109-ct Lesedi La Rona diamond, the world's second largest gem-quality diamond ever recovered. Karowe is truly one of the world's most unique sources of exceptionally large, high quality, gem diamonds. The financial strength and entrepreneurial vision of Lukas Lundin allowed Lucara to acquire the Karowe diamond project, and the engineering ability, processing knowledge and determination of William Lamb and his engineering and construction team brought it into production on schedule and under budget. Lukas and William are deserving recipients of the Hugo Dummett Diamond Award for their roles in the realization of this unique project. This year's recipients of the Colin Spence Award, for making a significant mineral discovery outside of British Columbia and Yukon through the original application of prospecting techniques or other geoscience technology, are Dr. David Broughton and Sello Kekana. They are being recognized for their outstanding work that led to the discovery of the Tier One Flatreef underground deposit at Ivanhoe Mines Ltd.'s Platreef platinum group metals (PGMs) and nickel-copper-gold project in the Northern Limb of South Africa's Bushveld Complex. David Broughton, who received a PhD in Geology from Colorado School of Mines, joined Ivanhoe Mines as Executive Vice President Exploration in January 2008 and is currently Senior Advisor, Exploration and Geology. His career began in Canada in 1984, where he was involved in the mining and exploration for gold, uranium and base metals. In 1997, his focus turned to stratiform copper deposits and he began working in the Central African Copperbelt followed by projects in Namibia, China, United States, Canada and Poland. David was co-leader of Ivanhoe Mines' Kamoa discovery team. Upon joining Ivanhoe, David also assumed responsibility for exploration at the Platreef Project. Sello Kekana was born in Kgobudi village, South Africa, which lies within Ivanhoe's Platreef Project area. He holds a Master of Science degree in Geology from the University of the Witwatersrand. Sello started his professional career in mineral research and then worked as a geotechnologist for a groundwater company. In 2003 he joined Ivanhoe Mines and has worked on projects in South Africa, the Democratic Republic of Congo and Zambia. Sello played a key role in the discovery of the Flatreef deposit, advancing from Geologist, to Project Manager, to General Manager, to Group Manager - Geology. During 2011-2012 Sello managed the deep drilling, which during his tenure expanded to include 30 drill rigs, that delineated the Flatreef deposit. Since January 2015, he has been the Head of Transformation for Ivanplats. Work leading to the discovery of the Flatreef deposit began more than 15 years ago. Exploration in the area by Ivanhoe Mines and its subsidiaries led to delineation of a large, near-surface, low-grade resource that was amenable to open pit mining; however, the open pit area was overlain by villages with a combined population of more than 30,000 people. Realizing the challenges involved with relocating the villagers, the company's geological team led by David and Sello began work to identify other zones of mineralization on the property. Their unique approach, which included applying advanced geophysical modelling to high-resolution airborne gravity data, resulted in the realization in 2010 that the regionally steeply west-dipping mineralized reef flattened at a depth of roughly 700 m below surface on Ivanhoe's property. Deep drilling on the deposit has defined a flat- to gently-dipping NI 43-101 compliant Indicated Mineral Resource with an average thickness of 24 m and a strike length in excess of 6 km, containing an estimated 1.2 million kg (42 million oz) of PGMs plus gold at a cut-off of 2 g/t, and an additional 1.5 million kg (52.8 million oz) of PGMs plus gold in Inferred Resources. The Indicated and Inferred Resources also contain 1.6 and 2.4 billion kilograms of nickel and copper, respectively. Project development commenced in 2014 and shaft sinking is underway. Flatreef is distinguished from other Bushveld projects by its tremendous size and thickness, its high-grade polymetallic nature and potential for byproduct credits of nickel and copper, and its flat-lying orientation leading to the potential for safe, mechanized underground mining. David Broughton and Sello Kekana are deserving recipients of the Colin Spence Award for their roles in the discovery and delineation of this world class deposit. Jim Cooney is the recipient of the Robert R. Hedley Award for Excellence in Social and Environmental Responsibility. Jim is a leader and mentor who has led and shaped the integration of environmental and social values into the mining industry. From early in his career in the 1970s he began incorporating social considerations into mining by directing Cominco's first social impact assessment at what is now the Highland Valley Copper mine. By the early 1990s, following the UN's adoption of sustainable development, Jim began publishing articles that promoted this as a mining company strategy for managing social and political risks. He has been an outspoken advocate for sustainable development ever since as well as an advocate for the inclusion of Indigenous peoples and perspectives into the mining industry. In 1996 Jim was the driving force that led Placer Dome to adopt a policy of sustainable development, the first mining company to do so. Shortly afterward as Chair of the Policy Committee of the International Council on Mining and the Environment (now the ICMM) he successfully led the effort to convince mining companies around the world to adopt sustainable development policies. Among his many significant accomplishments, Jim coined the term "social licence to operate" at a World Bank meeting in 1997. This term has become a widely accepted reference point for mining companies in their relationship with local communities. Jim has inspired and mentored more than one new generation of mining industry professionals. Through teaching at the University of British Columbia, presenting at conferences, participating on committees and providing his time and expertise, he has changed the industry's outlook on working with communities and bringing about positive benefits to communities. Although semi-retired, Jim continues to mentor industry practitioners and leaders, and to shape the progress of the mining industry's social and environmental practices. Graham Ennis is posthumously recognized with the David Barr Award for Excellence in Leadership and Innovation in Mineral Exploration Health and Safety. Graham's passion and dedication to the well-being and safety of employees was simply unsurpassed. His drive and devotion was primarily fueled by experiences from the former part of his career in the mining and forestry sectors, in both British Columbia and Yukon. Through his avalanche rescue and recovery work and mine rescue involvement within these respective sectors, Graham had the unfortunate experience of rescuing or recovering colleagues from both serious and fatal workplace accidents on multiple occasions. Graham transitioned to the mineral exploration sector in 2006 to pursue his passion for safety by accepting a position in the Northwest Territories as a Safety Representative with Major Drilling Group. He moved to Manitoba shortly thereafter upon being promoted to the role of Safety Coordinator, eventually leading to the position of Health, Safety, Environment and Community Manager few years later. During his tenure at Major, Graham worked tirelessly to improve safety performance, always with the best interest of the crews at heart. From the onset, he was adamant on training, emergency preparedness, the implementation of an intensive accident investigation protocol and the return to work process. Even in a managerial role, he kept a direct pulse on the safety culture as well as the challenges and issues faced by the crews through frequent field visits across Canadian surface and underground operations including some international sites. His observations often led to recommendations and continual improvement efforts within the organization. As such, he was instrumental in the development and implementation of numerous company safety programs, including a comprehensive program for constructing and working on ice covers. He was always eager to roll up his sleeves to take the lead or mentor ice crews on ice testing and monitoring techniques to ensure that company protocols were strictly followed. Graham was a strong advocate of sharing best practices, experiences and lessons learned, transcending company boundaries. He was always generous with his time as well as with his wealth of knowledge, experience and industry contacts accumulated over the years. He was an enthusiastic supporter of the Canadian Diamond Drilling Association (CDDA); his involvement ranged from presenting papers at the association's Annual General Meeting and Convention to working at the sub-committee level with respect to industry training and safety issues. He was also a long-standing chair of the CDDA's Western Safety Group - coordinating venues and speakers, and relentless rallying for continued support and participation from industry and government parties alike. Graham was also a very active and well-respected member of the Mine Accident Prevention Association of Manitoba (MAPAM) Board of Directors from 2008 through 2015. During this time, MAPAM's directors' collective efforts led to establishment of emergency planning, preparedness and response protocols for Manitoba's mining industry. They also realized marked industry improvements in safety culture and performance, attributed to the sharing of risk management information and lessons learned among their membered companies. Finally, Graham was avid mountaineer and fisherman, not to mention a great story teller. Coffee breaks, meetings and other gatherings were always good fun! Accounts of his excursions and past work experiences, often injected with safety messaging and a great sense of humour, drew his audience near and attracted anyone within earshot to listen in. On or off-the-job, Graham was a great role model - a devoted, energetic and sincere proponent of personal safety - who inspired others to follow suit. For these reasons, Graham Ennis is a fitting posthumous recipient of the David Barr Award. JoAnne Nelson, a 30-year veteran of the British Columbia Geological Survey, is being acknowledged with a Special Tribute for her significant contributions to the advancement of geoscientific knowledge relating to the tectonics, structural geology and metallogeny of the Northern Cordillera. Over this time span she has developed an outstanding geoscience reputation coupled with major contributions as a project leader, mentor and communicator. JoAnne was raised in the western United States where she initially became fascinated with rocks as a young teenager, during a mountaineering course at Yosemite National Park. Following completion of high school she went on to earn B.Sc. and M.Sc. degrees in geology at the University of Washington and at the University of British Columbia, in 1973 and 1976, respectively. While at UBC she also earned a B.Ed. degree, and later taught high school science on Haida Gwaii followed by sessional lecturing in geology at UBC and at Douglas College between 1978 and 1985. During this period, she also worked as a field geologist with Resource Associates of Alaska, and did some contract petrography for Vancouver Petrographics. Since joining the BCGS in 1986, JoAnne has conducted extensive field mapping and related geological studies throughout British Columbia, with a primary focus on the tectonics and metallogeny of the northwestern part of the province. She has also developed expertise in aspects of the evolution of the B.C.-Yukon-Alaskan Cordillera as a whole. Her current project, as Northwestern BC Manager, involves structural and geochronological studies of the Mesozoic porphyry-epithermal belt known as the Golden Triangle. Throughout her career, JoAnne has successfully interwoven the complex geology of the Cordillera with the wealth of mineral deposits it contains. She understands that this process is best done by also incorporating knowledge developed by industry geologists and prospectors. To this end, she meets with them in their offices and in the field, uses their reports, and engages with them at conferences. Her charisma and enthusiastic presentations at technical conferences and at regional community meetings have informed and inspired a broad spectrum of explorers, researchers, students and the general public. JoAnne's accomplishments were formally recognized in 2013 when she was listed in the top 100 Global Inspirational Women in Mining by the United Kingdom's Standard Bank. Additionally, in 2015, she was presented with the Gold Pick Award by the Kamloops Exploration Group (KEG) in recognition of "outstanding services and contributions to the minerals industry". AME is pleased to add to these accolades by awarding her the 2016 Special Tribute. Susan Craig is recognized with the Gold Pan Award for her exceptional meritorious service to the mineral exploration community through AME. Susan has more than a decade of experience supporting AME. She served as co-chair of the Mineral Exploration Roundup committee in 2009 and 2010, and was chair in 2011, when attendance at AME's Roundup conference first exceeded 7,000 participants. In 2004, she joined the First Nations & Community Relations Committee, and to this day serves on its successor, the Aboriginal Relations Committee. Susan has served on AME's Board of Directors from 2005 to 2008, and since 2014. She was a co-recipient of the inaugural 2007 Robert R. Hedley Award for Excellence in Social and Environmental Responsibility. Outside of AME, Susan has been Chair of the Yukon Minerals Advisory Group and is a director of the Yukon Chamber of Mines. The Frank Woodside Past Presidents and Past Chairs Award is presented to three individuals for their distinguished service to AME. Barbara Caelles graduated with a B.Sc. in Geology from the University of British Columbia, and has worked in the mining industry for more than 40 years. She started her career in exploration as a field geologist, but eventually turned to consulting in records management for mining in order to have a more balanced lifestyle. Barbara has been involved in women's groups since she was appointed in 1975 to the Women Geoscientists Committee in 1975, of which she became Chair in 1977. Barbara is a founding member of Women in Mining British Columbia (formerly known as Women in Mining Vancouver), sits on the executive of the Greater Vancouver Mining Women's Association, and was part of the BC HR Task Force, Diversity-Women Sub-committee. In 2010 Barbara received the Minerva Foundation's Women in Natural Resources Award for Philanthropy and Volunteerism, and was recognized as a Life Member by AME in 2015. Alex Christopher joined Teck's Exploration Group in 1984 and was appointed Senior Vice President, Exploration, Projects & Technical Services in July 2016. He previously held the position of Vice President, Exploration, and has held a number of positions in the company within Exploration, Exploration Business Development and Corporate Development. Alex holds a B.Sc. (Honours) degree in Geology from McMaster University and an Environmental Biology Technology Diploma from Canadore College. Alex is also on the Board of Directors of the Prospectors & Developers Association of Canada ("PDAC") and is a Director of Horizonte Minerals Plc. Alex has served on the AME's Finance & Audit Committee since 2006, and served as a Director from 2006 through 2009. Diane Gregory has a career that ranges from being the geologist and lands manager for Murray Pezim's Prime Explorations Ltd. during the Eskay Creek staking rush to being a land manager with The Claim Group Inc., a mineral tenure management company. Diane was part of the Land Use Committee of AME and Lands Committee of the PDAC several years during the late 1990s and early 2000s. As a Land and Contracts Manager with Kennecott Exploration Canada Inc., Diane sat at the Cassiar-Iskut-Stikine land use for two years and reported to AME regarding the deliberations. Along with Barbara Caelles, Diane was a founding member of Women in Mining British Columbia (formerly known as Women in Mining Vancouver). Diane was previously recognized as a Life Member by AME in 2012. Britannia Mine Museum is granted $10,000 to assist and support the Museum's Educational Program that is focused on earth science programs and events for students. These programs are attended annually by 10,000 students. The 2016 programs focused on the themes of What Use Are Minerals To Me?, Mineral Diversity Up Close and The Bigger Picture XL, a critical thinking game related to operating a mining company for the Grades 5 to 6 students. The inaugural DIG Day-Delving into Geoscience, an activity dealing with plate tectonics, volcanoes, minerals, rocks and fossils was featured during spring break.The educational initiatives for 2017 will focus on developing exhibits on carbon and carbon innovations, enhancing activities associated with DIG Day-Delving into Geoscience with a focus on geological events related to the origin of the Britannia copper deposits. Also, a permanent display of the hydrothermal Black Smoker chimney specimens from the Juan de Fuca Ridge will be developed at the Mineral Gallery of the Beaty - Lundin Visitor Centre. All programs and activities will be coordinated with the primary objective of supporting and assisting the teachers for educating students on geological science. Mineral Resources Education Program of BC (MineralsEd) is granted $10,000 for coordinating the Kids & Rocks hands-on classroom workshop in 2017 for children and students in Kindergarten to Grade 3 in the Lower Mainland schools of BC. A complementary version of the Kids & Rocks program, tentatively referred to as Kids & Rocks 5, will be introduced for Grade 4 to 6 classes. The main objective of Kids & Rocks program is to introduce children to the basic properties of various rocks and minerals and how they are utilized to benefit our lives. The kids are provided with a bag of about 25 rocks and minerals, a hand lens, hardness kit, streak plate, magnet and flashlight to experience and learn the basic physical properties of their specimens. As the children advance, they are introduced on how our daily lives are dependent on earth's non-renewable resources. The more advanced Kids & Rocks 5 program will challenge the students to identify "blind" mineral and rock samples by way of examining, recognizing and recording specific physical properties to identify the mineral specimens; and for rocks, determining whether it is an igneous, sedimentary or metamorphic rock. The Kids & Rocks project is an important stepping stone for our current and future mineral exploration industry.


News Article | December 23, 2016
Site: www.eurekalert.org

The Biophysical Society has announced the winners of its Education Committee Travel Awards to attend the Biophysical Society's 61st Annual Meeting in New Orleans, Louisiana, February 11-15, 2017. The recipients of this competitive award, all of whom are students and postdoctoral fellows, are selected based on scientific merit. Each awardee will be presenting their research during the meeting, will receive a travel grant, and will be recognized at a reception on Saturday, February 11, at the Ernest N. Morial Convention Center. Mihai Azoitei, University of North Carolina at Chapel Hill, NOVEL BIOSENSOR DESIGN REVEALS THE ROLE AND REGULATION OF GEF-H1 IN CELL MIGRATION. Mouhanad Babi, McMaster University, THE CHARACTERIZATION OF CELLULOSE NANOSTRUCTURE USING SUPER-RESOLUTION FLUORESCENCE MICROSCOPY. Curtis Balusek, Georgia Institute of Technology, CONSTRUCTING AN IN SILICO MODEL OF THE GRAM-NEGATIVE CELLULAR ENVELOPE. Paola Bisignano, University of California, San Francisco, STRUCTURAL INSIGHTS INTO SODIUM-DEPENDENT SUGAR TRANSPORTERS AND THEIR INHIBITION MECHANISM. Breane Budaitis, University of Michigan, THE ROLE OF THE COVER-NECK BUNDLE IN MULTI-MOTOR TRANSPORT AGAINST LOAD IN CELLS. Shirley Chen, University of Michigan, ENGINEERING INHIBITABLE KINESIN-3 MOTORS BY A NOVEL CHEMICAL-GENETIC APPROACH. Saikat Chowdhury, The Scripps Research Institute, USING CRYOEM TO UNDERSTAND HOW PHAGES EVADE BACTERIAL CRISPR DEFENSE SYSTEM. Alexander Chu, California Institute of Technology, TOWARDS A UNIVERSALCHARACTERIZATION OF THE MEMBRANE PROTEIN EXPRESSION LANDSCAPE. Miranda Collier, University of Oxford, EVIDENCE FOR CHAPERONE FUNCTION IN MECHANOSENSATION. Caitlin Cornell, University of Washington, DIRECT IMAGING OF LIQUID DOMAINS BY CRYOTEM IN SUBMICRON VESICLES. Yavuz Dagdas University of California, Berkeley, CONFORMATIONAL DYNAMICS OF CAS9 DURING DNA BINDING. Peter Dahl, University of Michigan, A SUPPORTED TUBULATED BILAYER SYSTEM SHOWS EFFECTS OF SYNAPTOTAGMIN-7 ON MEMBRANE CURVATURE. Russell Davidson, Colorado State University, MOLECULAR ALLOSTERY IN DENGUE NS3 HELICASE ALONG THE ATP HYDROLYSIS CYCLE. Melody Di Bona, Italian Institute of Technology, CHROMATIN ACCESSIBILITY STUDIED BY SLOW SCAN FCS IN THE EUKARYOTIC NUCLEUS. Matthew Dragovich, Lehigh University, INVESTIGATION OF THE RELIABILITY OF AFM NANOINDENTATION-DERIVED MEASUREMENTS OF CELL MECHANICS. Paige Engen, Hamline University, STRUCTURAL ANALYSIS OF TAU PEPTIDE INTERACTIONS WITH LIPID MEMBRANES USING FOURIER TRANSFORM INFRARED SPECTROSCOPY. CristianEscobar, Florida State University, CONFORMATION PLASTICITY ANDPEPTIDOGLYCAN CLEAVAGE BY THE N-TERMINAL INTRINSICALLY DISORDERED DOMAIN OF CHIZ. Gozde Eskici, University of Pennsylvania, MICROSECOND SIMULATIONS OF AMYLOID BETA FIBRIL NUCLEATION IN REVERSE MICELLES. Emmet Francis, University of California at Davis, SINGLE-CELL INVESTIGATION OFTHE ROLE OF CALCIUM BURSTS IN HUMAN IMMUNE CELLS. Wolfgang Gross, University of Bayreuth, MACROPHAGES ARE SENSITIVE TO SUBSTRATE ELASTICITY DURING PHAGOCYTOSIS. Shubhasis Haldar, Columbia University, TRIGGER FACTOR BOOSTS THE WORK DONE BY PROTEIN FOLDING UNDER FORCE. Alice Herneisen, Swarthmore College, SITE-DIRECTED SPIN LABELING EPR SPECTROSCOPY OF THE CYTOPLASMIC TAIL OF INFLUENZA A M2. Naoto Hori, University of Texas, MULTISTEP FOLDING KINETICS OF GROUP I INTRON RNA STUDIED BY Mg2+-CONCENTRATION JUMP SIMULATIONS. Jesse Howe, CSU San Marcos, EXPANDING THE SCOPE OF SINGLE MOLECULE FRET SPECTROSCOPY TOWARDS PRIMARILY UNDERGRADUATE INSTITUTIONS. Abir Kabbani, Wayne State University, NANOSCALE MEMBRANE BUDS INDUCED BY CTXB-GM1 IN ONE COMPONENT BILAYER DETECTED BY POLARIZED LOCALIZATION MICROSCOPY (PLM). Shachi Katira, University of California, Berkeley, PRE-TRANSITION EFFECTS MEDIATE FORCES OF ASSEMBLY BETWEEN TRANSMEMBRANE PROTEINS: RECENT RESULTS ON THE ORDERPHOBIC EFFECT. Hema Chandra, Kotamarthi, Massachusetts Institute of Technology, SINGLE-MOLECULE DISSECTION OF THE ROLE OF DIRECTIONALITY IN PROTEIN DEGRADATION BY Clp PROTEOLYTIC MACHINES. Sudipta Lahiri, Wesleyan University, ELUCIDATION OF THE STRUCTURE-FUNCTION RELATIONSHIP OF S. CEREVISIAE MUTS HOMOLOG MSH4 AND MSH5 WITH THE HOLLIDAY JUNCTION. Ying Lai, Stanford University, MUNC13 AND MUNC18 COOPERATE TO PROPERLY ASSEMBLE SNARES FOR FAST NEUROTRANSMITTER RELEASE. Christopher Lee, University of California, San Diego, INVESTIGATING TRANSPORT PROPERTIES WITH MULTI-SCALE COMPUTABLE MESH MODELS FROM HETEROGENEOUS STRUCTURAL DATASETS. Maureen Leninger, New York University, INVESTIGATING THE STRUCTURE OF THE DRUG TRANSPORTER EMRE. Alyssa Lombardi Temple University School of Medicine, GENETIC ABLATION OFFIBROBLAST MITOCHONDRIAL CALCIUM UPTAKE INCREASES MYOFIBROBLASTTRANSDIFFERENTIATION AND EXACERBATES FIBROSIS IN MYOCARDIAL INFARCTION. Victor Pui-Yan Ma, Emory University, RATIOMETRIC TENSION PROBES FOR MAPPING RECEPTOR FORCES AND CLUSTERING AT INTERMEMBRANE JUNCTIONS. Mohammad Mehdi Maneshi, University at Buffalo, SHEAR STRESS STIMULATED MSC ACTIVITIES: DIRECT CHANGES OF MEMBRANE TENSION OR CYTOSKELETALSTRESS? Dipak Maskey, Institute of Medicine, DEGRADATION OF CALPONIN 2 IS REQUIRED FOR CYTOKINESIS. Isha Mehta, Texas Woman's University, PROTEIN ENERGY NETWORK MODELS TO CLASSIFY AND PREDICT FUNCTIONALLY LINKED INTERFACES OF PROTEINS FROM FUNCTIONALLY UNCORRELATED INTERFACES. Paula Morales, University of North Carolina at Greensboro, CONSTRUCTION OF A GPR3 HOMOLOGY MODEL USING CONFORMATIONAL MEMORIES. Medeea Popescu, Wellesley College, EXAMINING THE ROLE OF PHOSPHORYLATION ON INTERACTIONS BETWEEN THE CARDIAC POTASSIUM CHANNEL ALPHA-SUBUNITS HERG AND KVLQT1. Dana Reinemann, Vanderbilt University, SINGLE MOLECULE CHARACTERIZATION OF MITOTIC KIF15 REVEALS CAPABILITY TO GENERATE FORCE IN ANTI-PARALLEL MICROTUBULES. Talant Ruzmetov, Kent State University, EXPLORING THE ROLE OF FLEXIBILITY IN BINDING KINETICS AND AFFINITY OF PKID-KIX THROUGH COARSE GRAINED SIMULATIONS. Kristin Schimert, University of Michigan, INTRACELLULAR CARGO TRANSPORT BY SINGLE-HEADED KINESIN MONOMERS. Digvijay Singh, Johns Hopkins University School of Medicine, INVESTIGATION OF DNA BINDING, NUCLEOLYSIS AND PRODUCT RELEASE SPECIFICITY OF RNA GUIDED ENDONUCLEASE CRISPR-CPF1 FAMILY REVEALS IMPORTANT DIFFERENCES FROM CAS9-RNA. Kyle Smith, Northwestern University, THE TWO GTPASE DOMAINS OF THE OUTER MITOCHONDRIAL MEMBRANE PROTEIN MIRO HAVE NOVEL ACTIVE SITE CONFORMATIONS AND DISTINCT BIOCHEMICAL PROPERTIES. Kevin Votaw, Colorado State University, INSIGHTS INTO DAMAGED BASE DETECTION BY DNA GLYCOSYLASES: A COMPUTATIONAL STUDY OF ALKD. Sienna Wong, Wayne State University, ENGINEERING OF CHIMERIC PROTEINS TO ENHANCE IMMUNOGENICITY FOR THE PRODUCTION OF HIGH-AFFINITY SPECIFIC MONOCLONAL ANTIBODIES. Riley Workman, Duquesne University, CHARACTERIZATION OF THE CONFORMATIONAL ENSEMBLE OF POLYGLUTAMINE PEPTIDES VIA METADYNAMICS MD SIMULATIONS AND UV RESONANCE RAMAN SPECTROSCOPY. Goli Yamini, The Catholic University of America, IMPACT OF DENDRIMER SURFACE CHEMISTRY ON ANTHRAX TOXIN CHANNEL BLOCKAGE: A SINGLE MOLECULE STUDY. Fan Yang, University of California, Davis, RATIONAL DESIGN AND VALIDATION OF A VANILLOID-SENSITIVE TRPV2 ION CHANNEL. Chen-Ching Yuan, University of Miami, DISTINCT LATTICE STRUCTURE ALTREATIONS IN DCM AND HCM MOUSE MODELS ASSOCIATED WITH MUTATIONS IN MYOSIN REGULATORY LIGHT CHAIN. Rebecca Zaunbrecher, University of Washington, GENETICALLY ENGINEERED HUMAN STEM CELL-DERIVED CARDIOMYOCYTES TO STUDY THE FUNCTIONALITY OF CRONOS TITIN. Zhenfu Zhang, University of Toronto, INTERPLAY AMONG BINDING, PHOSPHORYLATION AND DENATURATION IN DISORDERED 4E-BP2 AS PROBED BY SINGLE MOLECULE FLUORESCENCE. Yue Zhang, Mississippi State University, MODELING THE EARLY STAGES OF AGGREGATION IN DISORDERED ELASTIN-LIKE PROTEINS. Haiqing Zhao, University Of Maryland, PROMISCUOUS HISTONE MIS-ASSEMBLY IS ACTIVELY PREVENTED BY CHAPERONES. Chi Zhao, University of Texas at Austin, PLASMA MEMBRANE VESICLES WITH ENGINEERED TRANSMEMBRANE PROTEIN LIGANDS FOR HIGH-AFFINITY CELL TARGETING. The Biophysical Society, founded in 1958, is a professional, scientific Society established to encourage development and dissemination of knowledge in biophysics. The Society promotes growth in this expanding field through its annual meeting, monthly journal, and committee and outreach activities. Its 9000 members are located throughout the U.S. and the world, where they teach and conduct research in colleges, universities, laboratories, government agencies, and industry. For more information on these awards, the Society, or the 2017 Annual Meeting, visit http://www. .


News Article | September 26, 2016
Site: www.theenergycollective.com

SNC-Lavalin has signed an agreement with two Chinese nuclear energy firms to develop, market and build an advanced CANDU type nuclear reactor The Montreal, Canada, based engineering and construction giant SNC-Lavalin, which five years ago, bought AECL’s reactor division from the government, has a new joint venture with China National Nuclear Corp. (CNNC) and Shanghai Electric Co. The immediate results of the agreement will be the creation of two nuclear reactor design centers, one in China and the other in Canada. The design centers will collaborate to complete the Advanced Fuel CANDU Reactor (AFCR). It is expected that the first two units will be then built in China and then the reactor will offered via export to global markets. “’The market potential for AFCR technology in China is considerable. Each AFCR can use recycled-fuel from four light-water reactors (LWRs) to generate six million megawatt-hours (MWh) of additional carbon-free electricity without needing any new natural uranium fuel. This would be enough new electricity to power four million Chinese homes, and also displace six million tonnes of carbon emissions per year vs. coal, the equivalent of removing one million cars from the road. China has more than 33 LWR nuclear power reactors in operation and another 23 LWRs under construction.” The agreement occurred during an official four-day visit to Canada by Chinese Premier Li Keqiang. Canadian PM Justin Trudeau promoted the visit as a thaw in relations between the two nations following a decade of chilly diplomacy under the Conservative government of PM Stephen Harper. According to news coverage in the Toronto Globe & Mail for 9/22/16, John Luxat, a professor of nuclear safety analysis at McMaster University, told the newspaper the new reactor technology has “high potential for use in China because of the large number of light water reactors” who spent fuel could be used by CANDU designs. However, AltgaCorp investment analyst Chris Murray told the newspaper he sees the design and marketing effort to be a slow, drawn out effort and does not expect there to be any near-term financial impact. CANDU stands for CANada Deuterium Uranium, because it was invented in Canada, uses deuterium oxide (also known as heavy water) as a moderator, and uranium as a fuel. CANDU reactors are unique in that they use natural, unenriched uranium as a fuel; with some modification, they can also use enriched uranium, mixed fuels, and even thorium. Thus, CANDU reactors are ideally suited for using spent fuel from light water nuclear reactors, or downblended uranium from decommissioned nuclear weapons, as fuel, helping to reduce global arsenals. CANDU technical description and schematic courtesy of AECL and the Canadian Nuclear Association CANDU reactors can be refueled while operating at full power, while other light water designs, including PWRs and BWRs, must be shut down for refueling. Moreover, because natural uranium does not require enrichment, fuel costs for CANDU reactors are very low. Canada is one of the world’s leading sources of uranium with rich deposits in Saskatchewan and other provinces. It has no uranium enrichment capabilities. The safety systems of CANDU reactors are independent from the rest of the plant, and each key safety component has three backups. This redundancy increase the overall safety of the system, and it also makes it possible to test the safety system while the reactor is operating under full power. There are 19 CANDU reactors in Canada and 31 globally including two in China, two in Argentina, and two in Romania. While all three countries are potential markets for the new SNC-Lavalin / CNNC design, only China has committed, in principle to building the new ACFR. It is unclear to what extent the new AFCR benefits from a design heritage with the now suspended work on the ACR-1000 which was proposed in 2007 and 2008 for Canadian and UK power markets. The ACR-1000, a 1200 MW CANDU type reactor design, was proposed to be built in the tar sands region of Alberta for power and process heat customers and at Point Lepreau in New Brunswick for electric power customers. Neither projects ever made it off the drawing boards. Efforts to license the 1200 MW unit with the Canadian Nuclear Safety Commission ended in Spring 2008 when AECL also withdrew the design from consideration in the UK generic design assessment. AECL CEO Hugh MacDiarmid was quoted at the time as saying, “We believe very strongly that our best course of action to ensure the ACR-1000 is successful in the global market place is to focus first and foremost on establishing it here at home.” But there were no sales at home due to Bruce Power declining to consider the 1200 MW reactor. In June 2011 SANC-Lavalin bought the reactor division of AECL for the bargain basement price of $15 million which included all of AECL’s intellectual property related to CANDU reactor designs. The advanced CANDU reactor (ACR), in its current design status, frozen in 2008, is a Generation III+ nuclear reactor design and is a further development of existing CANDU reactors designed by Atomic Energy of Canada Limited (AECL). The ACR is a light-water-cooled reactor that incorporates features of both pressurized heavy water reactors (PHWR) and advanced pressurized water reactors (APWR) technologies. It uses a similar design concept to the steam-generating heavy water reactor (SGHWR). The difference between heritage CANDUs and the ACR is that it uses low enriched uranium (LEU) fuel, (3-5% U235), ordinary (light) water coolant, and a separate heavy water moderator. The ACR also incorporates characteristics of the CANDU design, including on-power refueling with the CANFLEX fuel; two fast, totally independent, safety shutdown systems; and an emergency core cooling system. The relatively small reactor core reduces core size by half for the same power output over the older CANDU design. The ACR fuel bundle is a variant of the 43-element CANFLEX design (CANFLEX-ACR). The use of LEU fuel would result in higher burn-up operation than traditional CANDU designs. None of these features were found to be compelling by potential customers and AECL shelved the entire effort to develop the ACR. About the New AFCR According to SNC_Lavalin the Advanced Fuel CANDU reactor (AFCR) (fact sheet) is a 700MW Class Generation III reactor based on the successful CANDU 6 and Enhanced CANDU 6 (EC6) reactors with a number of adaptations to meet the latest Canadian and international standards. This is 300 MW less in power than the ACR and also differs technically from the ACR in that it uses only heavy water as a moderator. Its fuel flexibility allows it to use recycled uranium or thorium as fuel. SNC-Lavalin calls such materials “natural uranium equivalent” fuels, It uses a heavy water moderator and heavy-water coolant in a pressure tube design. CANDU reactors can be refuelled on power. The firm claims it will have “one of the highest lifetime capacity factors among the world’s reactors.” The development of the AFCR was first reported by World Nuclear News in November 2014. That report also provided insights into the place in China’s nuclear fuel cycle that would be the niche for the reactor. WNN noted in its report that the used fuel from four conventional PWR reactors can completely supply one AFCR unit (as well as providing recycled plutonium for MOX). This process significantly reduces the task of managing used fuel and disposing of high-level wastes. The R&D effort also explored the use of thorium as a fuel for the new reactor. In June 1998, construction started on a CANDU 6 reactor in Qinshan China of the Qinshan Nuclear Power Plant, as Phase III (units 4 and 5) of the planned 11 unit facility. Commercial operation began in December 2002 and July 2003, respectively. These are the first heavy water reactors in China. In 2015 China signed agreements in principle with Romania and Argentina to supply CANDU reactors. In a World Nuclear News report in November 2015 report details were revealed that China and Argentina had in 2014 signed a new high-level agreement towards construction of a third CANDU type pressurized heavy water reactor (PHWR) at the Atucha plant in Argentina. Under the agreement, CNNC will be providing goods and services and long-term financing. The utility in Argentina will be designer, architect-engineer, builder and operator of the new PHWR (Atucha 3). Under the agreement, over 70% of the components to be used in the plant will be supplied by Argentine companies. CNNC is now expected to advance the negotiations with Chinese financial institutions to conclude project financing. Atucha 3 will be a part Canadian-developed Candu reactor running on natural uranium fuel, like the 648 MWe Embalse Candu reactor in Córdoba province. Because of the localization strategy for major components, and the history of the supply chain in Argentina with the other CANDU reactors, it is unlikely that Atucha 3 could be based on the new AFCR design. Atucha 3 is expected to cost almost $6 billion and to take eight years to build at the Atucha Nuclear Power Plant Complex in Buenos Aires province, where the 335 MWe Atucha I and 745 MWe Atucha 2 currently operate. Also in November 2015 World Nuclear News reported Romania’s Nuclearelectrica signed a memorandum of understanding (MOU) with China General Nuclear (CGN) for the development, construction, operation and decommissioning of units 3 and 4 of the Cernavoda nuclear power plant. The Romanian national nuclear company said a joint venture project company is to be established, with CGN owning at least 51% of the share capital. That company will oversee construction of the units, which will be 700 MWe Candu 6 reactors. Two Candu units already operate at the Cernavoda site. Romania and China signed a letter of intent in November 2013 during a visit to Bucharest by Chinese premier Li Keqiang. Cernavoda is home to two operating Candu 6 pressurized heavy water reactors (PHWRs) supplied by Candu Energy’s predecessor, Atomic Energy of Canada Ltd (AECL), and built by a Canadian-Italian consortium of AECL and Ansaldo. Unit 1 started up in 1996, but work was suspended on a further four units in 1991. Unit 2 was subsequently completed and has been in operation since 2007. Given Romania’s history with CANDU reactors, and its intent to apply its operating experience with them to Units 3 & 4, it is unlikely that country would be a market for the new AFCR model. Romania will supply the fuel for all four reactors. According to the same World Nuclear News report, the new conventional CANDU units will have an operating life of 30 years with the possibility of extension by an additional 25 years. With Argentina and Romania committed to conventional CANDU, off-the-shelf, technology, it is unclear what the commercial prospects will be for the new AFCR CANDU design. The design intent to use spent nuclear fuel in the reactor would make it attractive to many countries. China will build and operate the first two units to prove to potential customers that the design is safe, affordable, and will have a long and cost-competitive service life. Assuming the units can be built in China for $3,000 to $4,000 per Kw, a 700 MW unit will cost approximately $2.1 billion to $2.8 billion which is far less than the cost in the U.S. for a 1000 MW Westinghouse AP1000. Similar cost comparisons would be expected for new nuclear reactors in the UK. However, China is proposing its new PWR design, the Hualong One, for the UK market. Once China has proven the technical and financial viability of the AFCR CANDU, it will face the uncertain prospects of design safety reviews for first-of-a-kind units by nuclear regulatory agencies in countries where it wants to sell the reactors. By leveraging the well-known CANDU technology, SNC-Lavalin and CNNC are placing a bet that they will find willing buyers of their new nuclear reactor.


News Article | February 8, 2017
Site: www.techtimes.com

No time to hit the gym? Brief but intense stair-climbing, which can be done almost anywhere, is just as good for the heart as a physical workout, a new study suggests. A team of researchers at McMaster University in Ontario, Canada found that stair climbing is a convenient and easy way to fit exercise into your life, especially if your schedule is too packed. The study negates two common excuses of couch potatoes: no access to the gym and no time to visit one. Kinesiology professor Martin Gibala, lead author of the new study, said stair climbing is a kind of exercise that anyone can do after work or during lunch hour. "This research takes interval training out of the lab and makes it accessible to everyone," said Gibala, an expert at high-intensity interval training and author of a book called "The One Minute Workout." Past studies have shown that vigorous stair climbing accumulated over long periods of time - about 70 minutes in seven days - can have positive benefits. However, Gibala and his colleagues set out to investigate whether sprint interval training (SIT) is a time-efficient and effective alternative that improves heart health. SIT involves brief bursts of intense exercises separated by short periods of break. The research team recruited 31 women who were sedentary but otherwise healthy. They tested the effect of two different procedures, each of which lasted for 10 minutes, including periods of cool down, warm-up, and recovery. The first procedure involved three bouts of continuous climbing that lasted for 20 seconds. The results of this first procedure were compared among women who ran through the same procedure but with an exercise bike that has been proven to improve fitness. During the second procedure, participants vigorously climbed up and down one flight of stairs for 60 seconds - an experiment that can be performed at home. Both protocols, which lasted for 30 minutes, increased the cardiorespiratory fitness of the participants, which is an important health marker for longevity. Gibala said that instead of structuring your life around exercise, you can do stair climbing, especially if you don't have the time. Aside from exercise, you can also slowly change your lifestyle and diet into foods that are good for your heart health. The American Heart Association suggests adding oatmeal, wheat berries, and quinoa to your diet to make it healthy. Details of the new study are issued in the journal Medicine & Science in Sports & Exercise. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | November 10, 2016
Site: www.nature.com

Rachel was working towards her PhD in 2008 when depression first threatened to derail her career. The psychologist was clocking 14- to 16-hour days to launch a study and was overseeing 12 research assistants. In her spare time, she was planning her wedding. For three weeks, she barely slept and subsisted on sweets and energy bars. Then came a crying spell that started at a sad theatre performance and turned into three days of uncontrollable sobbing. “I was sitting on my couch, staring at the wall and crying,” says Rachel, who requested that her name be changed for this article. The seeds of Rachel's depression pre-dated her PhD. “You are bombarded with messages before you even apply for PhD programmes — that it's hard to get in, that 50% don't finish, that it's hard to get postdocs, that it's impossible to get grants,” she says. “At the same time, you are surrounded by people who have PhDs. If you already have a tendency toward perfectionism or self-doubt, it feeds that really nicely.” She returned to work after a two-week break that included therapy and a prescription for antidepressants. After completing her dissertation, she landed an assistant-professor post at a university in New York. “If you had asked me at the time, I would have said, 'Oh no, I'm never finishing. I'm leaving academia,'” she says about her break. When she shared her feelings with her father, who also holds a PhD, he told her, “Welcome to science.” Depression and anxiety are widespread, including among scientists, who often face intense pressure to work long hours, publish in high-profile journals, win grants to support themselves and others and rebound after repeated rejections. Depression affects 350 million people around the world and is the leading cause of disability globally, according to the World Health Organization (WHO). Each year in the United States, almost 7% of adults, or an estimated 16 million people, have at least one major depressive episode. To be diagnosed with the condition, people must experience a minimum of five specific symptoms that impair functioning or cause significant distress almost every day for at least two weeks. One of those must be a persistently low mood (marked perhaps by a sense of emptiness or hopelessness) or a loss of pleasure or interest in almost all activities. But they might also include recurrent thoughts of death or significant weight loss, for example. The chance that a person will develop depression during their lifetime varies by nation — in the United States, it is 17%. Depression frequently goes hand-in-hand with anxieties or worries that are so excessive that they interfere with life. Such anxiety affects about 18% of US adults, or 40 million people. More than 25% of Europeans have some form of anxiety or depression, according to the WHO. Research on the prevalence of anxiety and depression specifically in scientists is scarce. But risks are probably comparable to those for the rest of the population, says Jerald Kay, a psychiatrist at Wright State University in Dayton, Ohio, and co-editor of Mental Health Care in the College Community (Wiley, 2010), whose practice has focused on physicians, university students and faculty members, including researchers. Some situations are more likely to lead to anxiety and depression. Graduate studies can be particularly tough, because students suddenly face high expectations and low salaries and find that their fates lie in the hands of advisers, who can even live in another country. In a 2014 survey of 790 graduate students at the University of California, Berkeley, almost half of PhD students met the criteria for depression, including up to 46% of those in a category that included biological and physical sciences. The stigma associated with mental illness can make many researchers cautious about revealing their struggles to anyone, let alone to superiors. Still, experts say that it's important to seek help, at least from professionals. “If you feel like you're the only one struggling with a problem, you think, 'It's my personal problem, it's my fault,'” says Joeri Tijdink, a psychiatrist at the VU University Medical Center in Amsterdam, “not a fault of the system.” Most universities have mental-health services that offer confidential help, although many researchers who have weathered the storm of depression list superiors and colleagues as sources of support. In a high-pressure career that values prestige but is rife with criticism, it helps to know that you're not alone (see 'Dealing with depression'). Shweta Ramdas struggled quietly with depression for several years. Originally from India and a graduate of the National University of Singapore, Ramdas found winters increasingly intolerable when she moved to the University of Michigan, Ann Arbor, to do a PhD in bioinformatics. On some days she would just stare at her computer, taking weeks to finish one-day tasks. Uninterested in food and tired of feeling unhappy, she thought about quitting. Ramdas finally told her department chair, who said that others had faced similar problems. Soon colleagues were telling her their own stories. “These were amazing people who I really admire,” she says. “And they did not seem from the outside to be depressed.” Ramdas spent eight months with family in India, where she saw a therapist. Her professors in Michigan told her to take as much time as she needed. She returned this autumn determined to set limits on work. Now she is talking to her supervisors about helping others who struggle with depression. “I feel like graduate schools can do a better job about getting this into the open a lot more,” Ramdas says. “I could have handled it better if I had known it wasn't just me.” Elizabeth Droge-Young experienced her first depressive episode in early 2012 while studying the mating systems of promiscuous beetles for a PhD at Syracuse University in New York. At first, she would sit on the couch in her pyjamas playing video games, watching films or listening to sad music and questioning the meaning of life. As time passed, she became unable to get to the lab or take showers. In 2014, she spent ten days in a hospital almost within view of her lab. “As my life started falling apart, science was really the last thing I held on to,” says Droge-Young, who earned her degree this year and is now a science writer. “It kept me going for quite some time, until my depression became too big an issue.” The transition to graduate studies can be jarring, says Matthew Wilkins, an evolutionary biologist at the University of Nebraska–Lincoln. When he started his PhD programme at the University of Colorado Boulder in 2008, he was caught unawares by the sudden expectation to be self-driven and by the ruthlessness of a career in science, in which successes are often punctuated by rejections — for grants, publications and jobs. That endless need for external validation can foster anxiety, adds Wilkins, who once received a disappointing score on a high-stakes exam — a week before landing a prestigious fellowship. “In academia, success is not guaranteed,” he says. “You recognize that it's going to be hard. I don't think you recognize that it's going to take a psychological toll on you.” Tijdink chose to study the psychological effects of publication pressure, partly because of conversations with therapists who treat scientists. “They feel so pressured,” the therapists told him. “They are exhausted. They are suspicious of people stealing their ideas. Or they feel that colleagues want their positions.” He wanted to make the problem more visible. In a survey of more than 400 medical academics in the Netherlands, published in 2013, Tijdink reported that nearly 25% met the criteria for burnout, which is defined as emotional exhaustion ( et al. PLoS ONE 8, e73381; 2013). Some scientists struggle when they venture beyond conventional research tracks. Paul Andrews, an evolutionary psychologist at McMaster University in Hamilton, Canada, says that when he was a postdoc, he thought his prospects were good because he had published well-cited papers in good journals. But he couldn't find a position that allowed him to specialize in the biological basis of depression. Frustrated, he lost his motivation to eat, sleep and exercise. And he obsessed about whether to try getting one big study into an influential journal or to churn out lots of smaller papers. Andrews took the riskier first approach, eventually publishing a paper in Psychological Review in 2009 ( and Psychol. Rev. 116, 620–654; 2009) that received lots of publicity, including a feature about his work in The New York Times Magazine early in 2010. Even after that, he had trouble getting interviews, despite submitting many applications. “I was like, 'What do I have to do to get a job?'” says Andrews, who was by then desperate, depressed and anxious. He still has recurring depressive symptoms when he struggles with obstacles at work. His research, which challenges mainstream ideas about depression as a disorder and the role of serotonin, also raises doubts about the value of antidepressants. He has found it hard to get his work published. Sometimes, research topics can induce dark thoughts, says Alejandro Frid, who started studying endangered deer in Chile in 1990 and later investigated the effects of marine fisheries on predator–prey interactions in Alaska and British Columbia. The more his research pointed to the damaging implications of climate change, the more angry and nihilistic he became. “By nihilism, I mean that there is no point in caring about the future because there really isn't one,” says Frid, who is now a science coordinator at the Central Coast Indigenous Resource Alliance near Vancouver, Canada, and wrote the book A World For My Daughter: An Ecologist's Search for Optimism (Caitlin, 2015). “It's all doom. Humans are destructive and we don't know any better. There's no real vision worth living for.” Depression has become a recurring topic of conversation among environmentalists. Frid has cultivated hopefulness by focusing on ecological resilience and the human capacity for problem solving. He is also working to influence policies and human behaviours that affect the environment — approaches that helped to reshape his career and brighten his outlook. Scientists can be wary of admitting to symptoms of depression or anxiety. But researchers who confide in colleagues say they're often surprised by the support they receive. Like Ramdas, Droge-Young found that when she overcame her fear of telling lab colleagues about her mental illness, others told similar stories. One had spent time in the same hospital. Faculty members contributed to a Kickstarter funding campaign for two art shows that describe her experience of depression and self-harm. Her adviser and his family attended. “People are really caring,” she says, “if you open up with your vulnerabilities.” Not everyone feels comfortable talking to their superiors, but they should really see a professional as early as possible, says Kay. “If you think you're struggling, that's a good reason to get help,” he says. And if one therapist doesn't seem like a good fit, find another, Droge-Young advises. Allowing time for outside interests can help to alleviate work-related anxiety. For Droge-Young, that means getting outside or throwing Oscars-watching parties. Wilkins likes to rock-climb, play football and run. He also recommends developing short-term projects with quick deadlines that aren't work-related. This year, he and a friend started entering — and winning — film competitions. Recognizing that it is normal and even helpful to feel down when faced with complex problems may also help scientists to cope, says Andrews. He sees his own bouts of depression not as a sign of a malfunctioning brain, but as a response to important problems. That response helps him to focus. When prompted by social problems or work stresses, he says, the body reallocates energy to the brain. The hypothalamus kicks in, suppressing libido and other physical drives and inducing a fixation on negative thoughts. Although such rumination is often seen as a bad thing, dwelling on a problem can actually help to solve it because it helps the mind to break it down into smaller components. Just like a scientist does, Andrews says.


News Article | February 15, 2017
Site: www.eurekalert.org

Hamilton, Ont., Canada. -- McMaster University's innovative experimental co-location between an academic research centre and a rapidly growing startup company has begun to yield successes. The university's Computing Infrastructure Research Centre (CIRC, which is a research centre in the Faculty of Engineering, shares space with its founding industry partner Cinnos Mission Critical Inc. at the McMaster Innovation Park. CIRC's team of researchers and students are focused on developing cutting-edge technologies for data centres. Cinnos is a technology start-up forged in the McMaster Innovation Ecosystem, and designs and sells appliances for rapid, low cost, and highly efficient deployment of scalable data centre facilities. Breaking with the traditional industry-academic research paradigm, Cinnos and McMaster decided to collocate their resources by forming CIRC. The space is designed such that researchers and students at CIRC mingle freely with Cinnos entrepreneurs, enabling a close alignment between the market opportunities and customer needs of the industry with research and technology. This seamless collaboration between the two organizations has already brought tremendously successful products into the market place, such as the Cinnos flagship Smart MCX, the world`s first data centre in a box, as well as the Smart MC-M, a modular, data-driven, intelligent monitoring system for computing facilities. "CIRC is founded on a pioneering model of university-industry collaboration," says Suvojit Ghosh, the centre's co-founder and Executive Director. "It magnifies the impact of research, through accelerated translation of research for both economic and societal benefits, in a competitive real-world environment. Further, our students not only get a deep and meaningful research experience, but they also learn about the importance of the customer needs and market opportunities in defining and driving that research. These are things that could not happen if CIRC and Cinnos did not share the same space and similar visions." "Thanks to our innovative model, Cinnos proprietary MCX has sales both in Canada and internationally in less than 18 months from our inception. In addition, we have recently raised over $2M in financing to fund our global expansion. We simply could not have achieved this feat without the world-class team of CIRC and the strong and unwavering support from McMaster University and the Faculty of Engineering," said Hussam Haroun, CEO and co-founder of Cinnos, and among the architects of CIRC. With ambitions to be a global leader in the data centre industry, Cinnos envisioned a strong R&D program from its inception. This manifested in six projects that are designed to transform archaic and wasteful practices in the data centre industry. They were architected in a close collaboration with the Faculty of Engineering at McMaster University. The projects are funded through over $3M committed by Cinnos, and augmented by grants from multiple Government agencies. Cinnos has developed and commercialized the world's first data centre appliance that enables immediate deployment and a pay-as-you-grow model for data centre providers. Furthermore, thanks to its proprietary modular design, The Cinnos Smart MCX™ enables immediate deployment of data centres for a fraction of the cost of traditional mission critical facilities (MCF), hence accelerating revenues and bringing dramatically higher ROI to our customers as compared with the traditional construction-based MCF. Founded by Hussam Haroun in June 2015 following his graduation from McMaster MEEI program, Cinnos achieved breakeven in less than twelve (12) months of operations. For more information, please visit http://cinnos. CIRC, or the Computing Infrastructure Research Centre at McMaster University, is the first research centre focused on data centre innovations in Canada. CIRC was founded earlier this year, and is mandated to develop, promote, and advocate for technologies and products that eliminate wasteful practices in data centres, addressing a $100B+ global industry. The R&D functions of CIRC are unique in their emphasis on market validation from the conceptions stage, ensuring research relevance and guaranteed economic, societal, and environmental impact. This has manifested in high ROI on R&D expenses: within the first year of its existence, CIRC has developed technology that has led to revenue generating product lines for Cinnos.


HAMILTON, Ontario--(BUSINESS WIRE)--Fusion Pharmaceuticals, a newly formed biopharmaceutical company developing targeted alpha-particle radiotherapeutics for treating cancer, today announced the closing of a $25 million Series A financing led by founding venture investor, Johnson & Johnson Innovation – JJDC, Inc., with investments by HealthCap, TPG Biotech, Genesys Capital and FACIT (Fight Against Cancer Innovation Trust). Targeted alpha-particle emitting radiotherapeutics combine the precision of molecular targeting agents, such as antibodies with the potency of alpha-particle emitting radioisotopes to specifically attack and eradicate cancer cells. The syndicate is strengthened by HealthCap’s specialized expertise in pioneering a new wave of successful radiotherapeutic companies, such as Algeta and Nordic Nanovector. Fusion Pharmaceuticals is a spinout from the Centre for Probe Development and Commercialization (CPDC), an organization that Dr. John Valliant, Ph.D., founded in 2008 and is a Centre of Excellence for Commercialization and Research (CECR) located at McMaster University in Hamilton, Ontario, Canada. The CPDC, which was created with the support of multiple stakeholders, including the Networks of Centres of Excellence (NCE) and the Ontario Institute for Cancer Research (OICR), has rapidly become a world leader in the development, translation and manufacturing of radiopharmaceuticals. In addition to Dr. Valliant, founder and chief executive officer, the company’s board of directors consists of Asish Xavier, Ph.D. (Johnson & Johnson Innovation – JJDC, Inc.), Robert Sutherland, Ph.D., Centre for Probe Development and Commercialization (CPDC), Eran Nadav, Ph.D. (TPG Biotech), Johan Christenson, M.D. (HealthCap) and Damian Lamb (Genesys), who will assume the role of chairman of the board. “Targeted delivery of medical isotopes that emit alpha particles can be used to kill tumor cells with remarkable precision and unprecedented potency, and it has the added potential of having complementary effects with treatments which activate the immune system,” said Dr. John Valliant, CEO. “Fusion is focused on combining our expertise in radiopharmaceutical development and production with the appropriate targeting molecules to create a new generation of therapeutics that can address the need for better cancer treatments. Fusion is proud to join a wave of new Canadian biotech companies that are being launched with innovative technologies emerging from research institutions like McMaster University.” Fusion Pharmaceuticals will use the financing proceeds to advance its lead program, FPX-01, into human clinical trials. FPX-01 is an antibody-targeted radiotherapy, which seeks out a specific biomarker of resistance that is present on nearly all types of treatment refractory cancers. The technology is designed to selectively deliver actinium-225 to tumor cells so that in conjunction with internalization, the alpha particles emitted will eradicate diseased tissue. In parallel, Fusion Pharmaceuticals gained access to a centyrin-based targeting molecule in preclinical development that has the potential to deliver isotopes to several cancer types and access to the centyrin protein targeting platform in two licensing agreements with Janssen Biotech, Inc. in transactions facilitated by Johnson & Johnson Innovation. Centyrins are protein targeting agents, proprietary to Janssen Biotech, characterized by high selectivity and specificity, combined with tunable pharmaceutical properties and efficient manufacturing. Fusion Pharmaceuticals is building its pipeline through access to the centyrin platform in combination with proprietary labeling technologies, which can be applied to a wide range of targeting molecules. Fusion Pharmaceuticals – A Product of a National Centre of Excellence with Comprehensive Sector Expertise Fusion Pharmaceuticals is a spin out from the Centre for Probe Development and Commercialization (CPDC), which is a Centre of Excellence for Commercialization and Research (CECR) located at McMaster University. The CPDC was created to take promising new technologies developed at Universities and use the arising knowledge advantages to realize economic and health benefits for Canadians. The CPDC, which employs over 80 people and has locations and major partnerships in Hamilton, Toronto, Ottawa and Boston, is supported by a range of stakeholders including the Networks of Centres of Excellence, the Ontario Institute for Cancer Research, McMaster University and several industry partners. See www.imagingprobes.ca for additional details. Fusion Pharmaceuticals was founded by Dr. John Valliant, who was also the founder and CEO of CPDC. Under Dr. Valliant’s direction, the CPDC supplied radiopharmaceuticals for over 40 clinical trials, facilitated the creation of three new companies, including building a rapidly expanding manufacturing business. Dr. Valliant, a Canada Research Chair in Medical Isotopes and Molecular Imaging Probes, is a Professor of Chemistry and Chemical Biology at McMaster University. He has won numerous awards including being selected as one of Canada’s top 40 under 40 in 2010. Fusion’s discovery and development programs are led by the chief scientific officer, Dr. Eric Burak, Ph.D. Eric previously held positions at CPDC, Theracos, Rib-X Pharmaceuticals and Guilford Pharmaceuticals. Eric oversees a world-class team of chemists and biologists who have extensive experience and unique skills in the alpha therapy field. Certain medical isotopes emit alpha particles, which are highly energetic ions that deposit their energy over very short distances traveling approximately the width of a single cell. When alpha emitting medical isotopes are delivered to cancer cells, they can kill tumor cells through multiple mechanisms including double stranded DNA breaks, which makes repair and hence resistance unlikely. Targeted alpha therapeutics use significantly smaller amounts of material than typical antibody-drug conjugates making it possible to exploit a wider array of drug targets and they do not require complex linkers to release the warhead. One of the additional benefits of Fusion’s alpha therapeutic approach will be creation of a companion diagnostic with each candidate. Fusion Pharmaceuticals is a new pharmaceutical company located in Hamilton, Ontario, Canada focused on becoming the leader in the targeted alpha therapy field. Fusion will exploit its unique expertise in linking medical isotopes to targeting molecules to create highly effective therapeutics. In addition to its lead program, FPX-01, Fusion is building a pipeline of products through a protein discovery platform, that allows for the rapid screening of new targeting molecules to promote biomarker localization of alpha emitting medical isotopes. Fusion’s technology development team also has proprietary methods for introducing alpha emitters into targeting molecules. (http://www.fusionpharma.com)


News Article | February 15, 2017
Site: www.eurekalert.org

Here are summaries of research to be presented by CIFAR fellows at the 2017 AAAS meeting in Boston, MA from Feb. 16-19. CIFAR Humans & the Microbiome Program Co-Director Janet Rossant (Hospital for Sick Children) will moderate a discussion on the microbes that inhabit humans -- collectively called the microbiome. Program Co-Director Brett Finlay (University of British Columbia) will speak on the role of the microbiome in early childhood. Senior Fellow Eran Elinav (Weizmann Institute of Science) will delve into how genes, diet and microbiomes interact. Ana Duggan of Senior Fellow Hendrik Poinar's lab (McMaster University) will describe how they reconstruct ancient genomes and microbiomes. CIFAR Azrieli Brain, Mind & Consciousness Senior Fellow Sheena Josselyn (Hospital for Sick Children) brings together leaders in the field of memory research, approaching the expansive question of the temporal component of memory using unique tools. Josselyn recently discovered the neural rules for separating emotional memories across the temporal context in the amygdala, and will discuss how this process may go awry with psychiatric conditions. Eran Elinav, a Senior Fellow in CIFAR's Humans & the Microbiome program, will answer questions about how the microbiome affects humans (especially in regards to their diet) as well as how it can affect entire societies--shaping them through both common diseases and pandemics. A quantum mechanical representation of information could enable revolutionary technologies, from fast computation to unbreakable encryption. CIFAR Senior Fellow in the Quantum Information Science program Michele Mosca (University of Waterloo) will discuss cybersecurity in an era with quantum computers. Associate Fellow in the Quantum Information Science program Scott Aaronson (University of Texas) will speak on how quantum research is deepening our understanding of physics and mathematics. CIFAR creates knowledge that is transforming our world. Established in 1982, the Institute brings together interdisciplinary groups of extraordinary researchers from around the globe to address questions and challenges of importance to the world. Our networks help support the growth of research leaders and are catalysts for change in business, government and society. CIFAR is generously supported by the governments of Canada, British Columbia, Alberta, Ontario and Quebec, Canadian and international partners, as well as individuals, foundations and corporations.


News Article | April 29, 2016
Site: www.biosciencetechnology.com

People often complain they don’t have time to exercise or fit a work-out routine into their busy schedules, but a new study may throw that excuse out of the window.  Researchers at McMaster University in Canada say just one minute of high intensity exercise results in similar health benefits as 45 minutes of moderate-intensity training. For the study researchers randomly assigned 27 out of shape men to either sprint interval training (SIT), moderate-intensity continuous training (MICT) or a control group that did not exercise.  Those in the SIT and MICT groups performed three days of training each week for 12 weeks.  At the beginning of the study researchers examined the men’s cardiorespiratory fitness and their insulin sensitivity to see how well the body regulates sugar. The MICT interval training involved 45 minutes of continuous cycling on a stationary bicycle with a two-minute warm-up and three-minute cool down.  The SIT training totaled 10 minutes of cycling, with only one of those minutes at high intensity. Specifically it involved a two-minute warm up; then 20 seconds of intense cycling; followed by two minutes of riding at a slow pace; 20 more seconds of all-out pedaling; two minutes of recovery riding;  a final 20-second sprint; then a three minute cool down. At the end of the 12 weeks the researchers found the two groups saw remarkably similar health benefits, despite the MICT group performing five times as much exercise, 27 hours of riding, as the SIT group, who only exercised for a total of 6 hours – with 36 minutes of high intensity. The New York Times reported that both groups saw significant improvements in insulin resistance, and both increased endurance by almost 20 percent. “Our study shows that an interval-based approach can be more efficient – you can get health and fitness benefits comparable to the traditional approach, in less time,” lead study author Martin Gibala, professor of Kinesiology at McMaster, said in a prepared statement. The findings were published April 26 in PLOS One.


News Article | April 27, 2016
Site: www.nature.com

NOD/SCID Il2rgnull mice (Jackson Laboratory) were bred and maintained in the Stem Cell Unit animal barrier facility at McMaster University. All procedures were approved by the Animal Research Ethics Board at McMaster University. All patient samples were obtained with informed consent and with the approval of local human subject research ethics boards at McMaster University. Human umbilical cord blood mononuclear cells were collected by centrifugation with Ficoll-Paque Plus (GE), followed by red blood cell lysis with ammonium chloride (StemCell Technologies). Cells were then incubated with a cocktail of lineage-specific antibodies (CD2, CD3, CD11b, CD11c, CD14, CD16, CD19, CD24, CD56, CD61, CD66b, and GlyA; StemCell Technologies) for negative selection of Lin− cells using an EasySep immunomagnetic column (StemCell Technologies). Live cells were discriminated on the basis of cell size, granularity and, as needed, absence of viability dye 7-AAD (BD Biosciences) uptake. All flow cytometry analysis was performed using a BD LSR II instrument (BD Biosciences). Data acquisition was conducted using BD FACSDiva software (BD Biosciences) and analysis was performed using FlowJo software (Tree Star). To quantify MSI2 expression in human HSPCs, Lin− cord blood cells were stained with the appropriate antibody combinations to resolve HSC (CD34+ CD38− CD45RA− CD90+), MPP (CD34+ CD38− CD45RA− CD90−), CMP (CD34+ CD38+ CD71−) and EP (CD34+ CD38+ CD71+) fractions as similarly described previously18, 19 with all antibodies from BD Biosciences: CD45RA (HI100), CD90 (5E10), CD34 (581), CD38 (HB7) and CD71 (M-A712). Cell viability was assessed using the viability dye 7AAD (BD Biosciences). All cell subsets were isolated using a BD FACSAria II cell sorter (BD Biosciences) or a MoFlo XDP cell sorter (Beckman Coulter). HemaExplorer20 analysis was used to confirm MSI2 expression in human HSPCs and across the hierarchy. For all qRT–PCR determinations total cellular RNA was isolated with TRIzol LS reagent according to the manufacturer’s instructions (Invitrogen) and cDNA was synthesized using the qScript cDNA Synthesis Kit (Quanta Biosciences). qRT–PCR was done in triplicate with PerfeCTa qPCR SuperMix Low ROX (Quanta Biosciences) with gene-specific probes (Universal Probe Library (UPL), Roche) and primers: MSI2 UPL-26, F-GGCAGCAAGAGGATCAGG, R-CCGTAGAGATCGGCGACA; HSP90 UPL-46, F-GGGCAACACCTCTACAAGGA, R-CTTGGGTCTGGGTTTCCTC; CYP1B1 UPL-20, F-ACGTACCGGCCACTATCACT, R-CTCGAGTCTGCACATCAGGA; GAPDH UPL-60, F-AGCCACATCGCTCAGACAC, R-GCCCAATACGACCAAATCC; ACTB (UPL Set Reference Gene Assays, Roche). The mRNA content of samples compared by qRT–PCR was normalized based on the amplification of GAPDH or ACTB. MSI2 shRNAs were designed with the Dharmacon algorithm (http://www.dharmacon.com). Predicted sequences were synthesized as complimentary oligonucleotides, annealed and cloned downstream of the H1 promoter of the modfied cppt-PGK-EGFP-IRES-PAC-WPRE lentiviral expression vector18. Sequences for the MSI2 targeting and control RFP targeting shRNAs were as follows: shMSI2, 5′-GAGAGATCCCACTACGAAA-3′; shRFP, 5′-GTGGGAGCGCGTGATGAAC-3′. Human MSI2 cDNA (BC001526; Open Biosystems) was subcloned into the MA bi-directional lentiviral expression vector21. Human CYP1B1 cDNA (BC012049; Open Biosystems) was cloned in to psMALB22. All lentiviruses were prepared by transient transfection of 293FT (Invitrogen) cells with pMD2.G and psPAX2 packaging plasmids (Addgene) to create VSV-G pseudotyped lentiviral particles. All viral preparations were titrated on HeLa cells before use on cord blood. Standard SDS–PAGE and western blotting procedures were performed to validate the effects of knockdown on transduced NB4 cells (DSMZ) and overexpression on 293FT cells. Immunoblotting was performed with anti-MSI2 rabbit monoclonal IgG (EP1305Y, Epitomics) and β-actin mouse monoclonal IgG (ACTBD11B7, Santa Cruz Biotechnology) antibodies. Secondary antibodies used were IRDye 680 goat anti-rabbit IgG and IRDye 800 goat anti-mouse IgG (LI-COR). 293FT and NB4 cell lines tested negative for mycoplasma. NB4 cells were authenticated by ATRA treatment before use. Cord blood transductions were conducted as described previously18, 23. Briefly, thawed Lin− cord blood or flow-sorted Lin− CD34+ CD38− or Lin− CD34+ CD38+ cells were prestimulated for 8–12 h in StemSpan medium (StemCell Technologies) supplemented with growth factors interleukin 6 (IL-6; 20 ng ml−1, Peprotech), stem cell factor (SCF; 100 ng ml−1, R&D Systems), Flt3 ligand (FLT3-L; 100 ng ml−1, R&D Systems) and thrombopoietin (TPO; 20 ng ml−1, Peprotech). Lentivirus was then added in the same medium at a multiplicity of infection of 30–100 for 24 h. Cells were then given 2 days after transduction before use in in vitro or in vivo assays. For in vitro cord blood studies biological (experimental) replicates were performed with three independent cord blood samples. Human clonogenic progenitor cell assays were done in semi-solid methylcellulose medium (Methocult H4434; StemCell Technologies) with flow-sorted GFP+ cells post transduction (500 cells per ml) or from day seven cultured transduced cells (12,000 cells per ml). Colony counts were carried out after 14 days of incubation. CFU-GEMMs can seed secondary colonies owing to their limited self-renewal potential24. Replating of MSI2-overexpressing and control CFU-GEMMs for secondary CFU analysis was performed by picking single CFU-GEMMs at day 14 and disassociating colonies by vortexing. Cells were spun and resuspended in fresh methocult, mixed with a blunt-ended needle and syringe, and then plated into single wells of a 24-well plate. Secondary CFU analysis for shMSI2- and shControl-expressing cells was performed by harvesting total colony growth from a single dish (as nearly equivalent numbers of CFU-GEMMs were present in each dish), resuspending cells in fresh methocult by mixing vigorously with a blunt-ended needle and syringe and then plating into replicate 35-mm tissue culture dishes. In both protocols, secondary colony counts were done following incubation for 10 days. For primary and secondary colony forming assays performed with the AHR agonist FICZ (Santa Cruz Biotechnology), 200 nM FICZ or 0.1% DMSO was added directly to H4434 methocult medium. Two-way ANOVA analysis was performed to compare secondary CFU output and FICZ treatment for MSI2-overexpressing or control conditions. Colonies were imaged with a Q-Colour3 digital camera (Olympus) mounted to an Olympus IX5 microscope with a 10× objective lens. Image-Pro Plus imaging software (Media Cybernetics) was used to acquire pictures and subsequent image processing was performed with ImageJ software (NIH). Transduced human Lin− cord blood cells were sorted for GFP expression and seeded at a density of 105 cells per ml in IMDM 10% FBS supplemented with human growth factors IL-6 (10 ng ml−1), SCF (50 ng ml−1), FLT3-L (50 ng ml−1), and TPO (20 ng ml−1) as previously described25. To generate growth curves, every seven days cells were counted, washed, and resuspended in fresh medium with growth factors at a density of 105 cells per ml. Cells from suspension cultures were also used in clonogenic progenitor, cell cycle and apoptosis assays. Experiments performed on transduced Lin− CD34+ cord blood cells used serum-free conditions as described in the cord blood transduction subsection of Methods. For in vitro cord blood studies, biological (experimental) replicates were performed with three independent cord blood samples. Cell cycle progression was monitored with the addition of BrdU to day 10 suspension cultures at a final concentration of 10 μM. After 3 h of incubation, cells were assayed with the BrdU Flow Kit (BD Biosciences) according to the manufacturer’s protocol. Cell proliferation and quiescence were measured using Ki67 (BD Bioscience) and Hoechst 33342 (Sigma) on day 4 suspension cultures after fixing and permeabilizing cells with the Cytofix/Cytoperm kit (BD Biosciences). For apoptosis analysis, Annexin V (Invitrogen) and 7-AAD (BD Bioscience) staining of day 7 suspension cultures was performed according to the manufacturer’s protocol. Lin− cord blood cells were initially stained with anti-CD34 PE (581) and anit-CD38 APC (HB7) antibodies (BD Biosciences) then fixed with the Cytofix/Cytoperm kit (BD Biosciences) according to the manufacturer’s instructions. Fixed and permeabilized cells were immunostained with anti-MSI2 rabbit monoclonal IgG antibody (EP1305Y, Abcam) and detected by Alexa-488 goat anti-rabbit IgG antibody (Invitrogen). CD34+ cells were transduced with an MSI2-overexpression or MSI2-knockdown lentivirus along with their corresponding controls and sorted for GFP expression 3 days later. Transductions for MSI2 overexpression or knockdown were each performed on two independent cord blood samples. Total RNA from transduced cells (>1 × 105) was isolated using TRIzol LS as recommended by the manufacturer (Invitrogen), and then further purified using RNeasy columns (Qiagen). Sample quality was assessed using Bioanalyzer RNA Nano chips (Agilent). Paired-end, barcoded RNA-seq sequencing libraries were then generated using the TruSeq RNA Sample Prep Kit (v2) (Illumina) following the manufacturer’s protocols starting from 1 μg total RNA. The quality of library generation was then assessed using a Bioanalyzer platform (Agilent) and Illumina MiSeq-QC run was performed or quantified by qPCR using KAPA quantification kit (KAPA Biosystems). Sequencing was performed using an Illumina HiSeq2000 using TruSeq SBS v3 chemistry at the Institute for Research in Immunology and Cancer’s Genomics Platform (University of Montreal) with cluster density targeted at 750,000 clusters per mm2 and paired-end 2 × 100-bp read lengths. For each sample, 90–95 million reads were produced and mapped to the hg19 (GRCh37) human genome assembly using CASAVA (version 1.8). Read counts generated by CASAVA were processed in EdgeR (edgeR_3.12.0, R 3.2.2) using TMM normalization, paired design, and estimation of differential expression using a generalized linear model (glmFit). The false discovery rate (FDR) was calculated from the output P values using the Benjamini–Hochberg method. The fold change of logarithm of base 2 of TMM normalized data (logFC) was used to rank the data from top upregulated to top downregulated genes and FDR (0.05) was used to define significantly differentially expressed genes. RNA-seq data have been deposited in NCBI’s Gene Expression Omnibus (GEO) and are accessible through GEO Series accession number GSE70685. iRegulon26 was used to retrieve the top 100 AHR predicted targets with a minimal occurrence count threshold of 5. The data were analysed using GSEA27 with ranked data as input with parameters set to 2,000 gene-set permutations. The GEO dataset GSE28359, which contains Affymetrix Human Genome U133 Plus 2.0 Array gene expression data for CD34+ cells treated with SR1 at 30 nM, 100 nM, 300 nM and 1,000 nM was used to obtain lists of genes differentially expressed in the treated samples compared to the control ones (0 nM)2. Data were background corrected using Robust Multi-Array Average (RMA) and quantile normalized using the expresso() function of the affy Bioconductor package (affy_1.38.1, R 3.0.1). Lists of genes were created from the 150 top upregulated and downregulated genes from the SR1-treated samples at each dose compared to the non-treated samples (0 nM). The data were analysed using GSEA with ranked data as input with parameters set to 2,000 gene-set permutations. The normalized enrichment score (NES) and false discovery rate (FDR) were calculated for each comparison. The GEO data set GSE24759, which contains Affymetrix GeneChip HT-HG_U133A Early Access Array gene expression data for 38 distinct haematopoietic cell states4, was compared to the MSI2 overexpression and knockdown data. GSE24759 data were background corrected using Robust Multi-Array Average (RMA), quantile normalized using the expresso() function of the affy Bioconductor package (affy_1.38.1, R 3.0.1), batch corrected using the ComBat() function of the sva package (sva_3.6.0) and scaled using the standard score. Bar graphs were created by calculating for significantly differentially expressed genes the number of scaled data that were above (>0) or below (<0) the mean for each population. Percentages indicating for how long the observed value (set of up- or downregulated genes) was better represented in that population than random values were calculated from 1,000 trials. A unique list of genes closest to AHR-bound regions previously identified from TCDD-treated MCF7 ChIP–seq data14 was used to calculate the overlap with genes showing >1.5-fold downregulation in response to treatment with UM171 (35 nM) or SR1 (500 nM) relative to DMSO-treated samples3 as well as with genes significantly downregulated in MSI2-overexpressing versus control treated samples (FDR < 0.05). The percentage of downregulated genes with AHR-bound regions was then plotted for each gene set. P values were generated with Fisher’s exact test for comparisons between gene lists. AHR transcription factor binding sites in downregulated gene sets were identified with oPOSSUM-328. Genes showing >1.5-fold downregulation in response to treatment with UM171 (35 nM) or SR1 (500 nM) relative to DMSO-treated samples3 were used along with significantly downregulated genes (FDR < 0.05) with EdgeR-analysed MSI2-overexpressing versus control-treated samples. The three gene lists were uploaded into oPOSSUM-3 and the AHR:ARNT transcription factor binding site profile was used with the matrix score threshold set at 80% to analyse the region 1,500 bp upstream and 1,000 bp downstream of the transcription start site. The percentage of downregulated genes with AHR-binding sites in their promoters was then plotted for each gene set. Fisher’s exact test was used to identify significant overrepresentation of AHR-binding sites in gene lists relative to background. Eight- to 12-week-old male or female NSG mice were sublethally irradiated (315 cGy) one day before intrafemoral injection with transduced cells carried in IMDM 1% FBS at 25 μl per mouse. Injected mice were analysed for human haematopoietic engraftment 12–14 weeks after transplantation or at 3 and 6.5 weeks for STRC experiments. Mouse bones (femurs, tibiae and pelvis) and spleen were removed and bones were crushed with a mortar and pestle then filtered into single-cell suspensions. Bone marrow and spleen cells were blocked with mouse Fc block (BD Biosciences) and human IgG (Sigma) and then stained with fluorochrome-conjugated antibodies specific to human haematopoietic cells. For multilineage engraftment analysis, cells from mice were stained with CD45 (HI30) (Invitrogen), CD33 (P67.6), CD15 (HI98), CD14 (MφP9), CD19 (HIB19), CD235a/GlyA (GA-R2), CD41a (HIP8) and CD34 (581) (BD Biosciences). For MSI2 knockdown in HSCs, 5.0 × 104 and 2.5 × 104 sorted Lin− CD34+ CD38− cells were used per short-hairpin transduction experiment, leading to transplantation of day zero equivalent cell doses of 10 × 103 and 6.25 × 103, respectively, per mouse. For STRC LDA transplantation experiments, 105 sorted CD34+CD38+ cells were used per control or MSI2-overexpressing transduction. After assessing levels of gene transfer, day zero equivalent GFP+ cell doses were calculated to perform the LDA. Recipients with greater than 0.1% GFP+CD45+/− cells were considered to be repopulated. For STRC experiments that read out extended engraftment at 6.5 weeks, 2 × 105 CD34+ CD38+ cells were used per overexpressing or control transduction to allow non-limiting 5 × 104 day zero equivalent cell doses per mouse. For HSC expansion and LDA experiments, CD34+CD38− cells were sorted and transduced with MSI2-overexpressing or control vectors (50,000 cells per condition) for 3 days and then analysed for gene-transfer levels (% GFP+/−) and primitive cell marker expression (% CD34 and CD133). To ensure that equal numbers of GFP+ cells were transplanted into both control and MSI2-overexpressing recipient mice, we added identically cultured GFP− cells to the MSI2 culture to match the % GFP+ of the control culture (necessary owing to the differing efficiency of transduction). The adjusted MSI2-overexpressing culture was recounted and aliquoted (63,000 cells) to match the output of half of the control culture. Three day 0 equivalent GFP+ cell doses (1,000, 300 and 62 cells) were then transplanted per mouse to perform the D3 primary LDA. A second aliquot of the adjusted MSI2-overexpressing culture was then taken and put into culture in parallel with the remaining half of the control culture to perform another LDA after 7 days of growth (10 days total growth, D10 primary LDA). Altogether, four cell doses were transplanted; when converted back to day 0 equivalents these equalled approximately 1,000, 250, 100, and 20 GFP+ cells per mouse, respectively. Pooled bone marrow from six engrafted primary mice that received D10 cultured control or MSI2-overexpressing cells (from the two highest doses transplanted) was aliquoted into five cell doses of 15 million, 10 million, 6 million, 2 million and 1 million cells. The numbers of GFP+ cells within primary mice was estimated from nucleated cell counts obtained from NSG femurs, tibias and pelvises and from Colvin et al.29. The actual numbers of GFP+ cells used for determining numbers of GFP+ HSCs and the number of mice transplanted for all LDA experiments is shown in Supplementary Tables 3–5. The cut-off for HSC engraftment was a demonstration of multilineage reconstitution that was set at bone marrow having >0.1% GFP+ CD33+ and >0.1% GFP+ CD19+ cells. HSC and STRC frequency was assessed using ELDA software30. For all mouse transplantation experiments, mice were age- (6–12 week) and sex-matched. All transplanted mice were included for analysis unless mice died from radiation sickness before the experimental endpoint. No randomization or blinding was performed for animal experiments. Approximately 3–6 mice were used per cell dose for each cord blood transduction and transplantation experiment. CLIP–seq was performed as previously described15. Briefly, 25 million NB4 cells (a transformed human cell line of haematopoietic origin) were washed in PBS and UV-cross-linked at 400 mJ cm−2 on ice. Cells were pelleted, lysed in wash buffer (PBS, 0.1% SDS, 0.5% Na-deoxycholate, 0.5% NP-40) and DNase-treated, and supernatants from lysates were collected for immunoprecipitation. MSI2 was immunoprecipitated overnight using 5 μg of anti-MSI2 antibody (EP1305Y, Abcam) and Protein A Dynabeads (Invitrogen). Beads containing immunoprecipated RNA were washed twice with wash buffer, high-salt wash buffer (5× PBS, 0.1% SDS, 0.5% Na-Deoxycholate, 0.5% NP-40), and PNK buffer (50 mM Tris-Cl pH 7.4, 10 mM MgCl , 0.5% NP-40). Samples were then treated with 0.2 U MNase for 5 min at 37° with shaking to trim immunopreciptated RNA. MNase inactivation was then carried out with PNK + EGTA buffer (50 mM Tris-Cl pH 7.4, 20 mM EGTA, 0.5% NP-40). The sample was dephosphorylated using alkaline phosphatase (CIP, NEB) at 37° for 10 min followed by washing with PNK+EGTA, PNK buffer, and then 0.1 mg ml−1 BSA in nuclease-free water. 3′RNA linker ligation was performed at 16° overnight with the following adaptor: 5′P-UGGAAUUCUCGGGUGCCAAGG-puromycin. Samples were then washed with PNK buffer, radiolabelled using P32-y-ATP (Perkin Elmer), run on a 4–12% Bis-Tris gel and then transferred to a nitrocellulose membrane. The nitrocellulose membrane was developed via autoradiography and RNA–protein complexes 15–20 kDa above the molecular weight of MSI2 were extracted with proteinase K followed by RNA extraction with acid phenol-chloroform. A 5′RNA linker (5′HO-GUUCAGAGUUCUACAGUCCGACGAUC-OH) was ligated to the extracted RNA using T4 RNA ligase (Fermentas) for 2 h and the RNA was again purified using acid phenol-chloroform. Adaptor ligated RNA was re-suspended in nuclease-free water and reverse transcribed using Superscript III reverse transcriptase (Invitrogen). Twenty cycles of PCR were performed using NEB Phusion Polymerase using a 3′PCR primer that contained a unique Illumina barcode sequence. PCR products were run on an 8% TBE gel. Products ranging between 150 and 200 bp were extracted using the QIAquick gel extraction kit (Qiagen) and re-suspended in nuclease-free water. Two separate libraries were prepared and sent for single-end 50-bp Illumina sequencing at the Institute for Genomic Medicine at the University of California, San Diego. 47,098,127 reads from the first library passed quality filtering, of which 73.83% mapped uniquely to the human genome. 57,970,220 reads from the second library passed quality filtering, of which 69.53% mapped uniquely to the human genome. CLIP-data reproducibility was verified through high correlation between gene RPKMs and statistically significant overlaps in the clusters and genes within replicates. CLIP–seq data have been deposited in NCBI’s GEO and are accessible through GEO Series accession number GSE69583. Before sequence alignment of CLIP–seq reads to the human genome was performed, sequencing reads from libraries were trimmed of polyA tails, adapters, and low quality ends using Cutadapt with parameters–match-read-wildcards–times 2 -e 0 -O 5–quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT. Reads were then mapped against a database of repetitive elements derived from RepBase (version 18.05). Bowtie (version 1.0.0) with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences31. Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (version 2.3.0e)32 with parameters–outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1. To identify clusters in the genome of significantly enriched CLIP–seq reads, reads that were PCR replicates were removed from each CLIP–seq library using a custom script of the same method as in ref. 33; otherwise, reads were kept at each nucleotide position when more than one read’s 5′-end was mapped. Clusters were then assigned using the CLIPper software with parameters–bonferroni–superlocal–threshold-34. The ranked list of significant targets was calculated assuming a Poisson distribution, where the observed value is the number of reads in the cluster, and the background is the number of reads across the entire transcript and or across a window of 1000 bp ± the predicted cluster. Transcriptomic regions and gene classes were defined using annotations found in gencode v17. Depending on the analysis, clusters were associated by the Gencode-annotated 5′UTR, 3′UTR, CDS or intronic regions. If a cluster overlapped multiple regions, or a single part of a transcript was annotated as multiple regions, clusters were iteratively assigned first as CDS, then 3′UTR, 5′UTR and finally as proximal (<500 bases from an exon) or distal (>500 bases from an exon) introns. Overlapping peaks were calculated using bedtools and pybedtools35, 36. Significantly enriched gene ontology (GO) terms were identified using a hypergeometric test that compared the number of genes that were MSI2 targets in each GO term to genes expressed in each GO term as the proper background. Expressed genes were identified using the control samples in SRA study SRP012062. Mapping was performed identically to CLIP–seq mapping, without peak calling and changing the STAR parameter outFilterMultimapNmax to 10. Counts were calculated with featureCounts37 and RPKMs were then computed. Only genes with a mean RPKM > 1 between the two samples were used in the background expressed set. Randomly located clusters within the same genic regions as predicted MSI2 clusters were used to calculate a background distribution for motif and conservation analyses. Motif analysis was performed using the HOMER algorithm as in ref. 34. For evolutionary sequence conservation analysis, the mean (mammalian) phastCons score for each cluster was used. CD34+ cells (>5 × 104) were transduced with an MSI2-overexpression or control lentivirus. Three days later, GFP+ cells were sorted and then put back in to StemSpan medium containing growth factors IL-6 (20 ng ml−1), SCF (100 ng ml−1), FLT3-L (100 ng ml−1) and TPO (20 ng ml−1). A minimum of 10,000 cells were used for immunostaining at culture days 3 and 7 after GFP sorting. Cells were fixed in 2% PFA for 10 min, washed with PBS and then cytospun on to glass slides. Cytospun cells were then permeabilized (PBS, 0.2% Triton X-100) for 20 min, blocked (PBS, 0.1% saponin, 10% donkey serum) for 30 min and stained with primary antibodies (CYP1B1 (EPR14972, Abcam); HSP90 (68/hsp90, BD Biosciences)) in PBS with 10% donkey serum for 1 h. Detection with secondary antibody was performed in PBS 10% donkey serum with Alexa-647 donkey anti-rabbit antibody or Alexa-647 donkey anti-mouse antibodies for 45 min. Slides were mounted with Prolong Gold Antifade containing DAPI (Invitrogen). Several images (200–1,000 cells total) were captured per slide at 20× magnification using an Operetta HCS Reader (Perkin Elmer) with epifluorescence illumination and standard filter sets. Columbus software (Perkin Elmer) was used to automate the identification of nuclei and cytoplasm boundaries in order to quantify mean cell fluorescence. A 271-bp region of the CYP1B1 3′UTR that flanked CLIP–seq-identified MSI2-binding sites was cloned from human HEK293FT genomic DNA using the forward primer GTGACACAACTGTGTGATTAAAAGG and reverse primer TGATTTTTATTATTTTGGT AATGGTG and placed downstream of renilla luciferase in the dual-luciferase reporter vector pGL4 (Promega). A 271-bp geneblock (IDT) with 6 TAG > TCC mutations was cloned in to pGL4 using XbaI and NotI. The HSP90 3′UTR was amplified from HEK293FT genomic DNA with the forward primer TCTCTGGCTGAGGGATGACT and reverse primer TTTTAAGGCCAAGGAATTAAGTGA and cloned into pGL4. A geneblock of the HSP90 3′UTR (IDT) with 14 TAG > TCC mutations was cloned in to pGL4 using SfaAI and NotI. Co-transfection of wild-type or mutant luciferase reporter (40 ng) and control or MSI2-overexpressing lentiviral expression vector (100 ng) was performed in the NIH-3T3 cell line, which does not express MSI1 or MSI2 (50,000 cells per co-transfection). Reporter activity was measured using the Dual-Luciferase Reporter Assay System (Promega) 36–40 h later. For MSI2-overexpressing cultures with the AHR antagonist SR1, Lin− CD34+ cells were transduced with MSI2-overexpression or control lentivirus in medium supplemented with SR1 (750 nM; Abcam) or DMSO vehicle (0.1%). GFP+ cells were isolated (20,000 cells per culture) and allowed to proliferate with or without SR1 for an additional 7 days at which point they were counted and immunophenotyped for CD34 and CD133 expression. For MSI2-overexpressing cultures with the AHR agonist FICZ, Lin− CD34+ cells were transduced with MSI2-overexpression or control lentivirus. GFP+ cells were isolated (20,000 cells per culture) and allowed to proliferate with FICZ (200 nM; Santa Cruz Biotechnology) or DMSO (0.1%) for an additional 3 days, at which point they were immunophenotyped for CD34 and CD133 expression. Lin− CD34+ cells were cultured for 72 h (lentiviral treated but non-transduced flow-sorted GFP− cells) in StemSpan medium containing growth factors IL-6 (20 ng ml−1), SCF (100 ng ml−1), FLT3-L (100 ng ml−1) and TPO (20 ng ml−1) before the addition of the CYP1B1 inhibitor TMS (Abcam) at a concentration of 10 μM or mock treatment with 0.1% DMSO. Equal numbers of cells (12,000 per condition) were then allowed to proliferate for 7 days at which point they were counted and immunophenotyped for CD34 and CD133 expression. Unless stated otherwise (that is, analysis of RNA–seq and CLIP–seq data sets), all statistical analysis was performed using GraphPad Prism (GraphPad Software version 5.0). Unpaired student t-tests or Mann–Whitney tests were performed with P < 0.05 as the cut-off for statistical significance. No statistical methods were used to predetermine sample size.


Approximately 250 leading scientists and medical specialists from all over the world are meeting at the Royal Tropical Institute (KIT) in Amsterdam on December 1st and 2nd to discuss the influence of intestinal bacteria on the brain. The enormous enthusiasm for the Mind, Mood & Microbes conference shows that gut-brain communication is a hot topic. A human body contains more bacterial than human cells. Thanks to modern technology, we are increasingly able to determine what kinds of bacteria reside in the intestine and what effect they have on the body and brain. During the Mind, Mood & Microbes conference, neuropharmacologist Prof. Dr. John F. Cryan of University College Cork in Ireland will give a lecture on the influence of these intestinal bacteria (also called gut microbiota) on our brain. According to the professor, the composition of the gut microbiota and how they influence the brain via different substances/hormones is determined by different factors, such as; mode of delivery (cesarean section or vaginally), stress, use of antibiotics, and other environmental factors also play an important role. In the last ten years, there has been an enormous increase in fundamental research in this field. According to Cryan, your brain can't function normally without your gut microbiota.[1] Research with mice, for example, shows that sterile mice (without intestinal bacteria) exhibit abnormal behavior; they are anxious, less social and even show autistic-like behaviour. In addition, they have various structural changes in their brain that indicate the importance of bacteria in the intestines. It teaches us that microorganisms are necessary for the normal development of the brain. A disturbance in the gut microbiota may be connected with certain brain disorders. A lot of research is being conducted on the mechanisms how intestinal bacteria affect brain health and -function. Communication seems to take place via, among other things, neurons and messenger substances. Recent research shows that the composition of intestinal bacteria in patients with various brain disorders is different than the composition in healthy people.[2],[3] Professor Cryan sees potential in the use of beneficial bacteria (in other words, probiotics) for brain health. Now, clinical research is upcoming, in this way we can further unravel which microbial interventions have the desired effect in which type of patients. By bridging the gap between fundamental research and clinical practice during the Mind, Mood & Microbes conference, this will potentially lead to new, targeted therapies in the future. So-called 'psychobiotics' could play a role in the treatment of various neurological and psychiatric disorders, such as; depression, anxiety disorders, ADHD, aggression, Parkinson's, schizophrenia, autism and Alzheimer's disorders. The first results in humans have been published in anxiety, depression, and schizophrenia.[4]-[6] Some of these specific probiotics are already on the market. The international Mind, Mood & Microbes conference lasts two days and will start on Thursday at 8:30 with lectures by Prof. Dr. Cryan and professor of psychiatry Iris Sommer. There are also other renowed speakers, such as Prof. Dr. Jane Foster (McMaster University, Canada), Prof. Dr. Ted Dinan (Cork, Ireland), Dr. Francisco Quintana (Harvard, America) and many others. More information about the conference can be found at: http://www.mindmoodmicrobes.org 1. Cryan and T. G. Dinan (2016). "Transferring the blues: Depression-associated gut microbiota induces neurobehavioural changes in the rat." J Psychiatr Res 82: 109-118. 2. Scheperjans, F., V. Aho, P. A. Pereira, K. Koskinen, L. Paulin, E. Pekkonen, E. Haapaniemi, S. Kaakkola, J. Eerola-Rautio, M. Pohja, E. Kinnunen, K. Murros and P. Auvinen (2014). "Gut microbiota are related to Parkinson's disease and clinical phenotype." Mov Disord. 3. Giloteaux, L., J. K. Goodrich, W. A. Walters, S. M. Levine, R. E. Ley and M. R. Hanson (2016). "Reduced diversity and altered composition of the gut microbiome in individuals with myalgic encephalomyelitis/chronic fatigue syndrome." Microbiome 4(1): 30. 4. Steenbergen, L., Sellaro, R., van Hemert, S., Bosch, J. A. & Colzato, L. S. A randomized controlled trial to test the effect of multispecies probiotics on cognitive reactivity to sad mood. Brain, behavior, and immunity 48, 258-264, doi:10.1016/j.bbi.2015.04.003 (2015). 5. Messaoudi M1, Violle N, Bisson JF, Desor D, Javelot H & Rougeot C. (2011) Beneficial psychological effects of a probiotic formulation (Lactobacillus helveticus R0052 and Bifidobacterium longum R0175) in healthy human volunteers. Gut Microbes. jul-Aug;2(4):256-61. doi: 10.4161/gmic.2.4.16108. Epub 2011 Jul 1.


SOUTH SAN FRANCISCO, Calif., Nov. 28, 2016 (GLOBE NEWSWIRE) -- Portola Pharmaceuticals (Nasdaq:PTLA) today announced that clinical and preclinical results from studies of all three of its investigational drugs -- AndexXa™ (andexanet alfa), betrixaban and cerdulatinib -- will be presented at the upcoming 58th American Society of Hematology (ASH) Annual Meeting and Exposition, which is taking place from December 3-6 at the San Diego Convention Center. AndexXa, a U.S. Food and Drug Administration (FDA)-designated Breakthrough Therapy, is in development for patients treated with a direct (apixaban, rivaroxaban or edoxaban) or indirect (enoxaparin) Factor Xa inhibitor when reversal of anticoagulation is needed due to life-threatening or uncontrolled bleeding. Betrixaban, which has Fast Track designation from the FDA, is an oral Factor Xa inhibitor anticoagulant in development for the prevention of venous thromboembolism (VTE) in acute medically ill patients. Cerdulatinib, an oral, dual Syk/JAK kinase inhibitor, is in development to treat patients with resistant or relapsed hematologic cancer. The abstracts are now available at https://ash.confex.com/ash/2016/webprogram/start.html. Following are details of the oral and poster presentations, which will include additional data not available in the abstracts. Publication #: 143             Presenting Author: Mark Crowther, M.D., MSc, FRCPC, Professor, Department of Medicine, Hematology and Thromboembolism and Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario             Oral Session Name: 332. Antithrombotic Therapy: Anticoagulation and Bleeding             Presentation Date and Time: Saturday, December 3, 1:00 p.m. PT             Presentation Location: Room 30 Publication #: 3824             Presenting Author: Russell Hull, MBBS, University of Calgary, R.A.H. Faculty of Medicine, Alberta, Canada             Poster Session Name: 332. Antithrombotic Therapy: Poster III             Presentation Date and Time: Monday, December 5, 6:00-8:00 p.m. PT             Location: Hall GH Publication #: 351             Presenting Author: Andrew Steele, Ph.D., Associate Professor, Medicine, University of Southampton, Southampton, UK             Oral Session Name: 641. CLL: Biology and Pathophysiology, excluding Therapy: CLL Microenvironment: Cell Intrinsic and Extrinsic Factors             Presentation Date and Time: Sunday, December 4, 10:00 a.m. PT             Location: Room 5AB Publication #: 2768             Presenting Author: Greg Coffey, Ph.D., Senior Scientist II, Portola Pharmaceuticals             Poster Session Name: 605. Molecular Pharmacology, Drug Resistance -- Lymphoid and Other Diseases: Poster II             Presentation Date and Time: Sunday, December 4, 6:00-8:00 p.m. PT             Location: Hall GH About Portola Pharmaceuticals, Inc.  Portola Pharmaceuticals is a biopharmaceutical company developing product candidates that could significantly advance the fields of thrombosis and other hematologic diseases. The Company is advancing three programs, including betrixaban, an oral, once-daily Factor Xa inhibitor; AndexXa™ (andexanet alfa), a recombinant protein designed to reverse the anticoagulant effect in patients treated with an oral or injectable Factor Xa inhibitor; and cerdulatinib, a Syk/JAK inhibitor in development to treat hematologic cancers. Portola's partnered program is focused on developing selective Syk inhibitors for inflammatory conditions. For more information, visit www.portola.com and follow the Company on Twitter @Portola_Pharma.


SOUTH SAN FRANCISCO, Calif., Nov. 28, 2016 (GLOBE NEWSWIRE) -- Portola Pharmaceuticals (Nasdaq:PTLA) today announced that clinical and preclinical results from studies of all three of its investigational drugs -- AndexXa™ (andexanet alfa), betrixaban and cerdulatinib -- will be presented at the upcoming 58th American Society of Hematology (ASH) Annual Meeting and Exposition, which is taking place from December 3-6 at the San Diego Convention Center. AndexXa, a U.S. Food and Drug Administration (FDA)-designated Breakthrough Therapy, is in development for patients treated with a direct (apixaban, rivaroxaban or edoxaban) or indirect (enoxaparin) Factor Xa inhibitor when reversal of anticoagulation is needed due to life-threatening or uncontrolled bleeding. Betrixaban, which has Fast Track designation from the FDA, is an oral Factor Xa inhibitor anticoagulant in development for the prevention of venous thromboembolism (VTE) in acute medically ill patients. Cerdulatinib, an oral, dual Syk/JAK kinase inhibitor, is in development to treat patients with resistant or relapsed hematologic cancer. The abstracts are now available at https://ash.confex.com/ash/2016/webprogram/start.html. Following are details of the oral and poster presentations, which will include additional data not available in the abstracts. Publication #: 143             Presenting Author: Mark Crowther, M.D., MSc, FRCPC, Professor, Department of Medicine, Hematology and Thromboembolism and Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario             Oral Session Name: 332. Antithrombotic Therapy: Anticoagulation and Bleeding             Presentation Date and Time: Saturday, December 3, 1:00 p.m. PT             Presentation Location: Room 30 Publication #: 3824             Presenting Author: Russell Hull, MBBS, University of Calgary, R.A.H. Faculty of Medicine, Alberta, Canada             Poster Session Name: 332. Antithrombotic Therapy: Poster III             Presentation Date and Time: Monday, December 5, 6:00-8:00 p.m. PT             Location: Hall GH Publication #: 351             Presenting Author: Andrew Steele, Ph.D., Associate Professor, Medicine, University of Southampton, Southampton, UK             Oral Session Name: 641. CLL: Biology and Pathophysiology, excluding Therapy: CLL Microenvironment: Cell Intrinsic and Extrinsic Factors             Presentation Date and Time: Sunday, December 4, 10:00 a.m. PT             Location: Room 5AB Publication #: 2768             Presenting Author: Greg Coffey, Ph.D., Senior Scientist II, Portola Pharmaceuticals             Poster Session Name: 605. Molecular Pharmacology, Drug Resistance -- Lymphoid and Other Diseases: Poster II             Presentation Date and Time: Sunday, December 4, 6:00-8:00 p.m. PT             Location: Hall GH About Portola Pharmaceuticals, Inc.  Portola Pharmaceuticals is a biopharmaceutical company developing product candidates that could significantly advance the fields of thrombosis and other hematologic diseases. The Company is advancing three programs, including betrixaban, an oral, once-daily Factor Xa inhibitor; AndexXa™ (andexanet alfa), a recombinant protein designed to reverse the anticoagulant effect in patients treated with an oral or injectable Factor Xa inhibitor; and cerdulatinib, a Syk/JAK inhibitor in development to treat hematologic cancers. Portola's partnered program is focused on developing selective Syk inhibitors for inflammatory conditions. For more information, visit www.portola.com and follow the Company on Twitter @Portola_Pharma.


SOUTH SAN FRANCISCO, Calif., Nov. 28, 2016 (GLOBE NEWSWIRE) -- Portola Pharmaceuticals (Nasdaq:PTLA) today announced that clinical and preclinical results from studies of all three of its investigational drugs -- AndexXa™ (andexanet alfa), betrixaban and cerdulatinib -- will be presented at the upcoming 58th American Society of Hematology (ASH) Annual Meeting and Exposition, which is taking place from December 3-6 at the San Diego Convention Center. AndexXa, a U.S. Food and Drug Administration (FDA)-designated Breakthrough Therapy, is in development for patients treated with a direct (apixaban, rivaroxaban or edoxaban) or indirect (enoxaparin) Factor Xa inhibitor when reversal of anticoagulation is needed due to life-threatening or uncontrolled bleeding. Betrixaban, which has Fast Track designation from the FDA, is an oral Factor Xa inhibitor anticoagulant in development for the prevention of venous thromboembolism (VTE) in acute medically ill patients. Cerdulatinib, an oral, dual Syk/JAK kinase inhibitor, is in development to treat patients with resistant or relapsed hematologic cancer. The abstracts are now available at https://ash.confex.com/ash/2016/webprogram/start.html. Following are details of the oral and poster presentations, which will include additional data not available in the abstracts. Publication #: 143             Presenting Author: Mark Crowther, M.D., MSc, FRCPC, Professor, Department of Medicine, Hematology and Thromboembolism and Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario             Oral Session Name: 332. Antithrombotic Therapy: Anticoagulation and Bleeding             Presentation Date and Time: Saturday, December 3, 1:00 p.m. PT             Presentation Location: Room 30 Publication #: 3824             Presenting Author: Russell Hull, MBBS, University of Calgary, R.A.H. Faculty of Medicine, Alberta, Canada             Poster Session Name: 332. Antithrombotic Therapy: Poster III             Presentation Date and Time: Monday, December 5, 6:00-8:00 p.m. PT             Location: Hall GH Publication #: 351             Presenting Author: Andrew Steele, Ph.D., Associate Professor, Medicine, University of Southampton, Southampton, UK             Oral Session Name: 641. CLL: Biology and Pathophysiology, excluding Therapy: CLL Microenvironment: Cell Intrinsic and Extrinsic Factors             Presentation Date and Time: Sunday, December 4, 10:00 a.m. PT             Location: Room 5AB Publication #: 2768             Presenting Author: Greg Coffey, Ph.D., Senior Scientist II, Portola Pharmaceuticals             Poster Session Name: 605. Molecular Pharmacology, Drug Resistance -- Lymphoid and Other Diseases: Poster II             Presentation Date and Time: Sunday, December 4, 6:00-8:00 p.m. PT             Location: Hall GH About Portola Pharmaceuticals, Inc.  Portola Pharmaceuticals is a biopharmaceutical company developing product candidates that could significantly advance the fields of thrombosis and other hematologic diseases. The Company is advancing three programs, including betrixaban, an oral, once-daily Factor Xa inhibitor; AndexXa™ (andexanet alfa), a recombinant protein designed to reverse the anticoagulant effect in patients treated with an oral or injectable Factor Xa inhibitor; and cerdulatinib, a Syk/JAK inhibitor in development to treat hematologic cancers. Portola's partnered program is focused on developing selective Syk inhibitors for inflammatory conditions. For more information, visit www.portola.com and follow the Company on Twitter @Portola_Pharma.


SOUTH SAN FRANCISCO, Calif., Nov. 28, 2016 (GLOBE NEWSWIRE) -- Portola Pharmaceuticals (Nasdaq:PTLA) today announced that clinical and preclinical results from studies of all three of its investigational drugs -- AndexXa™ (andexanet alfa), betrixaban and cerdulatinib -- will be presented at the upcoming 58th American Society of Hematology (ASH) Annual Meeting and Exposition, which is taking place from December 3-6 at the San Diego Convention Center. AndexXa, a U.S. Food and Drug Administration (FDA)-designated Breakthrough Therapy, is in development for patients treated with a direct (apixaban, rivaroxaban or edoxaban) or indirect (enoxaparin) Factor Xa inhibitor when reversal of anticoagulation is needed due to life-threatening or uncontrolled bleeding. Betrixaban, which has Fast Track designation from the FDA, is an oral Factor Xa inhibitor anticoagulant in development for the prevention of venous thromboembolism (VTE) in acute medically ill patients. Cerdulatinib, an oral, dual Syk/JAK kinase inhibitor, is in development to treat patients with resistant or relapsed hematologic cancer. The abstracts are now available at https://ash.confex.com/ash/2016/webprogram/start.html. Following are details of the oral and poster presentations, which will include additional data not available in the abstracts. Publication #: 143             Presenting Author: Mark Crowther, M.D., MSc, FRCPC, Professor, Department of Medicine, Hematology and Thromboembolism and Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario             Oral Session Name: 332. Antithrombotic Therapy: Anticoagulation and Bleeding             Presentation Date and Time: Saturday, December 3, 1:00 p.m. PT             Presentation Location: Room 30 Publication #: 3824             Presenting Author: Russell Hull, MBBS, University of Calgary, R.A.H. Faculty of Medicine, Alberta, Canada             Poster Session Name: 332. Antithrombotic Therapy: Poster III             Presentation Date and Time: Monday, December 5, 6:00-8:00 p.m. PT             Location: Hall GH Publication #: 351             Presenting Author: Andrew Steele, Ph.D., Associate Professor, Medicine, University of Southampton, Southampton, UK             Oral Session Name: 641. CLL: Biology and Pathophysiology, excluding Therapy: CLL Microenvironment: Cell Intrinsic and Extrinsic Factors             Presentation Date and Time: Sunday, December 4, 10:00 a.m. PT             Location: Room 5AB Publication #: 2768             Presenting Author: Greg Coffey, Ph.D., Senior Scientist II, Portola Pharmaceuticals             Poster Session Name: 605. Molecular Pharmacology, Drug Resistance -- Lymphoid and Other Diseases: Poster II             Presentation Date and Time: Sunday, December 4, 6:00-8:00 p.m. PT             Location: Hall GH About Portola Pharmaceuticals, Inc.  Portola Pharmaceuticals is a biopharmaceutical company developing product candidates that could significantly advance the fields of thrombosis and other hematologic diseases. The Company is advancing three programs, including betrixaban, an oral, once-daily Factor Xa inhibitor; AndexXa™ (andexanet alfa), a recombinant protein designed to reverse the anticoagulant effect in patients treated with an oral or injectable Factor Xa inhibitor; and cerdulatinib, a Syk/JAK inhibitor in development to treat hematologic cancers. Portola's partnered program is focused on developing selective Syk inhibitors for inflammatory conditions. For more information, visit www.portola.com and follow the Company on Twitter @Portola_Pharma.


News Article | December 8, 2016
Site: www.eurekalert.org

A child mummy from the 17th century, found in a crypt underneath a Lithuanian church, was discovered to harbor the oldest known sample of the variola virus that causes smallpox. Researchers who sequenced the virus say it could help answer lingering questions about the history of smallpox, including how recently it appeared in humans (perhaps more recently than we thought) and when specific evolutionary events occurred. Their study appears December 8 in Current Biology. "There have been signs that Egyptian mummies that are 3,000 to 4,000 years old have pockmarked scarring that have been interpreted as cases of smallpox," says first author Ana Duggan, a postdoctoral fellow at the McMaster University Ancient DNA Center in Canada. "The new discoveries really throw those findings into question, and they suggest that the timeline of smallpox in human populations might be incorrect." The research team gathered the disintegrated variola virus DNA from the mummy after obtaining permission from the World Health Organization. Using RNA baits designed from existing variola sequences, the researchers targeted variola sequences found within the extracted DNA from the mummy's skin. Then they reconstructed the entire genome of the ancient strain of the virus and compared it to versions of the variola virus genome dating from the mid-1900s and before its eradication in the late 1970s. They concluded that these samples shared a common viral ancestor that originated sometime between 1588 and 1645--dates that coincide with a period of exploration, migration, and colonization that would have helped spread smallpox around the globe. "So now that we have a timeline, we have to ask whether the earlier documented historical evidence of smallpox, which goes back to Ramses V and includes everything up to the 1500s, is real," says co-author Henrik Poinar, the director of the Ancient DNA Centre at McMaster University in Canada. "Are these indeed real cases of smallpox, or are these misidentifications, which we know is very easy to do, because it is likely possible to mistake smallpox for chicken pox and measles." In addition to providing a more accurate timeline for the evolution of smallpox, the researchers were also able to identify distinct periods of viral evolution. One of the clearest instances of this occurred around the time that Edward Jenner famously developed his vaccine against the virus in the 18th century. During this period, the variola virus appears to have split into two strains, variola major and variola minor, which suggests that vaccination, which led to eradication of smallpox, may have changed the selection pressures acting on the virus and caused it to split into two strains. The researchers hope to use this work to identify how the sample they discovered in Lithuania compares to others that were sweeping throughout other countries in Europe at the same time. But in the bigger context of smallpox research, the scientists are optimistic that their work will provide a stepping stone to allow virologists to continue to trace smallpox and other DNA viruses back through time. "Now we know all the evolution of the sampled strains dates from 1650, but we still don't know when smallpox first appeared in humans, and we don't know what animal it came from, and we don't know that because we don't have any older historical samples to work with," says co-author Edward Holmes, a professor at the University of Sydney in Australia. "So this does put a new perspective on this very important disease, but it's also showing us that our historical knowledge of viruses is just the tip of the iceberg." This work was supported by the McMaster Ancient DNA Centre at McMaster University, the Department of Virology at the University of Helsinki, the Department of Anatomy, Histology and Anthropology at Vilnius University, the Marie Bashir Institute for Infectious Diseases and Biosecurity, the Department of Biochemistry and Molecular Science and Biotechnology at the University of Melbourne, the Department of History at Duke University, the Department of Biology at McMaster University, UC Irvine, the Mycroarray in Michigan, the Department of Chemical Engineering at the University of Michigan, the Center for Microbial Genetics and Genomics at Northern Arizona University, the Laboratoire d'Anthropologie Biologique Paul Broca at the PSL Research University, Helsinki University Hospital, the Department of Forensic Medicine at the University of Helsinki, the Department of Pathology at the University of Cambridge, the Michael G. DeGroote Institute for Infectious Disease Research at McMaster University and the Humans & the Microbiome Program at the Canadian Institute for Advanced Research. Current Biology, Duggan, Marciniak, Poinar, Emery, Poinar et al: "17th Century Variola Virus Reveals the Recent History of Smallpox" http://www.cell.com/current-biology/fulltext/S0960-9822(16)31324-0 Current Biology (@CurrentBiology), published by Cell Press, is a bimonthly journal that features papers across all areas of biology. Current Biology strives to foster communication across fields of biology, both by publishing important findings of general interest and through highly accessible front matter for non-specialists. Visit: http://www. . To receive Cell Press media alerts, contact press@cell.com.


Home > Press > Oxford Instruments announces Dr Brad Ramshaw of Cornell University, as winner of the 2017 Lee Osheroff Richardson Science Prize Abstract: The Lee Osheroff Richardson (LOR) Science Prize promotes and recognises the novel work of young scientists working in the fields of low temperatures and/or high magnetic fields in the Americas. Oxford Instruments is delighted to announce Dr Brad Ramshaw, Assistant Professor at Cornell University as the winner of the 2017 LOR Science Prize. “I am truly honoured to have been awarded this prize. As I build my new lab in Clark Hall in the same basement where Lee, Osheroff, and Richardson did their ground-breaking work, I am continually reminded of and humbled by their legacy in low-temperature physics. Their work also reminds me that science is a collaborative effort, and I want to thank the mentors and colleagues who have made these experiments possible and who have immeasurably influenced my approach to science”, commented Ramshaw. Dr Ramshaw is one of the most gifted young experimentalists currently active in the field of strongly correlated electron systems. Ramshaw’s technical contributions to condensed matter physics have focused on improving measurement techniques for pulsed magnetic fields up to 100 T, and on improving resonant ultrasound spectroscopy for low-temperature applications. He has applied these techniques to solve significant problems in both high-temperature and unconventional superconductivity. Most notably he has used quantum oscillation measurements to provide the first direct observation of the effects of quantum criticality on the electronic normal state of cuprate superconductors, and to determine that the Fermi surface of the cuprates is not reconstructed by magnetic order in high fields. The technique developments made by Ramshaw have had an impact beyond his own research—he has taken part in many collaborative pulsed-field research projects including the investigation of 2-D electrons in graphene and oxide heterostructures, symmetry breaking in heavy Fermions, and unconventional thermodynamics in topological semimetals. His most recent technique advancement, for which he was awarded a $430,000 development grant at Los Alamos National Labs, was the design and construction of an all-digital pulse-echo ultrasound apparatus for use in pulsed magnetic fields up to 100 Tesla. This has increased the relatively small number of thermodynamic probes available in these extreme magnetic fields, and will be particularly helpful for studying phase transitions in metals where magnetization signals can be swamped by noise and transport signatures are difficult to interpret. The Lee Osheroff Richardson Science Prize selection committee was very pleased to recognise Ramshaw’s outstanding achievements. The committee consists of leading American physicists and is chaired by Professor Bruce Gaulin of McMaster University, Hamilton, ON, Canada. Dr Ramshaw will be presented with the trophy and $8000 prize amount at Oxford Instruments’ “Socialize with Science” event on March 14th, 2017 during the 2017 APS March Meeting in New Orleans, LA, USA. Oxford Instruments is aware that there is a critical and often difficult stage for many between completing a PhD and gaining a permanent research position. The company has therefore been helping individuals who are producing innovative work by offering assistance both financially and through promotion of their research work, through sponsoring the Lee Osheroff Richardson Science Prize for research in physical science. The Prize is named in honour of Professors David M. Lee, Douglas D. Osheroff and the late Robert C. Richardson, joint recipients of The Nobel Prize in Physics 1996 "for their discovery of superfluidity in helium-3". The previous winners of the Lee Osheroff Richardson Science Prize, which celebrated its 10th year in 2015, are Dr Christian Lupien, Dr Jason Petta, Dr Suchitra Sebastian, Dr Eunseong Kim, Dr Vivien Zapf, Dr Jing Xia, Dr Kenneth Burch, Dr Lu Li, Dr Chiara Tarantini, Dr Cory Dean and Dr Mohammad Hamidian. More information on the Prize can be found at: www.oxford-instruments.com/scienceprize About Oxford Instruments NanoScience Oxford Instruments NanoScience designs, supplies and supports market-leading research tools that enable quantum technologies, new materials and device development in the physical sciences. Our tools support research down to the atomic scale through creation of high performance, cryogen free low temperature and magnetic environments, based upon our core technologies in low and ultra-low temperatures, high magnetic fields and system integration, with ever-increasing levels of experimental and measurement readiness. Oxford Instruments NanoScience is a part of the Oxford Instruments plc group. About Oxford Instruments plc Oxford Instruments designs, supplies and supports high-technology tools and systems with a focus on research and industrial applications. Innovation has been the driving force behind Oxford Instruments' growth and success for over 50 years, and its strategy is to effect the successful commercialisation of these ideas by bringing them to market in a timely and customer-focused fashion. The first technology business to be spun out from Oxford University, Oxford Instruments is now a global company and is listed on the London Stock Exchange (OXIG). Its objective is to be the leading provider of new generation tools and systems for the research and industrial sectors with a focus on nanotechnology. Its key market sectors include nano-fabrication and nano-materials. The company’s strategy is to expand the business into the life sciences arena, where nanotechnology and biotechnology intersect This involves the combination of core technologies in areas such as low temperature, high magnetic field and ultra high vacuum environments; Nuclear Magnetic Resonance; X-ray, electron, laser and optical based metrology; atomic force microscopy; optical imaging; advanced growth, deposition and etching. Oxford Instruments aims to pursue responsible development and deeper understanding of our world through science and technology. Its products, expertise, and ideas address global issues such as energy, environment, security and health. For more information, please click If you have a comment, please us. Issuers of news releases, not 7th Wave, Inc. or Nanotechnology Now, are solely responsible for the accuracy of the content.


News Article | October 22, 2015
Site: news.yahoo.com

In an era of thousand-dollar pills and DNA-altering technologies, doctors are increasingly turning to a seemingly crude technique to treat chronic intestinal problems: poop transplants. Fecal microbiota transplantation (FMT), as it is properly called — and there's no sugarcoating the description here — is the process of placing the feces of a healthy person into the gut of a patient with an intestinal problem, such as chronic diarrhea or irritable bowel syndrome. The transplant occurs via a tube or capsule put down one's throat or up one's bottom. The theory is that the transplanted stool — upward of 10 teaspoons' worth — introduces a healthy mix of bacteria that can overtake the harmful bacteria causing the intestinal problems. More than 4,000 gut specialists have gathered at the 80th annual meeting of the American College of Gastroenterology in Honolulu, Hawaii, and one item on their agenda is discussing the merits of FMT. Several presentations on Monday (Oct. 19) addressed the key concerns about FMT. It is now established that the technique is safer, more effective and less expensive than standard antibiotic treatment for at least one common ailment: recurrent Clostridium difficile (C. diff) infection, researchers said. And this may be true for other diseases, as well, the scientists said. [The Poop on Pooping: 5 Misconceptions Explained] C. diff, a gut-residing bacterium that can result in diarrhea so severe that the dehydration can be fatal, causes half a million infections and more than 29,000 deaths in the United States annually, according to a study published in February in the New England Journal of Medicine. People often contract the illness while they are in hospitals, after a treatment with antibiotics for some other sickness; the antibiotics can wipe out the population of good bacteria in one's gut and allow C. diff to flourish. The standard treatment for initial C. diff infection, perhaps ironically, is more antibiotics, even though this poses a 20 percent risk for a recurrent infection, said Dr. Sahil Khanna of the Mayo Clinic in Rochester, Minnesota, who presented his results yesterday at the Hawaii meeting. Khanna and his colleagues have developed a technique to accurately predict, for the first time, which patients are unlikely to benefit from antibiotic treatment, based on the number of various bacterial species in the patients' stool. Those who are at high risk of failing to improve with antibiotic treatment could consider FMT instead, he said. The new prediction technique could help tailor more appropriate treatments for patients, Khanna said. This can be crucial in saving lives, given that recurrent C. diff infections are even more difficult to treat than the initial infection, he said. Vancomycin and other drug treatments have only a 40 to 50 percent success rate in treating recurrent C. diff, compared to FMT's nearly 90 percent success rate. Dr. Zain Kassam, a research affiliate at Massachusetts Institute of Technology (MIT) Center for Microbiome Informatics and Therapeutics, reported that FMT is not only more effective but also less expensive than vancomycin in treating recurrent C. diff. The infection amounts to $4.8 billion in health care costs yearly, and using FMT from a "stool bank" instead of the standard treatment could save the nation more than $121 million yearly, he calculated. "Clinical guidelines for C. difficile — including [those from] the American College of Gastroenterology and the European Society of Clinical Microbiology and Infectious Diseases — are moving towards FMT being recommended for the treatment of recurrent C. difficile given the emerging evidence," Kassam told Live Science. Kassam is also chief medical officer at the MIT-affiliated OpenBiome, a nonprofit stool bank registered with the FDA that collects feces from donors, with the goal of expanding safe access to FMT. Donors are paid for their feces, and only 2.8 percent of candidate donors pass through the rigorous OpenBiome screening process, Kassam said. [The Poop on Pooping: 5 Misconceptions Explained] Safety is a top concern with FMT, because feces can harbor unknown pathogens. And stool is more difficult to test than a drug or donated blood. Although there have been no reports of people getting sick as a result of FMT, a case study published earlier this year reported that a thin woman gained 34 lbs. (15 kilograms), and couldn't lose the weight, after receiving a fecal transplant from an obese donor. Thus, doctors began to wonder whether one could "catch" obesity through FMT. But a new study, also presented at the Hawaii meeting, may ease those worries. Dr. Monika Fischer, of the Indiana University Department of Medicine in Indianapolis, found no risk of increased weight after FMT. Her study included 58 FMT patients, including 22 who received fecal transplants from overweight donors. As promising as FMT appears to be, it is in legal limbo in the United States, as the FDA continues to mull over how to regulate the procedure. The FDA announced a policy in July 2013 that allows physicians to treat a person who has a C. diff infection with FMT only if a few conditions are met: The patient must be failing to respond to standard therapy, and the doctor must obtain informed consent, explain the risk and benefits, and tell the patient that FMT is investigational. But to treat patients with C. diff that is not recurrent, or those who have another intestinal disorder, such as irritable bowel syndrome or Crohn's disease, doctors first need to complete an Investigational New Drug (IND) application. Some doctors say this requirement is cumbersome and discourages use of the treatment. "Our stool bank has a deep respect for the regulatory challenges the FDA is facing in this rapidly evolving field," Kassam said. "Overall, enforcement discretion paints a picture that the FDA recognizes that FMT is a square peg and doesn't fit nicely into a round hole like other therapies," such as blood transfusions and other tissue donations, he said. As the field grows and evidence mounts that FMT may treat diseases beyond C. diff, Kassam said that the FDA will face unique challenges balancing public health, economic impact and safety for this "potentially paradigm-shifting treatment." Other studies, mostly from non-U.S. institutions, have found that FMT is beneficial for people with inflammatory bowel disorders such as Crohn's disease and ulcerative colitis. One of the largest studies, published this year, was a randomized control trial of 70 patients with ulcerative colitis. The researchers, at McMaster University in Ontario, Canada, found significant improvements in patients who received FMT compared with those who received a placebo treatment. Follow Christopher Wanjek @wanjek for daily tweets on health and science with a humorous edge. Wanjek is the author of "Food at Work" and "Bad Medicine." His column, Bad Medicine, appears regularly on Live Science. 5 Things Your Poop Says About Your Health Copyright 2015 LiveScience, a Purch company. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.


Achilleos V.,National and Kapodistrian University of Athens | Frantzeskakis D.J.,National and Kapodistrian University of Athens | Kevrekidis P.G.,University of Massachusetts Amherst | Pelinovsky D.E.,McMaster University
Physical Review Letters | Year: 2013

We study matter-wave bright solitons in spin-orbit coupled Bose-Einstein condensates with attractive interactions. We use a multiscale expansion method to identify solution families for chemical potentials in the semi-infinite gap of the linear energy spectrum. Depending on the linear and spin-orbit coupling strengths, the solitons may present either a sech2-shaped or a modulated density profile reminiscent of the stripe phase of spin-orbit coupled repulsive Bose-Einstein condensates. Our numerical results are in excellent agreement with our analytical findings and demonstrate the potential robustness of solitons for experimentally relevant conditions. © 2013 American Physical Society.


Prince M.J.,King's College London | Wu F.,Shanghai Institutes of Preventative Medicine | Guo Y.,U.S. Center for Disease Control and Prevention | Gutierrez Robledo L.M.,National Autonomous University of Mexico | And 3 more authors.
The Lancet | Year: 2015

23% of the total global burden of disease is attributable to disorders in people aged 60 years and older. Although the proportion of the burden arising from older people (≤60 years) is highest in high-income regions, disability-adjusted life years (DALYs) per head are 40% higher in low-income and middle-income regions, accounted for by the increased burden per head of population arising from cardiovascular diseases, and sensory, respiratory, and infectious disorders. The leading contributors to disease burden in older people are cardiovascular diseases (30·3% of the total burden in people aged 60 years and older), malignant neoplasms (15·1%), chronic respiratory diseases (9·5%), musculoskeletal diseases (7·5%), and neurological and mental disorders (6·6%). A substantial and increased proportion of morbidity and mortality due to chronic disease occurs in older people. Primary prevention in adults aged younger than 60 years will improve health in successive cohorts of older people, but much of the potential to reduce disease burden will come from more effective primary, secondary, and tertiary prevention targeting older people. Obstacles include misplaced global health priorities, ageism, the poor preparedness of health systems to deliver age-appropriate care for chronic diseases, and the complexity of integrating care for complex multimorbidities. Although population ageing is driving the worldwide epidemic of chronic diseases, substantial untapped potential exists to modify the relation between chronological age and health. This objective is especially important for the most age-dependent disorders (ie, dementia, stroke, chronic obstructive pulmonary disease, and vision impairment), for which the burden of disease arises more from disability than from mortality, and for which long-term care costs outweigh health expenditure. The societal cost of these disorders is enormous. © 2015 Elsevier Ltd.


Das S.,University of Lethbridge | Bhaduri R.K.,McMaster University
Classical and Quantum Gravity | Year: 2015

We show that dark matter consisting of bosons of mass of about 1 eV or less has a critical temperature exceeding the temperature of the Universe at all times, and hence would have formed a Bose-Einstein condensate at very early epochs. We also show that the wavefunction of this condensate, via the quantum potential it produces, gives rise to a cosmological constant that may account for the correct dark energy content of our Universe. We argue that massive gravitons or axions are viable candidates for these constituents. In the far future this condensate is all that remains of our Universe. © 2015 IOP Publishing Ltd.


Cairney J.,McMaster University | Veldhuizen S.,Center for Addiction and Mental Health
Developmental Medicine and Child Neurology | Year: 2013

Developmental coordination disorder (DCD) is a common, neurodevelopmental disorder of children that results in significant impairment in everyday activities of living. Over the past two decades, a large body of work has documented associations between DCD, physical inactivity, and poor health-related fitness. The exact nature of these relations, however, has been relatively little studied. In this paper, we ask whether the balance of evidence supports the proposition that DCD is a fundamental cause of inactivity and poor fitness. To address this question, we apply Hill's criteria for causation. We conclude that the evidence is consistent with, and reasonably supportive of, this proposition, but does not exclude alternative explanations. © 2013 Mac Keith Press.


Hitchcock A.P.,McMaster University | Toney M.F.,SSRL
Journal of Synchrotron Radiation | Year: 2014

Current and future capabilities of X-ray spectromicroscopy are discussed based on coherence-limited imaging methods which will benefit from the dramatic increase in brightness expected from a diffraction-limited storage ring (DLSR). The methods discussed include advanced coherent diffraction techniques and nanoprobe-based real-space imaging using Fresnel zone plates or other diffractive optics whose performance is affected by the degree of coherence. The capabilities of current systems, improvements which can be expected, and some of the important scientific themes which will be impacted are described, with focus on energy materials applications. Potential performance improvements of these techniques based on anticipated DLSR performance are estimated. Several examples of energy sciences research problems which are out of reach of current instrumentation, but which might be solved with the enhanced DLSR performance, are discussed. © 2014 International Union of Crystallography.


Wu X.,McMaster University | Zhai G.,Shanghai JiaoTong University
IEEE Signal Processing Magazine | Year: 2013

A new paradigm of information display, called temporal psychoviusal modulation (TPVM), which is conceived as an ingenious interplay of signal processing, optoelectronics, and psychophysics, is proposed. In TPVM, a high-speed display sequentially emits a set of atom frames. Unlike in time multiplexing, these atom frames are not completely formed images but rather constituent parts of images; these atom frames are amplitude modulated by display-synchronized shutter devices. TPVM can be implemented by a combination of a high-speed display and display synchronized active liquid crystal (LC) glasses. The signal processing operations performed optoelectronically via the display-glasses coupling and the resulting psychovisual effects of TPVM can be mathematically modeled. A defining and unique characteristic of the new TPVM display system is that the optoelectronic modulator is coupled with a biological demodulator.


Ruiz-Irastorza G.,University of the Basque Country | Crowther M.,McMaster University | Branch W.,University of Utah | Khamashta M.A.,King's College
The Lancet | Year: 2010

The antiphospholipid syndrome causes venous, arterial, and small-vessel thrombosis; pregnancy loss; and preterm delivery for patients with severe pre-eclampsia or placental insufficiency. Other clinical manifestations are cardiac valvular disease, renal thrombotic microangiopathy, thrombocytopenia, haemolytic anaemia, and cognitive impairment. Antiphospholipid antibodies promote activation of endothelial cells, monocytes, and platelets; and overproduction of tissue factor and thromboxane A2. Complement activation might have a central pathogenetic role. Of the different antiphospholipid antibodies, lupus anticoagulant is the strongest predictor of features related to antiphospholipid syndrome. Therapy of thrombosis is based on long-term oral anticoagulation and patients with arterial events should be treated aggressively. Primary thromboprophylaxis is recommended in patients with systemic lupus erythematosus and probably in purely obstetric antiphospholipid syndrome. Obstetric care is based on combined medical-obstetric high-risk management and treatment with aspirin and heparin. Hydroxychloroquine is a potential additional treatment for this syndrome. Possible future therapies for non-pregnant patients with antiphospholipid syndrome are statins, rituximab, and new anticoagulant drugs. © 2010 Elsevier Ltd.


Garcia D.A.,University of New Mexico | Baglin T.P.,University of Cambridge | Weitz J.I.,McMaster University | Samama M.M.,University of Notre Dame
Chest | Year: 2012

This article describes the pharmacology of approved parenteral anticoagulants. These include the indirect anticoagulants, unfractionated heparin (UFH), low-molecular-weight heparins (LMWHs), fondaparinux, and danaparoid, as well as the direct thrombin inhibitors hirudin, bivalirudin, and argatroban. UFH is a heterogeneous mixture of glycosaminoglycans that bind to antithrombin via a unique pentasaccharide sequence and catalyze the inactivation of thrombin, factor Xa, and other clotting enzymes. Heparin also binds to cells and plasma proteins other than antithrombin causing unpredictable pharmacokinetic and pharmacodynamic properties and triggering nonhemorrhagic side effects, such as heparin-induced thrombocytopenia (HIT) and osteoporosis. LMWHs have greater inhibitory activity against factor Xa than thrombin and exhibit less binding to cells and plasma proteins than heparin. Consequently, LMWH preparations have more predictable pharmacokinetic and pharmacodynamic properties, have a longer half-life than heparin, and are associated with a lower risk of nonhemorrhagic side effects. LMWHs can be administered once daily or bid by subcutaneous injection, without coagulation monitoring. Based on their greater convenience, LMWHs have replaced UFH for many clinical indications. Fondaparinux, a synthetic pentasaccharide, catalyzes the inhibition of factor Xa, but not thrombin, in an antithrombin-dependent fashion. Fondaparinux binds only to antithrombin. Therefore, fondaparinux- associated HIT or osteoporosis is unlikely to occur. Fondaparinux exhibits complete bioavailability when administered subcutaneously, has a longer half-life than LMWHs, and is given once daily by subcutaneous injection in fixed doses, without coagulation monitoring. Three additional parenteral direct thrombin inhibitors and danaparoid are approved as alternatives to heparin in patients with HIT. © 2012 American College of Chest Physicians.


Kolb M.,McMaster University | Collard H.R.,University of California at San Francisco
European Respiratory Review | Year: 2014

Idiopathic pulmonary fibrosis (IPF) is traditionally staged with terms such as "mild", "severe", "early" and "advanced" based on pulmonary function tests. This approach allows physicians to monitor disease progression and advise patients and their families. However, it is not known if the stages of this model reflect distinct biological or clinical phenotypes and the therapeutic and prognostic value of this system is limited. Novel methods of IPF staging have recently been developed. The GAP model includes four baseline variables that were found to be predictive of outcome, as identified by logistic regression. These factors are: gender (G), age (A) and two lung physiology variables (P) (forced vital capacity and diffusing capacity of the lung for carbon monoxide). The clinical utility and accuracy of staging models may be further improved in the future by the integration of dynamic parameters that can be measured over time, as well as biological data from biomarkers which may be able to directly measure disease activity. The development of an evidence-based, multidimensional IPF staging model that builds on the current staging approaches to IPF is an important objective for improving the management of IPF. © ERS 2014.


Kallin C.,McMaster University | Berlinsky J.,Kavli Institute for Theoretical Physics
Reports on Progress in Physics | Year: 2016

Chiral superconductivity is a striking quantum phenomenon in which an unconventional superconductor spontaneously develops an angular momentum and lowers its free energy by eliminating nodes in the gap. It is a topologically non-trivial state and, as such, exhibits distinctive topological modes at surfaces and defects. In this paper we discuss the current theory and experimental results on chiral superconductors, focusing on two of the best-studied systems, Sr2RuO4, which is thought to be a chiral triplet p-wave superconductor, and UPt3, which has two low-temperature superconducting phases (in zero magnetic field), the lower of which is believed to be chiral triplet f-wave. Other systems that may exhibit chiral superconductivity are also discussed. Key signatures of chiral superconductivity are surface currents and chiral Majorana modes, Majorana states in vortex cores, and the possibility of half-flux quantum vortices in the case of triplet pairing. Experimental evidence for chiral superconductivity from μSR, NMR, strain, polar Kerr effect and Josephson tunneling experiments are discussed. © 2016 IOP Publishing Ltd.


Kuperman V.,McMaster University | Van Dyke J.A.,Haskins Laboratories
Journal of Memory and Language | Year: 2011

This study is a large-scale exploration of the influence that individual reading skills exert on eye-movement behavior in sentence reading. Seventy-one non-college-bound 16-24. year-old speakers of English completed a battery of 18 verbal and cognitive skill assessments, and read a series of sentences as their eye-movements were monitored. Statistical analyses were performed to establish what tests of reading abilities were predictive of eye-movement patterns across this population and how strong the effects were. We found that individual scores in rapid automatized naming and word identification tests (i) were the only participant variables with reliable predictivity throughout the time-course of reading; (ii) elicited effects that superceded in magnitude the effects of established predictors like word length or frequency; and (iii) strongly modulated the influence of word length and frequency on fixation times. We discuss implications of our findings for testing reading ability, as well as for research of eye-movements in reading. © 2011 Elsevier Inc.


Choquet H.,University of California at San Francisco | Meyre D.,McMaster University
Current Genomics | Year: 2011

Candidate gene and genome-wide association studies have led to the discovery of nine loci involved in Mendelian forms of obesity and 58 loci contributing to polygenic obesity. These loci explain a small fraction of the heritability for obesity and many genes remain to be discovered. However, efforts in obesity gene identification greatly modified our understanding of this disorder. In this review, we propose an overlook of major lessons learned from 15 years of research in the field of genetics and obesity. We comment on the existence of the genetic continuum between monogenic and polygenic forms of obesity that pinpoints the role of genes involved in the central regulation of food intake and genetic predisposition to obesity. We explain how the identification of novel obesity predisposing genes has clarified unsuspected biological pathways involved in the control of energy balance that have helped to understand past human history and to explore causality in epidemiology. We provide evidence that obesity predisposing genes interact with the environment and influence the response to treatment relevant to disease prediction. © 2011 Bentham Science Publishers Ltd.


Choquet H.,University of California at San Francisco | Meyre D.,McMaster University
Current Genomics | Year: 2011

Obesity is a global health problem that is gradually affecting each continent of the world. Obesity is a heterogeneous disorder, and the biological causes of obesity are complex. The rapid increase in obesity prevalence during the past few decades is due to major societal changes (sedentary lifestyle, over-nutrition) but who becomes obese at the individual level is determined to a great extent by genetic susceptibility. In this review, we evidence that obesity is a strongly heritable disorder, and provide an update on the molecular basis of obesity. To date, nine loci have been involved in Mendelian forms of obesity and 58 loci contribute to polygenic obesity, and rare and common structural variants have been reliably associated with obesity. Most of the obesity genes remain to be discovered, but promising technologies, methodologies and the use of "deep phenotyping" lead to optimism to chip away at the 'missing heritability' of obesity in the near future. In the longer term, the genetic dissection of obesity will help to characterize disease mechanisms, provide new targets for drug design, and lead to an early diagnosis, treatment, and prevention of obesity. © 2011 Bentham Science Publishers Ltd.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-SICA | Phase: HEALTH-2007-3.5-2 | Award Amount: 3.76M | Year: 2009

Inadequate access to and use of research evidence to inform health policy limits the achievement of universal and equitable access to healthcare, hinders quality improvement and makes it difficult to use healthcare resources wisely. Poorly informed decision-making about health policies and systems is one of the reasons why services fail to reach those most in need, health indicators are off track, and it appears unlikely that many countries in Africa will meet the health MDGs. SURE will support improvements in health policies and systems in low and middle-income countries (LMIC) by improving access to and use of policy-relevant syntheses of research evidence that are contextualized and tailored to meet the needs of decision makers. SURE will develop, pilot and evaluate five strategies designed to strengthen access to and use of reliable and timely research syntheses in policymaking: user friendly formats for research syntheses, clearing houses for syntheses and policy relevant research, mechanisms for responding rapidly to policymakers needs for research evidence, methods for organizing and managing deliberative forums involving policymakers, researchers and others, and methods for involving civil society and the public in policy development. SURE will develop capacity for evidence-informed healthcare policy and undertake a comparative evaluation of initiatives between policymakers and researchers using these and other strategies. SURE will collaborate with the Evidence-Informed Health Policy Network (EVIPNet) and the Regional East African Community Health (REACH) Policy Initiativetwo international efforts to improve the use of research evidence in policy and health systems decisions via partnerships between policymakers, researchers and civil society. SURE will use a range of dissemination strategies. Global dissemination will be coordinated by and capitalise on WHO, with the aim of maximising the projects impact on health policy in Africa and othe


Grant
Agency: GTR | Branch: NERC | Program: | Phase: Research Grant | Award Amount: 286.07K | Year: 2012

The Arctic is undergoing rapid climatic change, with dramatic consequences for the Frozen World (the cryosphere), including reductions in the depth, extent and duration of sea ice, and seasonal snow cover on land, retreat of ice sheets/glaciers, and melting of permafrost (ground that remains at or below 0 degrees C for at least two consecutive years). This is important not only for local and regional ecosystems and human communities, but also for the functioning of the entire earth system. Evidence is growing that organic matter frozen in permafrost soils (often for many millennia) is now thawing, making it available for decomposition by soil organisms, with the release of carbon dioxide (CO2) and methane (CH4), both greenhouse gases (GHGs), as by-products. A major concern now is that, because permafrost soils contain 1672 petagrams (1 Pg = 1 billion tonnes) of organic carbon (C), which is about 50% of the total global below-ground pool of organic C, and permafrost underlies ~ 25% (23 million km2) of the N hemisphere land surface, a melting-induced release of GHGs to the atmosphere from permafrost soils could result in a major acceleration of global warming. This is called a positive biogeochemical feedback on global change; in other words, an unintentional side-effect in the global C cycle and climate system. Unfortunately, the interacting biological, chemical and physical controls on CO2 and CH4 emissions from permafrost (and melting permafrost) environments to the atmosphere are the subject of much speculation because the scientific community does not know enough about the interactions between C and water cycling in permafrost systems. Warmer and drier soils may release more CO2, while warmer/wetter soils might release more CH4. Permafrost thawing also causes changes in the way water flows though the landscape (because frozen ground if often impermeable to water), and some areas may become drier, while others wetter. How the relative proportions of CO2 and CH4 emissions change, and their absolute amount, is critical for the overall global warming potential (GWP) because these two gases have different potency as GHGs. Release of C from soils into freshwaters also needs to be taken into account because down-stream de-gassing and decomposition of organic materials also influences releases of CO2 and CH4 from freshwater, or delivery of C to lakes/oceans. All-in-all, predicting the GWP of permafrost regions is scientifically challenging, and the interactions between the water (hydrological) and C cycles are poorly known. In this project we recognise the key role that hydrological processes play in landscape-scale C fluxes in arctic and boreal regions. In permafrost catchments in NW Canada (including areas where permafrost is known to be thawing) we will measure the capture of C from the atmosphere (through photosynthesis), its distribution in plants and soils, and the biological, physical and chemical controls of C transport and delivery from soils to freshwaters, and ultimately to the atmosphere as CO2 and CH4. In essence we wish to close the C cycle. Field-based measurements of key processes in the water and C cycles, including geochemical tracer and state-of-the-art C, hydrogen and oxygen isotope approaches, will be linked by computer modelling. The project team, together with partners in Canada, the US and UK, is in a unique position to link the water and C cycles in permafrost environments, and we will deliver essential scientific knowledge on the potential consequences of climate warming, and permafrost thawing, for GHG emissions from northern high latitudes. Both for local peoples directly dependent on arctic tundra/boreal forest ecosystems for their livelihoods and cultural identity, and for the global community who must respond to, and anticipate, potential consequences of climate and environmental change, this project will represent a significant step forward in understanding/predictive capacity.


Wang J.,Shanghai JiaoTong University | Chen J.,McMaster University
IEEE Transactions on Information Theory | Year: 2013

We derive a lower bound on each supporting line of the rate region of the vector Gaussian two-terminal CEO problem, which is a special case of the indirect vector Gaussian two-terminal source coding problem. The key technical ingredient is a new extremal inequality. It is shown that the lower bound coincides with the Berger-Tung upper bound in the high-resolution regime. Similar results are derived for the direct vector Gaussian two-terminal source coding problem. © 1963-2012 IEEE.


News Article | March 2, 2017
Site: www.prweb.com

ProMIS Neurosciences (“ProMIS” or the “Company”), a company focused on the discovery and development of precision treatments for neurodegenerative diseases, today announced the appointment of Anthony J. Giovinazzo, MBA, to its Board of Directors, effective immediately. “I first met Anthony over twenty years ago, working together on an Alzheimer’s diagnostics opportunity” stated Eugene Williams, ProMIS Executive Chairman. “He and I have been talking about a shared commitment to making a difference in Alzheimer’s for a long time. After the outstanding job that Anthony did at Cynapsus, for both Parkinson’s patients and shareholders, he has many alternatives. We are thrilled that he has chosen to apply his talents and energy to ProMIS”. Anthony Giovinazzo is currently President and CEO of Sunovion CNS Development Canada ULC. As President and CEO of Cynapsus Therapeutics from 2009 through 2016 he led the successful purchase of Cynapsus by Sunovion Pharmaceuticals, a member of the Dainipon Sumitomo Pharma group of Japan. At Cynapsus, Anthony led the successful development of APL 130277 (a sublingual strip of apomorphine) through to late stage Phase 3 studies and was responsible for Cynapsus up-listing from the TSX Venture exchange to the TSX and then the NASDAQ. “I am delighted to join the Board of Directors of ProMIS Neurosciences,” stated Mr. Giovinazzo. “Having devoted most of my career to the development and commercialization of therapies for neurodegenerative disease, I look forward to leveraging my experience to support the Company as it develops innovative, precision medicine therapeutics for Alzheimer’s disease and ALS”. About Anthony Giovinazzo, MBA. Anthony J. Giovinazzo has over thirty-eight years of professional experience. His first seven years were spent as an international corporate tax specialist primarily in multinational conglomerates. Over the subsequent eight years Anthony worked in Fortune 100 investment banking and private equity. For the last twenty-three years he worked exclusively on the discovery, development and commercialization of neurodegenerative disease therapeutics. His primary areas of focus have been Alzheimer’s, Parkinson’s and neuropathic pain. Since October 2016 he has been the President and CEO of Sunovion CNS Development Canada ULC., a successor company to Cynapsus Therapeutics Inc., which was purchased by Sunovion Pharmaceuticals Inc., a member of the Dainipon Sumitomo Pharma group of companies of Japan. He was President, CEO and a Director of Cynapsus Therapeutics Inc. from 2009 to 2016 and was one of the three original inventors and patent holders of the Cynapsus Parkinson’s focussed technology. Under his leadership the company successfully developed APL 130277 (a sublingual strip of apomorphine for OFF episodes) through to late stage Phase 3 studies. In addition, Anthony led the up-listing of Cynapsus from the TSX Venture exchange to the TSX and then the NASDAQ, attracting bulge bracket investment banks and some of the largest institutional life science investors in the USA. The sale of Cynapsus to Sunovion in 2016 resulted in a 120% premium to market price (CDN$841 million) via an all cash M&A transaction. Mr Giovinazzo is the co-author of several peer reviewed papers and author of several papers on strategic and financing issues in the biopharmaceutical industry. He was a finalist in the E&Y Entrepreneur of the Year (2014) for Ontario Canada. He is a Chartered Director and Audit Committee Certified, both from The Directors College, a degree granting affiliate of Mc Master University, Hamilton Canada. He also has completed the Leadership and Strategy in Pharmaceuticals and Biotech, in 2006 from Harvard Business School, Boston, MA; a Masters of Business Administration from IMD, Geneva Switzerland in 1986; Graduate Certificate Studies in Canadian Law Osgoode Hall Law School, York University, Toronto, in 1984; and his Bachelor of Arts in Economics and Accounting at McMaster University in 1978. The mission of ProMIS Neurosciences is to discover and develop precision medicine therapeutics for effective treatment of neurodegenerative diseases, in particular Alzheimer’s disease and ALS. ProMIS Neurosciences’ proprietary target discovery engine is based on the use of two, complementary techniques. The Company applies its thermodynamic, computational discovery platform—ProMIS™ and Collective Coordinates — to predict novel targets known as Disease Specific Epitopes (DSEs) on the molecular surface of misfolded proteins. Using this unique "precision medicine" approach, ProMIS Neurosciences is developing novel antibody therapeutics and specific companion diagnostics for Alzheimer’s disease and ALS. The company has also developed two proprietary technologies to specifically identify very low levels of misfolded proteins in a biological sample. In addition, ProMIS Neurosciences owns a portfolio of therapeutic and diagnostic patents relating to misfolded SOD1 in ALS, and currently has a preclinical monoclonal antibody therapeutic against this target. The TSX has not reviewed and does not accept responsibility for the adequacy or accuracy of this release. This information release may contain certain forward-looking information. Such information involves known and unknown risks, uncertainties and other factors that may cause actual results, performance or achievements to be materially different from those implied by statements herein, and therefore these statements should not be read as guarantees of future performance or results. All forward-looking statements are based on the Company's current beliefs as well as assumptions made by and information currently available to it as well as other factors. Readers are cautioned not to place undue reliance on these forward-looking statements, which speak only as of the date of this press release. Due to risks and uncertainties, including the risks and uncertainties identified by the Company in its public securities filings, actual events may differ materially from current expectations. The Company disclaims any intention or obligation to update or revise any forward-looking statements, whether as a result of new information, future events or otherwise. For further information please consult the Company's website at: http://www.promisneurosciences.com Like us on LinkedIn


MARKHAM, ONTARIO--(Marketwired - Oct. 31, 2016) - VIQ Solutions Inc. ("VIQ" or "VIQ Solutions") (TSX VENTURE:VQS), a global expert providing a cybersecurity protected technology and service platform for digital evidence capture and content management, is excited to announce that VIQ has partnered with the Department of Surgery of the Michael G. DeGroote School of Medicine at McMaster University ("McMaster") for an AV capture, management and collaborative web portal workflow geared towards improving how new surgeons are trained. The innovative AV training and assessment workflow follows the patent pending process outlined in VIQ's press release of September 26, 2016. "A prestigious customer like McMaster University using our new patent pending AV assessment workflow, including mobility, data analytics and our collaborative web portal, is a tremendous win for VIQ," said Sebastien Paré, President and CEO of VIQ Solutions. "Our innovative, collaborative technology sets VIQ apart for medical, insurance and law enforcement customers who demand innovative technology solutions without sacrificing the security and privacy of their digital content." McMaster University is ranked among the top research universities in Canada, and among the top 100 in the world. With a long-standing reputation as Canada's "most innovative" university, McMaster has pioneered a number of programs that have changed how professors teach and students learn. McMaster University's Michael G. DeGroote School of Medicine trains many of today's surgeons in multiple disciplines. As an innovator McMaster faculty are again leading the way with surgical training techniques and methodologies within Canada. To facilitate this innovative collaboration, McMaster chose VIQ for a pilot which provides programs with an innovative digital solution that has the ability to securely capture, manage and share critical content with the highest encryption security and confidentiality possible. Multiple channels of live, high-definition educational video can be captured and automatically synchronized to a secure central repository in real time. Using the VIQ solution, both learners and educators have the ability to tag key events during procedures and add additional notes related to specific occurrences. These timestamped events can later be easily located and analyzed for identifying key learning competencies, providing a new degree of training feedback that is integrated with program requirements. This smartphone centric solution provides students the ability to review their performance and complete a customized questionnaire related to specific areas of competency while still maintaining confidentiality and security. The questionnaire is automatically exchanged depending on the procedures being assessed, and is securely moved to the collaboration portal along with audio/video performance evidence. The captured AV content can be edited or clipped to specific areas of interest and routed to a secure content portal for training and education of authorized personnel, including McMaster medical students or for expert consultation. The VIQ content portal has been customized for McMaster and allows authorized personnel to log in and review surgical AV content using their standard web browser while maintaining the security and privacy of all medical data. "The sophisticated VIQ workflow gives McMaster University Faculty of Health Sciences staff a technological advantage in our quest for producing the best surgeons and promoting surgical competency. It is reassuring to know content will be captured and routed automatically using a private, completely confidential and secure platform," said Dr. Brad Petrisor, Associate Professor and Director of the Training Program in Orthopaedic Surgery at McMaster. "McMaster University has always been a leader in innovation in curriculum and evidence-based medicine. We're pleased to work with VIQ and their partners to implement these advanced solutions for our surgical programs which will allow us to continue to develop highly innovative and exceptional evidence-based surgical training programs," added Dr. Ranil Sonnadara, Director of the Department of Surgery's Office of Education Science, and Executive Director of Research and High Performance Computing at McMaster. For more information on what is making the news at VIQ Solutions, please visit our website at http://www.viqsolutions.com/news.html. McMaster University, based in Hamilton, Canada, is one of the leading academic research facilities in the country. The Center has consistently been ranked in the Top 100 universities in the world. Founded in 1887, it is renowned for its medical-doctoral, research-intensive programs dedicated to teaching, research and service. The university has a total student population of more than 26,000 from 79 countries. The Michael G. DeGroote School of Medicine is a flagship program with an international reputation for its unique three-year program based on small group, problem-based study and early introduction to the clinical experience. The program has approximately 5,000 applicants a year, more than any other Canadian medical school. The Center's mission is the discovery, communication and preservation of knowledge, committed to creativity, innovation and excellence. For more information, please visit our website at www.mcmaster.ca. VIQ Solutions is the leading technology and service platform provider for digital evidence capture and content management. Our secure modular software allows customers to onboard the VIQ platform at any stage of their organization's digitization, from the capture of digital content from video and audio devices through to online collaboration, mobility, data analytics and integration with sensors, facial recognition, speech recognition and case management or patient record systems. VIQ's technology leads the industry in security, meeting the highest international standards for digital/cyber security and privacy, including military and medical regulations. Our solutions are in use in over 20 countries with tens of thousands of users in over 200 government and private agencies including law enforcement, immigration, medical, legal, insurance, courts, and transportation and transcription services. VIQ also provides end to end transcription services to several large government agencies through our Australia-based reporting and transcription partners. VIQ operates worldwide with partners like security integrators, audio-video specialists, and hardware and data storage suppliers. Managing digital media evidence is what we do, and we do it better than anyone else. For more information about VIQ Solutions, please visit www.viqsolutions.com. Neither the TSX Venture Exchange nor its Regulation Service Provider (as that term is defined in the policies of the Exchange) accepts responsibility for the adequacy or accuracy of this release.


News Article | October 10, 2016
Site: www.rdmag.com

If you're angry or upset, you might want to simmer down before heading out for an intense run or gym workout. A large, international study ties heavy exertion while stressed or mad to a tripled risk of having a heart attack within an hour. Regular exercise is a healthy antidote to stress and can help prevent heart disease — the biggest problem is that too many people get too little of it. But the new research suggests there may be better or worse times to exercise, and that extremes can trigger harm. "This study is further evidence of the connection between mind and body. When you're angry, that's not the time to go out and chop a stack of wood," said Barry Jacobs, a psychologist at the Crozer-Keystone Health System in suburban Philadelphia and an American Heart Association volunteer. He had no role in the study , led by the Population Health Research Institute at McMaster University in Hamilton, Ontario. Results were published Monday in the Heart Association journal Circulation. Earlier studies have looked at anger and exertion as heart attack triggers but most were small or in one country, or included few women or minorities. The new study involved 12,461 people suffering a first heart attack in 52 countries. Their average age was 58 and three-fourths were men. They answered a survey about whether they were angry or upset, or had heavy exertion, in the hour before their heart attack or during the same time period the previous day. That way researchers could compare risk at different times in the same people and the effect of these potential heart attack triggers. Being angry or upset doubled the risk of suffering heart attack symptoms within an hour; heavy physical exertion did the same. Having both at the same time more than tripled the risk for a heart attack. The risk was greatest between 6 p.m. and midnight, and was independent of other factors such as smoking, high blood pressure or obesity. Big caveats: Patients reported their own stress or anger, and people who just had a heart attack may be more prone to recall or think they suffered one of these triggers than they otherwise might have been. Also, strenuous exertion is whatever the patient perceives it to be — for some people that could be climbing stairs and for others, running a marathon. The study also is observational, so it cannot prove cause and effect. But it's likely to be the best kind of information available — it's not possible to randomly assign people to be angry and exercise, then see how many have heart attacks. "This is a large enough sample size that we can put stock in the findings," Jacobs said. "We all need to find ways of modifying our emotional reactions and to avoid extreme anger," such as distracting ourselves, walking away from the stressful situation, trying to see it from a different perspective, talking it out and getting support from other people, he said. The study's findings also are biologically plausible. Emotional stress and exertion can raise blood pressure and heart rate, change the flow of blood in the vessels and reduce the heart's blood supply, said the study leader, Dr. Andrew Smyth of McMaster University. In an artery already clogged with plaque, a trigger could block blood flow and lead to a heart attack. "From a practical perspective, there will be times when exposure to such extremes is unavoidable," Smyth said. "We continue to advise regular physical activity for all, including those who use exercise to relieve stress," but people should not go beyond their usual routine at such times, he said. The study was funded by the Canadian Institutes of Health Research, other governmental bodies from various countries that participated, and grants from several drug companies.


MARKHAM, ONTARIO--(Marketwired - Nov. 29, 2016) - VIQ Solutions Inc. ("VIQ Solutions", "VIQ" or the "Corporation") (TSX VENTURE:VQS), a global expert providing cybersecurity protected technology and services, today reported financial results for the three month and nine month periods ended September 30, 2016. Results are reported in Canadian dollars and are prepared in accordance with International Financial Reporting Standards ("IFRS"). Consolidated quarterly revenue was approximately $2.9M, an increase of $0.6M or 26% over the previous year. Revenue was generated by new customer wins in the medical, law enforcement, intelligence and insurance markets as the transition to a more diversified customer base continues to successfully gain momentum. Recurring revenue for the quarter grew by 35% over the same period in 2015. During the quarter, the Company made strategic investments to advance the key initiative of transitioning revenue from the historical license plus maintenance model to a modernized subscription and cloud based model. "VIQ's subscription and cloud based revenue is strengthening with each quarter as customers demand the flexibility of secure cloud based solutions," said Sebastien Paré, President and CEO of VIQ Solutions. "The global transformation to recurring subscription revenue and SaaS holds many opportunities and short term transitioning pressure on trailing revenue, reported revenue and cash flow. "To drive this transition, we accelerated some strategic technology investments in Q3, ensuring VIQ continues to lead this global shift toward SaaS." VIQ's technology division recorded $0.8M quarterly revenue, an increase of 82% over the same period in 2015. The shift to paperless secure transfer of sensitive digital evidence, the emergence of low cost hardware enabling the interconnectedness of devices and the collection of vast amounts of audio and video data continue to drive VIQ technology sales. During the quarter, VIQ won new customer contracts that integrate its latest technology including smartphone mobile capture and speech recognition. "Integrated speech recognition contributed to our technology revenue increase in Q3. It is a key component of our growth plan, particularly in legal, medical and law enforcement markets," said Mr. Paré. "The integration of seamless, secure speech recognition technology through global providers like Nuance ensure VIQ a competitive edge to meet this growing customer demand." The increased revenue, particularly in the higher margin technology division, increased VIQ's overall gross profit margin to 40% for the quarter as compared to 36% in 2015. VIQ announced the award of patent pending status on key high performance intellectual property during the quarter. The patents relate to VIQ's secure digital workflow providing AV capture and competency assessment of training procedures. Subsequent to the period, a new medical AV training win was announced with McMaster University School of Medicine employing the VIQ patent pending workflow. "McMaster University School of Medicine is the first of many opportunities for VIQ with this sophisticated workflow as more and more industries digitize their training and workflow processes," said Mr. Paré. "The investments we made in Q3 to formally secure the patents on our key intellectual property were an important step in ensuring we capitalize on our technological leadership." VIQ's Australian services posted Q2 revenue of $2.1M, an increase of 17% over the same period in 2015. The revenue increase resulted from new customer wins in higher revenue blended reporting, technology and transcription contracts and breakthroughs in medical transcription. The unaudited third quarter 2016 condensed consolidated interim financial statements and results of operations and Management's Discussion and Analysis of Results and Financial Condition for the three and nine month periods ended September 30, 2016 will be posted on SEDAR's website at www.sedar.com. The financial information included in this release is qualified in its entirety and should be read together with the unaudited third quarter 2016 condensed consolidated interim financial statements and the audited consolidated financial statements for the year ended December 31, 2015, including the notes thereto. VIQ Solutions is the leading technology and service platform provider for digital evidence capture and content management. Our secure modular software allows customers to onboard the VIQ platform at any stage of their organization's digitization, from the capture of digital content from video and audio devices through to online collaboration, mobility, data analytics and integration with sensors, facial recognition, speech recognition and case management or patient record systems. VIQ's technology leads the industry in security, meeting the highest international standards for digital/cyber security and privacy, including military and medical regulations. Our solutions are in use in over 20 countries with tens of thousands of users in over 200 government and private agencies including law enforcement, immigration, medical, legal, insurance, courts, transportation and transcription service providers. VIQ also provides end to end transcription services to several large government agencies through our Australia-based reporting and transcription partners. VIQ operates worldwide with partners like security integrators, audio-video specialists, and hardware and data storage suppliers. For more information about VIQ Solutions, please visit www.viqsolutions.com. Certain statements included in this news release constitute forward looking statements or forward looking information under applicable securities legislation. Such forward looking statements or information are provided for the purpose of providing information about management's current expectations and plans relating to the future. Readers are cautioned that reliance on such information may not be appropriate for other purposes. Forward looking statements or information typically contain statements with words such as "anticipate", "believe", "expect", "plan", "intend", "estimate", "propose", "project" or similar words suggesting future outcomes or statements regarding an outlook. Forward looking statements or information in this news release include, but are not limited to, management's targets for the Corporation's growth in 2016 and beyond. Forward looking statements or information is based on a number of factors and assumptions which have been used to develop such statements and information but which may prove to be incorrect. Although VIQ Solutions believes that the expectations reflected in such forward looking statements or information are reasonable, undue reliance should not be placed on forward looking statements because VIQ Solutions can give no assurance that such expectations will prove to be correct. In addition to other factors and assumptions which may be identified in this news release, assumptions have been made regarding, among other things, the Corporation's recent initiatives, and that sales and prospects may provide incremental value for shareholders. Readers are cautioned that the foregoing list is not exhaustive of all factors and assumptions which have been used. Forward looking statements or information are based on current expectations, estimates and projections that involve a number of risks and uncertainties which could cause actual results to differ materially from those anticipated by VIQ Solutions and described in the forward looking statements or information. These risks and uncertainties may cause actual results to differ materially from the forward looking statements or information. Readers are cautioned that the foregoing list is not exhaustive of all possible risks and uncertainties. Neither the TSX Venture Exchange nor its Regulation Service Provider (as that term is defined in the policies of the Exchange) accepts responsibility for the adequacy or accuracy of this release.


News Article | December 23, 2016
Site: www.techtimes.com

Federal guidelines on daily dietary sugar intake could be based on poor evidences, reports a recent study. A team of researchers from McMaster University and The Hospital for Sick Children, who reviewed up to nine public dietary recommendations on sugar intake, including World Health Organization and U.S. Dietary Guidelines for Americans, argue that they are backed up by evidences of poor quality. While the study raises doubts on the quality of federal dietary guidelines, it doesn't encourage the consumption of sugary and nutrient-poor foods such as sugar-sweetened beverages, said Bradley Johnston, the lead author of the study. Johnston added that while it is advisable to limit the amount of daily sugar intake, the biggest question of the day is to what extent it should be limited. Furthermore, if one limits the amount of sugar in diet, what is the alternative suggested to replace it, questioned the researcher. The professor pointed out a similar recommendation in the past, which encouraged a low-fat diet that made the public and the people from food industry replace fat with simple sugars, which paved way for various health outcomes such as diabetes and obesity. Given that if sugar in diet has to replaced, people may increase the intake of starch and additives such as maltodextrine. Taking such additives not only provides same calories as that of sugar but also increases the body's glycemic index. On the other hand, the recommendations from leading authorities vary significantly from each other. For instance, WHO recommends sugar intake that accounts to less than 5 percent of dietary calories per day, while Institute of Medicine limits sugar intake to less than 25 percent of dietary calories taken every day. When the recommendations from reliable authorities contradict with each other, they not only pave way for confusion among people but also make them skeptic about the quality of the guidelines and the quality of evidences the guidelines are prepared with, added Johnston. However, Behnam Sadeghirad, a McMaster PhD student, said that none of the guidelines issued currently on the daily intake of sugar is associated with poor health outcomes. Therefore, it is expected that the current findings would promote them in coming up with more reliable recommendations in the future. "Overall, I would say the guidelines are not trustworthy," said Johnston, reported NPR. "What's happening is that guideline panelists are making strong recommendations based on low-quality evidence." The study is published in Annals of Internal Medicine. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | November 8, 2016
Site: www.prweb.com

Altus Assessments, the creators of the CASPer™ test, the online situational judgement test that top academic programs, like medical schools, around the world use to pre-screen their applicants personal and professional traits, and ZAP Solutions, the creator of AMP, a leading provider of student admissions software for leading post-secondary schools worldwide, today announced a technology partnership and integration. The partnership and integration provides mutual customers with their applicant’s CASPer scores and booking status automatically displayed in the AMP platform. This gives the admissions committee a single location to quickly screen for the most holistically strong applicants, looking beyond cognitive scores and book smarts. “We are thrilled to have the opportunity to partner with Altus, and to offer our clients the ability to utilize CASPer Data within our AMP software,” says Zach Hraber, President of ZAP Solutions. “We are continuously striving to improve AMP and we believe that CASPer Data will help us in providing our clients with the tools & data sets that they need to holistically choose the applicants that are the very best fit for their school.” AMP is your all-in-one enrollment management solution. Leading schools easily, seamlessly and securely manage the student lifecycle from prospect to alumni with the AMP student admissions software. AMP turns complex data into business intelligence to help institutions choose the candidates who are the very best fit for their program. AMP is configured to support each of the program’s specific enrollment requirements. And its seamless integration with other systems, such as centralized and common application services (CAS), commercial and proprietary student information systems (SIS), payment processing and other ERP systems, ensures AMP works well with the other software you’re already using. “The integration of AMP helps deliver on a core promise to help reduce the burden of effort on admissions teams, while simultaneously improving the quality of the information used in screening decision making” says Rich Emrich, CEO of Altus Assessments. “We’re also excited to work with the team from ZAP Solutions, who our customers rave about for their commitment to customer success. This is very much aligned with our internal culture and goals and I’m looking forward to seeing what else we can create together.” CASPer development started a decade ago by some of the same creators of the multiple mini interview (MMI) and in 2015 the test was taken by 20% of all US Medicine applicants and 50% of all Canadian Medicine applicants. It is an an online assessment of an applicant’s personal and professional characteristics, assessing traits such as cultural competence, ethical responsibility, teamwork, and communication. The test is taken from the applicant's computer online, consists of 12 sections in a situational judgement test (SJT) format and takes approximately 75 minutes to complete. Research into the reliability, predictive validity and accessibility of CASPer shows a marked improvement over the more traditional approaches to assess personal and professional characteristics like personal statements, reference letters or standard interviews. For admissions committees who are tasked every year with screening thousands, to tens of thousands of program applicants for only a few hundred spots, the integration of CASPer scores into AMP makes the process of finding strong students faster, more reliable and more defensible. Now filtering for non-cognitive personal and professional traits is as easy as screening for cognitive abilities, reducing the resource burden on staff while simultaneously improving the quality of decision making. Currently used by more than 100 elite public and private medical and graduate schools worldwide, AMP is a customizable, role-based web application designed to streamline and enhance the productivity of complex, multi-step enrollment management processes. AMP is just one of several success stories for ZAP Solutions which, since our founding in 1997, has served as a trusted web and mobile technology provider to agencies, large companies and small and medium businesses across many industries, with a focus on higher education. ZAP also offers a full complement of professional consulting and development services to build, support, implement and integrate our software to fit the unique business process of each institution, admissions office, or company we are working with. The company is headquartered in Pittsburgh, PA. For more information on AMP, please visit http://www.paperlessadmissions.com Altus Assessments Inc provides efficient and cost effective online applicant screening services for academic programs admissions departments (allied health, education, law, business schools etc.) looking for a proven method to pre-screen for personal characteristics and professionalism of their applicant pool. Our primary tool is the online CASPer™ test, delivered at http://takecasper.com. With little cost, or administrative burden, our tool helps programs find holistically better students while reducing effort and cost applied to ineffective tools like standard interviews, reference letters and personal statements. The CASPer™ test was developed starting a decade ago for McMaster University, and has been used to screen over 50,000 medical school applicants to date with good test reliability and predictive powers. The test is not health care specific, but rather uses everyday scenarios in the form of situational judgement testing to evaluate for universally useful skills like communication, collaboration, advocacy and judgment. For 2017 admissions, Altus assessed 30% of all US Medical School applicants and 50% of all Canadian Medical School Applicants. We also assessed 20% of all Canadian Nursing applicants. For more information on CASPer, please visit: https://altusassessments.com.


News Article | November 4, 2016
Site: www.eurekalert.org

Hamilton, ON (Nov. 4, 2016) - McMaster University researchers have found that for patients diagnosed in the late stages of one of the most common and deadly forms of skin cancer, treatment with a combination of immunotherapy options improves survival and lowers the risk of life-threatening events. "This is the first analysis to draw comparison between targeted and immune therapies for BRAF-mutated melanomas," said Feng Xie, an associate professor in the Department of Clinical Epidemiology and Biostatistics at McMaster's Michael G. DeGroote School of Medicine. "Our results will help patients and clinicians choose treatments." Feng Xie is a principal investigator of the study, recently published in JAMA Oncology. Cutaneous melanoma is an aggressive and deadly form of skin cancer. According to the Canadian Cancer Society, the disease accounts for 3.3 per cent of new cancer cases each year in Canada, and it has a 15 per cent death rate. In its early stages, melanoma is often cured with surgery alone, however most patients who are diagnosed in the late stages of disease are not candidates for surgery and drug therapy is the main course of treatment. Tahira Devji, the first author of the paper and a PhD student of McMaster's Health Research Methodology Program, said that around 40 to 60 per cent of melanomas have a mutation in the BRAF protein. A number of effective treatment options are available for patients with advanced BRAF-mutated melanoma, which fall under two classes of drug therapies: targeted therapy, like chemotherapy, which stops cancer from growing and spreading; and immunotherapy, which works by stimulating the immune system to attack tumour cells. It has been unclear which is the optimal initial treatment. The goal of the study was to estimate the relative efficacy and safety of systemic therapies for those who have been diagnosed with advanced BRAF-mutated melanoma but not yet received any treatment. The team evaluated 15 randomized controlled trials published between 2011 and 2015, assessing the benefits and harms of targeted or immune checkpoint inhibitors in 6,662 patients with cancer that had spread to the lymph nodes and surgery was not an option, or distant metastatic melanoma. They found that combined BRAF and MEK targeted therapy and PD-1 immunotherapy were both equally effective in improving overall survival. Combined BRAF and MEK inhibition was most effective in improving progression-free survival. PD-1 inhibition was associated with the lowest risk of life-threatening events. They concluded that the safety of PD-1 inhibitors supports using this treatment option as first-line therapy in circumstances where quick action is not a priority. "While the data in our study represents best available evidence, using more than one kind of immunotherapy shows promise in early outcomes in clinical trials and could change the treatment landscape once longer-term results are published," said Feng Xie.


News Article | December 13, 2016
Site: www.eurekalert.org

HAMILTON, Ont. (Dec. 13, 2016) -- Dr. Ali Emadi of McMaster University's Faculty of Engineering has been named a Fellow of the National Academy of Inventors (NAI). Election to NAI Fellow status is a high professional distinction awarded to academic inventors who have demonstrated a prolific spirit of innovation in creating or facilitating outstanding inventions that have made a tangible impact on quality of life, economic development, and the welfare of society. Emadi is the Canada Excellence Research Chair in Hybrid Powertrain and professor of electrical and computer engineering and mechanical engineering at McMaster University. He is internationally recognized for his expertise in transportation electrification and smart mobility. Emadi holds 40 U.S. patents and patents pending and successfully transferred technology from research to industry. His corporate-sponsored projects have received various recognitions including the 2014 Chrysler Innovation Award. He is also the founder of several university spin-off companies including Hybrid Electric Vehicle Technologies, Inc. and Enedym, Inc. "This prestigious recognition means a lot to me because it values not only inventions and technology transfer from academia to industry, but also mentoring students and translating inventions to benefit society," Emadi said. "I am humbled to receive this great honor and am thankful to my former and current research staff, graduate and undergraduate students, post-doctoral research associates, and visiting scholars, who have made our research group a world-class team focused on developing technologies for the next generation of smart energy systems and electrified and autonomous vehicles." With the election of the 2016 class there are now 757 NAI Fellows, representing 229 research universities and governmental and non-profit research institutes. Included among all NAI Fellows are more than 94 presidents and senior leaders of research universities and non-profit research institutes; 376 members of the three branches of the National Academy of Sciences; 28 inductees of the National Inventors Hall of Fame; 28 Nobel Laureates, among other awards and distinctions. The 2016 Fellows will be inducted on April 6, 2017, as part of the Sixth Annual Conference of the National Academy of Inventors at the John F. Kennedy Presidential Library & Museum in Boston, MA. The academic inventors and innovators elected to the rank of NAI Fellow are named inventors on U.S. patents and were nominated by their peers for outstanding contributions to innovation in areas such as patents and licensing, innovative discovery and technology, significant impact on society, and support and enhancement of innovation. McMaster University, one of four Canadian universities listed among the Top 100 universities in the world, is renowned for its innovation in both learning and discovery. It has a student population of 23,000, and more than 175,000 alumni in 140 countries. The National Academy of Inventors is a 501(c)(3) non-profit member organization comprising U.S. and international universities, and governmental and non-profit research institutes, with over 3,000 individual inventor members and Fellows spanning more than 240 institutions, and growing rapidly. It was founded in 2010 to recognize and encourage inventors with patents issued from the U.S. Patent and Trademark Office, enhance the visibility of academic technology and innovation, encourage the disclosure of intellectual property, educate and mentor innovative students, and translate the inventions of its members to benefit society.


TORONTO & MONTREAL & VANCOUVER, British Columbia--(BUSINESS WIRE)--Versant Ventures today announced that Toronto-based portfolio company Northern Biologics Inc. has executed a transformational deal that expands its pipeline and financial resources. The merger of Mosaic Biomedicals SL with Northern creates a global oncology company backed by Versant and Celgene Corp. (NASDAQ:CELG) that will advance a promising first-in-class antibody into clinical trials in 2017. This announcement also marks the fifth major investment by Versant in life science companies with Canadian operations. It closely follows last week’s debut of BlueRock Therapeutics, a stem cell company that Versant and Bayer AG jointly launched with a series A commitment of CAD$295 million, the largest ever for a Canadian life science startup. Both Northern and BlueRock are examples of harnessing top-tier science and building sustainable companies with the necessary intellectual and financial resources to bring new medicines to patients. In 2013, Versant undertook the challenge of expanding its global footprint and building a significant presence in Canada. The firm’s goal was to source the country’s best scientific opportunities and to manage those startups into successful global companies. “Since launching investment activities in Canada three years ago, our progress toward building a world-class biotech portfolio has exceeded any of our expectations,” said Brad Bolzon, Ph.D., Versant managing director. “It is a testament to the quality of the Canadian academic research community and the commitment of key stakeholders in government and the private sector to build a viable biotech ecosystem that can compete with all other global players.” Versant’s recent activity in Canada also includes portfolio company Turnstone Biologics Inc., which completed one of the largest-ever series B rounds for a Canadian biotech in November. The financing will allow Turnstone to complete ongoing clinical trials of its lead oncolytic immunotherapeutic and also launch three additional clinical programs in the coming 24 months. Like BlueRock and Northern, Turnstone’s foundation was built on scientific discoveries and new technologies developed at Canadian academic institutions. Collectively these institutions include UHN and its affiliates the McEwen Centre for Regenerative Medicine and Princess Margaret Cancer Centre, as well as the Children’s Hospital of Eastern Ontario (CHEO), McMaster University, Ontario Institute for Cancer Research (OICR), Ottawa Hospital Research Institute (OHRI), and the University of Toronto. To accelerate the development of its own investment portfolio in Canada, Versant has also established a network of laboratories across the country called Discovery Engines. These include Inception Sciences in Vancouver and Montreal, and Blueline Bioscience in Toronto. To date several new projects have been launched in the fields of oncology, ophthalmology and inflammatory diseases, some having secured series A backing from Versant and pharmaceutical partners like Bayer and Celgene. “A common theme is to catalyze the creation of companies and accelerate their maturation with our own resources and those of global pharmaceutical partners,” said Jerel Davis, Ph.D., managing director at Versant. “Our pan-Canadian portfolio spans multiple indications, with new companies built on world-class science and strategic partnerships. These startups need the capital resources to be successful, which historically had been a shortcoming of Canadian biotechs.” Canada has become a productive source of biotech investments for Versant. Versant’s Canadian footprint has grown to include three Discovery Engines that house more than 30 scientists, five fully backed companies, two seed investments and 10 academic grants supported by the firm. Together these investments represent more than CAD$500 million in committed capital from Versant, syndicate members and pharmaceutical partners. Versant Ventures is a leading healthcare investment firm committed to helping exceptional entrepreneurs build the next generation of great healthcare companies. The firm invests across the healthcare sector and at all stages of company development, with an emphasis on the discovery and development of novel therapeutics. With $1.9 billion under management and offices in North America and Europe, Versant has built a team with deep investment, operating, and scientific expertise that enables a hands-on approach to company building. Since the firm's founding in 1999, more than 65 Versant companies have achieved successful acquisitions or IPOs. For more information, please visit www.versantventures.com.


News Article | February 15, 2017
Site: www.eurekalert.org

Vitamin D supplements protect against acute respiratory infections including colds and flu, according to a study led by Queen Mary University of London (QMUL) Vitamin D supplements protect against acute respiratory infections including colds and flu, according to a study led by Queen Mary University of London (QMUL). The study provides the most robust evidence yet that vitamin D has benefits beyond bone and muscle health, and could have major implications for public health policy, including the fortification of foods with vitamin D to tackle high levels of deficiency in the UK. The results, published in the BMJ, are based on a new analysis of raw data from around 11,000 participants in 25 clinical trials conducted in 14 countries including the UK, USA, Japan, India, Afghanistan, Belgium, Italy, Australia and Canada. Individually, these trials yielded conflicting results, with some reporting that vitamin D protected against respiratory infections, and others showing no effect. Lead researcher Professor Adrian Martineau from QMUL said: "This major collaborative research effort has yielded the first definitive evidence that vitamin D really does protect against respiratory infections. Our analysis of pooled raw data from each of the 10,933 trial participants allowed us to address the thorny question of why vitamin D 'worked' in some trials, but not in others. "The bottom line is that the protective effects of vitamin D supplementation are strongest in those who have the lowest vitamin D levels, and when supplementation is given daily or weekly rather than in more widely spaced doses. "Vitamin D fortification of foods provides a steady, low-level intake of vitamin D that has virtually eliminated profound vitamin D deficiency in several countries. By demonstrating this new benefit of vitamin D, our study strengthens the case for introducing food fortification to improve vitamin D levels in countries such as the UK where profound vitamin D deficiency is common." Vitamin D - the 'sunshine vitamin' - is thought to protect against respiratory infections by boosting levels of antimicrobial peptides - natural antibiotic-like substances - in the lungs. Results of the study fit with the observation that colds and 'flu are commonest in winter and spring, when levels of vitamin D are at their lowest. They may also explain why vitamin D protects against asthma attacks, which are commonly triggered by respiratory viruses. Daily or weekly supplementation halved the risk of acute respiratory infection in people with the lowest baseline vitamin D levels, below 25 nanomoles per litre (nmol/L). However, people with higher baseline vitamin D levels also benefited, although the effect was more modest (10 per cent risk reduction). Overall, the reduction in risk of acute respiratory infection induced by vitamin D was on a par with the protective effect of injectable 'flu vaccine against 'flu-like illnesses. Acute respiratory infections are a major cause of global morbidity and mortality. Upper respiratory infections such as colds and 'flu are the commonest reason for GP consultations and days off work. Acute lower respiratory infections such as pneumonia are less common, but caused an estimated 2.65 million deaths worldwide in 2013. Vitamin D supplementation is safe and inexpensive, so reductions in acute respiratory infections brought about by vitamin D supplementation could be highly cost-effective. The study was conducted by a consortium of 25 investigators from 21 institutions worldwide* and funded by the National Institute for Health Research. Joel Winston, Public Relations Manager (School of Medicine and Dentistry) Queen Mary University of London j.winston@qmul.ac.uk Tel: +44 (0)20 7882 7943 / +44 (0)7970 096 188 * Institutions involved in the research: Edmond and Lily Safra Children's Hospital (Tel Hashomer, Israel), Geisel School of Medicine at Dartmouth (NH, USA), Harvard School of Public Health (Boston, MA, USA), Jikei University School of Medicine (Tokyo, Japan), Karolinska Institutet (Stockholm, Sweden), Massachusetts General Hospital (Boston, MA, USA), McMaster University (Hamilton, Ontario, Canada), Medical University of Lodz (Poland), QIMR Berghofer Medical Research Institute (Queensland, Australia), Queen Mary University of London (UK), The Pennsylvania State University (Hershey, PA, USA), Università degli Studi di Milano (Milan, Italy), Universitair ziekenhuis Leuven (Belgium), University of Auckland (New Zealand), University of Birmingham (UK), University of Colorado School of Medicine (Aurora, CO, USA), University of Delhi (India), University of Otago (Christchurch, New Zealand), University of Tampere (Finland), University of Tasmania (Australia), Winthrop University Hospital (Mineola, NY, USA). Research paper: 'Vitamin D supplementation to prevent acute respiratory infections: systematic review and meta-analysis of individual participant data'. Martineau et al. BMJ 2017 Queen Mary University of London (QMUL) is one of the UK's leading universities, and one of the largest institutions in the University of London, with 23,120 students from more than 155 countries. A member of the Russell Group, we work across the humanities and social sciences, medicine and dentistry, and science and engineering, with inspirational teaching directly informed by our research. In the most recent national assessment of the quality of research, we were placed ninth in the UK (REF 2014). As well as our main site at Mile End - which is home to one of the largest self-contained residential campuses in London - we have campuses at Whitechapel, Charterhouse Square, and West Smithfield dedicated to the study of medicine, and a base for legal studies at Lincoln's Inn Fields. We have a rich history in London with roots in Europe's first public hospital, St Barts; England's first medical school, The London; one of the first colleges to provide higher education to women, Westfield College; and the Victorian philanthropic project, the People's Palace at Mile End. Today, as well as retaining these close connections to our local community, we are known for our international collaborations in both teaching and research. QMUL has an annual turnover of £350m, a research income worth £125m (2014/15), and generates employment and output worth £700m to the UK economy each year. The National Institute for Health Research (NIHR) is funded by the Department of Health to improve the health and wealth of the nation through research. The NIHR is the research arm of the NHS. Since its establishment in April 2006, the NIHR has transformed research in the NHS. It has increased the volume of applied health research for the benefit of patients and the public, driven faster translation of basic science discoveries into tangible benefits for patients and the economy, and developed and supported the people who conduct and contribute to applied health research. The NIHR plays a key role in the Government's strategy for economic growth, attracting investment by the life-sciences industries through its world-class infrastructure for health research. Together, the NIHR people, programmes, centres of excellence and systems represent the most integrated health research system in the world. For further information, visit the NIHR website (http://www. ).


News Article | November 6, 2016
Site: www.sciencedaily.com

McMaster University researchers have found that for patients diagnosed in the late stages of one of the most common and deadly forms of skin cancer, treatment with a combination of immunotherapy options improves survival and lowers the risk of life-threatening events. "This is the first analysis to draw comparison between targeted and immune therapies for BRAF-mutated melanomas," said Feng Xie, an associate professor in the Department of Clinical Epidemiology and Biostatistics at McMaster's Michael G. DeGroote School of Medicine. "Our results will help patients and clinicians choose treatments." Feng Xie is a principal investigator of the study, recently published in JAMA Oncology. Cutaneous melanoma is an aggressive and deadly form of skin cancer. According to the Canadian Cancer Society, the disease accounts for 3.3 per cent of new cancer cases each year in Canada, and it has a 15 per cent death rate. In its early stages, melanoma is often cured with surgery alone, however most patients who are diagnosed in the late stages of disease are not candidates for surgery and drug therapy is the main course of treatment. Tahira Devji, the first author of the paper and a PhD student of McMaster's Health Research Methodology Program, said that around 40 to 60 per cent of melanomas have a mutation in the BRAF protein. A number of effective treatment options are available for patients with advanced BRAF-mutated melanoma, which fall under two classes of drug therapies: targeted therapy, like chemotherapy, which stops cancer from growing and spreading; and immunotherapy, which works by stimulating the immune system to attack tumour cells. It has been unclear which is the optimal initial treatment. The goal of the study was to estimate the relative efficacy and safety of systemic therapies for those who have been diagnosed with advanced BRAF-mutated melanoma but not yet received any treatment. The team evaluated 15 randomized controlled trials published between 2011 and 2015, assessing the benefits and harms of targeted or immune checkpoint inhibitors in 6,662 patients with cancer that had spread to the lymph nodes and surgery was not an option, or distant metastatic melanoma. They found that combined BRAF and MEK targeted therapy and PD-1 immunotherapy were both equally effective in improving overall survival. Combined BRAF and MEK inhibition was most effective in improving progression-free survival. PD-1 inhibition was associated with the lowest risk of life-threatening events. They concluded that the safety of PD-1 inhibitors supports using this treatment option as first-line therapy in circumstances where quick action is not a priority. "While the data in our study represents best available evidence, using more than one kind of immunotherapy shows promise in early outcomes in clinical trials and could change the treatment landscape once longer-term results are published," said Feng Xie.


LOS ANGELES--(BUSINESS WIRE)--Investigators from Children’s Hospital Los Angeles and 37 other Children’s Oncology Group hospitals in the U.S. and Canada have determined that sodium thiosulfate prevents cisplatin-induced hearing loss in children and adolescents with cancer. Results of this randomized, controlled, phase 3 study, called ACCL0431, have been published in the early online edition of Lancet Oncology. “This federally-funded, cooperative group study is the first to show that cisplatin-induced hearing loss can be reduced by about half in children and adolescents being treated for cancer,” said David R. Freyer, DO, MS, director of the Survivorship & Supportive Care Program in the Children’s Center for Cancer and Blood Diseases at Children’s Hospital Los Angeles, who was lead author and chair of the study. “It is an important step toward developing a safe and effective strategy that will greatly improve quality of life for cancer survivors.” Freyer is also professor of Clinical Pediatrics and Medicine at the Keck School of Medicine of USC. Cisplatin is a chemotherapy medication widely used to treat a variety of cancers in both adults and children. Although effective, cisplatin frequently causes permanent hearing loss and tinnitus (ringing in the ears), resulting in functional disability for patients who receive it. For young children in particular, hearing loss is especially serious because it results in impaired language development, learning and social interactions. Preventing ototoxicity, while preserving chemotherapeutic efficacy, has been a long-standing goal of physicians, scientists, parents and survivors. Historically, there have been no proven treatments for preventing cisplatin-induced hearing loss tested under the rigorous conditions of ACCL0431. Without otoprotection, the only way to prevent hearing loss is to delete or decrease cisplatin doses, which could render the cancer treatment less effective. In ACCL0431, 125 eligible participants between the ages of 1 to 18 years with newly-diagnosed cancer were enrolled over a 4 year period. The cancer diagnoses were hepatoblastoma, germ cell tumor, medulloblastoma, neuroblastoma, osteosarcoma, or other cancer types treated with cisplatin. Study participants were randomized to receive sodium thiosulfate or observation (control) during their chemotherapy. Their hearing was assessed at baseline, following completion of the chemotherapy regimen and 1 year later. The investigators reported a significant reduction in the incidence of hearing loss in participants who were treated with cisplatin and sodium thiosulfate (29%) compared to those who received cisplatin alone (56%). The greatest benefit was seen in children younger than 5 years of age, who are most susceptible to, and also most affected by, cisplatin-induced hearing loss. Other effects of sodium thiosulfate were carefully monitored in the study. Overall, sodium thiosulfate was tolerated well without any serious adverse events. Survival from the cancer was not affected by sodium thiosulfate among participants who had localized tumors. However, survival appeared to be lower among those with metastatic disease who received sodium thiosulfate. Additional research is needed to determine what role sodium thiosulfate should have in preventing hearing loss in specific subsets of patients being treated with cisplatin. Additional contributors to the study include Lu Chen, Mark D. Krailo, Doojduen Villaluna and Bonnie Bliss of the Keck School of Medicine of USC; Kristin Knight, Edward A. Neuwelt of Oregon Health and Science University; Brad H. Pollock of University of California Davis; Jagadeesh Ramdas of Geisinger Medical Center, Danville, PA; Beverly Lange of Children’s Hospital of Philadelphia; David Van Hoff and Michele L. Van Soelen of Helen DeVos Children’s Hospital, Grand Rapids, MI; John Wiernikowski of McMaster University, Hamilton, ON, Canada; and Lillian Sung of the Hospital for Sick Children, Toronto, ON, Canada. This research was supported by the Children’s Oncology Group and the National Cancer Institute of the National Institutes of Health (UG1-CA189955 and U10-CA095861). Children’s Hospital Los Angeles has been named the best children’s hospital in California and among the top 10 in the nation for clinical excellence with its selection to the prestigious U.S. News & World Report Honor Roll. Children’s Hospital is home to The Saban Research Institute, one of the largest and most productive pediatric research facilities in the United States. Children’s Hospital is also one of America's premier teaching hospitals through its affiliation since 1932 with the Keck School of Medicine of the University of Southern California. For more information, visit CHLA.org. Follow us on Twitter, Facebook, YouTube and LinkedIn, or visit our blog at http://researchlablog.org/.


News Article | February 22, 2017
Site: www.nature.com

One of the worst epidemics in human history, a sixteenth-century pestilence that devastated Mexico’s native population, may have been caused by a deadly form of salmonella from Europe, a pair of studies suggest. In one study, researchers say they have recovered DNA of the stomach bacterium from burials in Mexico linked to a 1540s epidemic that killed up to 80% of the country's native inhabitants. The team reports its findings in a preprint posted on the bioRxiv server on 8 February1. This is potentially the first genetic evidence of the pathogen that caused the massive decline in native populations after European colonization, says Hannes Schroeder, an ancient-DNA researcher at the Natural History Museum of Denmark in Copenhagen who was not involved in the work. “It’s a super-cool study.” In 1519, when forces led by Spanish conquistador Hernando Cortés arrived in Mexico, the native population was estimated at about 25 million. A century later, after a Spanish victory and a series of epidemics, numbers had plunged to around 1 million. The largest of these disease outbreaks were known as cocoliztli (from the word for ‘pestilence’ in Nahuatl, the Aztec language). Two major cocoliztli, beginning in 1545 and 1576, killed an estimated 7 million to 18 million people living in Mexico’s highland regions. “In the cities and large towns, big ditches were dug, and from morning to sunset the priests did nothing else but carry the dead bodies and throw them into the ditches,” noted a Franciscan historian who witnessed the 1576 outbreak. There has been little consensus on the cause of cocoliztli — although measles, smallpox and typhus have all been mooted. In 2002, researchers at the National Autonomous University of Mexico (UNAM) in Mexico City proposed that a viral haemorrhagic fever, exacerbated by a catastrophic drought, was behind the carnage2. They compared the magnitude of the 1545 outbreak to that of the Black Death in fourteenth-century Europe. In an attempt to settle the question, a team led by evolutionary geneticist Johannes Krause at the Max Planck Institute for the Science of Human History in Jena, Germany, extracted and sequenced DNA from the teeth of 29 people buried in the Oaxacan highlands of southern Mexico. All but five were linked to a cocoliztli that researchers think ran from 1545 to 1550. Ancient bacterial DNA recovered from several of the people matched that of Salmonella, based on comparisons with a database of more than 2,700 modern bacterial genomes. Further sequencing of short, damaged DNA fragments from the remains allowed the team to reconstruct two genomes of a Salmonella enterica strain known as Paratyphi C. Today, this bacterium causes enteric fever, a typhus-like illness, that occurs mostly in developing countries. If left untreated, it kills 10–15% of infected people. It’s perfectly reasonable that the bacterium could have caused this epidemic, says Schroeder. “They make a really good case.” But María Ávila-Arcos, an evolutionary geneticist at UNAM, isn't convinced. She notes that some people suggest that a virus caused the cocoliztli, and that wouldn't have been picked up by the team’s method. Krause and his colleagues’ proposal is helped by another study posted on bioRxiv last week, which raises the possibility that Salmonella Paratyphi C arrived in Mexico from Europe3. A team led by Mark Achtman, a microbiologist at the University of Warwick in Coventry, UK, collected and sequenced the genome of the bacterial strain from the remains of a young woman buried around 1200 in a cemetery in Trondheim, Norway. It is the earliest evidence for the now-rare Salmonella strain, and proof that it was circulating in Europe, according to the study. (Both teams declined to comment on their research because their papers have been submitted to a peer-reviewed journal.) “Really, what we’d like to do is look at both strains together,” says Hendrik Poinar, an evolutionary biologist at McMaster University in Hamilton, Canada. And if more ancient genomes can be collected from Europe and the Americas, it should be possible to find out more conclusively whether deadly pathogens such as Salmonella arrived in the New World from Europe. The existence of Salmonella Paratyphi C in Norway 300 years before it appeared in Mexico doesn’t prove that Europeans spread enteric fever to native Mexicans, says Schroeder, but that hypothesis is reasonable. A small percentage of people infected with Salmonella Paratyphi C carry the bacterium without falling ill, so apparently healthy Spaniards could have infected Mexicans who lacked natural resistance. Paratyphi C is transmitted through faecal material, and a collapse of social order during the Spanish conquest might have led to the poor sanitary conditions that are ripe for Salmonella spread, Krause and his team note in the paper. Krause’s study offers a blueprint for identifying the pathogens behind ancient outbreaks, says Schroeder. His own team plans to look for ancient pathogens in Caribbean burial sites that seem to be linked to catastrophic outbreaks, and that were established after the Europeans arrived. “The idea that some of them might have been caused by Salmonella is now a distinct possibility,” he says.


News Article | December 2, 2016
Site: www.eurekalert.org

Investigators from Children's Hospital Los Angeles and 37 other Children's Oncology Group hospitals in the U.S. and Canada have determined that sodium thiosulfate prevents cisplatin-induced hearing loss in children and adolescents with cancer. Results of this randomized, controlled, phase 3 study, called ACCL0431, have been published in the early online edition of Lancet Oncology. "This federally-funded, cooperative group study is the first to show that cisplatin-induced hearing loss can be reduced by about half in children and adolescents being treated for cancer," said David R. Freyer, DO, MS, director of the Survivorship & Supportive Care Program in the Children's Center for Cancer and Blood Diseases at Children's Hospital Los Angeles, who was lead author and chair of the study. "It is an important step toward developing a safe and effective strategy that will greatly improve quality of life for cancer survivors." Freyer is also professor of Clinical Pediatrics and Medicine at the Keck School of Medicine of USC. Cisplatin is a chemotherapy medication widely used to treat a variety of cancers in both adults and children. Although effective, cisplatin frequently causes permanent hearing loss and tinnitus (ringing in the ears), resulting in functional disability for patients who receive it. For young children in particular, hearing loss is especially serious because it results in impaired language development, learning and social interactions. Preventing ototoxicity, while preserving chemotherapeutic efficacy, has been a long-standing goal of physicians, scientists, parents and survivors. Historically, there have been no proven treatments for preventing cisplatin-induced hearing loss tested under the rigorous conditions of ACCL0431. Without otoprotection, the only way to prevent hearing loss is to delete or decrease cisplatin doses, which could render the cancer treatment less effective. In ACCL0431, 125 eligible participants between the ages of 1 to 18 years with newly-diagnosed cancer were enrolled over a 4 year period. The cancer diagnoses were hepatoblastoma, germ cell tumor, medulloblastoma, neuroblastoma, osteosarcoma, or other cancer types treated with cisplatin. Study participants were randomized to receive sodium thiosulfate or observation (control) during their chemotherapy. Their hearing was assessed at baseline, following completion of the chemotherapy regimen and 1 year later. The investigators reported a significant reduction in the incidence of hearing loss in participants who were treated with cisplatin and sodium thiosulfate (29%) compared to those who received cisplatin alone (56%). The greatest benefit was seen in children younger than 5 years of age, who are most susceptible to, and also most affected by, cisplatin-induced hearing loss. Other effects of sodium thiosulfate were carefully monitored in the study. Overall, sodium thiosulfate was tolerated well without any serious adverse events. Survival from the cancer was not affected by sodium thiosulfate among participants who had localized tumors. However, survival appeared to be lower among those with metastatic disease who received sodium thiosulfate. Additional research is needed to determine what role sodium thiosulfate should have in preventing hearing loss in specific subsets of patients being treated with cisplatin. Additional contributors to the study include Lu Chen, Mark D. Krailo, Doojduen Villaluna and Bonnie Bliss of the Keck School of Medicine of USC; Kristin Knight, Edward A. Neuwelt of Oregon Health and Science University; Brad H. Pollock of University of California Davis; Jagadeesh Ramdas of Geisinger Medical Center, Danville, PA; Beverly Lange of Children's Hospital of Philadelphia; David Van Hoff and Michele L. Van Soelen of Helen DeVos Children's Hospital, Grand Rapids, MI; John Wiernikowski of McMaster University, Hamilton, ON, Canada; and Lillian Sung of the Hospital for Sick Children, Toronto, ON, Canada. This research was supported by the Children's Oncology Group and the National Cancer Institute of the National Institutes of Health (UG1-CA189955 and U10-CA095861). Children's Hospital Los Angeles has been named the best children's hospital in California and among the top 10 in the nation for clinical excellence with its selection to the prestigious U.S. News & World Report Honor Roll. Children's Hospital is home to The Saban Research Institute, one of the largest and most productive pediatric research facilities in the United States. Children's Hospital is also one of America's premier teaching hospitals through its affiliation since 1932 with the Keck School of Medicine of the University of Southern California. For more information, visit CHLA.org. Follow us on Twitter, Facebook, YouTube and LinkedIn, or visit our blog at http://researchlablog. .


News Article | November 22, 2016
Site: www.marketwired.com

SUDBURY, ONTARIO--(Marketwired - Nov. 22, 2016) - Northern Superior Resources Inc. (TSX VENTURE:SUP) ("Northern Superior" or the "Company") is announcing changes in the composition of the its Board of Directors. This reorganization was prompted by the Board in response to the recent changes to the shareholder base and the Board's desire to provide a transformational change in Board leadership. Stepping down from the Board are Alan Moon, Arnold Klassen, Wayne Livingstone, Fred Lecoq, and John Pollesel. Arthur Murdy and Tom Morris will remain on the Board. Joining the Board are Andrew Farnncomb, Sidney Himmel, John Kiernan and François Perron. Thomas Morris, President and CEO stated "I would like to thank the departing directors for their hard work and dedication to Northern Superior over the years. The individuals currently joining the Board have strong experience in the mineral resources development space. Their skills include mining engineering, corporate finance, investor relations and corporate governance. I look forward to working with the new Board members." Brief resumes for the incoming Board members are provided directly below. Andrew Farncomb is a founder of Cairn Merchant Partners LP, an independent merchant bank that invests and offers advisory services to public and private companies. Prior to forming Cairn, Mr. Farncomb was a Partner at Paradigm Capital, a Canadian investment bank focused on small to medium sized companies. Prior to joining Paradigm Capital, Mr. Farncomb held a business development role at a consumer goods company in Hong Kong. Mr. Farncomb is a member of the Board of Directors of several TSX Venture Exchange listed and private companies. Mr. Farncomb graduated from the Smith School of Business at Queen's University with a Bachelor of Commerce (Honors) degree and received the Merrill Lynch Scholarship. Sidney Himmel B.Sc, B.A., was previously President and Chief Executive Officer of IC Potash Corp. and Chairman of the Board of Directors of Namaste Technologies Inc. He was also President of two other industrial mineral development companies traded on the Toronto Stock Exchange. His career has involved working as tax specialist with a major international accounting firm, a corporate finance specialist with international investment dealers, and as an institutional equity trader and salesman. His experience also included working as in equity investment analyst. His financial experience has included raising substantial amounts of equity funding for a variety of public and private companies including a variety of resource companies. John Kiernan is a Mining Engineer with over 30 years of mine operating, engineering, consulting, corporate and financial experience, including a cumulative four years as an underground miner and operating foreman. He was most recently VP Project Development for Magellan Minerals (acquired by Anfield Gold Corp), and is also a director of Kapuskasing Gold Ltd. Previously he was Manager Project Evaluation for QuadraFNX/ KGHM International, Mining Analyst for PI Financial Corp and VP Mining/Mine Manager for Roca Mines Inc. In the period from 1987 to 2006, Mr. Kiernan held various senior engineering positions with Strathcona Mineral Services, Inco Ltd., Wardrop and AMEC. Mr. Kiernan has a B.Sc in Mining Engineering from Queen's University, and an MBA from Laurentian University. François Perron is presently Vice-President at Renmark Financial Communications. Prior to that, Mr. Perron was the President and Chief Executive Officer of QMX Gold Corporation and was previously the President and Chief Executive Officer of Golden Goose Resources. Prior to joining Golden Goose Resources, Mr. Perron was involved in the financial markets as a portfolio manager. He managed resource focused portfolios for NBC Alternative Investments and various resource funds for the Caisse de dépôt et placement du Québec from 2001 to 2007. In 2006, he was recognized by Brendan Woods International as a Top Gun Asset Manager in Mining. He has a Bachelor of Science, Computer science from McMaster University (1986) and an MBA from the Hautes Etudes Commerciales which he obtained in 1992. Mr. Perron has been on the board of several junior resource companies, and currently is on the board of Goldstar Minerals. Northern Superior will continue its strategy of expanding the resource base of Croteau Est with additional drilling, seeking opportunities to advance its Ti-pa-kaa-ning project and exploiting its outstanding data base. In other business, there were 1,050,000 options granted to staff and management at $0.05, of which 700,000 were granted to senior officers. Northern Superior is a reporting issuer in British Columbia, Alberta, Ontario and Québec, and trades on the TSX Venture Exchange under the symbol SUP. For further information contact: Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. Cautionary Note Regarding Forward-Looking Statements: This Press Release contains forward-looking statements that involve risks and uncertainties, which may cause actual results to differ materially from the statements made. When used in this document, the words "may", "would", "could", "will", "intend", "plan", "anticipate", "believe", "estimate", "expect" and similar expressions are intended to identify forward-looking statements. Such statements reflect our current views with respect to future events and are subject to such risks and uncertainties. Many factors could cause our actual results to differ materially from the statements made, including those factors discussed in filings made by us with the Canadian securities regulatory authorities. Should one or more of these risks and uncertainties, such actual results of current exploration programs, the general risks associated with the mining industry, the price of gold and other metals, currency and interest rate fluctuations, increased competition and general economic and market factors, occur or should assumptions underlying the forward looking statements prove incorrect, actual results may vary materially from those described herein as intended, planned, anticipated, or expected. We do not intend and do not assume any obligation to update these forward-looking statements, except as required by law. Shareholders are cautioned not to put undue reliance on such forward-looking statements.


News Article | December 19, 2016
Site: phys.org

"Finding the toys at Walmart or Target, they're pretty much non-existent," said mom Dezaraye Wilgis, sitting with Scarlett in front of their twinkling Christmas tree in St. Augustine. "Or if you get them through a medical supplier they're extremely expensive." While major toy-makers have changed with the times and sell dolls with wheelchairs and crutches, those designed to be used by children with severe disabilities are still difficult, if not impossible, to find. Because the toys have to be customized for each child, the cost can skyrocket. This conundrum gave two University of North Florida professors an idea: mix engineering and physical therapy students in a lab with the goal of converting toys from store shelves into custom-made fun for disabled children. The Adaptive Toy Project is now in its third year and has drawn a five-year grant from the National Institutes of Health. It is helping families such as Scarlett's while giving the students a dose of community service and real-world experience that will stick with them long after graduation. Dr. Alison Cernich, a neuropsychologist and director at the NIH's Eunice Kennedy Shriver National Institute of Child Health and Human Development, said the agency funded the program because it forces students from different fields to collaborate and solve a problem in the community. "This program is getting students in the early phases of their training thinking about ordinary objects, toys, and how to adapt those toys so that children with limitations can use and play with them like children without limitations," she said. On a recent day, the school's small lab buzzed with the sound of tools and chatter as students customized cars for their new owners. Chris Martin, an electrical engineering student, had removed the hood of Scarlett's car, exposing its wires. A large push button replaced the steering, and light sensors mounted underneath the car will allow it to follow a line of tape along the floor whenever Scarlett hits the button. Now, Scarlett's parents can design routes for the car with tape or use a remote-control mode for family walks. When Martin first met Scarlett's mother, "she actually cried, and it just made me want to work harder," Martin said. "I just want to make it as perfect as possible for her." The cars retail between $250 and $500; the customization makes them worth well over $1,000. The families, about 18 so far, get the cars free. Mary Lundy, a UNF professor of physical therapy who started the Adaptive Toy Project with an engineering colleague, said the students meet with families, and go to therapy appointments and schools. "Engineering students teach the physical therapy students how to modify basic electronics ... and in the process engineers learn how to do people-centered designs, and how to look at their clients differently," Lundy said. For the kids, it's also a way to continue important therapies through play. Dr. Peter Rosenbaum, a professor of pediatrics at McMaster University in Canada, said his field is increasingly focusing on "augmented mobility," to give kids a way to move around so they can be more independent. "We can't fix them," Rosenbaum said. "What we can do instead is say, 'What would a child at this age and stage of development be doing if they didn't have their impairment? How can we give them those experiences?' This changes the perspectives of everyone around her, and her perspective of herself." UNF's program is one of 60 related toy car programs for disabled children internationally that are part of the Go Baby Go network, but is the only one that has enlisted students to customize the vehicles for free. After weeks of work, Scarlett finally tested the car Martin and his colleagues built. They strapped her in and showed her how to hit the push button in the toy she would hopefully use for at least three years. The car drove forward, and Scarlett rocked back and forth. Her mother fought back tears, and her father walked alongside her. "For her, she's going to be able to get out more and not be trapped by a wheelchair ... and for us it'll be nice to see her interact with other children. It's amazing," Dezaraye said. Explore further: Video: Physical therapy research improves the lives of children with cerebral palsy


News Article | October 11, 2016
Site: www.biosciencetechnology.com

If you're angry or upset, you might want to simmer down before heading out for an intense run or gym workout. A large, international study ties heavy exertion while stressed or mad to a tripled risk of having a heart attack within an hour. Regular exercise is a healthy antidote to stress and can help prevent heart disease - the biggest problem is that too many people get too little of it. But the new research suggests there may be better or worse times to exercise, and that extremes can trigger harm. "This study is further evidence of the connection between mind and body. When you're angry, that's not the time to go out and chop a stack of wood," said Barry Jacobs, a psychologist at the Crozer-Keystone Health System in suburban Philadelphia and an American Heart Association volunteer. He had no role in the study , led by the Population Health Research Institute at McMaster University in Hamilton, Ontario. Results were published Monday in the Heart Association journal Circulation. Earlier studies have looked at anger and exertion as heart attack triggers but most were small or in one country, or included few women or minorities. The new study involved 12,461 people suffering a first heart attack in 52 countries. Their average age was 58 and three-fourths were men. They answered a survey about whether they were angry or upset, or had heavy exertion, in the hour before their heart attack or during the same time period the previous day. That way researchers could compare risk at different times in the same people and the effect of these potential heart attack triggers. Being angry or upset doubled the risk of suffering heart attack symptoms within an hour; heavy physical exertion did the same. Having both at the same time more than tripled the risk for a heart attack. The risk was greatest between 6 p.m. and midnight, and was independent of other factors such as smoking, high blood pressure or obesity. Big caveats: Patients reported their own stress or anger, and people who just had a heart attack may be more prone to recall or think they suffered one of these triggers than they otherwise might have been. Also, strenuous exertion is whatever the patient perceives it to be - for some people that could be climbing stairs and for others, running a marathon. The study also is observational, so it cannot prove cause and effect. But it's likely to be the best kind of information available - it's not possible to randomly assign people to be angry and exercise, then see how many have heart attacks. "This is a large enough sample size that we can put stock in the findings," Jacobs said. "We all need to find ways of modifying our emotional reactions and to avoid extreme anger," such as distracting ourselves, walking away from the stressful situation, trying to see it from a different perspective, talking it out and getting support from other people, he said. The study's findings also are biologically plausible. Emotional stress and exertion can raise blood pressure and heart rate, change the flow of blood in the vessels and reduce the heart's blood supply, said the study leader, Dr. Andrew Smyth of McMaster University. In an artery already clogged with plaque, a trigger could block blood flow and lead to a heart attack. "From a practical perspective, there will be times when exposure to such extremes is unavoidable," Smyth said. "We continue to advise regular physical activity for all, including those who use exercise to relieve stress," but people should not go beyond their usual routine at such times, he said. The study was funded by the Canadian Institutes of Health Research, other governmental bodies from various countries that participated, and grants from several drug companies.


News Article | November 25, 2015
Site: www.techtimes.com

Ancient London may not have been so different from contemporary London in terms of ethnic diversity after all, a new study revealed. A genetic analysis of four sets of ancient skeletal remains unraveled how the first Londoners must have looked like, their eye and hair color, the disease that afflicted them and where they were from. Senior Curator Caroline McDonald of the Museum of London, where the remains are currently kept, said London had been cosmopolitan ever since the invasion of Romans about 2,000 years ago. McDonald explained that most of the first Londoners were not born in the city, as every first-generation Londoner came from somewhere else. They might have been from somewhere else in Britain, somewhere else in Europe, the Mediterranean or Africa. "So the stories we can tell about our ancient population are absolutely relevant to modern contemporary London because these are our stories - these are people just like us," said McDonald. Museum researchers, together with scientists from Durham University and McMaster University in Canada, reconstructed the DNA of the four ancient individuals. These skeletons were part of 20,000 human remains that came from about 5,500 years back. Researchers found that two of the four skeletons were of people who were born outside of Britain. Of these two, one was of a man who was genealogically connected to Eastern Europe and the Middle East, while the other was of a teenage girl with blue eyes from North Africa, researchers said. One of the four skeletons was of a Briton native. The Eastern Europe man had injuries to his skull which may suggest that he had been killed at an amphitheater in London before his head was dumped into a pit. He may have been a gladiator in his lifetime, scientists said. The girl may have been about 14 years old when she died. Her remains were found in a Roman cemetery at Lant Street in Southwark. Researchers said the girl suffered from rickets, a childhood disease caused by deficiency in vitamin D. The third skeleton was that of a woman, and she may have died shortly after the Romans came to London. She was buried with Roman pottery, and she may have been a native Briton who adopted the Roman lifestyle. Researchers typically drew up the life of the ancient individual by taking note of the belongings with which they were buried in, but the fourth skeleton had none. This man may have been 45 years old when he died, had very dark brown eyes and hair. His DNA linked him to North Africa and he may have grown up in London, experts said. Meanwhile, more skeletal remains in the Museum of London are awaiting further study. Among this list is a group of Napoleonic soldiers and marines, as well as more Roman Londoners. In the meantime, the skeletal remains of the four individuals will be on display at the museum starting Nov. 27 this year.


News Article | November 7, 2016
Site: www.biosciencetechnology.com

McMaster University researchers have found that for patients diagnosed in the late stages of one of the most common and deadly forms of skin cancer, treatment with a combination of immunotherapy options improves survival and lowers the risk of life-threatening events. "This is the first analysis to draw comparison between targeted and immune therapies for BRAF-mutated melanomas," said Feng Xie, an associate professor in the Department of Clinical Epidemiology and Biostatistics at McMaster's Michael G. DeGroote School of Medicine. "Our results will help patients and clinicians choose treatments." Feng Xie is a principal investigator of the study, recently published in JAMA Oncology. Cutaneous melanoma is an aggressive and deadly form of skin cancer. According to the Canadian Cancer Society, the disease accounts for 3.3 percent of new cancer cases each year in Canada, and it has a 15 percent death rate. In its early stages, melanoma is often cured with surgery alone, however most patients who are diagnosed in the late stages of disease are not candidates for surgery and drug therapy is the main course of treatment. Tahira Devji, the first author of the paper and a Ph.D. student of McMaster's Health Research Methodology Program, said that around 40 to 60 per cent of melanomas have a mutation in the BRAF protein. A number of effective treatment options are available for patients with advanced BRAF-mutated melanoma, which fall under two classes of drug therapies: targeted therapy, like chemotherapy, which stops cancer from growing and spreading; and immunotherapy, which works by stimulating the immune system to attack tumour cells. It has been unclear which is the optimal initial treatment. The goal of the study was to estimate the relative efficacy and safety of systemic therapies for those who have been diagnosed with advanced BRAF-mutated melanoma but not yet received any treatment. The team evaluated 15 randomized controlled trials published between 2011 and 2015, assessing the benefits and harms of targeted or immune checkpoint inhibitors in 6,662 patients with cancer that had spread to the lymph nodes and surgery was not an option, or distant metastatic melanoma. They found that combined BRAF and MEK targeted therapy and PD-1 immunotherapy were both equally effective in improving overall survival. Combined BRAF and MEK inhibition was most effective in improving progression-free survival. PD-1 inhibition was associated with the lowest risk of life-threatening events. They concluded that the safety of PD-1 inhibitors supports using this treatment option as first-line therapy in circumstances where quick action is not a priority. "While the data in our study represents best available evidence, using more than one kind of immunotherapy shows promise in early outcomes in clinical trials and could change the treatment landscape once longer-term results are published," said Feng Xie.


News Article | December 8, 2016
Site: www.eurekalert.org

New genetic research from an international team including McMaster University, University of Helsinki, Vilnius University and the University of Sydney, suggests that smallpox, a pathogen that caused millions of deaths worldwide, may not be an ancient disease but a much more modern killer that went on to become the first human disease eradicated by vaccination. The findings, published in the journal Current Biology, raise new questions about the role smallpox may have played in human history and fuels a longstanding debate over when the virus that causes smallpox, variola, first emerged and later evolved in response to inoculation and vaccination. "Scientists don't yet fully comprehend where smallpox came from and when it jumped into humans," says evolutionary geneticist Hendrik Poinar, senior author of the study, director of the McMaster Ancient DNA Centre and a researcher with Michael G. DeGroote Institute of Infectious Disease Research. "This research raises some interesting possibilities about our perception and age of the disease." Smallpox, one of the most devastating viral diseases ever to strike humankind, had long been thought to have appeared in human populations thousands of years ago in ancient Egypt, India and China, with some historical accounts suggesting that the pharaoh Ramses V -who died in 1145 BC--suffered from smallpox. In an attempt to better understand its evolutionary history, and after obtaining clearance from the WHO in Geneva, scientists extracted the heavily fragmented DNA, from the partial mummified remains of a Lithuanian child believed to have died between 1643 and 1665, a period in which several smallpox outbreaks were documented throughout Europe with increasing levels of mortality. The smallpox DNA was captured, sequenced and the ancient genome, one of the oldest viral genomes to date, was completely reconstructed. There was no indication of live virus in the sample and so the mummies are not infectious. Researchers compared and contrasted the 17th Century strain to those from a modern databank of samples dating from 1940 up to its eradication in 1977. Strikingly, the work shows that the evolution of smallpox virus occurred far more recently than previously thought, with all the available strains of the virus having an ancestor no older than 1580. "This study sets the clock of smallpox evolution to a much more recent time-scale" said evolutionary biologist Eddie Holmes, a professor at the University of Sydney, Australia. "Although it is still unclear what animal is the true reservoir of smallpox virus and when the virus first jumped into humans." The pox viral strains that represent the true reservoir for human smallpox remains currently unsampled. Both the closest gerbil (Tetarapox) and camel pox are very distantly related and consequently are not the likely ancestors to smallpox, suggesting that the real reservoir remains at large or has gone extinct. Researchers also discovered that smallpox virus evolved into two circulating strains, variola major and minor, after English physician Edward Jenner famously developed a vaccine in 1796. One form of VARV (Variola virus), known as V. major was highly virulent and deadly, the other V, minor much more benign. However, scientists say, the two forms experienced a 'major population bottleneck' with the rise of global immunization efforts. The date of the ancestor of the minor strain corresponds well with the Atlantic Slave trade which was likely responsible for partial worldwide dissemination. "This raises important questions about how a pathogen diversifies in the face of vaccination. While smallpox was eradicated in human populations, we can't become lazy or apathetic about its evolution - and possible reemergence--until we fully understand its origins," says Ana Duggan, a post doctoral fellow in the McMaster Ancient DNA Centre. Whether the date of the ancestor, approximately 1580, precludes the massive destruction of aboriginal populations in central America by smallpox, introduced by the Spanish, remains questionable. To that end, researchers must carefully examine the remains of individuals buried in epidemic burials in central and southern America, say scientists. "This work blurs the line between ancient diseases and emerging infections. Much of smallpox evolution apparently happened in historic time," says Margaret Humphreys, historian of medicine at Duke University. Attention editors: Additional quotes from collaborators are available here: "I am excited to see that these remains from the Holy Spirit crypt, once scheduled to be buried, are now revealing so much about the health conditions of past Vilnius inhabitans. This research is yielding extraordinary information and we should especially be grateful to those unnamed people that still tell us stories after centuries." - Dario Piombino-Mascali - Vilnius University "Indeed, behind our rear window is another world; the time machine through which we call Archaeovirology," say post doctoral fellow Maria Perdomo and professors Klaus Hedman and Antti Sajantila at University of Helsinki. McMaster provides a high definition broadcast studio that can connect with any television broadcaster around the world. To book an interview please contact:


HAYWARD, Calif., Dec. 06, 2016 (GLOBE NEWSWIRE) -- Today the Anthera Pharmaceuticals Inc. (NASDAQ:ANTH) Board of Directors announced J. Craig Thompson has been promoted to Chief Executive Officer.  Mr. Thompson has also been appointed to serve as a member of the Board of Directors of the Company.  Paul Truex has stepped down from the CEO role and been appointed to the newly created role of Executive Chairman, where he will assume the responsibilities of the Chairman of the Board and continue to provide guidance to Anthera’s senior executive team.  Concurrent with the leadership transition, Dr. Christopher Henney has stepped down as Chairman of the Board after more than 10 years of service to the Company in this role but will remain a member of Anthera’s Board of Directors “The addition of Craig at the beginning of this year has allowed the Company to incorporate commercial readiness planning into our development efforts.  Over the past twelve months Craig has proven his ability to lead and to fully integrate his experiences into the operation of Anthera,” continued Mr. Truex.  “His appointment prepares us for the commercialization of Sollpura and continued development of blisibimod for IgA nephropathy.  I am confident Anthera will continue to thrive with the expansion of Craig’s leadership." “We have been extremely fortunate to have had access to the guidance and experiences of Dr. Henney over the past decade,” commented Paul Truex.  “Chris’s willingness to go the extra mile to advance the Company has been an inspiration to all of us.  We are grateful he will remain on our board to provide his insights and further mentor our team.” “I am extremely proud of what our team has accomplished and I look forward to executing on our strategy to commercialize Sollpura while further exploring opportunities for blisibimod,” commented Craig Thompson.  “This is an exciting time for Anthera with new data emerging on both Sollpura and blisibimod, which could transform the Company’s future.” Following the recent announcement of data from the Phase 2 Proof of Concept Study in IgA Nephropathy with blisibimod, Anthera plans to announce Phase 3 clinical trial results from the Sollpura SOLUTION program before the end of December. About J. Craig Thompson Craig joined Anthera with over 20 years of experience in the pharmaceutical and healthcare industries. He has a proven track record in product development, global brand management, product positioning, access and reimbursement, including the strategic marketing of a number of industry-leading drugs. Prior to Anthera, Mr. Thompson was the Chief Operating Officer for Tetraphase Pharmaceuticals (Nasdaq:TTPH) where he oversaw the development and implementation of the marketing, access & reimbursement and sales strategy as well as the business development and the commercial manufacturing for Tetraphase. Prior to Tetraphase, Mr. Thompson served as Chief Commercial Officer for Trius Therapeutics through the acquisition of Trius by Cubist Pharmaceuticals, Inc. in September 2013. He led the planning of the commercial strategy, was actively involved in negotiating a regional partnership with Bayer as well as in the acquisition of the Trius by Cubist. During his tenure, he participated in three rounds of financing which raised approximately $115 MM. Prior to Trius, Mr. Thompson served in various global and U.S. commercial roles at Pfizer Inc. from 2003 to December 2010 ultimately serving as Vice President of Marketing for Pfizer’s Specialty Care Business Unit, where he was directly responsible for the U.S. commercial strategy for a portfolio of products with more than $1.5 billion in annual U.S. sales. From 1992 to 2003, Mr. Thompson served in positions of increasing responsibility at Merck & Co., Inc., where most notably he worked on commercial planning and marketing activities for the company’s major cardiovascular brands. Mr. Thompson holds a Bachelor’s degree in Commerce from McMaster University and an M.B.A. from the University of Notre Dame. About Paul Truex Mr. Truex served as Director and Chief Executive Officer since the inception of Anthera in 2004. He was responsible for negotiating Anthera’s product licenses for both blisibimod, an anti-BAFF peptibody from Amgen, and recently, Sollpura™(liprotamase), a novel enzyme replacement product from Eli Lilly and Company. During his career, Mr. Truex has been involved with over $500 million in private, public and debt financings and over $1 billion in various strategic in-licensing, out-licensing and merger/acquisition transactions.  Mr. Truex is a member of the Indiana University West Coast Advisory Board for the Johnson Center of Entrepreneurship and Innovation, is a member of the Board of Directors of Milestone Pharmaceuticals Limited (Chairman), CymaBay Therapeutics (Nasdaq:CBAY), LQT Therapeutics and involved as an advisor to a number of early stage ventures in multiple industries. His past board appointments include Peninsula Pharmaceuticals (acquired by Johnson and Johnson), Trius Therapeutics (acquired by Cubist Pharmaceuticals), Eiger Biopharmaceuticals, and Protagonist Therapeutics. About Chris Henney Dr. Henney has served as the Chairman of our board of directors since August 2008 and has been a member of Anthera’s Board of Directors since April 2005. Dr. Henney served as Chairman and Chief Executive Officer of Dendreon Corporation, a biotechnology company he co-founded, from 1997 until his retirement in July 2004.  Dr. Henney was previously a founder of Immunex Corp. and ICOS Corp.  Dr. Henney is currently the Chairman and a director of Cascadian Therapeutics, Inc. (formerly Oncothyreon, Inc.), is vice-chairman and a director of Cyclacel Pharmaceuticals, Inc. (Nasdaq:CYCC), and is a director of Prothena Corporation (Nasdaq:PRTA).  Dr. Henney holds a B.Sc. with honors in medical biochemistry, a Ph.D. in experimental pathology and a D.Sc. for contributions to the field of immunology, all from the University of Birmingham, England. About Anthera Pharmaceuticals, Inc. Anthera Pharmaceuticals is a biopharmaceutical company focused on developing and commercializing products to treat serious and life-threatening diseases, including exocrine pancreatic insufficiency due to cystic fibrosis, IgA nephropathy, lupus, and lupus with glomerulonephritis. Additional information on the Company can be found at www.anthera.com. Safe Harbor Statement Any statements contained in this press release that refer to future events or other non-historical matters, including statements that are preceded by, followed by, or that include such words as "estimate," "intend," "anticipate," "believe," "plan," "goal," "expect," "project," or similar statements, are forward-looking statements made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. These forward-looking statements are based on Anthera's expectations as of the date of this press release and are subject to certain risks and uncertainties that could cause actual results to differ materially as set forth in Anthera's public filings with the SEC, including Anthera's Quarterly Report on Form 10-Q for the quarter ended September 30, 2016. Anthera disclaims any intent or obligation to update any forward-looking statements, whether because of new information, future events or otherwise, except as required by applicable law.


HAYWARD, Calif., Dec. 06, 2016 (GLOBE NEWSWIRE) -- Today the Anthera Pharmaceuticals Inc. (NASDAQ:ANTH) Board of Directors announced J. Craig Thompson has been promoted to Chief Executive Officer.  Mr. Thompson has also been appointed to serve as a member of the Board of Directors of the Company.  Paul Truex has stepped down from the CEO role and been appointed to the newly created role of Executive Chairman, where he will assume the responsibilities of the Chairman of the Board and continue to provide guidance to Anthera’s senior executive team.  Concurrent with the leadership transition, Dr. Christopher Henney has stepped down as Chairman of the Board after more than 10 years of service to the Company in this role but will remain a member of Anthera’s Board of Directors “The addition of Craig at the beginning of this year has allowed the Company to incorporate commercial readiness planning into our development efforts.  Over the past twelve months Craig has proven his ability to lead and to fully integrate his experiences into the operation of Anthera,” continued Mr. Truex.  “His appointment prepares us for the commercialization of Sollpura and continued development of blisibimod for IgA nephropathy.  I am confident Anthera will continue to thrive with the expansion of Craig’s leadership." “We have been extremely fortunate to have had access to the guidance and experiences of Dr. Henney over the past decade,” commented Paul Truex.  “Chris’s willingness to go the extra mile to advance the Company has been an inspiration to all of us.  We are grateful he will remain on our board to provide his insights and further mentor our team.” “I am extremely proud of what our team has accomplished and I look forward to executing on our strategy to commercialize Sollpura while further exploring opportunities for blisibimod,” commented Craig Thompson.  “This is an exciting time for Anthera with new data emerging on both Sollpura and blisibimod, which could transform the Company’s future.” Following the recent announcement of data from the Phase 2 Proof of Concept Study in IgA Nephropathy with blisibimod, Anthera plans to announce Phase 3 clinical trial results from the Sollpura SOLUTION program before the end of December. About J. Craig Thompson Craig joined Anthera with over 20 years of experience in the pharmaceutical and healthcare industries. He has a proven track record in product development, global brand management, product positioning, access and reimbursement, including the strategic marketing of a number of industry-leading drugs. Prior to Anthera, Mr. Thompson was the Chief Operating Officer for Tetraphase Pharmaceuticals (Nasdaq:TTPH) where he oversaw the development and implementation of the marketing, access & reimbursement and sales strategy as well as the business development and the commercial manufacturing for Tetraphase. Prior to Tetraphase, Mr. Thompson served as Chief Commercial Officer for Trius Therapeutics through the acquisition of Trius by Cubist Pharmaceuticals, Inc. in September 2013. He led the planning of the commercial strategy, was actively involved in negotiating a regional partnership with Bayer as well as in the acquisition of the Trius by Cubist. During his tenure, he participated in three rounds of financing which raised approximately $115 MM. Prior to Trius, Mr. Thompson served in various global and U.S. commercial roles at Pfizer Inc. from 2003 to December 2010 ultimately serving as Vice President of Marketing for Pfizer’s Specialty Care Business Unit, where he was directly responsible for the U.S. commercial strategy for a portfolio of products with more than $1.5 billion in annual U.S. sales. From 1992 to 2003, Mr. Thompson served in positions of increasing responsibility at Merck & Co., Inc., where most notably he worked on commercial planning and marketing activities for the company’s major cardiovascular brands. Mr. Thompson holds a Bachelor’s degree in Commerce from McMaster University and an M.B.A. from the University of Notre Dame. About Paul Truex Mr. Truex served as Director and Chief Executive Officer since the inception of Anthera in 2004. He was responsible for negotiating Anthera’s product licenses for both blisibimod, an anti-BAFF peptibody from Amgen, and recently, Sollpura™(liprotamase), a novel enzyme replacement product from Eli Lilly and Company. During his career, Mr. Truex has been involved with over $500 million in private, public and debt financings and over $1 billion in various strategic in-licensing, out-licensing and merger/acquisition transactions.  Mr. Truex is a member of the Indiana University West Coast Advisory Board for the Johnson Center of Entrepreneurship and Innovation, is a member of the Board of Directors of Milestone Pharmaceuticals Limited (Chairman), CymaBay Therapeutics (Nasdaq:CBAY), LQT Therapeutics and involved as an advisor to a number of early stage ventures in multiple industries. His past board appointments include Peninsula Pharmaceuticals (acquired by Johnson and Johnson), Trius Therapeutics (acquired by Cubist Pharmaceuticals), Eiger Biopharmaceuticals, and Protagonist Therapeutics. About Chris Henney Dr. Henney has served as the Chairman of our board of directors since August 2008 and has been a member of Anthera’s Board of Directors since April 2005. Dr. Henney served as Chairman and Chief Executive Officer of Dendreon Corporation, a biotechnology company he co-founded, from 1997 until his retirement in July 2004.  Dr. Henney was previously a founder of Immunex Corp. and ICOS Corp.  Dr. Henney is currently the Chairman and a director of Cascadian Therapeutics, Inc. (formerly Oncothyreon, Inc.), is vice-chairman and a director of Cyclacel Pharmaceuticals, Inc. (Nasdaq:CYCC), and is a director of Prothena Corporation (Nasdaq:PRTA).  Dr. Henney holds a B.Sc. with honors in medical biochemistry, a Ph.D. in experimental pathology and a D.Sc. for contributions to the field of immunology, all from the University of Birmingham, England. About Anthera Pharmaceuticals, Inc. Anthera Pharmaceuticals is a biopharmaceutical company focused on developing and commercializing products to treat serious and life-threatening diseases, including exocrine pancreatic insufficiency due to cystic fibrosis, IgA nephropathy, lupus, and lupus with glomerulonephritis. Additional information on the Company can be found at www.anthera.com. Safe Harbor Statement Any statements contained in this press release that refer to future events or other non-historical matters, including statements that are preceded by, followed by, or that include such words as "estimate," "intend," "anticipate," "believe," "plan," "goal," "expect," "project," or similar statements, are forward-looking statements made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. These forward-looking statements are based on Anthera's expectations as of the date of this press release and are subject to certain risks and uncertainties that could cause actual results to differ materially as set forth in Anthera's public filings with the SEC, including Anthera's Quarterly Report on Form 10-Q for the quarter ended September 30, 2016. Anthera disclaims any intent or obligation to update any forward-looking statements, whether because of new information, future events or otherwise, except as required by applicable law.


HAYWARD, Calif., Dec. 06, 2016 (GLOBE NEWSWIRE) -- Today the Anthera Pharmaceuticals Inc. (NASDAQ:ANTH) Board of Directors announced J. Craig Thompson has been promoted to Chief Executive Officer.  Mr. Thompson has also been appointed to serve as a member of the Board of Directors of the Company.  Paul Truex has stepped down from the CEO role and been appointed to the newly created role of Executive Chairman, where he will assume the responsibilities of the Chairman of the Board and continue to provide guidance to Anthera’s senior executive team.  Concurrent with the leadership transition, Dr. Christopher Henney has stepped down as Chairman of the Board after more than 10 years of service to the Company in this role but will remain a member of Anthera’s Board of Directors “The addition of Craig at the beginning of this year has allowed the Company to incorporate commercial readiness planning into our development efforts.  Over the past twelve months Craig has proven his ability to lead and to fully integrate his experiences into the operation of Anthera,” continued Mr. Truex.  “His appointment prepares us for the commercialization of Sollpura and continued development of blisibimod for IgA nephropathy.  I am confident Anthera will continue to thrive with the expansion of Craig’s leadership." “We have been extremely fortunate to have had access to the guidance and experiences of Dr. Henney over the past decade,” commented Paul Truex.  “Chris’s willingness to go the extra mile to advance the Company has been an inspiration to all of us.  We are grateful he will remain on our board to provide his insights and further mentor our team.” “I am extremely proud of what our team has accomplished and I look forward to executing on our strategy to commercialize Sollpura while further exploring opportunities for blisibimod,” commented Craig Thompson.  “This is an exciting time for Anthera with new data emerging on both Sollpura and blisibimod, which could transform the Company’s future.” Following the recent announcement of data from the Phase 2 Proof of Concept Study in IgA Nephropathy with blisibimod, Anthera plans to announce Phase 3 clinical trial results from the Sollpura SOLUTION program before the end of December. About J. Craig Thompson Craig joined Anthera with over 20 years of experience in the pharmaceutical and healthcare industries. He has a proven track record in product development, global brand management, product positioning, access and reimbursement, including the strategic marketing of a number of industry-leading drugs. Prior to Anthera, Mr. Thompson was the Chief Operating Officer for Tetraphase Pharmaceuticals (Nasdaq:TTPH) where he oversaw the development and implementation of the marketing, access & reimbursement and sales strategy as well as the business development and the commercial manufacturing for Tetraphase. Prior to Tetraphase, Mr. Thompson served as Chief Commercial Officer for Trius Therapeutics through the acquisition of Trius by Cubist Pharmaceuticals, Inc. in September 2013. He led the planning of the commercial strategy, was actively involved in negotiating a regional partnership with Bayer as well as in the acquisition of the Trius by Cubist. During his tenure, he participated in three rounds of financing which raised approximately $115 MM. Prior to Trius, Mr. Thompson served in various global and U.S. commercial roles at Pfizer Inc. from 2003 to December 2010 ultimately serving as Vice President of Marketing for Pfizer’s Specialty Care Business Unit, where he was directly responsible for the U.S. commercial strategy for a portfolio of products with more than $1.5 billion in annual U.S. sales. From 1992 to 2003, Mr. Thompson served in positions of increasing responsibility at Merck & Co., Inc., where most notably he worked on commercial planning and marketing activities for the company’s major cardiovascular brands. Mr. Thompson holds a Bachelor’s degree in Commerce from McMaster University and an M.B.A. from the University of Notre Dame. About Paul Truex Mr. Truex served as Director and Chief Executive Officer since the inception of Anthera in 2004. He was responsible for negotiating Anthera’s product licenses for both blisibimod, an anti-BAFF peptibody from Amgen, and recently, Sollpura™(liprotamase), a novel enzyme replacement product from Eli Lilly and Company. During his career, Mr. Truex has been involved with over $500 million in private, public and debt financings and over $1 billion in various strategic in-licensing, out-licensing and merger/acquisition transactions.  Mr. Truex is a member of the Indiana University West Coast Advisory Board for the Johnson Center of Entrepreneurship and Innovation, is a member of the Board of Directors of Milestone Pharmaceuticals Limited (Chairman), CymaBay Therapeutics (Nasdaq:CBAY), LQT Therapeutics and involved as an advisor to a number of early stage ventures in multiple industries. His past board appointments include Peninsula Pharmaceuticals (acquired by Johnson and Johnson), Trius Therapeutics (acquired by Cubist Pharmaceuticals), Eiger Biopharmaceuticals, and Protagonist Therapeutics. About Chris Henney Dr. Henney has served as the Chairman of our board of directors since August 2008 and has been a member of Anthera’s Board of Directors since April 2005. Dr. Henney served as Chairman and Chief Executive Officer of Dendreon Corporation, a biotechnology company he co-founded, from 1997 until his retirement in July 2004.  Dr. Henney was previously a founder of Immunex Corp. and ICOS Corp.  Dr. Henney is currently the Chairman and a director of Cascadian Therapeutics, Inc. (formerly Oncothyreon, Inc.), is vice-chairman and a director of Cyclacel Pharmaceuticals, Inc. (Nasdaq:CYCC), and is a director of Prothena Corporation (Nasdaq:PRTA).  Dr. Henney holds a B.Sc. with honors in medical biochemistry, a Ph.D. in experimental pathology and a D.Sc. for contributions to the field of immunology, all from the University of Birmingham, England. About Anthera Pharmaceuticals, Inc. Anthera Pharmaceuticals is a biopharmaceutical company focused on developing and commercializing products to treat serious and life-threatening diseases, including exocrine pancreatic insufficiency due to cystic fibrosis, IgA nephropathy, lupus, and lupus with glomerulonephritis. Additional information on the Company can be found at www.anthera.com. Safe Harbor Statement Any statements contained in this press release that refer to future events or other non-historical matters, including statements that are preceded by, followed by, or that include such words as "estimate," "intend," "anticipate," "believe," "plan," "goal," "expect," "project," or similar statements, are forward-looking statements made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. These forward-looking statements are based on Anthera's expectations as of the date of this press release and are subject to certain risks and uncertainties that could cause actual results to differ materially as set forth in Anthera's public filings with the SEC, including Anthera's Quarterly Report on Form 10-Q for the quarter ended September 30, 2016. Anthera disclaims any intent or obligation to update any forward-looking statements, whether because of new information, future events or otherwise, except as required by applicable law.


HAYWARD, Calif., Dec. 06, 2016 (GLOBE NEWSWIRE) -- Today the Anthera Pharmaceuticals Inc. (NASDAQ:ANTH) Board of Directors announced J. Craig Thompson has been promoted to Chief Executive Officer.  Mr. Thompson has also been appointed to serve as a member of the Board of Directors of the Company.  Paul Truex has stepped down from the CEO role and been appointed to the newly created role of Executive Chairman, where he will assume the responsibilities of the Chairman of the Board and continue to provide guidance to Anthera’s senior executive team.  Concurrent with the leadership transition, Dr. Christopher Henney has stepped down as Chairman of the Board after more than 10 years of service to the Company in this role but will remain a member of Anthera’s Board of Directors “The addition of Craig at the beginning of this year has allowed the Company to incorporate commercial readiness planning into our development efforts.  Over the past twelve months Craig has proven his ability to lead and to fully integrate his experiences into the operation of Anthera,” continued Mr. Truex.  “His appointment prepares us for the commercialization of Sollpura and continued development of blisibimod for IgA nephropathy.  I am confident Anthera will continue to thrive with the expansion of Craig’s leadership." “We have been extremely fortunate to have had access to the guidance and experiences of Dr. Henney over the past decade,” commented Paul Truex.  “Chris’s willingness to go the extra mile to advance the Company has been an inspiration to all of us.  We are grateful he will remain on our board to provide his insights and further mentor our team.” “I am extremely proud of what our team has accomplished and I look forward to executing on our strategy to commercialize Sollpura while further exploring opportunities for blisibimod,” commented Craig Thompson.  “This is an exciting time for Anthera with new data emerging on both Sollpura and blisibimod, which could transform the Company’s future.” Following the recent announcement of data from the Phase 2 Proof of Concept Study in IgA Nephropathy with blisibimod, Anthera plans to announce Phase 3 clinical trial results from the Sollpura SOLUTION program before the end of December. About J. Craig Thompson Craig joined Anthera with over 20 years of experience in the pharmaceutical and healthcare industries. He has a proven track record in product development, global brand management, product positioning, access and reimbursement, including the strategic marketing of a number of industry-leading drugs. Prior to Anthera, Mr. Thompson was the Chief Operating Officer for Tetraphase Pharmaceuticals (Nasdaq:TTPH) where he oversaw the development and implementation of the marketing, access & reimbursement and sales strategy as well as the business development and the commercial manufacturing for Tetraphase. Prior to Tetraphase, Mr. Thompson served as Chief Commercial Officer for Trius Therapeutics through the acquisition of Trius by Cubist Pharmaceuticals, Inc. in September 2013. He led the planning of the commercial strategy, was actively involved in negotiating a regional partnership with Bayer as well as in the acquisition of the Trius by Cubist. During his tenure, he participated in three rounds of financing which raised approximately $115 MM. Prior to Trius, Mr. Thompson served in various global and U.S. commercial roles at Pfizer Inc. from 2003 to December 2010 ultimately serving as Vice President of Marketing for Pfizer’s Specialty Care Business Unit, where he was directly responsible for the U.S. commercial strategy for a portfolio of products with more than $1.5 billion in annual U.S. sales. From 1992 to 2003, Mr. Thompson served in positions of increasing responsibility at Merck & Co., Inc., where most notably he worked on commercial planning and marketing activities for the company’s major cardiovascular brands. Mr. Thompson holds a Bachelor’s degree in Commerce from McMaster University and an M.B.A. from the University of Notre Dame. About Paul Truex Mr. Truex served as Director and Chief Executive Officer since the inception of Anthera in 2004. He was responsible for negotiating Anthera’s product licenses for both blisibimod, an anti-BAFF peptibody from Amgen, and recently, Sollpura™(liprotamase), a novel enzyme replacement product from Eli Lilly and Company. During his career, Mr. Truex has been involved with over $500 million in private, public and debt financings and over $1 billion in various strategic in-licensing, out-licensing and merger/acquisition transactions.  Mr. Truex is a member of the Indiana University West Coast Advisory Board for the Johnson Center of Entrepreneurship and Innovation, is a member of the Board of Directors of Milestone Pharmaceuticals Limited (Chairman), CymaBay Therapeutics (Nasdaq:CBAY), LQT Therapeutics and involved as an advisor to a number of early stage ventures in multiple industries. His past board appointments include Peninsula Pharmaceuticals (acquired by Johnson and Johnson), Trius Therapeutics (acquired by Cubist Pharmaceuticals), Eiger Biopharmaceuticals, and Protagonist Therapeutics. About Chris Henney Dr. Henney has served as the Chairman of our board of directors since August 2008 and has been a member of Anthera’s Board of Directors since April 2005. Dr. Henney served as Chairman and Chief Executive Officer of Dendreon Corporation, a biotechnology company he co-founded, from 1997 until his retirement in July 2004.  Dr. Henney was previously a founder of Immunex Corp. and ICOS Corp.  Dr. Henney is currently the Chairman and a director of Cascadian Therapeutics, Inc. (formerly Oncothyreon, Inc.), is vice-chairman and a director of Cyclacel Pharmaceuticals, Inc. (Nasdaq:CYCC), and is a director of Prothena Corporation (Nasdaq:PRTA).  Dr. Henney holds a B.Sc. with honors in medical biochemistry, a Ph.D. in experimental pathology and a D.Sc. for contributions to the field of immunology, all from the University of Birmingham, England. About Anthera Pharmaceuticals, Inc. Anthera Pharmaceuticals is a biopharmaceutical company focused on developing and commercializing products to treat serious and life-threatening diseases, including exocrine pancreatic insufficiency due to cystic fibrosis, IgA nephropathy, lupus, and lupus with glomerulonephritis. Additional information on the Company can be found at www.anthera.com. Safe Harbor Statement Any statements contained in this press release that refer to future events or other non-historical matters, including statements that are preceded by, followed by, or that include such words as "estimate," "intend," "anticipate," "believe," "plan," "goal," "expect," "project," or similar statements, are forward-looking statements made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. These forward-looking statements are based on Anthera's expectations as of the date of this press release and are subject to certain risks and uncertainties that could cause actual results to differ materially as set forth in Anthera's public filings with the SEC, including Anthera's Quarterly Report on Form 10-Q for the quarter ended September 30, 2016. Anthera disclaims any intent or obligation to update any forward-looking statements, whether because of new information, future events or otherwise, except as required by applicable law.


News Article | November 7, 2016
Site: www.marketwired.com

TORONTO, ONTARIO--(Marketwired - Nov. 7, 2016) - Morumbi Resources Inc. (TSX VENTURE:MOC) ("Morumbi" or the "Company") is pleased to announce the appointments of Mr. Clifford Hale-Sanders to the position of Executive Vice President effective November 1, 2016 and Mr. Rohan Hazelton to the position of Chief Financial Officer and Corporate Secretary, effective November 15, 2016. Mr. Hale-Sanders career has spanned approximately 20 years in the capital markets industry working as a leading Base Metals and Bulk Commodities equity research analyst in Canada. During his career, he worked at RBC Capital Markets, TD Securities, CIBC World Markets and Cormark Securities. During this period, Mr. Hale-Sanders visited and reviewed numerous mining operations and corporate entities around the world from both an operational and financial perspective. Mr. Hale-Sanders holds a B.Sc. in Geology and Chemistry from the University of Toronto, an MBA from McMaster University and is a CFA Charter holder. Mr. Hale-Sanders initially joined the Company in February 2016 as Business Development Advisor to support the search for substantial acquisition opportunities within the mining industry and now transitions into a full-time role. Commenting on the appointment, Chris Buncic, President and CEO, states, "Having been an integral part of the team that identified, evaluated and executed the acquisition of El Mochito, we are pleased that Cliff has joined us in a full-time capacity. In addition to supporting day to day management and optimization of El Mochito, Cliff will play a pivotal role in identifying additional growth opportunities as Morumbi looks to grow into a mid tier mining company in the future." Mr. Hazelton has over 20 years of international finance experience, including 15 years in the mining sector. Mr. Hazelton was formerly the Vice President, Strategy for Goldcorp Inc. Mr. Hazelton has held a variety of senior management positions at Goldcorp including Vice President of Finance, Chief Financial Officer of Goldcorp Mexico, and Corporate Controller. Mr. Hazelton was one of the earliest employees at Wheaton River Minerals Ltd. and was a key part of the management team that led the growth of Wheaton River and later Goldcorp. Mr. Hazelton holds a B.A in Applied Mathematics and Economics from Harvard University, and is a Chartered Professional Accountant. Commenting on the appointment, Chris Buncic CEO, states, "Rohan has broad experience in mining finance and operations and his fluency in Spanish will be an asset to our team. His experience in growing Wheaton River Minerals and later Goldcorp from a $20M market cap company to a peak of approximately $40B will add value as Morumbi looks to grow into a mid tier mining company in the future. We are pleased that both Cliff add Rohan have joined the Morumbi team on a full-time basis as we enter the next phase of our corporate development." The Company also announces that Mr. Eric Szustak will step down as CFO effective November 15, 2016 but will remain as an advisor to the Company to assist during the transition. The Company's Board of Directors and management team would like to take this opportunity to sincerely thank Mr. Szustak for his hard work and dedication as its Chief Financial Officer & Corporate Secretary. Morumbi is a public company historically focused on evaluating resource opportunities. The Company recently announced a transaction to acquire the El Mochito mine in Honduras from Nyrstar BV, and is working to close this acquisition targeting the end of the year. The Company has been evaluating producing and advanced development stage mineral resource opportunities principally in Latin America. It also has a legacy light oil property in northwest Alberta. The Company trades on the TSX Venture Exchange under the symbol "MOC". Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This press release includes certain "forward-looking information" within the meaning of applicable Canadian securities legislation. Forward-looking information is based on reasonable assumptions that have been made by Morumbi as at the date of such information and is subject to known and unknown risks, uncertainties and other factors that may cause the actual results, level of activity, performance or achievements of Morumbi to be materially different from those expressed or implied by such forward-looking information, including but not limited to: the impact of general business and economic conditions; that all conditions precedent to the Offering will be met; that any accretive acquisitions, as a result of current discussions pertaining to mineral resource assets in Latin America or otherwise, will be completed; problems inherent to the marketability of base and precious metals; industry conditions, including fluctuations in the price of base and precious metals, fluctuations in interest rates; government entities interpreting existing tax legislation or enacting new tax legislation in a way which adversely affects Morumbi; stock market volatility; competition; risk factors disclosed in Morumbi's most recent Management's Discussion and Analysis available electronically on SEDAR; and such other factors described or referred to elsewhere herein, including unanticipated and/or unusual events. Many such factors are beyond Morumbi's ability to control or predict. Although Morumbi has attempted to identify important factors that could cause actual outcomes to differ materially, there may be other factors that cause results not to be as anticipated, estimated or intended. There can be no assurance that forward-looking information will prove to be accurate as actual outcomes and future events could differ materially from those reliant on forward-looking information. All of the forward-looking information given in this press release is qualified by these cautionary statements and readers are cautioned not to put undue reliance on forward-looking information due to its inherent uncertainty. Morumbi disclaims any intent or obligation to update any forward-looking information, whether as a result of new information, future events or results or otherwise, except as required by law. This forward-looking information should not be relied upon as representing the Company's views as of any date subsequent to the date of this press release.


News Article | December 22, 2016
Site: www.marketwired.com

TORONTO, ONTARIO--(Marketwired - Dec. 22, 2016) - Lakeside Minerals Inc. (NEX:LAK.H) (the "Company" or "Lakeside") is pleased to announce that it has formed a special committee ("Special Committee") to evaluate potential business expansion into cannabis space in the United States. The special committee is being comprised of David Posner, Hamish Sutherland and Robert Schwartz. The Company is currently a Tier 2 Mining Issuer pursuant to the policies of the TSXV. Management and board has considered potential strategies to maximize shareholder value in the mineral exploration sector, including strategic alternatives relating to the Company's Launay project. At this time, the Company's primary asset and focus continues to be advancement of the mineral exploration projects in its portfolio, until the board of directors determines otherwise, subject to obtaining requisite approvals. The Special Committee's mandate is to evaluate different facets of the US cannabis industry, especially in the light of recent regulatory developments in several US states and Canada, with specific focus on plant propagation and growing as retail segments of the value chain. The Company will only consider US states which have enacted or are in the process of enacting cannabis regulations for either medical or adult recreational use and are in compliance with the requirements of the Cole Memo. The Special Committee is in the process of considering various business models and acquisition/partnership opportunities, but at this time there is no undisclosed material information in regards to the potential change of business strategy. Mr. David Posner currently serves as the Chairman of the board of directors of Nutritional High International Inc., a director of The Tinley Beverage Company Inc., Capricorn Business Acquisitions Inc. and a director of Aura Health Corp. (a private company involved in the development and acquisition of marijuana health clinics in the US). Between 2012 and 2014, Mr. Posner served as the Acquisitions Manager for Stonegate Properties Inc., where he managed real estate properties and brokered deals in Canada and Oklahoma. He was a Managing Director of Sales and Acquisitions for Maria Chiquita Development Company from 2005 to 2012. From 2004 to 2007 he was a partner in a private investment group investment group involved in the acquisition, re-zoning and re-positioning for sale of land holdings in Costa Rica and Panama. Mr. Posner holds a Bachelor of Arts degree from York University. Mr. Hamish Sutherland is a former Chief Operating Officer of Bedrocan Cannabis Corp. Prior to which he was the Chief Operating Officer of Kaypok Inc, a start-up company that developed a proprietary analytical algorithm that manages and analyses social and conventional media conversations and their relative impact, raising seed capital from MaRS Innovation. He was also the Managing Partner of The Marketing Partners, a Toronto based consultancy providing strategic operating and marketing advice to businesses entering the Canadian market. Mr. Sutherland was also the president of Hunter Porcupine Gold Limited, a junior mineral exploration company. Mr. Sutherland holds a Bachelor of Engineering degree from McMaster University and an MBA from York University. Robert Schwartz has been a serial entrepreneur for over 15 years. His expertise lies in manufacturing, global distribution, and corporate restructuring. For over 15 years, Mr. Schwartz has been a leader in the import/export industry. He has direct ties with aftermarket automotive manufacturers and SOEs in China, distributing quality product throughout Canada, United States and Mexico. His background includes jobs at one of the top five banks in Canada and also financing micro-cap companies in the venture capital space. Robert currently serves as a director at Aura Health Corp. Mr. Schwartz holds a Bachelor of Arts degree from York University in Economics. Lakeside Minerals Inc. is engaged in acquiring, exploring, and developing mineral properties. The Company's flagship Launay property is located in the heart of the Abitibi, 48 km northeast of Rouyn-Noranda. The Launay property straddles a significant extent of the Macamic deformation zone: a major deformation zone in the Abitibi subprovince located north of the Porcupine-Destor deformation zone. Lakeside is also pursuing potential acquisitions of interests in undervalued mineral exploration properties. Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. FORWARD-LOOKING STATEMENTS: Certain of the information contained in this news release may contain "forward-looking information". Forward-looking information and statements may include, among others, statements regarding the future plans, costs, objectives or performance of the Company or the assumptions underlying any of the foregoing. In this news release, words such as "may", "would", "could", "will", "likely", "believe", "expect", "anticipate", "intend", "plan", "estimate" and similar words and the negative form thereof are used to identify forward-looking statements. Forward-looking statements should not be read as guarantees of future performance or results, and will not necessarily be accurate indications of whether, or the times at or by which, such future performance will be achieved. Forward-looking statements and information are based on information available at the time and/or management's good-faith belief with respect to future events and are subject to known or unknown risks, uncertainties, assumptions and other unpredictable factors, many of which are beyond the Company's control. The Company does not intend, nor does the Company undertake any obligation, to update or revise any forward -looking information or statements contained in this news release to reflect subsequent information, events or circumstances or otherwise, except if required by applicable laws.


Nidorf S.M.,Heart Care Western Australia | Eikelboom J.W.,McMaster University | Budgeon C.A.,University of Western Australia | Thompson P.L.,Western Research Institute
Journal of the American College of Cardiology | Year: 2013

Objectives: The objective of this study was to determine whether colchicine 0.5 mg/day can reduce the risk of cardiovascular events in patients with clinically stable coronary disease. Background: The presence of activated neutrophils in culprit atherosclerotic plaques of patients with unstable coronary disease raises the possibility that inhibition of neutrophil function with colchicine may reduce the risk of plaque instability and thereby improve clinical outcomes in patients with stable coronary disease. Methods: In a clinical trial with a prospective, randomized, observer-blinded endpoint design, 532 patients with stable coronary disease receiving aspirin and/or clopidogrel (93%) and statins (95%) were randomly assigned colchicine 0.5 mg/day or no colchicine and followed for a median of 3 years. The primary outcome was the composite incidence of acute coronary syndrome, out-of-hospital cardiac arrest, or noncardioembolic ischemic stroke. The primary analysis was by intention-to-treat. Results: The primary outcome occurred in 15 of 282 patients (5.3%) who received colchicine and 40 of 250 patients (16.0%) assigned no colchicine (hazard ratio: 0.33; 95% confidence interval [CI] 0.18 to 0.59; p < 0.001; number needed to treat: 11). In a pre-specified secondary on-treatment analysis that excluded 32 patients (11%) assigned to colchicine who withdrew within 30 days due to intestinal intolerance and a further 7 patients (2%) who did not start treatment, the primary outcome occurred in 4.5% versus 16.0% (hazard ratio: 0.29; 95% CI: 0.15 to 0.56; p < 0.001). Conclusions: Colchicine 0.5 mg/day administered in addition to statins and other standard secondary prevention therapies appeared effective for the prevention of cardiovascular events in patients with stable coronary disease. © 2013 American College of Cardiology Foundation.


Weitz J.I.,McMaster University | Pollack C.V.,University of Pennsylvania
Thrombosis and Haemostasis | Year: 2015

Non-vitamin K antagonist oral anticoagulants (NOACs) are increasingly used in the prevention and treatment of venous thromboembolism and in the prevention of stroke in patients with non-valvular atrial fibrillation. In phase III clinical trials and meta-analyses, the NOACs were at least as effective as vitamin K antagonists (VKAs) and were associated with a similar or lower incidence of major bleeding, including consistent and significant decreases in intracranial bleeding, although with an increase in gastrointestinal bleeding for some agents compared with VKAs. Subsequent real-world evidence supports these outcomes. Despite this, physicians have concerns about serious bleeding or emergencies because there are no specific reversal agents for the NOACs. However, in clinical trials, patients receiving NOACs generally had similar or better outcomes after these events than those taking VKAs. As with any bleeding, anticoagulant-related bleeding should first be stratified according to severity and location; risk can be minimised by ongoing assessment. Management protocols for NOAC-related bleeding are similar to those for VKAs but should take into account the pharmacological profile of the specific drug. Because of their short half-lives, NOAC-related mild bleeding can often be controlled by temporarily withholding treatment. More severe bleeding requires standard escalating haemodynamic support measures, and non-specific reversal agents can be considered in lifethreatening situations, based on limited clinical data. Specific and rapid reversal agents are not currently available for any oral anti - coagulant and restoration of coagulation may not necessarily lead to better outcomes. Nevertheless, specific NOAC reversal agents are in development and show promise in healthy volunteers. © Schattauer 2015.


Heller R.,McMaster University | Albrecht S.,University of Aarhus
Astrophysical Journal Letters | Year: 2014

We present two methods to determine an exomoon's sense of orbital motion (SOM), one with respect to the planet's circumstellar orbit and one with respect to the planetary rotation. Our simulations show that the required measurements will be possible with the European Extremely Large Telescope (E-ELT). The first method relies on mutual planet-moon events during stellar transits. Eclipses with the moon passing behind (in front of) the planet will be late (early) with regard to the moon's mean orbital period due to the finite speed of light. This "transit timing dichotomy" (TTD) determines an exomoon's SOM with respect to the circumstellar motion. For the 10 largest moons in the solar system, TTDs range between 2 and 12 s. The E-ELT will enable such measurements for Earth-sized moons around nearby Sun-like stars. The second method measures distortions in the IR spectrum of the rotating giant planet when it is transited by its moon. This Rossiter-McLaughlin effect (RME) in the planetary spectrum reveals the angle between the planetary equator and the moon's circumplanetary orbital plane, and therefore unveils the moon's SOM with respect to the planet's rotation. A reasonably large moon transiting a directly imaged planet like β Pic b causes an RME amplitude of almost 100 m s-1, about twice the stellar RME amplitude of the transiting exoplanet HD209458 b. Both new methods can be used to probe the origin of exomoons, that is, whether they are regular or irregular in nature. © 2014. The American Astronomical Society. All rights reserved.


Siegal D.M.,McMaster University | Cuker A.,University of Pennsylvania
Drug Discovery Today | Year: 2014

Target-specific oral anticoagulants (TSOACs) provide safe and effective anticoagulation for the prevention and treatment of thrombosis in a variety of clinical settings by interfering with the activity of thrombin (dabigatran) or factor Xa (rivaroxaban, apixaban, edoxaban, betrixaban). Although TSOACs have practical advantages over vitamin K antagonists (VKAs), there are currently no antidotes to reverse their anticoagulant effect. Herein we summarize the available evidence for TSOAC reversal using nonspecific and specific reversal agents. We discuss important limitations of existing evidence, which is derived from studies in human volunteers, animal models and in vitro experiments. Studies evaluating the safety and efficacy of reversal agents on clinical outcomes such as bleeding and mortality in patients with TSOAC-associated bleeding are needed. © 2014 Elsevier Ltd. All rights reserved.


Bauer C.M.T.,Hoffmann-La Roche | Morissette M.C.,McMaster University | Stampfli M.R.,McMaster University
Chest | Year: 2013

COPD is a complex syndrome that poses a serious health threat to > 1.1 billion smokers worldwide. The stable disease is punctuated by episodes of acute exacerbation, which are predominantly the result of viral and bacterial infections. Despite their devastating health impact, mechanisms underlying disease exacerbations remain poorly understood. Mounting evidence suggests that cigarette smoke profoundly affects the immune system, compromising the host's ability to mount appropriate immune and inflammatory responses against microbial agents. This review highlights recent advances in our understanding of the impact of cigarette smoke on type 1 interferon and IL-1 signaling cascades. The immune defects caused by cigarette smoke on these two key pathways contribute to the seemingly contradictory nature of cigarette smoke as both a damaging and a proinflammatory factor as well as an immunosuppressive factor. Understanding the impact of cigarette smoke on the immune system may unravel novel targets for therapies that could affect acute exacerbations and COPD pathogenesis. © 2013 American College of Chest Physicians.


Holmes Jr. D.R.,Mayo Medical School | Lakkireddy D.R.,University of Kansas | Whitlock R.P.,McMaster University | Waksman R.,MedStar Washington Hospital Center | Mack M.J.,Baylor Healthcare System
Journal of the American College of Cardiology | Year: 2014

Stroke prevention in patients with atrial fibrillation is a growing clinical dilemma as the incidence of the arrhythmia increases and risk profiles worsen. Strategies in patients with nonvalvular atrial fibrillation have included anticoagulation with a variety of drugs. Knowledge that stroke in this setting typically results from thrombus in the left atrial appendage has led to the development of mechanical approaches, both catheter-based and surgical, to occlude that structure. Such a device, if it were safe and effective, might avoid the need for anticoagulation and prevent stroke in the large number of patients who are currently not treated with anticoagulants. Regulatory approval has been difficult due to trial design challenges, balance of the risk-benefit ratio, specific patient populations studied, selection of treatment in the control group, and specific endpoints and statistical analyses selected. Accumulating data from randomized trials and registries with longer-term follow-up continues to support a role for left atrial appendage exclusion from the central circulation as an alternative to anticoagulation in carefully-selected patient populations. © 2014 by the American College of Cardiology Foundation.


Buller H.R.,University of Amsterdam | Bethune C.,Isis Pharmaceuticals | Bhanot S.,Isis Pharmaceuticals | Gailani D.,Vanderbilt University | And 5 more authors.
New England Journal of Medicine | Year: 2015

Background Experimental data indicate that reducing factor XI levels attenuates thrombosis without causing bleeding, but the role of factor XI in the prevention of postoperative venous thrombosis in humans is unknown. FXI-ASO (ISIS 416858) is a secondgeneration antisense oligonucleotide that specifically reduces factor XI levels. We compared the efficacy and safety of FXI-ASO with those of enoxaparin in patients undergoing total knee arthroplasty. Methods In this open-label, parallel-group study, we randomly assigned 300 patients who were undergoing elective primary unilateral total knee arthroplasty to receive one of two doses of FXI-ASO (200 mg or 300 mg) or 40 mg of enoxaparin once daily. The primary efficacy outcome was the incidence of venous thromboembolism (assessed by mandatory bilateral venography or report of symptomatic events). The principal safety outcome was major or clinically relevant nonmajor bleeding. Results Around the time of surgery, the mean (+ACY-plusmn;SE) factor XI levels were 0.38+ACY-plusmn;0.01 units per milliliter in the 200-mg FXI-ASO group, 0.20+ACY-plusmn;0.01 units per milliliter in the 300-mg FXI-ASO group, and 0.93+ACY-plusmn;0.02 units per milliliter in the enoxaparin group. The primary efficacy outcome occurred in 36 of 134 patients (27+ACU-) who received the 200-mg dose of FXI-ASO and in 3 of 71 patients (4+ACU-) who received the 300-mg dose of FXI-ASO, as compared with 21 of 69 patients (30+ACU-) who received enoxaparin. The 200-mg regimen was noninferior, and the 300-mg regimen was superior, to enoxaparin (P+ACY-lt;0.001). Bleeding occurred in 3+ACU-, 3+ACU-, and 8+ACU- of the patients in the three study groups, respectively. Conclusions This study showed that factor XI contributes to postoperative venous thromboembolism; reducing factor XI levels in patients undergoing elective primary unilateral total knee arthroplasty was an effective method for its prevention and appeared to be safe with respect to the risk of bleeding. Copyright + 2014 Massachusetts Medical Society.


Siegal D.M.,McMaster University | Cuker A.,University of Pennsylvania
Journal of Thrombosis and Thrombolysis | Year: 2013

Novel oral anticoagulants (NOACs) that directly inhibit thrombin (dabigatran) or factor Xa (rivaroxaban, apixaban, edoxaban) are effective therapies for the prevention and treatment of thromboembolism with reduced bleeding complications compared with warfarin for some indications. However, specific antidotes to reverse the anticoagulant activity of NOACs in the event of major bleeding are not available. Evidence supporting non-specific prohemostatic therapies (prothrombin complex concentrate [PCC], activated prothrombin complex concentrate [aPCC], recombinant factor VIIa) in this setting is limited to healthy human volunteers, animal models, and in vitro studies. Clinical outcome data are lacking. Administration of PCC or aPCC may be considered in addition to supportive measures for patients with severe or life-threatening bleeding. Clinical studies are needed to establish the efficacy and safety of these treatments. Target-specific antidotes are in development and hold promise for NOAC reversal, but require further investigation. © 2013 Springer Science+Business Media New York.


Cuker A.,University of Pennsylvania | Gimotty P.A.,University of Pennsylvania | Crowther M.A.,McMaster University | Warkentin T.E.,McMaster University
Blood | Year: 2012

The 4Ts is a pretest clinical scoring system for heparin-induced thrombocytopenia (HIT). Although widely used in clinical practice, its predictive value for HIT in diverse settings and patient populations is unknown. We performed a systematic review and meta-analysis to estimate the predictive value of the 4Ts in patients with suspected HIT.We searched PubMed, Cochrane Database, and ISI Web of Science for studies that included patients with suspected HIT, who were evaluated by both the 4Ts and a reference standard against which the 4Ts could be compared. Quality of eligible studies was assessed by QUADAS-2 criteria. Thirteen studies, collectively involving 3068 patients, fulfilled eligibility criteria. A total of 1712 (55.8%) patients were classified by 4Ts score as having a low probability of HIT. The negative predictive value of a low probability 4Ts score was 0.998 (95% CI, 0.970-1.000) and remained high irrespective of the party responsible for scoring, the prevalence of HIT, or the composition of the study population. The positive predictive value of an intermediate and high probability 4Ts score was 0.14 (0.09-0.22) and 0.64 (0.40-0.82), respectively. A low probability 4Ts score appears to be a robust means of excluding HIT. Patients with intermediate and high probability scores require further evaluation. © 2012 by The American Society of Hematology.


Eriksson B.I.,Sahlgrenska University Hospital | Quinlan D.J.,King's College | Eikelboom J.W.,McMaster University
Annual Review of Medicine | Year: 2011

The last decade has seen the evaluation of several new oral anticoagulants that directly target thrombin or activated factor X (FXa). All demonstrate a rapid onset of action, a low potential for food and drug interactions, and a predictable anticoagulant effect that obviates the need for routine coagulation monitoring. Those agents at the most advanced stages of clinical development are a direct thrombin inhibitor, dabigatran, and direct FXa inhibitors, rivaroxaban and apixaban. Dabigatran and rivaroxaban are approved in more than 70 countries for prevention of venous thromboembolism in patients undergoing elective hip or knee arthroplasty, and apixaban is being considered for approval by regulatory agencies for this indication. Dabigatran was shown in a large phase III trial to be more effective and safer than warfarin for the prevention of stroke or systemic embolism in patients with atrial fibrillation and has recently been approved for this indication. Edoxaban, an oral FXa inhibitor, is also being evaluated in phase III clinical trials. This review summarizes the pharmacology, clinical trial results, and future role of the new oral anticoagulants in clinical practice. © 2011 by Annual Reviews. All rights reserved.


Cuker A.,University of Pennsylvania | Siegal D.M.,McMaster University | Crowther M.A.,McMaster University | Garcia D.A.,University of Washington
Journal of the American College of Cardiology | Year: 2014

BACKGROUND Non-vitamin K oral anticoagulants (NOACs) do not require routine laboratory monitoring. However, laboratory measurement may be desirable in special situations and populations. OBJECTIVES This study's objective was to systematically review and summarize current evidence regarding laboratory measurement of the anticoagulant activity of dabigatran, rivaroxaban, and apixaban. METHODS We searched PubMed and Web of Science for studies that reported a relationship between drug levels of dabigatran, rivaroxaban, and apixaban and coagulation assay results. Study quality was evaluated using QUADAS-2 (Quality Assessment of Diagnostic Accuracy Studies 2). RESULTS We identified 17 eligible studies for dabigatran, 15 for rivaroxaban, and 4 for apixaban. For dabigatran, a normal thrombin time excludes clinically relevant drug concentrations. The activated partial thromboplastin time (APTT) and prothrombin time (PT) are less sensitive and may be normal at trough drug levels. The dilute thrombin time (R2 = 0.92 to 0.99) and ecarin-based assays (R2 = 0.92 to 1.00) show excellent linearity across on-therapy drug concentrations and may be used for drug quantification. For rivaroxaban and apixaban, anti-Xa activity is linear (R2 = 0.89 to 1.00) over a wide range of drug levels and may be used for drug quantification. Undetectable anti-Xa activity likely excludes clinically relevant drug concentrations. The PT is less sensitive (especially for apixaban); a normal PT may not exclude clinically relevant levels. The APTT demonstrates insufficient sensitivity and linearity for quantification. CONCLUSIONS Dabigatran, rivaroxaban, and apixaban exhibit variable effects on coagulation assays. Understanding these effects facilitates interpretation of test results in NOAC-treated patients. More information on the relationship between drug levels and clinical outcomes is needed. (J Am Coll Cardiol 2014;64:1128-39) © 2014 by the American College of Cardiology Foundation.


News Article | November 5, 2015
Site: phys.org

Showy plumage in birds is not just for the boys, ecologists from Massey University, McMaster University, Canada, Monash University, Australia, and Max Planck Institute for Ornithology, Germany, have demonstrated.


News Article | November 29, 2016
Site: www.eurekalert.org

LOS ALAMOS, N.M., Nov. 29, 2016 -- A new bioinformatics platform called Empowering the Development of Genomics Expertise (EDGE) will help democratize the genomics revolution by allowing users with limited bioinformatics expertise to quickly analyze and interpret genomic sequence data. Researchers at Los Alamos National Laboratory and their collaborators at the Naval Medical Research Center developed EDGE, which is described in a paper recently published in Nucleic Acids Research. "We realized that while next-generation sequencing instruments are becoming more widespread and more accessible to the average biologist or physician, the bioinformatics tools required to process and analyze the data were not as user-friendly or accessible," said Patrick Chain, of Los Alamos' Biosecurity and Public Health group and EDGE team lead. "Given the large number of applications where sequencing is now used, a robust bioinformatics platform that encapsulates a broad array of algorithms is required to help address questions a researcher may have. We sought to develop a web-based environment where non-bioinformatics experts could easily select what pipelines they need and rapidly obtain results and interact with their data." Stopping the spread of disease--from naturally occurring or manmade threats -- requires an in-depth understanding of pathogens and how they work. To this end, the ability to characterize organisms through accurately and rapidly comparing genomic data is an important part of Los Alamos' national security mission. Technology advancements have fueled the development of new sequencing applications and will flood current databases with raw data. A number of factors limit the use of these data, including the large number of associated software and hardware dependencies and the detailed expertise required to perform this analysis. To address these issues, Chain and his team have developed an intuitive web-based environment with a wide assortment of integrated and pioneering bioinformatics tools in pre-configured workflows, all of which can be readily applied to isolate genome sequencing projects or metagenomics projects. EDGE is a user-friendly and open-source platform that integrates hundreds of cutting-edge tools and helps reduce data analysis times from days or weeks to minutes or hours. The workflows in EDGE, along with its ease of use, provide novice next-generation sequencing users with the ability to perform many complex analyses with only a few mouse clicks. This bioinformatics platform is described as an initial attempt at empowering the development of genomics dxpertise, as its name suggests, for a wide range of applications in microbial research. EDGE has already helped streamline data analysis for groups in Thailand, Georgia, Peru, South Korea, Gabon, Uganda, Egypt and Cambodia, as well as within several government laboratories in the United States. The paper "Enabling the democratization of the genomics revolution with a fully integrated web-based bioinformatics platform" was published in Nucleic Acids Research in partnership with the Defense Threat Reduction Agency, the Naval Medical Research Center-Frederick and the Henry M. Jackson Foundation. Patrick Chain earned his master's of science in microbial genomics from McMaster University and his doctoral degree in molecular microbiology and molecular genetics at Michigan State University. He is currently leading the Bioinformatics and Analytics Team and the Metagenomics Program within the Biosecurity and Public Health group at Los Alamos National Laboratory. His background is in microbial ecology, evolution, genomics and bioinformatics, having spent the past 20 years using genomics to study various microbial systems, including the human microbiome, other environmental metagenomic communities, various isolate microbes or single cells, including bacterial and viral pathogens as well as fungal, algal, plant and animal systems. He currently leads a team of researchers whose charge is to devise novel methods, algorithms and strategies for the biological interpretation of massively parallel sequencing data. Los Alamos National Laboratory, a multidisciplinary research institution engaged in strategic science on behalf of national security, is operated by Los Alamos National Security, LLC, a team composed of Bechtel National, the University of California, BWXT Government Group, and URS, an AECOM company, for the Department of Energy's National Nuclear Security Administration. Los Alamos enhances national security by ensuring the safety and reliability of the U.S. nuclear stockpile, developing technologies to reduce threats from weapons of mass destruction, and solving problems related to energy, environment, infrastructure, health, and global security concerns.


News Article | April 4, 2016
Site: news.yahoo.com

A skull and two tusk fragments from a Columbian mammoth, found in a sand it in Oklahoma. More A bulldozer operator at a sand pit in northwestern Oklahoma got quite a surprise this month when he spotted a huge skull that belonged to a Columbian mammoth. These giants were plentiful across the plains of Oklahoma during the Pleistocene epoch, which lasted from about 1.8 million to 11,700 years ago, said Leland Bement of the Oklahoma Archaeological Survey. The discovery was not unheard of, as the Survey typically receives about three "mammoth-sighting" calls a year, Bement said. That made it now less exciting, though. "Archaeological fieldwork is always exciting. You never know what you are going to find," Bement told Live Science in an email. He added, "When it comes to mammoth finds, we are always on the lookout for the next one that has projectile points or stone tools associated with it to indicate that the animal was killed and butchered. We have so few of these sites across North America and only one so far in Oklahoma." [Photos: A 40,000-Year-Old Mammoth Autopsy] The skull had been deposited on the sandbar of a river channel, the archaeologists said. So far, the archaeologists have unearthed the animal's skull with a single tooth in place; apparently, another tooth had been removed from the skull during the clearing of the sand. "We don't know the cause of death. There is no sign that people killed or butchered it," Bement told Live Science in an email. "Its skull was washed around in the river. The rest of the animal could be anywhere." Though the scientists have not pinpointed an exact age for the skull, they know it’s more than 11,000 years old — the period when mammoths and other megafauna went extinct at the end of the Pleistocene. Scientists have put forth several reasons for the extinctions, ranging from rapid climate warming to ice age human hunters. Others have suggested a perfect storm of culprits. One group of dwarf mammoths is thought to have survived in the Arctic, on Wrangel Island, until about 3,700 years ago. Like other Columbian mammoths (Mammuthus columbi), this one was not the cold-adapted type and preferred more temperate stomping grounds in southern and central North America. The woolly mammoth (Mammuthus primigenius), the kind portrayed in the "Ice Age" movies, would have called the chilly tundra home. The Columbian variety was also much larger than the woollies, with Columbian males reaching up to twice the size of woolly males, according to Hendrik Poinar, an evolutionary geneticist at McMaster University in Hamilton, Canada. Columbian mammoths also arrived in North America about 1.5 million years ago, whereas woolly mammoths stepped onto the continent some 400,000 years ago, said Poinar, who spoke with Live Science in 2011. Finding mammoth bones, while a mammoth discovery, seems relatively common across the United States. This past January, a construction crew discovered the femur of a mammoth (possibly a Columbian mammoth) under the Oregon State University's football field. Last September, two Michigan farmers found a mammoth's skull and tusks while they were installing a drainage pipe. And, in October 2014, a volunteer "paleontologist" unearthed the skeleton of a mammoth on the banks of a reservoir in Idaho. That skeleton dated back more than 72,000 years, said the scientists involved in the excavation. Next, the researchers, including Oklahoma State University geographer Carlos Cordova, will analyze the mammoth teeth for particles from plants encased in tartar buildup, Bement said. "That will tell us what the mammoth was eating and also help in reconstructing the environment at the time he lived." The findings will be included in a broader study, by doctoral student Tom Cox, of the distribution of mammoths in Oklahoma, he added. Copyright 2016 LiveScience, a Purch company. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.


HAMILTON, ON and HACKENSACK, NJ--(Marketwired - November 10, 2016) - Triumvira Immunologics today announced that new data on the TAC platform will be presented Friday, November 11 at the 31st Annual Meeting of the Society for Immunotherapy of Cancer (SITC) in National Harbor, Maryland. Dr. Chris Helsen, Triumvira's Head of Platform Development, is presenting a poster (P18) entitled "T cell antigen couplers (TAC) demonstrate strong effectivity against solid tumors with no measurable toxicities, demonstrating an enhanced therapeutic index" which will include animal data from our solid tumor HER2 TAC-T cell program and new animal data from our CD19 and BCMA programs, demonstrating robust anti-tumor activity for both. An additional poster (P16), supported in part with funding from Triumvira, entitled "A novel xenograft model of chimeric antigen receptor-mediated toxicity sheds light on the influence of T cell source on the severity of the toxic sequalae" details the toxicity profile of HER2 CAR-T cells in mice, which contrasts sharply with the safety profile observed for HER2 TAC-T cells. Jonathan Bramson, PhD, Triumvira's Chief Scientific Officer, commented "We are pleased to have the opportunity to present new results from several programs at the SITC Annual Meeting. In particular, the results we have seen with CD19 and BCMA directed TAC-T cells give us great confidence in these two programs as we move them forward to the clinic." The SITC is the world's leading member-driven organization specifically dedicated to professionals working in the field of cancer immunology and immunotherapy. The SITC's Annual Meeting provides a multidisciplinary educational and interactive environment focused on improving outcomes for current and future patients with cancer by incorporating strategies based on basic and applied cancer immunotherapy. Triumvira Immunologics is a biotechnology company developing a novel platform for engineering T cells to attack cancers. Triumvira's innovative and proprietary technology for reprogramming T cells, called the T Cell-Antigen Coupler (or TAC), may possess advantages over other approaches to engineered T cells owing to the distinct biology and regulated activation of TAC-T cells. Triumvira has licensed the TAC technology from McMaster University in Hamilton, Ontario and its goal is to begin human testing of TAC T cells in early 2018.


News Article | December 19, 2016
Site: www.scientificamerican.com

Growing a human being is no small feat—just ask any newly pregnant woman. Her hormones surge as her body undergoes a massive physical transformation, and the changes don’t end there. A study published Monday in Nature Neuroscience reveals that during pregnancy women undergo significant brain remodeling that persists for at least two years after birth. The study also offers preliminary evidence that this remodeling may play a role in helping women transition into motherhood. A research team at Autonomous University of Barcelona, led by neuroscientist Elseline Hoekzema of Leiden University, performed brain scans on first-time mothers before and after pregnancy and found significant gray matter changes in brain regions associated with social cognition and theory of mind—the same regions that were activated when women looked at photos of their infants. These changes, which were still present two years after birth, predicted women’s scores on a test of maternal attachment, and were so clear that a computer algorithm could use them to identify which women had been pregnant. One of the hallmarks of pregnancy is an enormous increase in sex steroid hormones such as progesterone and estrogen, which help a woman’s body prepare for carrying a child. There is only one other time when our bodies produce similarly large quantities of these hormones: puberty. Previous research has shown that during puberty these hormones cause dramatic structural and organizational changes in the brain. Throughout adolescence both boys and girls lose gray matter as the brain connections they don’t need are pruned, and their brains are sculpted into their adult form. Very little research has focused on anatomical brain changes during pregnancy, however. “Most women undergo pregnancy at some point in their lives,” Hoekzema says, “But we have no idea what happens in the brain.” Hoekzema and her colleagues performed detailed anatomical brain scans on a group of women who were trying to get pregnant for the first time. The 25 women who got pregnant were rescanned soon after they gave birth; 11 of them were scanned two years after that. (For comparison, the researchers also scanned men and women who were not trying to have a child as well as first-time fathers). During the postpartum period, the researchers also performed brain scans on the new mothers while they looked at photos of their infants. The scientists used a standard scale to rate the attachment between mother and infant. The researchers found that the new mothers experienced gray matter reductions that lasted for at least two years after birth. This loss, however, is not necessarily a bad thing (according to Hoekzema, “the localization was quite remarkable”); it occurred in brain regions involved in social cognition, particularly in the network dedicated to theory of mind, which helps us think about what is going on in someone else’s mind—regions that had the strongest response when mothers looked at photos of their infants. These brain changes could also be used to predict how mothers scored on the attachment scale. In fact, researchers were able to use a computer algorithm to identify which women were new mothers based solely on their patterns of gray matter loss. Gray matter loss was not seen in new fathers or nonparents. It is not entirely clear why women lose gray matter during pregnancy, but Hoekzema thinks it may be because their brains are becoming more specialized in ways that will help them adapt to motherhood and respond to the needs of their babies. The study offers some preliminary evidence to support this idea. Whereas the present study focuses primarily on documenting brain changes during pregnancy, she expects follow-up work to tackle more applied questions such as how brain changes relate to postpartum depression or attachment difficulties between mother and child. Ronald Dahl, a neuroscientist at the University of California, Berkeley, who was not involved in the work, says he had “a delightful ‘wow’ moment” on seeing the study. “This is a pioneering contribution that not only documents structural brain changes linked to pregnancy but also compellingly offers evidence that suggests these represent adaptive changes,” he wrote in an e-mail. Mel Rutherford, an evolutionary psychologist at McMaster University in Ontario, is also enthusiastic about the study—which, to his knowledge, is the first that uses neuroimaging to track brain changes during pregnancy. “Probably the most exciting thing is that they were able to follow up two years after the birth of the baby,” he says, “So they have the longest-term evidence that we've seen of changes in the brain after pregnancy.” The results mesh with Rutherford’s own research on cognitive changes during pregnancy, which he approaches from an evolutionary perspective. “As a parent, you're now going to be solving slightly different adaptive problems, slightly different cognitive problems than you did before you had children,” he explains. “You have different priorities, you have different tasks you're going to be doing, and so your brain changes.”


News Article | November 23, 2016
Site: www.marketwired.com

The Patented Medicine Prices Review Board (PMPRB) is pleased to announce the reappointment of Dr. Mitchell Levine of Hamilton, Ontario as Vice-chairperson of the Board for a second five-year term. Dr. Levine was reappointed by His Excellency the Governor General in Council, on the recommendation of the Minister of Health, the Honourable Jane Philpott, following an open, transparent and merit-based selection process. Dr. Mitchell Levine, Professor in the departments of Medicine and Clinical Epidemiology and Biostatistics in the Faculty of Health Sciences at McMaster University and Director of the Centre for Evaluation of Medicines at St. Joseph's Healthcare in Hamilton, was first appointed Vice-chairperson of the Board in March 2011. "I am honoured to continue serving as Vice-chair of the Board and look forward to helping the PMPRB realize its vision of a sustainable pharmaceutical system where payers have the information they need to make smart reimbursement choices and Canadians can afford the patented medicines they need to live healthy and productive lives."


« Pioneer Valley Transit Authority acquires three Proterra electric buses | Main | SAE International and @GM announce new collegiate competition for autonomous technology; Chevy #Bolt as platform » A research team from University of Western Ontario, McMaster University and Beijing Computational Science Research Center has developed an effective synthesis method to produce isolated single platinum (Pt) atoms and clusters for use as catalysts for the hydrogen evolution reaction (HER) in water splitting to produce hydrogen. In an open-access paper published in Nature Communications, the researchers reported that the single Pt atom catalysts exhibit significantly enhanced catalytic activity (up to 37 times) and high stability in comparison to the state-of-the-art commercial platinum/carbon (Pt/C) catalysts. Platinum-based catalysts are generally considered to be the most effective electrocatalysts for the HER. Unfortunately, Pt is expensive and scarce, limiting the commercial potential for such catalysts. Significant effort has been devoted to the search of non-precious-metal based HER catalysts including sulfide-based materials, and C N . Although these candidate materials show promising activities for the HER, the activities of these catalysts in their present form are insufficient for industrial applications. In this work, the team fabricated single platinum atoms and clusters supported on nitrogen-doped graphene nanosheets (NGNs) using atomic layer deposition (ALD). The size and density of the Pt catalysts on the NGNs are precisely controlled by simply adjusting the number of ALD cycles. The researchers also prepared single Pt atoms on graphene to compare with the samples on N-doped graphene. The researchers found that the stability of the single Pt atoms on pure graphene was low, resulting in the loss of 24% of the initial HER activity after stability tests. On the other hand, the single Pt atoms on the N-doped graphene resulted in a decreased activity of only 4%. First-principles calculations showed that the interaction energy between the single Pt atoms and N-dopants is about 5.3 eV, which is approximately 3.4 eV larger than the bond strength between the Pt atoms on the graphene substrate, suggesting that the Pt prefers to bind to the N-sites. The researchers also studied the mechanisms of the single-atom catalysis. X-ray absorption fine structure (XAFS) and density functional theory (DFT) analyses indicated that the partially unoccupied density of states of the Pt atoms’ 5d orbitals on the N-doped graphene are responsible for the excellent performance.


The International Nurses Association is pleased to welcome Wanda J. Hall, RN, to their prestigious organization with her upcoming publication in the Worldwide Leaders In Healthcare. Wanda J. Hall is a Registered Nurse working for Alberta Health Services at South Health Campus in Calgary, Alberta, Canada. With over 33 years of experience in nursing, she is a nurse clinician working on the surgical unit.  She is presently working on a Diploma of Addiction Counselling from the McMaster University in Hamilton, Ontario. Wanda J. Hall received her Nursing Diploma in 1983 from the Saskatchewan Institute of Applied Arts and Sciences in Regina, Saskatchewan, Canada. She has had experience in out-post, emergency, postpartum, medical and surgical nursing. Wanda has 22 years of acute surgical nursing within the Recovery Room and is now a nurse clinician in surgical short stay nursing, and is also a nurse teacher. She maintains a professional membership with the College and Association of Registered Nurses of Alberta, and has been honored by both the Alberta Medical Association and the Saskatchewan Emergency Medical Services Association. She attributes her success to her passion for helping her diverse range of patients with their diverse problems, and when she is not working, Wanda enjoys reading, gardening, hiking, and spending time with her family and friends. Learn more about Wanda J. Hall here: http://inanurse.org/network/index.php?do=/4133705/info/ and read her upcoming publication in Worldwide Leaders In Healthcare.


News Article | January 18, 2016
Site: phys.org

The findings address the longstanding debate among scientists about whether or not the bacterium Yersinia pestis –responsible for the Black Death—remained within Europe for hundreds of years and was the principal cause of some of the worst re-emergences and subsequent plague epidemics in human history. Until now, some researchers believed repeated outbreaks were the result of the bacterium being re-introduced through major trade with China, a widely-known reservoir of the plague. Instead, it turns out the plague may never have left. "The more plague genomes we have from these disparate time periods, the better we are able to reconstruct the evolutionary history of this pathogen" says evolutionary geneticist Hendrik Poinar, director of McMaster University's Ancient DNA Centre and a principal investigator at the Michael G. DeGroote Institute for Infectious Disease Research. Poinar collaborated with Edward Holmes at the University of Sydney, Olivier Dutour of the École Pratique des Hautes Études in France, and Kirsti Bos and Johannes Krause at the University of Tubingen, and others, to map the complete genomes of Y.pestis which was harvested from five adult male victims of the 1722 Plague of Provence. To do so, they analyzed the dental pulp taken from the five bodies, originally buried in Marseille, France. Researchers were able to extract, purify and enrich specifically for the pathogen's DNA, and then compare the samples with over 150 plague genomes representing a world wide distribution as well as from other points in time, both modern and ancient. By comparing and contrasting the samples, researchers determined the Marseille strain is a direct descendant of the Black Death that devastated Europe nearly 400 years earlier and not a divergent strain that came, like the previous pandemic strains Justinian and Black Death, from separate emergences originating in Asia. More extensive sampling of modern rodent populations, in addition to ancient human and rodent remains from various regions in Asia, the Caucasus and Europe, may yield additional clues about past ecological niches for plague. "There are many unresolved questions that need to be answered: why did the plague erupt in these devastating waves and then lay dormant? Did it linger in the soil or did it re-emerge in rats? And ultimately why did it suddenly disappear and never come back? Sadly, we don't have the answer to this yet," says Poinar. "Understanding the evolution of the plague will be critically important as antibiotic resistance becomes a greater threat, particularly since we treat modern-day plague with standard antibiotics. Without methods of treatment, easily treatable infections can become devastating again," he says. The research was published online today in the bioarchive bioRXIV, and is under review at the journal eLife. Explore further: Researchers reconstruct genome of the Black Death


News Article | January 12, 2016
Site: www.sciencenews.org

When Elinor Sullivan was a postdoctoral fellow at Oregon Health & Science University in Portland, she set out to explore the influence of food and exercise habits on obesity. In one experiment, she and her colleagues fed a troop of macaque monkeys regular chow. Other macaques dined American-style, with a hefty 32 percent of calories from fat and ready access to peanut butter treats. Over time, the second group of monkeys grew noticeably fatter. Then they all had babies. Sullivan, now at the University of Portland, noticed odd behavior in the plump moms’ offspring. At playtime, they often slinked off by themselves. When handled by keepers, the infants tended to vocalize anxiously, and the males became aggressive. They were prone to repetitive habits, like pacing. In their carefully controlled world, the only difference between those monkeys and others at the facility was their mothers’ extra pounds and indulgent diet. The behavior was so striking that Sullivan changed the course of her research. “It made me start thinking about human children,” she says, and the twin epidemics of obesity and behavioral problems such as attention-deficit/hyperactivity disorder. Her research, published in 2010 in the Journal of Neuroscience, was one of the first studies to note that the progeny of female monkeys eating a high-fat diet were more likely to experience altered brain development and suffer anxiety. Not long after, researchers worldwide began compiling evidence linking the heaviness of human mothers to mental health in their children. One headline-grabbing study of more than 1,000 births, reported in 2012, found that autism spectrum disorders showed up more often in children of obese mothers than in normal-weight women (SN: 5/19/12, p. 16). Over the course of a generation, obesity rates among U.S. women have soared. Today, 38 percent of females in the population are obese (defined as a body mass index of 30 or higher). Among women of childbearing age, well over half are overweight or obese, with almost 8 percent considered extremely obese (a BMI of 40 or greater). Lucilla Poston, who is head of the division of women’s health at King’s College London, calls too much weight during pregnancy “the biggest problem in obstetrics at the moment.” of U.S. women are obese Within the body, obesity is not a passive state. Excess weight can inflame the immune system, upset the balance of hormones and even alter the microbial flora tucked inside the intestine. If shared by the fetus, any or all of these changes can affect the baby’s development in subtle but important ways. Further complicating matters, the fetus is probably being exposed to the effects of fattening, and perhaps inflammatory, foods. Only recently have researchers begun to understand what this physiological storm might mean for children. In part, obesity during pregnancy raises the odds that a baby will be born overly large, setting the stage for future health problems (SN: 5/31/14, p. 22). But when a mother is excessively overweight, risks persist even for newborns of normal size. One study published in 2013 in the journal BMJ analyzed medical records of more than 37,000 people born in Scotland between 1950 and 1976. After accounting for socioeconomic status, gender, weight at birth and many other variables, the researchers found that children born to obese mothers had a 35 percent higher mortality rate from birth to 2012. “Independent of birth weight, a child can grow up with increased blood pressure, obesity and risk of diabetes,” Poston says. The list doesn’t stop there. Perhaps most surprisingly, a mom’s metabolic state might compromise her child’s mental health—the very observation that changed Elinor Sullivan’s career. One study published in 2015 even raises the possibility that a child’s normal cognitive development might be slightly impaired by mom's high BMI. If there is a bright spot, it’s that unlike many threats during development, this one is preventable. As the risks of obesity during pregnancy emerge, researchers hope more young women on the verge of starting families see the importance of maintaining a healthy life—and that the culture around them will support efforts to do so. “Pregnancy is a good time to talk to people about lifestyle,” Poston says, “because they do care deeply about their babies.” Few research questions are easy, but epidemiologists studying maternal obesity face a particularly daunting challenge. They have to separate the effects of a mother’s weight from a multitude of other influences on children’s health. In the United States, obesity disproportionately affects low income and minority women. Children born in less affluent neighborhoods face obstacles to their well-being: more stress, heightened exposure to pollutants and less access to wholesome foods. Plus, the same food choices and lack of activity that drive a woman’s weight gain may also become the lifestyle adopted by her children. The data become even more difficult to tease apart when examining effects on the mind. Given the correlation of obesity with poverty, children of obese parents also might have educational disadvantages. Case in point: Studies have found that young children in poverty score lower on measures of school readiness, including motor-skill development, emotional health and social knowledge. That said, the latest studies—many published in recent months—attempt to overcome those biases. And they still find reason for concern. Lisa Bodnar, a nutritional epidemiologist at the University of Pittsburgh, describes a “small but growing literature” suggesting that obesity in a mother is associated with lower cognition and other mental health challenges in children. In 2015 in the Journal of Nutrition, Bodnar and her colleagues published a study of women on similar economic footing who were patients at Pittsburgh's Magee Women’s Hospital. The majority were unemployed, single mothers. The researchers nonetheless found that children of women who were obese at conception or gained excess weight during pregnancy scored slightly lower on tests of intelligence and executive function, a measure of the ability to plan, organize and adjust to new situations. Elinor Sullivan saw behavior differences between macaque infants born to mothers eating a high-fat diet versus those on normal chow. The stark distinctions made her shift her research focus and begin to look at diet and human development. Probably the most compelling data link maternal obesity with ADHD, says Sullivan, who continues her primate studies. Whether maternal obesity (or a fattening diet) can actually cause hyperactivity is unclear, but one study of rodents published in Molecular Psychiatry in 2012 described results that “point to a direct biological link between in utero exposure to maternal obesity and hyperactivity in the adult offspring.” Researchers from England and Sweden fed one group of female mice a high-fat diet that started six months before pregnancy and lasted until weaning, while another group ate regularly. The offspring of the obese mothers scored significantly higher on tests of hyperactivity. Another animal study, published in 2014 in the Journal of Neuroinflammation, found that female offspring of mice fed a high-fat diet had increased anxiety while the males were prone to hyperactivity. The study, from the Mayo Clinic in Rochester, Minn., and Oregon Health & Science University, also opened the door to prevention. When mother rats were given a healthier, less inflammatory diet while nursing, the mental health of the female pups improved, though the males still had issues. In November 2015, Sullivan and colleagues reviewed the evidence in Hormones and Behavior, making the grim prediction that, given persistent rates of obesity and pervasiveness of high-calorie foods, “the prevalence of neurodevelopmental and mental health disorders will continue to rise in future generations.” In December, researchers from George Washington University and Mathematica Policy Research announced that 12 percent of U.S. children and adolescents have been diagnosed with ADHD, a 43 percent increase since 2003. The field is still too new to explain biologically how obesity would impair fetal brain development, but Sullivan points to theoretical consequences of high glucose or the hormone leptin. Leptin inhibits appetite, but is often elevated in obese individuals and may affect brain development. Most commonly, however, researchers circle back to the effects of an agitated immune system on the brain. “We think of obesity as the state of chronic inflammation,” Sullivan says. “Many of the neurotransmitters in the brain are very sensitive [to inflammation] in early development.” The immune system isn’t the only part of body mechanics co-opted by obesity and diet. A compelling line of inquiry has linked the microbiome—specifically the microorganisms inside the digestive system— to body weight. For example, the microbiome of an obese person differs from the microbiome of someone of normal weight. In experiments involving lean mice with no intestinal microbes, transferring the microbiome of an obese person to a thin mouse is enough by itself to make the lean mouse pack on weight. Since a newborn gets its microbiome from mom, a baby could inherit microbes that want to hoard calories. In both human and animal studies, the microbiomes of offspring born to obese moms are different than in children born to lean moms, says Deborah Sloboda, a fetal physiologist at McMaster University in Hamilton, Ontario. “What we don’t know is whether it comes from transfer during pregnancy, transfer during birth or poor developmental environment altering how the gut forms.” The intestine is normally a fortress that does not like micro­organisms to escape. Several studies, however, have suggested that when under siege from a fast-food Western diet, the gut lining can become porous (SN: 5/30/15, p. 18). Perhaps bacteria slipping into the bloodstream during pregnancy could affect proper formation of the intestine. Other scenarios are also possible: The microbiome transferred during birth could, as it has in animal experiments, predispose a child to a microbiome that extracts more calories from a given amount of food. In Pediatric Research in 2015, Sloboda and colleagues reviewed research on obesity and the maternal microbiome. One theory holds, they noted,that the microbiomes of lean women remain stable during pregnancy; the microbiomes of obese women appear more volatile, experiencing a greater bloom of species associated with obesity. These women’s children may then start life with a microbiome inclined toward weight gain. Lean women generally carry a stable population of microbes in their intestines. In obese mothers, the microbes are out of balance, heavier on Firmicutes, bacteria linked to harvesting more energy from the diet. These changes can affect fetal gut development and future disease risk. Like researchers who study the brain, Sloboda and others suspect that inflammation—which also appears to be a consequence of the microbiome coping with junk food—lies at the heart of many risks conveyed to a developing fetus. “When you consider the spectrum of conditions that have been linked to maternal obesity,” says immunologist Ilhem Messaoudi of the University of California, Riverside, “one of the things that links all these diseases is inflammation.” In addition to the irritation that might come from the high-fat, high-sodium, high-calorie fare at the drive-through, adipose tissue itself provokes a mother’s immune system. In this state of overactivation, the normal cues for her baby’s immune formation might then become lost. “If you have to develop an immune system in the presence of inflammation, the programming of the immune system is going to change,” Messaoudi says. In an experiment published in 2015 in Pediatric Allergy and Immunology, she and her colleagues studied 39 pregnant women who were designated as lean, overweight or obese, based on their preconception body mass index, a measurement of body fat. The researchers extracted blood samples from the umbilical cords of the women’s newborns, and tested the reaction to antigens, molecules that are supposed to trigger an immune reaction. “The cord blood cells of babies born to obese moms did not respond to bacterial antigens,” she says. It was as if the immune system, put to its first real test, was stumped. “If your immune cells don’t know how to react, you’re going to be sick more often. You may not respond to vaccinations in the way your immune system is supposed to respond.” Although the research is still preliminary, studies are suggesting that a high-fat diet and obesity at conception and during a woman’s pregnancy could have lasting influences on her child’s mental health. Those findings may partially explain studies finding that children of obese mothers are more likely to develop disorders that arise from off-kilter immunity. In 2014, researchers who reviewed a dozen studies concluded in the journal Pediatrics that babies born to mothers with a high body mass index had a 20 to 30 percent greater risk of asthma and wheezing, though they noted that mechanisms remain unknown. Of all the possible consequences of maternal obesity, the data are most compelling in suggesting that overweight mothers tend to raise children who grow up to be overweight themselves. “It’s a very strong effect, and consistent, across all populations,” says Bodnar, from Pittsburgh. Chinese researchers writing in 2013 in PLOS ONE pooled the analysis of 45 studies examining whether children faced greater odds of being heavy based on mom’s size. Although studies have varied and genetics obviously play some role, the scientists concluded that having an obese mother roughly tripled the risk of obesity. In addition to a woman’s weight when she becomes pregnant, excessive weight gain during pregnancy, especially in the first months, is also linked to her child’s obesity risk. In one 2012 study comparing more than 6,600 Finnish mothers, those who put on more pounds during the first 20 weeks of gestation (compared with those who gained the least) had children who were 46 percent more likely to be overweight at age 16. Theories to explain the association are examining how increased glucose and hormonal balance affect fetal development, particularly in the brain. Leptin resistance, which leads to higher secretion of the hormone, can be a consequence of obesity. In the journal Acta Physiologica in 2014, Poston and her colleagues from King’s College pointed out that many studies have found that the presence of too much leptin can cause collateral damage to the developing hypothalamus, a key interface between the brain and the hormone-producing endocrine system. Animal studies suggest an altered hypothalamus could mean a child is born with difficulty regulating blood pressure and controlling appetite. “That particular part of the brain may become rewired, and a child may grow up eating more,” Poston says. With little sign that the obesity epidemic is abating, that theory and others are likely to take on increasing importance in medical research. This generation’s greatest health threat could leave an unexpected legacy. Scientists working in this field often worry that their research will be seen as solely finding fault with mothers. “I think it’s unfair to blame this on women,” Bodnar says. Obesity is a global problem. One starting point, she says, is for more doctors to speak with their patients about the importance of weight. Since half of all pregnancies are unplanned, those conversations should happen before a woman gets pregnant. Yet in a U.S. study published in 2014, overweight women of child-bearing age received diet and exercise advice during preventive medicine exams only 36 percent of the time. The number was even lower among pregnant women who were overweight. At the same time, Bodnar says, this is not going to be fixed in doctors’ offices. Women every day are offered cheap, calorie-dense food, pushed by companies with fat marketing budgets (McDonald’s alone spends about $900 million a year on advertising). “It’s not easy, in this environment, to lose weight,” Bodnar says. “We have to agree as a society that this matters.” Let’s not forget the father, whose size can alter sperm, perhaps in ways that affect a child’s risk of obesity, according to recent studies. In a study published online in December in Cell Metabolism, researchers compared sperm samples from 13 lean and 10 obese Danish men. Scientists from the University of Copenhagen looked for epigenetic differences — the chemical attachment of methyl groups to DNA that affects which genes are turned off or on. The researchers found significant differences depending on the men’s size. The obese men had more methylation in genes involved in metabolism and appetite control. Six of the obese men then underwent gastric bypass surgery and lost weight. A year later, their sperm had lost many of the epigenetic changes linked to obesity and appetite. The researchers caution, however, that the extent to which epigenetic changes affect a child’s appetite isn’t known. Other studies also suggest that overweight dads can harm a baby’s development. In September, a team of Australian researchers reported on a mouse experiment that found the offspring of two obese parents fared worse than if either parent alone was obese. The scientists found lower weights in the placenta and fetus, as well as cellular differences (such as impaired mitochondrial function) in the offspring of two obese mice. That study appeared in the American Journal of Physiology — Endocrinology and Metabolism. — Laura Beil This article appears in the January 23, 2016, issue of Science News under the headline, "Maternal Input: A mother's weight during pregnancy can shape her child's mental and physical health."


News Article | January 12, 2016
Site: www.sciencenews.org

When Elinor Sullivan was a postdoctoral fellow at Oregon Health & Science University in Portland, she set out to explore the influence of food and exercise habits on obesity. In one experiment, she and her colleagues fed a troop of macaque monkeys regular chow. Other macaques dined American-style, with a hefty 32 percent of calories from fat and ready access to peanut butter treats. Over time, the second group of monkeys grew noticeably fatter. Then they all had babies. Sullivan, now at the University of Portland, noticed odd behavior in the plump moms’ offspring. At playtime, they often slinked off by themselves. When handled by keepers, the infants tended to vocalize anxiously, and the males became aggressive. They were prone to repetitive habits, like pacing. In their carefully controlled world, the only difference between those monkeys and others at the facility was their mothers’ extra pounds and indulgent diet. The behavior was so striking that Sullivan changed the course of her research. “It made me start thinking about human children,” she says, and the twin epidemics of obesity and behavioral problems such as attention-deficit/hyperactivity disorder. Her research, published in 2010 in the Journal of Neuroscience, was one of the first studies to note that the progeny of female monkeys eating a high-fat diet were more likely to experience altered brain development and suffer anxiety. Not long after, researchers worldwide began compiling evidence linking the heaviness of human mothers to mental health in their children. One headline-grabbing study of more than 1,000 births, reported in 2012, found that autism spectrum disorders showed up more often in children of obese mothers than in normal-weight women (SN: 5/19/12, p. 16). Over the course of a generation, obesity rates among U.S. women have soared. Today, 38 percent of females in the population are obese (defined as a body mass index of 30 or higher). Among women of childbearing age, well over half are overweight or obese, with almost 8 percent considered extremely obese (a BMI of 40 or greater). Lucilla Poston, who is head of the division of women’s health at King’s College London, calls too much weight during pregnancy “the biggest problem in obstetrics at the moment.” of U.S. women are obese Within the body, obesity is not a passive state. Excess weight can inflame the immune system, upset the balance of hormones and even alter the microbial flora tucked inside the intestine. If shared by the fetus, any or all of these changes can affect the baby’s development in subtle but important ways. Further complicating matters, the fetus is probably being exposed to the effects of fattening, and perhaps inflammatory, foods. Only recently have researchers begun to understand what this physiological storm might mean for children. In part, obesity during pregnancy raises the odds that a baby will be born overly large, setting the stage for future health problems (SN: 5/31/14, p. 22). But when a mother is excessively overweight, risks persist even for newborns of normal size. One study published in 2013 in the journal BMJ analyzed medical records of more than 37,000 people born in Scotland between 1950 and 1976. After accounting for socioeconomic status, gender, weight at birth and many other variables, the researchers found that children born to obese mothers had a 35 percent higher mortality rate from birth to 2012. “Independent of birth weight, a child can grow up with increased blood pressure, obesity and risk of diabetes,” Poston says. The list doesn’t stop there. Perhaps most surprisingly, a mom’s metabolic state might compromise her child’s mental health—the very observation that changed Elinor Sullivan’s career. One study published in 2015 even raises the possibility that a child’s normal cognitive development might be slightly impaired by mom's high BMI. If there is a bright spot, it’s that unlike many threats during development, this one is preventable. As the risks of obesity during pregnancy emerge, researchers hope more young women on the verge of starting families see the importance of maintaining a healthy life—and that the culture around them will support efforts to do so. “Pregnancy is a good time to talk to people about lifestyle,” Poston says, “because they do care deeply about their babies.” Few research questions are easy, but epidemiologists studying maternal obesity face a particularly daunting challenge. They have to separate the effects of a mother’s weight from a multitude of other influences on children’s health. In the United States, obesity disproportionately affects low income and minority women. Children born in less affluent neighborhoods face obstacles to their well-being: more stress, heightened exposure to pollutants and less access to wholesome foods. Plus, the same food choices and lack of activity that drive a woman’s weight gain may also become the lifestyle adopted by her children. The data become even more difficult to tease apart when examining effects on the mind. Given the correlation of obesity with poverty, children of obese parents also might have educational disadvantages. Case in point: Studies have found that young children in poverty score lower on measures of school readiness, including motor-skill development, emotional health and social knowledge. That said, the latest studies—many published in recent months—attempt to overcome those biases. And they still find reason for concern. Lisa Bodnar, a nutritional epidemiologist at the University of Pittsburgh, describes a “small but growing literature” suggesting that obesity in a mother is associated with lower cognition and other mental health challenges in children. In 2015 in the Journal of Nutrition, Bodnar and her colleagues published a study of women on similar economic footing who were patients at Pittsburgh's Magee Women’s Hospital. The majority were unemployed, single mothers. The researchers nonetheless found that children of women who were obese at conception or gained excess weight during pregnancy scored slightly lower on tests of intelligence and executive function, a measure of the ability to plan, organize and adjust to new situations. Elinor Sullivan saw behavior differences between macaque infants born to mothers eating a high-fat diet versus those on normal chow. The stark distinctions made her shift her research focus and begin to look at diet and human development. Probably the most compelling data link maternal obesity with ADHD, says Sullivan, who continues her primate studies. Whether maternal obesity (or a fattening diet) can actually cause hyperactivity is unclear, but one study of rodents published in Molecular Psychiatry in 2012 described results that “point to a direct biological link between in utero exposure to maternal obesity and hyperactivity in the adult offspring.” Researchers from England and Sweden fed one group of female mice a high-fat diet that started six months before pregnancy and lasted until weaning, while another group ate regularly. The offspring of the obese mothers scored significantly higher on tests of hyperactivity. Another animal study, published in 2014 in the Journal of Neuroinflammation, found that female offspring of mice fed a high-fat diet had increased anxiety while the males were prone to hyperactivity. The study, from the Mayo Clinic in Rochester, Minn., and Oregon Health & Science University, also opened the door to prevention. When mother rats were given a healthier, less inflammatory diet while nursing, the mental health of the female pups improved, though the males still had issues. In November 2015, Sullivan and colleagues reviewed the evidence in Hormones and Behavior, making the grim prediction that, given persistent rates of obesity and pervasiveness of high-calorie foods, “the prevalence of neurodevelopmental and mental health disorders will continue to rise in future generations.” In December, researchers from George Washington University and Mathematica Policy Research announced that 12 percent of U.S. children and adolescents have been diagnosed with ADHD, a 43 percent increase since 2003. The field is still too new to explain biologically how obesity would impair fetal brain development, but Sullivan points to theoretical consequences of high glucose or the hormone leptin. Leptin inhibits appetite, but is often elevated in obese individuals and may affect brain development. Most commonly, however, researchers circle back to the effects of an agitated immune system on the brain. “We think of obesity as the state of chronic inflammation,” Sullivan says. “Many of the neurotransmitters in the brain are very sensitive [to inflammation] in early development.” The immune system isn’t the only part of body mechanics co-opted by obesity and diet. A compelling line of inquiry has linked the microbiome—specifically the microorganisms inside the digestive system— to body weight. For example, the microbiome of an obese person differs from the microbiome of someone of normal weight. In experiments involving lean mice with no intestinal microbes, transferring the microbiome of an obese person to a thin mouse is enough by itself to make the lean mouse pack on weight. Since a newborn gets its microbiome from mom, a baby could inherit microbes that want to hoard calories. In both human and animal studies, the microbiomes of offspring born to obese moms are different than in children born to lean moms, says Deborah Sloboda, a fetal physiologist at McMaster University in Hamilton, Ontario. “What we don’t know is whether it comes from transfer during pregnancy, transfer during birth or poor developmental environment altering how the gut forms.” The intestine is normally a fortress that does not like micro­organisms to escape. Several studies, however, have suggested that when under siege from a fast-food Western diet, the gut lining can become porous (SN: 5/30/15, p. 18). Perhaps bacteria slipping into the bloodstream during pregnancy could affect proper formation of the intestine. Other scenarios are also possible: The microbiome transferred during birth could, as it has in animal experiments, predispose a child to a microbiome that extracts more calories from a given amount of food. In Pediatric Research in 2015, Sloboda and colleagues reviewed research on obesity and the maternal microbiome. One theory holds, they noted,that the microbiomes of lean women remain stable during pregnancy; the microbiomes of obese women appear more volatile, experiencing a greater bloom of species associated with obesity. These women’s children may then start life with a microbiome inclined toward weight gain. Lean women generally carry a stable population of microbes in their intestines. In obese mothers, the microbes are out of balance, heavier on Firmicutes, bacteria linked to harvesting more energy from the diet. These changes can affect fetal gut development and future disease risk. Like researchers who study the brain, Sloboda and others suspect that inflammation—which also appears to be a consequence of the microbiome coping with junk food—lies at the heart of many risks conveyed to a developing fetus. “When you consider the spectrum of conditions that have been linked to maternal obesity,” says immunologist Ilhem Messaoudi of the University of California, Riverside, “one of the things that links all these diseases is inflammation.” In addition to the irritation that might come from the high-fat, high-sodium, high-calorie fare at the drive-through, adipose tissue itself provokes a mother’s immune system. In this state of overactivation, the normal cues for her baby’s immune formation might then become lost. “If you have to develop an immune system in the presence of inflammation, the programming of the immune system is going to change,” Messaoudi says. In an experiment published in 2015 in Pediatric Allergy and Immunology, she and her colleagues studied 39 pregnant women who were designated as lean, overweight or obese, based on their preconception body mass index, a measurement of body fat. The researchers extracted blood samples from the umbilical cords of the women’s newborns, and tested the reaction to antigens, molecules that are supposed to trigger an immune reaction. “The cord blood cells of babies born to obese moms did not respond to bacterial antigens,” she says. It was as if the immune system, put to its first real test, was stumped. “If your immune cells don’t know how to react, you’re going to be sick more often. You may not respond to vaccinations in the way your immune system is supposed to respond.” Although the research is still preliminary, studies are suggesting that a high-fat diet and obesity at conception and during a woman’s pregnancy could have lasting influences on her child’s mental health. Those findings may partially explain studies finding that children of obese mothers are more likely to develop disorders that arise from off-kilter immunity. In 2014, researchers who reviewed a dozen studies concluded in the journal Pediatrics that babies born to mothers with a high body mass index had a 20 to 30 percent greater risk of asthma and wheezing, though they noted that mechanisms remain unknown. Of all the possible consequences of maternal obesity, the data are most compelling in suggesting that overweight mothers tend to raise children who grow up to be overweight themselves. “It’s a very strong effect, and consistent, across all populations,” says Bodnar, from Pittsburgh. Chinese researchers writing in 2013 in PLOS ONE pooled the analysis of 45 studies examining whether children faced greater odds of being heavy based on mom’s size. Although studies have varied and genetics obviously play some role, the scientists concluded that having an obese mother roughly tripled the risk of obesity. In addition to a woman’s weight when she becomes pregnant, excessive weight gain during pregnancy, especially in the first months, is also linked to her child’s obesity risk. In one 2012 study comparing more than 6,600 Finnish mothers, those who put on more pounds during the first 20 weeks of gestation (compared with those who gained the least) had children who were 46 percent more likely to be overweight at age 16. Theories to explain the association are examining how increased glucose and hormonal balance affect fetal development, particularly in the brain. Leptin resistance, which leads to higher secretion of the hormone, can be a consequence of obesity. In the journal Acta Physiologica in 2014, Poston and her colleagues from King’s College pointed out that many studies have found that the presence of too much leptin can cause collateral damage to the developing hypothalamus, a key interface between the brain and the hormone-producing endocrine system. Animal studies suggest an altered hypothalamus could mean a child is born with difficulty regulating blood pressure and controlling appetite. “That particular part of the brain may become rewired, and a child may grow up eating more,” Poston says. With little sign that the obesity epidemic is abating, that theory and others are likely to take on increasing importance in medical research. This generation’s greatest health threat could leave an unexpected legacy. Scientists working in this field often worry that their research will be seen as solely finding fault with mothers. “I think it’s unfair to blame this on women,” Bodnar says. Obesity is a global problem. One starting point, she says, is for more doctors to speak with their patients about the importance of weight. Since half of all pregnancies are unplanned, those conversations should happen before a woman gets pregnant. Yet in a U.S. study published in 2014, overweight women of child-bearing age received diet and exercise advice during preventive medicine exams only 36 percent of the time. The number was even lower among pregnant women who were overweight. At the same time, Bodnar says, this is not going to be fixed in doctors’ offices. Women every day are offered cheap, calorie-dense food, pushed by companies with fat marketing budgets (McDonald’s alone spends about $900 million a year on advertising). “It’s not easy, in this environment, to lose weight,” Bodnar says. “We have to agree as a society that this matters.” Let’s not forget the father, whose size can alter sperm, perhaps in ways that affect a child’s risk of obesity, according to recent studies. In a study published online in December in Cell Metabolism, researchers compared sperm samples from 13 lean and 10 obese Danish men. Scientists from the University of Copenhagen looked for epigenetic differences — the chemical attachment of methyl groups to DNA that affects which genes are turned off or on. The researchers found significant differences depending on the men’s size. The obese men had more methylation in genes involved in metabolism and appetite control. Six of the obese men then underwent gastric bypass surgery and lost weight. A year later, their sperm had lost many of the epigenetic changes linked to obesity and appetite. The researchers caution, however, that the extent to which epigenetic changes affect a child’s appetite isn’t known. Other studies also suggest that overweight dads can harm a baby’s development. In September, a team of Australian researchers reported on a mouse experiment that found the offspring of two obese parents fared worse than if either parent alone was obese. The scientists found lower weights in the placenta and fetus, as well as cellular differences (such as impaired mitochondrial function) in the offspring of two obese mice. That study appeared in the American Journal of Physiology — Endocrinology and Metabolism. — Laura Beil This article appears in the January 23, 2016, issue of Science News under the headline, "Maternal Input: A mother's weight during pregnancy can shape her child's mental and physical health."


Leontiadis G.I.,McMaster University | Molloy-Bland M.,McMaster University | Moayyedi P.,Oxford Research Evaluation Unit | Howden C.W.,Northwestern University
American Journal of Gastroenterology | Year: 2013

OBJECTIVES:By systematic review and meta-analysis, we sought to assess the impact of comorbidity on short-term mortality in patients with peptic ulcer bleeding (PUB).METHODS:We conducted systematic searches in PubMed and Embase (January 1989-January 2010). Relative risks (RRs) were pooled across selected studies and an analysis of diagnostic test accuracy was performed to validate the results further.RESULTS:Of 1,572 identified studies, 16 were eligible for inclusion. Only three had a low risk of bias and the overall quality of evidence was low. The risk of death (30-day or in-hospital mortality) was significantly greater in PUB patients with comorbidity than in those without (RR: 4.44; 95% confidence interval (CI): 2.45-8.04). The pooled sensitivity for comorbidity predicting death in patients with PUB was 0.86 (95% CI: 0.66-0.95) and the pooled specificity was 0.53 (95% CI: 0.40-0.65). PUB patients with three or more comorbidities had a greater risk of dying than those with one or two (RR: 3.46; 95% CI: 1.34-8.89). All individual comorbidities that we assessed significantly increased the risk of death associated with PUB. However, RRs were higher for hepatic, renal, and malignant disease (range: 4.04-6.33; no significant heterogeneity) than for cardiovascular and respiratory disease and diabetes (2.39, 2.45, and 1.63, respectively; no significant heterogeneity).CONCLUSIONS: Underlying comorbidity is consistently associated with increased mortality in patients with PUB. The number and type of comorbidities in patients with PUB should be carefully evaluated and factored into initial management strategies.


Kirpalani H.,Children's Hospital of Philadelphia | Kirpalani H.,McMaster University | Millar D.,Royal Maternity Hospital | Lemyre B.,University of Ottawa | And 3 more authors.
New England Journal of Medicine | Year: 2013

BACKGROUND: To reduce the risk of bronchopulmonary dysplasia in extremely-low-birth-weight infants, clinicians attempt to minimize the use of endotracheal intubation by the early introduction of less invasive forms of positive airway pressure. METHODS: We randomly assigned 1009 infants with a birth weight of less than 1000 g and a gestational age of less than 30 weeks to one of two forms of noninvasive respiratory support - nasal intermittent positive-pressure ventilation (IPPV) or nasal continuous positive airway pressure (CPAP) - at the time of the first use of noninvasive respiratory support during the first 28 days of life. The primary outcome was death before 36 weeks of postmenstrual age or survival with bronchopulmonary dysplasia. RESULTS: Of the 497 infants assigned to nasal IPPV for whom adequate data were available, 191 died or survived with bronchopulmonary dysplasia (38.4%), as compared with 180 of 490 infants assigned to nasal CPAP (36.7%) (adjusted odds ratio, 1.09; 95% confidence interval, 0.83 to 1.43; P = 0.56). The frequencies of air leaks and necrotizing enterocolitis, the duration of respiratory support, and the time to full feedings did not differ significantly between treatment groups. CONCLUSIONS: Among extremely-low-birth-weight infants, the rate of survival to 36 weeks of post-menstrual age without bronchopulmonary dysplasia did not differ significantly after noninvasive respiratory support with nasal IPPV as compared with nasal CPAP. Copyright © 2013 Massachusetts Medical Society.


Kay V.R.,McMaster University | Bloom M.S.,University at Albany | Foster W.G.,McMaster University
Critical Reviews in Toxicology | Year: 2014

Phthalate diesters are a diverse group of chemicals used to make plastics flexible and are found in personal care products, medical equipment, and medication capsules. Ubiquitous in the environment, human exposure to phthalates is unavoidable; however, the clinical relevance of low concentrations in human tissues remains uncertain. The epidemiological literature was inadequate for prior reviews to conclusively evaluate the effects of phthalates on male reproductive tract development and function, but recent studies have expanded the literature. Therefore, we conducted a systematic review of the literature focused on the effects of phthalate exposure on the developing male reproductive tract, puberty, semen quality, fertility, and reproductive hormones. We conclude that although the epidemiological evidence for an association between phthalate exposure and most adverse outcomes in the reproductive system, at concentrations to which general human populations are exposed, is minimal to weak, the evidence for effects on semen quality is moderate. Results of animal studies reveal that, although DEHP was the most potent, different phthalates have similar effects and can adversely affect development of the male reproductive tract with semen quality being the most sensitive outcome. We also note that developmental exposure in humans was within an order of magnitude of the adverse effects documented in several animal studies. While the mechanisms underlying phthalate toxicity remain unclear, the animal literature suggests that mice are less sensitive than rats and potentially more relevant to estimating effects in humans. Potential for chemical interactions and effects across generations highlights the need for continued study. © 2014 Informa Healthcare USA, Inc.


Kuperman V.,McMaster University | Estes Z.,Bocconi University | Brysbaert M.,Ghent University | Warriner A.B.,McMaster University
Journal of Experimental Psychology: General | Year: 2014

Emotion influences most aspects of cognition and behavior, but emotional factors are conspicuously absent from current models of word recognition. The influence of emotion on word recognition has mostly been reported in prior studies on the automatic vigilance for negative stimuli, but the precise nature of this relationship is unclear. Various models of automatic vigilance have claimed that the effect of valence on response times is categorical, an inverted U, or interactive with arousal. In the present study, we used a sample of 12,658 words and included many lexical and semantic control factors to determine the precise nature of the effects of arousal and valence on word recognition. Converging empirical patterns observed in word-level and trial-level data from lexical decision and naming indicate that valence and arousal exert independent monotonic effects: Negative words are recognized more slowly than positive words, and arousing words are recognized more slowly than calming words. Valence explained about 2% of the variance in word recognition latencies, whereas the effect of arousal was smaller. Valence and arousal do not interact, but both interact with word frequency, such that valence and arousal exert larger effects among low-frequency words than among high-frequency words. These results necessitate a new model of affective word processing whereby the degree of negativity monotonically and independently predicts the speed of responding. This research also demonstrates that incorporating emotional factors, especially valence, improves the performance of models of word recognition. © 2013 American Psychological Association.


Warkentin T.E.,McMaster University | Basciano P.A.,Cornell University | Knopman J.,Weill Cornell Medical Center | Bernstein R.A.,Northwestern University
Blood | Year: 2014

The existence of spontaneous heparin-induced thrombocytopenia (HIT) syndrome (or autoimmune HIT), defined as a transient prothrombotic thrombocytopenic disorder without proximate heparin exposure serologically indistinguishable from HIT, is controversial. We describe 2 new cases presenting with thrombotic stroke/thrombocytopenia: one following shoulder hemi-arthroplasty (performed without heparin) and the other presenting to the emergency room without prior hospitalization, heparin exposure, or preceding infection. Both patients tested strongly positive for anti-platelet factor 4 (PF4)/heparin immunoglobulin (Ig)Gin 2 different immunoassays and in the platelet serotonin-release assay.Crucially, both patients' sera also caused strong (>80%) serotonin release in the absence of heparin, a serologic feature characteristic of delayed-onset HIT (ie, where heparin use precedes HIT but is not required for subsequent development or worsening of thrombocytopenia). We propose that a rigorous definition of spontaneous HIT syndrome should include otherwise unexplained thrombocytopenia/thrombosis without proximate heparin exposure and with anti-PF4/heparin IgG antibodies that cause strong in vitro platelet activation even in the absence of heparin. © 2014 by The American Society of Hematology.


Tikhonov D.B.,RAS Sechenov Institute of Evolutionary Physiology and Biochemistry | Zhorov B.S.,McMaster University
Molecular Pharmacology | Year: 2012

The X-ray structure of the bacterial sodium channel NavAb provides a new template for the study of sodium and calcium channels. Unlike potassium channels, NavAb contains P2 helices in the outer-pore region. Because the sequence similarity between eukaryotic and prokaryotic sodium channels in this region is poor, the structural similarity is unclear. We analyzed it by using experimental data on tetrodotoxin block of sodium channels. Key tetrodotoxin-binding residues are outer carboxylates in repeats I, II, and IV, three positions downstream from the selectivity-filter residues. In a NavAb-based model of Nav1 channels derived from the sequence alignment without insertions/deletions, the outer carboxylates did not face the pore and therefore did not interact with tetrodotoxin. The hypothesis that the evolutionary appearance of Nav1 channels involved point deletions in an ancestral channel between the selectivity filter and the outer carboxylates allowed building of a NavAb-based model with tetrodotoxin-channel contacts similar to those proposed previously. This hypothesis also allowed us to reproduce in Nav1 the folding-stabilizing contacts between long-side chain residues in P1 and P2, which are seen in NavAb. The NavAb-based inner-pore model of Nav1 preserved major features of our previous KcsA-based models, including the access pathway for ligands through the repeat III/IV interface and their interactions with specific residues. Thus, structural properties of eukaryotic voltage-gated sodium channels that are suggested by functional data were reproduced in the NavAb-based models built by using the unaltered template structure but with adjusted sequence alignment. Sequences of eukaryotic calcium channels aligned with NavAb without insertions/deletions, which suggests that NavAb is a promising basis for the modeling of calcium channels. Copyright © 2012 The American Society for Pharmacology and Experimental Therapeutics.


Andrews P.W.,McMaster University | Bharwani A.,McMaster University | Lee K.R.,McMaster University | Fox M.,University of California at Irvine | Thomson J.A.,University of Virginia
Neuroscience and Biobehavioral Reviews | Year: 2015

The role of serotonin in depression and antidepressant treatment remains unresolved despite decades of research. In this paper, we make three major claims. First, serotonin transmission is elevated in multiple depressive phenotypes, including melancholia, a subtype associated with sustained cognition. The primary challenge to this first claim is that the direct pharmacological effect of most symptom-reducing medications, such as the selective serotonin reuptake inhibitors (SSRIs), is to increase synaptic serotonin. The second claim, which is crucial to resolving this paradox, is that the serotonergic system evolved to regulate energy. By increasing extracellular serotonin, SSRIs disrupt energy homeostasis and often worsen symptoms during acute treatment. Our third claim is that symptom reduction is not achieved by the direct pharmacological properties of SSRIs, but by the brain's compensatory responses that attempt to restore energy homeostasis. These responses take several weeks to develop, which explains why SSRIs have a therapeutic delay. We demonstrate the utility of our claims by examining what happens in animal models of melancholia and during acute and chronic SSRI treatment. © 2015 Elsevier Ltd.


Goldhaber S.Z.,Harvard University | Leizorovicz A.,University of Lyon | Kakkar A.K.,University College London | Haas S.K.,TU Munich | And 3 more authors.
New England Journal of Medicine | Year: 2011

BACKGROUND: The efficacy and safety of prolonging prophylaxis for venous thromboembolism in medically ill patients beyond hospital discharge remain uncertain. We hypothesized that extended prophylaxis with apixaban would be safe and more effective than short-term prophylaxis with enoxaparin. METHODS: In this double-blind, double-dummy, placebo-controlled trial, we randomly assigned acutely ill patients who had congestive heart failure or respiratory failure or other medical disorders and at least one additional risk factor for venous thromboembolism and who were hospitalized with an expected stay of at least 3 days to receive apixaban, administered orally at a dose of 2.5 mg twice daily for 30 days, or enoxaparin, administered subcutaneously at a dose of 40 mg once daily for 6 to 14 days. The primary efficacy outcome was the 30-day composite of death related to venous thromboembolism, pulmonary embolism, symptomatic deep-vein thrombosis, or asymptomatic proximal-leg deep-vein thrombosis, as detected with the use of systematic bilateral compression ultrasonography on day 30. The primary safety outcome was bleeding. All efficacy and safety outcomes were independently adjudicated. RESULTS: A total of 6528 subjects underwent randomization, 4495 of whom could be evaluated for the primary efficacy outcome - 2211 in the apixaban group and 2284 in the enoxaparin group. Among the patients who could be evaluated, 2.71% in the apixaban group (60 patients) and 3.06% in the enoxaparin group (70 patients) met the criteria for the primary efficacy outcome (relative risk with apixaban, 0.87; 95% confidence interval [CI], 0.62 to 1.23; P = 0.44). By day 30, major bleeding had occurred in 0.47% of the patients in the apixaban group (15 of 3184 patients) and in 0.19% of the patients in the enoxaparin group (6 of 3217 patients) (relative risk, 2.58; 95% CI, 1.02 to 7.24; P = 0.04). CONCLUSIONS: In medically ill patients, an extended course of thromboprophylaxis with apixaban was not superior to a shorter course with enoxaparin. Apixaban was associated with significantly more major bleeding events than was enoxaparin. (Funded by Bristol- Myers Squibb and Pfizer; ClinicalTrials.gov number, NCT00457002.) Copyright © 2011 Massachusetts Medical Society.


Wystrach A.,University of Sussex | Schwarz S.,McMaster University
Current Biology | Year: 2013

Insect navigation is a fruitful system for analysing the ingenious and economical mechanisms that can underlie complex behaviour [1]. Past work has highlighted unsuspected navigational abilities in ants and bees, such as accurate path integration, long distance route following or homing from novel locations [2]. Here we report that ants can deal with one of the greatest challenges for any navigator: uncontrolled passive displacements. Foraging ants were blown by a jet of air over 3 meters into a dark pit. When subsequently released at windless unfamiliar locations, ants headed in the compass direction opposite to the one they had been blown away, thus functionally increasing their chance of returning to familiar areas. Ants do not appear to collect directional information during the actual passive displacement, but beforehand, while clutching the ground to resist the wind. During that time window, ants compute and store the compass direction of the wind. This is achieved by integrating the egocentric perception of the wind direction relative to their current body-axis with celestial compass information from their eyes. © 2013 Elsevier Ltd.


Spyropoulos A.C.,University of Rochester | Douketis J.D.,McMaster University
Blood | Year: 2012

The periprocedural management of patients receiving long-term oral anticoagulant therapy remains a common but difficult clinical problem, with a lack of highquality evidence to inform best practices. It is a patient's thromboembolic risk that drives the need for an aggressive periprocedural strategy, including the use of heparin bridging therapy, to minimize time off anticoagulant therapy, while the procedural bleed risk determines how and when postprocedural anticoagulant therapy should be resumed. Warfarin should be continued in patients undergoing selected minor procedures, whereas in major procedures that necessitate warfarin interruption, heparin bridging therapy should be considered in patients at high thromboembolic risk and in a minority of patients at moderate risk. Periprocedural data with the novel oral anticoagulants, such as dabigatran, rivaroxaban, and apixaban, are emerging, but their relatively short half-life, rapid onset of action, and predictable pharmacokinetics should simplify periprocedural use. This review aims to provide a practical, clinician-focused approach to periprocedural anticoagulant management. © 2012 by The American Society of Hematology.


Qiao H.,McMaster University | Agnew S.R.,University of Virginia | Wu P.D.,McMaster University
International Journal of Plasticity | Year: 2015

A recently developed crystal plasticity model for describing twinning and detwinning behavior is employed to simulate the behavior of extruded Mg alloy, ZK60A. Notably, accounting for the initial texture and calibrating the model using tension and compression along one direction permits prediction of the strength anisotropy, strength asymmetry, and strain hardening behavior along other directions, for cases for which the contribution of twinning is large, small and intermediate. The model discriminates between the stress required to initiate twinning and that required to grow (thicken) previously existing twins. This enables the model to simulate the unusual stress-strain hysteresis behavior during twinning (e.g., sharp yielding behavior) as well as that of detwinning (characterized by quite gradual yielding). The strain hardening plateau which occurs during both twinning and detwinning are captured, as are the rapid hardening induced by the exhaustion of these mechanisms. Finally, the modeling is validated using previously published in-situ neutron diffraction data. The predicted diffracted intensity evolution, which is indicative of the volume fraction of twinning compares well with the experimental data. For the first time, the lattice strain evolutions during cyclic loading (involving twinning and detwinning) of an extruded magnesium alloy are predicted. Most features of the experimentally observed internal strain evolution are well-described. In particular, the inflections which may be associated with the initiation of particular deformation mechanisms: basal and non-basal slips, as well as deformation twinning are predicted. Careful analysis of the lattice strains reveals greater than expected load sharing by the precipitate phase. © 2014 Elsevier Ltd.


Barto L.,McMaster University | Barto L.,Charles University | Kozik M.,Jagiellonian University
Proceedings of the Annual ACM Symposium on Theory of Computing | Year: 2012

An algorithm for a constraint satisfaction problem is called robust if it outputs an assignment satisfying at least (1-g(ε))-fraction of the constraints given a (1-ε)-satisfiable instance, where g(ε) → 0 as ε → 0, g(0)=0. Guruswami and Zhou conjectured a characterization of constraint languages for which the corresponding constraint satisfaction problem admits an efficient robust algorithm. This paper confirms their conjecture. © 2012 ACM.


Sana F.,McMaster University | Weston T.,York University | Cepeda N.J.,York University
Computers and Education | Year: 2013

Laptops are commonplace in university classrooms. In light of cognitive psychology theory on costs associated with multitasking, we examined the effects of in-class laptop use on student learning in a simulated classroom. We found that participants who multitasked on a laptop during a lecture scored lower on a test compared to those who did not multitask, and participants who were in direct view of a multitasking peer scored lower on a test compared to those who were not. The results demonstrate that multitasking on a laptop poses a significant distraction to both users and fellow students and can be detrimental to comprehension of lecture content. © 2012 Elsevier Ltd. All rights reserved.


Siegal D.,McMaster University | Yudin J.,McMaster University | Kaatz S.,Ford Motor Company | Douketis J.D.,McMaster University | And 2 more authors.
Circulation | Year: 2012

Background-: Periprocedural bridging with unfractionated heparin or low-molecular-weight heparin aims to reduce the risk of thromboembolic events in patients receiving long-term vitamin K antagonists. Optimal periprocedural anticoagulation has not been established. Methods and Results-: MEDLINE, EMBASE, and Cochrane databases (2001-2010) were searched for English-language studies including patients receiving heparin bridging during interruption of vitamin K antagonists for elective procedures. Data were independently collected by 2 investigators (κ=0.90). The final review included 34 studies with 1 randomized trial. Thromboembolic events occurred in 73 of 7118 bridged patients (pooled incidence, 0.9%; 95% confidence interval [CI], 0.0.0-3.4) and 32 of 5160 nonbridged patients (pooled incidence, 0.6%; 95% CI, 0.0-1.2). There was no difference in the risk of thromboembolic events in 8 studies comparing bridged and nonbridged groups (odds ratio, 0.80; 95% CI, 0.42-1.54). Bridging was associated with an increased risk of overall bleeding in 13 studies (odds ratio, 5.40; 95% CI, 3.00-9.74) and major bleeding in 5 studies (odds ratio, 3.60; 95% CI, 1.52-8.50) comparing bridged and nonbridged patients. There was no difference in thromboembolic events (odds ratio, 0.30; 95% CI, 0.04-2.09) but an increased risk of overall bleeding (odds ratio, 2.28; 95% CI, 1.27-4.08) with full versus prophylactic/intermediate-dose low-molecular-weight heparin bridging. Low-thromboembolic-risk and/or non-vitamin K antagonist patient groups were used for comparison. Study quality was poor with heterogeneity for some analyses. Conclusions-: Vitamin K antagonist-treated patients receiving periprocedural heparin bridging appear to be at increased risk of overall and major bleeding and at similar risk of thromboembolic events compared to nonbridged patients. Randomized trials are needed to define the role of periprocedural heparin bridging. © 2012 American Heart Association, Inc.


Belyk M.,McMaster University | Kraft S.J.,Wayne State University | Brown S.,McMaster University
European Journal of Neuroscience | Year: 2015

Stuttering is a speech disorder characterised by repetitions, prolongations and blocks that disrupt the forward movement of speech. An earlier meta-analysis of brain imaging studies of stuttering (Brown et al., 2005) revealed a general trend towards rightward lateralization of brain activations and hyperactivity in the larynx motor cortex bilaterally. The present study sought not only to update that meta-analysis with recent work but to introduce an important distinction not present in the first study, namely the difference between 'trait' and 'state' stuttering. The analysis of trait stuttering compares people who stutter (PWS) with people who do not stutter when behaviour is controlled for, i.e., when speech is fluent in both groups. In contrast, the analysis of state stuttering examines PWS during episodes of stuttered speech compared with episodes of fluent speech. Seventeen studies were analysed using activation likelihood estimation. Trait stuttering was characterised by the well-known rightward shift in lateralization for language and speech areas. State stuttering revealed a more diverse pattern. Abnormal activation of larynx and lip motor cortex was common to the two analyses. State stuttering was associated with overactivation in the right hemisphere larynx and lip motor cortex. Trait stuttering was associated with overactivation of lip motor cortex in the right hemisphere but underactivation of larynx motor cortex in the left hemisphere. These results support a large literature highlighting laryngeal and lip involvement in the symptomatology of stuttering, and disambiguate two possible sources of activation in neuroimaging studies of persistent developmental stuttering. © 2014 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-FP | Phase: HEALTH.2011.2.4.2-2;HEALTH.2011.2.4.3-3 | Award Amount: 7.93M | Year: 2011

Physical activity is a powerful lifestyle factor that on average reduces risk for development of diabetes and cardiovascular disease. Nevertheless, we have demonstrated that following supervised endurance exercise training, 20% of subjects show no change in fitness and 30% demonstrate no improvement in insulin sensitivity or worse-still an adverse response. Our concept is that by using molecular profiling of blood/muscle samples we will develop personalised lifestyle intervention tools. Further, revealing the biological basis for a variable metabolic or cardiovascular response to exercise will enable us to propose new targets and biomarkers for drug discovery efforts directly in humans. Using our established OMICS approaches (RNA, DNA and Metabo-) we will generate classifiers that predict the responses to exercise-therapy (fitness and insulin sensitivity). Classifier generation is a statistical strategy for diagnosis or prognosis. Critically, we have a large human tissue biobank, including subjects with insulin-resistance; young to elderly males and females, as well as twins. Our SME partners have significant intellectual property and capacity in the field of bio-prediction, with a proven track-record of collaboration with the team and product development. We will add to the diversity of our biobank by carrying-out an exercise intervention study using a novel time-efficient strategy that we have recently proven to be effective in reducing insulin resistance in sedentary young people and in middle aged obese subjects. A time-efficient protocol is a critical as lack-of-time is a key reason for not maintaining physical activity levels. Finally, we have a novel out-bred rodent model that replicates high and low exercise training responses and we will establish its suitability for future drug screening purposes. Because of these substantial pre-existing resources we believe that our project has a very high probability of delivering on its goals of improving the healthcare of European citizens


News Article | November 2, 2016
Site: marketersmedia.com

KIRKLAND LAKE, ON / ACCESSWIRE / November 2, 2016 / RJK Explorations Ltd. (TSXV: RJX.A) ("RJK" or the "Company") would like to announce that at its Annual and Special Shareholders Meeting, William ("Bill") E. MacRae M.Sc., P.Geo., was elected to the five-member board of the Company. Bill has over 40 years of varied experience in the mining industry, primarily in gold exploration and development, since graduating from McMaster University with a post graduate degree in Geology. Bill has worked for such companies as Noranda, Newmont, Kinross Gold, Placer Dome, the Geological Survey of Canada, the Ontario Geological Survey, along with several publicly-listed junior exploration companies, including acting as VP Exploration for one and a director of another. Bill has also taken executive positions with several volunteer boards (the Porcupine Prospectors and Developers - President, the Ontario Prospectors Association - Vice President, and the Timmins Economic Development Corporation (1991 to 2011). "We believe Bill will be an excellent addition to the Company and has already begun to contribute with his skill set on the corporate, exploration and development sides, particularly with the recent acquisition of the Maude Lake Gold Property," said Glenn Kasner, President of the Company. RJK is a junior exploration company primarily engaged in gold exploration with projects located in BC and Ontario. It's recently acquired 100 percent owned flagship "Maude Lake Gold Property" is an advanced project, located within the prolific Timmins- Matheson gold corridor. The project sits within Patented and Leased Mining Claims, containing a historic (non-compliant 43-101) high-grade gold resource historically delineated from over 49,000 meters of drilling, surface and underground development. This news release includes certain forward-looking statements, which may include, but are not limited to, statements concerning future mineral exploration and property option payments. Any statements contained herein that are not statements of historical facts may be deemed to be forward-looking, including those identified by the expressions "will", "anticipate", "believe", "plan", "estimate", "expect", "intend", "propose" and similar expressions. Forward-looking statements involve known and unknown risks and uncertainties that could cause actual results, performance, or achievements to differ materially from those expressed or implied in this news release. Factors that could cause actual results to differ materially from those anticipated in this news release include, but are not limited to, the financial resources of the Corporation being inadequate to carry out its stated plans. RJK assumes no obligation to update the forward-looking statements or to update the reasons why actual results could differ from those reflected in the forward-looking statements except as required by applicable law. KIRKLAND LAKE, ON / ACCESSWIRE / November 2, 2016 / RJK Explorations Ltd. (TSXV: RJX.A) ("RJK" or the "Company") would like to announce that at its Annual and Special Shareholders Meeting, William ("Bill") E. MacRae M.Sc., P.Geo., was elected to the five-member board of the Company. Bill has over 40 years of varied experience in the mining industry, primarily in gold exploration and development, since graduating from McMaster University with a post graduate degree in Geology. Bill has worked for such companies as Noranda, Newmont, Kinross Gold, Placer Dome, the Geological Survey of Canada, the Ontario Geological Survey, along with several publicly-listed junior exploration companies, including acting as VP Exploration for one and a director of another. Bill has also taken executive positions with several volunteer boards (the Porcupine Prospectors and Developers - President, the Ontario Prospectors Association - Vice President, and the Timmins Economic Development Corporation (1991 to 2011). "We believe Bill will be an excellent addition to the Company and has already begun to contribute with his skill set on the corporate, exploration and development sides, particularly with the recent acquisition of the Maude Lake Gold Property," said Glenn Kasner, President of the Company. RJK is a junior exploration company primarily engaged in gold exploration with projects located in BC and Ontario. It's recently acquired 100 percent owned flagship "Maude Lake Gold Property" is an advanced project, located within the prolific Timmins- Matheson gold corridor. The project sits within Patented and Leased Mining Claims, containing a historic (non-compliant 43-101) high-grade gold resource historically delineated from over 49,000 meters of drilling, surface and underground development. This news release includes certain forward-looking statements, which may include, but are not limited to, statements concerning future mineral exploration and property option payments. Any statements contained herein that are not statements of historical facts may be deemed to be forward-looking, including those identified by the expressions "will", "anticipate", "believe", "plan", "estimate", "expect", "intend", "propose" and similar expressions. Forward-looking statements involve known and unknown risks and uncertainties that could cause actual results, performance, or achievements to differ materially from those expressed or implied in this news release. Factors that could cause actual results to differ materially from those anticipated in this news release include, but are not limited to, the financial resources of the Corporation being inadequate to carry out its stated plans. RJK assumes no obligation to update the forward-looking statements or to update the reasons why actual results could differ from those reflected in the forward-looking statements except as required by applicable law.


News Article | November 10, 2016
Site: www.eurekalert.org

Hamilton, ON (Nov. 9, 2016) -- Middle-age adults living with a combination of arthritis, heart disease or diabetes, and depression are more likely to experience disability and limited involvement in society, new research from McMaster University has found. The study, published in the Journal of Epidemiology and Community Health, found that physical and mental chronic conditions, alone and in combination, were strongly associated with disability and social participation restrictions. However, the impact of these combinations of conditions differed by gender and age. The research was led by Lauren Griffith, an associate professor in the Department of Clinical Epidemiology and Biostatics and the holder of the McLaughlin Foundation Professorship in Population and Public Health. "These findings help us to better understand, at a population level, the biggest drivers of disability for middle-aged and older adults," said Griffith. "What this research shows is that depending on your age and sex, the specific chronic diseases most highly associated with disability in the population differ." To conduct the study, the research team analyzed population-based data from more than 15,000 participants in the Canadian Community Health Survey on Healthy Aging. The survey, which was conducted between 2008 and 2009, gathered information from adults aged 45 to 85 years old who were not institutionalized and living in one of 10 Canadian provinces. While the association between single chronic conditions and disability is well documented, there is little research examining the combination of both physical and mental chronic conditions on disability and social participation. The researchers concluded that knowing which chronic conditions are associated with greater disability and social participation limitations may help clinicians to target treatment strategies for patients. Similarly, for policy-makers, this information may help in the development of preventative health strategies for individual conditions, as well as clusters of diseases. "Oftentimes, when we are looking at disability, especially for chronic conditions, we are looking at the 65 and older age group," Griffith said. "But if we want to be able to develop interventions earlier to help prevent or slow down the progression of disability, we need to start looking at the impact of chronic conditions on younger age groups." A downloadable photo of Lauren Griffith may be found here: http://adobe. McMaster provides a high definition broadcast studio that can connect with any television broadcaster around the world. To book an interview, please contact:


News Article | April 27, 2016
Site: phys.org

Researchers at McMaster University's Stem Cell and Cancer Research Institute have made significant steps forward in understanding the stem cells of the human blood system after discovering how a key protein allows for better control and regeneration of these cells.


News Article | December 1, 2016
Site: www.newscientist.com

What can your face say about you? Face recognition technology can pick up on things like your age, gender and maybe even your mood. Now, two researchers say it could even tell whether you’re a criminal. They are claiming to have developed a system that, when shown a series of faces it has never encountered before, can pick out the ones belonging to convicted criminals. But other researchers have criticised the results, and say the work raises ethical questions over what face recognition technology can and should be used to detect. It’s clearly an “emotionally charged” subject, says Xiaolin Wu at McMaster University in Hamilton, Canada, who co-authored the study. He and his colleague Xi Zhang at Shanghai Jiao Tong University, China, had set out to disprove the idea that there could be a link between someone’s face and criminality – “so we were very surprised by the result”, says Wu. The researchers exploited machine learning, asking face recognition software to guess whether a person in an ID-style picture was a criminal or not, and then feeding it the correct answer. It learned to tell the difference, eventually achieving an accuracy of up to 90 per cent, they say. However, other face recognition experts question their methodology. One issue is that the criminal images came from a Chinese database of ID photos, whereas the non-criminal images were internet profile pictures belonging to Chinese citizens, meaning the system could have picked up on differences between the two sources rather than in people’s faces. Wu and Zhang tried to counteract this by standardising the images, for example making them the same size and turning them greyscale. But Jonathan Frankle from the Massachusetts Institute of Technology says that’s not enough. “The fact that the data comes from two different places is a fundamental flaw. Any differences will be picked up,” he says. It’s not a problem to ask a controversial question, says Francois Chollet, a deep learning researcher at Google, but the science has to be well founded. “It is not ethical to make a bad science argument,” he says. Mike Cook at Falmouth University, UK, says that this kind of research risks turning machine learning into the “phrenology of the 21st century”, like deducing a person’s traits from the bumps on their head. Seemingly impartial computer programs give an air of legitimacy to inaccurate or controversial interpretations. “Suddenly, the conclusions drawn by an algorithm have been cleaned up and made to look scientific,” he says. In fact, these systems are not objective and are often subject to the same biases as humans. “[They] are tools that are forged by being hammered with our own beliefs and observations,” says Cook. That’s not to say computers can’t make accurate observations about a person’s face, sometimes even better than humans. Face recognition software can already easily pick up things like the shape of a person’s nose or whether they are smiling. Researchers at the University of Rochester, New York, even claim to have developed an algorithm that can differentiate between the faces of Chinese, Japanese and Korean people with an accuracy of 75 per cent – significantly better than humans. But even where the science is sound, ethical questions arise over how these algorithms should be applied to real-world situations. Detecting someone’s ethnicity, for example, could be used to better target services, but it could also be used to discriminate. Last year, Microsoft released a web app that used machine learning to gauge someone’s age from their picture. It was intended as a “fun app”, but then some UK newspapers used the system on images of refugees in an attempt to detect adults taking advantage of concessions given to children, forcing Microsoft to respond that it was never meant to offer a definitive assessment of age. And when considering more complex or abstract characteristics than nose shape or age, it’s important to know the limits of what the technology can tell us. Alexander Todorov at Princeton University says you simply can’t glean someone’s general personality or behaviour from a snapshot of their face. It’s “super easy” to tell if a person is sleep-deprived based on paler skin and droopy eyes, he says – and this could even be used to prevent someone engaging in a task that requires alertness, such as operating dangerous machinery. “But if it is used to predict what the person is like in general, this is wrong.” Researchers do not always have control over how their work is used. Making findings public, as Wu and Zhang have done, means that anyone can scrutinise their validity, but it doesn’t have to be that way. “What would scare me more would be if a private company did this and sold it to a police department. There’s nothing to stop that from happening,” says Frankle. Earlier this year, Frankle and his colleagues found that the majority of US police departments using face recognition do little to ensure that the software is accurate. As the technology becomes more widely used, so does the urgency of weighing up the ethics of its use. Computer scientists are gaining increasing power over people’s lives, says Chollet, but they don’t have the ethical education to support that role. “This is something we have to fix.


News Article | November 8, 2016
Site: www.eurekalert.org

Hamilton, ON (Nov. 8, 2016) - Scientists at McMaster University's Stem Cell and Cancer Research Institute in collaboration with Sick Children's Hospital have discovered genetic alterations in the gene DIXDC1 in individuals with autism spectrum disorders (ASD). This gene was found to change the way brain cells grow and communicate. This finding, published today in Cell Reports, provides new insights into ASD that will guide identification of new medications for people with ASD. This is critical because ASD affects one in 68 individuals, and there are no medications that target the core symptoms of this complex disorder. The study was led by Karun Singh, a scientist with the Stem Cell and Cancer Research Institute (SCCRI) and an assistant professor of biochemistry and biomedical sciences at McMaster's Michael G. DeGroote School of Medicine. The researchers discovered an important 'on' button in DIXDC1 protein that instructs brain cells to form mature connections called synapses with other brain cells during development. Working with the leading geneticist Stephen Scherer from The Hospital for Sick Children and the University of Toronto, the team identified genetic changes that keep DIXDC1 turned "off" in a group individuals with autism, predicted to cause brain synapses to stay immature, and reduce brain activity. "Because we pinpointed why DIXDC1 is turned off in some forms of autism, my lab at the SCCRI, which specializes in drug discovery, now has the opportunity to begin the searching for drugs that will turn DIXDC1 back on and correct synaptic connections," said Singh. "This is exciting because such a drug would have the potential to be a new treatment for autism." While this discovery holds promise, mutations in DIXDC1 account for only a small number of individuals with autism and related psychiatric conditions, Singh said. "However, there is strong evidence that many other autism genes disrupt the development of synapses similar to DIXDC1; therefore, the key to a new treatment for autism will be to find safe medications that restores brain cell synapse growth and activity." Mick Bhatia, director of the SCCRI, said the discovery signifies the institute's strategic entry into the area of neural disease and genetic guided personalized drug development. "This is the first step of many ahead as the SCCRI continues to strive for near term impact on human health through stem cell research," he said, adding that the addition of Singh's team was enabled by the support from the David Braley Chair in Neural Stem Cell Research.


News Article | April 26, 2016
Site: www.biosciencetechnology.com

Could bacteria in your gut be used to cure or prevent neurological conditions such as post-traumatic stress disorder (PTSD), anxiety or even depression? Two researchers sponsored by the Office of Naval Research (ONR) think that's a strong possibility. Dr. John Bienenstock and Dr. Paul Forsythe--who work in The Brain-Body Institute at McMaster University in Ontario, Canada--are investigating intestinal bacteria and their effect on the human brain and mood. "This is extremely important work for U.S. warfighters because it suggests that gut microbes play a strong role in the body's response to stressful situations, as well as in who might be susceptible to conditions like PTSD," said Dr. Linda Chrisey, a program officer in ONR's Warfighter Performance Department, which sponsors the research. The trillions of microbes in the intestinal tract, collectively known as the gut microbiome, profoundly impact human biology--digesting food, regulating the immune system and even transmitting signals to the brain that alter mood and behavior. ONR is supporting research that's anticipated to increase warfighters' mental and physical resilience in situations involving dietary changes, sleep loss or disrupted circadian rhythms from shifting time zones or living in submarines. Through research on laboratory mice, Bienenstock and Forsythe have shown that gut bacteria seriously affect mood and demeanor. They also were able to control the moods of anxious mice by feeding them healthy microbes from fecal material collected from calm mice. Bienenstock and Forsythe used a "social defeat" scenario in which smaller mice were exposed to larger, more aggressive ones for a couple of minutes daily for 10 consecutive days. The smaller mice showed signs of heightened anxiety and stress--nervous shaking, diminished appetite and less social interaction with other mice. The researchers then collected fecal samples from the stressed mice and compared them to those from calm mice. "What we found was an imbalance in the gut microbiota of the stressed mice," said Forsythe. "There was less diversity in the types of bacteria present. The gut and bowels are a very complex ecology. The less diversity, the greater disruption to the body." Bienenstock and Forsythe then fed the stressed mice the same probiotics (live bacteria) found in the calm mice and examined the new fecal samples. Through magnetic resonance spectroscopy (MRS), a non-invasive analytical technique using powerful MRI technology, they also studied changes in brain chemistry. "Not only did the behavior of the mice improve dramatically with the probiotic treatment," said Bienenstock, "but it continued to get better for several weeks afterward. Also, the MRS technology enabled us to see certain chemical biomarkers in the brain when the mice were stressed and when they were taking the probiotics." Both researchers said stress biomarkers could potentially indicate if someone is suffering from PTSD or risks developing it, allowing for treatment or prevention with probiotics and antibiotics. Later this year, Bienenstock and Forsythe will perform experiments involving fecal transplants from calm mice to stressed mice. They also hope to secure funding to conduct clinical trials to administer probiotics to human volunteers and use MRS to monitor brain reactions to different stress levels. Gut microbiology is part of ONR's program in warfighter performance. ONR also is looking at the use of synthetic biology to enhance the gut microbiome. Synthetic biology creates or re-engineers microbes or other organisms to perform specific tasks like improving health and physical performance. The field was identified as a top ONR priority because of its potential far-ranging impact on warfighter performance and fleet capabilities.


News Article | November 23, 2016
Site: www.prweb.com

When using a flow cytometry core facility, researchers commonly evaluate how to process their cellular samples most efficiently, while also ensuring the highest quality and reproducibility of their data. In this webinar, sponsored by Miltenyi Biotec, case studies and examples will be presented on the how the Miltenyi Biotec line of instrumentation, including the gentleMACS™ Dissociator, autoMACS® Pro Separator and MACSQuant® Analyzer, has improved the performance and quality of research projects in a core facility setting. Participants of the webinar will learn best practices for optimizing sample preparation and experimental design for cell analysis that will help researchers get the most out of their flow analysis. Some key topics of discussion will include increased yield and reproducibility during tissue dissociation, efficient rare cell sorting through pre-enrichment and decreased time spent cleaning and maintaining instruments. Chris Spring, a flow cytometry core specialist at St. Michael’s Hospital Research Institute in Toronto, will be the speaker for this webinar. Spring received his Master of Science in cellular and molecular biology from McMaster University in Ontario. He has spent nearly 15 years working in cell biology, primarily working on analyzing the role of platelets in immunological and cardiovascular diseases. For the past six years, Spring has run a flow cytometry and cell sorting core facility serving nearly 45 laboratories and 500 scientists in the Keenan Research Centre for Biomedical Science at St. Michael’s Hospital. He also currently serves as the co-president of the Canadian Microscopy and Cytometry Association. LabRoots will host the webinar, with no cost for participants, beginning at 9 a.m. PT, 12 p.m. ET on November 30, 2016. To read full event details or to register for free, click here. About Miltenyi Biotec Miltenyi Biotec is a global provider of products and services that advance biomedical research and cellular therapy. The company’s innovative tools support research at every level, from basic research to translational research to clinical application. This integrated portfolio enables scientists and clinicians to obtain, analyze, and utilize the cell. Miltenyi Biotec’s technologies cover techniques of sample preparation, cell isolation, cell sorting, flow cytometry, cell culture, molecular analysis, and preclinical imaging. Their more than 25 years of expertise spans research areas including immunology, stem cell biology, neuroscience, and cancer, and clinical research areas like hematology, graft engineering, and apheresis. In their commitment to the scientific community, Miltenyi Biotec also offers comprehensive scientific support, consultation, and expert training. Today, Miltenyi Biotec has more than 1,500 employees in 25 countries – all dedicated to helping researchers and clinicians around the world make a greater impact on science and health. About LabRoots LabRoots is the leading scientific social networking website and producer of educational virtual events and webinars. Contributing to the advancement of science through content sharing capabilities, LabRoots is a powerful advocate in amplifying global networks and communities. Founded in 2008, LabRoots emphasizes digital innovation in scientific collaboration and learning, and is a primary source for current scientific news, webinars, virtual conferences, and more. LabRoots has grown into the world’s largest series of virtual events within the Life Sciences and Clinical Diagnostics community.


News Article | October 25, 2016
Site: phys.org

Research from the University of Sussex suggests that humans are unique among primates in being able to intentionally alter the frequencies of our voices to sound larger or smaller than we really are, a capacity that is likely to have evolved over many thousands of years. Body size is very important for many animals, including humans, in predicting social dominance, reproductive success and health. Because of this, communicating body size to others through vocal signals is important, and being able to alter ones voice to trick other members of the species is a useful evolutionary tool. Psychologists Dr Kasia Pisanski and Dr David Reby, in collaboration with researchers from the University of Havana, University of Wrocław, and McMaster University, have discovered that humans can intentionally lower or raise the frequencies of our voices to sound larger or smaller than we actually are. In the first study of its kind to focus exclusively on human vocal modulation of body size, the ability was demonstrated in men and women from three distinct cultures (Canada, Cuba and Poland). The researchers also found that men modulate their voices more than women, which supports the likelihood that exaggeration of body size was more important for men's social and reproductive success during human evolution. "Our results are really interesting when we compare ourselves to other animals," said Dr Pisanski, who worked on the research. "Nonhuman primates are far less capable than we are at modulating their voice pitch and resonances on demand, so we humans are special in this regard. This can provide clues into the evolution of nonverbal communication in humans. "Our results also compliment a growing number of studies that suggest that people might actually modulate their voices quite often in real life situations – changing their voice to sound more attractive on a first date, or to sound more dominant during a political debate, for example." The researchers' next step will be to fully test whether people can effectively "fake" their body size in modern life when interacting with other humans. More specifically, they will examine whether people are "tricked" by modulated vocal cues to body size, or rather, can detect that they are faked. "We are only just now beginning to explore the truly dynamic nature of the human voice as an everyday social tool," added Dr Pisanski. Explore further: Research reveals individual differences in adult male voices emerge long before puberty More information: Katarzyna Pisanski et al. Volitional exaggeration of body size through fundamental and formant frequency modulation in humans, Scientific Reports (2016). DOI: 10.1038/srep34389


News Article | December 8, 2016
Site: www.chromatographytechniques.com

Smallpox plagued humanity for centuries, claiming millions of lives, before vaccination eradicated it in 1980. Some theories place its scourge as far back as ancient Egypt and the peak of Rome. But DNA evidence in a 17th century mummy indicates smallpox may be a more modern disease than originally believed, according to a new study in the journal Current Biology. “Scientists don’t yet fully comprehend where smallpox came from and when it jumped into humans,” said Hendrik Poinar, senior author, from both McMaster University and the Michael G. DeGroote Institute of Infectious Disease Research. The smallpox DNA was collected from a child in Lithuania who had died in the middle of the 17th century – a time beset by smallpox outbreaks and rampant death. The DNA was heavily fragmented, but the scientists sequenced it. (Since none of the virus was live, it was not dangerous to handle). Many theories held that smallpox outbreaks had been the cause of widespread death as far back as ancient Egypt and the peak of the Roman Empire, all the way through to the 20th century. But the Lithuanian sample shows such similarities to the samples collected right before the 1980 eradication, that the evolutionary models showed it probably jumped to humans in just the last few centuries. “This study sets the clock of smallpox evolution to a much more recent time scale,” said Eddie Holmes, another author, from the University of Sydney. “Although it is still unclear what animal is the true reservoir of smallpox virus and when the virus first jumped into humans.” They also found that Variola virus evolved into two strains after the development of the first vaccines using dead forms of the virus at the end of the 18th century. The study raises further questions, especially whether the disease outbreaks among the people of Central and South America during Spanish colonization were indeed smallpox.


News Article | December 14, 2015
Site: news.mit.edu

On Nov. 29, a workshop was held at MIT to honor the career and achievements of Sow-Hsin Chen, emeritus professor of nuclear science and engineering, and to celebrate his 80th birthday. The one-day workshop on “Topics in Soft Condensed Matter” featured talks by 10 speakers from around the world and brought together his former collaborators, students, and other researchers in the field. “It is a great honor to have studied with Professor Chen as an MIT student many years ago,” said Yun Liu, a former graduate student, currently a professor at the University of Delaware. “We are very excited to celebrate his 80 birthday with this workshop. The breadth and depth of his scientific contribution to the neutron scattering field and soft condensed matter physics is tremendous and far-reaching.” Chen is a pioneer in using neutron scattering to study a wide range of scientific problems such as microemulsion, cement, proteins, surfactants, hydrogen storage materials, and water. He is especially well-known internationally for his contributions to understanding the dynamic properties of supercooled and interfacial water with the use of neutron-scattering techniques. His lifelong achievements have been recognized by the international community — as noted by many prestigious awards he has received. Of note, he won the 2008 Clifford G. Shull Prize for his seminal contributions to understanding the dynamical properties of supercooled and interfacial water, and the 2015 Guinier Prize for his scientific contributions to soft condensed-matter physics. Also as an educator, Chen has been recognized for his training of young scientists in the use of those same techniques. Chen received his BS in physics from National Taiwan University in 1956, and his MS in physics from National Tsing Hua University in 1958. He arrived in the U.S. under an International Atomic Energy Agency fellowship, and che ompleted an MS in nuclear science at the University of Michigan in 1962, and his PhD in physics at McMaster University in Canada in 1964 under the Nobel laureate Bertram N. Brockhouse. He joined the faculty of the MIT Department of Nuclear Engineering in 1968. Chen continues to be a valuable contributor and influencer in the field and the department.


News Article | April 28, 2016
Site: www.biosciencetechnology.com

Blood stem cells can be used as therapeutics for a range of blood-based disorders, such as leukemia, lymphoma and sickle cell disease, yet they are usually in short supply. A team of researchers from McMaster University’s Stem Cell and Cancer Research Institute have gained knowledge about a key protein that enables greater control and regeneration of these cells, leading to new strategies to control the growth of blood stem cells and making enhanced numbers for transplantation possible. Specifically, the team, led by Kristin Hope, assistant professor of biochemistry and biomedical sciences, examined stem cells from umbilical cord blood.  These types of stem cells have been proven to be effective for treating adult blood cancers, and unique properties such as accessibility and adaptability make them more appealing for transplantation.  However, they are not widely available as only five percent of all samples of individual cord blood samples contain enough cells for transplant. The findings, published April 27 in Nature, demonstrate how the protein known as Musashi-2 controls the function and development of these blood stem cells. “Most stem cell studies focus on proteins that bind DNA to control gene output,” co-corresponding author, Gene Yeo, associate professor at the University of California San Diego, said in a prepared statement. “The prominent role we found for Musashi-2, a protein that instead binds to RNA, also underscores an urgency to study this second layer of gene regulation in stem cells. In a university press release Hope said that by shining a light on the way these stem cells work, the researchers now have a new level of understanding as to how these cells operate, giving scientists a big advantage in deciding how to maximize the stem cells in therapeutics.  With the ability to control regeneration of the cells, more people will have access to necessary treatments. “Providing enhanced numbers of stem cells for transplantation could alleviate some of the current post-transplantation complications and allow for faster recoveries, in turn reducing overall health care costs and wait times for newly diagnosed patients seeking treatment,” Hope said. She noted that more donated samples could be used for transplants using the method demonstrated by the team.


News Article | February 23, 2017
Site: www.sciencenews.org

Even tiny brains can learn strange and tricky stuff, especially by watching tiny experts. Buff-tailed bumblebees got several chances to watch a trained bee roll a ball to a goal. These observers then quickly mastered the unusual task themselves when given a chance, researchers report in the Feb. 24 Science. And most of the newcomers even improved on the goal-sinking by taking a shortcut demo-bees hadn’t used, says behavioral ecologist Olli Loukola at Queen Mary University of London. Learning abilities of animals without big vertebrate brains often get severely underestimated, Loukola says. “The idea that small brains constrain insects is kind of wrong, or old-fashioned.” He and colleagues had previously challenged bees to learn, in stages, the not very beelike skill of pulling a string to reveal a hidden flower. Bees eventually succeeded. So the researchers devised an even more fiendish protocol to see how far insect learning could go. Loukola invented six-legged sort-of soccer (or football for bees in London) in which a Bombus terrestris rolls a yellow ball about the size of its own body down a trackway to a central goal, where researchers dispense sugary rewards. This time, there was no pampering, no working up in stages to full completion of the test. But bees could observe a trained ball roller, a ball moving on its own (thanks to a researcher sliding a magnet under the arena) or get no advance ball-movement hints at all. The 10 bees that saw an expert bee roll the ball and score three times before their own attempt succeeded in almost every trial at the task. Watching ghostly movement didn’t help as much, and only a few bees happened on the solution on their own. Social learning matters, but Loukola highlights the way bees changed the technique they watched. Most of the successful bees ignored the ball they had seen rolled and instead used one closer to the goal, doing less work for the same reward. “Fascinating,” says Dave Goulson of the University of Sussex in England, who studies bumblebees. Ball rolling may not be part of routine foraging behavior, but he notes that bees do drag around nesting material, moving backward as they do when playing soccer in the test. And they occasionally remove fat almost ball-like grubs from the nest with a similar technique. Exactly how the bees solved the problem remains a puzzle, says Bennett Galef of McMaster University in Hamilton, Canada, who has studied social learning. He would like to know more details, for instance, about how untrained bees react to a ball. Loukola often gets a different question: Could he train bumblebees to play a soccer match? He says he could certainly train some to score on one side of an arena and some on the opposite side. Then he might be able to study whether bumblebees could share a ball.


News Article | November 10, 2016
Site: www.sciencedaily.com

Scientists at McMaster University's Stem Cell and Cancer Research Institute in collaboration with Sick Children's Hospital have discovered genetic alterations in the gene DIXDC1 in individuals with autism spectrum disorders (ASD). This gene was found to change the way brain cells grow and communicate. This finding, published in Cell Reports, provides new insights into ASD that will guide identification of new medications for people with ASD. This is critical because ASD affects one in 68 individuals, and there are no medications that target the core symptoms of this complex disorder. The study was led by Karun Singh, a scientist with the Stem Cell and Cancer Research Institute (SCCRI) and an assistant professor of biochemistry and biomedical sciences at McMaster's Michael G. DeGroote School of Medicine. The researchers discovered an important 'on' button in DIXDC1 protein that instructs brain cells to form mature connections called synapses with other brain cells during development. Working with the leading geneticist Stephen Scherer from The Hospital for Sick Children and the University of Toronto, the team identified genetic changes that keep DIXDC1 turned "off" in a group individuals with autism, predicted to cause brain synapses to stay immature, and reduce brain activity. "Because we pinpointed why DIXDC1 is turned off in some forms of autism, my lab at the SCCRI, which specializes in drug discovery, now has the opportunity to begin the searching for drugs that will turn DIXDC1 back on and correct synaptic connections," said Singh. "This is exciting because such a drug would have the potential to be a new treatment for autism." While this discovery holds promise, mutations in DIXDC1 account for only a small number of individuals with autism and related psychiatric conditions, Singh said. "However, there is strong evidence that many other autism genes disrupt the development of synapses similar to DIXDC1; therefore, the key to a new treatment for autism will be to find safe medications that restores brain cell synapse growth and activity." Mick Bhatia, director of the SCCRI, said the discovery signifies the institute's strategic entry into the area of neural disease and genetic guided personalized drug development. "This is the first step of many ahead as the SCCRI continues to strive for near term impact on human health through stem cell research," he said, adding that the addition of Singh's team was enabled by the support from the David Braley Chair in Neural Stem Cell Research.


News Article | October 25, 2016
Site: www.chromatographytechniques.com

Research from the University of Sussex suggests that humans are unique among primates in being able to intentionally alter the frequencies of our voices to sound larger or smaller than we really are, a capacity that is likely to have evolved over many thousands of years. Body size is very important for many animals, including humans, in predicting social dominance, reproductive success and health. Because of this, communicating body size to others through vocal signals is important, and being able to alter ones voice to trick other members of the species is a useful evolutionary tool. Psychologists Kasia Pisanski and David Reby, in collaboration with researchers from the University of Havana, University of Wrocław and McMaster University, have discovered that humans can intentionally lower or raise the frequencies of our voices to sound larger or smaller than we actually are. In the first study of its kind to focus exclusively on human vocal modulation of body size, the ability was demonstrated in men and women from three distinct cultures (Canada, Cuba and Poland). The researchers also found that men modulate their voices more than women, which supports the likelihood that exaggeration of body size was more important for men's social and reproductive success during human evolution. "Our results are really interesting when we compare ourselves to other animals," said Pisanski, who worked on the research. "Nonhuman primates are far less capable than we are at modulating their voice pitch and resonances on demand, so we humans are special in this regard. This can provide clues into the evolution of nonverbal communication in humans. "Our results also compliment a growing number of studies that suggest that people might actually modulate their voices quite often in real life situations – changing their voice to sound more attractive on a first date, or to sound more dominant during a political debate, for example." The researchers' next step will be to fully test whether people can effectively "fake" their body size in modern life when interacting with other humans. More specifically, they will examine whether people are "tricked" by modulated vocal cues to body size, or rather, can detect that they are faked. "We are only just now beginning to explore the truly dynamic nature of the human voice as an everyday social tool," added Pisanski.


October 28, 2016 - How should plastic surgeons choose the best implant type and size for women undergoing breast augmentation surgery? Implant size selection systems based on breast tissue measurements may provide better outcomes, suggests a research review in the November issue of Plastic and Reconstructive Surgery®, the official medical journal of the American Society of Plastic Surgeons (ASPS). Tissue-based planning systems--using clinical guidelines to determine the optimal breast implant dimensions for individual patients--appear superior to approaches relying more on the patient's or surgeon's preference, according to the study by Drs. William P. Adams, Jr., of University of Texas Southwestern Medical Center, Dallas, and Daniel McKee of McMaster University, Hamilton, Ont., Canada. But further studies will be needed to clarify how breast implant size selection systems affect the outcomes of breast augmentation. The researchers performed a "data-driven review" of methods used by plastic surgeons to select the appropriate implant size for breast augmentation surgery. Breast augmentation is the most popular cosmetic plastic surgery procedure in the United States, with nearly 280,000 procedures performed in 2015, according to ASPS statistics. The review identified 33 articles on implant sizing systems. Studies evaluating TBP sizing systems were of higher quality than those in the other two categories. "The top ten studies based on methodological quality all used patients' breast dimensions before selecting final implant dimensions, and this should now be considered standard of practice based on our analysis," Drs. Adams and McKee write. The TBP studies reported low rates of repeat surgery, compared to industry standards and accepted research values. The researchers emphasize some major limitations of the available evidence on implant sizing systems. Just four out of 33 studies reported clinical outcomes that could be compared to any standard, while none of the studies compared two or more sizing systems. Overall, 60 percent of studies scored zero on the quality rating scale used--including some popular sizing systems that were "not grounded on any published data or evidence." The topic of implant selection can be an emotional one, with tension between the plastic surgeon's roles as "Artist" versus "Engineer." The researchers note that some TBP systems with the highest quality of evidence take a "middle-of-the-road" approach--based on measurements, but also considering the patient's aesthetic desires. Based on their data, Drs. Adams and McKee are evaluating a new "implant-specific" TBP system designed to guide the surgeon to a selection of manufactured implant styles and models. "Going forward," they write, "new published systems should [use] rigorous quantitative methods so that comparisons can be made in terms of patient outcomes." Plastic and Reconstructive Surgery® is published by Wolters Kluwer. Click here to read "Matching the Implant to the Breast: A Systematic Review of Implant Size Selection Systems for Breast Augmentation." Article: "Matching the Implant to the Breast: A Systematic Review of Implant Size Selection Systems for Breast Augmentation" (doi: 10.1097/PRS.0000000000002623) For more than 70 years, Plastic and Reconstructive Surgery® (http://www. ) has been the one consistently excellent reference for every specialist who uses plastic surgery techniques or works in conjunction with a plastic surgeon. The official journal of the American Society of Plastic Surgeons, Plastic and Reconstructive Surgery® brings subscribers up-to-the-minute reports on the latest techniques and follow-up for all areas of plastic and reconstructive surgery, including breast reconstruction, experimental studies, maxillofacial reconstruction, hand and microsurgery, burn repair, and cosmetic surgery, as well as news on medico-legal issues The American Society of Plastic Surgeons is the largest organization of board-certified plastic surgeons in the world. Representing more than 7,000 physician members, the Society is recognized as a leading authority and information source on cosmetic and reconstructive plastic surgery. ASPS comprises more than 94 percent of all board-certified plastic surgeons in the United States. Founded in 1931, the Society represents physicians certified by The American Board of Plastic Surgery or The Royal College of Physicians and Surgeons of Canada. Wolters Kluwer is a global leader in professional information services. Professionals in the areas of legal, business, tax, accounting, finance, audit, risk, compliance and healthcare rely on Wolters Kluwer's market leading information-enabled tools and software solutions to manage their business efficiently, deliver results to their clients, and succeed in an ever more dynamic world. Wolters Kluwer reported 2015 annual revenues of €4.2 billion. The group serves customers in over 180 countries, and employs over 19,000 people worldwide. The company is headquartered in Alphen aan den Rijn, the Netherlands. Wolters Kluwer shares are listed on Euronext Amsterdam (WKL) and are included in the AEX and Euronext 100 indices. Wolters Kluwer has a sponsored Level 1 American Depositary Receipt program. The ADRs are traded on the over-the-counter market in the U.S. (WTKWY). Wolters Kluwer Health is a leading global provider of information and point of care solutions for the healthcare industry. For more information about our products and organization, visit http://www. , follow @WKHealth or @Wolters_Kluwer on Twitter, like us on Facebook, follow us on LinkedIn, or follow WoltersKluwerComms on YouTube.


They were awarded a U.S. patent on Aug. 18 for their efforts. "Existing methods are already very effective at making hydrogen gas," said Bruce Logan, Evan Pugh Professor of Environmental Engineering. "The problem is that these methods consume fossil fuels in order to generate enough energy to create the hydrogen gas." In response to this dilemma, Logan, along with former graduate student Roland Cusick, assistant professor at the University of Illinois, and postdoctoral researcher Younggy Kim, assistant professor at McMaster University, in Hamilton, Ontario, discovered a new method for making hydrogen gas that does not require the use of fossil fuels. In this method, the researchers are able to effectively produce hydrogen gas using energy stored in ammonium bicarbonate (a heat regenerable salt) and solar heat or waste heat (like that available at power plants). "Since the new system runs on waste heat, it is effectively carbon neutral and fossil fuel neutral," Logan said. The patent, U.S. patent number 9,112,217, "Reverse electrodialysis supported microbial fuel cells and microbial electrolysis cells," describes the process. Ammonium bicarbonate and water are separated into high and low salt concentration streams using distillation, much like the process for distilling alcohol. Those streams are then fed into a reverse electrodialysis stack, which consists of a series of alternating charge (cation and anion) ion exchange membranes. This process creates an electrochemical reaction that splits the water forming both oxygen and hydrogen at the other electrode. That hydrogen can then be used on site, for example to make ammonia, or it can be compressed and containerized for a variety of other purposes. Previous similar systems have been designed to create electrical power from high and low salt concentration solutions, such as freshwater and seawater solutions. However, this is the first device created specifically for hydrogen gas production. "Many countries are limiting carbon emissions, and thus new carbon neutral methods are needed to produce transportable fuels," Logan said. "This process can help with both of those goals." The new method can be used on a large scale but is not yet economical due to the cost of the membranes. The researchers hope to find more economical solutions to this problem. "The next step is the development of very inexpensive membranes that can be produced in large amounts, similar to that done today for reverse osmosis membranes used for drinking water," Logan said. "The production of such low cost membranes could help stimulate a new industry in sustainable hydrogen gas production."


Tasker E.J.,McMaster University | Tasker E.J.,University of Florida
Astrophysical Journal | Year: 2011

We investigate the effect of star formation and diffuse photoelectric heating on the properties of giant molecular clouds (GMCs) formed in high-resolution (≲10pc) global (∼20kpc) simulations of isolated Milky-Way-type galaxy disks. The clouds are formed through gravitational fragmentation, and structures with densities n H,c>100 cm -3 are identified as GMCs. Between 1000 and 1500 clouds are created in the simulations with masses M>105 M 1 and 180-240 with masses M>106 M ⊙ in agreement with estimates of the Milky Way's population. We find that the effect of photoelectric heating is to suppress the fragmentation of the interstellar medium, resulting in a filamentary structure in the warm gas surrounding clouds. This environment suppresses the formation of a retrograde rotating cloud population, with 88% of the clouds rotating prograde with respect to the galaxy after 300Myr. The diffuse heating also reduces the initial star formation rate (SFR), slowing the conversation of gas into stars. We therefore conclude that the interstellar environment plays an important role in the GMC evolution. Our clouds live between 0 and 20Myr with a high infant mortality (t′ < 3Myr) due to cloud mergers and star formation. Other properties, including distributions of mass, size, and surface density, agree well with observations. Collisions between our clouds are common, occurring at a rate of ∼ 1/4 of the orbital period. It is not clear whether such collisions trigger or suppress star formation at our current resolution. Our SFR is a factor of 10 higher than observations in local galaxies. This is likely due to the absence of localized feedback in our models. © 2011. The American Astronomical Society. All rights reserved.


Phillips S.M.,McMaster University | van Loon L.J.C.,Maastricht University
Journal of Sports Sciences | Year: 2011

Opinion on the role of protein in promoting athletic performance is divided along the lines of how much aerobic-based versus resistance-based activity the athlete undertakes. Athletes seeking to gain muscle mass and strength are likely to consume higher amounts of dietary protein than their endurance-trained counterparts. The main belief behind the large quantities of dietary protein consumption in resistance-trained athletes is that it is needed to generate more muscle protein. Athletes may require protein for more than just alleviation of the risk for deficiency, inherent in the dietary guidelines, but also to aid in an elevated level of functioning and possibly adaptation to the exercise stimulus. It does appear, however, that there is a good rationale for recommending to athletes protein intakes that are higher than the RDA. Our consensus opinion is that leucine, and possibly the other branched-chain amino acids, occupy a position of prominence in stimulating muscle protein synthesis; that protein intakes in the range of 1.3-1.8 g · kg -1 · day -1 consumed as 3-4 isonitrogenous meals will maximize muscle protein synthesis. These recommendations may also be dependent on training status: experienced athletes would require less, while more protein should be consumed during periods of high frequency/intensity training. Elevated protein consumption, as high as 1.8-2.0 g · kg -1 · day -1 depending on the caloric deficit, may be advantageous in preventing lean mass losses during periods of energy restriction to promote fat loss. © 2011 Taylor and Francis Group, LLC.


Stockl H.,London School of Hygiene and Tropical Medicine | Devries K.,London School of Hygiene and Tropical Medicine | Rotstein A.,McMaster University | Abrahams N.,Gender and Health Research Unit | And 3 more authors.
The Lancet | Year: 2013

Background: Homicide is an important cause of premature mortality globally, but evidence for the magnitude of homicides by intimate partners is scarce and hampered by the large amount of missing information about the victim-offender relationship. The objective of the study was to estimate global and regional prevalence of intimate partner homicide. Methods: A systematic search of fi ve databases (Medline, Global Health, Embase, Social Policy, and Web of Science) yielded 2167 abstracts, and resulted in the inclusion of 118 full-text articles with 1122 estimates of the prevalence of intimate partner homicide after double-blind screening. All studies were included that reported the number or proportion of women or men who were murdered by an intimate partner in a country, province, or town, using an inclusive defi nition of an intimate partner. Additionally, a survey of offi cial sources of 169 countries provided a further 53 estimates. We selected one estimate per country-year using a quality assessment decision algorithm. The median prevalence of intimate partner homicide was calculated by country and region overall, and for women and men separately. Findings: Data were obtained for 66 countries. Overall 13.5% (IQR 9.2-18.2) of homicides were committed by an intimate partner, and this proportion was six times higher for female homicides than for male homicides (38.6%, 30.8-45.3, vs 6.3%, 3.1-6.3). Median percentages for all (male and female) and female intimate partner homicide were highest in high-income countries (all, 14.9%, 9.2-18.2; female homicide, 41.2%, 30.8-44.5) and in southeast Asia (18.8%, 11.3-18.8; 58.8%, 58.8-58.8). Adjustments to account for unknown victim-off ender relationships generally increased the prevalence, suggesting that results presented are conservative. Interpretation: At least one in seven homicides globally and more than a third of female homicides are perpetrated by an intimate partner. Such violence commonly represents the culmination of a long history of abuse. Strategies to reduce homicide risk include increased investment in intimate partner violence prevention, risk assessments at diff erent points of care, support for women experiencing intimate partner violence, and control of gun ownership for people with a history of violence. Improvements in country-level data collection and monitoring systems are also essential, because data availability and quality varied strongly across regions. Funding: WHO, Sigrid Rausing Trust, and the UK Economic and Social Research Council.


Al-Qabandi M.,Mubarak Al Kabeer Hospital | Gorter J.W.,McMaster University | Rosenbaum P.,McMaster University
Pediatrics | Year: 2011

BACKGROUND. Autism is a serious neurodevelopmental disorder that has a reportedly rising prevalence rate. The American Academy of Pediatrics recommends that screening for autism be incorporated into routine practice. It is important to consider the pros and cons of conducting autism screening as part of routine practice and its implications on the community. We have explored this question in the context of screening from a scientific point of view. METHOD: A literature search was conducted to assess the effectiveness of community screening programs for autism. RESULTS: Judged against critical questions about autism, screening programs failed to fulfill most criteria. Good screening tools and efficacious treatment are lacking, and there is no evidence yet that such a program would do more good than harm. CONCLUSIONS: On the basis of the available research, we believe that we do not have enough sound evidence to support the implementation of a routine population-based screening program for autism. Ongoing research in this field is certainly needed, including the development of excellent screening instruments and demonstrating with clinical trials that such programs work and do more good than harm. Copyright © 2011 by the American Academy of Pediatrics.


Kraeker C.,McMaster University | Chandler C.,London School of Hygiene and Tropical Medicine
Academic Medicine | Year: 2013

PURPOSE: It is increasingly common for health care professionals from developed countries to travel to developing regions of the world to learn or teach. This project aimed to describe the perceptions held by health care professionals in a developing region toward those who visit their communities to learn or teach. METHOD: Semistructured interviews were conducted in July, 2011, with nine health care professionals from the University of Namibia School of Medicine. Questions revolved around participants' perceptions of benefits, harms, and ethical impressions of a health care professional visiting from a developed country. Interviews were tape-recorded, transcribed, and analyzed qualitatively using an inductive, iterative approach. RESULTS: The interview analysis identified three main narratives that shaped participant perceptions of visits: (1) culture, context, and concern, (2) expectations, intentions, and miscommunications, and (3) partnership and the desire to share and gain knowledge. CONCLUSIONS: Participants' comments supported actively seeking out information regarding cultural and environmental context before visiting, completing a needs assessment to ensure that activities are needed and relevant, attempting to formulate long-term sustainable relationships, and traveling with the appropriate attitude. These themes provide valuable insight into how international educational collaborations can be created in order to be mutually beneficial.


Brown W.M.,Statistics Canada | Scott D.M.,McMaster University
Journal of Regional Science | Year: 2012

A growing literature has found a positive association between human capital and long-run employment growth across cities. These studies have increased interest in understanding the location choices of university degree holders, a group often used as a proxy measure of human capital. Based on data from the 2001 Canadian Census of Population, this paper investigates determinants of the location choices of degree and nondegree holders. With a multinomial logit model, it tests a series of hypotheses about the differential effects of thick labor markets and amenities on the location choice of these groups across metropolitan and nonmetropolitan areas in Canada. © 2012, Wiley Periodicals, Inc.


Belshe E.F.,University of Florida | Schuur E.A.G.,University of Florida | Bolker B.M.,McMaster University
Ecology Letters | Year: 2013

Are tundra ecosystems currently a carbon source or sink? What is the future trajectory of tundra carbon fluxes in response to climate change? These questions are of global importance because of the vast quantities of organic carbon stored in permafrost soils. In this meta-analysis, we compile 40 years of CO2 flux observations from 54 studies spanning 32 sites across northern high latitudes. Using time-series analysis, we investigated if seasonal or annual CO2 fluxes have changed over time, and whether spatial differences in mean annual temperature could help explain temporal changes in CO2 flux. Growing season net CO2 uptake has definitely increased since the 1990s; the data also suggest (albeit less definitively) an increase in winter CO2 emissions, especially in the last decade. In spite of the uncertainty in the winter trend, we estimate that tundra sites were annual CO2 sources from the mid-1980s until the 2000s, and data from the last 7 years show that tundra continue to emit CO2 annually. CO2 emissions exceed CO2 uptake across the range of temperatures that occur in the tundra biome. Taken together, these data suggest that despite increases in growing season uptake, tundra ecosystems are currently CO2 sources on an annual basis. © 2013 John Wiley & Sons Ltd/CNRS.


TORONTO, ON / ACCESSWIRE / December 2, 2016 / ChroMedX Corp. (CSE: CHX) (OTCQB: MNLIF) (FSE: EIY2) (the "Company"), developer of the HemoPalm Handheld Blood Analyzer System, is pleased to announce that it's collaboration with Dr. Leyla Soleymani and the Biointerface Institute of McMaster University has received a Voucher for Innovation and Productivity I (VIP I) grant from Ontario Centres of Excellence (OCE) for continued HemoPalm biosensor development. The VIP I program helps eligible companies develop, implement and commercialize technical innovations by supporting partnerships between Ontario's industry and publicly funded post-secondary institutions. Projects funded through VIP I enable the development of new products and/or processes, facilitate productivity improvements, and help generate new revenues and high-value jobs for Ontario. "We are very pleased with the continued support of our development with Dr. Soleymani. It enables us to work closely with Ontario's world-class academic institution to solve R & D challenges. Our close working relationship with Dr. Soleymani's team has enabled us to make significant headway on our development and continues to produce positive results. It has been a pleasure working with her team and we are excited to continue our collaboration to benefit the development of Canadian medical technology." said Ash Kaushal, President & CEO, ChroMedX Corp. Dr. Soleyemani and ChroMedX have previously worked together through an NSERC ENGAGE grant. The positive experience of the two teams through this collaboration in terms of expertise and infrastructure has motivated the proposed industry/academic collaboration. "Biosensor development is an exciting opportunity for us, I am pleased with the continued work on this project and with the ChroMedX team on their novel HemoPalm Point-of-care system" said Dr. Soleymani, Assistant Professor, Biointerfaces Institute (BI), McMaster University Dr. Soleymani's group will focus on addressing the company's specific challenges in (1) developing ion-selective formulations that can be generated via contact or non-contact printing; (2) integrating ion-selective membranes with miniaturized microfabricated electrodes; and (3) validating and optimizing the ion-selective electrode arrays for addressing the design requirements - sensitivity, selectivity, dynamic range, response time - of the blood analyzer. Dr. Soleymani's CFI/MRI-funded laboratory (Center for Cellular and Molecular Sensing) is equipped with all the necessary pieces of equipment for electrochemical sensor testing and validation. Biointerfaces Institute provides the technical expertise and infrastructure for developing application specific biosensing prototypes. The vast array of contact and non-contact printers coupled with high-throughput screening systems available at the BI are ideally suited for designing, fabricating, and optimizing the ion-selective membranes that are central to the HemoPalm blood analyzer. OCE is funded by the Government of Ontario to foster training and development of the next generation of innovators and entrepreneurs and is a key partner with Ontario's industry, universities, colleges, research hospitals, investors and governments. Their mission is to accelerate innovation through game-changing research leading to successful commercialization and vibrant collaboration between industry and academia, launching the next generation of products and jobs. Dr. Leyla Soleymani is an Assistant Professor at the Department of Engineering Physics and the School of Biomedical Engineering at McMaster. She is currently the Canada Research Chair in Miniaturized Biomedical Devices and has extensive expertise in the study, design, and development of electrochemical biosensors and their technology translation. Dr. Soleymani has developed materials engineering strategies for enhancing the performance metrics of biosensors and have been involved in developing biosensors for infectious diseases and cancer. The HemoPalm Handheld Blood Analyzer System is the only handheld blood analysis technology which combines Blood Gases & Electrolytes with full CO-oximetry. Currently this combination is not available on any of the handheld analyzers on the market. Existing technologies require users to purchase a second device to carry out the CO-oximetry. The Company's technology has the advantage of being able to offer a single handheld blood analyzer that provides all the required tests for Blood Gases & Electrolytes, with full CO-oximetry and bilirubin. Another competitive advantage of the HemoPalm system will be its ability to draw capillary blood directly from a pin-prick site into the cartridge, providing an alternative to arterial blood. Drawing arterial blood is painful and can cause nerve damage. CO-oximetry is the measurement of five different hemoglobin species in blood. The global market for Blood Gases & Electrolytes was estimated to be 1.5 Billion $US in 2015 and is projected to reach over 1.8 Billion by 2020. ChroMedX Corp. is a medical technology company focused on the development of novel medical devices for in vitro diagnostics and point-of-care testing. The devices are protected by the Company's issued and pending patents, dealing with blood collection, analysis and plasma/serum processing. NEITHER THE CANADIAN SECURITIES EXCHANGE NOR ITS REGULATIONS SERVICES PROVIDER HAVE REVIEWED OR ACCEPT RESPONSIBILITY FOR THE ADEQUACY OR ACCURACY OF THIS RELEASE. Except for statements of historic fact, this news release contains certain "forward-looking information" within the meaning of applicable securities law. Forward-looking information is frequently characterized by words such as "plan", "expect", "project", "intend", "believe", "anticipate", "estimate" and other similar words, or statements that certain events or conditions "may" or "will" occur. Forward-looking statements are based on the opinions and estimates at the date the statements are made, and are subject to a variety of risks and uncertainties and other factors that could cause actual events or results to differ materially from those anticipated in the forward-looking statements including, but not limited to delays or uncertainties with regulatory approvals, including that of the CSE. There are uncertainties inherent in forward-looking information, including factors beyond the Company's control. The Company undertakes no obligation to update forward-looking information if circumstances or management's estimates or opinions should change except as required by law. The reader is cautioned not to place undue reliance on forward-looking statements. Additional information identifying risks and uncertainties that could affect financial results is contained in the Company's filings with Canadian securities regulators, which filings are available at www.sedar.com TORONTO, ON / ACCESSWIRE / December 2, 2016 / ChroMedX Corp. (CSE: CHX) (OTCQB: MNLIF) (FSE: EIY2) (the "Company"), developer of the HemoPalm Handheld Blood Analyzer System, is pleased to announce that it's collaboration with Dr. Leyla Soleymani and the Biointerface Institute of McMaster University has received a Voucher for Innovation and Productivity I (VIP I) grant from Ontario Centres of Excellence (OCE) for continued HemoPalm biosensor development. The VIP I program helps eligible companies develop, implement and commercialize technical innovations by supporting partnerships between Ontario's industry and publicly funded post-secondary institutions. Projects funded through VIP I enable the development of new products and/or processes, facilitate productivity improvements, and help generate new revenues and high-value jobs for Ontario. "We are very pleased with the continued support of our development with Dr. Soleymani. It enables us to work closely with Ontario's world-class academic institution to solve R & D challenges. Our close working relationship with Dr. Soleymani's team has enabled us to make significant headway on our development and continues to produce positive results. It has been a pleasure working with her team and we are excited to continue our collaboration to benefit the development of Canadian medical technology." said Ash Kaushal, President & CEO, ChroMedX Corp. Dr. Soleyemani and ChroMedX have previously worked together through an NSERC ENGAGE grant. The positive experience of the two teams through this collaboration in terms of expertise and infrastructure has motivated the proposed industry/academic collaboration. "Biosensor development is an exciting opportunity for us, I am pleased with the continued work on this project and with the ChroMedX team on their novel HemoPalm Point-of-care system" said Dr. Soleymani, Assistant Professor, Biointerfaces Institute (BI), McMaster University Dr. Soleymani's group will focus on addressing the company's specific challenges in (1) developing ion-selective formulations that can be generated via contact or non-contact printing; (2) integrating ion-selective membranes with miniaturized microfabricated electrodes; and (3) validating and optimizing the ion-selective electrode arrays for addressing the design requirements - sensitivity, selectivity, dynamic range, response time - of the blood analyzer. Dr. Soleymani's CFI/MRI-funded laboratory (Center for Cellular and Molecular Sensing) is equipped with all the necessary pieces of equipment for electrochemical sensor testing and validation. Biointerfaces Institute provides the technical expertise and infrastructure for developing application specific biosensing prototypes. The vast array of contact and non-contact printers coupled with high-throughput screening systems available at the BI are ideally suited for designing, fabricating, and optimizing the ion-selective membranes that are central to the HemoPalm blood analyzer. OCE is funded by the Government of Ontario to foster training and development of the next generation of innovators and entrepreneurs and is a key partner with Ontario's industry, universities, colleges, research hospitals, investors and governments. Their mission is to accelerate innovation through game-changing research leading to successful commercialization and vibrant collaboration between industry and academia, launching the next generation of products and jobs. Dr. Leyla Soleymani is an Assistant Professor at the Department of Engineering Physics and the School of Biomedical Engineering at McMaster. She is currently the Canada Research Chair in Miniaturized Biomedical Devices and has extensive expertise in the study, design, and development of electrochemical biosensors and their technology translation. Dr. Soleymani has developed materials engineering strategies for enhancing the performance metrics of biosensors and have been involved in developing biosensors for infectious diseases and cancer. The HemoPalm Handheld Blood Analyzer System is the only handheld blood analysis technology which combines Blood Gases & Electrolytes with full CO-oximetry. Currently this combination is not available on any of the handheld analyzers on the market. Existing technologies require users to purchase a second device to carry out the CO-oximetry. The Company's technology has the advantage of being able to offer a single handheld blood analyzer that provides all the required tests for Blood Gases & Electrolytes, with full CO-oximetry and bilirubin. Another competitive advantage of the HemoPalm system will be its ability to draw capillary blood directly from a pin-prick site into the cartridge, providing an alternative to arterial blood. Drawing arterial blood is painful and can cause nerve damage. CO-oximetry is the measurement of five different hemoglobin species in blood. The global market for Blood Gases & Electrolytes was estimated to be 1.5 Billion $US in 2015 and is projected to reach over 1.8 Billion by 2020. ChroMedX Corp. is a medical technology company focused on the development of novel medical devices for in vitro diagnostics and point-of-care testing. The devices are protected by the Company's issued and pending patents, dealing with blood collection, analysis and plasma/serum processing. NEITHER THE CANADIAN SECURITIES EXCHANGE NOR ITS REGULATIONS SERVICES PROVIDER HAVE REVIEWED OR ACCEPT RESPONSIBILITY FOR THE ADEQUACY OR ACCURACY OF THIS RELEASE. Except for statements of historic fact, this news release contains certain "forward-looking information" within the meaning of applicable securities law. Forward-looking information is frequently characterized by words such as "plan", "expect", "project", "intend", "believe", "anticipate", "estimate" and other similar words, or statements that certain events or conditions "may" or "will" occur. Forward-looking statements are based on the opinions and estimates at the date the statements are made, and are subject to a variety of risks and uncertainties and other factors that could cause actual events or results to differ materially from those anticipated in the forward-looking statements including, but not limited to delays or uncertainties with regulatory approvals, including that of the CSE. There are uncertainties inherent in forward-looking information, including factors beyond the Company's control. The Company undertakes no obligation to update forward-looking information if circumstances or management's estimates or opinions should change except as required by law. The reader is cautioned not to place undue reliance on forward-looking statements. Additional information identifying risks and uncertainties that could affect financial results is contained in the Company's filings with Canadian securities regulators, which filings are available at www.sedar.com


News Article | December 8, 2016
Site: www.eurekalert.org

Hamilton, ON Dec. 8, 2016 -- Pioneering work being carried out in a cave in New Mexico by researchers at McMaster University and The University of Akron, Ohio, is changing the understanding of how antibiotic resistance may have emerged and how doctors can combat it in the future. In research published in Nature Communications today, the scientists examined one bacterium found 1,000 feet underground (called Paenibacillus) that demonstrated resistance to most antibiotics used today, including so-called 'drugs of last resort' such as daptomycin. These microorganisms have been isolated from the outside world for more than four million years within the cave. The results show the bacterium is resistant to 18 different antibiotics and uses identical methods of defense as similar species found in soils. This suggests that the evolutionary pressure to conserve these resistance genes has existed for millions of years -- not just since antibiotics were first used to treat disease. Among the different ways that the bacteria could be resistant to antibiotics, the scientists identified five novel pathways that were of potential clinical concern. Finding these new pathways is particularly valuable, as it gives researchers time to develop new drugs to combat this type of resistance, potentially decades before it will become a problem for doctors and their patients. "The diversity of antibiotic resistance and it's its prevalence in microbes across the globe should be humbling to everyone who uses these lifesaving drugs," said Gerry Wright, an author of the paper and scientific director of McMaster's Michael G. DeGroote Institute for Infectious Disease Research. "It reflects the fact that we must understand that antibiotic use and resistance go hand in hand." Hazel Barton, professor and director, Integrative Bioscience at The University of Akron, said: "Exploring these challenging and remote environments offers a unique opportunity to sample the genetic diversity of microbes untouched by human activity" The bacteria were found in Lechuguilla Cave, which is one of the longest caves in the world and deepest in the United States. It is an UNESCO World Heritage Site. Due to the fragile and highly technical nature of the cave, it has been closed to all except a few scientific researchers and cave experts since its original discovery in 1986. This restricted access makes it an ideal environment in which to study how microbes have evolved without the influence of human activity. Today's research publication follows work by the researchers in 2012 to examine microorganisms from the cave. Although use of antibiotics revolutionized the treatment of bacterial infections in the 20th century, overuse of antibiotics has led to the emergence of antibiotic resistance in disease causing bacteria. In the U.S., the Centers for Disease Control estimate that more than 20,000 people die each year from otherwise treatable disease. Both Health Canada and the U.S. national government have released national action plans to address the resistance crisis. Editors: New Mexico's Lechuguilla Cave, a place isolated from human contact until recently, is home to a remarkable prevalence of antibiotic-resistant bacteria. A photo is available for downloading here. https:/


SAN DIEGO--(BUSINESS WIRE)--Illumina, Inc. (NASDAQ: ILMN) today announced the appointment of Sam A. Samad, Senior Vice President and Chief Financial Officer. He will join the company on January 6th, 2017. “I look forward to welcoming Sam to Illumina’s executive team,” said Marc Stapley, Executive Vice President and Chief Administrative Officer of Illumina. “Sam’s global experience in leading large finance organizations at major corporations, coupled with his healthcare experience in sales and general management, has prepared him well to help us accomplish our mission. Personally, I look forward to welcoming Sam to my team and handing over the CFO reigns to him.” Sam will be responsible for the company’s finance, accounting, investor relations, internal audit and treasury functions. He joins Illumina from Cardinal Health where he held several senior leadership positions including most recently Senior Vice President and Corporate Treasurer, with leadership responsibility for Cardinal Health's China business. Sam was previously Senior Vice President and Chief Financial Officer for the pharmaceutical segment, and Vice President, Healthcare Supply Chain Services. He also previously held finance roles at Eli Lilly and PepsiCo Inc. Sam holds a BBA degree from the American University of Beirut in Lebanon and an MBA from McMaster University in Hamilton, Canada. Illumina is improving human health by unlocking the power of the genome. Our focus on innovation has established us as the global leader in DNA sequencing and array-based technologies, serving customers in the research, clinical, and applied markets. Our products are used for applications in the life sciences, oncology, reproductive health, agriculture, and other emerging segments. To learn more, visit www.illumina.com and follow @illumina. Forward-Looking Statements This release contains forward-looking statements that involve risks and uncertainties. Examples of forward-looking statements include, but are not limited to, statements we make regarding the expected availability dates for new products and services and FDA submission dates and intentions for certain products and services. Important factors that could cause actual results to differ materially from those in any forward-looking statements include challenges inherent in developing, manufacturing, and launching new products and services, and the other factors that are detailed in our filings with the Securities and Exchange Commission, including our most recent filings on Forms 10-K and 10-Q, or in information disclosed in public conference calls, the date and time of which are released beforehand. We do not intend to update any forward-looking statements after the date of this release.


The discovery increases the number of known clawed frog species from 22 to 29—a 30 percent increase. Each of the new species is documented online today in the journal PLOS ONE. "Because the African clawed frog is used as a model organism for biological research, it would be understandable to think that scientists had already pinned down the number of species and other aspects of their diversity such as where they live and how they are related to one another," says Ben Evans, lead author of the study and an associate professor in the Department of Biology at McMaster University. "But this isn't the case." These clawed frogs, found in west and central sub-Saharan Africa, live in slow moving or stagnant water and are characterized by flattened bodies, vocal organs which can produce sound underwater, and claws on its first three toes. Researchers were able to tease apart a wealth of information on its evolution with new analytical techniques using DNA, voice recordings, CT scanning of internal anatomy, chromosome analysis and more. Like most African clawed frogs, researchers found all are 'polyploid', meaning their DNA doubled during evolution, giving them a redundant copy of every gene. Genome duplication occurred several times in some of the species and two of the new ones are 'dodecaploid', because their genomes were duplicated a remarkable six times. "For biodiversity conservation, it is paramount that we understand how much diversity there is and where it occurs," says Evans. "This is particularly crucial in the tropics, where global biodiversity is highest and in groups of organisms that have subtle physical differences between species and in which species diversity is therefore 'cryptic'." His team will travel to Ghana next year to gather further genetic data and search for what Evans calls 'lost ancestors' of the clawed frog. These "lost ancestors" are species predicted to have existed in the past whose genomes became part of those of the polyploid species that exist today.


News Article | November 2, 2016
Site: www.eurekalert.org

The Ottawa Hospital, the Children's Hospital of Eastern Ontario (CHEO), the University of Ottawa (uOttawa) and McMaster University congratulate Turnstone Biologics Inc. (Turnstone) on securing US$ 41.4 million in new private investments. Turnstone was founded in 2015 to advance the development of novel oncolytic viral immunotherapies for cancer. Its technology is based on research led by Dr. John Bell (from The Ottawa Hospital and uOttawa), Dr. Brian Lichty (from McMaster University) and Dr. David Stojdl (from CHEO and uOttawa). Turnstone's most advanced product is an oncolytic Maraba virus that is engineered to express melanoma-associated antigen A3 (MAGEA3). This is currently being tested in a clinical trial led by The Ottawa Hospital, sponsored by the Canadian Cancer Trials Group, and funded by the Ontario Institute for Cancer Research. Full results are expected to be released in 2017. More information for patients is available here. Dr. David Stojdl, senior scientist, Children's Hospital of Eastern Ontario; associate professor, University of Ottawa: "This financing is incredible validation that we're on the right track. We all want to be part of a scientific narrative that changes lives, and I believe that our immunotherapy approach is it." Dr. Brian Lichty, associate professor at McMaster University: "We have had tremendous success with our technology so far, but this financial support as a commercial venture is essential in enhancing our ability to bring it to the bedside. We know there is so much potential." Dr. John Bell, senior scientist, The Ottawa Hospital; professor, University of Ottawa: "Community support has been and will continue to be crucial for our research. However developing new therapies is extremely costly, so we also need to engage the private sector to take our research to the next level. I want to express my deep gratitude to all the people who have helped get us to this exciting place." Dr. Derek Jonker, Principal Investigator for the Maraba trial; medical oncologist, The Ottawa Hospital; professor, University of Ottawa: "We are pleased with the progress of the clinical trial so far and now have a better understanding of how patients do after receiving the dual virus vaccine therapy. We anticipate moving to phase II for patients with lung, breast and esophagogastric cancers in the near future." Dr. Martin Osmond, CEO and Scientific Director, CHEO Research Institute: "CHEO is proud that the Stojdl lab was involved in the initial discovery and development of the Maraba virus! Today it's the lead asset in Turnstone's impressive portfolio, which is nothing short of inspiring. My heartfelt congratulations to the entire team at Turnstone for this major funding milestone which boosts the trajectory towards improved patient outcomes through research." Dr. Duncan Stewart, Executive Vice-President of Research, The Ottawa Hospital; professor, University of Ottawa: "It is incredibly challenging for academic researchers to take a discovery all the way from the lab bench to the patient's bedside, so I want to offer my heartfelt congratulations to Dr. Bell and his colleagues. Their success has helped to create a culture of translational research at The Ottawa Hospital that has huge potential for patients as well as the economy." Dr. Mona Nemer, Vice-President of Research, University of Ottawa "This investment represents a major milestone in the development and translation of academic research discoveries into the clinic. The University of Ottawa congratulates Turnstone and our researchers on their success. We look forward to working with Turnstone and the research team to advance this technology further." Dr. Paul O'Byrne, Dean and Vice-President, Faculty of Health Sciences, McMaster University "Commercialization of discoveries in our academic laboratories is an important move forward to a healthy society, both economically and physically. We are extremely thrilled by the work of Dr. Lichty and other McMaster scientists, and the collaboration on this project with CHEO, The Ottawa Hospital, University of Ottawa, other supporters and now, Turnstone. This significant investment being made in Turnstone is much appreciated." Dr. Lincoln Stein, Interim Scientific Director of The Ontario Institute for Cancer Research: "The Ontario Institute for Cancer Research is proud to stimulate the groundbreaking multi-institutional research behind Turnstone, including significant financial and in-kind support enabling the current clinical trial. We congratulate the Turnstone team on attracting further investment to the benefit of both patients with cancer and the innovation economy of Ontario." Dr. Stéphanie Michaud, President and CEO, BioCanRx "On behalf of BioCanRx, I wish to extend my congratulations to Turnstone Biologics on the significant investment announced today. This announcement not only reflects the accomplishments of Turnstone but also of the advancements in the oncolytic virus platform in Canada, and around the world. These novel therapies potentially offer a unique opportunity to change the way we treat cancer patients. We are delighted to continue working with Turnstone in transitioning these important new discoveries out of the lab and into the clinic."


News Article | November 30, 2016
Site: www.chromatographytechniques.com

A mass burial of bodies, known to be victims of the Black Death, has been discovered at the site of a 14th century monastery hospital at Thornton Abbey, Lincolnshire. Archaeologists from the University of Sheffield revealed 48 skeletons, many of which were children, at the extremely rare Black Death burial site. The Black Death was one of the worst pandemics in human history. It devastated European populations from 1346 to 1353 and resulted in the deaths of an estimated 75 to 200 million people. The presence of such a large burial site, containing both male and female adults, as well as 27 children, suggests the local community was overwhelmed by the Black Death and was left unable to cope with the number of people who died. Hugh Willmott from the University of Sheffield’s Department of Archaeology, who has been working on the excavation site since 2011, directed the excavations and explained why the find is of national importance. “Despite the fact it is now estimated that up to half the population of England perished during the Black Death, multiple graves associated with the event are extremely rare in this country, and it seems local communities continued to dispose of their loved ones in as ordinary a way as possible,” he said. “The only two previously identified 14th century sites where Yersinia pestis (the bacterium responsible for the plague) has been identified are historically documented cemeteries in London, where the civic authorities were forced to open new emergency burial grounds to cope with the very large numbers of the urban dead. “The finding of a previously unknown and completely unexpected mass burial dating to this period in a quiet corner of rural Lincolnshire is thus far unique, and sheds light into the real difficulties faced by a small community ill prepared to face such a devastating threat.” “While skeletons are interesting, they just represent the end of somebody’s life and actually what we are interested in as archaeologists is the life they led before they died,” added Willmott. “One of the ways we can connect with that is through the everyday objects they left behind. “One artifact that we found at Thornton Abbey was a little pendant. It is a Tau Cross and was found in the excavated hospital building. This pendant was used by some people as a supposed cure against a condition called St Antony’s fire, which in modern day science is probably a variety of skin conditions. “Before we began the dig the site was just an ordinary green field grazed by sheep for hundreds of years, but like many fields across England, as soon as you take away the turf, layers of history can be revealed by archaeology.” Teeth samples from the skeletons found at the Thornton Abbey site were sent to McMaster University in Canada where ancient DNA was successfully extracted from the tooth pulp. Tests on the DNA revealed the presence of Yersinia pestis, which is documented to have reached Lincolnshire in the spring of 1349. “Once the skeletons return to the lab we start properly learning who these people really are,” said Diana Mahoney Swales, from the University of Sheffield’s Department for Lifelong Learning, who is leading the study of the bodies. “We do this by identifying whether they are male or female, children or adults. And then we start to investigate the diseases that they may have lived through, such as metabolic diseases like rickets and scurvy which are degenerative diseases for the skeleton. However for diseases such as plague, which are lethal, we have to use ancient DNA analysis to investigate that further.”


News Article | December 21, 2016
Site: www.nature.com

Faced with an impending operation to remove his large intestine, Oli Adams started a desperate search for other options that might resolve his Crohn's disease and spare him surgery. Then 29, Adams was diagnosed with Crohn's when he was 23. For a decade before that — as he forged a career as a professional surfer — his fluctuating health had mystified him. He was one of few British surfers to compete in the sport's world tour, but his performance was erratic: one tournament he'd ace it, the next, feeling weak and with shaky legs, he looked like a different surfer. He thought it might be nerves or possibly that his vegetarianism was to blame. He hated the drugs he was prescribed when he was finally diagnosed — the side effects were horrendous. And for six years, Adams cycled through flare-ups and fleeting opportunities to ride waves, all the while trying to find a medication that he could tolerate and that managed his symptoms. One worked for a time, but the symptoms returned. “There's no rhyme or reason to it,” says Adams, of Crohn's. “How you're going to feel from one minute to the next, how your moods are going to be, whether you're going to be caught short ... It's embarrassing, it's painful, and at worse you're so malnourished that you are in a place you can't even describe — it's like a zone of pain, but also your brain is so in crisis that you can't really think.” Crohn's and ulcerative colitis — the two main types of inflammatory bowel disease (IBD) — are caused by a hyperactive immune system attacking the walls of the gastrointestinal tract, causing inflammation and ulceration (see page S98). But no one knows why this happens. The drugs Adams was given included decades-old steroids that suppress immune function as a whole and newer drugs that block more specific aspects of the inflammatory cascade. These drugs can be effective, but not for everybody — it's a common refrain in the IBD community that no two people's experiences are identical. When Adams's drugs stopped working and his intestine seemed to be in danger of rupturing, his doctors advised surgery. “It was like a race against time for me not to have the operation,” says Adams. And of all the avenues he could explore, “Faecal transplant was the main thing on the list.” A faecal transplant — or the preferred term, faecal microbiota therapy (FMT) — comes at IBD from the opposite direction to most drugs. Instead of assuming that the immune system is inherently faulty, whether because of genetics or environment, proponents argue that the hyperactive immune system is being provoked by something in the lumen, or interior, of the gut. The most plausible candidates are a pathogenic microorganism, a combination of such microbes or perhaps a shortage of microorganisms that lower levels of inflammation. If this is the case, changing the contents of the gut by seeding a new healthy community of microorganisms might halt the disease. Two years ago, when Adams thought FMT could be an alternative to surgery, there was nowhere in the United Kingdom that provided the treatment for those with IBD. Despite being gravely ill, Adams considered travelling to Australia to take part in a small study. But he ran out of time. When his condition deteriorated quickly, his doctors examined his intestines and feared they could burst at any moment. “I'd left it too long,” he says. “They did the operation there and then. Adams will never know if FMT would have helped his IBD. But it has become an established procedure for people with recurrent infections of the bacterium Clostridium difficile (an increasing problem owing to antibiotic resistance), and a small number of patients and gastroenterologists make enthusiastic claims about its effectiveness for IBD. But many others point to the modest results of systematic trials and urge more measured expectations. “Is there something to it? Perhaps,” says Alexander Khoruts, a gastroenterologist at the University of Minnesota in Minneapolis, who has used FMT extensively to treat C. difficile infections. “Are we anywhere close to it? No,” he says. “Is it worth pursuing? Yes. But pursuing it properly requires more than simply doing further transplants: it means knowing exactly how the procedure changes the recipient's microbiota. This information, alongside clinical observation, is necessary to truly evaluate the effects of FMT. And it may also shed light on the causes of IBD. Studies of the human microbiota — the myriad microorganisms that call our bodies home — have redefined how researchers view the contents of our gastrointestinal tracts. Scientists now know that humans co-evolved with a web of thousands of microbes: bacteria, viruses, fungi and unicellular organisms called archaea. The relationship we have with them is mutually beneficial — we provide warmth and nutrients, and they help us to digest our food, mop up toxins, make vitamins, hone our immune systems, communicate with our brains and crowd out malignant microbes such as C. difficile. To people in this field, poo ceased to be simply a repugnant by-product of human digestion years ago. FMT is based on the idea that a healthy intestinal flora can be transferred from a donor to a recipient through, as the name suggests, faecal matter. The research behind it is increasingly sophisticated, but the procedure is not. The stool of a healthy donor is blitzed with saline, filtered and then delivered to the recipient's gastrointestinal tract. Various administration routes are used: an enema or colonoscopy coming up one way, or a nasogastric tube or capsules going down the other. The latter are popularly known as 'crapsules'. As one patient told Nature, these gastrointestinal diseases are serious enough by themselves, without anyone being uptight about toilet humour. The first stool Khoruts ever transferred came from the husband of a 64-year-old woman with a recurrent C. difficile infection. When she came under his care in 2008, the patient was living in incontinence pads, passing diarrhoea every 15 minutes, night and day, and her weight had dropped by almost 30 kilograms. Fifteen months of antibiotics had got her nowhere. Needing to try something new, Khoruts found a growing body of literature that included positive case reports and small studies that convinced him FMT was worth a try. The husband's stool was delivered by colonoscopy and the patient reported feeling better while still in recovery. Khoruts recalls that after more than a year of relentless diarrhoea, she said she felt something inside beginning to feel whole again. Within two days, she had a normal bowel movement. Not only was this event transformative for the patient, but it was also a landmark for the field because Khoruts did something that those early case reports had not: with a group of microbial ecologists, he examined the DNA content of stool samples taken from the donor and the recipient before and after the transplant1. The analysis demonstrated that microorganisms from the husband's gut had colonized the patient's gut. “Suddenly,” Khoruts says, “there was some science there.” In the throes of her illness, the patient's gastrointestinal tract had been a desolate landscape, but seeded by her husband's intestinal flora, it now hosted a vigorous microbial ecosystem in which the bacteria causing the infection were unable to survive. FMT's effectiveness at treating recurrent C. difficile infections was cemented in early 2013. As part of a randomized control trial, only 7 out of 26 people receiving a control (which included the antibiotic vancomycin) recovered, but 15 out of 16 patients receiving FMT were cured. The treatment was so successful that the trial was terminated early because withholding FMT from the control group was deemed unethical2. This remarkable 94% success rate seems to be holding up, and an increasing number of physicians now use FMT to combat C. difficile. “I've become completely addicted,” Khoruts says. “I've helped 400 people like this in my own practice. We haven't charged them a penny, but I'm the richest man I know because of that feeling — saving somebody's life.” Buoyed by the effectiveness of FMT for treating C. difficile, the idea spread that any disease involving a malignant microbiota might be resolved by delivering a healthy one. IBD, in which inflammation and ulceration rage where the intestinal microbiota abuts human tissue, has long been thought to be next on the list of FMT-treatable conditions. But the reality showed that the procedure was anything but a straightforward fix and that understanding the exact role of the microbiota in disease is essential. Reports of FMT's effectiveness for IBD began in a similar way to those for C. difficile. In 1989, a gastroenterologist described how he had been in remission from his ulcerative colitis for six months following an enema of healthy stool3 (see 'Faecal attraction'). Since then, there has been a stream of anecdotal reports. No one doubts that at least some of these are valid, but whereas for C. difficile isolated accounts soon snowballed into larger studies and irrefutable clinical trials, for IBD they haven't. In 2014, gastroenterologists David Rubin and Ruben Colman both then at the University of Chicago in Illinois, reviewed case studies, small open-label investigations and a randomized controlled trial on the use of FMT to treat IBD4. They found that the studies' methodologies varied considerably: patients had varying severities and duration of IBD, and had received different numbers of transplants that had been delivered by different routes. The studies had also used different criteria to judge success — from a decrease in symptoms to a verified healing of the mucosa. Rubin and Colman concluded that FMT for ulcerative colitis — with huge variability between reports — seemed to benefit 22% of people. For Crohn's, the figure was higher, but here the studies were too limited in both quality and quantity to draw firm conclusions. The bias towards studies of ulcerative colitis rather than Crohn's stems mainly from the fact that the former affects only the colon and rectum, whereas Crohn's can affect any region of the gastrointestinal tract, including the mouth. Rubin says that their goal was to start a serious discussion about the procedure's use for IBD — and indeed, he says, “there was a signal” in the literature. The challenge now is for more controlled studies to decipher the nature of that signal. Paul Moayyedi, a gastroenterologist at McMaster University in Hamilton, Canada, has taken up that mantle. He led a randomized controlled trial for FMT in ulcerative colitis, published in 2015, in which participants received either colonic FMT or a water enema once a week for six weeks. A week after the final enema, the patients were checked for signs of colon healing. In the control group, 2 out of 37 entered remission, compared with 9 out of 38 in the FMT group, a statistically significant effect5. The 24% success rate is similar to that described by Rubin and Colman. By Moayyedi's own admission, it “needs to be a lot better”. But he also argues that this level of success is “the reality of treatments at the moment” and compares favourably with the remission rates seen with much-heralded immunosuppressant drugs. Moayyedi is now in the early stages of a second trial for FMT in ulcerative colitis. It is one of a number of larger, better controlled trials that are under way for both this disorder and Crohn's to determine the future of FMT as a treatment for IBD. It is now clear that recurrent C. difficile infection was a low-hanging fruit: a condition that is essentially tailor-made for FMT. This bacterium wreaks havoc, mainly in the bowels of people whose native microbiota has been wiped out through heavy antibiotic use. C. difficile survives because of its drug-resistant spores. But once the antibiotics have cleared, a new microbiota can easily take hold and crowd the bacterium out. No other condition is likely to be so easily bested by FMT, but the expectation is that it must be used to treat conditions caused by a pathogenic microbiota. And that the microorganisms in a healthy donor's stool must be able to colonize the recipient's gastrointestinal tract. Various studies have attempted to identify causative microbial factors for IBD by using ever more sophisticated genetic tools to examine the full suite of patients' intestinal inhabitants. Most studies have found alterations — a common conclusion is that the IBD-associated microbiota is less diverse — but frustratingly there is no consensus about which specific microbial populations are altered. More pressingly, however, these studies have been unable to determine whether these changes are pathogenic — provoking the immune system, and so causing the disease — or whether the pathological inflammation of IBD creates an intestinal environment that favours different microorganisms. Even studies showing that alterations in the microbiota correlate with disease severity, or that the microbiota normalizes with remission, fail to prove causation over correlation. This creates uncertainty over the extent to which FMT might work for IBD. It also places the procedure in an interesting position: trials of FMT might be able to unpick the riddle of cause and effect. Testing FMT is part clinical trial, part interventional clinical experiment. If installing a new microbiota works, it will be compelling evidence that the displaced microbiota had been central to generating IBD. Whereas, if symptoms persist after microbial transfer and the microbiota reverts, this will indicate that the problem lies with the immune system. A well-executed but failed trial of FMT, therefore, would offer the consolation of new insight into the mechanism of the disease. But before any of this can happen, researchers need to know whether introduced microorganisms effectively colonize the recipient's gastrointestinal tract. Without this information, it is impossible to interpret a changing or unchanging disease course. For this reason, Khoruts argues that establishing a reliable methodology should be the first goal of IBD research. “I wouldn't expect that one administration of FMT would really change the microbial community structure that much,” he says. Unlike the denuded bowels of people with a C. difficile infection, there are already microbes in the guts of people with IBD, leaving nowhere for the new arrivals to settle. “But if you do it repeatedly, there is a decent chance that you're going to have a substantial change in the microbial community,” says Khoruts. Moayyedi agrees. In his 2015 trial, DNA analysis of stool samples revealed that the microbial composition of FMT-treated participants shifted modestly towards the donor's profile after the six weekly transplants. In a second trial, set to begin next year, patients will first be given a two-week course of broad-spectrum antibiotics to make space in the gut, and then receive twice-weekly FMT for eight weeks. Moayyedi is also tweaking other aspects of the methodology in the new trial to explore signals that he noticed in the 2015 trial. All participants will receive stool from a single donor, for instance. The original trial used two main donors, A and B. Intriguingly, A's donations cured nobody, whereas B's had a 39% success rate. Disease duration is another variable that they have their eye on this time around: 3 of the 4 participants who'd had ulcerative colitis for less than 1 year responded to FMT, compared with only 6 of 34 who'd had the disease for longer. That is a lot of factors to explore, and every additional variable requires more participants and hence more funding. Rubin also wonders if there is a basic heterogeneity across IBD cases, such that a person whose disease began after a food-poisoning incident might benefit from FMT, whereas a more strongly genetic case might not. Funding large trials and sophisticated DNA analysis is challenging, especially for a treatment that, unlike a regular drug, has struggled to attract major financial investment. But this seems to be changing, as recently funded clinical trials in the United States, Australia, China and the United Kingdom indicate. One of those trials is at the University of Birmingham, UK — much closer to Adams's home. But he has no need for it now: his surgery worked and he is back out surfing again. “I feel like a completely different person,” he says. “I'm living a whole new life.” His thoughts about the therapy he was never able to try are pragmatic: “I really hope it at least gets the length it needs to be trialled properly and for a proper outcome to be obvious.


News Article | October 28, 2016
Site: www.prweb.com

Two organizations dedicated to evidence-based healthcare are joining forces to ensure that healthcare professionals can make decisions based on the best available evidence. The partnership between EBSCO Health and McMaster University’s Health Information Research Unit brings together two of the most established services that provide systematic literature surveillance to improve the effectiveness and efficiency of healthcare. McMaster University is the birthplace of evidence-based healthcare. The Health Information Research Unit was created at McMaster to study and facilitate the transfer of high quality evidence from health care research to practitioners and publishers, via McMaster Premium Literature Service. McMaster PLUS™ uses its Critical Appraisal Process to identify studies and systematic reviews that are scientifically sound. Articles from the 120 top journals that meet McMaster’s scientific criteria are then rated by frontline clinicians for relevance and newsworthiness through the McMaster Online Rating of Evidence (MORE™) system. By working with McMaster, EBSCO Health products will be uniquely empowered for continuously accessing systematically validated evidence for health care. This will complement EBSCO Health’s Evidence Validation Unit, which employs a systematic seven-step process to identify, critique, summarize and synthesize the best available evidence for clinical decision-making. EBSCO’s synthesized evidence is presented in DynaMed Plus® in an easy-to-access format so healthcare professionals can use it at the point of care to make the best evidence-based clinical decisions as quickly as possible. The evidence surveillance also informs Nursing Reference Center™, Rehabilitation Reference Center™ and Patient Education Reference Center™ to provide the best current information to professionals and patients across the health care system. McMaster and EBSCO Health will also team up to provide free updates of highly impactful evidence, organized and delivered with cutting edge technology. Currently, more than 200,000 subscribers receive recent and relevant studies that have been rated through the McMaster MORE system. With an overwhelming number of studies being published, this service allows healthcare professionals to have a resource that alerts them to the latest and best evidence in their particular field. Connecting this resource with EBSCO Health resources that provide context across healthcare will enhance the relevance and utility for these updates. EBSCO Health Senior Vice President of Medical Product Management Betsy Jones says that this partnership will promote the use of systematically validated evidence. “McMaster is well-known throughout the world for its pioneering efforts to disseminate evidence-based information. This is closely aligned with EBSCO Health’s commitment to provide the global healthcare community with the information they need to make informed decisions. The integration between the McMaster and EBSCO Heath systems of literature surveillance will ensure that users of all EBSCO Health products have rapid access to the most valid evidence for clinical care.” McMaster Industrial Liaison Office Chief, Gay Yuytung, provides the McMaster view on the agreement. “This joint venture with EBSCO provides McMaster’s Health Information Research Unit with a great opportunity to enhance generation and dissemination of health knowledge. McMaster and a world-class publisher like EBSCO can contribute very different but highly complementary components to their common goal of knowledge translation, aiming to improve the capabilities of clinicians for timely application of current best evidence for health care.” About McMaster University’s Health Information Research Unit (HiRU) HiRU was created in 1987 to study the problems in dissemination and uptake of validated health care knowledge, and to develop and test and deliver solutions to these problems. Beginning with more informative abstracts for journal articles in 1987, HiRU has created many innovations for knowledge transfer including ACP Journal Club (sponsored by the American College of Physicians), Evidence-Based Medicine (sponsored by the BMJ), and numerous internet-based “best evidence” services for clinicians, publishers, professional organizations, and others around the world. About EBSCO Health EBSCO Health, part of EBSCO Information Services, is a leading provider of clinical decision support solutions, healthcare business intelligence, and medical research information for the healthcare industry. EBSCO Health users include professionals in medicine, nursing, and allied health. Flagship products include CINAHL®, DynaMed Plus™, Nursing Reference Center™, clinical e-books and e-journals, EBSCO Discovery Service™, licensed databases (such as MEDLINE®), plus EBSCONET®. EBSCO databases are powered by EBSCOhost®, the electronic resource favored by libraries around the world.


Heating nanoparticles and atomic-level tracking allows for the development of other less expensive catalysts, such as platinum-iron nanoparticles. Typically, pricey platinum nanoparticles are used. Using advanced electron microscopic techniques the team was able to track the atomic-rearrangement process of an individual Platinum-Iron nanoparticle - as it got annealed inside the microscope. "Our work is pioneering in the application of advanced electron microscopy techniques to study the structural and compositional transformation of individual nanometer-sized particles during heating," said Gianluigi Botton, Professor of Materials Science and Engineering at McMaster University. The researchers' work on nanoparticles, which are as small as 1/50,000th of the diameter of a human hair, could have far-reaching impact on the automotive industry. With the depletion of fossil fuel reserves, there has been a surge of interest in developing alternative energy sources, particularly in the area of fuel cell technology. Fuel cell devices can power vehicles by converting chemical energy into electrical energy in a far more efficient and environmentally-friendly way than the conventional combustion technologies. However, they rely on catalysts to operate and reducing catalyst-cost is crucial for commercialization. McMaster's research team comprising of Sagar Prabhudev (Materials Science and Engineering PhD Student), Dr. Matthieu Bugnet (Post-doctoral researcher) and Botton carried out their work in collaboration with Dr. Christina Bock (NRC, Ottawa) and Dr. Guozhen Zhu (Shanghai Jiao Tong University, China). "Imagine that you placed millions of nanoparticles on a pan and started heating," said Prabhudev. "During the course of heating, you select one of the particles. And, with the help of a powerful microscope, watch the atoms move. That is the equivalent to what we have done." A Titan 80-300 cubed microscope at McMaster's Canadian Center for Electron Microscopy (CCEM) was used for the research. "In terms of capability, Titan electron microscope is similar to the Hubble Telescope. The difference is that the Titan allows us to explore atomic structure of materials, instead of stars and galaxies," said Botton, also the Scientific Director of CCEM. "This includes identifying atoms, measuring their chemical state and even probing the electrons that bind atoms together." The researchers point out that the insights obtained were previously inaccessible with traditional analytical methods. More information: Sagar Prabhudev et al. Surface Segregation of Fe in Pt-Fe Alloy Nanoparticles: Its Precedence and Effect on the Ordered-Phase Evolution during Thermal Annealing, ChemCatChem (2015). DOI: 10.1002/cctc.201500380


News Article | December 21, 2015
Site: www.nanotech-now.com

Abstract: Researchers from McMaster University in Hamilton, Ont., have taken atomic-level images of individual nanoparticles during heating that could lead to improved fuel-cell technologies at lower cost, reduce dependence on imported oil and minimize greenhouse gas emissions. Heating nanoparticles and atomic-level tracking allows for the development of other less expensive catalysts, such as platinum-iron nanoparticles. Typically, pricey platinum nanoparticles are used. Using advanced electron microscopic techniques the team was able to track the atomic-rearrangement process of an individual Platinum-Iron nanoparticle - as it got annealed inside the microscope. "Our work is pioneering in the application of advanced electron microscopy techniques to study the structural and compositional transformation of individual nanometer-sized particles during heating," said Gianluigi Botton, Professor of Materials Science and Engineering at McMaster University. The researchers' work on nanoparticles, which are as small as 1/50,000th of the diameter of a human hair, could have far-reaching impact on the automotive industry. With the depletion of fossil fuel reserves, there has been a surge of interest in developing alternative energy sources, particularly in the area of fuel cell technology. Fuel cell devices can power vehicles by converting chemical energy into electrical energy in a far more efficient and environmentally-friendly way than the conventional combustion technologies. However, they rely on catalysts to operate and reducing catalyst-cost is crucial for commercialization. McMaster's research team comprising of Sagar Prabhudev (Materials Science and Engineering PhD Student), Dr. Matthieu Bugnet (Post-doctoral researcher) and Botton carried out their work in collaboration with Dr. Christina Bock (NRC, Ottawa) and Dr. Guozhen Zhu (Shanghai Jiao Tong University, China). "Imagine that you placed millions of nanoparticles on a pan and started heating," said Prabhudev. "During the course of heating, you select one of the particles. And, with the help of a powerful microscope, watch the atoms move. That is the equivalent to what we have done." A Titan 80-300 cubed microscope at McMaster's Canadian Center for Electron Microscopy (CCEM) was used for the research. "In terms of capability, Titan electron microscope is similar to the Hubble Telescope. The difference is that the Titan allows us to explore atomic structure of materials, instead of stars and galaxies," said Botton, also the Scientific Director of CCEM. "This includes identifying atoms, measuring their chemical state and even probing the electrons that bind atoms together." The researchers point out that the insights obtained were previously inaccessible with traditional analytical methods. ### The work was carried out with financial support from NSERC (Discovery and Strategic grants), Automotive Partnership Canada (APC) (Carpe-FC grant) and McMaster University. For more information, please click If you have a comment, please us. Issuers of news releases, not 7th Wave, Inc. or Nanotechnology Now, are solely responsible for the accuracy of the content.


Woody E.Z.,University of Waterloo | Szechtman H.,McMaster University
Frontiers in Human Neuroscience | Year: 2013

Research indicates that there is a specially adapted, hard-wired brain circuit, the security motivation system, which evolved to manage potential threats, such as the possibility of contamination or predation. The existence of this system may have important implications for policy-making related to security. The system is sensitive to partial, uncertain cues of potential danger, detection of which activates a persistent, potent motivational state of wariness or anxiety. This state motivates behaviors to probe the potential danger, such as checking, and to correct for it, such as washing. Engagement in these behaviors serves as the terminating feedback for the activation of the system. Because security motivation theory makes predictions about what kinds of stimuli activate security motivation and what conditions terminate it, the theory may have applications both in understanding how policy-makers can best influence others, such as the public, and also in understanding the behavior of policy-makers themselves. © 2013 Woody and Szechtman.


Rheinstadter M.C.,McMaster University | Rheinstadter M.C.,University of Southern Denmark | Mouritsen O.G.,National Research Council Canada
Current Opinion in Colloid and Interface Science | Year: 2013

Cholesterol is the single most abundant molecule in animal plasma membranes, in the range of 20-30. mol%, where it is known to modulate the lipid-bilayer component of the membrane and lead to increased mechanical stability, lower permeability, larger thickness, and a distinct lateral organization. The phase equilibria of membranes with cholesterol and the associated large- and small-scale structure have turned out to be a particularly elusive problem. With the proposal that lipid domains and so-called 'rafts', characterized by high local levels of cholesterol in a liquid-ordered phase, are important for a wide range of cellular functions, an understanding and a quantitative assessment of the nature of these cholesterol-induced structures and their types of ordering have become urgent. Recent progress in neutron diffraction studies of lipid-cholesterol model membranes has now revealed details of the lateral ordering, and combined with earlier molecular model studies a picture emerges of the membrane as a locally structured liquid with small ordered 'domains' of a highly dynamic nature. © 2013 Elsevier Ltd.


Archer N.,McMaster University | Cocosila M.,Athabasca University
Journal of Medical Internet Research | Year: 2011

Background: There is a major campaign involving large expenditures of public money to increase the adoption rate of electronic health record (EHR) systems in Canada. To maximize the chances of success in this effort, physician views on EHRs must be addressed, since user perceptions are key to successful implementation of technology innovations. Objective: We propose a theoretical model comprising behavioral factors either favoring or against EHR adoption and use in Canadian medical practices, from the physicians' point of view. EHR perceptions of physicians already using EHR systems are compared with those not using one, through the lens of this model. Methods: We conducted an online cross-sectional survey in both English and French among medical practitioners across Canada. Data were collected both from physicians using EHRs and those not using EHRs, and analyzed with structural equation modeling (SEM) techniques. Results: We collected 119 responses from EHR users and 100 from nonusers, resulting in 2 valid samples of 102 and 83 participants, respectively. The theoretical adoption model explained 55.8% of the variance in behavioral intention to continue using EHRs for physicians already using them, and 66.8% of the variance in nonuser intention to adopt such systems. Perception of ease of use was found to be the strongest motivator for EHR users (total effect .525), while perceptions of usefulness and of ease of use were the key determinants for nonusers (total effect .538 and .519, respectively) to adopt the system. Users see perceived overall risk associated with EHR adoption as a major obstacle (total effect -.371), while nonusers perceive risk only as a weak indirect demotivator. Of the 13 paths of the SEM model, 5 showed significant differences between the 2 samples (at the .05 level): general doubts about using the system (P = .02), the necessity for the system to be relevant for their job (P < .001), and the necessity for the system to be useful (P = .049) are more important for EHR nonusers than for users, while perceptions of overall obstacles to adoption (P = .03) and system ease of use (P = .042) count more for EHR users than for nonusers. Conclusions: Relatively few differences in perceptions about EHR system adoption and use exist between physicians already using such systems and those not yet using the systems. To maximize the chances of success for new EHR implementations from a behavioral point of view, general doubts about the rationale for such systems must be mitigated through improving design, stressing how EHRs are relevant to physician jobs, and providing substantiating evidence that EHRs are easier to use and more effective than nonusers might expect.


Baumchen O.,McMaster University | McGraw J.D.,McMaster University | Forrest J.A.,University of Waterloo | Dalnoki-Veress K.,McMaster University
Physical Review Letters | Year: 2012

We have examined the direct effect of manipulating the number of free surfaces on the measured glass transition temperature T g of thin polystyrene films. Thin films in the range 35nm


Bates D.,University of Wisconsin - Madison | Machler M.,ETH Zurich | Bolker B.M.,McMaster University | Walker S.C.,McMaster University
Journal of Statistical Software | Year: 2015

Maximum likelihood or restricted maximum likelihood (REML) estimates of the parameters in linear mixed-effects models can be determined using the lmer function in the lme4 package for R. As for most model-fitting functions in R, the model is described in an lmer call by a formula, in this case including both fixed- and random-effects terms. The formula and data together determine a numerical representation of the model from which the profiled deviance or the profiled REML criterion can be evaluated as a function of some of the model parameters. The appropriate criterion is optimized, using one of the constrained optimization functions in R, to provide the parameter estimates. We describe the structure of the model, the steps in evaluating the profiled deviance or REML criterion, and the structure of classes or types that represents such a model. Sufficient detail is included to allow specialization of these structures by users who wish to write functions to fit specialized linear mixed models, such as models incorporating pedigrees or smoothing splines, that are not easily expressible in the formula language used by lmer. © 2015, American Statistical Association. All rights reserved.


Prabhudev S.,McMaster University | Bugnet M.,McMaster University | Bock C.,National Research Council Canada | Botton G.A.,McMaster University
ACS Nano | Year: 2013

Fine-tuning nanocatalysts to enhance their catalytic activity and durability is crucial to commercialize proton exchange membrane fuel cells. The structural ordering and time evolution of ordered Pt3Fe2 intermetallic core-shell nanocatalysts for the oxygen reduction reaction that exhibit increased mass activity (228%) and an enhanced catalytic activity (155%) compared to Pt/C has been quantified using aberration-corrected scanning transmission electron microscopy. These catalysts were found to exhibit a static core-dynamic shell regime wherein, despite treating over 10 000 cycles, there is negligible decrease (9%) in catalytic activity and the ordered Pt 3Fe2 core remained virtually intact while the Pt shell suffered a continuous enrichment. The existence of this regime was further confirmed by X-ray diffraction and the compositional analyses using energy-dispersive spectroscopy. With atomic-scale two-dimensional (2-D) surface relaxation mapping, we demonstrate that the Pt atoms on the surface are slightly relaxed with respect to bulk. The cycled nanocatalysts were found to exhibit a greater surface relaxation compared to noncycled catalysts. With 2-D lattice strain mapping, we show that the particle was about -3% strained with respect to pure Pt. While the observed enhancement in their activity is ascribed to such a strained lattice, our findings on the degradation kinetics establish that their extended catalytic durability is attributable to a sustained atomic order. © 2013 American Chemical Society.


Harris W.E.,McMaster University | Harris G.L.H.,University of Waterloo | Alessi M.,McMaster University
Astrophysical Journal | Year: 2013

We present a catalog of 422 galaxies with published measurements of their globular cluster (GC) populations. Of these, 248 are E galaxies, 93 are S0 galaxies, and 81 are spirals or irregulars. Among various correlations of the total number of GCs with other global galaxy properties, we find that N GC correlates well though nonlinearly with the dynamical mass of the galaxy bulge , where σe is the central velocity dispersion and Re the effective radius of the galaxy light profile. We also present updated versions of the GC specific frequency SN and specific mass S M versus host galaxy luminosity and baryonic mass. These graphs exhibit the previously known U-shape: highest SN or SM values occur for either dwarfs or supergiants, but in the midrange of galaxy size (109-1010 L ·) the GC numbers fall along a well-defined baseline value of SN ≃ 1 or SM = 0.1, similar among all galaxy types. Along with other recent discussions, we suggest that this trend may represent the effects of feedback, which systematically inhibited early star formation at either very low or very high galaxy mass, but which had its minimum effect for intermediate masses. Our results strongly reinforce recent proposals that GC formation efficiency appears to be most nearly proportional to the galaxy halo mass Mhalo. The mean "absolute" efficiency ratio for GC formation that we derive from the catalog data is M GCS/M halo = 6 × 10-5. We suggest that the galaxy-to-galaxy scatter around this mean value may arise in part because of differences in the relative timing of GC formation versus field-star formation. Finally, we find that an excellent empirical predictor of total GC population for galaxies of all luminosities is NGC (Re σe )1.3, a result consistent with fundamental plane scaling relations. © 2013. The American Astronomical Society. All rights reserved.


Puri I.K.,McMaster University | Ganguly R.,Jadavpur University
Annual Review of Fluid Mechanics | Year: 2014

Iron oxide magnetic nanoparticles, in ferrofluids or as magnetic microspheres, offer magnetic maneuverability, biochemical surface functionalization, and magnetic relaxation under the influence of an alternating field. The use of these properties for clinical applications requires an understanding of particles, forces, and scalar transport at various length scales. This review explains the behavior of magnetic nano- and microparticles during magnetic drug targeting and magnetic fluid hyperthermia, and the microfluidic transport of these particles in bioMEMS (biomedical microelectromechanical systems) devices for ex vivo therapeutic and diagnostic applications. Magnetic particle transport, the momentum interaction of these particles with a host fluid in a flow, and thermal transport in a particle-infused tissue are characterized through the governing electrodynamic, hydrodynamic, and scalar transport equations. Copyright © 2014 by Annual Reviews. All rights reserved.


Marie C.,French National Center for Scientific Research | Marie C.,McMaster University | Kujala T.,University of Helsinki | Besson M.,French National Center for Scientific Research
Cortex | Year: 2012

The aim of this experiment was two-fold. Our first goal was to determine whether linguistic expertise influences the pre-attentive [as reflected by the Mismatch Negativity - (MMN)] and the attentive processing (as reflected by behavioural discrimination accuracy) of non-speech, harmonic sounds. The second was to directly compare the effects of linguistic and musical expertise. To this end, we compared non-musician native speakers of a quantity language, Finnish, in which duration is a phonemically contrastive cue, with French musicians and French non-musicians. Results revealed that pre-attentive and attentive processing of duration deviants was enhanced in Finn non-musicians and French musicians compared to French non-musicians. By contrast, MMN in French musicians was larger than in both Finns and French non-musicians for frequency deviants, whereas no between-group differences were found for intensity deviants. By showing similar effects of linguistic and musical expertise, these results argue in favor of common processing of duration in music and speech. © 2010 Elsevier Srl.


Balakrishnan N.,McMaster University | Kundu D.,Indian Institute of Technology Kanpur
Computational Statistics and Data Analysis | Year: 2013

A hybrid censoring scheme is a mixture of Type-I and Type-II censoring schemes. In this review, we first discuss Type-I and Type-II hybrid censoring schemes and associated inferential issues. Next, we present details on developments regarding generalized hybrid censoring and unified hybrid censoring schemes that have been introduced in the literature. Hybrid censoring schemes have been adopted in competing risks set-up and in step-stress modeling and these results are outlined next. Recently, two new censoring schemes, viz.; progressive hybrid censoring and adaptive progressive censoring schemes have been introduced in the literature. We discuss these censoring schemes and describe inferential methods based on them, and point out their advantages and disadvantages. Determining an optimal hybrid censoring scheme is an important design problem, and we shed some light on this issue as well. Finally, we present some examples to illustrate some of the results described here. Throughout the article, we mention some open problems and suggest some possible future work for the benefit of readers interested in this area of research. © 2012 Elsevier B.V. All rights reserved.


Gardner J.S.,U.S. National Institute of Standards and Technology | Gardner J.S.,Indiana University | Gingras M.J.P.,University of Waterloo | Gingras M.J.P.,Canadian Institute for Advanced Research | Greedan J.E.,McMaster University
Reviews of Modern Physics | Year: 2010

Within the past 20 years or so, there has occurred an explosion of interest in the magnetic behavior of pyrochlore oxides of the type A2 3+ B2 4+ O7, where A is a rare-earth ion and B is usually a transition metal. Both the A and B sites form a network of corner-sharing tetrahedra which is the quintessential framework for a geometrically frustrated magnet. In these systems the natural tendency to form long-range ordered ground states in accord with the third law of thermodynamics is frustrated, resulting in some novel short-range ordered alternatives, such as spin glasses, spin ices, and spin liquids, and much new physics. This article attempts to review the myriad of properties found in pyrochlore oxides, mainly from a materials perspective, but with an appropriate theoretical context. © 2010 The American Physical Society.


Harris G.L.H.,University of Waterloo | Harris W.E.,McMaster University
Monthly Notices of the Royal Astronomical Society | Year: 2011

We explore the relation between the total globular population in a galaxy (NGC) and the mass of its central black hole (M•). Using a sample of 33 galaxies, twice as large as the original sample discussed by Burkert & Tremaine (2010), we find that NGC for elliptical and spiral galaxies increases in almost precisely direct proportion to M•. The S0-type galaxies by contrast do not follow a clear trend, showing large scatter in M• at a given NGC. After accounting for observational measurement uncertainty, we find that the mean relation defined by the E and S galaxies must also have an intrinsic or 'cosmic' scatter of ±0.2 in either log NGC or log M•. The residuals from this correlation show no trend with globular cluster specific frequency. We suggest that these two types of galaxy subsystems (central black hole and globular cluster system) may be closely correlated because they both originated at high redshift during the main epoch of hierarchical merging, and both require extremely high-density conditions for formation. Lastly, we note that roughly 10 per cent of the galaxies in our sample (one E, one S and two S0) deviate strongly from the main trend, all in the sense that their M• is at least 10 times smaller than would be predicted by the mean relation. © 2010 The Authors. Journal compilation © 2010 RAS.


News Article | October 10, 2016
Site: www.techtimes.com

Exercise is known to have stress-busting benefits. Physical activity boosts the production of the brain's feel-good neurotransmitters known as endorphins. In one study, researchers found that exercise can also help improve memory problems related to stress in breast cancer survivors. Findings of a new research, however, revealed that while exercise can help relieve stress and is generally beneficial to physical health, doing heavy exercise may not be a good idea when you are emotionally upset. Researchers found that doing hard workouts when you are angry can increase the risk for potentially deadly heart attack. In a large international study published in the journal Circulation on Oct. 11, researchers found that feeling intense anger while working out was associated with more than threefold increased risk for heart attack within the hour. Study researcher Andrew Smyth, from McMaster University in Canada, and colleagues also looked at emotional stress and exercise individually to see if each of these factors would influence heart attack risk on their own. They discovered that emotional stress alone or exercise alone can more than double a person's likelihood of having a heart attack within the hour. "We explored the triggering association of acute physical activity and anger or emotional upset with acute myocardial infarction to quantify the importance of these potential triggers in a large, international population," Smyth and colleagues wrote in their study. "Physical exertion and anger or emotional upset are triggers associated with first AMI in all regions of the world, in men and women, and in all age groups, with no significant effect modifiers." Smyth explained that extreme physical and emotional triggers are believed to have similar effects on the body. Both, for instance, increase heart rate and blood pressure, which can alter the flow of blood in blood vessels and reduce blood supply to the heart. The risk is particularly more concerning in those whose blood vessels are already narrowed by plaque that can block blood flow and lead to a heart attack. Based on their findings, the researchers recommended that those who are upset or angry who want to blow off steam by exercising to not go beyond their normal routine of physical activity. Barry Jacobs, from the American Heart Association who was not involved in the study, said that other than going for heavy exercise, there are several ways people can deal with their emotions such as through breathing and relaxation exercises as well as anger management programs and meditation. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | December 19, 2016
Site: www.marketwired.com

Many Canadian small- and medium-sized manufacturers delay adopting new technology, because of the risk of making large, upfront investments without first testing their innovations. By investing in a new advanced manufacturing network in the Golden Horseshoe, the Government of Canada will help Canadian manufacturers address this challenge and speed up technology adoption. Today, Vance Badawey, Member of Parliament for Niagara Centre, on behalf of the Honourable Navdeep Bains, Minister of Innovation, Science and Economic Development and Minister responsible for FedDev Ontario, announced a contribution of up to $7.3 million to Niagara College. This non-repayable contribution, through the Investing in Commercialization Partnerships Initiative, will help Niagara College to create the Southern Ontario Network for Advanced Manufacturing and Innovation (SONAMI), in partnership with Mohawk College, Sheridan College and McMaster University. SONAMI will offer a "single-window" approach to supporting manufacturers' research and development needs, encouraging them to adopt and integrate disruptive advanced manufacturing technologies into their operations with the help of the network. The project is expected to create or maintain 186 high-quality jobs, result in 170 new prototypes and up to 85 new products being commercialized. It will also provide opportunities for students from the SONAMI partner institutions to prepare for the manufacturing jobs of tomorrow. The Government's Innovation Agenda aims to make Canada a global centre for innovation - one that creates jobs, drives growth across all industries and improves the lives of all Canadians. This investment is an example of that idea in action. "The Government of Canada is committed to supporting innovation and competitiveness on a global scale. This means connecting our manufacturers to the tools they need to succeed and compete. This project exemplifies the type of collaboration between business, academia, research institutions and government that we need to foster innovation." - The Honourable Navdeep Bains, Minister of Innovation, Science and Economic Development and Minister Responsible for FedDev Ontario "Today's announcement is a great example of how our region is coming together to create unique partnerships and keep jobs local. I'm proud of the benefits that this network will have for helping our businesses access the tools and talent they need to succeed now, as well as training the workforce of the future." "We at Niagara College are proud to be the leaders of this unprecedented network, which will be a key resource and fill a demonstrated need for small- and medium-sized businesses in the Golden Horseshoe. According to recent research in southern Ontario, there are more than 6,500 manufacturers; nearly 4,000 of them have fewer than 10 employees." "Fostering collaboration and strengthening partnerships are a strategic priority for Mohawk. We're proud to join the Southern Ontario Network for Advanced Manufacturing and Innovation and we look forward to putting our technology students to work in helping industry partners bring innovative solutions to market." "Through our Centre for Advanced Manufacturing and Design Technologies, Sheridan brings a breadth of expertise to SONAMI in the areas of additive manufacturing, sustainable energy systems, robotics and automation. By combining our strengths with our partner educational institutions, SONAMI will deliver compelling value to industry while advancing economic growth in the Golden Horseshoe." "This unique partnership provides an opportunity for McMaster to lend its expertise in helping small, regional companies develop innovative manufacturing processes. We look forward to working with Niagara College, Mohawk and Sheridan to prepare Canadian companies to take their products to market and help them compete on a global stage. Backgrounder: FedDev Ontario Invests in Manufacturing Innovation in the Golden Horseshoe Subscribe to our news updates and follow us on Twitter @FedDevOntario FedDev Ontario Invests in Manufacturing Innovation in the Golden Horseshoe About the Southern Ontario Network for Advanced Manufacturing and Innovation While any member of the network can lead a project in the areas of additive manufacturing, flexible manufacturing and tooling adoption for advanced materials, each has a main area of focus: Niagara College of Applied Arts and Technology specializes in applied learning and research and innovation and is known for its strengths in advanced manufacturing. With 9,000 full-time students, Niagara College offers over 100 programs, including its Winery and Viticulture Technician Program, which received the Pinnacle Award from the International Festival and Events Association, for best supplier of graduates to the tourism industry. It was also awarded Best Program in Canada 2004 by the Association of Canadian Community Colleges. For more information, visit the Niagara College website. The ICP supports business-led partnerships with a focus on developing globally-competitive products and services, or innovation platforms that can demonstrate commercial value. Post-secondary institutions and incorporated not-for-profit organizations, publicly-funded colleges and universities, research institutions, and industry associations located in southern Ontario are eligible to apply under this initiative for projects that are business-led and focus on new technologies or platforms with demonstrated commercial value. For more information, visit the Investing in Commercialization Partnerships webpage. News release: FedDev Ontario Invests in Manufacturing Innovation in the Golden Horseshoe


News Article | March 1, 2017
Site: www.eurekalert.org

Hamilton, ON (March 1, 2017) - Research from McMaster University has found that bacteria in the gut impacts both intestinal and behavioural symptoms in patients suffering from irritable bowel syndrome (IBS), a finding which could lead to new microbiota-directed treatments. The new study, published today in Science Translational Medicine, was led by researchers from the Farncombe Family Digestive Health Research Institute at McMaster, Drs. Premysl Bercik and Stephen Collins, in collaboration with researchers from the University of Waterloo. IBS is the most common gastrointestinal disorder in the world. It affects the large intestine and patients suffer from abdominal pain and altered bowel habits like diarrhea and constipation, which are often accompanied by chronic anxiety or depression. Current treatments aimed at improving symptoms have limited efficacy because the underlying causes are unknown. The goal of the study was to explore whether fecal microbiota from human IBS patients with diarrhea has the ability to influence gut and brain function in recipient mice. Using fecal transplants, researchers transferred microbiota from IBS patients with or without anxiety into germ-free mice. The mice went on to develop changes both in intestinal function and behavior reminiscent of the donor IBS patients, compared to mice that were transplanted with microbiota from healthy individuals. The researchers found that aspects of the illness that were impacted through fecal transplants included gastrointestinal transit (the time it takes for food to leave the stomach and travel through the intestine); intestinal barrier dysfunction; low grade inflammation; and anxiety-like behaviour. "This is a landmark study because it moves the field beyond a simple association, and towards evidence that changes in the microbiota impact both intestinal and behavioral responses in IBS," said Giada De Palma, the study's first author and research associate with the Farncombe Family Digestive Health Research Institute. "Our findings provide the basis for developing therapies aimed at the intestinal microbiota, and for finding biomarkers for the diagnosis of IBS," said Premysl Bercik, the study's lead author and Associate Professor of Medicine at McMaster University. The authors conclude that their findings raise the possibility that "microbiota-directed therapies, including pre- or probiotic treatment, may be beneficial in treating not only intestinal symptoms but also components of the behavioural manifestations of IBS." Interestingly, the authors noted that since the study showed that microbiota in the gut can influence the brain, it "adds to evidence suggesting that the intestinal microbiota may play some role in the spectrum of brain disorders ranging from mood or anxiety to other problems that may include autism, Parkinson's disease and multiple sclerosis." However, they added that further work is required to better define the relationship in these conditions. This study was supported by grants from CIHR and Nestle Switzerland.


News Article | December 19, 2016
Site: www.marketwired.com

WELLAND, ONTARIO--(Marketwired - 19 déc. 2016) - Agence fédérale de développement économique pour le Sud de l'Ontario (Feddev Ontario) De nombreux fabricants canadiens, notamment de petites et moyennes entreprises, retardent l'adoption d'une nouvelle technologie en raison du risque de faire des investissements initiaux sans mettre à l'essai d'abord leurs innovations. En investissant dans un nouveau réseau du secteur de fabrication de pointe dans la région du Golden Horseshoe, le gouvernement du Canada aidera les fabricants canadiens à relever ce défi et à accélérer l'adoption d'une technologie. Aujourd'hui, Vance Badawey, député de Niagara-Nord, au nom de l'honorable Navdeep Bains, ministre de l'Innovation, des Sciences et du Développement économique et ministre responsable de FedDev Ontario, a annoncé une contribution pouvant atteindre 7,3 millions de dollars à l'attention du Niagara College. Cette contribution non remboursable, effectuée dans le cadre de l'initiative Investir dans les partenariats de commercialisation, aidera le Niagara College à créer le réseau du Sud de l'Ontario pour la fabrication de pointe et l'innovation, nommé Southern Ontario Network for Advanced Manufacturing and Innovation (SONAMI), en partenariat avec le Mohawk College, Sheridan College et la McMaster University. Le réseau SONAMI offrira une approche de « guichet unique » à l'appui des besoins en recherche et en développement des fabricants, en les encourageant à adopter et à intégrer des technologies de fabrication de pointe perturbatrices à leurs activités avec l'aide du réseau. Le projet devrait créer ou maintenir 186 emplois de haute qualité, ce qui se traduira par 170 nouveaux prototypes et jusqu'à 85 nouveaux produits pouvant être commercialisés. De plus, il donnera l'occasion aux étudiants des établissements d'enseignement partenaires du réseau SONAMI de se préparer aux emplois futurs dans le domaine de la fabrication. Le Programme d'innovation du Canada du gouvernement vise à faire du Canada un centre mondial de l'innovation - un centre qui crée des emplois, favorise la croissance de toutes les industries et améliore les vies de tous les Canadiens. Cet investissement est un exemple des mesures prises pour concrétiser cette idée. « Le gouvernement du Canada s'est engagé à soutenir l'innovation et la compétitivité à l'échelle internationale. Cet engagement permet à nos fabricants d'accéder aux outils dont ils ont besoin pour réussir et être concurrentiels. Ce projet est un exemple du type de collaboration entre les entreprises, le milieu universitaire, les institutions de recherche et le gouvernement dont nous avons besoin pour favoriser l'innovation ». - L'honorable Navdeep Bains, ministre de l'Innovation, des Sciences et du Développement économique et ministre responsable de FedDev Ontario. « L'annonce d'aujourd'hui est un excellent exemple de la façon dont notre région s'unit afin de créer des partenariats uniques et conserver les emplois localement. Je suis fier des avantages que ce réseau procurera à nos entreprises afin de les aider à accéder aux outils et au talent dont elles ont besoin pour réussir dès aujourd'hui et former la main-d'œuvre de l'avenir ». « Au Niagara College, nous sommes fiers d'être les leaders de ce réseau sans précédent, qui constituera une ressource clé et qui comblera un besoin avéré des petites et moyennes entreprises de la région du Golden Horseshoe. Selon des recherches récentes réalisées dans le Sud de l'Ontario, il existe plus de 6 500 fabricants, dont 4 000 compte moins de 10 employés. » « Favoriser la collaboration et renforcer des partenariats représentent une priorité stratégique pour le Mohawk College. Nous sommes fiers de nous joindre au réseau Southern Ontario Network for Advanced Manufacturing and Innovation et nous espérons mettre notre technologie au profit de nos étudiants en technologie pour qu'ils travaillent à aider les partenaires de l'industrie à lancer des solutions innovatrices sur le marché. » « Par l'intermédiaire de notre centre des technologies de fabrication de pointe et de conception, le Sheridan College étend son expertise au réseau SONAMI dans les domaines de la fabrication additive, des systèmes d'énergie durable, de la robotique et de l'automatisation. En combinant nos forces avec nos établissements d'enseignement partenaires, le réseau SONAMI apportera une valeur convaincante à l'industrie, tout en favorisant la croissance économique dans la région du Golden Horseshoe. » « Ce partenariat unique donne l'occasion à la McMaster University de prêter son expertise afin d'aider les petites entreprises régionales qui développent des procédés de fabrication novateurs. Nous anticipons avec plaisir de travailler avec le Niagara College, le Mohawk College et le Sheridan College afin de préparer les entreprises canadiennes à lancer leurs produits sur le marché et les aider à affronter la concurrence d'autres pays sur le marché mondial. - Stephen Veldhuis, professeur, Département du génie mécanique, et directeur, McMaster Manufacturing Research Institute Document d'information : FedDev Ontario investit dans l'innovation manufacturière dans la région du Golden Horseshoe Inscrivez-vous à nos bulletins de nouvelles et suivez-nous sur Twitter @FedDev_Ontario FedDev Ontario investit dans l'innovation manufacturière dans la région du Golden Horseshoe À propos du réseau du Sud de l'Ontario pour la fabrication de pointe et l'innovation, nommé Southern Ontario Network for Advanced Manufacturing and Innovation Bien que n'importe quel membre du réseau puisse mener un projet dans les domaines de la fabrication additive, de l'adoption de la fabrication et de l'outillage informatisés pour les matériaux de pointe, chacun a son principal domaine d'intérêt : Le Niagara College of Applied Arts and Technology se spécialise dans l'apprentissage appliqué et dans la recherche et l'innovation et est reconnu dans le domaine de la fabrication de pointe. Comptant 9 000 étudiants à temps plein, le Niagara College offre plus de 100 programmes, dont son programme de technicien en vinerie et en viticulture, qui a reçu le prix Pinnacle de l'Association internationale des festivals et des événements, pour être le meilleur fournisseur de diplômés à l'industrie du tourisme. Il a été aussi proclamé le « meilleur programme au Canada » en 2004 par l'Association des collèges communautaires du Canada. Pour de plus amples renseignements, visitez le site Web du Niagara College (en anglais seulement). FedDev Ontario investit dans l'initiative Investir dans des partenariats de commercialisation (IPC) L'initiative IPC appuie les partenariats menés par les entreprises en mettant l'accent sur l'élaboration de produits et services dans les marchés mondiaux, ou des plateformes d'innovation pouvant démontrer une valeur commerciale. Les établissements d'enseignement postsecondaires et les organismes à but non lucratif constitués en société, les collèges et les universités financés par l'État, les établissements de recherche et les associations de l'industrie situés dans le Sud de l'Ontario peuvent présenter une demande de financement dans le cadre de cette initiative pour des projets menés par des entreprises et axés sur de nouvelles technologies ou plateformes dont la valeur commerciale a été démontrée. Pour de plus amples renseignements, visitez la page Web de l'initiative Investir dans des partenariats de commercialisation. Communiqué de presse : FedDev Ontario investit dans l'innovation manufacturière dans la région du Golden Horseshoe


News Article | December 23, 2016
Site: www.accesswire.com

VANCOUVER, BC / ACCESSWIRE / December 23, 2016 / CanAlaska Uranium Ltd. (TSXV: CVV) (OTCQB: CVVUF) (FSE: DH7N) has received notice from De Beers for the termination of the West Athabasca project option. De Beers' exploration team has interpreted the 85 large magnetic anomalies scattered across the claims to be most likely associated with magnetic minerals within organic material in the overburden. To view an enhanced version of Figure 1, please visit: https://www.accesswire.com/uploads/CanAlaska1-12.23.16.jpg De Beers' drill program in September 2016 tested seven magnetic targets accessible before winter, located mostly in the southern claim groups. At five sites, the drill holes intercepted magnetic material within the organic overburden, unconsolidated sand and boulders, followed by sandstone. At one drill site, the overburden was not collected, but the sandstone intercepted did not explain the associated magnetic anomaly. One drill hole intercepted overburden consisting of peat, unconsolidated sands and boulders, followed by sandstone, and a thin diabase sill, which may explain the anomaly. To view an enhanced version of Figure 2, please visit: https://www.accesswire.com/uploads/CanAlaska2-12.23.16.jpg It is highly unusual to encounter such magnetic material in organic overburden. Samples from this material were sent to Saskatchewan Research Council (SRC) and McMaster University for analysis and review. There is some scientific literature that details bacterial production of magnetic material under certain conditions. Although the Western Athabasca Basin has the right geological and structural setting for the presence of diamondiferous kimberlite, De Beers decided not to continue drilling and, under the terms of the Option Agreement, have returned 100% of the project to CanAlaska. CanAlaska President Peter Dasler commented, "I am very pleased with the excellent relationship we have developed with De Beers through this project. The Western Athabasca merits exploration for diamonds and we will now concentrate on evaluating several of the more interesting magnetic anomalies within the remaining 78 targets that CanAlaska does not believe are related to magnetic organic material. The series of positive and negative (reverse) magnetic responses that are evident from the recent airborne surveys on our nearby properties, specifically West Carswell and Alberta, would not be caused by similar organic material. CanAlaska is currently marketing its Alberta property to third parties to explore for diamonds, and with the return of 100% of the West Athabasca project, we expect that there will be parties that will wish to help us test the remaining targets." In other news, CanAlaska has received correspondence from Cameco Corporation in relation to the West McArthur uranium project; Cameco expects to be able to provide a 2017 exploration program and budget by January 31, 2017. CanAlaska Uranium Ltd. (TSXV: CVV) (OTCQB: CVVUF) (FSE: DH7N) holds interests in approximately 500,000 hectares (1.2 million acres), one of the largest land positions in Canada's Athabasca Basin region - the "Saudi Arabia of Uranium." CanAlaska's strategic holdings have attracted major international mining companies Cameco, Denison, KORES, and KEPCO. CanAlaska is a project generator positioned for discovery success in the world's richest uranium district. For further information visit www.canalaska.com. The qualified technical person for this news release is Dr Karl Schimann, P. Geo, VP Exploration, for CanAlaska. On behalf of the Board of Directors Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. All statements included in this press release that address activities, events, or developments that the Company expects, believes, or anticipates will or may occur in the future are forward-looking statements. These forward-looking statements involve numerous assumptions made by the Company based on its experience, perception of historical trends, current conditions, expected future developments, and other factors it believes are appropriate in the circumstances. In addition, these statements involve substantial known and unknown risks and uncertainties that contribute to the possibility that the predictions, forecasts, projections, and other forward-looking statements will prove inaccurate, certain of which are beyond the Company's control. Readers should not place undue reliance on forward-looking statements. Except as required by law, the Company does not intend to revise or update these forward-looking statements after the date hereof or revise them to reflect the occurrence of future unanticipated events.


News Article | December 23, 2016
Site: marketersmedia.com

CVV) (OTCQB: CVVUF) (FSE: DH7N) has received notice from De Beers for the termination of the West Athabasca project option. De Beers' exploration team has interpreted the 85 large magnetic anomalies scattered across the claims to be most likely associated with magnetic minerals within organic material in the overburden. To view an enhanced version of Figure 1, please visit: https://www.accesswire.com/uploads/CanAlaska1-12.23.16.jpg De Beers' drill program in September 2016 tested seven magnetic targets accessible before winter, located mostly in the southern claim groups. At five sites, the drill holes intercepted magnetic material within the organic overburden, unconsolidated sand and boulders, followed by sandstone. At one drill site, the overburden was not collected, but the sandstone intercepted did not explain the associated magnetic anomaly. One drill hole intercepted overburden consisting of peat, unconsolidated sands and boulders, followed by sandstone, and a thin diabase sill, which may explain the anomaly. To view an enhanced version of Figure 2, please visit: https://www.accesswire.com/uploads/CanAlaska2-12.23.16.jpg It is highly unusual to encounter such magnetic material in organic overburden. Samples from this material were sent to Saskatchewan Research Council (SRC) and McMaster University for analysis and review. There is some scientific literature that details bacterial production of magnetic material under certain conditions. Although the Western Athabasca Basin has the right geological and structural setting for the presence of diamondiferous kimberlite, De Beers decided not to continue drilling and, under the terms of the Option Agreement, have returned 100% of the project to CanAlaska. CanAlaska President Peter Dasler commented, "I am very pleased with the excellent relationship we have developed with De Beers through this project. The Western Athabasca merits exploration for diamonds and we will now concentrate on evaluating several of the more interesting magnetic anomalies within the remaining 78 targets that CanAlaska does not believe are related to magnetic organic material. The series of positive and negative (reverse) magnetic responses that are evident from the recent airborne surveys on our nearby properties, specifically West Carswell and Alberta, would not be caused by similar organic material. CanAlaska is currently marketing its Alberta property to third parties to explore for diamonds, and with the return of 100% of the West Athabasca project, we expect that there will be parties that will wish to help us test the remaining targets." In other news, CanAlaska has received correspondence from Cameco Corporation in relation to the West McArthur uranium project; Cameco expects to be able to provide a 2017 exploration program and budget by January 31, 2017. CanAlaska Uranium Ltd. (TSXV: CVV) (OTCQB: CVVUF) (FSE: DH7N) holds interests in approximately 500,000 hectares (1.2 million acres), one of the largest land positions in Canada's Athabasca Basin region - the "Saudi Arabia of Uranium." CanAlaska's strategic holdings have attracted major international mining companies Cameco, Denison, KORES, and KEPCO. CanAlaska is a project generator positioned for discovery success in the world's richest uranium district. For further information visit www.canalaska.com. The qualified technical person for this news release is Dr Karl Schimann, P. Geo, VP Exploration, for CanAlaska. On behalf of the Board of Directors Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. All statements included in this press release that address activities, events, or developments that the Company expects, believes, or anticipates will or may occur in the future are forward-looking statements. These forward-looking statements involve numerous assumptions made by the Company based on its experience, perception of historical trends, current conditions, expected future developments, and other factors it believes are appropriate in the circumstances. In addition, these statements involve substantial known and unknown risks and uncertainties that contribute to the possibility that the predictions, forecasts, projections, and other forward-looking statements will prove inaccurate, certain of which are beyond the Company's control. Readers should not place undue reliance on forward-looking statements. Except as required by law, the Company does not intend to revise or update these forward-looking statements after the date hereof or revise them to reflect the occurrence of future unanticipated events.


News Article | March 2, 2017
Site: www.biosciencetechnology.com

Research from McMaster University has found that bacteria in the gut impacts both intestinal and behavioral symptoms in patients suffering from irritable bowel syndrome (IBS), a finding which could lead to new microbiota-directed treatments. The new study, published today in Science Translational Medicine, was led by researchers from the Farncombe Family Digestive Health Research Institute at McMaster, Drs. Premysl Bercik and Stephen Collins, in collaboration with researchers from the University of Waterloo. IBS is the most common gastrointestinal disorder in the world. It affects the large intestine and patients suffer from abdominal pain and altered bowel habits like diarrhea and constipation, which are often accompanied by chronic anxiety or depression. Current treatments aimed at improving symptoms have limited efficacy because the underlying causes are unknown. The goal of the study was to explore whether fecal microbiota from human IBS patients with diarrhea has the ability to influence gut and brain function in recipient mice. Using fecal transplants, researchers transferred microbiota from IBS patients with or without anxiety into germ-free mice. The mice went on to develop changes both in intestinal function and behavior reminiscent of the donor IBS patients, compared to mice that were transplanted with microbiota from healthy individuals. The researchers found that aspects of the illness that were impacted through fecal transplants included gastrointestinal transit (the time it takes for food to leave the stomach and travel through the intestine); intestinal barrier dysfunction; low grade inflammation; and anxiety-like behavior. "This is a landmark study because it moves the field beyond a simple association, and towards evidence that changes in the microbiota impact both intestinal and behavioral responses in IBS," said Giada De Palma, the study's first author and research associate with the Farncombe Family Digestive Health Research Institute. "Our findings provide the basis for developing therapies aimed at the intestinal microbiota, and for finding biomarkers for the diagnosis of IBS," said Premysl Bercik, the study's lead author and Associate Professor of Medicine at McMaster University. The authors conclude that their findings raise the possibility that "microbiota-directed therapies, including pre- or probiotic treatment, may be beneficial in treating not only intestinal symptoms but also components of the behavioral manifestations of IBS." Interestingly, the authors noted that since the study showed that microbiota in the gut can influence the brain, it "adds to evidence suggesting that the intestinal microbiota may play some role in the spectrum of brain disorders ranging from mood or anxiety to other problems that may include autism, Parkinson's disease and multiple sclerosis." However, they added that further work is required to better define the relationship in these conditions.


The International Nurses Association is pleased to welcome Debra White, RN, to their prestigious organization with her upcoming publication in the Worldwide Leaders in Healthcare. Debra White is a Registered Nurse with 28 years of experience in her field and an extensive expertise in all facets of nursing, especially critical care. Debra is currently serving patients as a Specialty Field Nurse, Critical Care Nurse, and Paramedic Examiner. She is also a Clinical Lead/Faculty in Health and Wellness at Georgian College in Barrie, Ontario. Debra White attended McMaster University, graduating with her Nursing Degree. Since graduating, Debra has completed numerous advanced training courses. She is certified in Advanced Cardiac Life Support, Pediatric Advanced Life Support, Chemotherapy/Biotherapy, Cardiac Medicine, Intensive Care, EKG, Neonatal Resuscitation Program, and Telemetry. Furthermore, Debra is a Certified Ambulatory Perianesthesia Nurse, Certified Critical Care Nurse, Certified Emergency Nurse, Certified Nurse, Educator, Certified Phlebotomy Technician, Certified Registered Nurse Intravenous, Certified Critical Care Transportation Nurse, and a Certified Vascular Nurse. Throughout her career, Debra has worked in many areas of the nursing field.  She maintains professional memberships with the Registered Nurses of Ontario, the Gerontological Nursing Association of Ontario, the Canadian Nurses Association, the Senior Health Research Transfer Networks, the Canadian and Ontario Networks for the Prevention of Elderly Abuse, and the Canadian Association of Health Sciences and Policy Research. She attributes her success to her passion for nursing and for helping others, and when she is not working, Debra enjoys running, skiing and driving ATVs, and is also involved in a number of philanthropic causes. Learn more about Debra White here: http://inanurse.org/network/index.php?do=/4133937/info/ and be sure to read her upcoming publication in Worldwide Leaders in Healthcare.


News Article | June 6, 2016
Site: www.techtimes.com

Nutritional supplements are a boon in many ways: past mice studies have shown that a combination of vitamin and mineral supplements may potentially slow down progression of genetic hearing loss in children. Now, new research has found that a dietary supplement that contains a blend of 30 vitamins and minerals may possibly reduce the development of debilitating neurological diseases such as ALS (amyotrophic lateral sclerosis also known as Lou Gehrig's disease), Parkinson's and Alzheimer's disease. Being dubbed as the "Fountain of Youth" pill, the supplement may dramatically reverse the effects of aging and prevent the loss of brain cells, researchers said. Scientists from McMaster University in Canada developed the formula for the supplement back in 2000 with the intention of making it an over-the-counter pill that would combat neurological degeneration and aging. In order for an ingredient to be added to the supplement, it has to have a history of fighting against any one of the five components involved in the process of neurological aging: inflammation, oxidative stress, membrane dysfunction, mitochondrial deterioration and weakened glucose metabolism. The ultimate combination for the supplement included 30 vitamins and minerals, including vitamins B, C and D, cod liver oil, folic acid, green tea extract and other types of nutraceuticals. McMaster researchers chronicled the anti-aging potential of the supplement in mice in a series of studies conducted for more than 15 years. The blend was administered on a piece of bagel to two groups of mice: the first group aged normally while the second group aged rapidly. They received the supplement over the course of their life spans. It's important to note that the second mice group had widespread loss of more than half of their brain cells. This severely impacted parts of their brain, mimicking cases of high-grade Alzheimer's disease. All of the lab mice were tested for balance, motor activity, coordination and balance, as well as other types of sensory functions and cognitive tests. In the end, researchers found that when the second group of mice were given the supplement, severe aging deterioration was completely prevented. In fact, both groups of mice got smarter as they grew older, they said. Additionally, scientists determined that older mice on the supplement became stronger and more active, and had improved vision, better balance and a boosted sense of smell compared with mice of the same age that were not treated. Although the supplement will not hit stores immediately, study researcher Jennifer Lemon says human studies will likely begin within two years. Still, knowing the potential effects of the pill raises hope. Lemon adds that their ultimate goal is for the supplement to offset severe illnesses and improve life quality. Details of the study are published in the journal Environmental and Molecular Mutagenesis. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


Huizinga J.D.,McMaster University | Chen J.-H.,Wuhan University
Current Gastroenterology Reports | Year: 2014

The basic science and clinical interest in the networks of interstitial cells of Cajal (ICC) keep growing, and here, research from 2010 to mid-2013 is highlighted. Highresolution gastrointestinal manometry and spatiotemporal mapping are bringing exciting new insights into motor patterns, their function and their myogenic and neurogenic origins, as well as the role of ICC. Critically important knowledge is emerging on the partaking of PDGFRa+ cells in ICC pacemaker networks. Evidence is emerging that ICC and PDGFRa+ cells have unique direct roles in muscle innervation. Chronic constipation is associated with loss and injury to ICC, which is stimulating extensive research into maintenance and repair of ICC after injury. In gastroparesis, high-resolution electrical and mechanical studies are beginning to elucidate the pathophysiological role of ICC and the pacemaker system in this condition. Receptors and ion channels that play a role in ICC function are being discovered and characterized, which paves the way for pharmacological interventions in gut motility disorders through ICC. © Springer Science+Business Media New York 2014.


Nakamura I.,California Institute of Technology | Shi A.-C.,McMaster University | Wang Z.-G.,California Institute of Technology
Physical Review Letters | Year: 2012

Using field-theoretic techniques, we study the solvation of salt ions in liquid mixtures, accounting for the permanent and induced dipole moments, as well as the molecular volume of the species. With no adjustable parameters, we predict solvation energies in both single-component liquids and binary liquid mixtures that are in excellent agreement with experimental data. Our study shows that the solvation energy of an ion is largely determined by the local response of the permanent and induced dipoles, as well as the local solvent composition in the case of mixtures, and does not simply correlate with the bulk dielectric constant. In particular, we show that, in a binary mixture, it is possible for the component with the lower bulk dielectric constant but larger molecular polarizability to be enriched near the ion. © 2012 American Physical Society.


Zipursky R.B.,McMaster University | Zipursky R.B.,St Josephs Healthcare Hamilton | Reilly T.J.,King's College | Murray R.M.,King's College
Schizophrenia Bulletin | Year: 2013

Schizophrenia has historically been considered to be a deteriorating disease, a view reinforced by recent MRI findings of progressive brain tissue loss over the early years of illness. On the other hand, the notion that recovery from schizophrenia is possible is increasingly embraced by consumer and family groups. This review critically examines the evidence from longitudinal studies of (1) clinical outcomes, (2) MRI brain volumes, and (3) cognitive functioning. First, the evidence shows that although approximately 25% of people with schizophrenia have a poor long-term outcome, few of these show the incremental loss of function that is characteristic of neurodegenerative illnesses. Second, MRI studies demonstrate subtle developmental abnormalities at first onset of psychosis and then further decreases in brain tissue volumes; however, these latter decreases are explicable by the effects of antipsychotic medication, substance abuse, and other secondary factors. Third, while patients do show cognitive deficits compared with controls, cognitive functioning does not appear to deteriorate over time. The majority of people with schizophrenia have the potential to achieve long-term remission and functional recovery. The fact that some experience deterioration in functioning over time may reflect poor access, or adherence, to treatment, the effects of concurrent conditions, and social and financial impoverishment. Mental health professionals need to join with patients and their families in understanding that schizophrenia is not a malignant disease that inevitably deteriorates over time but rather one from which most people can achieve a substantial degree of recovery. © 2012 The Author.


Emadi A.,McMaster University | Emadi A.,Hybrid Electric Vehicle Technologies
IEEE Power and Energy Magazine | Year: 2011

Most of our current transportation system is not sustainable. It represents transportation 1.0, mainly dependent on fossil fuels. There is a fierce global competition to develop the next generation of vehicles, however, and the most promising and practical sustainable solution is clearly electrificationtransportation 2.0. There is, in fact, an evolving paradigm shift in the transportation industry toward more efficient, more reliable, safer, smarter, and higher-performance vehicles that are more environmentally friendly. © 2011 IEEE.


News Article | November 1, 2016
Site: www.prweb.com

“We are pleased to have Bev Christian join the facilitator team at HDP. He brings years of experience in Electronics Assembly and Reliability Assessment. Bev’s skills in program management and background in PWB manufacturing, assembly, and testing will be a big asset to our PWB focused project segment.” said Marshall Andrews Executive Director of HDP user group. Bev’s background includes 26 years of experience in the electronics industry, with 10 of those years at Nortel and 15 years at BlackBerry. Most recently he was the Test Services Failure Analysis Director for CALCE at the University of Maryland. Bev holds a BSc in Honors Chemistry from the University of New Brunswick, Canada and a PhD in Inorganic Chemistry from McMaster University, Hamilton, Ontario, Canada. HDP User Group (http://www.hdpug.org) is a global research and development organization based in Cave Creek Arizona, is dedicated to “reducing the costs and risks for the Electronics Manufacturing industry when using advanced electronic packaging and assembly”. This international industry led group organizes and conducts R&D programs to address the technical issues facing the industry, including design, printed circuit board manufacturing, electronics assembly, and environmental compliance. HDP User Group maintains additional offices in Austin, Texas, Singapore, and Dollar, U.K. For more information, visit HDP User Group on the Internet at http://www.hdpug.org or contact Darryl Reiner at darrylr(at)hdpug(dot)org, phone number +1 480-951-1963


News Article | October 29, 2016
Site: www.sciencedaily.com

How should plastic surgeons choose the best implant type and size for women undergoing breast augmentation surgery? Implant size selection systems based on breast tissue measurements may provide better outcomes, suggests a research review in the November issue of Plastic and Reconstructive Surgery®, the official medical journal of the American Society of Plastic Surgeons (ASPS). Tissue-based planning systems -- using clinical guidelines to determine the optimal breast implant dimensions for individual patients -- appear superior to approaches relying more on the patient's or surgeon's preference, according to the study by Drs. William P. Adams, Jr., of University of Texas Southwestern Medical Center, Dallas, and Daniel McKee of McMaster University, Hamilton, Ont., Canada. But further studies will be needed to clarify how breast implant size selection systems affect the outcomes of breast augmentation. 'Tissue-Based Planning' Seems Best -- But Evidence Is Limited The researchers performed a "data-driven review" of methods used by plastic surgeons to select the appropriate implant size for breast augmentation surgery. Breast augmentation is the most popular cosmetic plastic surgery procedure in the United States, with nearly 280,000 procedures performed in 2015, according to ASPS statistics. Implant size selection systems were divided into three groups: • No breast measurements. Implants are chosen based solely on the patient's or surgeon's preference. • Dimensional analysis systems. Implants are chosen in order to establish a desired result, with measurements performed to determine the implant needed to achieve that result. • Tissue-based planning (TBP). Breast tissue measurements are used to set "clear and narrow boundaries" for implant selection based on clinical guidelines, with limited to no flexibility. The review identified 33 articles on implant sizing systems. Studies evaluating TBP sizing systems were of higher quality than those in the other two categories. "The top ten studies based on methodological quality all used patients' breast dimensions before selecting final implant dimensions, and this should now be considered standard of practice based on our analysis," Drs. Adams and McKee write. The TBP studies reported low rates of repeat surgery, compared to industry standards and accepted research values. The researchers emphasize some major limitations of the available evidence on implant sizing systems. Just four out of 33 studies reported clinical outcomes that could be compared to any standard, while none of the studies compared two or more sizing systems. Overall, 60 percent of studies scored zero on the quality rating scale used -- including some popular sizing systems that were "not grounded on any published data or evidence." The topic of implant selection can be an emotional one, with tension between the plastic surgeon's roles as "Artist" versus "Engineer." The researchers note that some TBP systems with the highest quality of evidence take a "middle-of-the-road" approach -- based on measurements, but also considering the patient's aesthetic desires. Based on their data, Drs. Adams and McKee are evaluating a new "implant-specific" TBP system designed to guide the surgeon to a selection of manufactured implant styles and models. "Going forward," they write, "new published systems should [use] rigorous quantitative methods so that comparisons can be made in terms of patient outcomes."

Loading McMaster University collaborators
Loading McMaster University collaborators