Hamilton, Canada
Hamilton, Canada

McMaster University is a public research university located in Hamilton, Ontario, Canada. The main campus is located on 121 hectares of land in the residential neighbourhood of Westdale, adjacent to Hamilton's Royal Botanical Gardens. The university operates six academic faculties: the DeGroote School of Business, Engineering, Health science, Humanities, Social Science, and Science. It is a member of the U15, a group of research-intensive universities in Canada.The university bears the name of Honourable William McMaster, a prominent Canadian Senator and banker who bequeathed C$900,000 to the founding of the university. McMaster University was incorporated under the terms of an act of the Legislative Assembly of Ontario in 1887, merging the Toronto Baptist College with Woodstock College. It opened in Toronto in 1890. Inadequate facilities and the gift of land in Hamilton prompted the institution to relocate in 1930. McMaster was controlled by the Baptist Convention of Ontario and Quebec until it became a privately chartered, publicly funded non-denominational institution in 1957.The university is co-educational, and has over 24,500 undergraduate and nearly 4,000 post-graduate students. Alumni and former students of the university can be found all across Canada and in 140 countries around the world. Notable alumni include government officials, academics, business leaders and two Nobel laureates. The university ranked 4th among Canadian universities and 92nd in the world according to the 2013-2014 Times Higher Education World University Rankings, 4th among Canadian universities and 90th in the world according to the 2014 Academic Ranking of World Universities, and 6th among Canadian universities and 113th in the world according to the 2014 QS World University Rankings. In addition, the McMaster University Medical School was ranked 1st in Canada and 14th in the world for clinical medicine by Times Higher Education in 2013. The McMaster athletic teams are known as the Marauders, and are members of the Canadian Interuniversity Sport. Wikipedia.


Time filter

Source Type

Patent
McMaster University | Date: 2016-11-04

Described are methods and compositions for treating cancer that include a dopamine receptor (DR) antagonist such as thioridazine and a chemotherapeutic agent. Optionally, the chemotherapeutic agent is a DNA synthesis inhibitor such as cytarabine or a microtubule inhibitor such as paclitaxel or docetaxel. The methods and compositions are useful for the treatment of cancers such as acute myeloid leukemia.


Patent
McMaster University | Date: 2015-04-07

A display illumination module for the illumination of a rear-projection screen is provided in which a first array of light sources is positioned adjacent to a first face of an optical modulating array layer for modulating the transmission of light emitted by the first array light sources. The first array light sources emit light within a defined angular range, and the optical modulating array layer is positioned relative to the first array of light sources so that light from adjacent light sources does not overlap at the optical modulating array layer. A second array of light sources is positioned adjacent to a second side of the optical modulation array layer and is arranged such that light from the second array of light sources does not pass through said optical modulation array layer and said second array of light sources does not substantially block light from the first array of light sources passing through the optical modulating array layer. One or more display modules may be incorporated into a display system that includes a rear projection screen that is spatially offset from the optical modulating array layer so that light emitted from adjacent light sources in either the first or the second array of light sources overlaps on the screen.


Duffett M.,McMaster University
Pediatric Critical Care Medicine | Year: 2017

OBJECTIVES:: High-quality, adequately powered, randomized controlled trials are needed to inform the care of critically ill children. Unfortunately, such evidence is not always available. Our objective was to identify barriers and facilitators of conducting high-quality randomized controlled trials in pediatric critical care, from the perspective of trialists in this field. DESIGN:: Self-administered online survey. Respondents rated the importance of barriers and effectiveness of facilitators on seven-point scales. SETTING:: Authors of 294 pediatric critical care randomized controlled trials (published 1986 to June 2015). SUBJECTS:: One hundred sixteen researchers from 25 countries participated. INTERVENTIONS:: None. MEASUREMENTS AND MAIN RESULTS:: Respondents reported a median (Q1, Q3) of 21 years (15, 26 yr) of experience and 41 (36%) had authored more than one randomized controlled trial. More survey respondents, compared with nonrespondents, had published more than one trial (35% vs 26%; p = 0.002) and their trials were more often cited (median citations/yr, 2.4 vs 1.5; p < 0.001). Of the barriers listed, the five most important were primarily related to lack of funding. The five facilitators perceived as most effective were protected time for research, ability to recruit participants 24 hours per day/7 days per week, conducting randomized controlled trials in collaboration with a research network, funding from government agencies specifically for randomized controlled trials in critically ill children, and academic department support for conducting randomized controlled trials. Respondent experience and country income level were associated with differences in importance ratings for eight of 41 barriers. There were fewer such differences for facilitators. CONCLUSIONS:: Lack of funding and time are major barriers to conducting pediatric critical care randomized controlled trials worldwide. Although barriers varied among country income levels, the facilitators of such trials were more consistent. In addition to increased funding, respondents identified other strategies such as research networks that are within the purview of the pediatric critical care research community, to facilitate the conduct of rigorous randomized controlled trials. ©2017The Society of Critical Care Medicine and the World Federation of Pediatric Intensive and Critical Care Societies


McConnell M.M.,McMaster University
Advances in health sciences education : theory and practice | Year: 2015

Testing has been shown to enhance retention of learned information beyond simple studying, a phenomena known as test-enhanced learning (TEL). Research has shown that TEL effects are greater for tests that require the production of responses [e.g., short-answer questions (SAQs)] relative to tests that require the recognition of correct answers [e.g., multiple-choice questions (MCQs)]. High stakes licensure examinations have recently differentiated MCQs that require the application of clinical knowledge (context-rich MCQs) from MCQs that rely on the recognition of "facts" (context-free MCQs). The present study investigated the influence of different types of educational activities (including studying, SAQs, context-rich MCQs and context-free MCQs) on later performance on a mock licensure examination. Fourth-year medical students (n = 224) from four Quebec universities completed four educational activities: one reading-based activity and three quiz-based activities (SAQs, context-rich MCQs, and context-free MCQs). We assessed the influence of the type of educational activity on students' subsequent performance in a mock licensure examination, which consisted of two types of context-rich MCQs: (1) verbatim replications of previous items and (2) items that tested the same learning objective but were new. Mean accuracy scores on the mock licensure exam were higher when intervening educational activities contained either context-rich MCQs (Mean z-score = 0.40) or SAQs (M = 0.39) compared to context-free MCQs (M = -0.38) or study only items (M = -0.42; all p < 0.001). Higher mean scores were only present for verbatim items (p < 0.001). The benefit of testing was observed when intervening educational activities required either the generation of a response (SAQs) or the application of knowledge (context-rich MCQs); however, this effect was only observed for verbatim test items. These data provide evidence that context-rich MCQs and SAQs enhance learning through testing compared to context-free MCQs or studying alone. The extent to which these findings generalize beyond verbatim questions remains to be seen.


Keller B.W.,McMaster University | Wadsley J.W.,McMaster University
Astrophysical Journal Letters | Year: 2017

Recent analysis of the Spitzer Photometry and Accurate Rotation Curve (SPARC) galaxy sample found a surprisingly tight relation between the radial acceleration inferred from the rotation curves and the acceleration due to the baryonic components of the disk. It has been suggested that this relation may be evidence for new physics, beyond ΛCDM. In this Letter, we show that 32 galaxies from the MUGS2 match the SPARC acceleration relation. These cosmological simulations of star-forming, rotationally supported disks were simulated with a WMAP3 ΛCDM cosmology, and match the SPARC acceleration relation with less scatter than the observational data. These results show that this acceleration relation is a consequence of dissipative collapse of baryons, rather than being evidence for exotic dark-sector physics or new dynamical laws. © 2017. The American Astronomical Society. All rights reserved.


Park S.W.,McMaster University | Bolker B.M.,McMaster University
PLoS Computational Biology | Year: 2017

Early in an epidemic, high densities of susceptible hosts select for relatively high parasite virulence; later in the epidemic, lower susceptible densities select for lower virulence. Thus over the course of a typical epidemic the average virulence of parasite strains increases initially, peaks partway through the epidemic, then declines again. However, precise quantitative outcomes, such as the peak virulence reached and its timing, may depend sensitively on epidemiological details. Fraser et al. proposed a model for the eco-evolutionary dynamics of HIV that incorporates the tradeoffs between transmission and virulence (mediated by set-point viral load, SPVL) and their heritability between hosts. Their model used implicit equations to capture the effects of partnership dynamics that are at the core of epidemics of sexually transmitted diseases. Our models combine HIV virulence tradeoffs with a range of contact models, explicitly modeling partnership formation and dissolution and allowing for individuals to transmit disease outside of partnerships. We assess summary statistics such as the peak virulence (corresponding to the maximum value of population mean log10SPVL achieved throughout the epidemic) across models for a range of parameters applicable to the HIV epidemic in sub-Saharan Africa. Although virulence trajectories are broadly similar across models, the timing and magnitude of the virulence peak vary considerably. Previously developed implicit models predicted lower virulence and slower progression at the peak (a maximum of 3.5 log10SPVL) compared both to more realistic models and to simple random-mixing models with no partnership structure at all (both with a maximum of ≈ 4.7 log10SPVL). In this range of models, the simplest random-mixing structure best approximates the most realistic model; this surprising outcome occurs because the dominance of extra-pair contact in the realistic model swamps the effects of partnership structure. © 2017 Park, Bolker.


Keller B.W.,McMaster University | Wadsley J.,McMaster University | Couchman H.,McMaster University
Monthly Notices of the Royal Astronomical Society | Year: 2015

We present the first cosmological galaxy evolved using the modern smoothed particle hydrodynamics (SPH) code GASOLINE2 with superbubble feedback.We show that superbubble-driven galactic outflows powered by Type II supernovae alone can produce L* galaxies with flat rotation curves with circular velocities ~200 km s-1, low bulge-to-disc ratios, and stellar mass fractions that match observed values from high redshift to the present. These features are made possible by the high mass loadings generated by the evaporative growth of superbubbles. Outflows are driven extremely effectively at high redshift, expelling gas at early times and preventing overproduction of stars before z = 2. Centrally concentrated gas in previous simulations has often lead to unrealistically high bulge to total ratios and strongly peaked rotation curves. We show that supernova-powered superbubbles alone can produce galaxies that agree well with observed properties without the need for additional feedback mechanisms or increased feedback energy. We present additional results arising from properly modelled hot feedback. © 2015 The Authors. Published by Oxford University Press on behalf of the Royal Astronomical Society.


Weitz J.I.,McMaster University | Fredenburgh J.C.,McMaster University
Blood | Year: 2017

In this issue of Blood, Verhoef et al provide evidence that platelets contain polyphosphate polymers of sufficient size to promote activation of factor XII (FXII), thereby addressing a long-standing enigma as to the potential contribution of platelet polyphosphate to thrombosis. © 2017 by The American Society of Hematology.


Kamel H.,Feil Family Brain and Mind Research Institute | Healey J.S.,McMaster University
Circulation Research | Year: 2017

Cardiac embolism accounts for an increasing proportion of ischemic strokes and might multiply several-fold during the next decades. However, research points to several potential strategies to stem this expected rise in cardioembolic stroke. First, although one-third of strokes are of unclear cause, it is increasingly accepted that many of these cryptogenic strokes arise from a distant embolism rather than in situ cerebrovascular disease, leading to the recent formulation of embolic stroke of undetermined source as a distinct target for investigation. Second, recent clinical trials have indicated that embolic stroke of undetermined source may often stem from subclinical atrial fibrillation, which can be diagnosed with prolonged heart rhythm monitoring. Third, emerging evidence indicates that a thrombogenic atrial substrate can lead to atrial thromboembolism even in the absence of atrial fibrillation. Such an atrial cardiomyopathy may explain many cases of embolic stroke of undetermined source, and oral anticoagulant drugs may prove to reduce stroke risk from atrial cardiomyopathy given its parallels to atrial fibrillation. Non-vitamin K antagonist oral anticoagulant drugs have recently expanded therapeutic options for preventing cardioembolic stroke and are currently being tested for stroke prevention in patients with embolic stroke of undetermined source, including specifically those with atrial cardiomyopathy. Fourth, increasing appreciation of thrombogenic atrial substrate and the common coexistence of cardiac and extracardiac stroke risk factors suggest benefits from global vascular risk factor management in addition to anticoagulation. Finally, improved imaging of ventricular thrombus plus the availability of non-vitamin K antagonist oral anticoagulant drugs may lead to better prevention of stroke from acute myocardial infarction and heart failure. © 2017 American Heart Association, Inc.


DiGiovanni L.F.,McMaster University | Mocle A.J.,McMaster University | Xia J.,McMaster University | Truant R.,McMaster University
Human Molecular Genetics | Year: 2016

The N17 domain of the huntingtin protein is post-translationallymodified and is themaster regulator of huntingtin intracellular localization. In Huntington's disease (HD),mutant huntingtin is hypo-phosphorylated at serines 13 and 16 within N17, and increasing N17 phosphorylation has been shown to be protective in HDmousemodels. Thus, N17 phosphorylation is defined as a sub-target of huntingtin for potential therapeutic intervention.We have previously shown that cellular stress can affect huntingtin nuclear entry and phosphorylation. Here, we demonstrate that huntingtin localization can be specifically affected by reactive oxygen species (ROS) stress.We have located the sensor of this stress to the N17 domain, specifically to a highly conserved methionine at position 8. In vitro, we show by circular dichroismspectroscopy structural studies that the alpha-helical structure of N17 changes in response to redox conditions and show that the consequence of this change is enhanced N17 phosphorylation and nuclear targeting of endogenous huntingtin. Using N17 substitution pointmutants, we demonstrate that N17 sulphoxidation enhances N17 dissociation fromthe endoplasmic reticulum(ER)membrane. This enhanced solubilitymakes N17 a better substrate for phosphorylation and subsequent nuclear retention. This ability of huntingtin to sense ROS levels at the ER, with phosphorylation and nuclear localization as a response, suggests that ROS stress due to aging could be a criticalmolecular trigger of huntingtin functions and dysfunctions in HD andmay explain the age-onset nature of the disorder. © The Author 2016. Published by Oxford University Press. All rights reserved.


Doumouras A.G.,McMaster University
Annals of Surgery | Year: 2017

OBJECTIVE:: To determine the effect of cumulative volume on all-cause morbidity and operative time. BACKGROUND:: Gastric bypass is an important public health procedure, but it is difficult to master with little data about how surgeon cumulative volume affects outcomes longitudinally. METHODS:: This was a longitudinal study of 29 surgeons during the first 6 years of performing bariatric surgery in a high-volume, regionalized center of excellence system. Cumulative volume was determined using date and time of the procedure. Cumulative volume was analyzed in blocks of 75 cases. The main outcome of interest was all-cause morbidity during the index admission and the secondary outcome was operative time. RESULTS:: Overall, 11,684 gastric bypasses were performed by 29 surgeons at 9 centers of excellence. The overall morbidity rate was 10.1% and short-term outcomes were related significantly to cumulative volume. Perioperative risk plateaued after approximately 500 cases and was lowest for surgeons who had completed more than 600 cases (odds ratio 0.53 95% confidence interval 0.26–0.96 P = 0.04) compared to the first 75 cases. Operative time also stabilized after approximately 500 cases, with an operative time 44.7 minutes faster than surgeons in their first 75 cases (95% confidence interval 37.0–52.4 min P < 0.001). CONCLUSIONS:: The present study demonstrated the clear, substantial influence of surgeon cumulative volume on improved perioperative outcomes and operative time. This finding emphasizes role of the individual surgeon in perioperative outcomes and that the true learning curve needed to master a complex surgical procedure such as gastric bypass is longer than previously thought, in this case requiring approximately 500 cases to plateau. Copyright © 2017 Wolters Kluwer Health, Inc. All rights reserved.


Jones S.E.,McMaster University | Elliot M.A.,McMaster University
Trends in Microbiology | Year: 2017

Streptomyces bacteria are prolific producers of specialized metabolites, and have a well studied, complex life cycle. Recent work has revealed a new type of Streptomyces growth termed 'exploration' - so named for the ability of explorer cells to rapidly traverse solid surfaces. Streptomyces exploration is stimulated by fungal interactions, and is associated with the production of an alkaline volatile organic compound (VOC) capable of inducing exploration by other streptomycetes. Here, we examine Streptomyces exploration from the perspectives of interkingdom interactions, pH-induced morphological switches, and VOC-mediated communication. The phenotypic diversity that can be revealed through microbial interactions and VOC exposure is providing us with insight into novel modes of microbial development, and an opportunity to exploit VOCs to stimulate desired microbial behaviours. The classical Streptomyces life cycle involves three growth stages: vegetative hyphae, aerial hyphae, and spores. A novel form of Streptomyces development termed 'exploratory growth' has now been identified. Explorer cells are nonbranching vegetative hyphae that can rapidly move across surfaces. Streptomyces do not typically initiate exploration when grown alone in laboratory environments. Exploration was first observed when Streptomyces venezuelae was cultured with yeast. Investigating bacterial development in the context of multispecies interactions therefore has the potential to reveal novel microbial behaviours. Streptomyces exploration is promoted by the volatile compound trimethylamine.Different growth conditions, such as alkaline environments, can dramatically alter microbial development. © 2017 Elsevier Ltd.


Razi A.,McMaster University | Ortega J.,McMaster University
EMBO Journal | Year: 2017

One of the most fundamental processes of life is protein synthesis by the ribosome. Although much is known about the function and structure of this macromolecular complex, our understanding on its assembly is still vague. In this issue of The EMBO Journal, Malyutin et al () provide a detailed picture of one of the latest assembly stages of the yeast 60S ribosomal subunit. The cryo-EM map of the 60S-Nmd3-Lsg1-Tif6 complex sheds new light on the function of Nmd3, Lsg1 and Tif6-and their release mechanisms-right before the 60S subunit joins the pool of actively translating ribosomes. © 2017 EMBO.


Reddon H.,McMaster University
Medicine and Science in Sports and Exercise | Year: 2017

PURPOSE: Physical activity is associated with an array of physical and mental health benefits among children and adolescents. The development of self-worth/self-esteem has been proposed as a mechanism to explain the mental health benefits derived from physical activity. Despite several studies that have analyzed the association between physical activity and self-worth, the results have been inconsistent. It is also uncertain how related physical health measures, such as sedentary behaviour, body composition and fitness influence the relationship between physical activity and self-worth over time. In the present study, we (1) analyzed if the association between physical activity and self-worth remained constant over time, and whether this relationship varied by sex and (2) investigated if changes in body composition and fitness level mediated the relationship between physical activity and self-worth. METHODS: Data from the Physical Health Activity Study Team (PHAST) was used for this analysis. PHAST is a prospective cohort study that included 2278 children at baseline (ages 9-10) and included eight follow-up contacts over a four-year study period. Linear mixed-effects models were used to estimate global self-worth (GSW) over follow-up. RESULTS: Increased physical activity was associated with greater GSW across all waves of data collection, and this relationship did not vary significantly over time or between sexes. Aerobic fitness was positively associated with GSW while BMI was inversely related to GSW. Both aerobic fitness and BMI appeared to mediate the association between physical activity and GSW. Sedentary behaviour was not significantly associated with GSW. CONCLUSION: Physical activity is associated with greater GSW, and this relationship appears to be mediated by BMI and aerobic fitness. These findings reinforce the importance of physical behaviours and physical characteristics in shaping GSW in children. © 2017 American College of Sports Medicine


Collister D.,McMaster University
Current Opinion in Nephrology and Hypertension | Year: 2017

PURPOSE OF REVIEW: This review describes the current state of anemia management with erythropoietin (EPO)-stimulating agents and iron supplementation in both chronic kidney disease and dialysis patients, with a focus on novel therapies. RECENT FINDINGS: We review the benefits and risks of EPO-stimulating agents, focusing on health-related quality of life and the uncertainties regarding optimal iron utilization in patients with kidney disease. We discuss novel therapies for iron supplementation including iron-based phosphate binders and dialysate iron delivery as well as alternatives to EPO-stimulating agents including hypoxia-inducible factor prolyl hydroxylase inhibitors. SUMMARY: Individualization of hemoglobin targets using EPO-stimulating agents and iron supplementation may be considered in younger, healthier patients with kidney disease to improve health-related quality of life. Optimal iron utilization in kidney disease patients is unclear, but novel iron base phosphate binders and dialysate iron delivery may play a role in intravenous iron avoidance and its potential complications. Phase 3 randomized controlled trials of hypoxia-inducible factor prolyl hydroxylase inhibitors are ongoing and are promising new alternatives to EPO-stimulating agents and their known adverse effects. Copyright © 2017 Wolters Kluwer Health, Inc. All rights reserved.


Pace J.E.,McMaster University | Grenier A.,McMaster University
Journals of Gerontology - Series B Psychological Sciences and Social Sciences | Year: 2017

Objectives: Indigenous older peoples' voices and experiences remain largely absent in the dominant models and critical scholarship on aging and late life. This article examines the relevance of the model of successful aging for Indigenous peoples in North America. Method: This article presents the results of a review of the published conceptual literature on successful aging among Indigenous peoples. Our intent was to explore the current state of the field of successful aging among Indigenous peoples and suggest dimensions that may be more reflective of Indigenous voices and experiences that leads to a more inclusive model of successful aging. Results: Based on our review, we suggest four dimensions that may broaden understandings of successful aging to be more inclusive of Indigenous older people: health and wellness, empowerment and resilience, engagement and behavior, and connectedness. Discussion: Our review suggests that Indigenous peoples' voices and experiences are beginning to be included in academic literature on successful aging. However, we suggest that understandings of successful aging be broadened based on our summative findings and a process of community involvement. Such processes can lead to the development of models that are more inclusive to a wide range of older people, including Indigenous older peoples. © The Author 2016. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved.


Safdar A.,McMaster University
European Journal of Human Genetics | Year: 2017

Recent research has suggested that transmembrane protein 65 (TMEM65) is localized within the inner mitochondrial membrane. Little else is known about its function. In this study we investigated the location and function of TMEM65. Further, we report the functional consequences of a novel homozygous splice variant (c.472+1G>A) in the TMEM65 gene in a patient with mitochondrial encephalomyopathy. Here we investigated the location of TMEM65 by immunofluorescence staining of the protein and by immunoblotting of the isolated mitochondrial fractions in healthy fibroblasts and those from the patient. To study the function of TMEM65 we knocked down mRNA using TMEM65-specific siRNA, and measured mitochondrial function by enzymology, protein abundance and oxygen consumption rate in fibroblasts. Subcellular fractionation confirmed that the TMEM65 protein was present in the inner mitochondrial membrane. Knocking down TMEM65 expression in dermal fibroblasts severely affected mitochondrial content and respiration rate. Further evidence for the essential role of TMEM65 in mitochondrial function came from the demonstration of severe cellular and clinical consequences resulting from the novel TMEM65 gene mutation. In conclusion, these findings suggest that TMEM65, an inner mitochondrial membrane protein, plays a significant role in mitochondrial respiratory chain function. We also provide the first evidence that a mutation in the TMEM65 gene results in mitochondrial dysfunction and a severe mitochondrial encephalomyopathy phenotype.European Journal of Human Genetics advance online publication, 15 March 2017; doi:10.1038/ejhg.2017.20. © 2017 Macmillan Publishers Limited, part of Springer Nature.


News Article | April 22, 2017
Site: motherboard.vice.com

Toronto is a tricky city in terms of weather, but Saturday couldn't have been a better day for the Sun to shine. Scientists and their allies gathered downtown for the city's March for Science on April 22, Earth Day. Similar marches were taking place in cities across Canada and around the world—from London to Vancouver—and in Toronto, the crowd grew by the minute. Today's principal March for Science was in Washington DC, and for many was a protest against anti-science policies introduced under President Trump. In Toronto, panelists spoke about the unique challenges that Canadian scientists have faced, like their muzzling under Stephen Harper, as well as ongoing issues around diversity in science and tech, including the need for greater inclusion of Indigenous communities and women in Canadian research. Katie Gibbs, Executive Director (currently on leave) for nonprofit Evidence for Democracy, told Motherboard in a phone interview before Saturday's march that issues surrounding science don't just stay on one side of the border. When scientists in Canada were fighting against the Harper government, Gibbs said, they had support and solidarity from American counterparts, and now they want to extend the same to colleagues in the US. The Union of Concerned Scientists, for example, "was really supportive when we were going through these same issues," she said, "and it's partly why it's so important for us to be there and stand with them." Gibbs said the point of marching is not to change Trump's mind, but to show US scientists that people all across the world are aware of their struggle. And it's not like Trump's policies won't affect anyone outside of his country, either. She pointed out that Trump is pulling funding to clean up the Great Lakes, which could affect drinking water for millions of people on both sides of the border. Chants heard during the Toronto rally—like "Climate change is real, vaccines work!" and "Show us the data!"—echoed this frustration. Diversity issues in science were addressed at the march by speakers including Dawn Martin-Hill, a member of the Mohawk Nation, Wolf Clan, and co-founder of the Indigenous Studies Program at McMaster University in Hamilton, Ont. She outlined some of the issues that Indigenous peoples still face in both Canada and the US. "We understand that everybody has a right to their own ways of being, as long as you respect our Earth," she said. Alya Bhimji, a recent PhD graduate from the University of Toronto studying laboratory medicine and pathobiology, said she's marching because she thinks that the public should be aware of the impact and importance of scientific knowledge. As what she thinks about Trump, "he should believe more in scientific facts, rather than alternative facts." March organizer Evan Savage said that science depends on global cooperation. "We see echoes of what happened here in Canada, in the US," he said. "That being said, we are and have always positioned ourselves as explicitly non-partisan. We're not against Trump, we're not against Republicans, Conservatives or Harper. We're against the policies that were put in place to undermine scientists." Savage didn't let Canada's Justin Trudeau off the hook, though. He said that the current Prime Minister could be doing more to support the sciences. Canadian marchers were calling on government to enact recommendations from the recent Naylor Report, which looked into problems with the state of Canadian research, including diversity issues. "The Naylor Report highlighted the urgent need to increase the amount of funding for basic research here in Canada," he said. Because this report was released after the federal budget came out, Savage worries we're not going to see any real funding change for at least a year. "Canada isn't immune to censorship when it comes to science," said Aadita Chaudhury, a speaker at the Toronto march and a PhD student at York University, in a phone call with Motherboard before the main event. "We shouldn't feel better about ourselves just because we're not in Trump's America." Subscribe to Science Solved It, Motherboard's new show about the greatest mysteries that were solved by science.


News Article | April 26, 2017
Site: marketersmedia.com

VANCOUVER, BC / ACCESSWIRE / April 26, 2017 / VANGOLD RESOURCES LTD. (TSX-V: VAN) (OTC PINK: VNGRF) (the "Company" or "Vangold") is pleased to announce the appointments of Mr. Mark Ashley, Mr. Hernan Dorado Smith and Mr. Cameron Scott King to the Board of Directors of Vangold. Mr. Ashley, who is joining the board as a non-executive director, is a successful resource executive with over 30-years' experience in asset selection, mine development and corporate and strategic optimizations. Vangold will be relying on Mr. Ashley to bring his in-depth knowledge of the technical, commercial, and financial aspects to the development of the El Pinguico Mine. As CEO of LionOre Mining International based in Australia, Mr. Ashley led the successful growth of the company culminating in its takeover by Norilsk Nickel in 2007 for US$7 Billion. He has held senior executive roles with several internationally listed entities including Normandy Mining, Cluff Resources, Kagara Zinc and Apex Minerals. Mr. Ashley was also a director of the Australian Gold Council, the Royal Flying Doctor Service (Western Australia) and a Council Member for Curtin University (in West Australian). He has significant international corporate finance experience in the mining and resource sector and has worked for extensive periods in China, Turkey, UK and Australia. Mr. Ashley is a Fellow of the Chartered Institute of Management Accountants. Mr. Hernan Dorado Smith is a 5th generation mining engineer and possesses 15 years of underground and open pit mining experience. He has in-depth and local knowledge of the El Pinguico mine and the surrounding geological formation. Hernan has worked with several world class producers on major projects, such as, New Gold at Peak Mine, Australia and Rainy River, Canada; Panamerican Silver at Navidad, Argentina and La Preciosa, Mexico. His experience at the various stages of mining, pre-feasibility, feasibility, construction and operations bring considerable value to Vangold. Hernan graduated as a Mining Engineer from Universidad de Guanajuato in 2003, received an Executive MBA from Escuela Europea de Negocios, Salamanca in 2013, and is a member of the Mining of the Mineral and Metallurgical Society of America (MMSA). In addition, Vangold is also pleased to announce the appointment of Mr. Cameron King as a Director and Vangold's new President and CEO. Mr. King brings over 25 years' experience in investment banking strategy, mergers and acquisitions and building corporate development relationships. Mr. King was a member of the Corporate Banking team with the Bank of Nova Scotia specializing in M&A and Senior VP Mid-Market Finance with Jendens Financial, London UK. Throughout Mr. King`s career, he has held director positions with Petro Novus AG, Endeavor Energy, Quest Oil and Holloman Energy Corporation. Mr. King founded the mining engineering firm Camline Mining Wear Technologies Ltd. in 1994, specializing in mineral processing, operations and efficiencies. Mr. King obtained his MBA in 1991 from Lake Superior State University, Michigan and holds a degree in Chemical Engineering and Bachelor of Commerce from McMaster University. Mr. Dal Brynelsen has stepped down as President and CEO, but will remain as a director and Chairman of the Board. Vangold is extremely grateful for his almost 30 years of dedication to Vangold, and we will continue to rely on Dal`s guidance, experience and success. He is a founding director of Griffin Mining Limited (LSE:GFM), which is one of the few western mining companies operating in China. Mr. Keith Anderson has also resigned as director of the Company. Vangold would like to thank Mr. Keith Anderson for his continued support and wishes him the very best in his future endeavours. The company is pleased to announce that it has closed the final tranche of its $500,000 non-brokered private placement of $0.05 units (the "$0.05 Placement" - see news release dated December 13, 2016) and its $500,000 non-brokered private placement of $0.09 units (the "$0.09 Placement" - refer news release dated February 23, 2017). The final tranche of the $0.05 Placement consisted of 3,500,000 units at a price of $0.05 per unit for gross proceeds of $175,000 (for unit terms, see news release dated December 13, 2016). The securities issued in the final tranche have a hold period expiring August 25, 2017. The $0.09 Placement consisted of 5,555,556 units at a price of $0.09 per unit for gross proceeds of $500,000 (for unit terms, see news release dated February 23, 2017). Finder's fees were paid in the amount of $10,500 and 116,667 finder's warrants. All securities issued in the $0.09 Placement have a hold period expiring August 25, 2017. Vangold is a development stage silver company, focused on silver and gold production in Mexico and is aggressively pursuing its business plan of becoming a senior producer through the development of its existing mineral property assets and the pursuit through acquisition of additional mineral assets which contribute to Vangold achieving its aggressive corporate growth objectives. Neither the TSX Venture Exchange nor its Regulations Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This news release includes certain "Forward-Looking Statements" within the meaning of the United States Private Securities Litigation Reform Act of 1995 and applicable Canadian securities laws. When used in this news release, the words "anticipate", "believe", "estimate", "expect", "target", "plan", "forecast", "may", "schedule" and similar words or expressions, identify forward-looking statements or information. These forward-looking statements or information relate to, among other things: the price of silver and other metals; the accuracy of mineral reserve and resource estimates and estimates of future production and costs of production at our properties; estimated production rates for silver and other payable metals produced by us, the estimated cost of development of our development projects; the effects of laws, regulations and government policies on our operations, including, without limitation, the laws in Mexico which currently have significant restrictions related to mining; obtaining or maintaining necessary permits, licences and approvals from government authorities; and continued access to necessary infrastructure, including, without limitation, access to power, land, water and roads to carry on activities as planned. These statements reflect the Company's current views with respect to future events and are necessarily based upon a number of assumptions and estimates that, while considered reasonable by the Company, are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors, both known and unknown, could cause actual results, performance or achievements to be materially different from the results, performance or achievements that are or may be expressed or implied by such forward-looking statements or information and the Company has made assumptions and estimates based on or related to many of these factors. Such factors include, without limitation: fluctuations in the spot and forward price of silver, gold, base metals or certain other commodities (such as natural gas, fuel oil and electricity); fluctuations in the currency markets (such as the Canadian dollar and Mexican peso versus the U.S. dollar); changes in national and local government, legislation, taxation, controls, regulations and political or economic developments in Canada, Mexico; operating or technical difficulties in connection with mining or development activities; risks and hazards associated with the business of mineral exploration, development and mining (including environmental hazards, industrial accidents, unusual or unexpected formations, pressures, cave-ins and flooding); risks relating to the credit worthiness or financial condition of suppliers, refiners and other parties with whom the Company does business; inability to obtain adequate insurance to cover risks and hazards; and the presence of laws and regulations that may impose restrictions on mining, including those currently enacted in Mexico; employee relations; relationships with and claims by local communities and indigenous populations; availability and increasing costs associated with mining inputs and labour; the speculative nature of mineral exploration and development, including the risks of obtaining necessary licenses, permits and approvals from government authorities; diminishing quantities or grades of mineral reserves as properties are mined; the Company's title to properties; and the factors identified under the caption "Risk Factors" in the Company's Annual Information Form, under the caption "Risks Relating to Vangold Resource's Business". Investors are cautioned against attributing undue certainty to forward-looking statements or information. Although the Company has attempted to identify important factors that could cause actual results to differ materially, there may be other factors that cause results not to be anticipated, estimated or intended. The Company does not intend, and does not assume any obligation, to update these forward-looking statements or information to reflect changes in assumptions or changes in circumstances or any other events affecting such statements or information, other than as required by applicable law. VANCOUVER, BC / ACCESSWIRE / April 26, 2017 / VANGOLD RESOURCES LTD. (TSX-V: VAN) (OTC PINK: VNGRF) (the "Company" or "Vangold") is pleased to announce the appointments of Mr. Mark Ashley, Mr. Hernan Dorado Smith and Mr. Cameron Scott King to the Board of Directors of Vangold. Mr. Ashley, who is joining the board as a non-executive director, is a successful resource executive with over 30-years' experience in asset selection, mine development and corporate and strategic optimizations. Vangold will be relying on Mr. Ashley to bring his in-depth knowledge of the technical, commercial, and financial aspects to the development of the El Pinguico Mine. As CEO of LionOre Mining International based in Australia, Mr. Ashley led the successful growth of the company culminating in its takeover by Norilsk Nickel in 2007 for US$7 Billion. He has held senior executive roles with several internationally listed entities including Normandy Mining, Cluff Resources, Kagara Zinc and Apex Minerals. Mr. Ashley was also a director of the Australian Gold Council, the Royal Flying Doctor Service (Western Australia) and a Council Member for Curtin University (in West Australian). He has significant international corporate finance experience in the mining and resource sector and has worked for extensive periods in China, Turkey, UK and Australia. Mr. Ashley is a Fellow of the Chartered Institute of Management Accountants. Mr. Hernan Dorado Smith is a 5th generation mining engineer and possesses 15 years of underground and open pit mining experience. He has in-depth and local knowledge of the El Pinguico mine and the surrounding geological formation. Hernan has worked with several world class producers on major projects, such as, New Gold at Peak Mine, Australia and Rainy River, Canada; Panamerican Silver at Navidad, Argentina and La Preciosa, Mexico. His experience at the various stages of mining, pre-feasibility, feasibility, construction and operations bring considerable value to Vangold. Hernan graduated as a Mining Engineer from Universidad de Guanajuato in 2003, received an Executive MBA from Escuela Europea de Negocios, Salamanca in 2013, and is a member of the Mining of the Mineral and Metallurgical Society of America (MMSA). In addition, Vangold is also pleased to announce the appointment of Mr. Cameron King as a Director and Vangold's new President and CEO. Mr. King brings over 25 years' experience in investment banking strategy, mergers and acquisitions and building corporate development relationships. Mr. King was a member of the Corporate Banking team with the Bank of Nova Scotia specializing in M&A and Senior VP Mid-Market Finance with Jendens Financial, London UK. Throughout Mr. King`s career, he has held director positions with Petro Novus AG, Endeavor Energy, Quest Oil and Holloman Energy Corporation. Mr. King founded the mining engineering firm Camline Mining Wear Technologies Ltd. in 1994, specializing in mineral processing, operations and efficiencies. Mr. King obtained his MBA in 1991 from Lake Superior State University, Michigan and holds a degree in Chemical Engineering and Bachelor of Commerce from McMaster University. Mr. Dal Brynelsen has stepped down as President and CEO, but will remain as a director and Chairman of the Board. Vangold is extremely grateful for his almost 30 years of dedication to Vangold, and we will continue to rely on Dal`s guidance, experience and success. He is a founding director of Griffin Mining Limited (LSE:GFM), which is one of the few western mining companies operating in China. Mr. Keith Anderson has also resigned as director of the Company. Vangold would like to thank Mr. Keith Anderson for his continued support and wishes him the very best in his future endeavours. The company is pleased to announce that it has closed the final tranche of its $500,000 non-brokered private placement of $0.05 units (the "$0.05 Placement" - see news release dated December 13, 2016) and its $500,000 non-brokered private placement of $0.09 units (the "$0.09 Placement" - refer news release dated February 23, 2017). The final tranche of the $0.05 Placement consisted of 3,500,000 units at a price of $0.05 per unit for gross proceeds of $175,000 (for unit terms, see news release dated December 13, 2016). The securities issued in the final tranche have a hold period expiring August 25, 2017. The $0.09 Placement consisted of 5,555,556 units at a price of $0.09 per unit for gross proceeds of $500,000 (for unit terms, see news release dated February 23, 2017). Finder's fees were paid in the amount of $10,500 and 116,667 finder's warrants. All securities issued in the $0.09 Placement have a hold period expiring August 25, 2017. Vangold is a development stage silver company, focused on silver and gold production in Mexico and is aggressively pursuing its business plan of becoming a senior producer through the development of its existing mineral property assets and the pursuit through acquisition of additional mineral assets which contribute to Vangold achieving its aggressive corporate growth objectives. Neither the TSX Venture Exchange nor its Regulations Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This news release includes certain "Forward-Looking Statements" within the meaning of the United States Private Securities Litigation Reform Act of 1995 and applicable Canadian securities laws. When used in this news release, the words "anticipate", "believe", "estimate", "expect", "target", "plan", "forecast", "may", "schedule" and similar words or expressions, identify forward-looking statements or information. These forward-looking statements or information relate to, among other things: the price of silver and other metals; the accuracy of mineral reserve and resource estimates and estimates of future production and costs of production at our properties; estimated production rates for silver and other payable metals produced by us, the estimated cost of development of our development projects; the effects of laws, regulations and government policies on our operations, including, without limitation, the laws in Mexico which currently have significant restrictions related to mining; obtaining or maintaining necessary permits, licences and approvals from government authorities; and continued access to necessary infrastructure, including, without limitation, access to power, land, water and roads to carry on activities as planned. These statements reflect the Company's current views with respect to future events and are necessarily based upon a number of assumptions and estimates that, while considered reasonable by the Company, are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors, both known and unknown, could cause actual results, performance or achievements to be materially different from the results, performance or achievements that are or may be expressed or implied by such forward-looking statements or information and the Company has made assumptions and estimates based on or related to many of these factors. Such factors include, without limitation: fluctuations in the spot and forward price of silver, gold, base metals or certain other commodities (such as natural gas, fuel oil and electricity); fluctuations in the currency markets (such as the Canadian dollar and Mexican peso versus the U.S. dollar); changes in national and local government, legislation, taxation, controls, regulations and political or economic developments in Canada, Mexico; operating or technical difficulties in connection with mining or development activities; risks and hazards associated with the business of mineral exploration, development and mining (including environmental hazards, industrial accidents, unusual or unexpected formations, pressures, cave-ins and flooding); risks relating to the credit worthiness or financial condition of suppliers, refiners and other parties with whom the Company does business; inability to obtain adequate insurance to cover risks and hazards; and the presence of laws and regulations that may impose restrictions on mining, including those currently enacted in Mexico; employee relations; relationships with and claims by local communities and indigenous populations; availability and increasing costs associated with mining inputs and labour; the speculative nature of mineral exploration and development, including the risks of obtaining necessary licenses, permits and approvals from government authorities; diminishing quantities or grades of mineral reserves as properties are mined; the Company's title to properties; and the factors identified under the caption "Risk Factors" in the Company's Annual Information Form, under the caption "Risks Relating to Vangold Resource's Business". Investors are cautioned against attributing undue certainty to forward-looking statements or information. Although the Company has attempted to identify important factors that could cause actual results to differ materially, there may be other factors that cause results not to be anticipated, estimated or intended. The Company does not intend, and does not assume any obligation, to update these forward-looking statements or information to reflect changes in assumptions or changes in circumstances or any other events affecting such statements or information, other than as required by applicable law.


News Article | April 20, 2017
Site: www.eurekalert.org

Hamilton, ON (April 20, 2017) - You've heard of pre-biotics and pro-biotics, but now you'll be hearing a lot more about post-biotics. Researchers at McMaster University have begun to identify how post-biotics, or the by-products of bacteria, lower blood glucose and allow insulin to work better. Jonathan Schertzer, assistant professor of biochemistry and biomedical sciences and senior author of a paper published by Cell Metabolism today, explains it this way: "We know that gut bacteria, often called the microbiome, send inflammation signals that change how well insulin works to lower blood glucose. "It was previously thought that bacteria only caused problems such as higher inflammation and higher blood glucose. But this is only half of the story. We discovered that a specific component of bacteria actually lowers blood glucose and allows insulin to work better during obesity. "Understanding how different parts of bacteria control glucose could lead to new therapies that avoid some of the problems with pro-biotics or pre-biotics. We have found a "post-biotic" that lowers blood glucose during obesity." This work is important as more than half of Canadians are overweight or obese, which leads to higher levels of blood insulin and glucose. These features of prediabetes can lead to type 2 diabetes. "But we haven't understood what triggers elevated blood glucose," said Schertzer. "This is significant because only some individuals with obesity develop prediabetes. Blood glucose is influenced by our genes, the food we eat, and the bacteria in our gut." His research team is working to develop new bacterial-based drugs to lower blood glucose and combat prediabetes before type 2 diabetes develops. At this time, they have had success in trials with mice with a drug currently used for osteosarcoma, a bone cancer. The research featured in Cell Metabolism was supported by the Canadian Institutes of Health Research, the Natural Sciences and Engineering Research Council of Canada and the Canadian Diabetes Association.


Not all cases of weight gain can be attributed to lack of willpower or excessive consumption of high calorie foods. In rare situations, obesity is triggered by genetic factors, which Canadian researchers found are more prevalent than previously estimated. Their work not only provides more insight into the genetic causes of obesity, but it could also be used to help millions of people all around the world take back control over their weight problem. According to senior study author David Meyre, associate professor at the McMaster University in Ontario and Canada Research Chair in Genetics of Obesity, a deeper understanding of a particular gene and the way it functions pinpoints to the faulty biological mechanism responsible for the onset of obesity. As he told CNN, detailed information on obesity genetics can find applications to the other forms of this condition, which is typically portrayed by a body mass index equal to or over 30. After looking into seven different databases and reviewing 161 papers cited in medical literature on this topic, researchers at the McMaster University and the University of British Columbia discovered the number of genetic conditions associated with obesity far exceeds prior calculations. The team led by Meyre found a staggering total of 79 genetic syndromes, as opposed to just under 30 formerly known. "These syndromes, although individually rare, are much more numerous and diverse than anticipated," said Yuvreet Kaur, first author of the study and BSc at McMaster University. In 19 of these cases, the syndromes were clarified through genetics, reaching the point where the condition could be detected via a plain lab test. A group of 11 other syndromes were partly resolved, whereas another 27 syndromes were linked to specific chromosomes. The remainder 22 syndromes are yet to be attributed to any genetic origin or chromosomal location. The new findings were featured March 27 in the journal Obesity Reviews. Meyre clarified several of the more frequent syndromes have been treated with hormone therapy, which proved effective in alleviating their symptoms. As he puts it, solving the genetics behind each syndrome would allow researchers to establish the most suitable course of treatment. One example is leptin, the "satiety hormone," whose genetic origin was discovered in 1990 and has greatly contributed to the subsequent comprehension of adipose cells. His research primarily targeted monogenic forms of obesity, in which the presence of a genetic mutation automatically triggers the onset of weight gain. In these extremely rare cases — which occur in just 0.5 percent of obese Canadians, literally one in a million — the syndromes provoke not only obesity, but "many additional clinical features, such as intellectual disability, facial and organ-specific abnormalities," detailed Meyre in a news release. His hope is that the study will enable medical professionals to identify these syndromes in their patients and provide appropriate treatments. Canadian statistics report nearly 20 percent of the population is obese, while in the United States obesity rates are even higher, at over 30 percent, with southern regions holding the record of America's fattest cities. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | April 26, 2017
Site: www.accesswire.com

VANCOUVER, BC / ACCESSWIRE / April 26, 2017 / VANGOLD RESOURCES LTD. (TSX-V: VAN) (OTC PINK: VNGRF) (the "Company" or "Vangold") is pleased to announce the appointments of Mr. Mark Ashley, Mr. Hernan Dorado Smith and Mr. Cameron Scott King to the Board of Directors of Vangold. Mr. Ashley, who is joining the board as a non-executive director, is a successful resource executive with over 30-years' experience in asset selection, mine development and corporate and strategic optimizations. Vangold will be relying on Mr. Ashley to bring his in-depth knowledge of the technical, commercial, and financial aspects to the development of the El Pinguico Mine. As CEO of LionOre Mining International based in Australia, Mr. Ashley led the successful growth of the company culminating in its takeover by Norilsk Nickel in 2007 for US$7 Billion. He has held senior executive roles with several internationally listed entities including Normandy Mining, Cluff Resources, Kagara Zinc and Apex Minerals. Mr. Ashley was also a director of the Australian Gold Council, the Royal Flying Doctor Service (Western Australia) and a Council Member for Curtin University (in West Australian). He has significant international corporate finance experience in the mining and resource sector and has worked for extensive periods in China, Turkey, UK and Australia. Mr. Ashley is a Fellow of the Chartered Institute of Management Accountants. Mr. Hernan Dorado Smith is a 5th generation mining engineer and possesses 15 years of underground and open pit mining experience. He has in-depth and local knowledge of the El Pinguico mine and the surrounding geological formation. Hernan has worked with several world class producers on major projects, such as, New Gold at Peak Mine, Australia and Rainy River, Canada; Panamerican Silver at Navidad, Argentina and La Preciosa, Mexico. His experience at the various stages of mining, pre-feasibility, feasibility, construction and operations bring considerable value to Vangold. Hernan graduated as a Mining Engineer from Universidad de Guanajuato in 2003, received an Executive MBA from Escuela Europea de Negocios, Salamanca in 2013, and is a member of the Mining of the Mineral and Metallurgical Society of America (MMSA). In addition, Vangold is also pleased to announce the appointment of Mr. Cameron King as a Director and Vangold's new President and CEO. Mr. King brings over 25 years' experience in investment banking strategy, mergers and acquisitions and building corporate development relationships. Mr. King was a member of the Corporate Banking team with the Bank of Nova Scotia specializing in M&A and Senior VP Mid-Market Finance with Jendens Financial, London UK. Throughout Mr. King`s career, he has held director positions with Petro Novus AG, Endeavor Energy, Quest Oil and Holloman Energy Corporation. Mr. King founded the mining engineering firm Camline Mining Wear Technologies Ltd. in 1994, specializing in mineral processing, operations and efficiencies. Mr. King obtained his MBA in 1991 from Lake Superior State University, Michigan and holds a degree in Chemical Engineering and Bachelor of Commerce from McMaster University. Mr. Dal Brynelsen has stepped down as President and CEO, but will remain as a director and Chairman of the Board. Vangold is extremely grateful for his almost 30 years of dedication to Vangold, and we will continue to rely on Dal`s guidance, experience and success. He is a founding director of Griffin Mining Limited (LSE:GFM), which is one of the few western mining companies operating in China. Mr. Keith Anderson has also resigned as director of the Company. Vangold would like to thank Mr. Keith Anderson for his continued support and wishes him the very best in his future endeavours. The company is pleased to announce that it has closed the final tranche of its $500,000 non-brokered private placement of $0.05 units (the "$0.05 Placement" - see news release dated December 13, 2016) and its $500,000 non-brokered private placement of $0.09 units (the "$0.09 Placement" - refer news release dated February 23, 2017). The final tranche of the $0.05 Placement consisted of 3,500,000 units at a price of $0.05 per unit for gross proceeds of $175,000 (for unit terms, see news release dated December 13, 2016). The securities issued in the final tranche have a hold period expiring August 25, 2017. The $0.09 Placement consisted of 5,555,556 units at a price of $0.09 per unit for gross proceeds of $500,000 (for unit terms, see news release dated February 23, 2017). Finder's fees were paid in the amount of $10,500 and 116,667 finder's warrants. All securities issued in the $0.09 Placement have a hold period expiring August 25, 2017. Vangold is a development stage silver company, focused on silver and gold production in Mexico and is aggressively pursuing its business plan of becoming a senior producer through the development of its existing mineral property assets and the pursuit through acquisition of additional mineral assets which contribute to Vangold achieving its aggressive corporate growth objectives. Neither the TSX Venture Exchange nor its Regulations Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This news release includes certain "Forward-Looking Statements" within the meaning of the United States Private Securities Litigation Reform Act of 1995 and applicable Canadian securities laws. When used in this news release, the words "anticipate", "believe", "estimate", "expect", "target", "plan", "forecast", "may", "schedule" and similar words or expressions, identify forward-looking statements or information. These forward-looking statements or information relate to, among other things: the price of silver and other metals; the accuracy of mineral reserve and resource estimates and estimates of future production and costs of production at our properties; estimated production rates for silver and other payable metals produced by us, the estimated cost of development of our development projects; the effects of laws, regulations and government policies on our operations, including, without limitation, the laws in Mexico which currently have significant restrictions related to mining; obtaining or maintaining necessary permits, licences and approvals from government authorities; and continued access to necessary infrastructure, including, without limitation, access to power, land, water and roads to carry on activities as planned. These statements reflect the Company's current views with respect to future events and are necessarily based upon a number of assumptions and estimates that, while considered reasonable by the Company, are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors, both known and unknown, could cause actual results, performance or achievements to be materially different from the results, performance or achievements that are or may be expressed or implied by such forward-looking statements or information and the Company has made assumptions and estimates based on or related to many of these factors. Such factors include, without limitation: fluctuations in the spot and forward price of silver, gold, base metals or certain other commodities (such as natural gas, fuel oil and electricity); fluctuations in the currency markets (such as the Canadian dollar and Mexican peso versus the U.S. dollar); changes in national and local government, legislation, taxation, controls, regulations and political or economic developments in Canada, Mexico; operating or technical difficulties in connection with mining or development activities; risks and hazards associated with the business of mineral exploration, development and mining (including environmental hazards, industrial accidents, unusual or unexpected formations, pressures, cave-ins and flooding); risks relating to the credit worthiness or financial condition of suppliers, refiners and other parties with whom the Company does business; inability to obtain adequate insurance to cover risks and hazards; and the presence of laws and regulations that may impose restrictions on mining, including those currently enacted in Mexico; employee relations; relationships with and claims by local communities and indigenous populations; availability and increasing costs associated with mining inputs and labour; the speculative nature of mineral exploration and development, including the risks of obtaining necessary licenses, permits and approvals from government authorities; diminishing quantities or grades of mineral reserves as properties are mined; the Company's title to properties; and the factors identified under the caption "Risk Factors" in the Company's Annual Information Form, under the caption "Risks Relating to Vangold Resource's Business". Investors are cautioned against attributing undue certainty to forward-looking statements or information. Although the Company has attempted to identify important factors that could cause actual results to differ materially, there may be other factors that cause results not to be anticipated, estimated or intended. The Company does not intend, and does not assume any obligation, to update these forward-looking statements or information to reflect changes in assumptions or changes in circumstances or any other events affecting such statements or information, other than as required by applicable law.


News Article | April 18, 2017
Site: news.yahoo.com

Being called a “faker” is an insult that stings. We resent fakers — and for good reason. We see “faking it” as lying in action a way to dupe the gullible. And we hate to find ourselves among the gullible. Not surprisingly, nobody wants to be perceived as a faker, and nobody wants a faker on their team. Yet, it turns out that, the ability to “fake it” — as a mental tool rather than a way to scam — is a powerful engine of career change and the self-reinvention it requires. It means stepping into a role you aren’t quite prepared for and retooling yourself for it on the fly — drawing on the assets you already have and accepting your inevitable stumbles along the way as part of the process. Understanding your stumbles this way, as well as developing a tolerance for the uncomfortable feelings that come with “faking it,” are valuable competitive assets in any self-reinvention. Of course, the ability to reinvent oneself is increasingly important nowadays, as artificial intelligence and other technological advances are launching waves of career upheaval and opportunity in many economic sectors. Read: This is how many U.S. jobs robots will create over the next 10 years In the years (and possibly months) to come, many jobs will be revamped, redefined, or even outright eliminated—and not just those of truck drivers and call center operators. A torrent of change is coming for lawyers, doctors, and others with years of expensive professional training — training which doesn’t make them immune from the job-plundering waves of new technologies. Yet another common driver of career reinvention is job dissatisfaction. We may recognize — sometimes midcareer — that the job we’re in is a poor fit for our personality or needs. Masters of self-reinvention — call them “mindshifters” — realize that the first step of breaking out of career dead zones and doing any kind of reinvention generally involves feeling like a fake. The psychological term for these feelings is the “impostor syndrome.” These feelings of imposterhood often arise when we’re learning something new. After all, we usually are less competent than others who are further down the new path we’re taking. Psychologists commonly say that these feelings of imposterhood are bad — that we shouldn’t be thinking of how we’re not on a par with others; we should instead be mustering feelings of confidence in ourselves and our ability to succeed. Master mindshifters know better. Rather than seeking to squash feelings of imposterhood, they embrace these feelings. Learning a new discipline is fostered by a “beginners’ mind” — an open willingness to grow and change. Such a mindset is—oddly enough—harder to achieve when you’re confident. Although confidence is important in long-term success, it may impede the openness to learning from others that is an integral part of growing into a new career. In fact, overconfidence has killed many a potential personal reinvention. When combined with a shortage of competence, it’s dashed the plans of would-be restaurateurs. New non-profits go under when the well-meaning management team has an overly rosy view about financing their helpful intentions. Even scientists crash and burn. A distinguished professor of physics decided to shift to neuroscience. He set up a lab, got a post-doctoral assistant, and launched into research—but eventually found his lab shut down because he was too dedicated to his version of reality to learn from others in his new discipline. Of course, if you fear career change because you’re starting from home plate in a field where others are already on third base, you’re not alone. The reality is, whether you’re switching from working as a language translator to becoming a mechanical engineer, or from being an Uber driver into computer programming, you have underlying meta-skills you can transfer over to enhance your new career. (Yes, even if you’re an Uber driver. Being able to talk easily and comfortably with others is an invaluable skill that many computer programmers envy—and need.) During any career change or personal reinvention, you will inevitably have times—sometimes frequently—where you feel like a fake. Don’t shove them away. Embrace those feelings and use them to retain your openness. Meanwhile, keep going and growing. Eventually, you should look up from your new job and realize that you’ve reinvented yourself—and have indeed become the expert you had been pretending to be. Barbara Oakley, PhD, is the Ramón y Cajal Distinguished Scholar of Global Digital Learning, McMaster University, and the author of the new book “Mindshift: Break Through Obstacles to Learning and Discover Your Hidden Potential” (Tarcher-Perigee, 2017).


News Article | April 26, 2017
Site: www.sciencemag.org

Fifty thousand years ago, a Neandertal relieved himself in a cave in present-day Belgium, depositing, among other things, a sample of his DNA. The urine clung to minerals in the soil and the feces eventually decomposed. But traces of the DNA remained, embedded in the cave floor, where earth falling from the cave’s ceiling and blowing in from outside eventually entombed it. Now, researchers have shown they can find and identify such genetic traces of both Neandertals and Denisovans, another type of  archaic human, enabling them to test for the presence of ancient humans even in sites where no bones have been found. “It’s a great breakthrough,” says Chris Stringer, an anthropologist at the Natural History Museum in London. “Anyone who’s digging cave sites from the Pleistocene now should put [screening sediments for human DNA] on their list of things that they must do.” Adds Svante Pääbo, the head of the Max Planck Institute for Evolutionary Anthropology in Leipzig, Germany, where the work was done: “I think this will become a standard tool in archaeology, maybe even like radiocarbon dating.” Scientists have known that DNA can survive in ancient sediments since 2003, when Eske Willerslev, an evolutionary geneticist at the University of Copenhagen, sequenced the DNA of mammoths, horses, and 19 plant taxa from cores drawn from Siberian permafrost and temperate caves. But at the time, Willerslev recalls, he had no way of distinguishing ancient human sequences from the modern ones that can contaminate samples as they are handled. Since then, techniques for filtering out such contamination have improved, which encouraged Max Planck geneticist Matthias Meyer to try to sieve out human DNA from sediments in once-occupied caves. When Meyer and Max Planck doctoral student Viviane Slon first sequenced environmental DNA from Pleistocene cave sediments around Europe, the data overwhelmed them. “It’s on the order of trillions of DNA fragments in a sample the size of a teaspoon,” Meyer says. Only a tiny fraction of those fragments might belong to ancient humans. To capture them, the researchers developed a delicate DNA hook, crafted from modern human DNA from the mitochondria, the tiny power plants that produce energy for cells. The molecular hook fished out the sequences that most resembled it, which Meyer and Slon then compared to known mitochondrial DNA (mtDNA) sequences from Neandertals and Denisovans. They looked for mtDNA because it is much more abundant than nuclear DNA, with thousands of copies per cell. The pair worried that human DNA would be so scarce that even their careful fishing would fail to find it. “My jaw dropped,” Slon said, at the sight of the first Neandertal sequences. She and Meyer detected Neandertal DNA in sediment from four of seven cave sites, ranging from Spain to Russia, where archaic humans were known to have lived, they report in a story published online today. They also found Denisovan DNA from sediment in Denisova Cave, the Siberian site containing the only known Denisovan bones. There, both Neandertal and Denisovan DNA emerged from layers where no bones had been found, pushing back the period of human occupation by tens of thousands of years. Meyer and Slon even managed to find Neandertal DNA in Belgium’s Trou Al’Wesse Cave, which contains no Neandertal bones at all—only characteristic stone tools. Meyer and Slon also analyzed the DNA of other mammals known to have inhabited the caves, based on bones found there. The DNA and bones told the same story about when and where the animals were present, giving the researchers confidence that chronologies derived from soil DNA are reliable. “I’m so happy to see the field move in this direction,” says Hendrik Poinar, head of the ancient DNA lab at McMaster University in Hamilton, Canada. Several researchers say ancient DNA from sediments will help them complete the map of ancient human occupations and allow them to see where species may have overlapped and interacted. That’s important because bones of humans are extremely rare. For example, ancient human DNA might have strengthened the controversial claim this week of the oldest human presence in the Americas. “If one must rely on finding bones, one will always have incomplete data,” says Beth Shapiro, an evolutionary biologist at the University of California, Santa Cruz. “By isolating DNA directly from sediments, we can dramatically expand what we know about where people were, when they got there, and how long they stayed.” This could be particularly important for the Denisovans, identified so far only from one cave. Genetic traces lingering in living people suggest that this archaic species must once have lived across Asia. But researchers don’t know exactly where, or when. Stringer suspects ancient human DNA from sediments could also help resolve whether certain controversial stone tool technologies, such as the Uluzzian found in Italy, were made by modern humans or Neandertals. It could even reveal the existence of ancient human species that scientists don’t yet know about, he says. “What else is out there?”


News Article | April 26, 2017
Site: www.accesswire.com

VANCOUVER, BC / ACCESSWIRE / April 26, 2017 / VANGOLD RESOURCES LTD. (TSXV: VAN) (OTC PINK: VNGRF) (the "Company" or "Vangold") is pleased to announce the appointments of Mr. Mark Ashley, Mr. Hernan Dorado Smith and Mr. Cameron Scott King to the Board of Directors of Vangold. Mr. Ashley is a successful resource executive with over 30-years' experience in asset selection and optimizing mining properties for production. Vangold will be relying on Mr. Ashley to bring his in-depth knowledge of the technical, commercial, and financial aspects to the development of the El Pinguico Mine. As CEO of LionOre Mining International, Mr. Ashley led the successful takeover by Norilsk Nickel in 2007 for $6 Billion CDN. He has held senior executive roles in several internationally listed entities including Normandy Mining, Cluff Resources, Kagara Zinc and Apex Minerals. Mr. Ashley was also a director of the Australian Gold Council, the World Gold Council and a Council Member for Curtin University (in West Australian). He has significant international corporate finance experience in the mining and resource sector and has worked in China, Turkey, UK and Australia. Mr. Ashley is a registered FCMA and Graduate of Emile Woolf University, London. Mr. Hernan Dorado Smith is a 5th generation mining engineer and possesses 15 years of underground and open pit mining experience. He has in-depth and local knowledge of the El Pinguico mine and the surrounding geological formation. Hernan has worked with several world class producers on major projects, such as, New Gold at Peak Mine, Australia and Rainy River, Canada; Panamerican Silver at Navidad, Argentina and La Preciosa, Mexico. His experience at the various stages of mining, pre-feasibility, feasibility, construction and operations bring considerable value to Vangold. Hernan graduated as a Mining Engineer from Universidad de Guanajuato in 2003, received an Executive MBA from Escuela Europea de Negocios, Salamanca in 2013, and is a member of the Mining of the Mineral and Metallurgical Society of America (MMSA). In addition, Vangold is also pleased to announce the appointment of Mr. Cameron King as a Director and Vangold's new President and CEO. Mr. King brings over 25 years' experience in investment banking strategy, mergers and acquisitions and building corporate development relationships. Mr. King was a member of the Corporate Banking team with the Bank of Nova Scotia specializing in M&A and Senior VP Mid-Market Finance with Jendens Financial, London UK. Throughout Mr. King`s career, he has held director positions with Petro Novus AG, Endeavor Energy, Quest Oil and Holloman Energy Corporation. Mr. King founded the mining engineering firm Camline Mining Wear Technologies Ltd. in 1994, specializing in mineral processing, operations and efficiencies. Mr. King obtained his MBA in 1991 from Lake Superior State University, Michigan and holds a degree in Chemical Engineering and Bachelor of Commerce from McMaster University. Mr. Dal Brynelsen has stepped down as President and CEO, but will remain as a director and Chairman of the Board. Vangold is extremely grateful for his almost 30 years of dedication to Vangold, and we will continue to rely on Dal`s guidance, experience and success. He is a founding director of Griffin Mining Limited (LSE: GFM), which is one of the few western mining companies operating China. Mr. Keith Anderson has also resigned as director of the Company. Vangold would like to thank Mr. Keith Anderson for his continued support and wishes him the very best in his future endeavours. The company is pleased to announce that it has closed the final tranche of its $500,000 non-brokered private placement of $0.05 units (the "$0.05 Placement" - see news release dated December 13, 2016) and its $500,000 non-brokered private placement of $0.09 units (the "$0.09 Placement" - refer news release dated February 23, 2017). The final tranche of the $0.05 Placement consisted of 3,500,000 units at a price of $0.05 per unit for gross proceeds of $175,000 (for unit terms, see news release dated December 13, 2016). The securities issued in the final tranche have a hold period expiring August 25, 2017. The $0.09 Placement consisted of 5,555,556 units at a price of $0.09 per unit for gross proceeds of $500,000 (for unit terms, see news release dated February 23, 2017). Finder's fees were paid in the amount of $10,500 and 116,667 finder's warrants. All securities issued in the $0.09 Placement have a hold period expiring August 25, 2017. Vangold is a development stage silver company, focused on silver and gold production in Mexico and is aggressively pursuing its business plan of becoming a senior producer through the development of its existing mineral property assets and the pursuit through acquisition of additional mineral assets which contribute to Vangold achieving its aggressive corporate growth objectives. Neither the TSX Venture Exchange nor its Regulations Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This news release includes certain "Forward-Looking Statements" within the meaning of the United States Private Securities Litigation Reform Act of 1995 and applicable Canadian securities laws. When used in this news release, the words "anticipate", "believe", "estimate", "expect", "target", "plan", "forecast", "may", "schedule" and similar words or expressions, identify forward-looking statements or information. These forward-looking statements or information relate to, among other things: the price of silver and other metals; the accuracy of mineral reserve and resource estimates and estimates of future production and costs of production at our properties; estimated production rates for silver and other payable metals produced by us, the estimated cost of development of our development projects; the effects of laws, regulations and government policies on our operations, including, without limitation, the laws in Mexico which currently have significant restrictions related to mining; obtaining or maintaining necessary permits, licences and approvals from government authorities; and continued access to necessary infrastructure, including, without limitation, access to power, land, water and roads to carry on activities as planned. These statements reflect the Company's current views with respect to future events and are necessarily based upon a number of assumptions and estimates that, while considered reasonable by the Company, are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors, both known and unknown, could cause actual results, performance or achievements to be materially different from the results, performance or achievements that are or may be expressed or implied by such forward-looking statements or information and the Company has made assumptions and estimates based on or related to many of these factors. Such factors include, without limitation: fluctuations in the spot and forward price of silver, gold, base metals or certain other commodities (such as natural gas, fuel oil and electricity); fluctuations in the currency markets (such as the Canadian dollar and Mexican peso versus the U.S. dollar); changes in national and local government, legislation, taxation, controls, regulations and political or economic developments in Canada, Mexico; operating or technical difficulties in connection with mining or development activities; risks and hazards associated with the business of mineral exploration, development and mining (including environmental hazards, industrial accidents, unusual or unexpected formations, pressures, cave-ins and flooding); risks relating to the credit worthiness or financial condition of suppliers, refiners and other parties with whom the Company does business; inability to obtain adequate insurance to cover risks and hazards; and the presence of laws and regulations that may impose restrictions on mining, including those currently enacted in Mexico; employee relations; relationships with and claims by local communities and indigenous populations; availability and increasing costs associated with mining inputs and labour; the speculative nature of mineral exploration and development, including the risks of obtaining necessary licenses, permits and approvals from government authorities; diminishing quantities or grades of mineral reserves as properties are mined; the Company's title to properties; and the factors identified under the caption "Risk Factors" in the Company's Annual Information Form, under the caption "Risks Relating to Vangold Resource's Business." Investors are cautioned against attributing undue certainty to forward-looking statements or information. Although the Company has attempted to identify important factors that could cause actual results to differ materially, there may be other factors that cause results not to be anticipated, estimated or intended. The Company does not intend, and does not assume any obligation, to update these forward-looking statements or information to reflect changes in assumptions or changes in circumstances or any other events affecting such statements or information, other than as required by applicable law.


News Article | April 20, 2017
Site: www.sciencemag.org

Naked mole rats are the superheroes of lab animals. They show few signs of aging, are resistant to some types of pain, and almost never get cancer. Now, scientists have discovered another superpower: The animals can survive more than 18 minutes without oxygen. They do that by essentially switching their bodies from using one fuel to another—a strategy that might point to new ways of combatting strokes and heart attacks in people. “This is an exceptional feat for a mammal,” says Grant McClelland, a comparative exercise physiologist at McMaster University in Hamilton, Canada, who was not involved in the work. Naked mole rats are unusually resistant to air containing high levels of carbon dioxide or little oxygen. The mouse-size hairless mammals live in colonies of up to 300 individuals in underground burrows where oxygen can be scarce. To find out just how little oxygen they need, Thomas Park, a neuroscientist at the University of Illinois in Chicago, and Gary Lewin, a physiologist at the Max Delbrück Center for Molecular Medicine in Berlin, put naked mole rats and mice in a chamber with no oxygen. Mice died in less than a minute. Not so for the naked mole rats. Their heartbeat slowed from 200 to 50 beats per minute, and they quickly lost consciousness. But even after 18 minutes in the chamber, they recovered completely when exposed to normal air, the researchers write today in  . The trick may have to do with how naked mole rats metabolize sugar. Humans and other mammals break down the sugar glucose to generate energy in a multistep process called glycolysis. That process requires oxygen; without it, byproducts such as lactate build up that inhibit the first steps of glycolysis, and energy production ceases. Energy stores are quickly depleted, especially in the brain, and cells start dying. Looking for chemical changes in the oxygen-deprived naked mole rats, the researchers found sharply higher levels of two sugars in the blood, fructose and sucrose (a molecule consisting of fructose and glucose). And compared with other mammals, those mole rats also had higher levels throughout the body of both GLUT5—a molecule that transports fructose into cells—and an enzyme that converts fructose into a form that can enter glycolysis. “Together this allows the naked mole rat to use fructose as fuel instead of glucose when there is no oxygen,” Lewin says. Because fructose enters glycolysis at a later stage, energy production can go on if no oxygen is present and the first steps of glycolysis are blocked. According to McClelland, even fish or turtles that can survive long periods without oxygen have not modified glycolysis in that way. “It is a great example of evolution finding different solutions for the same or similar environmental challenges,” he says. “I’m fascinated by this glucose-to-fructose switch,” says Rochelle Buffenstein, a biologist at Calico, a research company in South San Francisco, California, that former Google board member Arthur Levinson founded to combat aging. Buffenstein has studied naked mole rats for more than 30 years and says the animals still manage to surprise her. Researchers should start to look whether other animals in low-oxygen environments have evolved to use fructose that way, she says, adding, “there’s a whole world of wonderful, crazy critters out there.” Still, how important the switch to fructose is for the animals’ survival isn’t clear, cautions Göran Erik Nilsson, a comparative physiologist at the University of Oslo. Other mechanisms such as slowing down metabolism play a role, as does the mole rats’ unusually low body temperature, a cool 30°C. Better understanding the mole rat’s energy switchover will be key to any hope of somehow using it to help humans. During a stroke or a heart attack, for example, oxygen flow to the brain is interrupted and brain cells begin to die within minutes, Park says. “If we could activate the fructose pathway, we could significantly extend that time span,” he predicts. “I’m very excited by this paper,” Buffenstein says. “I’m looking forward to seeing what happens next.”


News Article | April 21, 2017
Site: cen.acs.org

Naked mole rats are famous for their lovable ugliness, their extremely long lives, their ability to evade cancer, and now, too, their capacity to survive without oxygen for 18 minutes. This suffocating experience would kill a mouse—a mammal of similar size, albeit with significantly more hair. According to a new study, the naked mole rat manages the feat by altering its metabolism (Science 2017, DOI: 10.1126/science.aan1505). Naked mole rats are both social and subterranean: The population in one of their underground colonies can surge to nearly 300 members. As a result, the air in these confined, packed spaces is often low in oxygen and high in carbon dioxide. To survive these conditions, naked mole rats switch to fueling their energy-producing glycolysis pathways with fructose instead of glucose, explains Gary R. Lewin of the Max Delbrück Center for Molecular Medicine, who led the research with postdoc Jane Reznick and Thomas J. Park of the University of Illinois, Chicago. For other mammals, low oxygen conditions trigger a shutdown of glycolysis. Without this metabolic pathway, cells can’t produce adenosine triphosphate (ATP), a chemical unit of energy currency. No ATP means that cells eventually run out of energy and die, killing the organism in the process. Naked mole rats manage to avoid total glycolysis shutdown and death by pumping fructose into their cells during oxygen crises. Fructose feeds into the glycolysis pathway by bypassing a regulatory step that typically shuts down the ATP-making process in low-oxygen conditions. “Like a cab driver taking a back-road detour around stopped traffic, this rewiring of metabolism permits continued flux through glycolysis,” explain University of Nebraska, Lincoln’s Jay F. Storz and McMaster University’s Grant B. McClelland in a commentary associated with the study (Science 2017, DOI: 10.1126/science.aab3896). “Because every aspect of naked mole rat biology seems to be unusual and bizarre in some way,” the scientists add, “it is perhaps not surprising that they have evolved a particular means of tolerating low oxygen conditions.”


News Article | April 17, 2017
Site: cen.acs.org

Among the most nefarious human pathogens are bacteria with two sets of membranes protecting their innards. The doubled armor can prevent antibiotics from penetrating these so-called Gram-negative bacteria, and it can help them develop resistance to antibiotics. Now a team led by Eric Brown at McMaster University has found a way to weaken the outer membrane of Gram-negative microbes so that previously unusable drugs can penetrate and kill the pathogens—including several multi-drug-resistant strains (Nat. Microbiol. 2017, DOI: 10.1038/nmicrobiol.2017.28). In late February, the World Health Organization published a list of our planet’s most problematic bacterial pathogens. The top three are multi-drug-resistant Gram-negative microbes from the Acinetobacter and Pseudomonas genera and Enterobacteriaceae family. They can cause life-threatening pneumonia or systemic infections, and patients are increasingly acquiring them in hospitals. As a last resort, doctors can treat infected people with antibiotics that are toxic to nerve and kidney cells. But bacteria are developing resistance to even these suboptimal drugs, threatening “to cause a serious breach in our last line of defense against multi-drug-resistant Gram-negative pathogens,” Brown explains. To tackle this problem, Brown and colleagues looked for compounds that disrupt the outer membranes of Gram-negative bacteria. They found an existing drug, pentamidine, which doctors often use to kill the protozoan pathogens that cause sleeping sickness and leishmaniasis. After infecting mice with multi-drug-resistant Acinetobacter baumannii, the team could cure the animals by administering a combination of pentamidine and antibiotics for Gram-positive pathogens, bacteria with only one membrane. “Pentamidine can breathe life into drugs we don’t usually use for Gram-negative infections because they wouldn’t have been able to cross the outer membrane,” comments Robert Hancock, a University of British Columbia microbiologist who characterized Gram-negative pathogens early in his career and now focuses on battling antibiotic resistance. “And another exciting thing is that pentamidine is already a drug,” he adds. So there’s a possibility it could be fast-tracked by regulatory agencies such as the Food & Drug Administration because it’s already been proved safe in humans. The new work supports a growing belief among scientists that developing compounds to weaken rather than kill bacteria can lessen pathogens’ evolutionary drive to become resistant. Once weakened, the pathogens can be killed with a drug that wouldn’t otherwise work. “The idea,” Brown adds, “is to add an agent to take care of a resistance mechanism, or in this case, to get around intrinsic resistance.” But to date, Brown says only one success story for this strategy in the clinic comes to mind: bacteria that are resistant to antibiotics with a β-lactam ring in their structure (a family of broad-spectrum drugs that includes penicillin). These antibiotic-resistant bacteria have enzymes that break down the ring structure. So doctors prescribe β-lactamase inhibitors—weakening agents—along with β-lactam antibiotics to kill the pathogens. This article has been translated into Spanish by Divulgame.org and can be found here.


News Article | April 26, 2017
Site: marketersmedia.com

VANCOUVER, BC / ACCESSWIRE / April 26, 2017 / VANGOLD RESOURCES LTD. (TSXV: VAN) (OTC PINK: VNGRF) (the "Company" or "Vangold") is pleased to announce the appointments of Mr. Mark Ashley, Mr. Hernan Dorado Smith and Mr. Cameron Scott King to the Board of Directors of Vangold. Mr. Ashley is a successful resource executive with over 30-years' experience in asset selection and optimizing mining properties for production. Vangold will be relying on Mr. Ashley to bring his in-depth knowledge of the technical, commercial, and financial aspects to the development of the El Pinguico Mine. As CEO of LionOre Mining International, Mr. Ashley led the successful takeover by Norilsk Nickel in 2007 for $6 Billion CDN. He has held senior executive roles in several internationally listed entities including Normandy Mining, Cluff Resources, Kagara Zinc and Apex Minerals. Mr. Ashley was also a director of the Australian Gold Council, the World Gold Council and a Council Member for Curtin University (in West Australian). He has significant international corporate finance experience in the mining and resource sector and has worked in China, Turkey, UK and Australia. Mr. Ashley is a registered FCMA and Graduate of Emile Woolf University, London. Mr. Hernan Dorado Smith is a 5th generation mining engineer and possesses 15 years of underground and open pit mining experience. He has in-depth and local knowledge of the El Pinguico mine and the surrounding geological formation. Hernan has worked with several world class producers on major projects, such as, New Gold at Peak Mine, Australia and Rainy River, Canada; Panamerican Silver at Navidad, Argentina and La Preciosa, Mexico. His experience at the various stages of mining, pre-feasibility, feasibility, construction and operations bring considerable value to Vangold. Hernan graduated as a Mining Engineer from Universidad de Guanajuato in 2003, received an Executive MBA from Escuela Europea de Negocios, Salamanca in 2013, and is a member of the Mining of the Mineral and Metallurgical Society of America (MMSA). In addition, Vangold is also pleased to announce the appointment of Mr. Cameron King as a Director and Vangold's new President and CEO. Mr. King brings over 25 years' experience in investment banking strategy, mergers and acquisitions and building corporate development relationships. Mr. King was a member of the Corporate Banking team with the Bank of Nova Scotia specializing in M&A and Senior VP Mid-Market Finance with Jendens Financial, London UK. Throughout Mr. King`s career, he has held director positions with Petro Novus AG, Endeavor Energy, Quest Oil and Holloman Energy Corporation. Mr. King founded the mining engineering firm Camline Mining Wear Technologies Ltd. in 1994, specializing in mineral processing, operations and efficiencies. Mr. King obtained his MBA in 1991 from Lake Superior State University, Michigan and holds a degree in Chemical Engineering and Bachelor of Commerce from McMaster University. Mr. Dal Brynelsen has stepped down as President and CEO, but will remain as a director and Chairman of the Board. Vangold is extremely grateful for his almost 30 years of dedication to Vangold, and we will continue to rely on Dal`s guidance, experience and success. He is a founding director of Griffin Mining Limited (LSE: GFM), which is one of the few western mining companies operating China. Mr. Keith Anderson has also resigned as director of the Company. Vangold would like to thank Mr. Keith Anderson for his continued support and wishes him the very best in his future endeavours. The company is pleased to announce that it has closed the final tranche of its $500,000 non-brokered private placement of $0.05 units (the "$0.05 Placement" - see news release dated December 13, 2016) and its $500,000 non-brokered private placement of $0.09 units (the "$0.09 Placement" - refer news release dated February 23, 2017). The final tranche of the $0.05 Placement consisted of 3,500,000 units at a price of $0.05 per unit for gross proceeds of $175,000 (for unit terms, see news release dated December 13, 2016). The securities issued in the final tranche have a hold period expiring August 25, 2017. The $0.09 Placement consisted of 5,555,556 units at a price of $0.09 per unit for gross proceeds of $500,000 (for unit terms, see news release dated February 23, 2017). Finder's fees were paid in the amount of $10,500 and 116,667 finder's warrants. All securities issued in the $0.09 Placement have a hold period expiring August 25, 2017. Vangold is a development stage silver company, focused on silver and gold production in Mexico and is aggressively pursuing its business plan of becoming a senior producer through the development of its existing mineral property assets and the pursuit through acquisition of additional mineral assets which contribute to Vangold achieving its aggressive corporate growth objectives. Neither the TSX Venture Exchange nor its Regulations Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This news release includes certain "Forward-Looking Statements" within the meaning of the United States Private Securities Litigation Reform Act of 1995 and applicable Canadian securities laws. When used in this news release, the words "anticipate", "believe", "estimate", "expect", "target", "plan", "forecast", "may", "schedule" and similar words or expressions, identify forward-looking statements or information. These forward-looking statements or information relate to, among other things: the price of silver and other metals; the accuracy of mineral reserve and resource estimates and estimates of future production and costs of production at our properties; estimated production rates for silver and other payable metals produced by us, the estimated cost of development of our development projects; the effects of laws, regulations and government policies on our operations, including, without limitation, the laws in Mexico which currently have significant restrictions related to mining; obtaining or maintaining necessary permits, licences and approvals from government authorities; and continued access to necessary infrastructure, including, without limitation, access to power, land, water and roads to carry on activities as planned. These statements reflect the Company's current views with respect to future events and are necessarily based upon a number of assumptions and estimates that, while considered reasonable by the Company, are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors, both known and unknown, could cause actual results, performance or achievements to be materially different from the results, performance or achievements that are or may be expressed or implied by such forward-looking statements or information and the Company has made assumptions and estimates based on or related to many of these factors. Such factors include, without limitation: fluctuations in the spot and forward price of silver, gold, base metals or certain other commodities (such as natural gas, fuel oil and electricity); fluctuations in the currency markets (such as the Canadian dollar and Mexican peso versus the U.S. dollar); changes in national and local government, legislation, taxation, controls, regulations and political or economic developments in Canada, Mexico; operating or technical difficulties in connection with mining or development activities; risks and hazards associated with the business of mineral exploration, development and mining (including environmental hazards, industrial accidents, unusual or unexpected formations, pressures, cave-ins and flooding); risks relating to the credit worthiness or financial condition of suppliers, refiners and other parties with whom the Company does business; inability to obtain adequate insurance to cover risks and hazards; and the presence of laws and regulations that may impose restrictions on mining, including those currently enacted in Mexico; employee relations; relationships with and claims by local communities and indigenous populations; availability and increasing costs associated with mining inputs and labour; the speculative nature of mineral exploration and development, including the risks of obtaining necessary licenses, permits and approvals from government authorities; diminishing quantities or grades of mineral reserves as properties are mined; the Company's title to properties; and the factors identified under the caption "Risk Factors" in the Company's Annual Information Form, under the caption "Risks Relating to Vangold Resource's Business." Investors are cautioned against attributing undue certainty to forward-looking statements or information. Although the Company has attempted to identify important factors that could cause actual results to differ materially, there may be other factors that cause results not to be anticipated, estimated or intended. The Company does not intend, and does not assume any obligation, to update these forward-looking statements or information to reflect changes in assumptions or changes in circumstances or any other events affecting such statements or information, other than as required by applicable law. VANCOUVER, BC / ACCESSWIRE / April 26, 2017 / VANGOLD RESOURCES LTD. (TSXV: VAN) (OTC PINK: VNGRF) (the "Company" or "Vangold") is pleased to announce the appointments of Mr. Mark Ashley, Mr. Hernan Dorado Smith and Mr. Cameron Scott King to the Board of Directors of Vangold. Mr. Ashley is a successful resource executive with over 30-years' experience in asset selection and optimizing mining properties for production. Vangold will be relying on Mr. Ashley to bring his in-depth knowledge of the technical, commercial, and financial aspects to the development of the El Pinguico Mine. As CEO of LionOre Mining International, Mr. Ashley led the successful takeover by Norilsk Nickel in 2007 for $6 Billion CDN. He has held senior executive roles in several internationally listed entities including Normandy Mining, Cluff Resources, Kagara Zinc and Apex Minerals. Mr. Ashley was also a director of the Australian Gold Council, the World Gold Council and a Council Member for Curtin University (in West Australian). He has significant international corporate finance experience in the mining and resource sector and has worked in China, Turkey, UK and Australia. Mr. Ashley is a registered FCMA and Graduate of Emile Woolf University, London. Mr. Hernan Dorado Smith is a 5th generation mining engineer and possesses 15 years of underground and open pit mining experience. He has in-depth and local knowledge of the El Pinguico mine and the surrounding geological formation. Hernan has worked with several world class producers on major projects, such as, New Gold at Peak Mine, Australia and Rainy River, Canada; Panamerican Silver at Navidad, Argentina and La Preciosa, Mexico. His experience at the various stages of mining, pre-feasibility, feasibility, construction and operations bring considerable value to Vangold. Hernan graduated as a Mining Engineer from Universidad de Guanajuato in 2003, received an Executive MBA from Escuela Europea de Negocios, Salamanca in 2013, and is a member of the Mining of the Mineral and Metallurgical Society of America (MMSA). In addition, Vangold is also pleased to announce the appointment of Mr. Cameron King as a Director and Vangold's new President and CEO. Mr. King brings over 25 years' experience in investment banking strategy, mergers and acquisitions and building corporate development relationships. Mr. King was a member of the Corporate Banking team with the Bank of Nova Scotia specializing in M&A and Senior VP Mid-Market Finance with Jendens Financial, London UK. Throughout Mr. King`s career, he has held director positions with Petro Novus AG, Endeavor Energy, Quest Oil and Holloman Energy Corporation. Mr. King founded the mining engineering firm Camline Mining Wear Technologies Ltd. in 1994, specializing in mineral processing, operations and efficiencies. Mr. King obtained his MBA in 1991 from Lake Superior State University, Michigan and holds a degree in Chemical Engineering and Bachelor of Commerce from McMaster University. Mr. Dal Brynelsen has stepped down as President and CEO, but will remain as a director and Chairman of the Board. Vangold is extremely grateful for his almost 30 years of dedication to Vangold, and we will continue to rely on Dal`s guidance, experience and success. He is a founding director of Griffin Mining Limited (LSE: GFM), which is one of the few western mining companies operating China. Mr. Keith Anderson has also resigned as director of the Company. Vangold would like to thank Mr. Keith Anderson for his continued support and wishes him the very best in his future endeavours. The company is pleased to announce that it has closed the final tranche of its $500,000 non-brokered private placement of $0.05 units (the "$0.05 Placement" - see news release dated December 13, 2016) and its $500,000 non-brokered private placement of $0.09 units (the "$0.09 Placement" - refer news release dated February 23, 2017). The final tranche of the $0.05 Placement consisted of 3,500,000 units at a price of $0.05 per unit for gross proceeds of $175,000 (for unit terms, see news release dated December 13, 2016). The securities issued in the final tranche have a hold period expiring August 25, 2017. The $0.09 Placement consisted of 5,555,556 units at a price of $0.09 per unit for gross proceeds of $500,000 (for unit terms, see news release dated February 23, 2017). Finder's fees were paid in the amount of $10,500 and 116,667 finder's warrants. All securities issued in the $0.09 Placement have a hold period expiring August 25, 2017. Vangold is a development stage silver company, focused on silver and gold production in Mexico and is aggressively pursuing its business plan of becoming a senior producer through the development of its existing mineral property assets and the pursuit through acquisition of additional mineral assets which contribute to Vangold achieving its aggressive corporate growth objectives. Neither the TSX Venture Exchange nor its Regulations Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This news release includes certain "Forward-Looking Statements" within the meaning of the United States Private Securities Litigation Reform Act of 1995 and applicable Canadian securities laws. When used in this news release, the words "anticipate", "believe", "estimate", "expect", "target", "plan", "forecast", "may", "schedule" and similar words or expressions, identify forward-looking statements or information. These forward-looking statements or information relate to, among other things: the price of silver and other metals; the accuracy of mineral reserve and resource estimates and estimates of future production and costs of production at our properties; estimated production rates for silver and other payable metals produced by us, the estimated cost of development of our development projects; the effects of laws, regulations and government policies on our operations, including, without limitation, the laws in Mexico which currently have significant restrictions related to mining; obtaining or maintaining necessary permits, licences and approvals from government authorities; and continued access to necessary infrastructure, including, without limitation, access to power, land, water and roads to carry on activities as planned. These statements reflect the Company's current views with respect to future events and are necessarily based upon a number of assumptions and estimates that, while considered reasonable by the Company, are inherently subject to significant business, economic, competitive, political and social uncertainties and contingencies. Many factors, both known and unknown, could cause actual results, performance or achievements to be materially different from the results, performance or achievements that are or may be expressed or implied by such forward-looking statements or information and the Company has made assumptions and estimates based on or related to many of these factors. Such factors include, without limitation: fluctuations in the spot and forward price of silver, gold, base metals or certain other commodities (such as natural gas, fuel oil and electricity); fluctuations in the currency markets (such as the Canadian dollar and Mexican peso versus the U.S. dollar); changes in national and local government, legislation, taxation, controls, regulations and political or economic developments in Canada, Mexico; operating or technical difficulties in connection with mining or development activities; risks and hazards associated with the business of mineral exploration, development and mining (including environmental hazards, industrial accidents, unusual or unexpected formations, pressures, cave-ins and flooding); risks relating to the credit worthiness or financial condition of suppliers, refiners and other parties with whom the Company does business; inability to obtain adequate insurance to cover risks and hazards; and the presence of laws and regulations that may impose restrictions on mining, including those currently enacted in Mexico; employee relations; relationships with and claims by local communities and indigenous populations; availability and increasing costs associated with mining inputs and labour; the speculative nature of mineral exploration and development, including the risks of obtaining necessary licenses, permits and approvals from government authorities; diminishing quantities or grades of mineral reserves as properties are mined; the Company's title to properties; and the factors identified under the caption "Risk Factors" in the Company's Annual Information Form, under the caption "Risks Relating to Vangold Resource's Business." Investors are cautioned against attributing undue certainty to forward-looking statements or information. Although the Company has attempted to identify important factors that could cause actual results to differ materially, there may be other factors that cause results not to be anticipated, estimated or intended. The Company does not intend, and does not assume any obligation, to update these forward-looking statements or information to reflect changes in assumptions or changes in circumstances or any other events affecting such statements or information, other than as required by applicable law.


News Article | April 17, 2017
Site: cen.acs.org

Among the most nefarious human pathogens are bacteria with two sets of membranes protecting their innards. The doubled armor can prevent antibiotics from penetrating these so-called Gram-negative bacteria, and it can help them develop resistance to antibiotics. Now a team led by Eric Brown at McMaster University has found a way to weaken the outer membrane of Gram-negative microbes so that previously unusable drugs can penetrate and kill the pathogens—including several multidrug . . .


News Article | May 8, 2017
Site: www.eurekalert.org

Hamilton, ON (May 8, 2017) -- Canadian physicians are being advised to reduce their prescribing of opioid medication to patients with chronic non-cancer pain in a new guideline for clinical care that focuses on harm reduction. The guideline was developed in response to concerns that Canadians are the second highest users per capita of opioids in the world, while the rates of opioid prescribing and opioid-related hospital visits and deaths have been increasing rapidly. The guideline's recommendations for clinical practice have been developed by an international team of clinicians, researchers and patients, led by the Michael G. DeGroote National Pain Centre at McMaster University and funded by Health Canada and the Canadian Institutes of Health Research. The guideline was published by the Canadian Medical Association Journal (CMAJ) today at http://bit. . The guideline incorporates medical evidence published since the previous national opioid use guideline was made available in 2010. They are recommendations for physicians, but are not regulatory requirements. An estimated 15% to 19% of Canadians live with chronic non-cancer pain, which is pain lasting more than three months and interfering with daily activities. The guideline does not look at opioid use for acute pain, nor for patients with pain due to cancer or in palliative care, or those under treatment for opioid use disorder or opioid addiction. The guideline and related material is available at http://bit. . This also includes an app available to help physicians and patients work through shared decision-making on the topic. This is available at http://bit. . "Opioids are not first line therapy for chronic non-cancer pain. There are important risks associated with opioids, such as unintentional overdose, and these risks increase with higher doses," said Jason Busse, principal investigator for the guideline development, an associate professor of anesthesia of McMaster's Michael G. DeGroote School of Medicine, and researcher for the Michael G. DeGroote National Pain Centre. "Canada is in the midst of an opioid epidemic. The guideline aspires to promote evidence-based prescribing of opioids for chronic non-cancer pain." Also in the CMAJ today is a related commentary http://bit. about the new Canadian guideline. Dr. Andrea Furlan of Toronto Rehabilitation Hospital and Dr. Owen Williamson of Monash University in Australia, say the updated guideline aims "to promote safer and more effective opioid prescribing to the small proportion of patients with chronic non-cancer pain who may benefit from their use, and this may well be achieved." Busse added that Canadian physicians must now learn about the new guideline and apply its recommendations in practice, noting that recent research has shown limited impact of the guideline published in 2010. "The guideline isn't self-implementing. We recognize implementation is a provincial responsibility, but we need dedicated funding for a national strategy to effectively ensure the guideline is used, and that we measure its impact." The guideline's recommendations were developed over the past two years by a team that included a four-member steering committee; a 15-member guideline panel of clinicians, research methodologists and patients; a 13-member multi-disciplinary advisory group of experts in the treatment of pain and use of opioids, and a 16-person patient advisory committee. Specific care was made to ensure the recommendations are evidence-based, guided by patients' values and preferences, and that guideline panel members who voted on the recommendations were free of important financial or intellectual conflicts of interest. For the final guideline, consideration was given to more than 500 comments from individuals and associations who answered a call for response to the draft recommendations released in January. To book an interview, please contact:


News Article | April 19, 2017
Site: www.eurekalert.org

In an article published yesterday in the journal Nature Ecology and Evolution John Fitzpatrick, a lecturer at Stockholm University, and his colleagues show self interest is what leads to the evolution of complex cooperative societies in African cichlid fishes. "In some group living animals - like meerkats - a few dominant individuals do all the breeding and receive help in raising their offspring from other members of the group. In birds and mammals, this helping behaviour evolves because the helpers are related to the offspring they are caring for. This wasn't the case in cichlid fishes", says Fitzpatrick, the senior author on the study. To determine which behaviours are associated with cooperatively rearing offspring, the researchers examined the behaviours of almost 70 cichlid species living in Lake Tanganyika, Africa. "Our results show that cichlids followed a different path to cooperation that what we see in other animal groups", explained Sigal Balshine, a Professor at the McMaster University and one of the authors of the article. "For cichlids, living in a group reduces your chances of being eaten by a predator. So it is likely that fear of predators is a driving factor behind the evolution of helping behaviour". "From an evolutionary standpoint, this is highly interesting", says John Fitzpatrick. "These cichlid fish have found a model where cooperation works because of it is so hard to make it on your own. Basically, it´s cooperation for selfish reasons." Cooperation in cichlid fish may be different form other species because they have short life spans, which prevents family groups from becoming established. The study Direct benefits and evolutionary transitions to complex societies is an important piece in our knowledge of the evolutionary development of complex societies. It´s available here: http://www. For more information contact John Fitzpatrick at the Department of Zoology on +46 73 710 63 59. Email john.fitzpatrick@zoologi.su.se. The selective forces driving the evolution of cooperation are intensely debated. Evolutionary transitions to cooperative breeding, a complex form of cooperation, are hypothesized to be linked to low degrees of promiscuity, which increases intragroup relatedness and the indirect (i.e. kin selected) benefits of helping. However, ecological factors also promote cooperative breeding, and may be more important than relatedness in some contexts. Identifying the key evolutionary drivers of cooperative breeding therefore requires an integrated assessment of these hypotheses. Here, using a phylogenetic framework that explicitly evaluates mating behaviours and ecological factors, we show that evolutionary transitions to cooperative breeding in cichlid fishes were not associated with social monogamy. Instead, group living, bi-parental care and diet type directly favoured the evolution of cooperative breeding. Our results suggest that cichlid fishes exhibit an alternative path to the evolution of complex societies compared to other previously studied vertebrates, and these transitions are driven primarily by direct fitness benefits.


TORONTO, ON--(Marketwired - May 08, 2017) - The Canadian-Croatian Chamber of Commerce (Chamber) is pleased to be welcoming Mate Rimac, Founder and CEO of Rimac Automobili d.o.o. to Canada. The Chamber will be organizing and hosting a number of events featuring Rimac in Toronto and surrounding areas during his visit from May 8-13, 2017. Rimac is the creator of one of the world's fastest electric supercars. He founded Rimac Automobili with the vision to create the sports car of the 21st century. Today he is producing the next generation of hypercars and high-performance drivetrain systems. An incredible story about a young man, who at the age of 19 in 2007, started his business as a garage hobby when he converted his BMW E30 to incorporate an electric powertrain and subsequently gained attention from press and investors. Today, Rimac Automobili is a team of over 250 under the leadership of Mate Rimac. In addition to becoming recognized as a hypercar manufacturer, Rimac Automobili is partnering up with many global brands including Aston Martin, Koenigsegg and Tajima, among others -- developing and producing high-performance battery systems, powertrains and other systems for many big names in the auto industry. British luxury car manufacturer Aston Martin recently announced that Rimac Automobili will be one of their key technical partners for AM-RB 001, the hypercar they are working on with Red Bull Racing. Rimac Automobili considers itself a technology company that helps the industry make electrified, smart and exciting cars for the future. During his visit to Canada, Rimac will, among other activities, tour the Waterloo Centre for Automotive Research (WatCAR) at the University of Waterloo and the McMaster Automotive Resource Centre (MARC) at McMaster University in Hamilton; meet with local companies focused on electric vehicles and related technologies; and meet with business professionals on Bay Street in Toronto to discuss potential opportunities. To conclude his visit, Rimac will deliver a keynote address on Friday, May 12 at the 15th Annual Business Excellence Awards dinner hosted by the Chamber in Burlington, Ontario. The event is an excellent opportunity for those in attendance to hear more about Rimac's contributions to innovation and development of high-performance electric vehicles. "We are honoured to host Mate Rimac during his visit to Canada," said Ivan Grbesic, a member of the board of directors of the Chamber and one of the coordinators of the visit. "Rimac Automobili has done a great job at not only developing the Concept One and Concept S models but in using its vehicles to showcase the technologies that it develops in Croatia -- a country with no car industry to speak of. Nikola Tesla would be extremely proud of the said vehicles, Rimac Automobili and his Croatian homeland for their contributions to the advancement and developments in electric vehicles," said Grbesic. Founded in 1995, the Canadian-Croatian Chamber of Commerce is a not-for-profit network of Croatian-Canadian businesses, professionals and organizations that has emerged as the voice of Croatian-Canadian business in Canada. Canada has one of the largest and most successful Croatian communities outside of Croatia and the Chamber brings together businesses, professionals and organizations with strategic relationships (economic, commercial, political, and cultural) in both Canada and Croatia.


News Article | May 8, 2017
Site: www.eurekalert.org

A new guideline for prescribing opioids for people with chronic non-cancer pain is aimed at helping health care professionals in Canada limit use of these addictive and potentially lethal drugs. The guideline, published in CMAJ (Canadian Medical Association Journal) contains 10 recommendations, of which 7 are focused on preventing harm from opioid use. "Opioids are not first-line treatment for chronic non-cancer pain, and should only be considered after non-opioid therapy has been optimized," says guideline lead Jason Busse, an associate professor of anesthesia at the Michael G. DeGroote School of Medicine, McMaster University, Hamilton, Ont., and researcher for the National Pain Centre. "There are important risks associated with opioids, such as unintentional overdose, and these risks increase with higher doses." Chronic non-cancer pain is defined as pain lasting more than three months that negatively affects quality of life and interferes with daily activities. An estimated 15% to 19% of Canadians experience this type of pain. This guideline incorporates all new evidence published since the last guideline was issued in 2010. An innovative approach was taken in developing the guideline, with involvement from chronic pain patients across Canada, clinicians with expertise in pain management and diverse views on the role of opioids, as well as researchers. The guideline does not address opioid prescribing for patients with pain due to cancer, or those with opioid addiction or opioid use disorder. Canada has the second highest rate of opioid prescribing in the world, and the highest when measuring daily doses. Hospital visits for opioid overdoses as well as fatalities have continued to rise in recent years. The recommendations for health care providers focus on minimizing harm in a range of patients with chronic non-cancer pain, including people with current or past substance use disorders, other psychiatric disorders, and persistent pain despite opioid therapy. "Canadian physicians' awareness of and adherence to the 2010 Canadian guideline recommendations for use of opioids to manage chronic pain have been limited," write the authors. "We have formally explored barriers to implementation and used the findings (e.g., excessive length of guidelines) to guide design and format of the current guideline." The guideline and related material may be found at http://nationalpaincentre. . The full guideline may also be found at http://www. . There is also an app available at https:/ to help physicians and patients work through shared decision-making on the topic. The new guideline is consistent with the 2016 United States Centers for Disease Control and Prevention (CDC) guideline's recommendations around dose escalation. It differs, however, in the involvement of clinical experts with diverse views toward opioids for chronic non-cancer pain, a dedicated patient advisory committee, restricting recommendations to only areas in which sufficient evidence exists, and in only allowing panel members without important financial or intellectual conflicts of interest to vote on recommendations. "Guidelines are not self-implementing, and there is an important lesson to be learned from the limited impact of the 2010 guideline. Publication of the 2017 guideline must be accompanied by a dedicated knowledge transfer and implementation strategy if it is to play an important role in addressing Canada's opioid crisis," said Dr. Busse. The guideline group is seeking funding to help communicate these opioid prescribing guidelines and ensure widespread uptake and application of the recommendations. In a related commentary http://www. , Drs. Andrea Furlan, Toronto Rehabilitation Institute, and Owen Williamson, Monash University, Melbourne, Australia, write that the aim of the updated guideline " ... is to promote safer and more effective opioid prescribing to the small proportion of patients with chronic noncancer pain who may benefit from their use, and this may well be achieved." However, the opioid crisis will not be solved without a national strategy that offers non-opioid pain relief for people with long-term pain. "The updated guideline will not address the public health crisis related to opioids without support from a comprehensive national pain strategy to ensure evidence-based alternative treatments for the one in five Canadians currently living with chronic pain," write the commentary authors. The guideline development group involved researchers and clinicians from Michael G. DeGroote National Pain Centre at McMaster University, Hamilton, Ont.; University Hospitals of Geneva, Geneva, Switzerland; American University of Beirut, Beirut, Lebanon; Canadian Pain Coalition, Oshawa, Ont.; University of Bern, Bern, Switzerland; VA Eastern Colorado School of Medicine, Denver, Colo. ; College of Physicians and Surgeons of Nova Scotia, Halifax, NS; St. Michael's Hospital, Toronto, Ont.; Argus Medical Centre, Oakville, Ont.; University of Ottawa, Ottawa, Ont.; and Innlandet Hospital Trust-Division, Gjovik, Norway.


News Article | May 8, 2017
Site: www.prlog.org

-- LiveActive Sport Medicine would like to formally welcome Joshua Rago to the team. With an extensive background and diverse skillset, Joshua is a highly qualified massage therapist and we're lucky to have him. Joshua will be available Monday and Thursday evenings, and Friday mornings.Welcome to the team Joshua!When athletes and active individuals experience injuries, it is not uncommon for their lives to unravel and affect all aspects of their life. Joshua's greatest passion is providing care and treatment to those individuals who have experienced setbacks to any degree with in their sport. He helps provide the highest standard of care, education, motivation and peace of mind for every person he works with.Joshua knows that no one-single approach to treatment is right for everyone, and so he has been formally trained in a range of additional modalities including Neurofunctional Acupuncture, Sport Massage Therapist, Graston Technique ® Provider, Kinesio / Athletic Taping, Cupping Massage and Shiatsu / Floor assisted athletic stretching.His educational background includes McMaster University (Neurofunctional Acupuncture), Everest College (Massage Therapy) and Humber College (Adv. Diploma in Fitness and Health Promotions) with Kinesiology Theory studied at York University. Joshua leverages his knowledge in Exercise Science and experience working as a Personal Trainer (7 years) to provide patients with exemplary remedial exercise and homecare to best accelerate recovery and success with treatment.Some highlights of Joshua's career so far include Team Massage Therapist for the CWHL's 2016/17 Toronto Furies, Instructor at Mohawk College, Event Massage Therapist 2017 CWBL Woman's National Championship, Event Massage Therapist OFSAA 2017 Wrestling Championship, Team Massage Therapist for the 2016 National Ontario Junior Wheelchair Basketball Team, Athlete Medical for the 2016 Ontario Summer Games, Athlete Medical for the 2015 Toronto PanAm/ParaPanAm Games, Event Sport Massage Therapist for the 2015 Canadian Master's Swimming Championship and Sport Massage Therapist for the past 3 consecutive years for the Ride To Conquer Cancer.A quote that he stands behind "The supreme misfortune is when theory outstrips performance"Leonardo DiVinciFor more information please visit www.liveactivesportmed.com and to stay up to date with current events see our routine blog posts at http://www.liveactivesportmed.com/ liveactive-news- events/


Following the appointment of Mr. Krinsky and Mr. Perier, the Board will consist of seven members, six of whom are independent. "We are pleased to welcome Itzhak and Frank to the Concordia Board of Directors, and believe their pharmaceutical and financial experience will help the Company through this critical transformation period in our corporate lifecycle," said Jordan Kupinsky, Non-Executive Chairman of Concordia. "We believe that their combination of domestic and global business experience will be a significant asset to the Board. They both have strong track records as trusted leaders in the pharmaceutical industry and bring a wealth of knowledge to our Company. I look forward to leveraging their expertise as we focus on stabilizing Concordia's business and completing the Company's longer-term growth strategy." Mr. Krinsky commented: "I am thrilled to be joining Concordia's Board of Directors at this important time, and look forward to begin working with the Company as we focus on executing against the Company's short-term and longer-term business objectives." "I am excited to join Concordia's Board of Directors," said Mr. Perier. "This is a unique opportunity to help shape a Company with valuable assets and a global footprint. I look forward to working with Allan Oberman, and the rest of the Board, to strengthen the business." About the New Board Members Mr. Krinsky brings extensive global pharmaceutical, investment banking, and M&A experience to Concordia. He has been with Teva Pharmaceutical Industries for more than 10 years. As Executive Vice President of Corporate Business Development, he led more than 30 M&A transactions for the company. In his most recent role, Mr. Krinsky served as Chairman of Teva Japan and Chairman of Teva South Korea, where he was responsible for overseeing Teva's pharmaceutical businesses in both countries. In 2014, he was named by SCRIP as one of the top 100 Global Leaders in the Pharmaceutical Industry. Prior to joining Teva, Mr. Krinsky served as Managing Director at Deutsche Bank, the Silverfern Group and Trenwith Securities, LLC, investment banks in New York City. He holds Bachelor, and Master of Arts in Economics degrees from Tel Aviv University and a Doctorate in Economics from McMaster University. Mr. Perier has more than 18 years of experience in the pharmaceutical and healthcare industries, including senior roles at two major pharmaceutical companies. Most recently, he served as Chief Financial Officer of Forest Laboratories for 10 years, where he played a significant leadership role in the company's multi-year growth initiative, in addition to overseeing multiple financial transactions. Prior to Forest Laboratories, Mr. Perier served in several senior financial positions at Bristol-Myers Squibb (BMS), including four years as Vice President of Finance, Planning, Business Development and Information Technology in the ConvaTec Division, where he was responsible for the execution of the company's strategic plan and business objectives. Prior to his time at BMS, Mr. Perier served in multiple roles at Deloitte & Touche LLP from 1981 to 1996, most recently as partner. He holds a Master of Business Administration (MBA) from New York University's Leonard N. Stern School of Business and a Bachelor of Science in Accounting from Villanova University. He is also a Certified Public Accountant. Concordia is a diverse, international specialty pharmaceutical company focused on generic and legacy pharmaceutical products. The Company has an international footprint with sales in more than 90 countries, and has a diversified portfolio of more than 200 established, off-patent products. Concordia also markets Photofrin® for the treatment of certain rare forms of cancer. Concordia operates out of facilities in Oakville, Ontario and, through its subsidiaries, operates out of facilities in Bridgetown, Barbados; London, England and Mumbai, India. This press release includes forward-looking statements within the meaning of the United States Private Securities Litigation Reform Act of 1995 and forward-looking information within the meaning of Canadian securities laws, regarding Concordia and its business, which may include, but are not limited to, Concordia's commercial platform, the value of Concordia's assets, Concordia's transformation as an organization, each of Mr. Perier's and Mr. Krinsky's respective experience, knowledge and track record, the strengthening of Concordia's business, Mr. Perier's and Mr. Krinsky's respective experiences being a significant asset to the Board of Concordia, Mr. Perier's and Mr. Krinsky's ability to help Concordia through a transformation period, the ability to leverage each of Mr. Perier's and Mr. Krinsky's experience as Concordia moves towards business stabilization and developing its long-term growth strategy, the development of a long term growth strategy (and the timing thereof), the stabilization of Concordia's business, the ability of Concordia to execute and deliver on its objectives, business plans and growth strategies, optimism about Concordia's future, the stability of Concordia's business (including, without limitation, with respect to its business in certain jurisdictions), the diversification of the Company's geographic and therapeutic platform, product lines and/or sales channels and the future growth of the Company (including, without limitation, the Company's expansion globally). Often, but not always, forward-looking statements and forward-looking information can be identified by the use of words such as "plans", "is expected", "expects", "scheduled", "intends", "contemplates", "anticipates", "believes", "proposes" or variations (including negative and grammatical variations) of such words and phrases, or state that certain actions, events or results "may", "could", "would", "might" or "will" be taken, occur or be achieved. Such statements are based on the current expectations of Concordia's management, and are based on assumptions and subject to risks and uncertainties. Although Concordia's management believes that the assumptions underlying these statements are reasonable, they may prove to be incorrect. The forward-looking events and circumstances discussed in this press release may not occur by certain specified dates or at all and could differ materially as a result of known and unknown risk factors and uncertainties affecting Concordia, including Concordia's inability to transform its business, Concordia's inability to stabilize its business or to execute its business objectives, Concordia's inability to develop a long term strategic plan or being delayed in developing such plan, the inability of Mr. Perier and/or Mr. Krinsky to help Concordia through a transformation period, execute its business objectives and/or stabilize Concordia's business, the inability to leverage Mr. Perier's and/or Mr. Krinsky's experience as Concordia moves towards business stabilization and developing its long-term growth strategy, Mr. Krinsky and/or Mr. Perier not being a significant asset to the Board of Concordia, the inability of Mr. Krinsky and/or Mr. Perier to bring a wealth of knowledge to Concordia, cash on hand and cash flows from operations being insufficient to meet Concordia's liquidity needs, which could result in Concordia having to refinance or restructure its debt, sell assets or seek to raise additional capital, which may be at less favourable terms, the inability to implement Concordia's objectives and priorities for 2017, which could result in financial strain on the Company and continued pressure on the Company's business, Concordia's securities, risks associated with developing new product indications, increased indebtedness and leverage, the inability to generate cash flows, revenues and/or stable margins, the inability to grow organically, the inability to repay debt and/or satisfy future obligations (including, without limitation, earn out obligations), risks associated with Concordia's outstanding debt, risks associated with the geographic markets in which Concordia operates and/or distributes its products, risks associated with fluctuations in exchange rates (including, without limitation, fluctuations in currencies), risks associated with the use of Concordia's products to treat certain diseases, the pharmaceutical industry and the regulation thereof, the failure to comply with applicable laws, risks relating to distribution arrangements, possible failure to realize the anticipated benefits of acquisitions and/or product launches, risks associated with the integration of assets and businesses into Concordia's business, the inability to launch products, the fact that historical and projected financial information may not be representative of Concordia's future results, the failure to obtain regulatory approvals, economic factors, market conditions, acquisition opportunities, risks associated with the acquisition and/or launch of pharmaceutical products, risks relating to clinical trials and/or patient enrollment into clinical trials, the equity and debt markets generally, risks associated with growth and competition (including, without limitation, with respect to Concordia's niche, hard-to-make products and Concordia's key products in its International and North America segments), general economic and stock market conditions, risks associated with the United Kingdom's exit from the European Union (including, without limitation, risks associated with regulatory changes in the pharmaceutical industry, changes in cross-border tariff and cost structures and the loss of access to the European Union global trade markets), risks associated with regulatory investigations (including investigations by competition authorities with respect to the Company's operations), risks related to the introduction of new legislation, or amendments to existing legislation, in the jurisdictions in which Concordia carries on business (including the now enacted UK Health Service Medical Supplies (Costs) Bill), risks related to patent infringement actions, the loss of intellectual property rights, risks associated with class action litigation, risks associated with Concordia's inability to defend itself in certain legal actions or being found to have violated certain laws (including, without limitation, the regulatory investigations and class actions which Concordia is currently subject to), which may require Concordia to make certain payments in respect of such legal matters or which may result in certain fines being levied against Concordia, risks and uncertainties detailed from time to time in Concordia's filings with the Securities and Exchange Commission and the Canadian Securities Administrators and many other factors beyond the control of Concordia. Although Concordia has attempted to identify important factors that could cause actual actions, events or results to differ materially from those described in forward-looking statements and forward-looking information, there may be other factors that cause actions, events or results to differ from those anticipated, estimated or intended. No forward-looking statement or forward-looking information can be guaranteed. Except as required by applicable securities laws, forward-looking statements and forward-looking information speak only as of the date on which they are made and Concordia undertakes no obligation to publicly update or revise any forward-looking statement or forward-looking information, whether as a result of new information, future events, or otherwise.


News Article | April 19, 2017
Site: www.marketwired.com

VANCOUVER, BRITISH COLUMBIA--(Marketwired - April 19, 2017) - United Hunter Oil & Gas Corp. ("Corporation") (TSX VENTURE:UHO)(FRANKFURT:A118VK) announces the appointment of Miles Nagamatsu as Chief Financial Officer of the Corporation, effective immediately. Mr. Nagamatsu previously served the Corporation in a similar capacity and we welcome his services once again. A Chartered Professional Accountant, Chartered Accountant with over 35 years of experience who serves as Chief Financial Officer and director of public and private companies primarily in the mineral exploration and investment management sectors. Mr. Nagamatsu has over 35 years of experience in accounting, management, lending, restructurings and turnarounds. Since 1993, Miles has acted as a Chief Financial Officer of public and private companies primarily in the mineral exploration and investment management sectors. For over 25 years, Mr. Nagamatsu has served as volunteer Chair of the Finance Committee and Director of Cystic Fibrosis Canada. He holds a Bachelor of Commerce degree from McMaster University and is a Chartered Accountant. Furthermore, the Corporation would like to announce the appointment of Mr. Alec Robinson, as a new member to the Board of Directors. Alec brings an extensive level of experience encompassing the many senior level executive positions that he held within a major oil company and the work efforts he held with several junior exploration companies. His experience includes several international, onshore and offshore, exploration and production projects, which span from South America to Europe, the Middle East and Africa. He has a Master's Degree in petroleum geology from Imperial College, London. Timothy Turner, CEO of the Corporation, stated that "United Hunter is pleased to welcome both Miles Nagamatsu, as the new Chief Financial Officer, and Alec Robinson, as a new Board Member, to the Corporation. I have had the opportunity to work with Miles in the past and I know that he will bring a high level of energy and work ethic to this position and to our organization. Also, we are pleased to welcome Mr. Alec Robinson to the Board of Directors. We anticipate that Alec's worldwide exploration and production experience will deliver an additional level of experience so as to continue our efforts to locate scalable projects for the Corporation and look forward to his contribution to the Corporation's future successes. He will be a significant asset to our Board and we look forward to working with both gentlemen well into the future." Both appointments will require filing the necessary regulatory paperwork to the TSX Venture exchange. Certain statements in the documents referred to in this press release may constitute forward-looking statements within the meaning of applicable securities laws. Forward-looking statements include, but are not limited to, statements concerning (i) the acquisition of the Property Interest; and (ii) potential results from the Property Interest. Forward-looking statements generally can be identified by the use of forward looking terminology such as "outlook", "objective", "may", "will", "expect", "intend", "estimate", "anticipate", "believe", "should", "plans" or "continue", or similar expressions suggesting future outcomes or events. Such forward-looking statements reflect management's current beliefs and are based on information currently available to management. Forward-looking statements involve risks and uncertainties that could cause actual results to differ materially from those contemplated by such statements. Such forward-looking statements are subject to risks and uncertainties that may cause actual results, performance or developments to differ materially from those contained in the statements including, without limitation, the risks that: (1) UHO may not achieve the results currently anticipated; and (2) UHO may not be able to obtain financing in the future. Although UHO believes that the expectations reflected in its forward-looking information are reasonable, undue reliance should not be placed on forward-looking information because UHO can give no assurance that such expectations will prove to be correct. In addition to other factors and assumptions which may be identified in this press release, assumptions have been made regarding and are implicit in, among other things, the timely receipt of required regulatory approvals. Details of the risk factors relating to UHO and its business are discussed under the heading "Risk Factors" in the Management Discussion & Analysis dated November 22, 2016, a copy of which is available on UHO's SEDAR profile at www.sedar.com. Readers are cautioned that the foregoing list is not exhaustive of all factors and assumptions which have been used. Forward-looking information is based on current expectations, estimates and projections that involve a number of risks and uncertainties which could cause actual results to differ materially from those anticipated by UHO and described in the forward looking information. The forward-looking information contained in this press release is made as of the date hereof and UHO undertakes no obligation to update publicly or revise any forward-looking information, whether as a result of new information, future events or otherwise, unless required by applicable securities laws. The forward looking information contained in this press release is expressly qualified by this cautionary statement. Neither the TSX Venture Exchange nor its regulation services provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release.


News Article | April 6, 2017
Site: www.medicalnewstoday.com

In a landmark study, researchers at St. Joseph's Healthcare Hamilton and McMaster University have found that providing clinical (low) doses of penicillin to pregnant mice and their offspring results in long-term behavioural changes. These changes include elevated levels of aggression and lower levels of anxiety, accompanied by characteristic neurochemical changes in the brain and an imbalance in their gut microbes. Giving these mice a lactobacillus strain of bacteria helped to prevent these effects. The study was published in Nature Communications and was funded by the United States Office of Naval Research. "In this paper, we report that low-dose penicillin taken late in pregnancy and in early life of mice offspring, changes behaviour and the balance of microbes in the gut. While these studies have been performed in mice, they point to popular increasing concerns about the long-term effects of antibiotics," says Dr. John Bienenstock, Director of the Brain-Body Institute at St. Joseph's Healthcare Hamilton and Distinguished Professor at McMaster University. "Furthermore, our results suggest that a probiotic might be effective in preventing the detrimental effects of the penicillin." Other studies have shown that large doses of broad-spectrum antibiotics in adult animals can affect behaviour. But there haven't been previous studies that have tested the effects of clinical doses of a commonly-used, narrow-spectrum antibiotic such as penicillin on gut bacteria and behaviour. "There are almost no babies in North America that haven't received a course of antibiotics in their first year of life," says Dr. Bienenstock. "Antibiotics aren't only prescribed, but they're also found in meat and dairy products. If mothers are passing along the effects of these drugs to their as yet unborn children or children after birth, this raises further questions about the long-term effects of our society's consumption of antibiotics." A previous study in 2014 raised similar concerns after finding that giving clinical doses of penicillin to mice in late pregnancy and early life led to a state of vulnerability to dietary induction of obesity. The research team will follow up their studies by analyzing the effects of penicillin on the offspring, if given only to the pregnant mothers. They also plan on investigating the efficacy of different types of potentially-beneficial bacteria in protecting offspring against the behavioural changes that result from antibiotic usage. Article: Low-dose penicillin in early life induces long-term changes in murine gut microbiota, brain cytokines and behavior, Sophie Leclercq, Firoz M. Mian, Andrew M. Stanisz, Laure B. Bindels, Emmanuel Cambier, Hila Ben-Amram, Omry Koren, Paul Forsythe & John Bienenstock, Nature Communications, doi: 10.1038/ncomms15062, published online 4 April 2017.


News Article | April 19, 2017
Site: phys.org

Why do animals help raise offspring that aren't their own? A new study by an international team of researchers from Sweden, Canada and the UK shows that fish cooperate to raise another fish's offspring to reduce their own risk of being eaten by a predator. In an article published yesterday in the journal Nature Ecology and Evolution John Fitzpatrick, a lecturer at Stockholm University, and his colleagues show self interest is what leads to the evolution of complex cooperative societies in African cichlid fishes. "In some group living animals – like meerkats – a few dominant individuals do all the breeding and receive help in raising their offspring from other members of the group. In birds and mammals, this helping behaviour evolves because the helpers are related to the offspring they are caring for. This wasn't the case in cichlid fishes", says Fitzpatrick, the senior author on the study. To determine which behaviours are associated with cooperatively rearing offspring, the researchers examined the behaviours of almost 70 cichlid species living in Lake Tanganyika, Africa. "Our results show that cichlids followed a different path to cooperation that what we see in other animal groups", explained Sigal Balshine, a Professor at the McMaster University and one of the authors of the article. "For cichlids, living in a group reduces your chances of being eaten by a predator. So it is likely that fear of predators is a driving factor behind the evolution of helping behaviour". "From an evolutionary standpoint, this is highly interesting", says John Fitzpatrick. "These cichlid fish have found a model where cooperation works because of it is so hard to make it on your own. Basically, it´s cooperation for selfish reasons." Cooperation in cichlid fish may be different form other species because they have short life spans, which prevents family groups from becoming established. More information: Cody J. Dey et al. Direct benefits and evolutionary transitions to complex societies, Nature Ecology & Evolution (2017). DOI: 10.1038/s41559-017-0137


News Article | May 3, 2017
Site: motherboard.vice.com

This is a series around POWER, a Motherboard 360/VR documentary about nuclear energy. Follow along here. As Chinese Premier Li Keqiang stood alongside Justin Trudeau at Parliament's centre block in September, a quiet confidence was growing in Canada's nuclear industry. The Prime Minister and the Chinese leader were overseeing a signing ceremony between the China National Nuclear Corporation (CNNC) and Canadian engineering giant, SNC-Lavalin, which owns CANDU technology. The agreement will see two next-generation CANDU nuclear reactors installed about 100 kilometres southwest of Shanghai, and could transform nuclear power. Canada's nuclear industry is on the upswing, partly because of a global push to cut greenhouse gas emissions. The deal with CNNC is part of that. Teams here are developing advanced nuclear technologies that will ideally help wean us off fossil fuels, which is one reason many environmentalists are starting to embrace nuclear. Watch more from Motherboard: Going Nuclear If all goes according to plan, the CANDU reactors slated for the Qinshan nuclear site will be powered by what the industry calls advanced fuels: reprocessed uranium recycled from conventional reactors, and later, the radioactive element thorium, said Justin Hannah, Director of Marketing, Strategy and External Relations for SNC's CANDU division. Only a handful of sites in Europe and Japan are able to reprocess uranium today, and there is no standard on how to reuse it as a fuel, so it's not widely used. Even so, it has the potential to reduce stockpiles of radioactive waste and make countries that use it less dependent on uranium imports. CANDUs could start using thorium, with China's backing, putting the world closer to what proponents call the thorium dream Thorium has its own advantages when compared to uranium: it's about three times more abundant and can provide just as much power, plus it's far less useful for making nuclear weapons, mainly because its fuel cycle doesn't produce plutonium. But thorium is notoriously difficult to mine. Using it as a fuel is also complex, so reactor designs and supply chains aren't readily available. The fact that CANDUs could start using thorium, with China's backing, may put the world closer to what proponents call the thorium dream of safer, cleaner and more abundant nuclear power. China currently has 36 nuclear reactors in operation, another 21 under construction, and wants to double its nuclear power generation by 2021. Most of the existing reactors are conventional pressurized water reactors that run on enriched uranium, but the country is moving aggressively towards advanced reactor designs that can make use of the spent uranium from their current reactors, and the growing stockpiles of thorium that are a byproduct of mining for rare earth elements, a market that China dominates. China has a growing appetite for carbon-free energy, and the government has declared war on pollution from coal-fired power plants, so nuclear makes sense. But Canada's technology could also be of strategic value. "They have the thorium, they have the spent uranium," said Hannah. This country stands to benefit from the agreement with China, too. If we get this joint venture right, "Canada's nuclear industry could be seen as world leaders," said Jerry Hopwood, President of the University Network of Excellence in Nuclear Engineering, a partnership between 12 Canadian universities, government, and Canada's nuclear industry. The new Chinese-Canadian commercial entity is expected to be registered in China by mid-2017, with pre-construction work beginning in 2019 and 2026 targeted for the first AFCR to be operational, said Hannah. Thorium could be in use in the 2030s. As for whether Canada could one day switch to thorium, we've got large, high-quality uranium reserves, so any move to bring a thorium-powered AFCR here will depend on both politics and economics. "There's no strong economic driver for it," argued John Luxat, a nuclear safety expert at McMaster University. "The utilities don't want to switch over, but it's nice to know that we could." After what Hopwood called a lull in Canada's industry in the early 2000s, he believes recent investments and the push for carbon-free power show there's a resurgence in nuclear. The industry got a boost in 2016 from Ontario's support for the refurbishment of the Darlington nuclear plant, and the 2015 plan to extend the life of Bruce Power's nuclear reactors—each project projected to cost about $13 billion. Apart from that, SNC may be building another CANDU reactor in Argentina. Canadian nuclear startups are also chasing new technologies. Terrestrial Energy has plans to build a commercially-viable molten salt reactor (MSR) by the 2020s. Read More: The Plan to Build a Million-Year Nuclear Waste Dump on the Great Lakes Since the concept was first developed at the Oak Ridge National Laboratory in the 1960s, it's been touted as a safer alternative. Terrestrial's small, modular design is targeted at remote communities and providing carbon-free power directly to heavy industrial installations. The nuclear fuel used in an MSR is liquid, so it can't melt down, and it's chemically bound to the molten salt coolant. That means a loss of coolant, like the one that happened at the Fukushima nuclear plant in 2011, isn't possible, said Canon Bryan, Terrestrial's co-founder. Watch more from Motherboard: The Thorium Dream The molten fuel is highly corrosive, so MSRs still need further development to be proven safe. But the company has garnered nearly $30 million in investment, among other undisclosed grants, and Terrestrial's application to the US government for a $1 billion loan guarantee through its US subsidiary is advancing well, said Bryan. While Terrestrial's MSR design could potentially use thorium fuel in the future, the goal of becoming commercially viable as soon as possible means that the company will be sticking with uranium for now, since it's well-understood by the industry. "The conversation is changing," said Jerry Hopwood. "The fact that Canada is serious about dealing with climate change [has] put nuclear in a good position." Subscribe to Science Solved It, Motherboard's new show about the greatest mysteries that were solved by science.


Anglin R.E.S.,McMaster University | Samaan Z.,St Josephs Hospital | Walter S.D.,McMaster University | Sarah D. McDonald,McMaster University
British Journal of Psychiatry | Year: 2013

Background: There is conflicting evidence about the relationship between vitamin D deficiency and depression, and a systematic assessment of the literature has not been available. Aims: To determine the relationship, if any, between vitamin D deficiency and depression. Method: A systematic review and meta-analysis of observational studies and randomised controlled trials was conducted. Results: One case-control study, ten cross-sectional studies and three cohort studies with a total of 31424 participants were analysed. Lower vitamin D levels were found in people with depression compared with controls (SMD = 0.60, 95% CI 0.23-0.97) and there was an increased odds ratio of depression for the lowest v. highest vitamin D categories in the cross-sectional studies (OR = 1.31, 95% CI 1.0-1.71). The cohort studies showed a significantly increased hazard ratio of depression for the lowest v. highest vitamin D categories (HR = 2.21, 95% CI 1.40-3.49). Conclusions: Our analyses are consistent with the hypothesis that low vitamin D concentration is associated with depression, and highlight the need for randomised controlled trials of vitamin D for the prevention and treatment of depression to determine whether this association is causal. © The British Journal of Psychiatry 2013.


Johnson N.J.J.,University of Victoria | Korinek A.,McMaster University | Dong C.,University of Victoria | Van Veggel F.C.J.M.,University of Victoria
Journal of the American Chemical Society | Year: 2012

We demonstrate a novel epitaxial layer-by-layer growth on upconverting NaYF 4 nanocrystals (NCs) utilizing Ostwald ripening dynamics tunable both in thickness and composition. Injection of small sacrificial NCs (SNCs) as shell precursors into larger core NCs results in the rapid dissolution of the SNCs and their deposition onto the larger core NCs to yield core-shell structured NCs. Exploiting this NC size dependent dissolution/growth, the shell thickness can be controlled either by manipulating the number of SNCs injected or by successive injection of SNCs. In either of these approaches, the NCs self-focus from an initial bimodal distribution to a unimodal distribution (σ <5%) of core-shell NCs. The successive injection approach facilitates layer-by-layer epitaxial growth without the need for tedious multiple reactions for generating tunable shell thickness, and does not require any control over the injection rate of the SNCs, as is the case for shell growth by precursor injection. © 2012 American Chemical Society.


Hutchison B.,McMaster University | Glazier R.,Institute for Clinical Evaluative science
Health Affairs | Year: 2013

Primary care in Ontario, Canada, has undergone a series of reforms designed to improve access to care, patient and provider satisfaction, care quality, and health system efficiency and sustainability. We highlight key features of the reforms, which included patient enrollment with a primary care provider; funding for interprofessional primary care organizations; and physician reimbursement based on varying blends of fee-for-service, capitation, and pay-for-performance. With nearly 75 percent of Ontario's population now enrolled in these new models, total payments to primary care physicians increased by 32 percent between 2006 and 2010, and the proportion of Ontario primary care physicians who reported overall satisfaction with the practice of medicine rose from 76 percent in 2009 to 84 percent in 2012. However, primary care in Ontario also faces challenges. There is no meaningful performance measurement system that tracks the impact of these innovations, for example. A better system of risk adjustment is also needed in capitated plans so that groups have the incentive to take on high-need patients. Ongoing investment in these models is required despite fiscal constraints. We recommend a clearly articulated policy road map to continue the transformation. © 2013 Project HOPE-The People-to-People Health Foundation, Inc.


Agnelli G.,University of Perugia | Cohen A.,King's College | Curto M.,Pfizer | Gallus A.S.,Flinders University | And 4 more authors.
New England Journal of Medicine | Year: 2013

BACKGROUND: Apixaban, an oral factor Xa inhibitor that can be administered in a simple, fixed-dose regimen, may be an option for the extended treatment of venous thromboembolism. METHODS: In this randomized, double-blind study, we compared two doses of apixaban (2.5 mg and 5 mg, twice daily) with placebo in patients with venous thromboembolism who had completed 6 to 12 months of anticoagulation therapy and for whom there was clinical equipoise regarding the continuation or cessation of anticoagulation therapy. The study drugs were administered for 12 months. RESULTS: A total of 2486 patients underwent randomization, of whom 2482 were included in the intention-to-treat analyses. Symptomatic recurrent venous thromboembolism or death from venous thromboembolism occurred in 73 of the 829 patients (8.8%) who were receiving placebo, as compared with 14 of the 840 patients (1.7%) who were receiving 2.5 mg of apixaban (a difference of 7.2 percentage points; 95% confidence interval [CI], 5.0 to 9.3) and 14 of the 813 patients (1.7%) who were receiving 5 mg of apixaban (a difference of 7.0 percentage points; 95% CI, 4.9 to 9.1) (P<0.001 for both comparisons). The rates of major bleeding were 0.5% in the placebo group, 0.2% in the 2.5-mg apixaban group, and 0.1% in the 5-mg apixaban group. The rates of clinically relevant nonmajor bleeding were 2.3% in the placebo group, 3.0% in the 2.5-mg apixaban group, and 4.2% in the 5-mg apixaban group. The rate of death from any cause was 1.7% in the placebo group, as compared with 0.8% in the 2.5-mg apixaban group and 0.5% in the 5-mg apixaban group. CONCLUSIONS: Extended anticoagulation with apixaban at either a treatment dose (5 mg) or a thromboprophylactic dose (2.5 mg) reduced the risk of recurrent venous thromboembolism without increasing the rate of major bleeding. (Funded by Bristol-Myers Squibb and Pfizer; AMPLIFY-EXT ClinicalTrials.gov number, NCT00633893.) Copyright © 2012 Massachusetts Medical Society.


Hassini E.,McMaster University | Surti C.,University of Ontario Institute of Technology | Searcy C.,Ryerson University
International Journal of Production Economics | Year: 2012

We review the literature on sustainable supply chains during the last decade; 2000-2010. We analyze the literature from different perspectives. We then provide frameworks for sustainable supply chain management and performance measures. We also provide a case study to illustrate the experience of a utility supply chain in setting performance indicators. © 2012 Elsevier B.V. All rights reserved.


In the last 4 years, 6 phase 3 trials including a total of 27 023 patients with venous thromboembolism (VTE) compared a direct oral anticoagulant (DOAC) with vitamin K antagonists (VKAs). To aid the clinician in assessing the amount of information, we address frequently raised clinical questions in a review of combined trial results. We included the phase 3 trials that compared dabigatran etexilate, rivaroxaban, apixaban, or edoxaban with VKA therapy inpatients with acute symptomatic VTE. Recurrent VTE occurredin2.0% of DOAC recipients compared with 2.2% in VKA recipients (relative risk [RR] 0.90, 95% confidence interval [CI] 0.77-1.06). Treatment with a DOAC significantly reduced the risk of major bleeding (RR 0.61, 95% CI 0.45-0.83). In parallel, intracranial bleeding, fatal bleeding, and clinically relevant nonmajor bleeding occurred significantly less in DOAC recipients. The efficacy and safety of DOACs were consistent in patients with pulmonary embolism, deep venous thrombosis, a body weight ≥100kg, moderate renal in sufficiency, an age ≥75 years, and cancer. In conclusion, DOACs and VKAs have similar efficacy in the treatment of acute symptomatic VTE, a finding that is consistent in key clinical subgroups. Treatment with a DOAC significantly reduces the risks of major bleeding. © 2014 by The American Society of Hematology.


Zhang D.,Shijiazhuang University | Pelton R.,McMaster University
Langmuir | Year: 2012

Self-assembly from mixed dispersions of three sizes of monodisperse polystyrene nanoparticles, large (L), medium (M), and small (S), was controlled by coating each particle type with either a monofunctional or bifunctional polymer capable of participating in specific complexation reactions. The complexation reactions were (1) complexation between phenolic polymers and polyethylene glycol (PEG) containing polymers and (2) condensation of phenylboronic acid containing polymers with polyols. These complexation reactions function independently and can be "turned off" independently; phenylboronic acid complexation was reversed by lowering the pH, whereas the interactions of phenolic copolymers with PEG copolymers could be reversed by adding excess PEG homopolymer. The specificity and reversibility of the interactions was demonstrated by the formation of simple binary aggregates from mixtures. The bifunctional copolymers were poly(vinyl phenol-co- diallyldimethyl ammonium chloride), Ph-DADMAC, and poly(3-acrylamide phenylboronic acid-co-PEG methacrylate), PBA-PEG. The monofunctional polymer was polyvinylalcohol, PVA. Ph-DADMAC forms complexes with PBA-PEG (H-bonding) and with anionic surfaces or polymers (electrostatic/polyelectrolyte complexation). PBA-PEG complexes with Ph-DADMAC (H-bonding) and with PVA (boronate ester formation). PVA does not interact with Ph-DADMAC; therefore, PVA coated particles do not deposit onto Ph-DADMAC coated particles. © 2012 American Chemical Society.


Grant
Agency: European Commission | Branch: H2020 | Program: RIA | Phase: PHC-22-2015 | Award Amount: 5.74M | Year: 2016

Major depressive disorder, dementia, anxiety disorders, and substance abuse affect a substantial part of the European older population. Over 70% of Europeans reside in cities, and this percentage will increase in the next decades. Urbanization and ageing have enormous implications for public mental health. Cities pose major challenges for older citizens, but also offer opportunities for the design of policies, clinical and public health interventions that promote mental health. The overall aim of the MINDMAP project is to identify the opportunities offered by the urban environment for the promotion of mental wellbeing and cognitive function of older individuals in Europe. The project will advance understanding by bringing together longitudinal studies across cities in Europe, the US and Canada to unravel the causal pathways and multi-level interactions between the urban environment and the social, behavioural, psychosocial and biological determinants of mental health and cognitive function in older adults. Specifically, the project will (a) assess the impact of the urban environment on the mental wellbeing and disorders associated with ageing, and estimate the extent to which exposure to specific urban environmental factors and policies explain differences in ageing-related mental and cognitive disorders both within as well as between European cities, (b) assess the causal pathways and interactions between the urban environment and the individual determinants of mental health and cognitive ageing in older adults, (c) use agent-based modelling to simulate the effect of urban environmental, prevention and care policies on the trajectories of mental health and cognitive ageing across cities in Europe. Knowledge will significantly contribute to future-proof preventive strategies in urban settings favouring the mental dimension of healthy ageing, the reduction of the negative impact of mental disorders on co-morbidities, and maintaining cognitive ability in old age.


News Article | September 26, 2016
Site: www.theenergycollective.com

SNC-Lavalin has signed an agreement with two Chinese nuclear energy firms to develop, market and build an advanced CANDU type nuclear reactor The Montreal, Canada, based engineering and construction giant SNC-Lavalin, which five years ago, bought AECL’s reactor division from the government, has a new joint venture with China National Nuclear Corp. (CNNC) and Shanghai Electric Co. The immediate results of the agreement will be the creation of two nuclear reactor design centers, one in China and the other in Canada. The design centers will collaborate to complete the Advanced Fuel CANDU Reactor (AFCR). It is expected that the first two units will be then built in China and then the reactor will offered via export to global markets. “’The market potential for AFCR technology in China is considerable. Each AFCR can use recycled-fuel from four light-water reactors (LWRs) to generate six million megawatt-hours (MWh) of additional carbon-free electricity without needing any new natural uranium fuel. This would be enough new electricity to power four million Chinese homes, and also displace six million tonnes of carbon emissions per year vs. coal, the equivalent of removing one million cars from the road. China has more than 33 LWR nuclear power reactors in operation and another 23 LWRs under construction.” The agreement occurred during an official four-day visit to Canada by Chinese Premier Li Keqiang. Canadian PM Justin Trudeau promoted the visit as a thaw in relations between the two nations following a decade of chilly diplomacy under the Conservative government of PM Stephen Harper. According to news coverage in the Toronto Globe & Mail for 9/22/16, John Luxat, a professor of nuclear safety analysis at McMaster University, told the newspaper the new reactor technology has “high potential for use in China because of the large number of light water reactors” who spent fuel could be used by CANDU designs. However, AltgaCorp investment analyst Chris Murray told the newspaper he sees the design and marketing effort to be a slow, drawn out effort and does not expect there to be any near-term financial impact. CANDU stands for CANada Deuterium Uranium, because it was invented in Canada, uses deuterium oxide (also known as heavy water) as a moderator, and uranium as a fuel. CANDU reactors are unique in that they use natural, unenriched uranium as a fuel; with some modification, they can also use enriched uranium, mixed fuels, and even thorium. Thus, CANDU reactors are ideally suited for using spent fuel from light water nuclear reactors, or downblended uranium from decommissioned nuclear weapons, as fuel, helping to reduce global arsenals. CANDU technical description and schematic courtesy of AECL and the Canadian Nuclear Association CANDU reactors can be refueled while operating at full power, while other light water designs, including PWRs and BWRs, must be shut down for refueling. Moreover, because natural uranium does not require enrichment, fuel costs for CANDU reactors are very low. Canada is one of the world’s leading sources of uranium with rich deposits in Saskatchewan and other provinces. It has no uranium enrichment capabilities. The safety systems of CANDU reactors are independent from the rest of the plant, and each key safety component has three backups. This redundancy increase the overall safety of the system, and it also makes it possible to test the safety system while the reactor is operating under full power. There are 19 CANDU reactors in Canada and 31 globally including two in China, two in Argentina, and two in Romania. While all three countries are potential markets for the new SNC-Lavalin / CNNC design, only China has committed, in principle to building the new ACFR. It is unclear to what extent the new AFCR benefits from a design heritage with the now suspended work on the ACR-1000 which was proposed in 2007 and 2008 for Canadian and UK power markets. The ACR-1000, a 1200 MW CANDU type reactor design, was proposed to be built in the tar sands region of Alberta for power and process heat customers and at Point Lepreau in New Brunswick for electric power customers. Neither projects ever made it off the drawing boards. Efforts to license the 1200 MW unit with the Canadian Nuclear Safety Commission ended in Spring 2008 when AECL also withdrew the design from consideration in the UK generic design assessment. AECL CEO Hugh MacDiarmid was quoted at the time as saying, “We believe very strongly that our best course of action to ensure the ACR-1000 is successful in the global market place is to focus first and foremost on establishing it here at home.” But there were no sales at home due to Bruce Power declining to consider the 1200 MW reactor. In June 2011 SANC-Lavalin bought the reactor division of AECL for the bargain basement price of $15 million which included all of AECL’s intellectual property related to CANDU reactor designs. The advanced CANDU reactor (ACR), in its current design status, frozen in 2008, is a Generation III+ nuclear reactor design and is a further development of existing CANDU reactors designed by Atomic Energy of Canada Limited (AECL). The ACR is a light-water-cooled reactor that incorporates features of both pressurized heavy water reactors (PHWR) and advanced pressurized water reactors (APWR) technologies. It uses a similar design concept to the steam-generating heavy water reactor (SGHWR). The difference between heritage CANDUs and the ACR is that it uses low enriched uranium (LEU) fuel, (3-5% U235), ordinary (light) water coolant, and a separate heavy water moderator. The ACR also incorporates characteristics of the CANDU design, including on-power refueling with the CANFLEX fuel; two fast, totally independent, safety shutdown systems; and an emergency core cooling system. The relatively small reactor core reduces core size by half for the same power output over the older CANDU design. The ACR fuel bundle is a variant of the 43-element CANFLEX design (CANFLEX-ACR). The use of LEU fuel would result in higher burn-up operation than traditional CANDU designs. None of these features were found to be compelling by potential customers and AECL shelved the entire effort to develop the ACR. About the New AFCR According to SNC_Lavalin the Advanced Fuel CANDU reactor (AFCR) (fact sheet) is a 700MW Class Generation III reactor based on the successful CANDU 6 and Enhanced CANDU 6 (EC6) reactors with a number of adaptations to meet the latest Canadian and international standards. This is 300 MW less in power than the ACR and also differs technically from the ACR in that it uses only heavy water as a moderator. Its fuel flexibility allows it to use recycled uranium or thorium as fuel. SNC-Lavalin calls such materials “natural uranium equivalent” fuels, It uses a heavy water moderator and heavy-water coolant in a pressure tube design. CANDU reactors can be refuelled on power. The firm claims it will have “one of the highest lifetime capacity factors among the world’s reactors.” The development of the AFCR was first reported by World Nuclear News in November 2014. That report also provided insights into the place in China’s nuclear fuel cycle that would be the niche for the reactor. WNN noted in its report that the used fuel from four conventional PWR reactors can completely supply one AFCR unit (as well as providing recycled plutonium for MOX). This process significantly reduces the task of managing used fuel and disposing of high-level wastes. The R&D effort also explored the use of thorium as a fuel for the new reactor. In June 1998, construction started on a CANDU 6 reactor in Qinshan China of the Qinshan Nuclear Power Plant, as Phase III (units 4 and 5) of the planned 11 unit facility. Commercial operation began in December 2002 and July 2003, respectively. These are the first heavy water reactors in China. In 2015 China signed agreements in principle with Romania and Argentina to supply CANDU reactors. In a World Nuclear News report in November 2015 report details were revealed that China and Argentina had in 2014 signed a new high-level agreement towards construction of a third CANDU type pressurized heavy water reactor (PHWR) at the Atucha plant in Argentina. Under the agreement, CNNC will be providing goods and services and long-term financing. The utility in Argentina will be designer, architect-engineer, builder and operator of the new PHWR (Atucha 3). Under the agreement, over 70% of the components to be used in the plant will be supplied by Argentine companies. CNNC is now expected to advance the negotiations with Chinese financial institutions to conclude project financing. Atucha 3 will be a part Canadian-developed Candu reactor running on natural uranium fuel, like the 648 MWe Embalse Candu reactor in Córdoba province. Because of the localization strategy for major components, and the history of the supply chain in Argentina with the other CANDU reactors, it is unlikely that Atucha 3 could be based on the new AFCR design. Atucha 3 is expected to cost almost $6 billion and to take eight years to build at the Atucha Nuclear Power Plant Complex in Buenos Aires province, where the 335 MWe Atucha I and 745 MWe Atucha 2 currently operate. Also in November 2015 World Nuclear News reported Romania’s Nuclearelectrica signed a memorandum of understanding (MOU) with China General Nuclear (CGN) for the development, construction, operation and decommissioning of units 3 and 4 of the Cernavoda nuclear power plant. The Romanian national nuclear company said a joint venture project company is to be established, with CGN owning at least 51% of the share capital. That company will oversee construction of the units, which will be 700 MWe Candu 6 reactors. Two Candu units already operate at the Cernavoda site. Romania and China signed a letter of intent in November 2013 during a visit to Bucharest by Chinese premier Li Keqiang. Cernavoda is home to two operating Candu 6 pressurized heavy water reactors (PHWRs) supplied by Candu Energy’s predecessor, Atomic Energy of Canada Ltd (AECL), and built by a Canadian-Italian consortium of AECL and Ansaldo. Unit 1 started up in 1996, but work was suspended on a further four units in 1991. Unit 2 was subsequently completed and has been in operation since 2007. Given Romania’s history with CANDU reactors, and its intent to apply its operating experience with them to Units 3 & 4, it is unlikely that country would be a market for the new AFCR model. Romania will supply the fuel for all four reactors. According to the same World Nuclear News report, the new conventional CANDU units will have an operating life of 30 years with the possibility of extension by an additional 25 years. With Argentina and Romania committed to conventional CANDU, off-the-shelf, technology, it is unclear what the commercial prospects will be for the new AFCR CANDU design. The design intent to use spent nuclear fuel in the reactor would make it attractive to many countries. China will build and operate the first two units to prove to potential customers that the design is safe, affordable, and will have a long and cost-competitive service life. Assuming the units can be built in China for $3,000 to $4,000 per Kw, a 700 MW unit will cost approximately $2.1 billion to $2.8 billion which is far less than the cost in the U.S. for a 1000 MW Westinghouse AP1000. Similar cost comparisons would be expected for new nuclear reactors in the UK. However, China is proposing its new PWR design, the Hualong One, for the UK market. Once China has proven the technical and financial viability of the AFCR CANDU, it will face the uncertain prospects of design safety reviews for first-of-a-kind units by nuclear regulatory agencies in countries where it wants to sell the reactors. By leveraging the well-known CANDU technology, SNC-Lavalin and CNNC are placing a bet that they will find willing buyers of their new nuclear reactor.


News Article | November 10, 2016
Site: www.nature.com

Rachel was working towards her PhD in 2008 when depression first threatened to derail her career. The psychologist was clocking 14- to 16-hour days to launch a study and was overseeing 12 research assistants. In her spare time, she was planning her wedding. For three weeks, she barely slept and subsisted on sweets and energy bars. Then came a crying spell that started at a sad theatre performance and turned into three days of uncontrollable sobbing. “I was sitting on my couch, staring at the wall and crying,” says Rachel, who requested that her name be changed for this article. The seeds of Rachel's depression pre-dated her PhD. “You are bombarded with messages before you even apply for PhD programmes — that it's hard to get in, that 50% don't finish, that it's hard to get postdocs, that it's impossible to get grants,” she says. “At the same time, you are surrounded by people who have PhDs. If you already have a tendency toward perfectionism or self-doubt, it feeds that really nicely.” She returned to work after a two-week break that included therapy and a prescription for antidepressants. After completing her dissertation, she landed an assistant-professor post at a university in New York. “If you had asked me at the time, I would have said, 'Oh no, I'm never finishing. I'm leaving academia,'” she says about her break. When she shared her feelings with her father, who also holds a PhD, he told her, “Welcome to science.” Depression and anxiety are widespread, including among scientists, who often face intense pressure to work long hours, publish in high-profile journals, win grants to support themselves and others and rebound after repeated rejections. Depression affects 350 million people around the world and is the leading cause of disability globally, according to the World Health Organization (WHO). Each year in the United States, almost 7% of adults, or an estimated 16 million people, have at least one major depressive episode. To be diagnosed with the condition, people must experience a minimum of five specific symptoms that impair functioning or cause significant distress almost every day for at least two weeks. One of those must be a persistently low mood (marked perhaps by a sense of emptiness or hopelessness) or a loss of pleasure or interest in almost all activities. But they might also include recurrent thoughts of death or significant weight loss, for example. The chance that a person will develop depression during their lifetime varies by nation — in the United States, it is 17%. Depression frequently goes hand-in-hand with anxieties or worries that are so excessive that they interfere with life. Such anxiety affects about 18% of US adults, or 40 million people. More than 25% of Europeans have some form of anxiety or depression, according to the WHO. Research on the prevalence of anxiety and depression specifically in scientists is scarce. But risks are probably comparable to those for the rest of the population, says Jerald Kay, a psychiatrist at Wright State University in Dayton, Ohio, and co-editor of Mental Health Care in the College Community (Wiley, 2010), whose practice has focused on physicians, university students and faculty members, including researchers. Some situations are more likely to lead to anxiety and depression. Graduate studies can be particularly tough, because students suddenly face high expectations and low salaries and find that their fates lie in the hands of advisers, who can even live in another country. In a 2014 survey of 790 graduate students at the University of California, Berkeley, almost half of PhD students met the criteria for depression, including up to 46% of those in a category that included biological and physical sciences. The stigma associated with mental illness can make many researchers cautious about revealing their struggles to anyone, let alone to superiors. Still, experts say that it's important to seek help, at least from professionals. “If you feel like you're the only one struggling with a problem, you think, 'It's my personal problem, it's my fault,'” says Joeri Tijdink, a psychiatrist at the VU University Medical Center in Amsterdam, “not a fault of the system.” Most universities have mental-health services that offer confidential help, although many researchers who have weathered the storm of depression list superiors and colleagues as sources of support. In a high-pressure career that values prestige but is rife with criticism, it helps to know that you're not alone (see 'Dealing with depression'). Shweta Ramdas struggled quietly with depression for several years. Originally from India and a graduate of the National University of Singapore, Ramdas found winters increasingly intolerable when she moved to the University of Michigan, Ann Arbor, to do a PhD in bioinformatics. On some days she would just stare at her computer, taking weeks to finish one-day tasks. Uninterested in food and tired of feeling unhappy, she thought about quitting. Ramdas finally told her department chair, who said that others had faced similar problems. Soon colleagues were telling her their own stories. “These were amazing people who I really admire,” she says. “And they did not seem from the outside to be depressed.” Ramdas spent eight months with family in India, where she saw a therapist. Her professors in Michigan told her to take as much time as she needed. She returned this autumn determined to set limits on work. Now she is talking to her supervisors about helping others who struggle with depression. “I feel like graduate schools can do a better job about getting this into the open a lot more,” Ramdas says. “I could have handled it better if I had known it wasn't just me.” Elizabeth Droge-Young experienced her first depressive episode in early 2012 while studying the mating systems of promiscuous beetles for a PhD at Syracuse University in New York. At first, she would sit on the couch in her pyjamas playing video games, watching films or listening to sad music and questioning the meaning of life. As time passed, she became unable to get to the lab or take showers. In 2014, she spent ten days in a hospital almost within view of her lab. “As my life started falling apart, science was really the last thing I held on to,” says Droge-Young, who earned her degree this year and is now a science writer. “It kept me going for quite some time, until my depression became too big an issue.” The transition to graduate studies can be jarring, says Matthew Wilkins, an evolutionary biologist at the University of Nebraska–Lincoln. When he started his PhD programme at the University of Colorado Boulder in 2008, he was caught unawares by the sudden expectation to be self-driven and by the ruthlessness of a career in science, in which successes are often punctuated by rejections — for grants, publications and jobs. That endless need for external validation can foster anxiety, adds Wilkins, who once received a disappointing score on a high-stakes exam — a week before landing a prestigious fellowship. “In academia, success is not guaranteed,” he says. “You recognize that it's going to be hard. I don't think you recognize that it's going to take a psychological toll on you.” Tijdink chose to study the psychological effects of publication pressure, partly because of conversations with therapists who treat scientists. “They feel so pressured,” the therapists told him. “They are exhausted. They are suspicious of people stealing their ideas. Or they feel that colleagues want their positions.” He wanted to make the problem more visible. In a survey of more than 400 medical academics in the Netherlands, published in 2013, Tijdink reported that nearly 25% met the criteria for burnout, which is defined as emotional exhaustion ( et al. PLoS ONE 8, e73381; 2013). Some scientists struggle when they venture beyond conventional research tracks. Paul Andrews, an evolutionary psychologist at McMaster University in Hamilton, Canada, says that when he was a postdoc, he thought his prospects were good because he had published well-cited papers in good journals. But he couldn't find a position that allowed him to specialize in the biological basis of depression. Frustrated, he lost his motivation to eat, sleep and exercise. And he obsessed about whether to try getting one big study into an influential journal or to churn out lots of smaller papers. Andrews took the riskier first approach, eventually publishing a paper in Psychological Review in 2009 ( and Psychol. Rev. 116, 620–654; 2009) that received lots of publicity, including a feature about his work in The New York Times Magazine early in 2010. Even after that, he had trouble getting interviews, despite submitting many applications. “I was like, 'What do I have to do to get a job?'” says Andrews, who was by then desperate, depressed and anxious. He still has recurring depressive symptoms when he struggles with obstacles at work. His research, which challenges mainstream ideas about depression as a disorder and the role of serotonin, also raises doubts about the value of antidepressants. He has found it hard to get his work published. Sometimes, research topics can induce dark thoughts, says Alejandro Frid, who started studying endangered deer in Chile in 1990 and later investigated the effects of marine fisheries on predator–prey interactions in Alaska and British Columbia. The more his research pointed to the damaging implications of climate change, the more angry and nihilistic he became. “By nihilism, I mean that there is no point in caring about the future because there really isn't one,” says Frid, who is now a science coordinator at the Central Coast Indigenous Resource Alliance near Vancouver, Canada, and wrote the book A World For My Daughter: An Ecologist's Search for Optimism (Caitlin, 2015). “It's all doom. Humans are destructive and we don't know any better. There's no real vision worth living for.” Depression has become a recurring topic of conversation among environmentalists. Frid has cultivated hopefulness by focusing on ecological resilience and the human capacity for problem solving. He is also working to influence policies and human behaviours that affect the environment — approaches that helped to reshape his career and brighten his outlook. Scientists can be wary of admitting to symptoms of depression or anxiety. But researchers who confide in colleagues say they're often surprised by the support they receive. Like Ramdas, Droge-Young found that when she overcame her fear of telling lab colleagues about her mental illness, others told similar stories. One had spent time in the same hospital. Faculty members contributed to a Kickstarter funding campaign for two art shows that describe her experience of depression and self-harm. Her adviser and his family attended. “People are really caring,” she says, “if you open up with your vulnerabilities.” Not everyone feels comfortable talking to their superiors, but they should really see a professional as early as possible, says Kay. “If you think you're struggling, that's a good reason to get help,” he says. And if one therapist doesn't seem like a good fit, find another, Droge-Young advises. Allowing time for outside interests can help to alleviate work-related anxiety. For Droge-Young, that means getting outside or throwing Oscars-watching parties. Wilkins likes to rock-climb, play football and run. He also recommends developing short-term projects with quick deadlines that aren't work-related. This year, he and a friend started entering — and winning — film competitions. Recognizing that it is normal and even helpful to feel down when faced with complex problems may also help scientists to cope, says Andrews. He sees his own bouts of depression not as a sign of a malfunctioning brain, but as a response to important problems. That response helps him to focus. When prompted by social problems or work stresses, he says, the body reallocates energy to the brain. The hypothalamus kicks in, suppressing libido and other physical drives and inducing a fixation on negative thoughts. Although such rumination is often seen as a bad thing, dwelling on a problem can actually help to solve it because it helps the mind to break it down into smaller components. Just like a scientist does, Andrews says.


HAMILTON, Ontario--(BUSINESS WIRE)--Fusion Pharmaceuticals, a newly formed biopharmaceutical company developing targeted alpha-particle radiotherapeutics for treating cancer, today announced the closing of a $25 million Series A financing led by founding venture investor, Johnson & Johnson Innovation – JJDC, Inc., with investments by HealthCap, TPG Biotech, Genesys Capital and FACIT (Fight Against Cancer Innovation Trust). Targeted alpha-particle emitting radiotherapeutics combine the precision of molecular targeting agents, such as antibodies with the potency of alpha-particle emitting radioisotopes to specifically attack and eradicate cancer cells. The syndicate is strengthened by HealthCap’s specialized expertise in pioneering a new wave of successful radiotherapeutic companies, such as Algeta and Nordic Nanovector. Fusion Pharmaceuticals is a spinout from the Centre for Probe Development and Commercialization (CPDC), an organization that Dr. John Valliant, Ph.D., founded in 2008 and is a Centre of Excellence for Commercialization and Research (CECR) located at McMaster University in Hamilton, Ontario, Canada. The CPDC, which was created with the support of multiple stakeholders, including the Networks of Centres of Excellence (NCE) and the Ontario Institute for Cancer Research (OICR), has rapidly become a world leader in the development, translation and manufacturing of radiopharmaceuticals. In addition to Dr. Valliant, founder and chief executive officer, the company’s board of directors consists of Asish Xavier, Ph.D. (Johnson & Johnson Innovation – JJDC, Inc.), Robert Sutherland, Ph.D., Centre for Probe Development and Commercialization (CPDC), Eran Nadav, Ph.D. (TPG Biotech), Johan Christenson, M.D. (HealthCap) and Damian Lamb (Genesys), who will assume the role of chairman of the board. “Targeted delivery of medical isotopes that emit alpha particles can be used to kill tumor cells with remarkable precision and unprecedented potency, and it has the added potential of having complementary effects with treatments which activate the immune system,” said Dr. John Valliant, CEO. “Fusion is focused on combining our expertise in radiopharmaceutical development and production with the appropriate targeting molecules to create a new generation of therapeutics that can address the need for better cancer treatments. Fusion is proud to join a wave of new Canadian biotech companies that are being launched with innovative technologies emerging from research institutions like McMaster University.” Fusion Pharmaceuticals will use the financing proceeds to advance its lead program, FPX-01, into human clinical trials. FPX-01 is an antibody-targeted radiotherapy, which seeks out a specific biomarker of resistance that is present on nearly all types of treatment refractory cancers. The technology is designed to selectively deliver actinium-225 to tumor cells so that in conjunction with internalization, the alpha particles emitted will eradicate diseased tissue. In parallel, Fusion Pharmaceuticals gained access to a centyrin-based targeting molecule in preclinical development that has the potential to deliver isotopes to several cancer types and access to the centyrin protein targeting platform in two licensing agreements with Janssen Biotech, Inc. in transactions facilitated by Johnson & Johnson Innovation. Centyrins are protein targeting agents, proprietary to Janssen Biotech, characterized by high selectivity and specificity, combined with tunable pharmaceutical properties and efficient manufacturing. Fusion Pharmaceuticals is building its pipeline through access to the centyrin platform in combination with proprietary labeling technologies, which can be applied to a wide range of targeting molecules. Fusion Pharmaceuticals – A Product of a National Centre of Excellence with Comprehensive Sector Expertise Fusion Pharmaceuticals is a spin out from the Centre for Probe Development and Commercialization (CPDC), which is a Centre of Excellence for Commercialization and Research (CECR) located at McMaster University. The CPDC was created to take promising new technologies developed at Universities and use the arising knowledge advantages to realize economic and health benefits for Canadians. The CPDC, which employs over 80 people and has locations and major partnerships in Hamilton, Toronto, Ottawa and Boston, is supported by a range of stakeholders including the Networks of Centres of Excellence, the Ontario Institute for Cancer Research, McMaster University and several industry partners. See www.imagingprobes.ca for additional details. Fusion Pharmaceuticals was founded by Dr. John Valliant, who was also the founder and CEO of CPDC. Under Dr. Valliant’s direction, the CPDC supplied radiopharmaceuticals for over 40 clinical trials, facilitated the creation of three new companies, including building a rapidly expanding manufacturing business. Dr. Valliant, a Canada Research Chair in Medical Isotopes and Molecular Imaging Probes, is a Professor of Chemistry and Chemical Biology at McMaster University. He has won numerous awards including being selected as one of Canada’s top 40 under 40 in 2010. Fusion’s discovery and development programs are led by the chief scientific officer, Dr. Eric Burak, Ph.D. Eric previously held positions at CPDC, Theracos, Rib-X Pharmaceuticals and Guilford Pharmaceuticals. Eric oversees a world-class team of chemists and biologists who have extensive experience and unique skills in the alpha therapy field. Certain medical isotopes emit alpha particles, which are highly energetic ions that deposit their energy over very short distances traveling approximately the width of a single cell. When alpha emitting medical isotopes are delivered to cancer cells, they can kill tumor cells through multiple mechanisms including double stranded DNA breaks, which makes repair and hence resistance unlikely. Targeted alpha therapeutics use significantly smaller amounts of material than typical antibody-drug conjugates making it possible to exploit a wider array of drug targets and they do not require complex linkers to release the warhead. One of the additional benefits of Fusion’s alpha therapeutic approach will be creation of a companion diagnostic with each candidate. Fusion Pharmaceuticals is a new pharmaceutical company located in Hamilton, Ontario, Canada focused on becoming the leader in the targeted alpha therapy field. Fusion will exploit its unique expertise in linking medical isotopes to targeting molecules to create highly effective therapeutics. In addition to its lead program, FPX-01, Fusion is building a pipeline of products through a protein discovery platform, that allows for the rapid screening of new targeting molecules to promote biomarker localization of alpha emitting medical isotopes. Fusion’s technology development team also has proprietary methods for introducing alpha emitters into targeting molecules. (http://www.fusionpharma.com)


News Article | February 15, 2017
Site: www.eurekalert.org

Here are summaries of research to be presented by CIFAR fellows at the 2017 AAAS meeting in Boston, MA from Feb. 16-19. CIFAR Humans & the Microbiome Program Co-Director Janet Rossant (Hospital for Sick Children) will moderate a discussion on the microbes that inhabit humans -- collectively called the microbiome. Program Co-Director Brett Finlay (University of British Columbia) will speak on the role of the microbiome in early childhood. Senior Fellow Eran Elinav (Weizmann Institute of Science) will delve into how genes, diet and microbiomes interact. Ana Duggan of Senior Fellow Hendrik Poinar's lab (McMaster University) will describe how they reconstruct ancient genomes and microbiomes. CIFAR Azrieli Brain, Mind & Consciousness Senior Fellow Sheena Josselyn (Hospital for Sick Children) brings together leaders in the field of memory research, approaching the expansive question of the temporal component of memory using unique tools. Josselyn recently discovered the neural rules for separating emotional memories across the temporal context in the amygdala, and will discuss how this process may go awry with psychiatric conditions. Eran Elinav, a Senior Fellow in CIFAR's Humans & the Microbiome program, will answer questions about how the microbiome affects humans (especially in regards to their diet) as well as how it can affect entire societies--shaping them through both common diseases and pandemics. A quantum mechanical representation of information could enable revolutionary technologies, from fast computation to unbreakable encryption. CIFAR Senior Fellow in the Quantum Information Science program Michele Mosca (University of Waterloo) will discuss cybersecurity in an era with quantum computers. Associate Fellow in the Quantum Information Science program Scott Aaronson (University of Texas) will speak on how quantum research is deepening our understanding of physics and mathematics. CIFAR creates knowledge that is transforming our world. Established in 1982, the Institute brings together interdisciplinary groups of extraordinary researchers from around the globe to address questions and challenges of importance to the world. Our networks help support the growth of research leaders and are catalysts for change in business, government and society. CIFAR is generously supported by the governments of Canada, British Columbia, Alberta, Ontario and Quebec, Canadian and international partners, as well as individuals, foundations and corporations.


News Article | December 8, 2016
Site: www.eurekalert.org

A child mummy from the 17th century, found in a crypt underneath a Lithuanian church, was discovered to harbor the oldest known sample of the variola virus that causes smallpox. Researchers who sequenced the virus say it could help answer lingering questions about the history of smallpox, including how recently it appeared in humans (perhaps more recently than we thought) and when specific evolutionary events occurred. Their study appears December 8 in Current Biology. "There have been signs that Egyptian mummies that are 3,000 to 4,000 years old have pockmarked scarring that have been interpreted as cases of smallpox," says first author Ana Duggan, a postdoctoral fellow at the McMaster University Ancient DNA Center in Canada. "The new discoveries really throw those findings into question, and they suggest that the timeline of smallpox in human populations might be incorrect." The research team gathered the disintegrated variola virus DNA from the mummy after obtaining permission from the World Health Organization. Using RNA baits designed from existing variola sequences, the researchers targeted variola sequences found within the extracted DNA from the mummy's skin. Then they reconstructed the entire genome of the ancient strain of the virus and compared it to versions of the variola virus genome dating from the mid-1900s and before its eradication in the late 1970s. They concluded that these samples shared a common viral ancestor that originated sometime between 1588 and 1645--dates that coincide with a period of exploration, migration, and colonization that would have helped spread smallpox around the globe. "So now that we have a timeline, we have to ask whether the earlier documented historical evidence of smallpox, which goes back to Ramses V and includes everything up to the 1500s, is real," says co-author Henrik Poinar, the director of the Ancient DNA Centre at McMaster University in Canada. "Are these indeed real cases of smallpox, or are these misidentifications, which we know is very easy to do, because it is likely possible to mistake smallpox for chicken pox and measles." In addition to providing a more accurate timeline for the evolution of smallpox, the researchers were also able to identify distinct periods of viral evolution. One of the clearest instances of this occurred around the time that Edward Jenner famously developed his vaccine against the virus in the 18th century. During this period, the variola virus appears to have split into two strains, variola major and variola minor, which suggests that vaccination, which led to eradication of smallpox, may have changed the selection pressures acting on the virus and caused it to split into two strains. The researchers hope to use this work to identify how the sample they discovered in Lithuania compares to others that were sweeping throughout other countries in Europe at the same time. But in the bigger context of smallpox research, the scientists are optimistic that their work will provide a stepping stone to allow virologists to continue to trace smallpox and other DNA viruses back through time. "Now we know all the evolution of the sampled strains dates from 1650, but we still don't know when smallpox first appeared in humans, and we don't know what animal it came from, and we don't know that because we don't have any older historical samples to work with," says co-author Edward Holmes, a professor at the University of Sydney in Australia. "So this does put a new perspective on this very important disease, but it's also showing us that our historical knowledge of viruses is just the tip of the iceberg." This work was supported by the McMaster Ancient DNA Centre at McMaster University, the Department of Virology at the University of Helsinki, the Department of Anatomy, Histology and Anthropology at Vilnius University, the Marie Bashir Institute for Infectious Diseases and Biosecurity, the Department of Biochemistry and Molecular Science and Biotechnology at the University of Melbourne, the Department of History at Duke University, the Department of Biology at McMaster University, UC Irvine, the Mycroarray in Michigan, the Department of Chemical Engineering at the University of Michigan, the Center for Microbial Genetics and Genomics at Northern Arizona University, the Laboratoire d'Anthropologie Biologique Paul Broca at the PSL Research University, Helsinki University Hospital, the Department of Forensic Medicine at the University of Helsinki, the Department of Pathology at the University of Cambridge, the Michael G. DeGroote Institute for Infectious Disease Research at McMaster University and the Humans & the Microbiome Program at the Canadian Institute for Advanced Research. Current Biology, Duggan, Marciniak, Poinar, Emery, Poinar et al: "17th Century Variola Virus Reveals the Recent History of Smallpox" http://www.cell.com/current-biology/fulltext/S0960-9822(16)31324-0 Current Biology (@CurrentBiology), published by Cell Press, is a bimonthly journal that features papers across all areas of biology. Current Biology strives to foster communication across fields of biology, both by publishing important findings of general interest and through highly accessible front matter for non-specialists. Visit: http://www. . To receive Cell Press media alerts, contact press@cell.com.


News Article | December 23, 2016
Site: www.eurekalert.org

The Biophysical Society has announced the winners of its Education Committee Travel Awards to attend the Biophysical Society's 61st Annual Meeting in New Orleans, Louisiana, February 11-15, 2017. The recipients of this competitive award, all of whom are students and postdoctoral fellows, are selected based on scientific merit. Each awardee will be presenting their research during the meeting, will receive a travel grant, and will be recognized at a reception on Saturday, February 11, at the Ernest N. Morial Convention Center. Mihai Azoitei, University of North Carolina at Chapel Hill, NOVEL BIOSENSOR DESIGN REVEALS THE ROLE AND REGULATION OF GEF-H1 IN CELL MIGRATION. Mouhanad Babi, McMaster University, THE CHARACTERIZATION OF CELLULOSE NANOSTRUCTURE USING SUPER-RESOLUTION FLUORESCENCE MICROSCOPY. Curtis Balusek, Georgia Institute of Technology, CONSTRUCTING AN IN SILICO MODEL OF THE GRAM-NEGATIVE CELLULAR ENVELOPE. Paola Bisignano, University of California, San Francisco, STRUCTURAL INSIGHTS INTO SODIUM-DEPENDENT SUGAR TRANSPORTERS AND THEIR INHIBITION MECHANISM. Breane Budaitis, University of Michigan, THE ROLE OF THE COVER-NECK BUNDLE IN MULTI-MOTOR TRANSPORT AGAINST LOAD IN CELLS. Shirley Chen, University of Michigan, ENGINEERING INHIBITABLE KINESIN-3 MOTORS BY A NOVEL CHEMICAL-GENETIC APPROACH. Saikat Chowdhury, The Scripps Research Institute, USING CRYOEM TO UNDERSTAND HOW PHAGES EVADE BACTERIAL CRISPR DEFENSE SYSTEM. Alexander Chu, California Institute of Technology, TOWARDS A UNIVERSALCHARACTERIZATION OF THE MEMBRANE PROTEIN EXPRESSION LANDSCAPE. Miranda Collier, University of Oxford, EVIDENCE FOR CHAPERONE FUNCTION IN MECHANOSENSATION. Caitlin Cornell, University of Washington, DIRECT IMAGING OF LIQUID DOMAINS BY CRYOTEM IN SUBMICRON VESICLES. Yavuz Dagdas University of California, Berkeley, CONFORMATIONAL DYNAMICS OF CAS9 DURING DNA BINDING. Peter Dahl, University of Michigan, A SUPPORTED TUBULATED BILAYER SYSTEM SHOWS EFFECTS OF SYNAPTOTAGMIN-7 ON MEMBRANE CURVATURE. Russell Davidson, Colorado State University, MOLECULAR ALLOSTERY IN DENGUE NS3 HELICASE ALONG THE ATP HYDROLYSIS CYCLE. Melody Di Bona, Italian Institute of Technology, CHROMATIN ACCESSIBILITY STUDIED BY SLOW SCAN FCS IN THE EUKARYOTIC NUCLEUS. Matthew Dragovich, Lehigh University, INVESTIGATION OF THE RELIABILITY OF AFM NANOINDENTATION-DERIVED MEASUREMENTS OF CELL MECHANICS. Paige Engen, Hamline University, STRUCTURAL ANALYSIS OF TAU PEPTIDE INTERACTIONS WITH LIPID MEMBRANES USING FOURIER TRANSFORM INFRARED SPECTROSCOPY. CristianEscobar, Florida State University, CONFORMATION PLASTICITY ANDPEPTIDOGLYCAN CLEAVAGE BY THE N-TERMINAL INTRINSICALLY DISORDERED DOMAIN OF CHIZ. Gozde Eskici, University of Pennsylvania, MICROSECOND SIMULATIONS OF AMYLOID BETA FIBRIL NUCLEATION IN REVERSE MICELLES. Emmet Francis, University of California at Davis, SINGLE-CELL INVESTIGATION OFTHE ROLE OF CALCIUM BURSTS IN HUMAN IMMUNE CELLS. Wolfgang Gross, University of Bayreuth, MACROPHAGES ARE SENSITIVE TO SUBSTRATE ELASTICITY DURING PHAGOCYTOSIS. Shubhasis Haldar, Columbia University, TRIGGER FACTOR BOOSTS THE WORK DONE BY PROTEIN FOLDING UNDER FORCE. Alice Herneisen, Swarthmore College, SITE-DIRECTED SPIN LABELING EPR SPECTROSCOPY OF THE CYTOPLASMIC TAIL OF INFLUENZA A M2. Naoto Hori, University of Texas, MULTISTEP FOLDING KINETICS OF GROUP I INTRON RNA STUDIED BY Mg2+-CONCENTRATION JUMP SIMULATIONS. Jesse Howe, CSU San Marcos, EXPANDING THE SCOPE OF SINGLE MOLECULE FRET SPECTROSCOPY TOWARDS PRIMARILY UNDERGRADUATE INSTITUTIONS. Abir Kabbani, Wayne State University, NANOSCALE MEMBRANE BUDS INDUCED BY CTXB-GM1 IN ONE COMPONENT BILAYER DETECTED BY POLARIZED LOCALIZATION MICROSCOPY (PLM). Shachi Katira, University of California, Berkeley, PRE-TRANSITION EFFECTS MEDIATE FORCES OF ASSEMBLY BETWEEN TRANSMEMBRANE PROTEINS: RECENT RESULTS ON THE ORDERPHOBIC EFFECT. Hema Chandra, Kotamarthi, Massachusetts Institute of Technology, SINGLE-MOLECULE DISSECTION OF THE ROLE OF DIRECTIONALITY IN PROTEIN DEGRADATION BY Clp PROTEOLYTIC MACHINES. Sudipta Lahiri, Wesleyan University, ELUCIDATION OF THE STRUCTURE-FUNCTION RELATIONSHIP OF S. CEREVISIAE MUTS HOMOLOG MSH4 AND MSH5 WITH THE HOLLIDAY JUNCTION. Ying Lai, Stanford University, MUNC13 AND MUNC18 COOPERATE TO PROPERLY ASSEMBLE SNARES FOR FAST NEUROTRANSMITTER RELEASE. Christopher Lee, University of California, San Diego, INVESTIGATING TRANSPORT PROPERTIES WITH MULTI-SCALE COMPUTABLE MESH MODELS FROM HETEROGENEOUS STRUCTURAL DATASETS. Maureen Leninger, New York University, INVESTIGATING THE STRUCTURE OF THE DRUG TRANSPORTER EMRE. Alyssa Lombardi Temple University School of Medicine, GENETIC ABLATION OFFIBROBLAST MITOCHONDRIAL CALCIUM UPTAKE INCREASES MYOFIBROBLASTTRANSDIFFERENTIATION AND EXACERBATES FIBROSIS IN MYOCARDIAL INFARCTION. Victor Pui-Yan Ma, Emory University, RATIOMETRIC TENSION PROBES FOR MAPPING RECEPTOR FORCES AND CLUSTERING AT INTERMEMBRANE JUNCTIONS. Mohammad Mehdi Maneshi, University at Buffalo, SHEAR STRESS STIMULATED MSC ACTIVITIES: DIRECT CHANGES OF MEMBRANE TENSION OR CYTOSKELETALSTRESS? Dipak Maskey, Institute of Medicine, DEGRADATION OF CALPONIN 2 IS REQUIRED FOR CYTOKINESIS. Isha Mehta, Texas Woman's University, PROTEIN ENERGY NETWORK MODELS TO CLASSIFY AND PREDICT FUNCTIONALLY LINKED INTERFACES OF PROTEINS FROM FUNCTIONALLY UNCORRELATED INTERFACES. Paula Morales, University of North Carolina at Greensboro, CONSTRUCTION OF A GPR3 HOMOLOGY MODEL USING CONFORMATIONAL MEMORIES. Medeea Popescu, Wellesley College, EXAMINING THE ROLE OF PHOSPHORYLATION ON INTERACTIONS BETWEEN THE CARDIAC POTASSIUM CHANNEL ALPHA-SUBUNITS HERG AND KVLQT1. Dana Reinemann, Vanderbilt University, SINGLE MOLECULE CHARACTERIZATION OF MITOTIC KIF15 REVEALS CAPABILITY TO GENERATE FORCE IN ANTI-PARALLEL MICROTUBULES. Talant Ruzmetov, Kent State University, EXPLORING THE ROLE OF FLEXIBILITY IN BINDING KINETICS AND AFFINITY OF PKID-KIX THROUGH COARSE GRAINED SIMULATIONS. Kristin Schimert, University of Michigan, INTRACELLULAR CARGO TRANSPORT BY SINGLE-HEADED KINESIN MONOMERS. Digvijay Singh, Johns Hopkins University School of Medicine, INVESTIGATION OF DNA BINDING, NUCLEOLYSIS AND PRODUCT RELEASE SPECIFICITY OF RNA GUIDED ENDONUCLEASE CRISPR-CPF1 FAMILY REVEALS IMPORTANT DIFFERENCES FROM CAS9-RNA. Kyle Smith, Northwestern University, THE TWO GTPASE DOMAINS OF THE OUTER MITOCHONDRIAL MEMBRANE PROTEIN MIRO HAVE NOVEL ACTIVE SITE CONFORMATIONS AND DISTINCT BIOCHEMICAL PROPERTIES. Kevin Votaw, Colorado State University, INSIGHTS INTO DAMAGED BASE DETECTION BY DNA GLYCOSYLASES: A COMPUTATIONAL STUDY OF ALKD. Sienna Wong, Wayne State University, ENGINEERING OF CHIMERIC PROTEINS TO ENHANCE IMMUNOGENICITY FOR THE PRODUCTION OF HIGH-AFFINITY SPECIFIC MONOCLONAL ANTIBODIES. Riley Workman, Duquesne University, CHARACTERIZATION OF THE CONFORMATIONAL ENSEMBLE OF POLYGLUTAMINE PEPTIDES VIA METADYNAMICS MD SIMULATIONS AND UV RESONANCE RAMAN SPECTROSCOPY. Goli Yamini, The Catholic University of America, IMPACT OF DENDRIMER SURFACE CHEMISTRY ON ANTHRAX TOXIN CHANNEL BLOCKAGE: A SINGLE MOLECULE STUDY. Fan Yang, University of California, Davis, RATIONAL DESIGN AND VALIDATION OF A VANILLOID-SENSITIVE TRPV2 ION CHANNEL. Chen-Ching Yuan, University of Miami, DISTINCT LATTICE STRUCTURE ALTREATIONS IN DCM AND HCM MOUSE MODELS ASSOCIATED WITH MUTATIONS IN MYOSIN REGULATORY LIGHT CHAIN. Rebecca Zaunbrecher, University of Washington, GENETICALLY ENGINEERED HUMAN STEM CELL-DERIVED CARDIOMYOCYTES TO STUDY THE FUNCTIONALITY OF CRONOS TITIN. Zhenfu Zhang, University of Toronto, INTERPLAY AMONG BINDING, PHOSPHORYLATION AND DENATURATION IN DISORDERED 4E-BP2 AS PROBED BY SINGLE MOLECULE FLUORESCENCE. Yue Zhang, Mississippi State University, MODELING THE EARLY STAGES OF AGGREGATION IN DISORDERED ELASTIN-LIKE PROTEINS. Haiqing Zhao, University Of Maryland, PROMISCUOUS HISTONE MIS-ASSEMBLY IS ACTIVELY PREVENTED BY CHAPERONES. Chi Zhao, University of Texas at Austin, PLASMA MEMBRANE VESICLES WITH ENGINEERED TRANSMEMBRANE PROTEIN LIGANDS FOR HIGH-AFFINITY CELL TARGETING. The Biophysical Society, founded in 1958, is a professional, scientific Society established to encourage development and dissemination of knowledge in biophysics. The Society promotes growth in this expanding field through its annual meeting, monthly journal, and committee and outreach activities. Its 9000 members are located throughout the U.S. and the world, where they teach and conduct research in colleges, universities, laboratories, government agencies, and industry. For more information on these awards, the Society, or the 2017 Annual Meeting, visit http://www. .


News Article | October 22, 2015
Site: news.yahoo.com

In an era of thousand-dollar pills and DNA-altering technologies, doctors are increasingly turning to a seemingly crude technique to treat chronic intestinal problems: poop transplants. Fecal microbiota transplantation (FMT), as it is properly called — and there's no sugarcoating the description here — is the process of placing the feces of a healthy person into the gut of a patient with an intestinal problem, such as chronic diarrhea or irritable bowel syndrome. The transplant occurs via a tube or capsule put down one's throat or up one's bottom. The theory is that the transplanted stool — upward of 10 teaspoons' worth — introduces a healthy mix of bacteria that can overtake the harmful bacteria causing the intestinal problems. More than 4,000 gut specialists have gathered at the 80th annual meeting of the American College of Gastroenterology in Honolulu, Hawaii, and one item on their agenda is discussing the merits of FMT. Several presentations on Monday (Oct. 19) addressed the key concerns about FMT. It is now established that the technique is safer, more effective and less expensive than standard antibiotic treatment for at least one common ailment: recurrent Clostridium difficile (C. diff) infection, researchers said. And this may be true for other diseases, as well, the scientists said. [The Poop on Pooping: 5 Misconceptions Explained] C. diff, a gut-residing bacterium that can result in diarrhea so severe that the dehydration can be fatal, causes half a million infections and more than 29,000 deaths in the United States annually, according to a study published in February in the New England Journal of Medicine. People often contract the illness while they are in hospitals, after a treatment with antibiotics for some other sickness; the antibiotics can wipe out the population of good bacteria in one's gut and allow C. diff to flourish. The standard treatment for initial C. diff infection, perhaps ironically, is more antibiotics, even though this poses a 20 percent risk for a recurrent infection, said Dr. Sahil Khanna of the Mayo Clinic in Rochester, Minnesota, who presented his results yesterday at the Hawaii meeting. Khanna and his colleagues have developed a technique to accurately predict, for the first time, which patients are unlikely to benefit from antibiotic treatment, based on the number of various bacterial species in the patients' stool. Those who are at high risk of failing to improve with antibiotic treatment could consider FMT instead, he said. The new prediction technique could help tailor more appropriate treatments for patients, Khanna said. This can be crucial in saving lives, given that recurrent C. diff infections are even more difficult to treat than the initial infection, he said. Vancomycin and other drug treatments have only a 40 to 50 percent success rate in treating recurrent C. diff, compared to FMT's nearly 90 percent success rate. Dr. Zain Kassam, a research affiliate at Massachusetts Institute of Technology (MIT) Center for Microbiome Informatics and Therapeutics, reported that FMT is not only more effective but also less expensive than vancomycin in treating recurrent C. diff. The infection amounts to $4.8 billion in health care costs yearly, and using FMT from a "stool bank" instead of the standard treatment could save the nation more than $121 million yearly, he calculated. "Clinical guidelines for C. difficile — including [those from] the American College of Gastroenterology and the European Society of Clinical Microbiology and Infectious Diseases — are moving towards FMT being recommended for the treatment of recurrent C. difficile given the emerging evidence," Kassam told Live Science. Kassam is also chief medical officer at the MIT-affiliated OpenBiome, a nonprofit stool bank registered with the FDA that collects feces from donors, with the goal of expanding safe access to FMT. Donors are paid for their feces, and only 2.8 percent of candidate donors pass through the rigorous OpenBiome screening process, Kassam said. [The Poop on Pooping: 5 Misconceptions Explained] Safety is a top concern with FMT, because feces can harbor unknown pathogens. And stool is more difficult to test than a drug or donated blood. Although there have been no reports of people getting sick as a result of FMT, a case study published earlier this year reported that a thin woman gained 34 lbs. (15 kilograms), and couldn't lose the weight, after receiving a fecal transplant from an obese donor. Thus, doctors began to wonder whether one could "catch" obesity through FMT. But a new study, also presented at the Hawaii meeting, may ease those worries. Dr. Monika Fischer, of the Indiana University Department of Medicine in Indianapolis, found no risk of increased weight after FMT. Her study included 58 FMT patients, including 22 who received fecal transplants from overweight donors. As promising as FMT appears to be, it is in legal limbo in the United States, as the FDA continues to mull over how to regulate the procedure. The FDA announced a policy in July 2013 that allows physicians to treat a person who has a C. diff infection with FMT only if a few conditions are met: The patient must be failing to respond to standard therapy, and the doctor must obtain informed consent, explain the risk and benefits, and tell the patient that FMT is investigational. But to treat patients with C. diff that is not recurrent, or those who have another intestinal disorder, such as irritable bowel syndrome or Crohn's disease, doctors first need to complete an Investigational New Drug (IND) application. Some doctors say this requirement is cumbersome and discourages use of the treatment. "Our stool bank has a deep respect for the regulatory challenges the FDA is facing in this rapidly evolving field," Kassam said. "Overall, enforcement discretion paints a picture that the FDA recognizes that FMT is a square peg and doesn't fit nicely into a round hole like other therapies," such as blood transfusions and other tissue donations, he said. As the field grows and evidence mounts that FMT may treat diseases beyond C. diff, Kassam said that the FDA will face unique challenges balancing public health, economic impact and safety for this "potentially paradigm-shifting treatment." Other studies, mostly from non-U.S. institutions, have found that FMT is beneficial for people with inflammatory bowel disorders such as Crohn's disease and ulcerative colitis. One of the largest studies, published this year, was a randomized control trial of 70 patients with ulcerative colitis. The researchers, at McMaster University in Ontario, Canada, found significant improvements in patients who received FMT compared with those who received a placebo treatment. Follow Christopher Wanjek @wanjek for daily tweets on health and science with a humorous edge. Wanjek is the author of "Food at Work" and "Bad Medicine." His column, Bad Medicine, appears regularly on Live Science. 5 Things Your Poop Says About Your Health Copyright 2015 LiveScience, a Purch company. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.


News Article | April 29, 2016
Site: www.biosciencetechnology.com

People often complain they don’t have time to exercise or fit a work-out routine into their busy schedules, but a new study may throw that excuse out of the window.  Researchers at McMaster University in Canada say just one minute of high intensity exercise results in similar health benefits as 45 minutes of moderate-intensity training. For the study researchers randomly assigned 27 out of shape men to either sprint interval training (SIT), moderate-intensity continuous training (MICT) or a control group that did not exercise.  Those in the SIT and MICT groups performed three days of training each week for 12 weeks.  At the beginning of the study researchers examined the men’s cardiorespiratory fitness and their insulin sensitivity to see how well the body regulates sugar. The MICT interval training involved 45 minutes of continuous cycling on a stationary bicycle with a two-minute warm-up and three-minute cool down.  The SIT training totaled 10 minutes of cycling, with only one of those minutes at high intensity. Specifically it involved a two-minute warm up; then 20 seconds of intense cycling; followed by two minutes of riding at a slow pace; 20 more seconds of all-out pedaling; two minutes of recovery riding;  a final 20-second sprint; then a three minute cool down. At the end of the 12 weeks the researchers found the two groups saw remarkably similar health benefits, despite the MICT group performing five times as much exercise, 27 hours of riding, as the SIT group, who only exercised for a total of 6 hours – with 36 minutes of high intensity. The New York Times reported that both groups saw significant improvements in insulin resistance, and both increased endurance by almost 20 percent. “Our study shows that an interval-based approach can be more efficient – you can get health and fitness benefits comparable to the traditional approach, in less time,” lead study author Martin Gibala, professor of Kinesiology at McMaster, said in a prepared statement. The findings were published April 26 in PLOS One.


The current political rhetoric between India and Pakistan underlines the risk of failing to manage correctly and cooperatively vital water resources shared between nations. India's suspension of the Indus Water Commission meeting on 26 September 2016, and its convening of a meeting to review India's options for modifying or walking away from the Indus Water Treaty, was immediately met with sharp retorts from political leaders in Pakistan, who suggested that any Indian attempt to renege from the Treaty would be deemed an act of war. This potential global catastrophe looms in Asia as rapidly rising water demand collides with a diminishing resource on which at least 300 million people depend directly, warns a new book from United Nations University's Canada-based Institute for Water, Environment and Health (UNU-INWEH). The book, "Imagining Industan," appeals to the three nuclear armed powers sharing the Indus River basin -- India, Pakistan and China -- and Afghanistan to begin working together as never before to manage the precious resource. Its editors describe the book as an effort "to kindle serious discussion of the trans-boundary cooperation needed to confront what more and more water experts believe is developing into one of the planet's most gravely threatened river basins." The book's 14 contributing experts acknowledge the immensity of the challenges in a region prone to political and military conflict but say "much greater collective planning is essential...if the Indus basin is to escape the likely disastrous consequences of continued failure to collaborate." Published by Springer, the 216-page work is the culmination of a project supported by UNU-INWEH and proposes a new course for the 1,120,000 km2 basin drained by the Indus River, six major tributaries and connected waterways covering over 65% of Pakistan, a significant part of India (14%) and smaller areas of Afghanistan (11%) and China (1%). Zafar Adeel, Executive Director of the Pacific Water Research Centre at Simon Fraser University, Canada, co-edited the work with Robert G. Wirsing, recently retired Professor of Government at Georgetown University's School of Foreign Service in Doha, Qatar. Most of the Indus waters flow from glaciers and melting snow high in the Himalayan Mountains and the Tibetan Plateau. Pakistan and India have, until now, been by far its biggest consumers -- mainly for irrigation and generating hydroelectric energy -- through one of the most extensive system of dams and canals that originated with British engineers during the colonial period. Mushrooming water demand has led to pollution, shortages and conflict in those countries, and rapid population and economic growth adds to these problems. Disputes over water have fuelled conflicts within and between the riparian nations, and that history of conflict, in turn, increases the difficulty of achieving amicable and sustainable solutions. The situation will only worsen as climate change threatens the resource and China and Afghanistan divert more of it for their own uses. Numerous new dams are planned or under construction in all four countries. "Industan" is a play on words to emphasize the need to think of the basin as a single, integrated resource. The basin "lies in a part of the world where intense distrust, chronic conflict, and bitterly contentious water policies have a long history," the editors say, and Dr. Wirsing admits that "the subject of this book might seem imprudently optimistic." However, "it was not really optimism that drove the project to completion but a combination of the available opportunities and what might happen if they are not availed." The consensus of all the book's contributors: "Further delay in tackling collectively the region's widely shared and massive problem of water insecurity probably risked intensifying already considerable tensions among the four states sharing the basin." Water shortages could lead to economic distress and internal political instability, particularly in Pakistan, whose freshwater withdrawal at 183 billion m3 per year is the world's fourth highest rate of water use behind India, China, and the United States. Making matters worse, the Indus basin is widely expected to be among the world's worst-affected from climate change, leading to drought, desertification, less predictable monsoon rains, weather turbulence, flooding, sea level rise, and glacial retreat -- all with "potentially harmful collective economic and political consequences." Co-operation could start with sharing data, which would not only increase understanding of the resource but raise the level of trust among the four nations. Cooperation is possible also on specific areas of concern, such as dealing with the impacts of climate change, the sharing of hydropower energy, and collective responses to water-related natural disasters. Says UNU-INWEH Director Vladimir Smakhtin: "The book is an important contribution to creating the awareness of the existing and emerging water-related conflicts in the world, and a loud call for immediate strengthening of transboundary cooperation - to increase both water security and overall regional security. The Indus river basin may be seen as a water time bomb, which may go off any time with increasing water scarcity, variability and progressively changing climate. There are similar water-related accumulating tensions and issues in other major river basins and UNU-INWEH has embarked on the scrupulous analysis of those to ensure peaceful and sustainable trajectory of river basin developments." Views of the authors do not necessarily reflect those of the University. The UNU Institute for Water, Environment and Health is a member of the United Nations University family of organizations. It is a UN Think Tank on Water and its mission is to help resolve pressing water challenges of concern to the UN Member States through science synthesis, cutting edge research, application of on-the-ground science-based scalable solutions and targeted public outreach. It is supported by the Government of Canada and hosted by McMaster University.


Approximately 250 leading scientists and medical specialists from all over the world are meeting at the Royal Tropical Institute (KIT) in Amsterdam on December 1st and 2nd to discuss the influence of intestinal bacteria on the brain. The enormous enthusiasm for the Mind, Mood & Microbes conference shows that gut-brain communication is a hot topic. A human body contains more bacterial than human cells. Thanks to modern technology, we are increasingly able to determine what kinds of bacteria reside in the intestine and what effect they have on the body and brain. During the Mind, Mood & Microbes conference, neuropharmacologist Prof. Dr. John F. Cryan of University College Cork in Ireland will give a lecture on the influence of these intestinal bacteria (also called gut microbiota) on our brain. According to the professor, the composition of the gut microbiota and how they influence the brain via different substances/hormones is determined by different factors, such as; mode of delivery (cesarean section or vaginally), stress, use of antibiotics, and other environmental factors also play an important role. In the last ten years, there has been an enormous increase in fundamental research in this field. According to Cryan, your brain can't function normally without your gut microbiota.[1] Research with mice, for example, shows that sterile mice (without intestinal bacteria) exhibit abnormal behavior; they are anxious, less social and even show autistic-like behaviour. In addition, they have various structural changes in their brain that indicate the importance of bacteria in the intestines. It teaches us that microorganisms are necessary for the normal development of the brain. A disturbance in the gut microbiota may be connected with certain brain disorders. A lot of research is being conducted on the mechanisms how intestinal bacteria affect brain health and -function. Communication seems to take place via, among other things, neurons and messenger substances. Recent research shows that the composition of intestinal bacteria in patients with various brain disorders is different than the composition in healthy people.[2],[3] Professor Cryan sees potential in the use of beneficial bacteria (in other words, probiotics) for brain health. Now, clinical research is upcoming, in this way we can further unravel which microbial interventions have the desired effect in which type of patients. By bridging the gap between fundamental research and clinical practice during the Mind, Mood & Microbes conference, this will potentially lead to new, targeted therapies in the future. So-called 'psychobiotics' could play a role in the treatment of various neurological and psychiatric disorders, such as; depression, anxiety disorders, ADHD, aggression, Parkinson's, schizophrenia, autism and Alzheimer's disorders. The first results in humans have been published in anxiety, depression, and schizophrenia.[4]-[6] Some of these specific probiotics are already on the market. The international Mind, Mood & Microbes conference lasts two days and will start on Thursday at 8:30 with lectures by Prof. Dr. Cryan and professor of psychiatry Iris Sommer. There are also other renowed speakers, such as Prof. Dr. Jane Foster (McMaster University, Canada), Prof. Dr. Ted Dinan (Cork, Ireland), Dr. Francisco Quintana (Harvard, America) and many others. More information about the conference can be found at: http://www.mindmoodmicrobes.org 1. Cryan and T. G. Dinan (2016). "Transferring the blues: Depression-associated gut microbiota induces neurobehavioural changes in the rat." J Psychiatr Res 82: 109-118. 2. Scheperjans, F., V. Aho, P. A. Pereira, K. Koskinen, L. Paulin, E. Pekkonen, E. Haapaniemi, S. Kaakkola, J. Eerola-Rautio, M. Pohja, E. Kinnunen, K. Murros and P. Auvinen (2014). "Gut microbiota are related to Parkinson's disease and clinical phenotype." Mov Disord. 3. Giloteaux, L., J. K. Goodrich, W. A. Walters, S. M. Levine, R. E. Ley and M. R. Hanson (2016). "Reduced diversity and altered composition of the gut microbiome in individuals with myalgic encephalomyelitis/chronic fatigue syndrome." Microbiome 4(1): 30. 4. Steenbergen, L., Sellaro, R., van Hemert, S., Bosch, J. A. & Colzato, L. S. A randomized controlled trial to test the effect of multispecies probiotics on cognitive reactivity to sad mood. Brain, behavior, and immunity 48, 258-264, doi:10.1016/j.bbi.2015.04.003 (2015). 5. Messaoudi M1, Violle N, Bisson JF, Desor D, Javelot H & Rougeot C. (2011) Beneficial psychological effects of a probiotic formulation (Lactobacillus helveticus R0052 and Bifidobacterium longum R0175) in healthy human volunteers. Gut Microbes. jul-Aug;2(4):256-61. doi: 10.4161/gmic.2.4.16108. Epub 2011 Jul 1.


News Article | February 8, 2017
Site: www.techtimes.com

No time to hit the gym? Brief but intense stair-climbing, which can be done almost anywhere, is just as good for the heart as a physical workout, a new study suggests. A team of researchers at McMaster University in Ontario, Canada found that stair climbing is a convenient and easy way to fit exercise into your life, especially if your schedule is too packed. The study negates two common excuses of couch potatoes: no access to the gym and no time to visit one. Kinesiology professor Martin Gibala, lead author of the new study, said stair climbing is a kind of exercise that anyone can do after work or during lunch hour. "This research takes interval training out of the lab and makes it accessible to everyone," said Gibala, an expert at high-intensity interval training and author of a book called "The One Minute Workout." Past studies have shown that vigorous stair climbing accumulated over long periods of time - about 70 minutes in seven days - can have positive benefits. However, Gibala and his colleagues set out to investigate whether sprint interval training (SIT) is a time-efficient and effective alternative that improves heart health. SIT involves brief bursts of intense exercises separated by short periods of break. The research team recruited 31 women who were sedentary but otherwise healthy. They tested the effect of two different procedures, each of which lasted for 10 minutes, including periods of cool down, warm-up, and recovery. The first procedure involved three bouts of continuous climbing that lasted for 20 seconds. The results of this first procedure were compared among women who ran through the same procedure but with an exercise bike that has been proven to improve fitness. During the second procedure, participants vigorously climbed up and down one flight of stairs for 60 seconds - an experiment that can be performed at home. Both protocols, which lasted for 30 minutes, increased the cardiorespiratory fitness of the participants, which is an important health marker for longevity. Gibala said that instead of structuring your life around exercise, you can do stair climbing, especially if you don't have the time. Aside from exercise, you can also slowly change your lifestyle and diet into foods that are good for your heart health. The American Heart Association suggests adding oatmeal, wheat berries, and quinoa to your diet to make it healthy. Details of the new study are issued in the journal Medicine & Science in Sports & Exercise. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | February 15, 2017
Site: www.eurekalert.org

Hamilton, Ont., Canada. -- McMaster University's innovative experimental co-location between an academic research centre and a rapidly growing startup company has begun to yield successes. The university's Computing Infrastructure Research Centre (CIRC, which is a research centre in the Faculty of Engineering, shares space with its founding industry partner Cinnos Mission Critical Inc. at the McMaster Innovation Park. CIRC's team of researchers and students are focused on developing cutting-edge technologies for data centres. Cinnos is a technology start-up forged in the McMaster Innovation Ecosystem, and designs and sells appliances for rapid, low cost, and highly efficient deployment of scalable data centre facilities. Breaking with the traditional industry-academic research paradigm, Cinnos and McMaster decided to collocate their resources by forming CIRC. The space is designed such that researchers and students at CIRC mingle freely with Cinnos entrepreneurs, enabling a close alignment between the market opportunities and customer needs of the industry with research and technology. This seamless collaboration between the two organizations has already brought tremendously successful products into the market place, such as the Cinnos flagship Smart MCX, the world`s first data centre in a box, as well as the Smart MC-M, a modular, data-driven, intelligent monitoring system for computing facilities. "CIRC is founded on a pioneering model of university-industry collaboration," says Suvojit Ghosh, the centre's co-founder and Executive Director. "It magnifies the impact of research, through accelerated translation of research for both economic and societal benefits, in a competitive real-world environment. Further, our students not only get a deep and meaningful research experience, but they also learn about the importance of the customer needs and market opportunities in defining and driving that research. These are things that could not happen if CIRC and Cinnos did not share the same space and similar visions." "Thanks to our innovative model, Cinnos proprietary MCX has sales both in Canada and internationally in less than 18 months from our inception. In addition, we have recently raised over $2M in financing to fund our global expansion. We simply could not have achieved this feat without the world-class team of CIRC and the strong and unwavering support from McMaster University and the Faculty of Engineering," said Hussam Haroun, CEO and co-founder of Cinnos, and among the architects of CIRC. With ambitions to be a global leader in the data centre industry, Cinnos envisioned a strong R&D program from its inception. This manifested in six projects that are designed to transform archaic and wasteful practices in the data centre industry. They were architected in a close collaboration with the Faculty of Engineering at McMaster University. The projects are funded through over $3M committed by Cinnos, and augmented by grants from multiple Government agencies. Cinnos has developed and commercialized the world's first data centre appliance that enables immediate deployment and a pay-as-you-grow model for data centre providers. Furthermore, thanks to its proprietary modular design, The Cinnos Smart MCX™ enables immediate deployment of data centres for a fraction of the cost of traditional mission critical facilities (MCF), hence accelerating revenues and bringing dramatically higher ROI to our customers as compared with the traditional construction-based MCF. Founded by Hussam Haroun in June 2015 following his graduation from McMaster MEEI program, Cinnos achieved breakeven in less than twelve (12) months of operations. For more information, please visit http://cinnos. CIRC, or the Computing Infrastructure Research Centre at McMaster University, is the first research centre focused on data centre innovations in Canada. CIRC was founded earlier this year, and is mandated to develop, promote, and advocate for technologies and products that eliminate wasteful practices in data centres, addressing a $100B+ global industry. The R&D functions of CIRC are unique in their emphasis on market validation from the conceptions stage, ensuring research relevance and guaranteed economic, societal, and environmental impact. This has manifested in high ROI on R&D expenses: within the first year of its existence, CIRC has developed technology that has led to revenue generating product lines for Cinnos.


SOUTH SAN FRANCISCO, Calif., Nov. 28, 2016 (GLOBE NEWSWIRE) -- Portola Pharmaceuticals (Nasdaq:PTLA) today announced that clinical and preclinical results from studies of all three of its investigational drugs -- AndexXa™ (andexanet alfa), betrixaban and cerdulatinib -- will be presented at the upcoming 58th American Society of Hematology (ASH) Annual Meeting and Exposition, which is taking place from December 3-6 at the San Diego Convention Center. AndexXa, a U.S. Food and Drug Administration (FDA)-designated Breakthrough Therapy, is in development for patients treated with a direct (apixaban, rivaroxaban or edoxaban) or indirect (enoxaparin) Factor Xa inhibitor when reversal of anticoagulation is needed due to life-threatening or uncontrolled bleeding. Betrixaban, which has Fast Track designation from the FDA, is an oral Factor Xa inhibitor anticoagulant in development for the prevention of venous thromboembolism (VTE) in acute medically ill patients. Cerdulatinib, an oral, dual Syk/JAK kinase inhibitor, is in development to treat patients with resistant or relapsed hematologic cancer. The abstracts are now available at https://ash.confex.com/ash/2016/webprogram/start.html. Following are details of the oral and poster presentations, which will include additional data not available in the abstracts. Publication #: 143             Presenting Author: Mark Crowther, M.D., MSc, FRCPC, Professor, Department of Medicine, Hematology and Thromboembolism and Pathology and Molecular Medicine, McMaster University, Hamilton, Ontario             Oral Session Name: 332. Antithrombotic Therapy: Anticoagulation and Bleeding             Presentation Date and Time: Saturday, December 3, 1:00 p.m. PT             Presentation Location: Room 30 Publication #: 3824             Presenting Author: Russell Hull, MBBS, University of Calgary, R.A.H. Faculty of Medicine, Alberta, Canada             Poster Session Name: 332. Antithrombotic Therapy: Poster III             Presentation Date and Time: Monday, December 5, 6:00-8:00 p.m. PT             Location: Hall GH Publication #: 351             Presenting Author: Andrew Steele, Ph.D., Associate Professor, Medicine, University of Southampton, Southampton, UK             Oral Session Name: 641. CLL: Biology and Pathophysiology, excluding Therapy: CLL Microenvironment: Cell Intrinsic and Extrinsic Factors             Presentation Date and Time: Sunday, December 4, 10:00 a.m. PT             Location: Room 5AB Publication #: 2768             Presenting Author: Greg Coffey, Ph.D., Senior Scientist II, Portola Pharmaceuticals             Poster Session Name: 605. Molecular Pharmacology, Drug Resistance -- Lymphoid and Other Diseases: Poster II             Presentation Date and Time: Sunday, December 4, 6:00-8:00 p.m. PT             Location: Hall GH About Portola Pharmaceuticals, Inc.  Portola Pharmaceuticals is a biopharmaceutical company developing product candidates that could significantly advance the fields of thrombosis and other hematologic diseases. The Company is advancing three programs, including betrixaban, an oral, once-daily Factor Xa inhibitor; AndexXa™ (andexanet alfa), a recombinant protein designed to reverse the anticoagulant effect in patients treated with an oral or injectable Factor Xa inhibitor; and cerdulatinib, a Syk/JAK inhibitor in development to treat hematologic cancers. Portola's partnered program is focused on developing selective Syk inhibitors for inflammatory conditions. For more information, visit www.portola.com and follow the Company on Twitter @Portola_Pharma.


News Article | April 27, 2016
Site: www.nature.com

NOD/SCID Il2rgnull mice (Jackson Laboratory) were bred and maintained in the Stem Cell Unit animal barrier facility at McMaster University. All procedures were approved by the Animal Research Ethics Board at McMaster University. All patient samples were obtained with informed consent and with the approval of local human subject research ethics boards at McMaster University. Human umbilical cord blood mononuclear cells were collected by centrifugation with Ficoll-Paque Plus (GE), followed by red blood cell lysis with ammonium chloride (StemCell Technologies). Cells were then incubated with a cocktail of lineage-specific antibodies (CD2, CD3, CD11b, CD11c, CD14, CD16, CD19, CD24, CD56, CD61, CD66b, and GlyA; StemCell Technologies) for negative selection of Lin− cells using an EasySep immunomagnetic column (StemCell Technologies). Live cells were discriminated on the basis of cell size, granularity and, as needed, absence of viability dye 7-AAD (BD Biosciences) uptake. All flow cytometry analysis was performed using a BD LSR II instrument (BD Biosciences). Data acquisition was conducted using BD FACSDiva software (BD Biosciences) and analysis was performed using FlowJo software (Tree Star). To quantify MSI2 expression in human HSPCs, Lin− cord blood cells were stained with the appropriate antibody combinations to resolve HSC (CD34+ CD38− CD45RA− CD90+), MPP (CD34+ CD38− CD45RA− CD90−), CMP (CD34+ CD38+ CD71−) and EP (CD34+ CD38+ CD71+) fractions as similarly described previously18, 19 with all antibodies from BD Biosciences: CD45RA (HI100), CD90 (5E10), CD34 (581), CD38 (HB7) and CD71 (M-A712). Cell viability was assessed using the viability dye 7AAD (BD Biosciences). All cell subsets were isolated using a BD FACSAria II cell sorter (BD Biosciences) or a MoFlo XDP cell sorter (Beckman Coulter). HemaExplorer20 analysis was used to confirm MSI2 expression in human HSPCs and across the hierarchy. For all qRT–PCR determinations total cellular RNA was isolated with TRIzol LS reagent according to the manufacturer’s instructions (Invitrogen) and cDNA was synthesized using the qScript cDNA Synthesis Kit (Quanta Biosciences). qRT–PCR was done in triplicate with PerfeCTa qPCR SuperMix Low ROX (Quanta Biosciences) with gene-specific probes (Universal Probe Library (UPL), Roche) and primers: MSI2 UPL-26, F-GGCAGCAAGAGGATCAGG, R-CCGTAGAGATCGGCGACA; HSP90 UPL-46, F-GGGCAACACCTCTACAAGGA, R-CTTGGGTCTGGGTTTCCTC; CYP1B1 UPL-20, F-ACGTACCGGCCACTATCACT, R-CTCGAGTCTGCACATCAGGA; GAPDH UPL-60, F-AGCCACATCGCTCAGACAC, R-GCCCAATACGACCAAATCC; ACTB (UPL Set Reference Gene Assays, Roche). The mRNA content of samples compared by qRT–PCR was normalized based on the amplification of GAPDH or ACTB. MSI2 shRNAs were designed with the Dharmacon algorithm (http://www.dharmacon.com). Predicted sequences were synthesized as complimentary oligonucleotides, annealed and cloned downstream of the H1 promoter of the modfied cppt-PGK-EGFP-IRES-PAC-WPRE lentiviral expression vector18. Sequences for the MSI2 targeting and control RFP targeting shRNAs were as follows: shMSI2, 5′-GAGAGATCCCACTACGAAA-3′; shRFP, 5′-GTGGGAGCGCGTGATGAAC-3′. Human MSI2 cDNA (BC001526; Open Biosystems) was subcloned into the MA bi-directional lentiviral expression vector21. Human CYP1B1 cDNA (BC012049; Open Biosystems) was cloned in to psMALB22. All lentiviruses were prepared by transient transfection of 293FT (Invitrogen) cells with pMD2.G and psPAX2 packaging plasmids (Addgene) to create VSV-G pseudotyped lentiviral particles. All viral preparations were titrated on HeLa cells before use on cord blood. Standard SDS–PAGE and western blotting procedures were performed to validate the effects of knockdown on transduced NB4 cells (DSMZ) and overexpression on 293FT cells. Immunoblotting was performed with anti-MSI2 rabbit monoclonal IgG (EP1305Y, Epitomics) and β-actin mouse monoclonal IgG (ACTBD11B7, Santa Cruz Biotechnology) antibodies. Secondary antibodies used were IRDye 680 goat anti-rabbit IgG and IRDye 800 goat anti-mouse IgG (LI-COR). 293FT and NB4 cell lines tested negative for mycoplasma. NB4 cells were authenticated by ATRA treatment before use. Cord blood transductions were conducted as described previously18, 23. Briefly, thawed Lin− cord blood or flow-sorted Lin− CD34+ CD38− or Lin− CD34+ CD38+ cells were prestimulated for 8–12 h in StemSpan medium (StemCell Technologies) supplemented with growth factors interleukin 6 (IL-6; 20 ng ml−1, Peprotech), stem cell factor (SCF; 100 ng ml−1, R&D Systems), Flt3 ligand (FLT3-L; 100 ng ml−1, R&D Systems) and thrombopoietin (TPO; 20 ng ml−1, Peprotech). Lentivirus was then added in the same medium at a multiplicity of infection of 30–100 for 24 h. Cells were then given 2 days after transduction before use in in vitro or in vivo assays. For in vitro cord blood studies biological (experimental) replicates were performed with three independent cord blood samples. Human clonogenic progenitor cell assays were done in semi-solid methylcellulose medium (Methocult H4434; StemCell Technologies) with flow-sorted GFP+ cells post transduction (500 cells per ml) or from day seven cultured transduced cells (12,000 cells per ml). Colony counts were carried out after 14 days of incubation. CFU-GEMMs can seed secondary colonies owing to their limited self-renewal potential24. Replating of MSI2-overexpressing and control CFU-GEMMs for secondary CFU analysis was performed by picking single CFU-GEMMs at day 14 and disassociating colonies by vortexing. Cells were spun and resuspended in fresh methocult, mixed with a blunt-ended needle and syringe, and then plated into single wells of a 24-well plate. Secondary CFU analysis for shMSI2- and shControl-expressing cells was performed by harvesting total colony growth from a single dish (as nearly equivalent numbers of CFU-GEMMs were present in each dish), resuspending cells in fresh methocult by mixing vigorously with a blunt-ended needle and syringe and then plating into replicate 35-mm tissue culture dishes. In both protocols, secondary colony counts were done following incubation for 10 days. For primary and secondary colony forming assays performed with the AHR agonist FICZ (Santa Cruz Biotechnology), 200 nM FICZ or 0.1% DMSO was added directly to H4434 methocult medium. Two-way ANOVA analysis was performed to compare secondary CFU output and FICZ treatment for MSI2-overexpressing or control conditions. Colonies were imaged with a Q-Colour3 digital camera (Olympus) mounted to an Olympus IX5 microscope with a 10× objective lens. Image-Pro Plus imaging software (Media Cybernetics) was used to acquire pictures and subsequent image processing was performed with ImageJ software (NIH). Transduced human Lin− cord blood cells were sorted for GFP expression and seeded at a density of 105 cells per ml in IMDM 10% FBS supplemented with human growth factors IL-6 (10 ng ml−1), SCF (50 ng ml−1), FLT3-L (50 ng ml−1), and TPO (20 ng ml−1) as previously described25. To generate growth curves, every seven days cells were counted, washed, and resuspended in fresh medium with growth factors at a density of 105 cells per ml. Cells from suspension cultures were also used in clonogenic progenitor, cell cycle and apoptosis assays. Experiments performed on transduced Lin− CD34+ cord blood cells used serum-free conditions as described in the cord blood transduction subsection of Methods. For in vitro cord blood studies, biological (experimental) replicates were performed with three independent cord blood samples. Cell cycle progression was monitored with the addition of BrdU to day 10 suspension cultures at a final concentration of 10 μM. After 3 h of incubation, cells were assayed with the BrdU Flow Kit (BD Biosciences) according to the manufacturer’s protocol. Cell proliferation and quiescence were measured using Ki67 (BD Bioscience) and Hoechst 33342 (Sigma) on day 4 suspension cultures after fixing and permeabilizing cells with the Cytofix/Cytoperm kit (BD Biosciences). For apoptosis analysis, Annexin V (Invitrogen) and 7-AAD (BD Bioscience) staining of day 7 suspension cultures was performed according to the manufacturer’s protocol. Lin− cord blood cells were initially stained with anti-CD34 PE (581) and anit-CD38 APC (HB7) antibodies (BD Biosciences) then fixed with the Cytofix/Cytoperm kit (BD Biosciences) according to the manufacturer’s instructions. Fixed and permeabilized cells were immunostained with anti-MSI2 rabbit monoclonal IgG antibody (EP1305Y, Abcam) and detected by Alexa-488 goat anti-rabbit IgG antibody (Invitrogen). CD34+ cells were transduced with an MSI2-overexpression or MSI2-knockdown lentivirus along with their corresponding controls and sorted for GFP expression 3 days later. Transductions for MSI2 overexpression or knockdown were each performed on two independent cord blood samples. Total RNA from transduced cells (>1 × 105) was isolated using TRIzol LS as recommended by the manufacturer (Invitrogen), and then further purified using RNeasy columns (Qiagen). Sample quality was assessed using Bioanalyzer RNA Nano chips (Agilent). Paired-end, barcoded RNA-seq sequencing libraries were then generated using the TruSeq RNA Sample Prep Kit (v2) (Illumina) following the manufacturer’s protocols starting from 1 μg total RNA. The quality of library generation was then assessed using a Bioanalyzer platform (Agilent) and Illumina MiSeq-QC run was performed or quantified by qPCR using KAPA quantification kit (KAPA Biosystems). Sequencing was performed using an Illumina HiSeq2000 using TruSeq SBS v3 chemistry at the Institute for Research in Immunology and Cancer’s Genomics Platform (University of Montreal) with cluster density targeted at 750,000 clusters per mm2 and paired-end 2 × 100-bp read lengths. For each sample, 90–95 million reads were produced and mapped to the hg19 (GRCh37) human genome assembly using CASAVA (version 1.8). Read counts generated by CASAVA were processed in EdgeR (edgeR_3.12.0, R 3.2.2) using TMM normalization, paired design, and estimation of differential expression using a generalized linear model (glmFit). The false discovery rate (FDR) was calculated from the output P values using the Benjamini–Hochberg method. The fold change of logarithm of base 2 of TMM normalized data (logFC) was used to rank the data from top upregulated to top downregulated genes and FDR (0.05) was used to define significantly differentially expressed genes. RNA-seq data have been deposited in NCBI’s Gene Expression Omnibus (GEO) and are accessible through GEO Series accession number GSE70685. iRegulon26 was used to retrieve the top 100 AHR predicted targets with a minimal occurrence count threshold of 5. The data were analysed using GSEA27 with ranked data as input with parameters set to 2,000 gene-set permutations. The GEO dataset GSE28359, which contains Affymetrix Human Genome U133 Plus 2.0 Array gene expression data for CD34+ cells treated with SR1 at 30 nM, 100 nM, 300 nM and 1,000 nM was used to obtain lists of genes differentially expressed in the treated samples compared to the control ones (0 nM)2. Data were background corrected using Robust Multi-Array Average (RMA) and quantile normalized using the expresso() function of the affy Bioconductor package (affy_1.38.1, R 3.0.1). Lists of genes were created from the 150 top upregulated and downregulated genes from the SR1-treated samples at each dose compared to the non-treated samples (0 nM). The data were analysed using GSEA with ranked data as input with parameters set to 2,000 gene-set permutations. The normalized enrichment score (NES) and false discovery rate (FDR) were calculated for each comparison. The GEO data set GSE24759, which contains Affymetrix GeneChip HT-HG_U133A Early Access Array gene expression data for 38 distinct haematopoietic cell states4, was compared to the MSI2 overexpression and knockdown data. GSE24759 data were background corrected using Robust Multi-Array Average (RMA), quantile normalized using the expresso() function of the affy Bioconductor package (affy_1.38.1, R 3.0.1), batch corrected using the ComBat() function of the sva package (sva_3.6.0) and scaled using the standard score. Bar graphs were created by calculating for significantly differentially expressed genes the number of scaled data that were above (>0) or below (<0) the mean for each population. Percentages indicating for how long the observed value (set of up- or downregulated genes) was better represented in that population than random values were calculated from 1,000 trials. A unique list of genes closest to AHR-bound regions previously identified from TCDD-treated MCF7 ChIP–seq data14 was used to calculate the overlap with genes showing >1.5-fold downregulation in response to treatment with UM171 (35 nM) or SR1 (500 nM) relative to DMSO-treated samples3 as well as with genes significantly downregulated in MSI2-overexpressing versus control treated samples (FDR < 0.05). The percentage of downregulated genes with AHR-bound regions was then plotted for each gene set. P values were generated with Fisher’s exact test for comparisons between gene lists. AHR transcription factor binding sites in downregulated gene sets were identified with oPOSSUM-328. Genes showing >1.5-fold downregulation in response to treatment with UM171 (35 nM) or SR1 (500 nM) relative to DMSO-treated samples3 were used along with significantly downregulated genes (FDR < 0.05) with EdgeR-analysed MSI2-overexpressing versus control-treated samples. The three gene lists were uploaded into oPOSSUM-3 and the AHR:ARNT transcription factor binding site profile was used with the matrix score threshold set at 80% to analyse the region 1,500 bp upstream and 1,000 bp downstream of the transcription start site. The percentage of downregulated genes with AHR-binding sites in their promoters was then plotted for each gene set. Fisher’s exact test was used to identify significant overrepresentation of AHR-binding sites in gene lists relative to background. Eight- to 12-week-old male or female NSG mice were sublethally irradiated (315 cGy) one day before intrafemoral injection with transduced cells carried in IMDM 1% FBS at 25 μl per mouse. Injected mice were analysed for human haematopoietic engraftment 12–14 weeks after transplantation or at 3 and 6.5 weeks for STRC experiments. Mouse bones (femurs, tibiae and pelvis) and spleen were removed and bones were crushed with a mortar and pestle then filtered into single-cell suspensions. Bone marrow and spleen cells were blocked with mouse Fc block (BD Biosciences) and human IgG (Sigma) and then stained with fluorochrome-conjugated antibodies specific to human haematopoietic cells. For multilineage engraftment analysis, cells from mice were stained with CD45 (HI30) (Invitrogen), CD33 (P67.6), CD15 (HI98), CD14 (MφP9), CD19 (HIB19), CD235a/GlyA (GA-R2), CD41a (HIP8) and CD34 (581) (BD Biosciences). For MSI2 knockdown in HSCs, 5.0 × 104 and 2.5 × 104 sorted Lin− CD34+ CD38− cells were used per short-hairpin transduction experiment, leading to transplantation of day zero equivalent cell doses of 10 × 103 and 6.25 × 103, respectively, per mouse. For STRC LDA transplantation experiments, 105 sorted CD34+CD38+ cells were used per control or MSI2-overexpressing transduction. After assessing levels of gene transfer, day zero equivalent GFP+ cell doses were calculated to perform the LDA. Recipients with greater than 0.1% GFP+CD45+/− cells were considered to be repopulated. For STRC experiments that read out extended engraftment at 6.5 weeks, 2 × 105 CD34+ CD38+ cells were used per overexpressing or control transduction to allow non-limiting 5 × 104 day zero equivalent cell doses per mouse. For HSC expansion and LDA experiments, CD34+CD38− cells were sorted and transduced with MSI2-overexpressing or control vectors (50,000 cells per condition) for 3 days and then analysed for gene-transfer levels (% GFP+/−) and primitive cell marker expression (% CD34 and CD133). To ensure that equal numbers of GFP+ cells were transplanted into both control and MSI2-overexpressing recipient mice, we added identically cultured GFP− cells to the MSI2 culture to match the % GFP+ of the control culture (necessary owing to the differing efficiency of transduction). The adjusted MSI2-overexpressing culture was recounted and aliquoted (63,000 cells) to match the output of half of the control culture. Three day 0 equivalent GFP+ cell doses (1,000, 300 and 62 cells) were then transplanted per mouse to perform the D3 primary LDA. A second aliquot of the adjusted MSI2-overexpressing culture was then taken and put into culture in parallel with the remaining half of the control culture to perform another LDA after 7 days of growth (10 days total growth, D10 primary LDA). Altogether, four cell doses were transplanted; when converted back to day 0 equivalents these equalled approximately 1,000, 250, 100, and 20 GFP+ cells per mouse, respectively. Pooled bone marrow from six engrafted primary mice that received D10 cultured control or MSI2-overexpressing cells (from the two highest doses transplanted) was aliquoted into five cell doses of 15 million, 10 million, 6 million, 2 million and 1 million cells. The numbers of GFP+ cells within primary mice was estimated from nucleated cell counts obtained from NSG femurs, tibias and pelvises and from Colvin et al.29. The actual numbers of GFP+ cells used for determining numbers of GFP+ HSCs and the number of mice transplanted for all LDA experiments is shown in Supplementary Tables 3–5. The cut-off for HSC engraftment was a demonstration of multilineage reconstitution that was set at bone marrow having >0.1% GFP+ CD33+ and >0.1% GFP+ CD19+ cells. HSC and STRC frequency was assessed using ELDA software30. For all mouse transplantation experiments, mice were age- (6–12 week) and sex-matched. All transplanted mice were included for analysis unless mice died from radiation sickness before the experimental endpoint. No randomization or blinding was performed for animal experiments. Approximately 3–6 mice were used per cell dose for each cord blood transduction and transplantation experiment. CLIP–seq was performed as previously described15. Briefly, 25 million NB4 cells (a transformed human cell line of haematopoietic origin) were washed in PBS and UV-cross-linked at 400 mJ cm−2 on ice. Cells were pelleted, lysed in wash buffer (PBS, 0.1% SDS, 0.5% Na-deoxycholate, 0.5% NP-40) and DNase-treated, and supernatants from lysates were collected for immunoprecipitation. MSI2 was immunoprecipitated overnight using 5 μg of anti-MSI2 antibody (EP1305Y, Abcam) and Protein A Dynabeads (Invitrogen). Beads containing immunoprecipated RNA were washed twice with wash buffer, high-salt wash buffer (5× PBS, 0.1% SDS, 0.5% Na-Deoxycholate, 0.5% NP-40), and PNK buffer (50 mM Tris-Cl pH 7.4, 10 mM MgCl , 0.5% NP-40). Samples were then treated with 0.2 U MNase for 5 min at 37° with shaking to trim immunopreciptated RNA. MNase inactivation was then carried out with PNK + EGTA buffer (50 mM Tris-Cl pH 7.4, 20 mM EGTA, 0.5% NP-40). The sample was dephosphorylated using alkaline phosphatase (CIP, NEB) at 37° for 10 min followed by washing with PNK+EGTA, PNK buffer, and then 0.1 mg ml−1 BSA in nuclease-free water. 3′RNA linker ligation was performed at 16° overnight with the following adaptor: 5′P-UGGAAUUCUCGGGUGCCAAGG-puromycin. Samples were then washed with PNK buffer, radiolabelled using P32-y-ATP (Perkin Elmer), run on a 4–12% Bis-Tris gel and then transferred to a nitrocellulose membrane. The nitrocellulose membrane was developed via autoradiography and RNA–protein complexes 15–20 kDa above the molecular weight of MSI2 were extracted with proteinase K followed by RNA extraction with acid phenol-chloroform. A 5′RNA linker (5′HO-GUUCAGAGUUCUACAGUCCGACGAUC-OH) was ligated to the extracted RNA using T4 RNA ligase (Fermentas) for 2 h and the RNA was again purified using acid phenol-chloroform. Adaptor ligated RNA was re-suspended in nuclease-free water and reverse transcribed using Superscript III reverse transcriptase (Invitrogen). Twenty cycles of PCR were performed using NEB Phusion Polymerase using a 3′PCR primer that contained a unique Illumina barcode sequence. PCR products were run on an 8% TBE gel. Products ranging between 150 and 200 bp were extracted using the QIAquick gel extraction kit (Qiagen) and re-suspended in nuclease-free water. Two separate libraries were prepared and sent for single-end 50-bp Illumina sequencing at the Institute for Genomic Medicine at the University of California, San Diego. 47,098,127 reads from the first library passed quality filtering, of which 73.83% mapped uniquely to the human genome. 57,970,220 reads from the second library passed quality filtering, of which 69.53% mapped uniquely to the human genome. CLIP-data reproducibility was verified through high correlation between gene RPKMs and statistically significant overlaps in the clusters and genes within replicates. CLIP–seq data have been deposited in NCBI’s GEO and are accessible through GEO Series accession number GSE69583. Before sequence alignment of CLIP–seq reads to the human genome was performed, sequencing reads from libraries were trimmed of polyA tails, adapters, and low quality ends using Cutadapt with parameters–match-read-wildcards–times 2 -e 0 -O 5–quality-cutoff' 6 -m 18 -b TCGTATGCCGTCTTCTGCTTG -b ATCTCGTATGCCGTCTTCTGCTTG -b CGACAGGTTCAGAGTTCTACAGTCCGACGATC -b TGGAATTCTCGGGTGCCAAGG -b AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-b TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT. Reads were then mapped against a database of repetitive elements derived from RepBase (version 18.05). Bowtie (version 1.0.0) with parameters -S -q -p 16 -e 100 -l 20 was used to align reads against an index generated from Repbase sequences31. Reads not mapped to Repbase sequences were aligned to the hg19 human genome (UCSC assembly) using STAR (version 2.3.0e)32 with parameters–outSAMunmapped Within –outFilterMultimapNmax 1 –outFilterMultimapScoreRange 1. To identify clusters in the genome of significantly enriched CLIP–seq reads, reads that were PCR replicates were removed from each CLIP–seq library using a custom script of the same method as in ref. 33; otherwise, reads were kept at each nucleotide position when more than one read’s 5′-end was mapped. Clusters were then assigned using the CLIPper software with parameters–bonferroni–superlocal–threshold-34. The ranked list of significant targets was calculated assuming a Poisson distribution, where the observed value is the number of reads in the cluster, and the background is the number of reads across the entire transcript and or across a window of 1000 bp ± the predicted cluster. Transcriptomic regions and gene classes were defined using annotations found in gencode v17. Depending on the analysis, clusters were associated by the Gencode-annotated 5′UTR, 3′UTR, CDS or intronic regions. If a cluster overlapped multiple regions, or a single part of a transcript was annotated as multiple regions, clusters were iteratively assigned first as CDS, then 3′UTR, 5′UTR and finally as proximal (<500 bases from an exon) or distal (>500 bases from an exon) introns. Overlapping peaks were calculated using bedtools and pybedtools35, 36. Significantly enriched gene ontology (GO) terms were identified using a hypergeometric test that compared the number of genes that were MSI2 targets in each GO term to genes expressed in each GO term as the proper background. Expressed genes were identified using the control samples in SRA study SRP012062. Mapping was performed identically to CLIP–seq mapping, without peak calling and changing the STAR parameter outFilterMultimapNmax to 10. Counts were calculated with featureCounts37 and RPKMs were then computed. Only genes with a mean RPKM > 1 between the two samples were used in the background expressed set. Randomly located clusters within the same genic regions as predicted MSI2 clusters were used to calculate a background distribution for motif and conservation analyses. Motif analysis was performed using the HOMER algorithm as in ref. 34. For evolutionary sequence conservation analysis, the mean (mammalian) phastCons score for each cluster was used. CD34+ cells (>5 × 104) were transduced with an MSI2-overexpression or control lentivirus. Three days later, GFP+ cells were sorted and then put back in to StemSpan medium containing growth factors IL-6 (20 ng ml−1), SCF (100 ng ml−1), FLT3-L (100 ng ml−1) and TPO (20 ng ml−1). A minimum of 10,000 cells were used for immunostaining at culture days 3 and 7 after GFP sorting. Cells were fixed in 2% PFA for 10 min, washed with PBS and then cytospun on to glass slides. Cytospun cells were then permeabilized (PBS, 0.2% Triton X-100) for 20 min, blocked (PBS, 0.1% saponin, 10% donkey serum) for 30 min and stained with primary antibodies (CYP1B1 (EPR14972, Abcam); HSP90 (68/hsp90, BD Biosciences)) in PBS with 10% donkey serum for 1 h. Detection with secondary antibody was performed in PBS 10% donkey serum with Alexa-647 donkey anti-rabbit antibody or Alexa-647 donkey anti-mouse antibodies for 45 min. Slides were mounted with Prolong Gold Antifade containing DAPI (Invitrogen). Several images (200–1,000 cells total) were captured per slide at 20× magnification using an Operetta HCS Reader (Perkin Elmer) with epifluorescence illumination and standard filter sets. Columbus software (Perkin Elmer) was used to automate the identification of nuclei and cytoplasm boundaries in order to quantify mean cell fluorescence. A 271-bp region of the CYP1B1 3′UTR that flanked CLIP–seq-identified MSI2-binding sites was cloned from human HEK293FT genomic DNA using the forward primer GTGACACAACTGTGTGATTAAAAGG and reverse primer TGATTTTTATTATTTTGGT AATGGTG and placed downstream of renilla luciferase in the dual-luciferase reporter vector pGL4 (Promega). A 271-bp geneblock (IDT) with 6 TAG > TCC mutations was cloned in to pGL4 using XbaI and NotI. The HSP90 3′UTR was amplified from HEK293FT genomic DNA with the forward primer TCTCTGGCTGAGGGATGACT and reverse primer TTTTAAGGCCAAGGAATTAAGTGA and cloned into pGL4. A geneblock of the HSP90 3′UTR (IDT) with 14 TAG > TCC mutations was cloned in to pGL4 using SfaAI and NotI. Co-transfection of wild-type or mutant luciferase reporter (40 ng) and control or MSI2-overexpressing lentiviral expression vector (100 ng) was performed in the NIH-3T3 cell line, which does not express MSI1 or MSI2 (50,000 cells per co-transfection). Reporter activity was measured using the Dual-Luciferase Reporter Assay System (Promega) 36–40 h later. For MSI2-overexpressing cultures with the AHR antagonist SR1, Lin− CD34+ cells were transduced with MSI2-overexpression or control lentivirus in medium supplemented with SR1 (750 nM; Abcam) or DMSO vehicle (0.1%). GFP+ cells were isolated (20,000 cells per culture) and allowed to proliferate with or without SR1 for an additional 7 days at which point they were counted and immunophenotyped for CD34 and CD133 expression. For MSI2-overexpressing cultures with the AHR agonist FICZ, Lin− CD34+ cells were transduced with MSI2-overexpression or control lentivirus. GFP+ cells were isolated (20,000 cells per culture) and allowed to proliferate with FICZ (200 nM; Santa Cruz Biotechnology) or DMSO (0.1%) for an additional 3 days, at which point they were immunophenotyped for CD34 and CD133 expression. Lin− CD34+ cells were cultured for 72 h (lentiviral treated but non-transduced flow-sorted GFP− cells) in StemSpan medium containing growth factors IL-6 (20 ng ml−1), SCF (100 ng ml−1), FLT3-L (100 ng ml−1) and TPO (20 ng ml−1) before the addition of the CYP1B1 inhibitor TMS (Abcam) at a concentration of 10 μM or mock treatment with 0.1% DMSO. Equal numbers of cells (12,000 per condition) were then allowed to proliferate for 7 days at which point they were counted and immunophenotyped for CD34 and CD133 expression. Unless stated otherwise (that is, analysis of RNA–seq and CLIP–seq data sets), all statistical analysis was performed using GraphPad Prism (GraphPad Software version 5.0). Unpaired student t-tests or Mann–Whitney tests were performed with P < 0.05 as the cut-off for statistical significance. No statistical methods were used to predetermine sample size.


Home > Press > Oxford Instruments announces Dr Brad Ramshaw of Cornell University, as winner of the 2017 Lee Osheroff Richardson Science Prize Abstract: The Lee Osheroff Richardson (LOR) Science Prize promotes and recognises the novel work of young scientists working in the fields of low temperatures and/or high magnetic fields in the Americas. Oxford Instruments is delighted to announce Dr Brad Ramshaw, Assistant Professor at Cornell University as the winner of the 2017 LOR Science Prize. “I am truly honoured to have been awarded this prize. As I build my new lab in Clark Hall in the same basement where Lee, Osheroff, and Richardson did their ground-breaking work, I am continually reminded of and humbled by their legacy in low-temperature physics. Their work also reminds me that science is a collaborative effort, and I want to thank the mentors and colleagues who have made these experiments possible and who have immeasurably influenced my approach to science”, commented Ramshaw. Dr Ramshaw is one of the most gifted young experimentalists currently active in the field of strongly correlated electron systems. Ramshaw’s technical contributions to condensed matter physics have focused on improving measurement techniques for pulsed magnetic fields up to 100 T, and on improving resonant ultrasound spectroscopy for low-temperature applications. He has applied these techniques to solve significant problems in both high-temperature and unconventional superconductivity. Most notably he has used quantum oscillation measurements to provide the first direct observation of the effects of quantum criticality on the electronic normal state of cuprate superconductors, and to determine that the Fermi surface of the cuprates is not reconstructed by magnetic order in high fields. The technique developments made by Ramshaw have had an impact beyond his own research—he has taken part in many collaborative pulsed-field research projects including the investigation of 2-D electrons in graphene and oxide heterostructures, symmetry breaking in heavy Fermions, and unconventional thermodynamics in topological semimetals. His most recent technique advancement, for which he was awarded a $430,000 development grant at Los Alamos National Labs, was the design and construction of an all-digital pulse-echo ultrasound apparatus for use in pulsed magnetic fields up to 100 Tesla. This has increased the relatively small number of thermodynamic probes available in these extreme magnetic fields, and will be particularly helpful for studying phase transitions in metals where magnetization signals can be swamped by noise and transport signatures are difficult to interpret. The Lee Osheroff Richardson Science Prize selection committee was very pleased to recognise Ramshaw’s outstanding achievements. The committee consists of leading American physicists and is chaired by Professor Bruce Gaulin of McMaster University, Hamilton, ON, Canada. Dr Ramshaw will be presented with the trophy and $8000 prize amount at Oxford Instruments’ “Socialize with Science” event on March 14th, 2017 during the 2017 APS March Meeting in New Orleans, LA, USA. Oxford Instruments is aware that there is a critical and often difficult stage for many between completing a PhD and gaining a permanent research position. The company has therefore been helping individuals who are producing innovative work by offering assistance both financially and through promotion of their research work, through sponsoring the Lee Osheroff Richardson Science Prize for research in physical science. The Prize is named in honour of Professors David M. Lee, Douglas D. Osheroff and the late Robert C. Richardson, joint recipients of The Nobel Prize in Physics 1996 "for their discovery of superfluidity in helium-3". The previous winners of the Lee Osheroff Richardson Science Prize, which celebrated its 10th year in 2015, are Dr Christian Lupien, Dr Jason Petta, Dr Suchitra Sebastian, Dr Eunseong Kim, Dr Vivien Zapf, Dr Jing Xia, Dr Kenneth Burch, Dr Lu Li, Dr Chiara Tarantini, Dr Cory Dean and Dr Mohammad Hamidian. More information on the Prize can be found at: www.oxford-instruments.com/scienceprize About Oxford Instruments NanoScience Oxford Instruments NanoScience designs, supplies and supports market-leading research tools that enable quantum technologies, new materials and device development in the physical sciences. Our tools support research down to the atomic scale through creation of high performance, cryogen free low temperature and magnetic environments, based upon our core technologies in low and ultra-low temperatures, high magnetic fields and system integration, with ever-increasing levels of experimental and measurement readiness. Oxford Instruments NanoScience is a part of the Oxford Instruments plc group. About Oxford Instruments plc Oxford Instruments designs, supplies and supports high-technology tools and systems with a focus on research and industrial applications. Innovation has been the driving force behind Oxford Instruments' growth and success for over 50 years, and its strategy is to effect the successful commercialisation of these ideas by bringing them to market in a timely and customer-focused fashion. The first technology business to be spun out from Oxford University, Oxford Instruments is now a global company and is listed on the London Stock Exchange (OXIG). Its objective is to be the leading provider of new generation tools and systems for the research and industrial sectors with a focus on nanotechnology. Its key market sectors include nano-fabrication and nano-materials. The company’s strategy is to expand the business into the life sciences arena, where nanotechnology and biotechnology intersect This involves the combination of core technologies in areas such as low temperature, high magnetic field and ultra high vacuum environments; Nuclear Magnetic Resonance; X-ray, electron, laser and optical based metrology; atomic force microscopy; optical imaging; advanced growth, deposition and etching. Oxford Instruments aims to pursue responsible development and deeper understanding of our world through science and technology. Its products, expertise, and ideas address global issues such as energy, environment, security and health. For more information, please click If you have a comment, please us. Issuers of news releases, not 7th Wave, Inc. or Nanotechnology Now, are solely responsible for the accuracy of the content.


News Article | December 8, 2016
Site: www.marketwired.com

Leaders in Mineral Exploration and Mine Development to be Recognized at January 25 Gala VANCOUVER, BC--(Marketwired - December 07, 2016) - The Association for Mineral Exploration ("AME") is pleased to announce its 2016 award recipients. AME will salute its leaders at the AME Awards Celebration of Excellence Gala on January 25 during the AME Roundup 2017 conference. Tickets are available through registration at www.amebc.ca/roundup. "It is our honor to recognize with these awards those in our industry who through their leadership, resilience and innovation have contributed at the highest standards of excellence in exploration and mineral development," says Diane Nicolson, Chair of the Board of Directors of AME. "What they have attained is an inspiration to all and we look forward to celebrating their achievements with you at the Awards Gala at AME Roundup." Chris Rockingham, Carl Edmunds and Wade Barnes, recognized with the H.H. "Spud" Huestis Award for excellence in prospecting and mineral exploration for their discovery and resource definition of AuRico Metals Inc.'s Kemess East deposit in British Columbia. Don Parsons and Steve Robertson, recipients of the E.A. Scholz Award for excellence in mine development in British Columbia and Yukon. They are honoured for their pivotal role in advancing Imperial Metals Corporation's Red Chris copper-gold project in British Columbia from development to commercial production. Terry Salman, recipient of the 2016 Murray Pezim Award recognizing perseverance and success in financing mining exploration. Terry has been a leader in junior company exploration financing for the past 40 years through his career at Nesbitt Thomson, Salman Partners and Salman Capital Inc. William Lamb and Lukas Lundin, recognized with the Hugo Dummett Diamond Award for excellence in diamond exploration and development in recognition of their roles in developing Lucara Diamond Corporation's Karowe Mine in Botswana. Dr. David Broughton and Sello Kekana, recipients of the Colin Spence Award for excellence in global mineral exploration. They are recognized for their work that led to the discovery of the Tier One Flatreef underground deposit at Ivanhoe Mines' Platreef platinum group metals-nickel-copper-gold project in the heart of South Africa's Bushveld Complex. Jim Cooney, recipient of the Robert R. Hedley Award for excellence in social and environmental responsibility as a leader and mentor who has led and shaped the integration of environmental and social values into the mining industry. The late Graham Ennis, honoured with the David Barr Award for excellence in leadership and innovation in mineral exploration health and safety for passion and dedication to the well-being and safety of employees in the diamond drilling industry. JoAnne Nelson, a 30-year veteran of the British Columbia Geological Survey, the recipient of a Special Tribute in recognition of her distinguished career in geoscience work focused on the tectonics, structural geology and metallogeny of the Northern Cordillera spanning British Columbia, Yukon and Alaska. Susan Craig, recognized with the Gold Pan Award for her exceptional meritorious service to the mineral exploration community through AME. Barb Caelles, Alex Christopher and Diane Gregory, honoured with the Frank Woodside Past Presidents and Past Chairs Award for their distinguished service to the association and/or contribution to the mineral industry. The two recipients of AME's Outreach Education Fund are Britannia Mine Museum for its education programs and MineralsEd for its Kids & Rocks program. AME is the lead association for the mineral exploration and development industry based in British Columbia. Established in 1912, AME represents, advocates, protects and promotes the interests of thousands of members who are engaged in mineral exploration and development in British Columbia and throughout the world. AME encourages a safe, economically strong and environmentally responsible industry by providing clear initiatives, policies, events and tools to support its membership. Leaders in Mineral Exploration and Mine Development to be Recognized at January 25 Gala Vancouver, B.C. - December 7, 2016 - The Association for Mineral Exploration (AME) is pleased to announce its 2016 award recipients. AME will salute its leaders at the AME Awards Celebration of Excellence Gala on January 25 during the AME Roundup 2017 conference. Tickets are available through registration at www.amebc.ca/roundup. Chris Rockingham, Carl Edmunds and Wade Barnes are the recipients of the 2016 H.H. "Spud" Huestis Award for Excellence in Prospecting and Mineral Exploration. It is often said that patience and perseverance surmount every difficulty. The discovery of the Kemess East deposit epitomizes this. Under the leadership of Chris Rockingham, the geological insight of Carl Edmunds and execution of Wade Barnes, a blind porphyry gold copper deposit was discovered and delineated. The recognition that the Kemess North deposit was terminated on its northern and eastern edges by faults led the team to search for the offset under deep post-mineral cover. The first indications of a blind mineralized system were encountered in 2002. By the following year, with a large area of phyllic alteration and some low-grade mineralization, Chris, Carl and Wade were confident that they were vectoring towards better mineralization. This was apparent in 2007 when their fourth hole intersected the longest mineralized intercept in the entire Kemess database to that point, but perhaps more importantly, hole 24 intersected 162 m of 0.62 g/t gold and 0.53% copper in potassic altered intrusive. At this point, however, all exploration stopped as the Kemess North open pit proposal was rejected by the federal government. By 2010, commodity price changes made the concept of block caving appear viable, and Kemess North studies were reinitiated. Nonetheless, exploration did not resume again at Kemess East until 2013 and by January 2015, the first resource estimate was released. The most recent drilling has confirmed and upgraded the initial resources estimation, with spectacular drill intercepts such as 628 m of 0.53 g/t gold with 0.41% copper and the deposit remains open in some areas. Chris has a Master of Science in Geology from the University of Western Ontario and an MBA from the Richard Ivey School of Business. Chris's current role is Vice President, Development at AuRico Metals Inc. While Chris's unwavering belief in the project has been critical, perhaps the key role that he has brought to this project has been his thoughtful commitment to aboriginal engagement. Carl graduated from Queen's University with a Master of Science in Mineral Exploration and currently holds the position of Chief Geologist at Silver Standard Resources Inc. Carl was Exploration Manager at Kemess from 2003 to 2012 and along with Wade made the seemingly bold projections on the potential grade and tonnage at Kemess East. Wade is a geology graduate of Simon Fraser University and has been with the project almost since its inception. As Project Geologist, Wade was instrumental in designing and overseeing the 2013-2015 drilling campaigns with his interpretations being the basis for the resource estimates. Don Parsons and Steve Robertson are the recipients of the 2016 E.A. Scholz Award for Excellence in Mine Development in British Columbia and/or Yukon. They are being honoured for their pivotal role in advancing the Red Chris copper-gold project in northwestern British Columbia from development to commercial production between 2007 and 2015. Exploration at the Red Chris deposit was first reported in 1956 but its development began in earnest after the project was acquired in February 2007 by Imperial Metals Corporation, where Don was Chief Operating Officer (as he is today) and Steve was Exploration Manager. Following the acquisition of Red Chris, Imperial's engineering and development team under the leadership of Don re-appraised the existing engineering and feasibility studies and incorporated updated financial, political and technical data into their mine plan. Concurrently, Imperial began a deep drilling campaign under Steve's direction to ascertain the ultimate size of the project. The results of this program exceeded all expectations for tonnage and grade and helped facilitate financing and a positive construction decision for the mine. The Mines Act Permit application was submitted in 2010 and was shepherded through the process over the next two years under the direction of Don and Steve, with its successful completion allowing the start of mine construction at Red Chris in the summer of 2012. Concurrently with mine construction, a 93-kilometre extension of the 287 kilovolt Northwest Transmission Line power line to the mine site was permitted and built. While Don was overseeing the construction and commissioning of the mine, Steve continued to work in his new role as Vice President Corporate Affairs on all the social and political aspects of the project. This included ongoing permitting issues and working with the Tahltan Nation to ultimately complete an Impact, Benefit and Co-Management Agreement which provides the basis for partnership between the Tahltan people and Red Chris for the life of the mine. The Red Chris mine, treating 30,000 tonnes of copper-gold ore per day and employing 350 workers including 120 Tahltan from local communities, commenced commercial production on July 1, 2015 and has operated since then without significant issues. Currently, it has a mine life of another 26 years. Developing, permitting and constructing a project of the magnitude of Red Chris requires many dedicated and hard-working people with talents and abilities in a variety of fields. Don and Steve were able to coordinate and direct those people so as to achieve a common goal: the successful construction of a new mine. For their skill, dedication and perseverance, Don Parsons and Steve Robertson are worthy recipients of the E. A. Scholz Award for 2016. The Murray Pezim Award was created to recognize perseverance and success in financing mining exploration in British Columbia and Yukon. Terry Salman is the 2016 recipient of this award in recognition of his remarkable career in Canadian mining finance. Terry has been a leader in financing junior exploration and mid-cap to large mining companies over the past 35 years. He began his career at Nesbitt Thomson in 1973, rising from a Research Analyst to Executive Vice-President and Director. He is a highly respected investment banker with a focus on natural resources. At Nesbitt Thomson, Terry helped create the first mining team and in the early 1990s established Nesbitt Thomson's first gold conference in Whistler, which ultimately became BMO's Global Metals & Mining Conference. He left Nesbitt Thomson in 1994 to form Salman Partners where he was President, Chief Executive Officer and Co-Director of Research. For 22 years, Salman Partners was a leading resource based investment dealer known for its high-quality research and integrity. Salman Partners participated in syndicates that helped raise $20 billion for more than 400 companies. Salman Partners provided investment analysis across a wide range of sectors, but over the years carved out a specialty in the Vancouver-based resource industry. In 2016, Salman Partners voluntarily resigned from the Investment Industry Regulatory Organization of Canada due to a dramatically changing investment climate for independent investment dealers. Currently, Terry is President and CEO of Salman Capital Inc., an investment advisory and merchant banking firm, capitalizing on his extensive network and relationships he has built in the mining and investment business. In addition to his highly successful work career, Terry has tirelessly devoted his services to many industry and community non-profit organizations, including an important role in initial fundraising for the Britannia Mine Museum. In 2008, Terry was appointed to the Government of Canada's Expert Panel on Securities Regulations. He is a Past-Chair of the Investment Dealers Association of Canada. In 2009, he was awarded a Doctor of Technology honoris causa by the British Columbia Institute of Technology. Terry also served as Chair of the Vancouver Public Library Foundation for sixteen years and is currently Chair Emeritus. Terry has also served as Chair of St. Paul's Hospital Foundation and has been a director of the Prostate Cancer Research Foundation of Canada and the Canadian Stem Cell Network. Currently, he serves on the advisory boards of the Investment Industry Association of Canada and Pathfinder Asset Management Limited and is a member of the Campaign Executive Committee of St. Paul's Hospital Foundation. In recognition of his outstanding volunteer contributions, Terry was awarded the Queen Elizabeth II Diamond Jubilee Medal in 2012. Because of his outstanding career in financing the junior exploration industry, as well as his commitment to volunteer community stewardship, Terry Salman is a deserving recipient of the 2016 Murray Pezim Award. The Hugo Dummett Diamond Award was created to honour those who have made a significant contribution to diamond exploration, discovery or diamond mine development. William Lamb and Lukas Lundin, President, CEO & Director and Chairman & Director respectively, of Lucara Diamond Corp. are the 2016 recipients of the Hugo Dummett Award in recognition of their roles in developing the Karowe Mine in Botswana. William has a Diploma in Extraction Metallurgy, an MBA in Finance and over 23 years of experience in operational and project management in the precious metals, coal, chrome and diamond sectors in South Africa and Canada. Prior to joining Lucara in 2008, he spent 13 years with De Beers working across their operations in southern Africa and at the Victor Mine in Canada, focusing on heavy mineral concentration, project development and operational readiness. Lukas has an engineering degree and he is well known for recognizing value and superior global investment opportunities in the natural resource sector. His uninhibited pursuit of highly prospective properties around the world has resulted in numerous resource discoveries in addition to Karowe including the multi-million ounce Veladero gold discovery. Lucara is a member of the Lundin Group of Companies and was founded, with Lukas's backing, as a diamond company in 2007. The AK6 kimberlite pipe, now known as Karowe, was discovered almost 50 years ago. It was deemed uneconomic at the time, and there was limited exploration on the property until around 12 years ago. William, who had been given the mandate by Lukas and the Lucara Board of Directors to find the best undeveloped diamond project in the world and bring it into production, was aware of Karowe and believed the original assessment was not correct. He and his technical team determined that the value of the project had been underestimated due to diamond breakage. Lukas provided the financial backing to initially acquire a 70% interest in the project, and then a full 100% interest in the project in 2010. Lukas brought it into production in 2012 by way of a personal loan facility, a guarantee for the original purchase price and the financial support to raise funds to finance development of the mine. Further analysis confirmed that Karowe had the potential for the recovery of large, high value Type IIA diamonds, which could also positively impact the commercial diamond value. William recognized the importance of applying and installing new, cutting-edge X-ray technology in tandem with high capacity bulk sorting to facilitate recovery of these large stones. The potential for large, high-value diamonds at Karowe has been validated by the recovery of over 100 diamonds of greater than 100 carats each since the mine opened, including the 813-ct Constellation and the 1109-ct Lesedi La Rona diamond, the world's second largest gem-quality diamond ever recovered. Karowe is truly one of the world's most unique sources of exceptionally large, high quality, gem diamonds. The financial strength and entrepreneurial vision of Lukas Lundin allowed Lucara to acquire the Karowe diamond project, and the engineering ability, processing knowledge and determination of William Lamb and his engineering and construction team brought it into production on schedule and under budget. Lukas and William are deserving recipients of the Hugo Dummett Diamond Award for their roles in the realization of this unique project. This year's recipients of the Colin Spence Award, for making a significant mineral discovery outside of British Columbia and Yukon through the original application of prospecting techniques or other geoscience technology, are Dr. David Broughton and Sello Kekana. They are being recognized for their outstanding work that led to the discovery of the Tier One Flatreef underground deposit at Ivanhoe Mines Ltd.'s Platreef platinum group metals (PGMs) and nickel-copper-gold project in the Northern Limb of South Africa's Bushveld Complex. David Broughton, who received a PhD in Geology from Colorado School of Mines, joined Ivanhoe Mines as Executive Vice President Exploration in January 2008 and is currently Senior Advisor, Exploration and Geology. His career began in Canada in 1984, where he was involved in the mining and exploration for gold, uranium and base metals. In 1997, his focus turned to stratiform copper deposits and he began working in the Central African Copperbelt followed by projects in Namibia, China, United States, Canada and Poland. David was co-leader of Ivanhoe Mines' Kamoa discovery team. Upon joining Ivanhoe, David also assumed responsibility for exploration at the Platreef Project. Sello Kekana was born in Kgobudi village, South Africa, which lies within Ivanhoe's Platreef Project area. He holds a Master of Science degree in Geology from the University of the Witwatersrand. Sello started his professional career in mineral research and then worked as a geotechnologist for a groundwater company. In 2003 he joined Ivanhoe Mines and has worked on projects in South Africa, the Democratic Republic of Congo and Zambia. Sello played a key role in the discovery of the Flatreef deposit, advancing from Geologist, to Project Manager, to General Manager, to Group Manager - Geology. During 2011-2012 Sello managed the deep drilling, which during his tenure expanded to include 30 drill rigs, that delineated the Flatreef deposit. Since January 2015, he has been the Head of Transformation for Ivanplats. Work leading to the discovery of the Flatreef deposit began more than 15 years ago. Exploration in the area by Ivanhoe Mines and its subsidiaries led to delineation of a large, near-surface, low-grade resource that was amenable to open pit mining; however, the open pit area was overlain by villages with a combined population of more than 30,000 people. Realizing the challenges involved with relocating the villagers, the company's geological team led by David and Sello began work to identify other zones of mineralization on the property. Their unique approach, which included applying advanced geophysical modelling to high-resolution airborne gravity data, resulted in the realization in 2010 that the regionally steeply west-dipping mineralized reef flattened at a depth of roughly 700 m below surface on Ivanhoe's property. Deep drilling on the deposit has defined a flat- to gently-dipping NI 43-101 compliant Indicated Mineral Resource with an average thickness of 24 m and a strike length in excess of 6 km, containing an estimated 1.2 million kg (42 million oz) of PGMs plus gold at a cut-off of 2 g/t, and an additional 1.5 million kg (52.8 million oz) of PGMs plus gold in Inferred Resources. The Indicated and Inferred Resources also contain 1.6 and 2.4 billion kilograms of nickel and copper, respectively. Project development commenced in 2014 and shaft sinking is underway. Flatreef is distinguished from other Bushveld projects by its tremendous size and thickness, its high-grade polymetallic nature and potential for byproduct credits of nickel and copper, and its flat-lying orientation leading to the potential for safe, mechanized underground mining. David Broughton and Sello Kekana are deserving recipients of the Colin Spence Award for their roles in the discovery and delineation of this world class deposit. Jim Cooney is the recipient of the Robert R. Hedley Award for Excellence in Social and Environmental Responsibility. Jim is a leader and mentor who has led and shaped the integration of environmental and social values into the mining industry. From early in his career in the 1970s he began incorporating social considerations into mining by directing Cominco's first social impact assessment at what is now the Highland Valley Copper mine. By the early 1990s, following the UN's adoption of sustainable development, Jim began publishing articles that promoted this as a mining company strategy for managing social and political risks. He has been an outspoken advocate for sustainable development ever since as well as an advocate for the inclusion of Indigenous peoples and perspectives into the mining industry. In 1996 Jim was the driving force that led Placer Dome to adopt a policy of sustainable development, the first mining company to do so. Shortly afterward as Chair of the Policy Committee of the International Council on Mining and the Environment (now the ICMM) he successfully led the effort to convince mining companies around the world to adopt sustainable development policies. Among his many significant accomplishments, Jim coined the term "social licence to operate" at a World Bank meeting in 1997. This term has become a widely accepted reference point for mining companies in their relationship with local communities. Jim has inspired and mentored more than one new generation of mining industry professionals. Through teaching at the University of British Columbia, presenting at conferences, participating on committees and providing his time and expertise, he has changed the industry's outlook on working with communities and bringing about positive benefits to communities. Although semi-retired, Jim continues to mentor industry practitioners and leaders, and to shape the progress of the mining industry's social and environmental practices. Graham Ennis is posthumously recognized with the David Barr Award for Excellence in Leadership and Innovation in Mineral Exploration Health and Safety. Graham's passion and dedication to the well-being and safety of employees was simply unsurpassed. His drive and devotion was primarily fueled by experiences from the former part of his career in the mining and forestry sectors, in both British Columbia and Yukon. Through his avalanche rescue and recovery work and mine rescue involvement within these respective sectors, Graham had the unfortunate experience of rescuing or recovering colleagues from both serious and fatal workplace accidents on multiple occasions. Graham transitioned to the mineral exploration sector in 2006 to pursue his passion for safety by accepting a position in the Northwest Territories as a Safety Representative with Major Drilling Group. He moved to Manitoba shortly thereafter upon being promoted to the role of Safety Coordinator, eventually leading to the position of Health, Safety, Environment and Community Manager few years later. During his tenure at Major, Graham worked tirelessly to improve safety performance, always with the best interest of the crews at heart. From the onset, he was adamant on training, emergency preparedness, the implementation of an intensive accident investigation protocol and the return to work process. Even in a managerial role, he kept a direct pulse on the safety culture as well as the challenges and issues faced by the crews through frequent field visits across Canadian surface and underground operations including some international sites. His observations often led to recommendations and continual improvement efforts within the organization. As such, he was instrumental in the development and implementation of numerous company safety programs, including a comprehensive program for constructing and working on ice covers. He was always eager to roll up his sleeves to take the lead or mentor ice crews on ice testing and monitoring techniques to ensure that company protocols were strictly followed. Graham was a strong advocate of sharing best practices, experiences and lessons learned, transcending company boundaries. He was always generous with his time as well as with his wealth of knowledge, experience and industry contacts accumulated over the years. He was an enthusiastic supporter of the Canadian Diamond Drilling Association (CDDA); his involvement ranged from presenting papers at the association's Annual General Meeting and Convention to working at the sub-committee level with respect to industry training and safety issues. He was also a long-standing chair of the CDDA's Western Safety Group - coordinating venues and speakers, and relentless rallying for continued support and participation from industry and government parties alike. Graham was also a very active and well-respected member of the Mine Accident Prevention Association of Manitoba (MAPAM) Board of Directors from 2008 through 2015. During this time, MAPAM's directors' collective efforts led to establishment of emergency planning, preparedness and response protocols for Manitoba's mining industry. They also realized marked industry improvements in safety culture and performance, attributed to the sharing of risk management information and lessons learned among their membered companies. Finally, Graham was avid mountaineer and fisherman, not to mention a great story teller. Coffee breaks, meetings and other gatherings were always good fun! Accounts of his excursions and past work experiences, often injected with safety messaging and a great sense of humour, drew his audience near and attracted anyone within earshot to listen in. On or off-the-job, Graham was a great role model - a devoted, energetic and sincere proponent of personal safety - who inspired others to follow suit. For these reasons, Graham Ennis is a fitting posthumous recipient of the David Barr Award. JoAnne Nelson, a 30-year veteran of the British Columbia Geological Survey, is being acknowledged with a Special Tribute for her significant contributions to the advancement of geoscientific knowledge relating to the tectonics, structural geology and metallogeny of the Northern Cordillera. Over this time span she has developed an outstanding geoscience reputation coupled with major contributions as a project leader, mentor and communicator. JoAnne was raised in the western United States where she initially became fascinated with rocks as a young teenager, during a mountaineering course at Yosemite National Park. Following completion of high school she went on to earn B.Sc. and M.Sc. degrees in geology at the University of Washington and at the University of British Columbia, in 1973 and 1976, respectively. While at UBC she also earned a B.Ed. degree, and later taught high school science on Haida Gwaii followed by sessional lecturing in geology at UBC and at Douglas College between 1978 and 1985. During this period, she also worked as a field geologist with Resource Associates of Alaska, and did some contract petrography for Vancouver Petrographics. Since joining the BCGS in 1986, JoAnne has conducted extensive field mapping and related geological studies throughout British Columbia, with a primary focus on the tectonics and metallogeny of the northwestern part of the province. She has also developed expertise in aspects of the evolution of the B.C.-Yukon-Alaskan Cordillera as a whole. Her current project, as Northwestern BC Manager, involves structural and geochronological studies of the Mesozoic porphyry-epithermal belt known as the Golden Triangle. Throughout her career, JoAnne has successfully interwoven the complex geology of the Cordillera with the wealth of mineral deposits it contains. She understands that this process is best done by also incorporating knowledge developed by industry geologists and prospectors. To this end, she meets with them in their offices and in the field, uses their reports, and engages with them at conferences. Her charisma and enthusiastic presentations at technical conferences and at regional community meetings have informed and inspired a broad spectrum of explorers, researchers, students and the general public. JoAnne's accomplishments were formally recognized in 2013 when she was listed in the top 100 Global Inspirational Women in Mining by the United Kingdom's Standard Bank. Additionally, in 2015, she was presented with the Gold Pick Award by the Kamloops Exploration Group (KEG) in recognition of "outstanding services and contributions to the minerals industry". AME is pleased to add to these accolades by awarding her the 2016 Special Tribute. Susan Craig is recognized with the Gold Pan Award for her exceptional meritorious service to the mineral exploration community through AME. Susan has more than a decade of experience supporting AME. She served as co-chair of the Mineral Exploration Roundup committee in 2009 and 2010, and was chair in 2011, when attendance at AME's Roundup conference first exceeded 7,000 participants. In 2004, she joined the First Nations & Community Relations Committee, and to this day serves on its successor, the Aboriginal Relations Committee. Susan has served on AME's Board of Directors from 2005 to 2008, and since 2014. She was a co-recipient of the inaugural 2007 Robert R. Hedley Award for Excellence in Social and Environmental Responsibility. Outside of AME, Susan has been Chair of the Yukon Minerals Advisory Group and is a director of the Yukon Chamber of Mines. The Frank Woodside Past Presidents and Past Chairs Award is presented to three individuals for their distinguished service to AME. Barbara Caelles graduated with a B.Sc. in Geology from the University of British Columbia, and has worked in the mining industry for more than 40 years. She started her career in exploration as a field geologist, but eventually turned to consulting in records management for mining in order to have a more balanced lifestyle. Barbara has been involved in women's groups since she was appointed in 1975 to the Women Geoscientists Committee in 1975, of which she became Chair in 1977. Barbara is a founding member of Women in Mining British Columbia (formerly known as Women in Mining Vancouver), sits on the executive of the Greater Vancouver Mining Women's Association, and was part of the BC HR Task Force, Diversity-Women Sub-committee. In 2010 Barbara received the Minerva Foundation's Women in Natural Resources Award for Philanthropy and Volunteerism, and was recognized as a Life Member by AME in 2015. Alex Christopher joined Teck's Exploration Group in 1984 and was appointed Senior Vice President, Exploration, Projects & Technical Services in July 2016. He previously held the position of Vice President, Exploration, and has held a number of positions in the company within Exploration, Exploration Business Development and Corporate Development. Alex holds a B.Sc. (Honours) degree in Geology from McMaster University and an Environmental Biology Technology Diploma from Canadore College. Alex is also on the Board of Directors of the Prospectors & Developers Association of Canada ("PDAC") and is a Director of Horizonte Minerals Plc. Alex has served on the AME's Finance & Audit Committee since 2006, and served as a Director from 2006 through 2009. Diane Gregory has a career that ranges from being the geologist and lands manager for Murray Pezim's Prime Explorations Ltd. during the Eskay Creek staking rush to being a land manager with The Claim Group Inc., a mineral tenure management company. Diane was part of the Land Use Committee of AME and Lands Committee of the PDAC several years during the late 1990s and early 2000s. As a Land and Contracts Manager with Kennecott Exploration Canada Inc., Diane sat at the Cassiar-Iskut-Stikine land use for two years and reported to AME regarding the deliberations. Along with Barbara Caelles, Diane was a founding member of Women in Mining British Columbia (formerly known as Women in Mining Vancouver). Diane was previously recognized as a Life Member by AME in 2012. Britannia Mine Museum is granted $10,000 to assist and support the Museum's Educational Program that is focused on earth science programs and events for students. These programs are attended annually by 10,000 students. The 2016 programs focused on the themes of What Use Are Minerals To Me?, Mineral Diversity Up Close and The Bigger Picture XL, a critical thinking game related to operating a mining company for the Grades 5 to 6 students. The inaugural DIG Day-Delving into Geoscience, an activity dealing with plate tectonics, volcanoes, minerals, rocks and fossils was featured during spring break.The educational initiatives for 2017 will focus on developing exhibits on carbon and carbon innovations, enhancing activities associated with DIG Day-Delving into Geoscience with a focus on geological events related to the origin of the Britannia copper deposits. Also, a permanent display of the hydrothermal Black Smoker chimney specimens from the Juan de Fuca Ridge will be developed at the Mineral Gallery of the Beaty - Lundin Visitor Centre. All programs and activities will be coordinated with the primary objective of supporting and assisting the teachers for educating students on geological science. Mineral Resources Education Program of BC (MineralsEd) is granted $10,000 for coordinating the Kids & Rocks hands-on classroom workshop in 2017 for children and students in Kindergarten to Grade 3 in the Lower Mainland schools of BC. A complementary version of the Kids & Rocks program, tentatively referred to as Kids & Rocks 5, will be introduced for Grade 4 to 6 classes. The main objective of Kids & Rocks program is to introduce children to the basic properties of various rocks and minerals and how they are utilized to benefit our lives. The kids are provided with a bag of about 25 rocks and minerals, a hand lens, hardness kit, streak plate, magnet and flashlight to experience and learn the basic physical properties of their specimens. As the children advance, they are introduced on how our daily lives are dependent on earth's non-renewable resources. The more advanced Kids & Rocks 5 program will challenge the students to identify "blind" mineral and rock samples by way of examining, recognizing and recording specific physical properties to identify the mineral specimens; and for rocks, determining whether it is an igneous, sedimentary or metamorphic rock. The Kids & Rocks project is an important stepping stone for our current and future mineral exploration industry.


Achilleos V.,National and Kapodistrian University of Athens | Frantzeskakis D.J.,National and Kapodistrian University of Athens | Kevrekidis P.G.,University of Massachusetts Amherst | Pelinovsky D.E.,McMaster University
Physical Review Letters | Year: 2013

We study matter-wave bright solitons in spin-orbit coupled Bose-Einstein condensates with attractive interactions. We use a multiscale expansion method to identify solution families for chemical potentials in the semi-infinite gap of the linear energy spectrum. Depending on the linear and spin-orbit coupling strengths, the solitons may present either a sech2-shaped or a modulated density profile reminiscent of the stripe phase of spin-orbit coupled repulsive Bose-Einstein condensates. Our numerical results are in excellent agreement with our analytical findings and demonstrate the potential robustness of solitons for experimentally relevant conditions. © 2013 American Physical Society.


Prince M.J.,King's College London | Wu F.,Shanghai Institutes of Preventative Medicine | Guo Y.,U.S. Center for Disease Control and Prevention | Gutierrez Robledo L.M.,National Autonomous University of Mexico | And 3 more authors.
The Lancet | Year: 2015

23% of the total global burden of disease is attributable to disorders in people aged 60 years and older. Although the proportion of the burden arising from older people (≤60 years) is highest in high-income regions, disability-adjusted life years (DALYs) per head are 40% higher in low-income and middle-income regions, accounted for by the increased burden per head of population arising from cardiovascular diseases, and sensory, respiratory, and infectious disorders. The leading contributors to disease burden in older people are cardiovascular diseases (30·3% of the total burden in people aged 60 years and older), malignant neoplasms (15·1%), chronic respiratory diseases (9·5%), musculoskeletal diseases (7·5%), and neurological and mental disorders (6·6%). A substantial and increased proportion of morbidity and mortality due to chronic disease occurs in older people. Primary prevention in adults aged younger than 60 years will improve health in successive cohorts of older people, but much of the potential to reduce disease burden will come from more effective primary, secondary, and tertiary prevention targeting older people. Obstacles include misplaced global health priorities, ageism, the poor preparedness of health systems to deliver age-appropriate care for chronic diseases, and the complexity of integrating care for complex multimorbidities. Although population ageing is driving the worldwide epidemic of chronic diseases, substantial untapped potential exists to modify the relation between chronological age and health. This objective is especially important for the most age-dependent disorders (ie, dementia, stroke, chronic obstructive pulmonary disease, and vision impairment), for which the burden of disease arises more from disability than from mortality, and for which long-term care costs outweigh health expenditure. The societal cost of these disorders is enormous. © 2015 Elsevier Ltd.


Das S.,University of Lethbridge | Bhaduri R.K.,McMaster University
Classical and Quantum Gravity | Year: 2015

We show that dark matter consisting of bosons of mass of about 1 eV or less has a critical temperature exceeding the temperature of the Universe at all times, and hence would have formed a Bose-Einstein condensate at very early epochs. We also show that the wavefunction of this condensate, via the quantum potential it produces, gives rise to a cosmological constant that may account for the correct dark energy content of our Universe. We argue that massive gravitons or axions are viable candidates for these constituents. In the far future this condensate is all that remains of our Universe. © 2015 IOP Publishing Ltd.


Cairney J.,McMaster University | Veldhuizen S.,Center for Addiction and Mental Health
Developmental Medicine and Child Neurology | Year: 2013

Developmental coordination disorder (DCD) is a common, neurodevelopmental disorder of children that results in significant impairment in everyday activities of living. Over the past two decades, a large body of work has documented associations between DCD, physical inactivity, and poor health-related fitness. The exact nature of these relations, however, has been relatively little studied. In this paper, we ask whether the balance of evidence supports the proposition that DCD is a fundamental cause of inactivity and poor fitness. To address this question, we apply Hill's criteria for causation. We conclude that the evidence is consistent with, and reasonably supportive of, this proposition, but does not exclude alternative explanations. © 2013 Mac Keith Press.


Hitchcock A.P.,McMaster University | Toney M.F.,SSRL
Journal of Synchrotron Radiation | Year: 2014

Current and future capabilities of X-ray spectromicroscopy are discussed based on coherence-limited imaging methods which will benefit from the dramatic increase in brightness expected from a diffraction-limited storage ring (DLSR). The methods discussed include advanced coherent diffraction techniques and nanoprobe-based real-space imaging using Fresnel zone plates or other diffractive optics whose performance is affected by the degree of coherence. The capabilities of current systems, improvements which can be expected, and some of the important scientific themes which will be impacted are described, with focus on energy materials applications. Potential performance improvements of these techniques based on anticipated DLSR performance are estimated. Several examples of energy sciences research problems which are out of reach of current instrumentation, but which might be solved with the enhanced DLSR performance, are discussed. © 2014 International Union of Crystallography.


Wu X.,McMaster University | Zhai G.,Shanghai JiaoTong University
IEEE Signal Processing Magazine | Year: 2013

A new paradigm of information display, called temporal psychoviusal modulation (TPVM), which is conceived as an ingenious interplay of signal processing, optoelectronics, and psychophysics, is proposed. In TPVM, a high-speed display sequentially emits a set of atom frames. Unlike in time multiplexing, these atom frames are not completely formed images but rather constituent parts of images; these atom frames are amplitude modulated by display-synchronized shutter devices. TPVM can be implemented by a combination of a high-speed display and display synchronized active liquid crystal (LC) glasses. The signal processing operations performed optoelectronically via the display-glasses coupling and the resulting psychovisual effects of TPVM can be mathematically modeled. A defining and unique characteristic of the new TPVM display system is that the optoelectronic modulator is coupled with a biological demodulator.


Ruiz-Irastorza G.,University of the Basque Country | Crowther M.,McMaster University | Branch W.,University of Utah | Khamashta M.A.,King's College
The Lancet | Year: 2010

The antiphospholipid syndrome causes venous, arterial, and small-vessel thrombosis; pregnancy loss; and preterm delivery for patients with severe pre-eclampsia or placental insufficiency. Other clinical manifestations are cardiac valvular disease, renal thrombotic microangiopathy, thrombocytopenia, haemolytic anaemia, and cognitive impairment. Antiphospholipid antibodies promote activation of endothelial cells, monocytes, and platelets; and overproduction of tissue factor and thromboxane A2. Complement activation might have a central pathogenetic role. Of the different antiphospholipid antibodies, lupus anticoagulant is the strongest predictor of features related to antiphospholipid syndrome. Therapy of thrombosis is based on long-term oral anticoagulation and patients with arterial events should be treated aggressively. Primary thromboprophylaxis is recommended in patients with systemic lupus erythematosus and probably in purely obstetric antiphospholipid syndrome. Obstetric care is based on combined medical-obstetric high-risk management and treatment with aspirin and heparin. Hydroxychloroquine is a potential additional treatment for this syndrome. Possible future therapies for non-pregnant patients with antiphospholipid syndrome are statins, rituximab, and new anticoagulant drugs. © 2010 Elsevier Ltd.


Garcia D.A.,University of New Mexico | Baglin T.P.,University of Cambridge | Weitz J.I.,McMaster University | Samama M.M.,University of Notre Dame
Chest | Year: 2012

This article describes the pharmacology of approved parenteral anticoagulants. These include the indirect anticoagulants, unfractionated heparin (UFH), low-molecular-weight heparins (LMWHs), fondaparinux, and danaparoid, as well as the direct thrombin inhibitors hirudin, bivalirudin, and argatroban. UFH is a heterogeneous mixture of glycosaminoglycans that bind to antithrombin via a unique pentasaccharide sequence and catalyze the inactivation of thrombin, factor Xa, and other clotting enzymes. Heparin also binds to cells and plasma proteins other than antithrombin causing unpredictable pharmacokinetic and pharmacodynamic properties and triggering nonhemorrhagic side effects, such as heparin-induced thrombocytopenia (HIT) and osteoporosis. LMWHs have greater inhibitory activity against factor Xa than thrombin and exhibit less binding to cells and plasma proteins than heparin. Consequently, LMWH preparations have more predictable pharmacokinetic and pharmacodynamic properties, have a longer half-life than heparin, and are associated with a lower risk of nonhemorrhagic side effects. LMWHs can be administered once daily or bid by subcutaneous injection, without coagulation monitoring. Based on their greater convenience, LMWHs have replaced UFH for many clinical indications. Fondaparinux, a synthetic pentasaccharide, catalyzes the inhibition of factor Xa, but not thrombin, in an antithrombin-dependent fashion. Fondaparinux binds only to antithrombin. Therefore, fondaparinux- associated HIT or osteoporosis is unlikely to occur. Fondaparinux exhibits complete bioavailability when administered subcutaneously, has a longer half-life than LMWHs, and is given once daily by subcutaneous injection in fixed doses, without coagulation monitoring. Three additional parenteral direct thrombin inhibitors and danaparoid are approved as alternatives to heparin in patients with HIT. © 2012 American College of Chest Physicians.


Kolb M.,McMaster University | Collard H.R.,University of California at San Francisco
European Respiratory Review | Year: 2014

Idiopathic pulmonary fibrosis (IPF) is traditionally staged with terms such as "mild", "severe", "early" and "advanced" based on pulmonary function tests. This approach allows physicians to monitor disease progression and advise patients and their families. However, it is not known if the stages of this model reflect distinct biological or clinical phenotypes and the therapeutic and prognostic value of this system is limited. Novel methods of IPF staging have recently been developed. The GAP model includes four baseline variables that were found to be predictive of outcome, as identified by logistic regression. These factors are: gender (G), age (A) and two lung physiology variables (P) (forced vital capacity and diffusing capacity of the lung for carbon monoxide). The clinical utility and accuracy of staging models may be further improved in the future by the integration of dynamic parameters that can be measured over time, as well as biological data from biomarkers which may be able to directly measure disease activity. The development of an evidence-based, multidimensional IPF staging model that builds on the current staging approaches to IPF is an important objective for improving the management of IPF. © ERS 2014.


Kallin C.,McMaster University | Berlinsky J.,Kavli Institute for Theoretical Physics
Reports on Progress in Physics | Year: 2016

Chiral superconductivity is a striking quantum phenomenon in which an unconventional superconductor spontaneously develops an angular momentum and lowers its free energy by eliminating nodes in the gap. It is a topologically non-trivial state and, as such, exhibits distinctive topological modes at surfaces and defects. In this paper we discuss the current theory and experimental results on chiral superconductors, focusing on two of the best-studied systems, Sr2RuO4, which is thought to be a chiral triplet p-wave superconductor, and UPt3, which has two low-temperature superconducting phases (in zero magnetic field), the lower of which is believed to be chiral triplet f-wave. Other systems that may exhibit chiral superconductivity are also discussed. Key signatures of chiral superconductivity are surface currents and chiral Majorana modes, Majorana states in vortex cores, and the possibility of half-flux quantum vortices in the case of triplet pairing. Experimental evidence for chiral superconductivity from μSR, NMR, strain, polar Kerr effect and Josephson tunneling experiments are discussed. © 2016 IOP Publishing Ltd.


Kuperman V.,McMaster University | Van Dyke J.A.,Haskins Laboratories
Journal of Memory and Language | Year: 2011

This study is a large-scale exploration of the influence that individual reading skills exert on eye-movement behavior in sentence reading. Seventy-one non-college-bound 16-24. year-old speakers of English completed a battery of 18 verbal and cognitive skill assessments, and read a series of sentences as their eye-movements were monitored. Statistical analyses were performed to establish what tests of reading abilities were predictive of eye-movement patterns across this population and how strong the effects were. We found that individual scores in rapid automatized naming and word identification tests (i) were the only participant variables with reliable predictivity throughout the time-course of reading; (ii) elicited effects that superceded in magnitude the effects of established predictors like word length or frequency; and (iii) strongly modulated the influence of word length and frequency on fixation times. We discuss implications of our findings for testing reading ability, as well as for research of eye-movements in reading. © 2011 Elsevier Inc.


Choquet H.,University of California at San Francisco | Meyre D.,McMaster University
Current Genomics | Year: 2011

Candidate gene and genome-wide association studies have led to the discovery of nine loci involved in Mendelian forms of obesity and 58 loci contributing to polygenic obesity. These loci explain a small fraction of the heritability for obesity and many genes remain to be discovered. However, efforts in obesity gene identification greatly modified our understanding of this disorder. In this review, we propose an overlook of major lessons learned from 15 years of research in the field of genetics and obesity. We comment on the existence of the genetic continuum between monogenic and polygenic forms of obesity that pinpoints the role of genes involved in the central regulation of food intake and genetic predisposition to obesity. We explain how the identification of novel obesity predisposing genes has clarified unsuspected biological pathways involved in the control of energy balance that have helped to understand past human history and to explore causality in epidemiology. We provide evidence that obesity predisposing genes interact with the environment and influence the response to treatment relevant to disease prediction. © 2011 Bentham Science Publishers Ltd.


Choquet H.,University of California at San Francisco | Meyre D.,McMaster University
Current Genomics | Year: 2011

Obesity is a global health problem that is gradually affecting each continent of the world. Obesity is a heterogeneous disorder, and the biological causes of obesity are complex. The rapid increase in obesity prevalence during the past few decades is due to major societal changes (sedentary lifestyle, over-nutrition) but who becomes obese at the individual level is determined to a great extent by genetic susceptibility. In this review, we evidence that obesity is a strongly heritable disorder, and provide an update on the molecular basis of obesity. To date, nine loci have been involved in Mendelian forms of obesity and 58 loci contribute to polygenic obesity, and rare and common structural variants have been reliably associated with obesity. Most of the obesity genes remain to be discovered, but promising technologies, methodologies and the use of "deep phenotyping" lead to optimism to chip away at the 'missing heritability' of obesity in the near future. In the longer term, the genetic dissection of obesity will help to characterize disease mechanisms, provide new targets for drug design, and lead to an early diagnosis, treatment, and prevention of obesity. © 2011 Bentham Science Publishers Ltd.


Grant
Agency: European Commission | Branch: FP7 | Program: CP-SICA | Phase: HEALTH-2007-3.5-2 | Award Amount: 3.76M | Year: 2009

Inadequate access to and use of research evidence to inform health policy limits the achievement of universal and equitable access to healthcare, hinders quality improvement and makes it difficult to use healthcare resources wisely. Poorly informed decision-making about health policies and systems is one of the reasons why services fail to reach those most in need, health indicators are off track, and it appears unlikely that many countries in Africa will meet the health MDGs. SURE will support improvements in health policies and systems in low and middle-income countries (LMIC) by improving access to and use of policy-relevant syntheses of research evidence that are contextualized and tailored to meet the needs of decision makers. SURE will develop, pilot and evaluate five strategies designed to strengthen access to and use of reliable and timely research syntheses in policymaking: user friendly formats for research syntheses, clearing houses for syntheses and policy relevant research, mechanisms for responding rapidly to policymakers needs for research evidence, methods for organizing and managing deliberative forums involving policymakers, researchers and others, and methods for involving civil society and the public in policy development. SURE will develop capacity for evidence-informed healthcare policy and undertake a comparative evaluation of initiatives between policymakers and researchers using these and other strategies. SURE will collaborate with the Evidence-Informed Health Policy Network (EVIPNet) and the Regional East African Community Health (REACH) Policy Initiativetwo international efforts to improve the use of research evidence in policy and health systems decisions via partnerships between policymakers, researchers and civil society. SURE will use a range of dissemination strategies. Global dissemination will be coordinated by and capitalise on WHO, with the aim of maximising the projects impact on health policy in Africa and othe


Grant
Agency: GTR | Branch: NERC | Program: | Phase: Research Grant | Award Amount: 286.07K | Year: 2012

The Arctic is undergoing rapid climatic change, with dramatic consequences for the Frozen World (the cryosphere), including reductions in the depth, extent and duration of sea ice, and seasonal snow cover on land, retreat of ice sheets/glaciers, and melting of permafrost (ground that remains at or below 0 degrees C for at least two consecutive years). This is important not only for local and regional ecosystems and human communities, but also for the functioning of the entire earth system. Evidence is growing that organic matter frozen in permafrost soils (often for many millennia) is now thawing, making it available for decomposition by soil organisms, with the release of carbon dioxide (CO2) and methane (CH4), both greenhouse gases (GHGs), as by-products. A major concern now is that, because permafrost soils contain 1672 petagrams (1 Pg = 1 billion tonnes) of organic carbon (C), which is about 50% of the total global below-ground pool of organic C, and permafrost underlies ~ 25% (23 million km2) of the N hemisphere land surface, a melting-induced release of GHGs to the atmosphere from permafrost soils could result in a major acceleration of global warming. This is called a positive biogeochemical feedback on global change; in other words, an unintentional side-effect in the global C cycle and climate system. Unfortunately, the interacting biological, chemical and physical controls on CO2 and CH4 emissions from permafrost (and melting permafrost) environments to the atmosphere are the subject of much speculation because the scientific community does not know enough about the interactions between C and water cycling in permafrost systems. Warmer and drier soils may release more CO2, while warmer/wetter soils might release more CH4. Permafrost thawing also causes changes in the way water flows though the landscape (because frozen ground if often impermeable to water), and some areas may become drier, while others wetter. How the relative proportions of CO2 and CH4 emissions change, and their absolute amount, is critical for the overall global warming potential (GWP) because these two gases have different potency as GHGs. Release of C from soils into freshwaters also needs to be taken into account because down-stream de-gassing and decomposition of organic materials also influences releases of CO2 and CH4 from freshwater, or delivery of C to lakes/oceans. All-in-all, predicting the GWP of permafrost regions is scientifically challenging, and the interactions between the water (hydrological) and C cycles are poorly known. In this project we recognise the key role that hydrological processes play in landscape-scale C fluxes in arctic and boreal regions. In permafrost catchments in NW Canada (including areas where permafrost is known to be thawing) we will measure the capture of C from the atmosphere (through photosynthesis), its distribution in plants and soils, and the biological, physical and chemical controls of C transport and delivery from soils to freshwaters, and ultimately to the atmosphere as CO2 and CH4. In essence we wish to close the C cycle. Field-based measurements of key processes in the water and C cycles, including geochemical tracer and state-of-the-art C, hydrogen and oxygen isotope approaches, will be linked by computer modelling. The project team, together with partners in Canada, the US and UK, is in a unique position to link the water and C cycles in permafrost environments, and we will deliver essential scientific knowledge on the potential consequences of climate warming, and permafrost thawing, for GHG emissions from northern high latitudes. Both for local peoples directly dependent on arctic tundra/boreal forest ecosystems for their livelihoods and cultural identity, and for the global community who must respond to, and anticipate, potential consequences of climate and environmental change, this project will represent a significant step forward in understanding/predictive capacity.


Wang J.,Shanghai JiaoTong University | Chen J.,McMaster University
IEEE Transactions on Information Theory | Year: 2013

We derive a lower bound on each supporting line of the rate region of the vector Gaussian two-terminal CEO problem, which is a special case of the indirect vector Gaussian two-terminal source coding problem. The key technical ingredient is a new extremal inequality. It is shown that the lower bound coincides with the Berger-Tung upper bound in the high-resolution regime. Similar results are derived for the direct vector Gaussian two-terminal source coding problem. © 1963-2012 IEEE.


News Article | October 10, 2016
Site: www.rdmag.com

If you're angry or upset, you might want to simmer down before heading out for an intense run or gym workout. A large, international study ties heavy exertion while stressed or mad to a tripled risk of having a heart attack within an hour. Regular exercise is a healthy antidote to stress and can help prevent heart disease — the biggest problem is that too many people get too little of it. But the new research suggests there may be better or worse times to exercise, and that extremes can trigger harm. "This study is further evidence of the connection between mind and body. When you're angry, that's not the time to go out and chop a stack of wood," said Barry Jacobs, a psychologist at the Crozer-Keystone Health System in suburban Philadelphia and an American Heart Association volunteer. He had no role in the study , led by the Population Health Research Institute at McMaster University in Hamilton, Ontario. Results were published Monday in the Heart Association journal Circulation. Earlier studies have looked at anger and exertion as heart attack triggers but most were small or in one country, or included few women or minorities. The new study involved 12,461 people suffering a first heart attack in 52 countries. Their average age was 58 and three-fourths were men. They answered a survey about whether they were angry or upset, or had heavy exertion, in the hour before their heart attack or during the same time period the previous day. That way researchers could compare risk at different times in the same people and the effect of these potential heart attack triggers. Being angry or upset doubled the risk of suffering heart attack symptoms within an hour; heavy physical exertion did the same. Having both at the same time more than tripled the risk for a heart attack. The risk was greatest between 6 p.m. and midnight, and was independent of other factors such as smoking, high blood pressure or obesity. Big caveats: Patients reported their own stress or anger, and people who just had a heart attack may be more prone to recall or think they suffered one of these triggers than they otherwise might have been. Also, strenuous exertion is whatever the patient perceives it to be — for some people that could be climbing stairs and for others, running a marathon. The study also is observational, so it cannot prove cause and effect. But it's likely to be the best kind of information available — it's not possible to randomly assign people to be angry and exercise, then see how many have heart attacks. "This is a large enough sample size that we can put stock in the findings," Jacobs said. "We all need to find ways of modifying our emotional reactions and to avoid extreme anger," such as distracting ourselves, walking away from the stressful situation, trying to see it from a different perspective, talking it out and getting support from other people, he said. The study's findings also are biologically plausible. Emotional stress and exertion can raise blood pressure and heart rate, change the flow of blood in the vessels and reduce the heart's blood supply, said the study leader, Dr. Andrew Smyth of McMaster University. In an artery already clogged with plaque, a trigger could block blood flow and lead to a heart attack. "From a practical perspective, there will be times when exposure to such extremes is unavoidable," Smyth said. "We continue to advise regular physical activity for all, including those who use exercise to relieve stress," but people should not go beyond their usual routine at such times, he said. The study was funded by the Canadian Institutes of Health Research, other governmental bodies from various countries that participated, and grants from several drug companies.


MARKHAM, ONTARIO--(Marketwired - Nov. 29, 2016) - VIQ Solutions Inc. ("VIQ Solutions", "VIQ" or the "Corporation") (TSX VENTURE:VQS), a global expert providing cybersecurity protected technology and services, today reported financial results for the three month and nine month periods ended September 30, 2016. Results are reported in Canadian dollars and are prepared in accordance with International Financial Reporting Standards ("IFRS"). Consolidated quarterly revenue was approximately $2.9M, an increase of $0.6M or 26% over the previous year. Revenue was generated by new customer wins in the medical, law enforcement, intelligence and insurance markets as the transition to a more diversified customer base continues to successfully gain momentum. Recurring revenue for the quarter grew by 35% over the same period in 2015. During the quarter, the Company made strategic investments to advance the key initiative of transitioning revenue from the historical license plus maintenance model to a modernized subscription and cloud based model. "VIQ's subscription and cloud based revenue is strengthening with each quarter as customers demand the flexibility of secure cloud based solutions," said Sebastien Paré, President and CEO of VIQ Solutions. "The global transformation to recurring subscription revenue and SaaS holds many opportunities and short term transitioning pressure on trailing revenue, reported revenue and cash flow. "To drive this transition, we accelerated some strategic technology investments in Q3, ensuring VIQ continues to lead this global shift toward SaaS." VIQ's technology division recorded $0.8M quarterly revenue, an increase of 82% over the same period in 2015. The shift to paperless secure transfer of sensitive digital evidence, the emergence of low cost hardware enabling the interconnectedness of devices and the collection of vast amounts of audio and video data continue to drive VIQ technology sales. During the quarter, VIQ won new customer contracts that integrate its latest technology including smartphone mobile capture and speech recognition. "Integrated speech recognition contributed to our technology revenue increase in Q3. It is a key component of our growth plan, particularly in legal, medical and law enforcement markets," said Mr. Paré. "The integration of seamless, secure speech recognition technology through global providers like Nuance ensure VIQ a competitive edge to meet this growing customer demand." The increased revenue, particularly in the higher margin technology division, increased VIQ's overall gross profit margin to 40% for the quarter as compared to 36% in 2015. VIQ announced the award of patent pending status on key high performance intellectual property during the quarter. The patents relate to VIQ's secure digital workflow providing AV capture and competency assessment of training procedures. Subsequent to the period, a new medical AV training win was announced with McMaster University School of Medicine employing the VIQ patent pending workflow. "McMaster University School of Medicine is the first of many opportunities for VIQ with this sophisticated workflow as more and more industries digitize their training and workflow processes," said Mr. Paré. "The investments we made in Q3 to formally secure the patents on our key intellectual property were an important step in ensuring we capitalize on our technological leadership." VIQ's Australian services posted Q2 revenue of $2.1M, an increase of 17% over the same period in 2015. The revenue increase resulted from new customer wins in higher revenue blended reporting, technology and transcription contracts and breakthroughs in medical transcription. The unaudited third quarter 2016 condensed consolidated interim financial statements and results of operations and Management's Discussion and Analysis of Results and Financial Condition for the three and nine month periods ended September 30, 2016 will be posted on SEDAR's website at www.sedar.com. The financial information included in this release is qualified in its entirety and should be read together with the unaudited third quarter 2016 condensed consolidated interim financial statements and the audited consolidated financial statements for the year ended December 31, 2015, including the notes thereto. VIQ Solutions is the leading technology and service platform provider for digital evidence capture and content management. Our secure modular software allows customers to onboard the VIQ platform at any stage of their organization's digitization, from the capture of digital content from video and audio devices through to online collaboration, mobility, data analytics and integration with sensors, facial recognition, speech recognition and case management or patient record systems. VIQ's technology leads the industry in security, meeting the highest international standards for digital/cyber security and privacy, including military and medical regulations. Our solutions are in use in over 20 countries with tens of thousands of users in over 200 government and private agencies including law enforcement, immigration, medical, legal, insurance, courts, transportation and transcription service providers. VIQ also provides end to end transcription services to several large government agencies through our Australia-based reporting and transcription partners. VIQ operates worldwide with partners like security integrators, audio-video specialists, and hardware and data storage suppliers. For more information about VIQ Solutions, please visit www.viqsolutions.com. Certain statements included in this news release constitute forward looking statements or forward looking information under applicable securities legislation. Such forward looking statements or information are provided for the purpose of providing information about management's current expectations and plans relating to the future. Readers are cautioned that reliance on such information may not be appropriate for other purposes. Forward looking statements or information typically contain statements with words such as "anticipate", "believe", "expect", "plan", "intend", "estimate", "propose", "project" or similar words suggesting future outcomes or statements regarding an outlook. Forward looking statements or information in this news release include, but are not limited to, management's targets for the Corporation's growth in 2016 and beyond. Forward looking statements or information is based on a number of factors and assumptions which have been used to develop such statements and information but which may prove to be incorrect. Although VIQ Solutions believes that the expectations reflected in such forward looking statements or information are reasonable, undue reliance should not be placed on forward looking statements because VIQ Solutions can give no assurance that such expectations will prove to be correct. In addition to other factors and assumptions which may be identified in this news release, assumptions have been made regarding, among other things, the Corporation's recent initiatives, and that sales and prospects may provide incremental value for shareholders. Readers are cautioned that the foregoing list is not exhaustive of all factors and assumptions which have been used. Forward looking statements or information are based on current expectations, estimates and projections that involve a number of risks and uncertainties which could cause actual results to differ materially from those anticipated by VIQ Solutions and described in the forward looking statements or information. These risks and uncertainties may cause actual results to differ materially from the forward looking statements or information. Readers are cautioned that the foregoing list is not exhaustive of all possible risks and uncertainties. Neither the TSX Venture Exchange nor its Regulation Service Provider (as that term is defined in the policies of the Exchange) accepts responsibility for the adequacy or accuracy of this release.


News Article | December 23, 2016
Site: www.techtimes.com

Federal guidelines on daily dietary sugar intake could be based on poor evidences, reports a recent study. A team of researchers from McMaster University and The Hospital for Sick Children, who reviewed up to nine public dietary recommendations on sugar intake, including World Health Organization and U.S. Dietary Guidelines for Americans, argue that they are backed up by evidences of poor quality. While the study raises doubts on the quality of federal dietary guidelines, it doesn't encourage the consumption of sugary and nutrient-poor foods such as sugar-sweetened beverages, said Bradley Johnston, the lead author of the study. Johnston added that while it is advisable to limit the amount of daily sugar intake, the biggest question of the day is to what extent it should be limited. Furthermore, if one limits the amount of sugar in diet, what is the alternative suggested to replace it, questioned the researcher. The professor pointed out a similar recommendation in the past, which encouraged a low-fat diet that made the public and the people from food industry replace fat with simple sugars, which paved way for various health outcomes such as diabetes and obesity. Given that if sugar in diet has to replaced, people may increase the intake of starch and additives such as maltodextrine. Taking such additives not only provides same calories as that of sugar but also increases the body's glycemic index. On the other hand, the recommendations from leading authorities vary significantly from each other. For instance, WHO recommends sugar intake that accounts to less than 5 percent of dietary calories per day, while Institute of Medicine limits sugar intake to less than 25 percent of dietary calories taken every day. When the recommendations from reliable authorities contradict with each other, they not only pave way for confusion among people but also make them skeptic about the quality of the guidelines and the quality of evidences the guidelines are prepared with, added Johnston. However, Behnam Sadeghirad, a McMaster PhD student, said that none of the guidelines issued currently on the daily intake of sugar is associated with poor health outcomes. Therefore, it is expected that the current findings would promote them in coming up with more reliable recommendations in the future. "Overall, I would say the guidelines are not trustworthy," said Johnston, reported NPR. "What's happening is that guideline panelists are making strong recommendations based on low-quality evidence." The study is published in Annals of Internal Medicine. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | November 8, 2016
Site: www.prweb.com

Altus Assessments, the creators of the CASPer™ test, the online situational judgement test that top academic programs, like medical schools, around the world use to pre-screen their applicants personal and professional traits, and ZAP Solutions, the creator of AMP, a leading provider of student admissions software for leading post-secondary schools worldwide, today announced a technology partnership and integration. The partnership and integration provides mutual customers with their applicant’s CASPer scores and booking status automatically displayed in the AMP platform. This gives the admissions committee a single location to quickly screen for the most holistically strong applicants, looking beyond cognitive scores and book smarts. “We are thrilled to have the opportunity to partner with Altus, and to offer our clients the ability to utilize CASPer Data within our AMP software,” says Zach Hraber, President of ZAP Solutions. “We are continuously striving to improve AMP and we believe that CASPer Data will help us in providing our clients with the tools & data sets that they need to holistically choose the applicants that are the very best fit for their school.” AMP is your all-in-one enrollment management solution. Leading schools easily, seamlessly and securely manage the student lifecycle from prospect to alumni with the AMP student admissions software. AMP turns complex data into business intelligence to help institutions choose the candidates who are the very best fit for their program. AMP is configured to support each of the program’s specific enrollment requirements. And its seamless integration with other systems, such as centralized and common application services (CAS), commercial and proprietary student information systems (SIS), payment processing and other ERP systems, ensures AMP works well with the other software you’re already using. “The integration of AMP helps deliver on a core promise to help reduce the burden of effort on admissions teams, while simultaneously improving the quality of the information used in screening decision making” says Rich Emrich, CEO of Altus Assessments. “We’re also excited to work with the team from ZAP Solutions, who our customers rave about for their commitment to customer success. This is very much aligned with our internal culture and goals and I’m looking forward to seeing what else we can create together.” CASPer development started a decade ago by some of the same creators of the multiple mini interview (MMI) and in 2015 the test was taken by 20% of all US Medicine applicants and 50% of all Canadian Medicine applicants. It is an an online assessment of an applicant’s personal and professional characteristics, assessing traits such as cultural competence, ethical responsibility, teamwork, and communication. The test is taken from the applicant's computer online, consists of 12 sections in a situational judgement test (SJT) format and takes approximately 75 minutes to complete. Research into the reliability, predictive validity and accessibility of CASPer shows a marked improvement over the more traditional approaches to assess personal and professional characteristics like personal statements, reference letters or standard interviews. For admissions committees who are tasked every year with screening thousands, to tens of thousands of program applicants for only a few hundred spots, the integration of CASPer scores into AMP makes the process of finding strong students faster, more reliable and more defensible. Now filtering for non-cognitive personal and professional traits is as easy as screening for cognitive abilities, reducing the resource burden on staff while simultaneously improving the quality of decision making. Currently used by more than 100 elite public and private medical and graduate schools worldwide, AMP is a customizable, role-based web application designed to streamline and enhance the productivity of complex, multi-step enrollment management processes. AMP is just one of several success stories for ZAP Solutions which, since our founding in 1997, has served as a trusted web and mobile technology provider to agencies, large companies and small and medium businesses across many industries, with a focus on higher education. ZAP also offers a full complement of professional consulting and development services to build, support, implement and integrate our software to fit the unique business process of each institution, admissions office, or company we are working with. The company is headquartered in Pittsburgh, PA. For more information on AMP, please visit http://www.paperlessadmissions.com Altus Assessments Inc provides efficient and cost effective online applicant screening services for academic programs admissions departments (allied health, education, law, business schools etc.) looking for a proven method to pre-screen for personal characteristics and professionalism of their applicant pool. Our primary tool is the online CASPer™ test, delivered at http://takecasper.com. With little cost, or administrative burden, our tool helps programs find holistically better students while reducing effort and cost applied to ineffective tools like standard interviews, reference letters and personal statements. The CASPer™ test was developed starting a decade ago for McMaster University, and has been used to screen over 50,000 medical school applicants to date with good test reliability and predictive powers. The test is not health care specific, but rather uses everyday scenarios in the form of situational judgement testing to evaluate for universally useful skills like communication, collaboration, advocacy and judgment. For 2017 admissions, Altus assessed 30% of all US Medical School applicants and 50% of all Canadian Medical School Applicants. We also assessed 20% of all Canadian Nursing applicants. For more information on CASPer, please visit: https://altusassessments.com.


News Article | November 4, 2016
Site: www.eurekalert.org

Hamilton, ON (Nov. 4, 2016) - McMaster University researchers have found that for patients diagnosed in the late stages of one of the most common and deadly forms of skin cancer, treatment with a combination of immunotherapy options improves survival and lowers the risk of life-threatening events. "This is the first analysis to draw comparison between targeted and immune therapies for BRAF-mutated melanomas," said Feng Xie, an associate professor in the Department of Clinical Epidemiology and Biostatistics at McMaster's Michael G. DeGroote School of Medicine. "Our results will help patients and clinicians choose treatments." Feng Xie is a principal investigator of the study, recently published in JAMA Oncology. Cutaneous melanoma is an aggressive and deadly form of skin cancer. According to the Canadian Cancer Society, the disease accounts for 3.3 per cent of new cancer cases each year in Canada, and it has a 15 per cent death rate. In its early stages, melanoma is often cured with surgery alone, however most patients who are diagnosed in the late stages of disease are not candidates for surgery and drug therapy is the main course of treatment. Tahira Devji, the first author of the paper and a PhD student of McMaster's Health Research Methodology Program, said that around 40 to 60 per cent of melanomas have a mutation in the BRAF protein. A number of effective treatment options are available for patients with advanced BRAF-mutated melanoma, which fall under two classes of drug therapies: targeted therapy, like chemotherapy, which stops cancer from growing and spreading; and immunotherapy, which works by stimulating the immune system to attack tumour cells. It has been unclear which is the optimal initial treatment. The goal of the study was to estimate the relative efficacy and safety of systemic therapies for those who have been diagnosed with advanced BRAF-mutated melanoma but not yet received any treatment. The team evaluated 15 randomized controlled trials published between 2011 and 2015, assessing the benefits and harms of targeted or immune checkpoint inhibitors in 6,662 patients with cancer that had spread to the lymph nodes and surgery was not an option, or distant metastatic melanoma. They found that combined BRAF and MEK targeted therapy and PD-1 immunotherapy were both equally effective in improving overall survival. Combined BRAF and MEK inhibition was most effective in improving progression-free survival. PD-1 inhibition was associated with the lowest risk of life-threatening events. They concluded that the safety of PD-1 inhibitors supports using this treatment option as first-line therapy in circumstances where quick action is not a priority. "While the data in our study represents best available evidence, using more than one kind of immunotherapy shows promise in early outcomes in clinical trials and could change the treatment landscape once longer-term results are published," said Feng Xie.


TORONTO & MONTREAL & VANCOUVER, British Columbia--(BUSINESS WIRE)--Versant Ventures today announced that Toronto-based portfolio company Northern Biologics Inc. has executed a transformational deal that expands its pipeline and financial resources. The merger of Mosaic Biomedicals SL with Northern creates a global oncology company backed by Versant and Celgene Corp. (NASDAQ:CELG) that will advance a promising first-in-class antibody into clinical trials in 2017. This announcement also marks the fifth major investment by Versant in life science companies with Canadian operations. It closely follows last week’s debut of BlueRock Therapeutics, a stem cell company that Versant and Bayer AG jointly launched with a series A commitment of CAD$295 million, the largest ever for a Canadian life science startup. Both Northern and BlueRock are examples of harnessing top-tier science and building sustainable companies with the necessary intellectual and financial resources to bring new medicines to patients. In 2013, Versant undertook the challenge of expanding its global footprint and building a significant presence in Canada. The firm’s goal was to source the country’s best scientific opportunities and to manage those startups into successful global companies. “Since launching investment activities in Canada three years ago, our progress toward building a world-class biotech portfolio has exceeded any of our expectations,” said Brad Bolzon, Ph.D., Versant managing director. “It is a testament to the quality of the Canadian academic research community and the commitment of key stakeholders in government and the private sector to build a viable biotech ecosystem that can compete with all other global players.” Versant’s recent activity in Canada also includes portfolio company Turnstone Biologics Inc., which completed one of the largest-ever series B rounds for a Canadian biotech in November. The financing will allow Turnstone to complete ongoing clinical trials of its lead oncolytic immunotherapeutic and also launch three additional clinical programs in the coming 24 months. Like BlueRock and Northern, Turnstone’s foundation was built on scientific discoveries and new technologies developed at Canadian academic institutions. Collectively these institutions include UHN and its affiliates the McEwen Centre for Regenerative Medicine and Princess Margaret Cancer Centre, as well as the Children’s Hospital of Eastern Ontario (CHEO), McMaster University, Ontario Institute for Cancer Research (OICR), Ottawa Hospital Research Institute (OHRI), and the University of Toronto. To accelerate the development of its own investment portfolio in Canada, Versant has also established a network of laboratories across the country called Discovery Engines. These include Inception Sciences in Vancouver and Montreal, and Blueline Bioscience in Toronto. To date several new projects have been launched in the fields of oncology, ophthalmology and inflammatory diseases, some having secured series A backing from Versant and pharmaceutical partners like Bayer and Celgene. “A common theme is to catalyze the creation of companies and accelerate their maturation with our own resources and those of global pharmaceutical partners,” said Jerel Davis, Ph.D., managing director at Versant. “Our pan-Canadian portfolio spans multiple indications, with new companies built on world-class science and strategic partnerships. These startups need the capital resources to be successful, which historically had been a shortcoming of Canadian biotechs.” Canada has become a productive source of biotech investments for Versant. Versant’s Canadian footprint has grown to include three Discovery Engines that house more than 30 scientists, five fully backed companies, two seed investments and 10 academic grants supported by the firm. Together these investments represent more than CAD$500 million in committed capital from Versant, syndicate members and pharmaceutical partners. Versant Ventures is a leading healthcare investment firm committed to helping exceptional entrepreneurs build the next generation of great healthcare companies. The firm invests across the healthcare sector and at all stages of company development, with an emphasis on the discovery and development of novel therapeutics. With $1.9 billion under management and offices in North America and Europe, Versant has built a team with deep investment, operating, and scientific expertise that enables a hands-on approach to company building. Since the firm's founding in 1999, more than 65 Versant companies have achieved successful acquisitions or IPOs. For more information, please visit www.versantventures.com.


News Article | November 6, 2016
Site: www.sciencedaily.com

McMaster University researchers have found that for patients diagnosed in the late stages of one of the most common and deadly forms of skin cancer, treatment with a combination of immunotherapy options improves survival and lowers the risk of life-threatening events. "This is the first analysis to draw comparison between targeted and immune therapies for BRAF-mutated melanomas," said Feng Xie, an associate professor in the Department of Clinical Epidemiology and Biostatistics at McMaster's Michael G. DeGroote School of Medicine. "Our results will help patients and clinicians choose treatments." Feng Xie is a principal investigator of the study, recently published in JAMA Oncology. Cutaneous melanoma is an aggressive and deadly form of skin cancer. According to the Canadian Cancer Society, the disease accounts for 3.3 per cent of new cancer cases each year in Canada, and it has a 15 per cent death rate. In its early stages, melanoma is often cured with surgery alone, however most patients who are diagnosed in the late stages of disease are not candidates for surgery and drug therapy is the main course of treatment. Tahira Devji, the first author of the paper and a PhD student of McMaster's Health Research Methodology Program, said that around 40 to 60 per cent of melanomas have a mutation in the BRAF protein. A number of effective treatment options are available for patients with advanced BRAF-mutated melanoma, which fall under two classes of drug therapies: targeted therapy, like chemotherapy, which stops cancer from growing and spreading; and immunotherapy, which works by stimulating the immune system to attack tumour cells. It has been unclear which is the optimal initial treatment. The goal of the study was to estimate the relative efficacy and safety of systemic therapies for those who have been diagnosed with advanced BRAF-mutated melanoma but not yet received any treatment. The team evaluated 15 randomized controlled trials published between 2011 and 2015, assessing the benefits and harms of targeted or immune checkpoint inhibitors in 6,662 patients with cancer that had spread to the lymph nodes and surgery was not an option, or distant metastatic melanoma. They found that combined BRAF and MEK targeted therapy and PD-1 immunotherapy were both equally effective in improving overall survival. Combined BRAF and MEK inhibition was most effective in improving progression-free survival. PD-1 inhibition was associated with the lowest risk of life-threatening events. They concluded that the safety of PD-1 inhibitors supports using this treatment option as first-line therapy in circumstances where quick action is not a priority. "While the data in our study represents best available evidence, using more than one kind of immunotherapy shows promise in early outcomes in clinical trials and could change the treatment landscape once longer-term results are published," said Feng Xie.


News Article | February 22, 2017
Site: www.nature.com

One of the worst epidemics in human history, a sixteenth-century pestilence that devastated Mexico’s native population, may have been caused by a deadly form of salmonella from Europe, a pair of studies suggest. In one study, researchers say they have recovered DNA of the stomach bacterium from burials in Mexico linked to a 1540s epidemic that killed up to 80% of the country's native inhabitants. The team reports its findings in a preprint posted on the bioRxiv server on 8 February1. This is potentially the first genetic evidence of the pathogen that caused the massive decline in native populations after European colonization, says Hannes Schroeder, an ancient-DNA researcher at the Natural History Museum of Denmark in Copenhagen who was not involved in the work. “It’s a super-cool study.” In 1519, when forces led by Spanish conquistador Hernando Cortés arrived in Mexico, the native population was estimated at about 25 million. A century later, after a Spanish victory and a series of epidemics, numbers had plunged to around 1 million. The largest of these disease outbreaks were known as cocoliztli (from the word for ‘pestilence’ in Nahuatl, the Aztec language). Two major cocoliztli, beginning in 1545 and 1576, killed an estimated 7 million to 18 million people living in Mexico’s highland regions. “In the cities and large towns, big ditches were dug, and from morning to sunset the priests did nothing else but carry the dead bodies and throw them into the ditches,” noted a Franciscan historian who witnessed the 1576 outbreak. There has been little consensus on the cause of cocoliztli — although measles, smallpox and typhus have all been mooted. In 2002, researchers at the National Autonomous University of Mexico (UNAM) in Mexico City proposed that a viral haemorrhagic fever, exacerbated by a catastrophic drought, was behind the carnage2. They compared the magnitude of the 1545 outbreak to that of the Black Death in fourteenth-century Europe. In an attempt to settle the question, a team led by evolutionary geneticist Johannes Krause at the Max Planck Institute for the Science of Human History in Jena, Germany, extracted and sequenced DNA from the teeth of 29 people buried in the Oaxacan highlands of southern Mexico. All but five were linked to a cocoliztli that researchers think ran from 1545 to 1550. Ancient bacterial DNA recovered from several of the people matched that of Salmonella, based on comparisons with a database of more than 2,700 modern bacterial genomes. Further sequencing of short, damaged DNA fragments from the remains allowed the team to reconstruct two genomes of a Salmonella enterica strain known as Paratyphi C. Today, this bacterium causes enteric fever, a typhus-like illness, that occurs mostly in developing countries. If left untreated, it kills 10–15% of infected people. It’s perfectly reasonable that the bacterium could have caused this epidemic, says Schroeder. “They make a really good case.” But María Ávila-Arcos, an evolutionary geneticist at UNAM, isn't convinced. She notes that some people suggest that a virus caused the cocoliztli, and that wouldn't have been picked up by the team’s method. Krause and his colleagues’ proposal is helped by another study posted on bioRxiv last week, which raises the possibility that Salmonella Paratyphi C arrived in Mexico from Europe3. A team led by Mark Achtman, a microbiologist at the University of Warwick in Coventry, UK, collected and sequenced the genome of the bacterial strain from the remains of a young woman buried around 1200 in a cemetery in Trondheim, Norway. It is the earliest evidence for the now-rare Salmonella strain, and proof that it was circulating in Europe, according to the study. (Both teams declined to comment on their research because their papers have been submitted to a peer-reviewed journal.) “Really, what we’d like to do is look at both strains together,” says Hendrik Poinar, an evolutionary biologist at McMaster University in Hamilton, Canada. And if more ancient genomes can be collected from Europe and the Americas, it should be possible to find out more conclusively whether deadly pathogens such as Salmonella arrived in the New World from Europe. The existence of Salmonella Paratyphi C in Norway 300 years before it appeared in Mexico doesn’t prove that Europeans spread enteric fever to native Mexicans, says Schroeder, but that hypothesis is reasonable. A small percentage of people infected with Salmonella Paratyphi C carry the bacterium without falling ill, so apparently healthy Spaniards could have infected Mexicans who lacked natural resistance. Paratyphi C is transmitted through faecal material, and a collapse of social order during the Spanish conquest might have led to the poor sanitary conditions that are ripe for Salmonella spread, Krause and his team note in the paper. Krause’s study offers a blueprint for identifying the pathogens behind ancient outbreaks, says Schroeder. His own team plans to look for ancient pathogens in Caribbean burial sites that seem to be linked to catastrophic outbreaks, and that were established after the Europeans arrived. “The idea that some of them might have been caused by Salmonella is now a distinct possibility,” he says.


News Article | November 22, 2016
Site: www.marketwired.com

SUDBURY, ONTARIO--(Marketwired - Nov. 22, 2016) - Northern Superior Resources Inc. (TSX VENTURE:SUP) ("Northern Superior" or the "Company") is announcing changes in the composition of the its Board of Directors. This reorganization was prompted by the Board in response to the recent changes to the shareholder base and the Board's desire to provide a transformational change in Board leadership. Stepping down from the Board are Alan Moon, Arnold Klassen, Wayne Livingstone, Fred Lecoq, and John Pollesel. Arthur Murdy and Tom Morris will remain on the Board. Joining the Board are Andrew Farnncomb, Sidney Himmel, John Kiernan and François Perron. Thomas Morris, President and CEO stated "I would like to thank the departing directors for their hard work and dedication to Northern Superior over the years. The individuals currently joining the Board have strong experience in the mineral resources development space. Their skills include mining engineering, corporate finance, investor relations and corporate governance. I look forward to working with the new Board members." Brief resumes for the incoming Board members are provided directly below. Andrew Farncomb is a founder of Cairn Merchant Partners LP, an independent merchant bank that invests and offers advisory services to public and private companies. Prior to forming Cairn, Mr. Farncomb was a Partner at Paradigm Capital, a Canadian investment bank focused on small to medium sized companies. Prior to joining Paradigm Capital, Mr. Farncomb held a business development role at a consumer goods company in Hong Kong. Mr. Farncomb is a member of the Board of Directors of several TSX Venture Exchange listed and private companies. Mr. Farncomb graduated from the Smith School of Business at Queen's University with a Bachelor of Commerce (Honors) degree and received the Merrill Lynch Scholarship. Sidney Himmel B.Sc, B.A., was previously President and Chief Executive Officer of IC Potash Corp. and Chairman of the Board of Directors of Namaste Technologies Inc. He was also President of two other industrial mineral development companies traded on the Toronto Stock Exchange. His career has involved working as tax specialist with a major international accounting firm, a corporate finance specialist with international investment dealers, and as an institutional equity trader and salesman. His experience also included working as in equity investment analyst. His financial experience has included raising substantial amounts of equity funding for a variety of public and private companies including a variety of resource companies. John Kiernan is a Mining Engineer with over 30 years of mine operating, engineering, consulting, corporate and financial experience, including a cumulative four years as an underground miner and operating foreman. He was most recently VP Project Development for Magellan Minerals (acquired by Anfield Gold Corp), and is also a director of Kapuskasing Gold Ltd. Previously he was Manager Project Evaluation for QuadraFNX/ KGHM International, Mining Analyst for PI Financial Corp and VP Mining/Mine Manager for Roca Mines Inc. In the period from 1987 to 2006, Mr. Kiernan held various senior engineering positions with Strathcona Mineral Services, Inco Ltd., Wardrop and AMEC. Mr. Kiernan has a B.Sc in Mining Engineering from Queen's University, and an MBA from Laurentian University. François Perron is presently Vice-President at Renmark Financial Communications. Prior to that, Mr. Perron was the President and Chief Executive Officer of QMX Gold Corporation and was previously the President and Chief Executive Officer of Golden Goose Resources. Prior to joining Golden Goose Resources, Mr. Perron was involved in the financial markets as a portfolio manager. He managed resource focused portfolios for NBC Alternative Investments and various resource funds for the Caisse de dépôt et placement du Québec from 2001 to 2007. In 2006, he was recognized by Brendan Woods International as a Top Gun Asset Manager in Mining. He has a Bachelor of Science, Computer science from McMaster University (1986) and an MBA from the Hautes Etudes Commerciales which he obtained in 1992. Mr. Perron has been on the board of several junior resource companies, and currently is on the board of Goldstar Minerals. Northern Superior will continue its strategy of expanding the resource base of Croteau Est with additional drilling, seeking opportunities to advance its Ti-pa-kaa-ning project and exploiting its outstanding data base. In other business, there were 1,050,000 options granted to staff and management at $0.05, of which 700,000 were granted to senior officers. Northern Superior is a reporting issuer in British Columbia, Alberta, Ontario and Québec, and trades on the TSX Venture Exchange under the symbol SUP. For further information contact: Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. Cautionary Note Regarding Forward-Looking Statements: This Press Release contains forward-looking statements that involve risks and uncertainties, which may cause actual results to differ materially from the statements made. When used in this document, the words "may", "would", "could", "will", "intend", "plan", "anticipate", "believe", "estimate", "expect" and similar expressions are intended to identify forward-looking statements. Such statements reflect our current views with respect to future events and are subject to such risks and uncertainties. Many factors could cause our actual results to differ materially from the statements made, including those factors discussed in filings made by us with the Canadian securities regulatory authorities. Should one or more of these risks and uncertainties, such actual results of current exploration programs, the general risks associated with the mining industry, the price of gold and other metals, currency and interest rate fluctuations, increased competition and general economic and market factors, occur or should assumptions underlying the forward looking statements prove incorrect, actual results may vary materially from those described herein as intended, planned, anticipated, or expected. We do not intend and do not assume any obligation to update these forward-looking statements, except as required by law. Shareholders are cautioned not to put undue reliance on such forward-looking statements.


News Article | December 19, 2016
Site: phys.org

"Finding the toys at Walmart or Target, they're pretty much non-existent," said mom Dezaraye Wilgis, sitting with Scarlett in front of their twinkling Christmas tree in St. Augustine. "Or if you get them through a medical supplier they're extremely expensive." While major toy-makers have changed with the times and sell dolls with wheelchairs and crutches, those designed to be used by children with severe disabilities are still difficult, if not impossible, to find. Because the toys have to be customized for each child, the cost can skyrocket. This conundrum gave two University of North Florida professors an idea: mix engineering and physical therapy students in a lab with the goal of converting toys from store shelves into custom-made fun for disabled children. The Adaptive Toy Project is now in its third year and has drawn a five-year grant from the National Institutes of Health. It is helping families such as Scarlett's while giving the students a dose of community service and real-world experience that will stick with them long after graduation. Dr. Alison Cernich, a neuropsychologist and director at the NIH's Eunice Kennedy Shriver National Institute of Child Health and Human Development, said the agency funded the program because it forces students from different fields to collaborate and solve a problem in the community. "This program is getting students in the early phases of their training thinking about ordinary objects, toys, and how to adapt those toys so that children with limitations can use and play with them like children without limitations," she said. On a recent day, the school's small lab buzzed with the sound of tools and chatter as students customized cars for their new owners. Chris Martin, an electrical engineering student, had removed the hood of Scarlett's car, exposing its wires. A large push button replaced the steering, and light sensors mounted underneath the car will allow it to follow a line of tape along the floor whenever Scarlett hits the button. Now, Scarlett's parents can design routes for the car with tape or use a remote-control mode for family walks. When Martin first met Scarlett's mother, "she actually cried, and it just made me want to work harder," Martin said. "I just want to make it as perfect as possible for her." The cars retail between $250 and $500; the customization makes them worth well over $1,000. The families, about 18 so far, get the cars free. Mary Lundy, a UNF professor of physical therapy who started the Adaptive Toy Project with an engineering colleague, said the students meet with families, and go to therapy appointments and schools. "Engineering students teach the physical therapy students how to modify basic electronics ... and in the process engineers learn how to do people-centered designs, and how to look at their clients differently," Lundy said. For the kids, it's also a way to continue important therapies through play. Dr. Peter Rosenbaum, a professor of pediatrics at McMaster University in Canada, said his field is increasingly focusing on "augmented mobility," to give kids a way to move around so they can be more independent. "We can't fix them," Rosenbaum said. "What we can do instead is say, 'What would a child at this age and stage of development be doing if they didn't have their impairment? How can we give them those experiences?' This changes the perspectives of everyone around her, and her perspective of herself." UNF's program is one of 60 related toy car programs for disabled children internationally that are part of the Go Baby Go network, but is the only one that has enlisted students to customize the vehicles for free. After weeks of work, Scarlett finally tested the car Martin and his colleagues built. They strapped her in and showed her how to hit the push button in the toy she would hopefully use for at least three years. The car drove forward, and Scarlett rocked back and forth. Her mother fought back tears, and her father walked alongside her. "For her, she's going to be able to get out more and not be trapped by a wheelchair ... and for us it'll be nice to see her interact with other children. It's amazing," Dezaraye said. Explore further: Video: Physical therapy research improves the lives of children with cerebral palsy


News Article | October 11, 2016
Site: www.biosciencetechnology.com

If you're angry or upset, you might want to simmer down before heading out for an intense run or gym workout. A large, international study ties heavy exertion while stressed or mad to a tripled risk of having a heart attack within an hour. Regular exercise is a healthy antidote to stress and can help prevent heart disease - the biggest problem is that too many people get too little of it. But the new research suggests there may be better or worse times to exercise, and that extremes can trigger harm. "This study is further evidence of the connection between mind and body. When you're angry, that's not the time to go out and chop a stack of wood," said Barry Jacobs, a psychologist at the Crozer-Keystone Health System in suburban Philadelphia and an American Heart Association volunteer. He had no role in the study , led by the Population Health Research Institute at McMaster University in Hamilton, Ontario. Results were published Monday in the Heart Association journal Circulation. Earlier studies have looked at anger and exertion as heart attack triggers but most were small or in one country, or included few women or minorities. The new study involved 12,461 people suffering a first heart attack in 52 countries. Their average age was 58 and three-fourths were men. They answered a survey about whether they were angry or upset, or had heavy exertion, in the hour before their heart attack or during the same time period the previous day. That way researchers could compare risk at different times in the same people and the effect of these potential heart attack triggers. Being angry or upset doubled the risk of suffering heart attack symptoms within an hour; heavy physical exertion did the same. Having both at the same time more than tripled the risk for a heart attack. The risk was greatest between 6 p.m. and midnight, and was independent of other factors such as smoking, high blood pressure or obesity. Big caveats: Patients reported their own stress or anger, and people who just had a heart attack may be more prone to recall or think they suffered one of these triggers than they otherwise might have been. Also, strenuous exertion is whatever the patient perceives it to be - for some people that could be climbing stairs and for others, running a marathon. The study also is observational, so it cannot prove cause and effect. But it's likely to be the best kind of information available - it's not possible to randomly assign people to be angry and exercise, then see how many have heart attacks. "This is a large enough sample size that we can put stock in the findings," Jacobs said. "We all need to find ways of modifying our emotional reactions and to avoid extreme anger," such as distracting ourselves, walking away from the stressful situation, trying to see it from a different perspective, talking it out and getting support from other people, he said. The study's findings also are biologically plausible. Emotional stress and exertion can raise blood pressure and heart rate, change the flow of blood in the vessels and reduce the heart's blood supply, said the study leader, Dr. Andrew Smyth of McMaster University. In an artery already clogged with plaque, a trigger could block blood flow and lead to a heart attack. "From a practical perspective, there will be times when exposure to such extremes is unavoidable," Smyth said. "We continue to advise regular physical activity for all, including those who use exercise to relieve stress," but people should not go beyond their usual routine at such times, he said. The study was funded by the Canadian Institutes of Health Research, other governmental bodies from various countries that participated, and grants from several drug companies.


News Article | November 25, 2015
Site: www.techtimes.com

Ancient London may not have been so different from contemporary London in terms of ethnic diversity after all, a new study revealed. A genetic analysis of four sets of ancient skeletal remains unraveled how the first Londoners must have looked like, their eye and hair color, the disease that afflicted them and where they were from. Senior Curator Caroline McDonald of the Museum of London, where the remains are currently kept, said London had been cosmopolitan ever since the invasion of Romans about 2,000 years ago. McDonald explained that most of the first Londoners were not born in the city, as every first-generation Londoner came from somewhere else. They might have been from somewhere else in Britain, somewhere else in Europe, the Mediterranean or Africa. "So the stories we can tell about our ancient population are absolutely relevant to modern contemporary London because these are our stories - these are people just like us," said McDonald. Museum researchers, together with scientists from Durham University and McMaster University in Canada, reconstructed the DNA of the four ancient individuals. These skeletons were part of 20,000 human remains that came from about 5,500 years back. Researchers found that two of the four skeletons were of people who were born outside of Britain. Of these two, one was of a man who was genealogically connected to Eastern Europe and the Middle East, while the other was of a teenage girl with blue eyes from North Africa, researchers said. One of the four skeletons was of a Briton native. The Eastern Europe man had injuries to his skull which may suggest that he had been killed at an amphitheater in London before his head was dumped into a pit. He may have been a gladiator in his lifetime, scientists said. The girl may have been about 14 years old when she died. Her remains were found in a Roman cemetery at Lant Street in Southwark. Researchers said the girl suffered from rickets, a childhood disease caused by deficiency in vitamin D. The third skeleton was that of a woman, and she may have died shortly after the Romans came to London. She was buried with Roman pottery, and she may have been a native Briton who adopted the Roman lifestyle. Researchers typically drew up the life of the ancient individual by taking note of the belongings with which they were buried in, but the fourth skeleton had none. This man may have been 45 years old when he died, had very dark brown eyes and hair. His DNA linked him to North Africa and he may have grown up in London, experts said. Meanwhile, more skeletal remains in the Museum of London are awaiting further study. Among this list is a group of Napoleonic soldiers and marines, as well as more Roman Londoners. In the meantime, the skeletal remains of the four individuals will be on display at the museum starting Nov. 27 this year.


News Article | November 7, 2016
Site: www.biosciencetechnology.com

McMaster University researchers have found that for patients diagnosed in the late stages of one of the most common and deadly forms of skin cancer, treatment with a combination of immunotherapy options improves survival and lowers the risk of life-threatening events. "This is the first analysis to draw comparison between targeted and immune therapies for BRAF-mutated melanomas," said Feng Xie, an associate professor in the Department of Clinical Epidemiology and Biostatistics at McMaster's Michael G. DeGroote School of Medicine. "Our results will help patients and clinicians choose treatments." Feng Xie is a principal investigator of the study, recently published in JAMA Oncology. Cutaneous melanoma is an aggressive and deadly form of skin cancer. According to the Canadian Cancer Society, the disease accounts for 3.3 percent of new cancer cases each year in Canada, and it has a 15 percent death rate. In its early stages, melanoma is often cured with surgery alone, however most patients who are diagnosed in the late stages of disease are not candidates for surgery and drug therapy is the main course of treatment. Tahira Devji, the first author of the paper and a Ph.D. student of McMaster's Health Research Methodology Program, said that around 40 to 60 per cent of melanomas have a mutation in the BRAF protein. A number of effective treatment options are available for patients with advanced BRAF-mutated melanoma, which fall under two classes of drug therapies: targeted therapy, like chemotherapy, which stops cancer from growing and spreading; and immunotherapy, which works by stimulating the immune system to attack tumour cells. It has been unclear which is the optimal initial treatment. The goal of the study was to estimate the relative efficacy and safety of systemic therapies for those who have been diagnosed with advanced BRAF-mutated melanoma but not yet received any treatment. The team evaluated 15 randomized controlled trials published between 2011 and 2015, assessing the benefits and harms of targeted or immune checkpoint inhibitors in 6,662 patients with cancer that had spread to the lymph nodes and surgery was not an option, or distant metastatic melanoma. They found that combined BRAF and MEK targeted therapy and PD-1 immunotherapy were both equally effective in improving overall survival. Combined BRAF and MEK inhibition was most effective in improving progression-free survival. PD-1 inhibition was associated with the lowest risk of life-threatening events. They concluded that the safety of PD-1 inhibitors supports using this treatment option as first-line therapy in circumstances where quick action is not a priority. "While the data in our study represents best available evidence, using more than one kind of immunotherapy shows promise in early outcomes in clinical trials and could change the treatment landscape once longer-term results are published," said Feng Xie.


News Article | December 8, 2016
Site: www.eurekalert.org

New genetic research from an international team including McMaster University, University of Helsinki, Vilnius University and the University of Sydney, suggests that smallpox, a pathogen that caused millions of deaths worldwide, may not be an ancient disease but a much more modern killer that went on to become the first human disease eradicated by vaccination. The findings, published in the journal Current Biology, raise new questions about the role smallpox may have played in human history and fuels a longstanding debate over when the virus that causes smallpox, variola, first emerged and later evolved in response to inoculation and vaccination. "Scientists don't yet fully comprehend where smallpox came from and when it jumped into humans," says evolutionary geneticist Hendrik Poinar, senior author of the study, director of the McMaster Ancient DNA Centre and a researcher with Michael G. DeGroote Institute of Infectious Disease Research. "This research raises some interesting possibilities about our perception and age of the disease." Smallpox, one of the most devastating viral diseases ever to strike humankind, had long been thought to have appeared in human populations thousands of years ago in ancient Egypt, India and China, with some historical accounts suggesting that the pharaoh Ramses V -who died in 1145 BC--suffered from smallpox. In an attempt to better understand its evolutionary history, and after obtaining clearance from the WHO in Geneva, scientists extracted the heavily fragmented DNA, from the partial mummified remains of a Lithuanian child believed to have died between 1643 and 1665, a period in which several smallpox outbreaks were documented throughout Europe with increasing levels of mortality. The smallpox DNA was captured, sequenced and the ancient genome, one of the oldest viral genomes to date, was completely reconstructed. There was no indication of live virus in the sample and so the mummies are not infectious. Researchers compared and contrasted the 17th Century strain to those from a modern databank of samples dating from 1940 up to its eradication in 1977. Strikingly, the work shows that the evolution of smallpox virus occurred far more recently than previously thought, with all the available strains of the virus having an ancestor no older than 1580. "This study sets the clock of smallpox evolution to a much more recent time-scale" said evolutionary biologist Eddie Holmes, a professor at the University of Sydney, Australia. "Although it is still unclear what animal is the true reservoir of smallpox virus and when the virus first jumped into humans." The pox viral strains that represent the true reservoir for human smallpox remains currently unsampled. Both the closest gerbil (Tetarapox) and camel pox are very distantly related and consequently are not the likely ancestors to smallpox, suggesting that the real reservoir remains at large or has gone extinct. Researchers also discovered that smallpox virus evolved into two circulating strains, variola major and minor, after English physician Edward Jenner famously developed a vaccine in 1796. One form of VARV (Variola virus), known as V. major was highly virulent and deadly, the other V, minor much more benign. However, scientists say, the two forms experienced a 'major population bottleneck' with the rise of global immunization efforts. The date of the ancestor of the minor strain corresponds well with the Atlantic Slave trade which was likely responsible for partial worldwide dissemination. "This raises important questions about how a pathogen diversifies in the face of vaccination. While smallpox was eradicated in human populations, we can't become lazy or apathetic about its evolution - and possible reemergence--until we fully understand its origins," says Ana Duggan, a post doctoral fellow in the McMaster Ancient DNA Centre. Whether the date of the ancestor, approximately 1580, precludes the massive destruction of aboriginal populations in central America by smallpox, introduced by the Spanish, remains questionable. To that end, researchers must carefully examine the remains of individuals buried in epidemic burials in central and southern America, say scientists. "This work blurs the line between ancient diseases and emerging infections. Much of smallpox evolution apparently happened in historic time," says Margaret Humphreys, historian of medicine at Duke University. Attention editors: Additional quotes from collaborators are available here: "I am excited to see that these remains from the Holy Spirit crypt, once scheduled to be buried, are now revealing so much about the health conditions of past Vilnius inhabitans. This research is yielding extraordinary information and we should especially be grateful to those unnamed people that still tell us stories after centuries." - Dario Piombino-Mascali - Vilnius University "Indeed, behind our rear window is another world; the time machine through which we call Archaeovirology," say post doctoral fellow Maria Perdomo and professors Klaus Hedman and Antti Sajantila at University of Helsinki. McMaster provides a high definition broadcast studio that can connect with any television broadcaster around the world. To book an interview please contact:


HAYWARD, Calif., Dec. 06, 2016 (GLOBE NEWSWIRE) -- Today the Anthera Pharmaceuticals Inc. (NASDAQ:ANTH) Board of Directors announced J. Craig Thompson has been promoted to Chief Executive Officer.  Mr. Thompson has also been appointed to serve as a member of the Board of Directors of the Company.  Paul Truex has stepped down from the CEO role and been appointed to the newly created role of Executive Chairman, where he will assume the responsibilities of the Chairman of the Board and continue to provide guidance to Anthera’s senior executive team.  Concurrent with the leadership transition, Dr. Christopher Henney has stepped down as Chairman of the Board after more than 10 years of service to the Company in this role but will remain a member of Anthera’s Board of Directors “The addition of Craig at the beginning of this year has allowed the Company to incorporate commercial readiness planning into our development efforts.  Over the past twelve months Craig has proven his ability to lead and to fully integrate his experiences into the operation of Anthera,” continued Mr. Truex.  “His appointment prepares us for the commercialization of Sollpura and continued development of blisibimod for IgA nephropathy.  I am confident Anthera will continue to thrive with the expansion of Craig’s leadership." “We have been extremely fortunate to have had access to the guidance and experiences of Dr. Henney over the past decade,” commented Paul Truex.  “Chris’s willingness to go the extra mile to advance the Company has been an inspiration to all of us.  We are grateful he will remain on our board to provide his insights and further mentor our team.” “I am extremely proud of what our team has accomplished and I look forward to executing on our strategy to commercialize Sollpura while further exploring opportunities for blisibimod,” commented Craig Thompson.  “This is an exciting time for Anthera with new data emerging on both Sollpura and blisibimod, which could transform the Company’s future.” Following the recent announcement of data from the Phase 2 Proof of Concept Study in IgA Nephropathy with blisibimod, Anthera plans to announce Phase 3 clinical trial results from the Sollpura SOLUTION program before the end of December. About J. Craig Thompson Craig joined Anthera with over 20 years of experience in the pharmaceutical and healthcare industries. He has a proven track record in product development, global brand management, product positioning, access and reimbursement, including the strategic marketing of a number of industry-leading drugs. Prior to Anthera, Mr. Thompson was the Chief Operating Officer for Tetraphase Pharmaceuticals (Nasdaq:TTPH) where he oversaw the development and implementation of the marketing, access & reimbursement and sales strategy as well as the business development and the commercial manufacturing for Tetraphase. Prior to Tetraphase, Mr. Thompson served as Chief Commercial Officer for Trius Therapeutics through the acquisition of Trius by Cubist Pharmaceuticals, Inc. in September 2013. He led the planning of the commercial strategy, was actively involved in negotiating a regional partnership with Bayer as well as in the acquisition of the Trius by Cubist. During his tenure, he participated in three rounds of financing which raised approximately $115 MM. Prior to Trius, Mr. Thompson served in various global and U.S. commercial roles at Pfizer Inc. from 2003 to December 2010 ultimately serving as Vice President of Marketing for Pfizer’s Specialty Care Business Unit, where he was directly responsible for the U.S. commercial strategy for a portfolio of products with more than $1.5 billion in annual U.S. sales. From 1992 to 2003, Mr. Thompson served in positions of increasing responsibility at Merck & Co., Inc., where most notably he worked on commercial planning and marketing activities for the company’s major cardiovascular brands. Mr. Thompson holds a Bachelor’s degree in Commerce from McMaster University and an M.B.A. from the University of Notre Dame. About Paul Truex Mr. Truex served as Director and Chief Executive Officer since the inception of Anthera in 2004. He was responsible for negotiating Anthera’s product licenses for both blisibimod, an anti-BAFF peptibody from Amgen, and recently, Sollpura™(liprotamase), a novel enzyme replacement product from Eli Lilly and Company. During his career, Mr. Truex has been involved with over $500 million in private, public and debt financings and over $1 billion in various strategic in-licensing, out-licensing and merger/acquisition transactions.  Mr. Truex is a member of the Indiana University West Coast Advisory Board for the Johnson Center of Entrepreneurship and Innovation, is a member of the Board of Directors of Milestone Pharmaceuticals Limited (Chairman), CymaBay Therapeutics (Nasdaq:CBAY), LQT Therapeutics and involved as an advisor to a number of early stage ventures in multiple industries. His past board appointments include Peninsula Pharmaceuticals (acquired by Johnson and Johnson), Trius Therapeutics (acquired by Cubist Pharmaceuticals), Eiger Biopharmaceuticals, and Protagonist Therapeutics. About Chris Henney Dr. Henney has served as the Chairman of our board of directors since August 2008 and has been a member of Anthera’s Board of Directors since April 2005. Dr. Henney served as Chairman and Chief Executive Officer of Dendreon Corporation, a biotechnology company he co-founded, from 1997 until his retirement in July 2004.  Dr. Henney was previously a founder of Immunex Corp. and ICOS Corp.  Dr. Henney is currently the Chairman and a director of Cascadian Therapeutics, Inc. (formerly Oncothyreon, Inc.), is vice-chairman and a director of Cyclacel Pharmaceuticals, Inc. (Nasdaq:CYCC), and is a director of Prothena Corporation (Nasdaq:PRTA).  Dr. Henney holds a B.Sc. with honors in medical biochemistry, a Ph.D. in experimental pathology and a D.Sc. for contributions to the field of immunology, all from the University of Birmingham, England. About Anthera Pharmaceuticals, Inc. Anthera Pharmaceuticals is a biopharmaceutical company focused on developing and commercializing products to treat serious and life-threatening diseases, including exocrine pancreatic insufficiency due to cystic fibrosis, IgA nephropathy, lupus, and lupus with glomerulonephritis. Additional information on the Company can be found at www.anthera.com. Safe Harbor Statement Any statements contained in this press release that refer to future events or other non-historical matters, including statements that are preceded by, followed by, or that include such words as "estimate," "intend," "anticipate," "believe," "plan," "goal," "expect," "project," or similar statements, are forward-looking statements made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. These forward-looking statements are based on Anthera's expectations as of the date of this press release and are subject to certain risks and uncertainties that could cause actual results to differ materially as set forth in Anthera's public filings with the SEC, including Anthera's Quarterly Report on Form 10-Q for the quarter ended September 30, 2016. Anthera disclaims any intent or obligation to update any forward-looking statements, whether because of new information, future events or otherwise, except as required by applicable law.


News Article | December 22, 2016
Site: www.marketwired.com

TORONTO, ONTARIO--(Marketwired - Dec. 22, 2016) - Lakeside Minerals Inc. (NEX:LAK.H) (the "Company" or "Lakeside") is pleased to announce that it has formed a special committee ("Special Committee") to evaluate potential business expansion into cannabis space in the United States. The special committee is being comprised of David Posner, Hamish Sutherland and Robert Schwartz. The Company is currently a Tier 2 Mining Issuer pursuant to the policies of the TSXV. Management and board has considered potential strategies to maximize shareholder value in the mineral exploration sector, including strategic alternatives relating to the Company's Launay project. At this time, the Company's primary asset and focus continues to be advancement of the mineral exploration projects in its portfolio, until the board of directors determines otherwise, subject to obtaining requisite approvals. The Special Committee's mandate is to evaluate different facets of the US cannabis industry, especially in the light of recent regulatory developments in several US states and Canada, with specific focus on plant propagation and growing as retail segments of the value chain. The Company will only consider US states which have enacted or are in the process of enacting cannabis regulations for either medical or adult recreational use and are in compliance with the requirements of the Cole Memo. The Special Committee is in the process of considering various business models and acquisition/partnership opportunities, but at this time there is no undisclosed material information in regards to the potential change of business strategy. Mr. David Posner currently serves as the Chairman of the board of directors of Nutritional High International Inc., a director of The Tinley Beverage Company Inc., Capricorn Business Acquisitions Inc. and a director of Aura Health Corp. (a private company involved in the development and acquisition of marijuana health clinics in the US). Between 2012 and 2014, Mr. Posner served as the Acquisitions Manager for Stonegate Properties Inc., where he managed real estate properties and brokered deals in Canada and Oklahoma. He was a Managing Director of Sales and Acquisitions for Maria Chiquita Development Company from 2005 to 2012. From 2004 to 2007 he was a partner in a private investment group investment group involved in the acquisition, re-zoning and re-positioning for sale of land holdings in Costa Rica and Panama. Mr. Posner holds a Bachelor of Arts degree from York University. Mr. Hamish Sutherland is a former Chief Operating Officer of Bedrocan Cannabis Corp. Prior to which he was the Chief Operating Officer of Kaypok Inc, a start-up company that developed a proprietary analytical algorithm that manages and analyses social and conventional media conversations and their relative impact, raising seed capital from MaRS Innovation. He was also the Managing Partner of The Marketing Partners, a Toronto based consultancy providing strategic operating and marketing advice to businesses entering the Canadian market. Mr. Sutherland was also the president of Hunter Porcupine Gold Limited, a junior mineral exploration company. Mr. Sutherland holds a Bachelor of Engineering degree from McMaster University and an MBA from York University. Robert Schwartz has been a serial entrepreneur for over 15 years. His expertise lies in manufacturing, global distribution, and corporate restructuring. For over 15 years, Mr. Schwartz has been a leader in the import/export industry. He has direct ties with aftermarket automotive manufacturers and SOEs in China, distributing quality product throughout Canada, United States and Mexico. His background includes jobs at one of the top five banks in Canada and also financing micro-cap companies in the venture capital space. Robert currently serves as a director at Aura Health Corp. Mr. Schwartz holds a Bachelor of Arts degree from York University in Economics. Lakeside Minerals Inc. is engaged in acquiring, exploring, and developing mineral properties. The Company's flagship Launay property is located in the heart of the Abitibi, 48 km northeast of Rouyn-Noranda. The Launay property straddles a significant extent of the Macamic deformation zone: a major deformation zone in the Abitibi subprovince located north of the Porcupine-Destor deformation zone. Lakeside is also pursuing potential acquisitions of interests in undervalued mineral exploration properties. Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. FORWARD-LOOKING STATEMENTS: Certain of the information contained in this news release may contain "forward-looking information". Forward-looking information and statements may include, among others, statements regarding the future plans, costs, objectives or performance of the Company or the assumptions underlying any of the foregoing. In this news release, words such as "may", "would", "could", "will", "likely", "believe", "expect", "anticipate", "intend", "plan", "estimate" and similar words and the negative form thereof are used to identify forward-looking statements. Forward-looking statements should not be read as guarantees of future performance or results, and will not necessarily be accurate indications of whether, or the times at or by which, such future performance will be achieved. Forward-looking statements and information are based on information available at the time and/or management's good-faith belief with respect to future events and are subject to known or unknown risks, uncertainties, assumptions and other unpredictable factors, many of which are beyond the Company's control. The Company does not intend, nor does the Company undertake any obligation, to update or revise any forward -looking information or statements contained in this news release to reflect subsequent information, events or circumstances or otherwise, except if required by applicable laws.


News Article | November 7, 2016
Site: www.marketwired.com

TORONTO, ONTARIO--(Marketwired - Nov. 7, 2016) - Morumbi Resources Inc. (TSX VENTURE:MOC) ("Morumbi" or the "Company") is pleased to announce the appointments of Mr. Clifford Hale-Sanders to the position of Executive Vice President effective November 1, 2016 and Mr. Rohan Hazelton to the position of Chief Financial Officer and Corporate Secretary, effective November 15, 2016. Mr. Hale-Sanders career has spanned approximately 20 years in the capital markets industry working as a leading Base Metals and Bulk Commodities equity research analyst in Canada. During his career, he worked at RBC Capital Markets, TD Securities, CIBC World Markets and Cormark Securities. During this period, Mr. Hale-Sanders visited and reviewed numerous mining operations and corporate entities around the world from both an operational and financial perspective. Mr. Hale-Sanders holds a B.Sc. in Geology and Chemistry from the University of Toronto, an MBA from McMaster University and is a CFA Charter holder. Mr. Hale-Sanders initially joined the Company in February 2016 as Business Development Advisor to support the search for substantial acquisition opportunities within the mining industry and now transitions into a full-time role. Commenting on the appointment, Chris Buncic, President and CEO, states, "Having been an integral part of the team that identified, evaluated and executed the acquisition of El Mochito, we are pleased that Cliff has joined us in a full-time capacity. In addition to supporting day to day management and optimization of El Mochito, Cliff will play a pivotal role in identifying additional growth opportunities as Morumbi looks to grow into a mid tier mining company in the future." Mr. Hazelton has over 20 years of international finance experience, including 15 years in the mining sector. Mr. Hazelton was formerly the Vice President, Strategy for Goldcorp Inc. Mr. Hazelton has held a variety of senior management positions at Goldcorp including Vice President of Finance, Chief Financial Officer of Goldcorp Mexico, and Corporate Controller. Mr. Hazelton was one of the earliest employees at Wheaton River Minerals Ltd. and was a key part of the management team that led the growth of Wheaton River and later Goldcorp. Mr. Hazelton holds a B.A in Applied Mathematics and Economics from Harvard University, and is a Chartered Professional Accountant. Commenting on the appointment, Chris Buncic CEO, states, "Rohan has broad experience in mining finance and operations and his fluency in Spanish will be an asset to our team. His experience in growing Wheaton River Minerals and later Goldcorp from a $20M market cap company to a peak of approximately $40B will add value as Morumbi looks to grow into a mid tier mining company in the future. We are pleased that both Cliff add Rohan have joined the Morumbi team on a full-time basis as we enter the next phase of our corporate development." The Company also announces that Mr. Eric Szustak will step down as CFO effective November 15, 2016 but will remain as an advisor to the Company to assist during the transition. The Company's Board of Directors and management team would like to take this opportunity to sincerely thank Mr. Szustak for his hard work and dedication as its Chief Financial Officer & Corporate Secretary. Morumbi is a public company historically focused on evaluating resource opportunities. The Company recently announced a transaction to acquire the El Mochito mine in Honduras from Nyrstar BV, and is working to close this acquisition targeting the end of the year. The Company has been evaluating producing and advanced development stage mineral resource opportunities principally in Latin America. It also has a legacy light oil property in northwest Alberta. The Company trades on the TSX Venture Exchange under the symbol "MOC". Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This press release includes certain "forward-looking information" within the meaning of applicable Canadian securities legislation. Forward-looking information is based on reasonable assumptions that have been made by Morumbi as at the date of such information and is subject to known and unknown risks, uncertainties and other factors that may cause the actual results, level of activity, performance or achievements of Morumbi to be materially different from those expressed or implied by such forward-looking information, including but not limited to: the impact of general business and economic conditions; that all conditions precedent to the Offering will be met; that any accretive acquisitions, as a result of current discussions pertaining to mineral resource assets in Latin America or otherwise, will be completed; problems inherent to the marketability of base and precious metals; industry conditions, including fluctuations in the price of base and precious metals, fluctuations in interest rates; government entities interpreting existing tax legislation or enacting new tax legislation in a way which adversely affects Morumbi; stock market volatility; competition; risk factors disclosed in Morumbi's most recent Management's Discussion and Analysis available electronically on SEDAR; and such other factors described or referred to elsewhere herein, including unanticipated and/or unusual events. Many such factors are beyond Morumbi's ability to control or predict. Although Morumbi has attempted to identify important factors that could cause actual outcomes to differ materially, there may be other factors that cause results not to be as anticipated, estimated or intended. There can be no assurance that forward-looking information will prove to be accurate as actual outcomes and future events could differ materially from those reliant on forward-looking information. All of the forward-looking information given in this press release is qualified by these cautionary statements and readers are cautioned not to put undue reliance on forward-looking information due to its inherent uncertainty. Morumbi disclaims any intent or obligation to update any forward-looking information, whether as a result of new information, future events or results or otherwise, except as required by law. This forward-looking information should not be relied upon as representing the Company's views as of any date subsequent to the date of this press release.


News Article | March 2, 2017
Site: www.prweb.com

ProMIS Neurosciences (“ProMIS” or the “Company”), a company focused on the discovery and development of precision treatments for neurodegenerative diseases, today announced the appointment of Anthony J. Giovinazzo, MBA, to its Board of Directors, effective immediately. “I first met Anthony over twenty years ago, working together on an Alzheimer’s diagnostics opportunity” stated Eugene Williams, ProMIS Executive Chairman. “He and I have been talking about a shared commitment to making a difference in Alzheimer’s for a long time. After the outstanding job that Anthony did at Cynapsus, for both Parkinson’s patients and shareholders, he has many alternatives. We are thrilled that he has chosen to apply his talents and energy to ProMIS”. Anthony Giovinazzo is currently President and CEO of Sunovion CNS Development Canada ULC. As President and CEO of Cynapsus Therapeutics from 2009 through 2016 he led the successful purchase of Cynapsus by Sunovion Pharmaceuticals, a member of the Dainipon Sumitomo Pharma group of Japan. At Cynapsus, Anthony led the successful development of APL 130277 (a sublingual strip of apomorphine) through to late stage Phase 3 studies and was responsible for Cynapsus up-listing from the TSX Venture exchange to the TSX and then the NASDAQ. “I am delighted to join the Board of Directors of ProMIS Neurosciences,” stated Mr. Giovinazzo. “Having devoted most of my career to the development and commercialization of therapies for neurodegenerative disease, I look forward to leveraging my experience to support the Company as it develops innovative, precision medicine therapeutics for Alzheimer’s disease and ALS”. About Anthony Giovinazzo, MBA. Anthony J. Giovinazzo has over thirty-eight years of professional experience. His first seven years were spent as an international corporate tax specialist primarily in multinational conglomerates. Over the subsequent eight years Anthony worked in Fortune 100 investment banking and private equity. For the last twenty-three years he worked exclusively on the discovery, development and commercialization of neurodegenerative disease therapeutics. His primary areas of focus have been Alzheimer’s, Parkinson’s and neuropathic pain. Since October 2016 he has been the President and CEO of Sunovion CNS Development Canada ULC., a successor company to Cynapsus Therapeutics Inc., which was purchased by Sunovion Pharmaceuticals Inc., a member of the Dainipon Sumitomo Pharma group of companies of Japan. He was President, CEO and a Director of Cynapsus Therapeutics Inc. from 2009 to 2016 and was one of the three original inventors and patent holders of the Cynapsus Parkinson’s focussed technology. Under his leadership the company successfully developed APL 130277 (a sublingual strip of apomorphine for OFF episodes) through to late stage Phase 3 studies. In addition, Anthony led the up-listing of Cynapsus from the TSX Venture exchange to the TSX and then the NASDAQ, attracting bulge bracket investment banks and some of the largest institutional life science investors in the USA. The sale of Cynapsus to Sunovion in 2016 resulted in a 120% premium to market price (CDN$841 million) via an all cash M&A transaction. Mr Giovinazzo is the co-author of several peer reviewed papers and author of several papers on strategic and financing issues in the biopharmaceutical industry. He was a finalist in the E&Y Entrepreneur of the Year (2014) for Ontario Canada. He is a Chartered Director and Audit Committee Certified, both from The Directors College, a degree granting affiliate of Mc Master University, Hamilton Canada. He also has completed the Leadership and Strategy in Pharmaceuticals and Biotech, in 2006 from Harvard Business School, Boston, MA; a Masters of Business Administration from IMD, Geneva Switzerland in 1986; Graduate Certificate Studies in Canadian Law Osgoode Hall Law School, York University, Toronto, in 1984; and his Bachelor of Arts in Economics and Accounting at McMaster University in 1978. The mission of ProMIS Neurosciences is to discover and develop precision medicine therapeutics for effective treatment of neurodegenerative diseases, in particular Alzheimer’s disease and ALS. ProMIS Neurosciences’ proprietary target discovery engine is based on the use of two, complementary techniques. The Company applies its thermodynamic, computational discovery platform—ProMIS™ and Collective Coordinates — to predict novel targets known as Disease Specific Epitopes (DSEs) on the molecular surface of misfolded proteins. Using this unique "precision medicine" approach, ProMIS Neurosciences is developing novel antibody therapeutics and specific companion diagnostics for Alzheimer’s disease and ALS. The company has also developed two proprietary technologies to specifically identify very low levels of misfolded proteins in a biological sample. In addition, ProMIS Neurosciences owns a portfolio of therapeutic and diagnostic patents relating to misfolded SOD1 in ALS, and currently has a preclinical monoclonal antibody therapeutic against this target. The TSX has not reviewed and does not accept responsibility for the adequacy or accuracy of this release. This information release may contain certain forward-looking information. Such information involves known and unknown risks, uncertainties and other factors that may cause actual results, performance or achievements to be materially different from those implied by statements herein, and therefore these statements should not be read as guarantees of future performance or results. All forward-looking statements are based on the Company's current beliefs as well as assumptions made by and information currently available to it as well as other factors. Readers are cautioned not to place undue reliance on these forward-looking statements, which speak only as of the date of this press release. Due to risks and uncertainties, including the risks and uncertainties identified by the Company in its public securities filings, actual events may differ materially from current expectations. The Company disclaims any intention or obligation to update or revise any forward-looking statements, whether as a result of new information, future events or otherwise. For further information please consult the Company's website at: http://www.promisneurosciences.com Like us on LinkedIn


News Article | December 2, 2016
Site: www.eurekalert.org

Investigators from Children's Hospital Los Angeles and 37 other Children's Oncology Group hospitals in the U.S. and Canada have determined that sodium thiosulfate prevents cisplatin-induced hearing loss in children and adolescents with cancer. Results of this randomized, controlled, phase 3 study, called ACCL0431, have been published in the early online edition of Lancet Oncology. "This federally-funded, cooperative group study is the first to show that cisplatin-induced hearing loss can be reduced by about half in children and adolescents being treated for cancer," said David R. Freyer, DO, MS, director of the Survivorship & Supportive Care Program in the Children's Center for Cancer and Blood Diseases at Children's Hospital Los Angeles, who was lead author and chair of the study. "It is an important step toward developing a safe and effective strategy that will greatly improve quality of life for cancer survivors." Freyer is also professor of Clinical Pediatrics and Medicine at the Keck School of Medicine of USC. Cisplatin is a chemotherapy medication widely used to treat a variety of cancers in both adults and children. Although effective, cisplatin frequently causes permanent hearing loss and tinnitus (ringing in the ears), resulting in functional disability for patients who receive it. For young children in particular, hearing loss is especially serious because it results in impaired language development, learning and social interactions. Preventing ototoxicity, while preserving chemotherapeutic efficacy, has been a long-standing goal of physicians, scientists, parents and survivors. Historically, there have been no proven treatments for preventing cisplatin-induced hearing loss tested under the rigorous conditions of ACCL0431. Without otoprotection, the only way to prevent hearing loss is to delete or decrease cisplatin doses, which could render the cancer treatment less effective. In ACCL0431, 125 eligible participants between the ages of 1 to 18 years with newly-diagnosed cancer were enrolled over a 4 year period. The cancer diagnoses were hepatoblastoma, germ cell tumor, medulloblastoma, neuroblastoma, osteosarcoma, or other cancer types treated with cisplatin. Study participants were randomized to receive sodium thiosulfate or observation (control) during their chemotherapy. Their hearing was assessed at baseline, following completion of the chemotherapy regimen and 1 year later. The investigators reported a significant reduction in the incidence of hearing loss in participants who were treated with cisplatin and sodium thiosulfate (29%) compared to those who received cisplatin alone (56%). The greatest benefit was seen in children younger than 5 years of age, who are most susceptible to, and also most affected by, cisplatin-induced hearing loss. Other effects of sodium thiosulfate were carefully monitored in the study. Overall, sodium thiosulfate was tolerated well without any serious adverse events. Survival from the cancer was not affected by sodium thiosulfate among participants who had localized tumors. However, survival appeared to be lower among those with metastatic disease who received sodium thiosulfate. Additional research is needed to determine what role sodium thiosulfate should have in preventing hearing loss in specific subsets of patients being treated with cisplatin. Additional contributors to the study include Lu Chen, Mark D. Krailo, Doojduen Villaluna and Bonnie Bliss of the Keck School of Medicine of USC; Kristin Knight, Edward A. Neuwelt of Oregon Health and Science University; Brad H. Pollock of University of California Davis; Jagadeesh Ramdas of Geisinger Medical Center, Danville, PA; Beverly Lange of Children's Hospital of Philadelphia; David Van Hoff and Michele L. Van Soelen of Helen DeVos Children's Hospital, Grand Rapids, MI; John Wiernikowski of McMaster University, Hamilton, ON, Canada; and Lillian Sung of the Hospital for Sick Children, Toronto, ON, Canada. This research was supported by the Children's Oncology Group and the National Cancer Institute of the National Institutes of Health (UG1-CA189955 and U10-CA095861). Children's Hospital Los Angeles has been named the best children's hospital in California and among the top 10 in the nation for clinical excellence with its selection to the prestigious U.S. News & World Report Honor Roll. Children's Hospital is home to The Saban Research Institute, one of the largest and most productive pediatric research facilities in the United States. Children's Hospital is also one of America's premier teaching hospitals through its affiliation since 1932 with the Keck School of Medicine of the University of Southern California. For more information, visit CHLA.org. Follow us on Twitter, Facebook, YouTube and LinkedIn, or visit our blog at http://researchlablog. .


LOS ANGELES--(BUSINESS WIRE)--Investigators from Children’s Hospital Los Angeles and 37 other Children’s Oncology Group hospitals in the U.S. and Canada have determined that sodium thiosulfate prevents cisplatin-induced hearing loss in children and adolescents with cancer. Results of this randomized, controlled, phase 3 study, called ACCL0431, have been published in the early online edition of Lancet Oncology. “This federally-funded, cooperative group study is the first to show that cisplatin-induced hearing loss can be reduced by about half in children and adolescents being treated for cancer,” said David R. Freyer, DO, MS, director of the Survivorship & Supportive Care Program in the Children’s Center for Cancer and Blood Diseases at Children’s Hospital Los Angeles, who was lead author and chair of the study. “It is an important step toward developing a safe and effective strategy that will greatly improve quality of life for cancer survivors.” Freyer is also professor of Clinical Pediatrics and Medicine at the Keck School of Medicine of USC. Cisplatin is a chemotherapy medication widely used to treat a variety of cancers in both adults and children. Although effective, cisplatin frequently causes permanent hearing loss and tinnitus (ringing in the ears), resulting in functional disability for patients who receive it. For young children in particular, hearing loss is especially serious because it results in impaired language development, learning and social interactions. Preventing ototoxicity, while preserving chemotherapeutic efficacy, has been a long-standing goal of physicians, scientists, parents and survivors. Historically, there have been no proven treatments for preventing cisplatin-induced hearing loss tested under the rigorous conditions of ACCL0431. Without otoprotection, the only way to prevent hearing loss is to delete or decrease cisplatin doses, which could render the cancer treatment less effective. In ACCL0431, 125 eligible participants between the ages of 1 to 18 years with newly-diagnosed cancer were enrolled over a 4 year period. The cancer diagnoses were hepatoblastoma, germ cell tumor, medulloblastoma, neuroblastoma, osteosarcoma, or other cancer types treated with cisplatin. Study participants were randomized to receive sodium thiosulfate or observation (control) during their chemotherapy. Their hearing was assessed at baseline, following completion of the chemotherapy regimen and 1 year later. The investigators reported a significant reduction in the incidence of hearing loss in participants who were treated with cisplatin and sodium thiosulfate (29%) compared to those who received cisplatin alone (56%). The greatest benefit was seen in children younger than 5 years of age, who are most susceptible to, and also most affected by, cisplatin-induced hearing loss. Other effects of sodium thiosulfate were carefully monitored in the study. Overall, sodium thiosulfate was tolerated well without any serious adverse events. Survival from the cancer was not affected by sodium thiosulfate among participants who had localized tumors. However, survival appeared to be lower among those with metastatic disease who received sodium thiosulfate. Additional research is needed to determine what role sodium thiosulfate should have in preventing hearing loss in specific subsets of patients being treated with cisplatin. Additional contributors to the study include Lu Chen, Mark D. Krailo, Doojduen Villaluna and Bonnie Bliss of the Keck School of Medicine of USC; Kristin Knight, Edward A. Neuwelt of Oregon Health and Science University; Brad H. Pollock of University of California Davis; Jagadeesh Ramdas of Geisinger Medical Center, Danville, PA; Beverly Lange of Children’s Hospital of Philadelphia; David Van Hoff and Michele L. Van Soelen of Helen DeVos Children’s Hospital, Grand Rapids, MI; John Wiernikowski of McMaster University, Hamilton, ON, Canada; and Lillian Sung of the Hospital for Sick Children, Toronto, ON, Canada. This research was supported by the Children’s Oncology Group and the National Cancer Institute of the National Institutes of Health (UG1-CA189955 and U10-CA095861). Children’s Hospital Los Angeles has been named the best children’s hospital in California and among the top 10 in the nation for clinical excellence with its selection to the prestigious U.S. News & World Report Honor Roll. Children’s Hospital is home to The Saban Research Institute, one of the largest and most productive pediatric research facilities in the United States. Children’s Hospital is also one of America's premier teaching hospitals through its affiliation since 1932 with the Keck School of Medicine of the University of Southern California. For more information, visit CHLA.org. Follow us on Twitter, Facebook, YouTube and LinkedIn, or visit our blog at http://researchlablog.org/.


News Article | February 15, 2017
Site: www.eurekalert.org

Vitamin D supplements protect against acute respiratory infections including colds and flu, according to a study led by Queen Mary University of London (QMUL) Vitamin D supplements protect against acute respiratory infections including colds and flu, according to a study led by Queen Mary University of London (QMUL). The study provides the most robust evidence yet that vitamin D has benefits beyond bone and muscle health, and could have major implications for public health policy, including the fortification of foods with vitamin D to tackle high levels of deficiency in the UK. The results, published in the BMJ, are based on a new analysis of raw data from around 11,000 participants in 25 clinical trials conducted in 14 countries including the UK, USA, Japan, India, Afghanistan, Belgium, Italy, Australia and Canada. Individually, these trials yielded conflicting results, with some reporting that vitamin D protected against respiratory infections, and others showing no effect. Lead researcher Professor Adrian Martineau from QMUL said: "This major collaborative research effort has yielded the first definitive evidence that vitamin D really does protect against respiratory infections. Our analysis of pooled raw data from each of the 10,933 trial participants allowed us to address the thorny question of why vitamin D 'worked' in some trials, but not in others. "The bottom line is that the protective effects of vitamin D supplementation are strongest in those who have the lowest vitamin D levels, and when supplementation is given daily or weekly rather than in more widely spaced doses. "Vitamin D fortification of foods provides a steady, low-level intake of vitamin D that has virtually eliminated profound vitamin D deficiency in several countries. By demonstrating this new benefit of vitamin D, our study strengthens the case for introducing food fortification to improve vitamin D levels in countries such as the UK where profound vitamin D deficiency is common." Vitamin D - the 'sunshine vitamin' - is thought to protect against respiratory infections by boosting levels of antimicrobial peptides - natural antibiotic-like substances - in the lungs. Results of the study fit with the observation that colds and 'flu are commonest in winter and spring, when levels of vitamin D are at their lowest. They may also explain why vitamin D protects against asthma attacks, which are commonly triggered by respiratory viruses. Daily or weekly supplementation halved the risk of acute respiratory infection in people with the lowest baseline vitamin D levels, below 25 nanomoles per litre (nmol/L). However, people with higher baseline vitamin D levels also benefited, although the effect was more modest (10 per cent risk reduction). Overall, the reduction in risk of acute respiratory infection induced by vitamin D was on a par with the protective effect of injectable 'flu vaccine against 'flu-like illnesses. Acute respiratory infections are a major cause of global morbidity and mortality. Upper respiratory infections such as colds and 'flu are the commonest reason for GP consultations and days off work. Acute lower respiratory infections such as pneumonia are less common, but caused an estimated 2.65 million deaths worldwide in 2013. Vitamin D supplementation is safe and inexpensive, so reductions in acute respiratory infections brought about by vitamin D supplementation could be highly cost-effective. The study was conducted by a consortium of 25 investigators from 21 institutions worldwide* and funded by the National Institute for Health Research. Joel Winston, Public Relations Manager (School of Medicine and Dentistry) Queen Mary University of London j.winston@qmul.ac.uk Tel: +44 (0)20 7882 7943 / +44 (0)7970 096 188 * Institutions involved in the research: Edmond and Lily Safra Children's Hospital (Tel Hashomer, Israel), Geisel School of Medicine at Dartmouth (NH, USA), Harvard School of Public Health (Boston, MA, USA), Jikei University School of Medicine (Tokyo, Japan), Karolinska Institutet (Stockholm, Sweden), Massachusetts General Hospital (Boston, MA, USA), McMaster University (Hamilton, Ontario, Canada), Medical University of Lodz (Poland), QIMR Berghofer Medical Research Institute (Queensland, Australia), Queen Mary University of London (UK), The Pennsylvania State University (Hershey, PA, USA), Università degli Studi di Milano (Milan, Italy), Universitair ziekenhuis Leuven (Belgium), University of Auckland (New Zealand), University of Birmingham (UK), University of Colorado School of Medicine (Aurora, CO, USA), University of Delhi (India), University of Otago (Christchurch, New Zealand), University of Tampere (Finland), University of Tasmania (Australia), Winthrop University Hospital (Mineola, NY, USA). Research paper: 'Vitamin D supplementation to prevent acute respiratory infections: systematic review and meta-analysis of individual participant data'. Martineau et al. BMJ 2017 Queen Mary University of London (QMUL) is one of the UK's leading universities, and one of the largest institutions in the University of London, with 23,120 students from more than 155 countries. A member of the Russell Group, we work across the humanities and social sciences, medicine and dentistry, and science and engineering, with inspirational teaching directly informed by our research. In the most recent national assessment of the quality of research, we were placed ninth in the UK (REF 2014). As well as our main site at Mile End - which is home to one of the largest self-contained residential campuses in London - we have campuses at Whitechapel, Charterhouse Square, and West Smithfield dedicated to the study of medicine, and a base for legal studies at Lincoln's Inn Fields. We have a rich history in London with roots in Europe's first public hospital, St Barts; England's first medical school, The London; one of the first colleges to provide higher education to women, Westfield College; and the Victorian philanthropic project, the People's Palace at Mile End. Today, as well as retaining these close connections to our local community, we are known for our international collaborations in both teaching and research. QMUL has an annual turnover of £350m, a research income worth £125m (2014/15), and generates employment and output worth £700m to the UK economy each year. The National Institute for Health Research (NIHR) is funded by the Department of Health to improve the health and wealth of the nation through research. The NIHR is the research arm of the NHS. Since its establishment in April 2006, the NIHR has transformed research in the NHS. It has increased the volume of applied health research for the benefit of patients and the public, driven faster translation of basic science discoveries into tangible benefits for patients and the economy, and developed and supported the people who conduct and contribute to applied health research. The NIHR plays a key role in the Government's strategy for economic growth, attracting investment by the life-sciences industries through its world-class infrastructure for health research. Together, the NIHR people, programmes, centres of excellence and systems represent the most integrated health research system in the world. For further information, visit the NIHR website (http://www. ).


News Article | December 13, 2016
Site: www.eurekalert.org

HAMILTON, Ont. (Dec. 13, 2016) -- Dr. Ali Emadi of McMaster University's Faculty of Engineering has been named a Fellow of the National Academy of Inventors (NAI). Election to NAI Fellow status is a high professional distinction awarded to academic inventors who have demonstrated a prolific spirit of innovation in creating or facilitating outstanding inventions that have made a tangible impact on quality of life, economic development, and the welfare of society. Emadi is the Canada Excellence Research Chair in Hybrid Powertrain and professor of electrical and computer engineering and mechanical engineering at McMaster University. He is internationally recognized for his expertise in transportation electrification and smart mobility. Emadi holds 40 U.S. patents and patents pending and successfully transferred technology from research to industry. His corporate-sponsored projects have received various recognitions including the 2014 Chrysler Innovation Award. He is also the founder of several university spin-off companies including Hybrid Electric Vehicle Technologies, Inc. and Enedym, Inc. "This prestigious recognition means a lot to me because it values not only inventions and technology transfer from academia to industry, but also mentoring students and translating inventions to benefit society," Emadi said. "I am humbled to receive this great honor and am thankful to my former and current research staff, graduate and undergraduate students, post-doctoral research associates, and visiting scholars, who have made our research group a world-class team focused on developing technologies for the next generation of smart energy systems and electrified and autonomous vehicles." With the election of the 2016 class there are now 757 NAI Fellows, representing 229 research universities and governmental and non-profit research institutes. Included among all NAI Fellows are more than 94 presidents and senior leaders of research universities and non-profit research institutes; 376 members of the three branches of the National Academy of Sciences; 28 inductees of the National Inventors Hall of Fame; 28 Nobel Laureates, among other awards and distinctions. The 2016 Fellows will be inducted on April 6, 2017, as part of the Sixth Annual Conference of the National Academy of Inventors at the John F. Kennedy Presidential Library & Museum in Boston, MA. The academic inventors and innovators elected to the rank of NAI Fellow are named inventors on U.S. patents and were nominated by their peers for outstanding contributions to innovation in areas such as patents and licensing, innovative discovery and technology, significant impact on society, and support and enhancement of innovation. McMaster University, one of four Canadian universities listed among the Top 100 universities in the world, is renowned for its innovation in both learning and discovery. It has a student population of 23,000, and more than 175,000 alumni in 140 countries. The National Academy of Inventors is a 501(c)(3) non-profit member organization comprising U.S. and international universities, and governmental and non-profit research institutes, with over 3,000 individual inventor members and Fellows spanning more than 240 institutions, and growing rapidly. It was founded in 2010 to recognize and encourage inventors with patents issued from the U.S. Patent and Trademark Office, enhance the visibility of academic technology and innovation, encourage the disclosure of intellectual property, educate and mentor innovative students, and translate the inventions of its members to benefit society.


MARKHAM, ONTARIO--(Marketwired - Oct. 31, 2016) - VIQ Solutions Inc. ("VIQ" or "VIQ Solutions") (TSX VENTURE:VQS), a global expert providing a cybersecurity protected technology and service platform for digital evidence capture and content management, is excited to announce that VIQ has partnered with the Department of Surgery of the Michael G. DeGroote School of Medicine at McMaster University ("McMaster") for an AV capture, management and collaborative web portal workflow geared towards improving how new surgeons are trained. The innovative AV training and assessment workflow follows the patent pending process outlined in VIQ's press release of September 26, 2016. "A prestigious customer like McMaster University using our new patent pending AV assessment workflow, including mobility, data analytics and our collaborative web portal, is a tremendous win for VIQ," said Sebastien Paré, President and CEO of VIQ Solutions. "Our innovative, collaborative technology sets VIQ apart for medical, insurance and law enforcement customers who demand innovative technology solutions without sacrificing the security and privacy of their digital content." McMaster University is ranked among the top research universities in Canada, and among the top 100 in the world. With a long-standing reputation as Canada's "most innovative" university, McMaster has pioneered a number of programs that have changed how professors teach and students learn. McMaster University's Michael G. DeGroote School of Medicine trains many of today's surgeons in multiple disciplines. As an innovator McMaster faculty are again leading the way with surgical training techniques and methodologies within Canada. To facilitate this innovative collaboration, McMaster chose VIQ for a pilot which provides programs with an innovative digital solution that has the ability to securely capture, manage and share critical content with the highest encryption security and confidentiality possible. Multiple channels of live, high-definition educational video can be captured and automatically synchronized to a secure central repository in real time. Using the VIQ solution, both learners and educators have the ability to tag key events during procedures and add additional notes related to specific occurrences. These timestamped events can later be easily located and analyzed for identifying key learning competencies, providing a new degree of training feedback that is integrated with program requirements. This smartphone centric solution provides students the ability to review their performance and complete a customized questionnaire related to specific areas of competency while still maintaining confidentiality and security. The questionnaire is automatically exchanged depending on the procedures being assessed, and is securely moved to the collaboration portal along with audio/video performance evidence. The captured AV content can be edited or clipped to specific areas of interest and routed to a secure content portal for training and education of authorized personnel, including McMaster medical students or for expert consultation. The VIQ content portal has been customized for McMaster and allows authorized personnel to log in and review surgical AV content using their standard web browser while maintaining the security and privacy of all medical data. "The sophisticated VIQ workflow gives McMaster University Faculty of Health Sciences staff a technological advantage in our quest for producing the best surgeons and promoting surgical competency. It is reassuring to know content will be captured and routed automatically using a private, completely confidential and secure platform," said Dr. Brad Petrisor, Associate Professor and Director of the Training Program in Orthopaedic Surgery at McMaster. "McMaster University has always been a leader in innovation in curriculum and evidence-based medicine. We're pleased to work with VIQ and their partners to implement these advanced solutions for our surgical programs which will allow us to continue to develop highly innovative and exceptional evidence-based surgical training programs," added Dr. Ranil Sonnadara, Director of the Department of Surgery's Office of Education Science, and Executive Director of Research and High Performance Computing at McMaster. For more information on what is making the news at VIQ Solutions, please visit our website at http://www.viqsolutions.com/news.html. McMaster University, based in Hamilton, Canada, is one of the leading academic research facilities in the country. The Center has consistently been ranked in the Top 100 universities in the world. Founded in 1887, it is renowned for its medical-doctoral, research-intensive programs dedicated to teaching, research and service. The university has a total student population of more than 26,000 from 79 countries. The Michael G. DeGroote School of Medicine is a flagship program with an international reputation for its unique three-year program based on small group, problem-based study and early introduction to the clinical experience. The program has approximately 5,000 applicants a year, more than any other Canadian medical school. The Center's mission is the discovery, communication and preservation of knowledge, committed to creativity, innovation and excellence. For more information, please visit our website at www.mcmaster.ca. VIQ Solutions is the leading technology and service platform provider for digital evidence capture and content management. Our secure modular software allows customers to onboard the VIQ platform at any stage of their organization's digitization, from the capture of digital content from video and audio devices through to online collaboration, mobility, data analytics and integration with sensors, facial recognition, speech recognition and case management or patient record systems. VIQ's technology leads the industry in security, meeting the highest international standards for digital/cyber security and privacy, including military and medical regulations. Our solutions are in use in over 20 countries with tens of thousands of users in over 200 government and private agencies including law enforcement, immigration, medical, legal, insurance, courts, and transportation and transcription services. VIQ also provides end to end transcription services to several large government agencies through our Australia-based reporting and transcription partners. VIQ operates worldwide with partners like security integrators, audio-video specialists, and hardware and data storage suppliers. Managing digital media evidence is what we do, and we do it better than anyone else. For more information about VIQ Solutions, please visit www.viqsolutions.com. Neither the TSX Venture Exchange nor its Regulation Service Provider (as that term is defined in the policies of the Exchange) accepts responsibility for the adequacy or accuracy of this release.


Nidorf S.M.,Heart Care Western Australia | Eikelboom J.W.,McMaster University | Budgeon C.A.,University of Western Australia | Thompson P.L.,Western Research Institute
Journal of the American College of Cardiology | Year: 2013

Objectives: The objective of this study was to determine whether colchicine 0.5 mg/day can reduce the risk of cardiovascular events in patients with clinically stable coronary disease. Background: The presence of activated neutrophils in culprit atherosclerotic plaques of patients with unstable coronary disease raises the possibility that inhibition of neutrophil function with colchicine may reduce the risk of plaque instability and thereby improve clinical outcomes in patients with stable coronary disease. Methods: In a clinical trial with a prospective, randomized, observer-blinded endpoint design, 532 patients with stable coronary disease receiving aspirin and/or clopidogrel (93%) and statins (95%) were randomly assigned colchicine 0.5 mg/day or no colchicine and followed for a median of 3 years. The primary outcome was the composite incidence of acute coronary syndrome, out-of-hospital cardiac arrest, or noncardioembolic ischemic stroke. The primary analysis was by intention-to-treat. Results: The primary outcome occurred in 15 of 282 patients (5.3%) who received colchicine and 40 of 250 patients (16.0%) assigned no colchicine (hazard ratio: 0.33; 95% confidence interval [CI] 0.18 to 0.59; p < 0.001; number needed to treat: 11). In a pre-specified secondary on-treatment analysis that excluded 32 patients (11%) assigned to colchicine who withdrew within 30 days due to intestinal intolerance and a further 7 patients (2%) who did not start treatment, the primary outcome occurred in 4.5% versus 16.0% (hazard ratio: 0.29; 95% CI: 0.15 to 0.56; p < 0.001). Conclusions: Colchicine 0.5 mg/day administered in addition to statins and other standard secondary prevention therapies appeared effective for the prevention of cardiovascular events in patients with stable coronary disease. © 2013 American College of Cardiology Foundation.


Weitz J.I.,McMaster University | Pollack C.V.,University of Pennsylvania
Thrombosis and Haemostasis | Year: 2015

Non-vitamin K antagonist oral anticoagulants (NOACs) are increasingly used in the prevention and treatment of venous thromboembolism and in the prevention of stroke in patients with non-valvular atrial fibrillation. In phase III clinical trials and meta-analyses, the NOACs were at least as effective as vitamin K antagonists (VKAs) and were associated with a similar or lower incidence of major bleeding, including consistent and significant decreases in intracranial bleeding, although with an increase in gastrointestinal bleeding for some agents compared with VKAs. Subsequent real-world evidence supports these outcomes. Despite this, physicians have concerns about serious bleeding or emergencies because there are no specific reversal agents for the NOACs. However, in clinical trials, patients receiving NOACs generally had similar or better outcomes after these events than those taking VKAs. As with any bleeding, anticoagulant-related bleeding should first be stratified according to severity and location; risk can be minimised by ongoing assessment. Management protocols for NOAC-related bleeding are similar to those for VKAs but should take into account the pharmacological profile of the specific drug. Because of their short half-lives, NOAC-related mild bleeding can often be controlled by temporarily withholding treatment. More severe bleeding requires standard escalating haemodynamic support measures, and non-specific reversal agents can be considered in lifethreatening situations, based on limited clinical data. Specific and rapid reversal agents are not currently available for any oral anti - coagulant and restoration of coagulation may not necessarily lead to better outcomes. Nevertheless, specific NOAC reversal agents are in development and show promise in healthy volunteers. © Schattauer 2015.


Heller R.,McMaster University | Albrecht S.,University of Aarhus
Astrophysical Journal Letters | Year: 2014

We present two methods to determine an exomoon's sense of orbital motion (SOM), one with respect to the planet's circumstellar orbit and one with respect to the planetary rotation. Our simulations show that the required measurements will be possible with the European Extremely Large Telescope (E-ELT). The first method relies on mutual planet-moon events during stellar transits. Eclipses with the moon passing behind (in front of) the planet will be late (early) with regard to the moon's mean orbital period due to the finite speed of light. This "transit timing dichotomy" (TTD) determines an exomoon's SOM with respect to the circumstellar motion. For the 10 largest moons in the solar system, TTDs range between 2 and 12 s. The E-ELT will enable such measurements for Earth-sized moons around nearby Sun-like stars. The second method measures distortions in the IR spectrum of the rotating giant planet when it is transited by its moon. This Rossiter-McLaughlin effect (RME) in the planetary spectrum reveals the angle between the planetary equator and the moon's circumplanetary orbital plane, and therefore unveils the moon's SOM with respect to the planet's rotation. A reasonably large moon transiting a directly imaged planet like β Pic b causes an RME amplitude of almost 100 m s-1, about twice the stellar RME amplitude of the transiting exoplanet HD209458 b. Both new methods can be used to probe the origin of exomoons, that is, whether they are regular or irregular in nature. © 2014. The American Astronomical Society. All rights reserved.


Siegal D.M.,McMaster University | Cuker A.,University of Pennsylvania
Drug Discovery Today | Year: 2014

Target-specific oral anticoagulants (TSOACs) provide safe and effective anticoagulation for the prevention and treatment of thrombosis in a variety of clinical settings by interfering with the activity of thrombin (dabigatran) or factor Xa (rivaroxaban, apixaban, edoxaban, betrixaban). Although TSOACs have practical advantages over vitamin K antagonists (VKAs), there are currently no antidotes to reverse their anticoagulant effect. Herein we summarize the available evidence for TSOAC reversal using nonspecific and specific reversal agents. We discuss important limitations of existing evidence, which is derived from studies in human volunteers, animal models and in vitro experiments. Studies evaluating the safety and efficacy of reversal agents on clinical outcomes such as bleeding and mortality in patients with TSOAC-associated bleeding are needed. © 2014 Elsevier Ltd. All rights reserved.


Bauer C.M.T.,Hoffmann-La Roche | Morissette M.C.,McMaster University | Stampfli M.R.,McMaster University
Chest | Year: 2013

COPD is a complex syndrome that poses a serious health threat to > 1.1 billion smokers worldwide. The stable disease is punctuated by episodes of acute exacerbation, which are predominantly the result of viral and bacterial infections. Despite their devastating health impact, mechanisms underlying disease exacerbations remain poorly understood. Mounting evidence suggests that cigarette smoke profoundly affects the immune system, compromising the host's ability to mount appropriate immune and inflammatory responses against microbial agents. This review highlights recent advances in our understanding of the impact of cigarette smoke on type 1 interferon and IL-1 signaling cascades. The immune defects caused by cigarette smoke on these two key pathways contribute to the seemingly contradictory nature of cigarette smoke as both a damaging and a proinflammatory factor as well as an immunosuppressive factor. Understanding the impact of cigarette smoke on the immune system may unravel novel targets for therapies that could affect acute exacerbations and COPD pathogenesis. © 2013 American College of Chest Physicians.


Holmes Jr. D.R.,Mayo Medical School | Lakkireddy D.R.,University of Kansas | Whitlock R.P.,McMaster University | Waksman R.,MedStar Washington Hospital Center | Mack M.J.,Baylor Healthcare System
Journal of the American College of Cardiology | Year: 2014

Stroke prevention in patients with atrial fibrillation is a growing clinical dilemma as the incidence of the arrhythmia increases and risk profiles worsen. Strategies in patients with nonvalvular atrial fibrillation have included anticoagulation with a variety of drugs. Knowledge that stroke in this setting typically results from thrombus in the left atrial appendage has led to the development of mechanical approaches, both catheter-based and surgical, to occlude that structure. Such a device, if it were safe and effective, might avoid the need for anticoagulation and prevent stroke in the large number of patients who are currently not treated with anticoagulants. Regulatory approval has been difficult due to trial design challenges, balance of the risk-benefit ratio, specific patient populations studied, selection of treatment in the control group, and specific endpoints and statistical analyses selected. Accumulating data from randomized trials and registries with longer-term follow-up continues to support a role for left atrial appendage exclusion from the central circulation as an alternative to anticoagulation in carefully-selected patient populations. © 2014 by the American College of Cardiology Foundation.


Buller H.R.,University of Amsterdam | Bethune C.,Isis Pharmaceuticals | Bhanot S.,Isis Pharmaceuticals | Gailani D.,Vanderbilt University | And 5 more authors.
New England Journal of Medicine | Year: 2015

Background Experimental data indicate that reducing factor XI levels attenuates thrombosis without causing bleeding, but the role of factor XI in the prevention of postoperative venous thrombosis in humans is unknown. FXI-ASO (ISIS 416858) is a secondgeneration antisense oligonucleotide that specifically reduces factor XI levels. We compared the efficacy and safety of FXI-ASO with those of enoxaparin in patients undergoing total knee arthroplasty. Methods In this open-label, parallel-group study, we randomly assigned 300 patients who were undergoing elective primary unilateral total knee arthroplasty to receive one of two doses of FXI-ASO (200 mg or 300 mg) or 40 mg of enoxaparin once daily. The primary efficacy outcome was the incidence of venous thromboembolism (assessed by mandatory bilateral venography or report of symptomatic events). The principal safety outcome was major or clinically relevant nonmajor bleeding. Results Around the time of surgery, the mean (+ACY-plusmn;SE) factor XI levels were 0.38+ACY-plusmn;0.01 units per milliliter in the 200-mg FXI-ASO group, 0.20+ACY-plusmn;0.01 units per milliliter in the 300-mg FXI-ASO group, and 0.93+ACY-plusmn;0.02 units per milliliter in the enoxaparin group. The primary efficacy outcome occurred in 36 of 134 patients (27+ACU-) who received the 200-mg dose of FXI-ASO and in 3 of 71 patients (4+ACU-) who received the 300-mg dose of FXI-ASO, as compared with 21 of 69 patients (30+ACU-) who received enoxaparin. The 200-mg regimen was noninferior, and the 300-mg regimen was superior, to enoxaparin (P+ACY-lt;0.001). Bleeding occurred in 3+ACU-, 3+ACU-, and 8+ACU- of the patients in the three study groups, respectively. Conclusions This study showed that factor XI contributes to postoperative venous thromboembolism; reducing factor XI levels in patients undergoing elective primary unilateral total knee arthroplasty was an effective method for its prevention and appeared to be safe with respect to the risk of bleeding. Copyright + 2014 Massachusetts Medical Society.


Siegal D.M.,McMaster University | Cuker A.,University of Pennsylvania
Journal of Thrombosis and Thrombolysis | Year: 2013

Novel oral anticoagulants (NOACs) that directly inhibit thrombin (dabigatran) or factor Xa (rivaroxaban, apixaban, edoxaban) are effective therapies for the prevention and treatment of thromboembolism with reduced bleeding complications compared with warfarin for some indications. However, specific antidotes to reverse the anticoagulant activity of NOACs in the event of major bleeding are not available. Evidence supporting non-specific prohemostatic therapies (prothrombin complex concentrate [PCC], activated prothrombin complex concentrate [aPCC], recombinant factor VIIa) in this setting is limited to healthy human volunteers, animal models, and in vitro studies. Clinical outcome data are lacking. Administration of PCC or aPCC may be considered in addition to supportive measures for patients with severe or life-threatening bleeding. Clinical studies are needed to establish the efficacy and safety of these treatments. Target-specific antidotes are in development and hold promise for NOAC reversal, but require further investigation. © 2013 Springer Science+Business Media New York.


Cuker A.,University of Pennsylvania | Gimotty P.A.,University of Pennsylvania | Crowther M.A.,McMaster University | Warkentin T.E.,McMaster University
Blood | Year: 2012

The 4Ts is a pretest clinical scoring system for heparin-induced thrombocytopenia (HIT). Although widely used in clinical practice, its predictive value for HIT in diverse settings and patient populations is unknown. We performed a systematic review and meta-analysis to estimate the predictive value of the 4Ts in patients with suspected HIT.We searched PubMed, Cochrane Database, and ISI Web of Science for studies that included patients with suspected HIT, who were evaluated by both the 4Ts and a reference standard against which the 4Ts could be compared. Quality of eligible studies was assessed by QUADAS-2 criteria. Thirteen studies, collectively involving 3068 patients, fulfilled eligibility criteria. A total of 1712 (55.8%) patients were classified by 4Ts score as having a low probability of HIT. The negative predictive value of a low probability 4Ts score was 0.998 (95% CI, 0.970-1.000) and remained high irrespective of the party responsible for scoring, the prevalence of HIT, or the composition of the study population. The positive predictive value of an intermediate and high probability 4Ts score was 0.14 (0.09-0.22) and 0.64 (0.40-0.82), respectively. A low probability 4Ts score appears to be a robust means of excluding HIT. Patients with intermediate and high probability scores require further evaluation. © 2012 by The American Society of Hematology.


Eriksson B.I.,Sahlgrenska University Hospital | Quinlan D.J.,King's College | Eikelboom J.W.,McMaster University
Annual Review of Medicine | Year: 2011

The last decade has seen the evaluation of several new oral anticoagulants that directly target thrombin or activated factor X (FXa). All demonstrate a rapid onset of action, a low potential for food and drug interactions, and a predictable anticoagulant effect that obviates the need for routine coagulation monitoring. Those agents at the most advanced stages of clinical development are a direct thrombin inhibitor, dabigatran, and direct FXa inhibitors, rivaroxaban and apixaban. Dabigatran and rivaroxaban are approved in more than 70 countries for prevention of venous thromboembolism in patients undergoing elective hip or knee arthroplasty, and apixaban is being considered for approval by regulatory agencies for this indication. Dabigatran was shown in a large phase III trial to be more effective and safer than warfarin for the prevention of stroke or systemic embolism in patients with atrial fibrillation and has recently been approved for this indication. Edoxaban, an oral FXa inhibitor, is also being evaluated in phase III clinical trials. This review summarizes the pharmacology, clinical trial results, and future role of the new oral anticoagulants in clinical practice. © 2011 by Annual Reviews. All rights reserved.


Cuker A.,University of Pennsylvania | Siegal D.M.,McMaster University | Crowther M.A.,McMaster University | Garcia D.A.,University of Washington
Journal of the American College of Cardiology | Year: 2014

BACKGROUND Non-vitamin K oral anticoagulants (NOACs) do not require routine laboratory monitoring. However, laboratory measurement may be desirable in special situations and populations. OBJECTIVES This study's objective was to systematically review and summarize current evidence regarding laboratory measurement of the anticoagulant activity of dabigatran, rivaroxaban, and apixaban. METHODS We searched PubMed and Web of Science for studies that reported a relationship between drug levels of dabigatran, rivaroxaban, and apixaban and coagulation assay results. Study quality was evaluated using QUADAS-2 (Quality Assessment of Diagnostic Accuracy Studies 2). RESULTS We identified 17 eligible studies for dabigatran, 15 for rivaroxaban, and 4 for apixaban. For dabigatran, a normal thrombin time excludes clinically relevant drug concentrations. The activated partial thromboplastin time (APTT) and prothrombin time (PT) are less sensitive and may be normal at trough drug levels. The dilute thrombin time (R2 = 0.92 to 0.99) and ecarin-based assays (R2 = 0.92 to 1.00) show excellent linearity across on-therapy drug concentrations and may be used for drug quantification. For rivaroxaban and apixaban, anti-Xa activity is linear (R2 = 0.89 to 1.00) over a wide range of drug levels and may be used for drug quantification. Undetectable anti-Xa activity likely excludes clinically relevant drug concentrations. The PT is less sensitive (especially for apixaban); a normal PT may not exclude clinically relevant levels. The APTT demonstrates insufficient sensitivity and linearity for quantification. CONCLUSIONS Dabigatran, rivaroxaban, and apixaban exhibit variable effects on coagulation assays. Understanding these effects facilitates interpretation of test results in NOAC-treated patients. More information on the relationship between drug levels and clinical outcomes is needed. (J Am Coll Cardiol 2014;64:1128-39) © 2014 by the American College of Cardiology Foundation.


News Article | November 5, 2015
Site: phys.org

Showy plumage in birds is not just for the boys, ecologists from Massey University, McMaster University, Canada, Monash University, Australia, and Max Planck Institute for Ornithology, Germany, have demonstrated.


News Article | April 4, 2016
Site: news.yahoo.com

A skull and two tusk fragments from a Columbian mammoth, found in a sand it in Oklahoma. More A bulldozer operator at a sand pit in northwestern Oklahoma got quite a surprise this month when he spotted a huge skull that belonged to a Columbian mammoth. These giants were plentiful across the plains of Oklahoma during the Pleistocene epoch, which lasted from about 1.8 million to 11,700 years ago, said Leland Bement of the Oklahoma Archaeological Survey. The discovery was not unheard of, as the Survey typically receives about three "mammoth-sighting" calls a year, Bement said. That made it now less exciting, though. "Archaeological fieldwork is always exciting. You never know what you are going to find," Bement told Live Science in an email. He added, "When it comes to mammoth finds, we are always on the lookout for the next one that has projectile points or stone tools associated with it to indicate that the animal was killed and butchered. We have so few of these sites across North America and only one so far in Oklahoma." [Photos: A 40,000-Year-Old Mammoth Autopsy] The skull had been deposited on the sandbar of a river channel, the archaeologists said. So far, the archaeologists have unearthed the animal's skull with a single tooth in place; apparently, another tooth had been removed from the skull during the clearing of the sand. "We don't know the cause of death. There is no sign that people killed or butchered it," Bement told Live Science in an email. "Its skull was washed around in the river. The rest of the animal could be anywhere." Though the scientists have not pinpointed an exact age for the skull, they know it’s more than 11,000 years old — the period when mammoths and other megafauna went extinct at the end of the Pleistocene. Scientists have put forth several reasons for the extinctions, ranging from rapid climate warming to ice age human hunters. Others have suggested a perfect storm of culprits. One group of dwarf mammoths is thought to have survived in the Arctic, on Wrangel Island, until about 3,700 years ago. Like other Columbian mammoths (Mammuthus columbi), this one was not the cold-adapted type and preferred more temperate stomping grounds in southern and central North America. The woolly mammoth (Mammuthus primigenius), the kind portrayed in the "Ice Age" movies, would have called the chilly tundra home. The Columbian variety was also much larger than the woollies, with Columbian males reaching up to twice the size of woolly males, according to Hendrik Poinar, an evolutionary geneticist at McMaster University in Hamilton, Canada. Columbian mammoths also arrived in North America about 1.5 million years ago, whereas woolly mammoths stepped onto the continent some 400,000 years ago, said Poinar, who spoke with Live Science in 2011. Finding mammoth bones, while a mammoth discovery, seems relatively common across the United States. This past January, a construction crew discovered the femur of a mammoth (possibly a Columbian mammoth) under the Oregon State University's football field. Last September, two Michigan farmers found a mammoth's skull and tusks while they were installing a drainage pipe. And, in October 2014, a volunteer "paleontologist" unearthed the skeleton of a mammoth on the banks of a reservoir in Idaho. That skeleton dated back more than 72,000 years, said the scientists involved in the excavation. Next, the researchers, including Oklahoma State University geographer Carlos Cordova, will analyze the mammoth teeth for particles from plants encased in tartar buildup, Bement said. "That will tell us what the mammoth was eating and also help in reconstructing the environment at the time he lived." The findings will be included in a broader study, by doctoral student Tom Cox, of the distribution of mammoths in Oklahoma, he added. Copyright 2016 LiveScience, a Purch company. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.


HAMILTON, ON and HACKENSACK, NJ--(Marketwired - November 10, 2016) - Triumvira Immunologics today announced that new data on the TAC platform will be presented Friday, November 11 at the 31st Annual Meeting of the Society for Immunotherapy of Cancer (SITC) in National Harbor, Maryland. Dr. Chris Helsen, Triumvira's Head of Platform Development, is presenting a poster (P18) entitled "T cell antigen couplers (TAC) demonstrate strong effectivity against solid tumors with no measurable toxicities, demonstrating an enhanced therapeutic index" which will include animal data from our solid tumor HER2 TAC-T cell program and new animal data from our CD19 and BCMA programs, demonstrating robust anti-tumor activity for both. An additional poster (P16), supported in part with funding from Triumvira, entitled "A novel xenograft model of chimeric antigen receptor-mediated toxicity sheds light on the influence of T cell source on the severity of the toxic sequalae" details the toxicity profile of HER2 CAR-T cells in mice, which contrasts sharply with the safety profile observed for HER2 TAC-T cells. Jonathan Bramson, PhD, Triumvira's Chief Scientific Officer, commented "We are pleased to have the opportunity to present new results from several programs at the SITC Annual Meeting. In particular, the results we have seen with CD19 and BCMA directed TAC-T cells give us great confidence in these two programs as we move them forward to the clinic." The SITC is the world's leading member-driven organization specifically dedicated to professionals working in the field of cancer immunology and immunotherapy. The SITC's Annual Meeting provides a multidisciplinary educational and interactive environment focused on improving outcomes for current and future patients with cancer by incorporating strategies based on basic and applied cancer immunotherapy. Triumvira Immunologics is a biotechnology company developing a novel platform for engineering T cells to attack cancers. Triumvira's innovative and proprietary technology for reprogramming T cells, called the T Cell-Antigen Coupler (or TAC), may possess advantages over other approaches to engineered T cells owing to the distinct biology and regulated activation of TAC-T cells. Triumvira has licensed the TAC technology from McMaster University in Hamilton, Ontario and its goal is to begin human testing of TAC T cells in early 2018.


« Pioneer Valley Transit Authority acquires three Proterra electric buses | Main | SAE International and @GM announce new collegiate competition for autonomous technology; Chevy #Bolt as platform » A research team from University of Western Ontario, McMaster University and Beijing Computational Science Research Center has developed an effective synthesis method to produce isolated single platinum (Pt) atoms and clusters for use as catalysts for the hydrogen evolution reaction (HER) in water splitting to produce hydrogen. In an open-access paper published in Nature Communications, the researchers reported that the single Pt atom catalysts exhibit significantly enhanced catalytic activity (up to 37 times) and high stability in comparison to the state-of-the-art commercial platinum/carbon (Pt/C) catalysts. Platinum-based catalysts are generally considered to be the most effective electrocatalysts for the HER. Unfortunately, Pt is expensive and scarce, limiting the commercial potential for such catalysts. Significant effort has been devoted to the search of non-precious-metal based HER catalysts including sulfide-based materials, and C N . Although these candidate materials show promising activities for the HER, the activities of these catalysts in their present form are insufficient for industrial applications. In this work, the team fabricated single platinum atoms and clusters supported on nitrogen-doped graphene nanosheets (NGNs) using atomic layer deposition (ALD). The size and density of the Pt catalysts on the NGNs are precisely controlled by simply adjusting the number of ALD cycles. The researchers also prepared single Pt atoms on graphene to compare with the samples on N-doped graphene. The researchers found that the stability of the single Pt atoms on pure graphene was low, resulting in the loss of 24% of the initial HER activity after stability tests. On the other hand, the single Pt atoms on the N-doped graphene resulted in a decreased activity of only 4%. First-principles calculations showed that the interaction energy between the single Pt atoms and N-dopants is about 5.3 eV, which is approximately 3.4 eV larger than the bond strength between the Pt atoms on the graphene substrate, suggesting that the Pt prefers to bind to the N-sites. The researchers also studied the mechanisms of the single-atom catalysis. X-ray absorption fine structure (XAFS) and density functional theory (DFT) analyses indicated that the partially unoccupied density of states of the Pt atoms’ 5d orbitals on the N-doped graphene are responsible for the excellent performance.


The International Nurses Association is pleased to welcome Wanda J. Hall, RN, to their prestigious organization with her upcoming publication in the Worldwide Leaders In Healthcare. Wanda J. Hall is a Registered Nurse working for Alberta Health Services at South Health Campus in Calgary, Alberta, Canada. With over 33 years of experience in nursing, she is a nurse clinician working on the surgical unit.  She is presently working on a Diploma of Addiction Counselling from the McMaster University in Hamilton, Ontario. Wanda J. Hall received her Nursing Diploma in 1983 from the Saskatchewan Institute of Applied Arts and Sciences in Regina, Saskatchewan, Canada. She has had experience in out-post, emergency, postpartum, medical and surgical nursing. Wanda has 22 years of acute surgical nursing within the Recovery Room and is now a nurse clinician in surgical short stay nursing, and is also a nurse teacher. She maintains a professional membership with the College and Association of Registered Nurses of Alberta, and has been honored by both the Alberta Medical Association and the Saskatchewan Emergency Medical Services Association. She attributes her success to her passion for helping her diverse range of patients with their diverse problems, and when she is not working, Wanda enjoys reading, gardening, hiking, and spending time with her family and friends. Learn more about Wanda J. Hall here: http://inanurse.org/network/index.php?do=/4133705/info/ and read her upcoming publication in Worldwide Leaders In Healthcare.


News Article | January 18, 2016
Site: phys.org

The findings address the longstanding debate among scientists about whether or not the bacterium Yersinia pestis –responsible for the Black Death—remained within Europe for hundreds of years and was the principal cause of some of the worst re-emergences and subsequent plague epidemics in human history. Until now, some researchers believed repeated outbreaks were the result of the bacterium being re-introduced through major trade with China, a widely-known reservoir of the plague. Instead, it turns out the plague may never have left. "The more plague genomes we have from these disparate time periods, the better we are able to reconstruct the evolutionary history of this pathogen" says evolutionary geneticist Hendrik Poinar, director of McMaster University's Ancient DNA Centre and a principal investigator at the Michael G. DeGroote Institute for Infectious Disease Research. Poinar collaborated with Edward Holmes at the University of Sydney, Olivier Dutour of the École Pratique des Hautes Études in France, and Kirsti Bos and Johannes Krause at the University of Tubingen, and others, to map the complete genomes of Y.pestis which was harvested from five adult male victims of the 1722 Plague of Provence. To do so, they analyzed the dental pulp taken from the five bodies, originally buried in Marseille, France. Researchers were able to extract, purify and enrich specifically for the pathogen's DNA, and then compare the samples with over 150 plague genomes representing a world wide distribution as well as from other points in time, both modern and ancient. By comparing and contrasting the samples, researchers determined the Marseille strain is a direct descendant of the Black Death that devastated Europe nearly 400 years earlier and not a divergent strain that came, like the previous pandemic strains Justinian and Black Death, from separate emergences originating in Asia. More extensive sampling of modern rodent populations, in addition to ancient human and rodent remains from various regions in Asia, the Caucasus and Europe, may yield additional clues about past ecological niches for plague. "There are many unresolved questions that need to be answered: why did the plague erupt in these devastating waves and then lay dormant? Did it linger in the soil or did it re-emerge in rats? And ultimately why did it suddenly disappear and never come back? Sadly, we don't have the answer to this yet," says Poinar. "Understanding the evolution of the plague will be critically important as antibiotic resistance becomes a greater threat, particularly since we treat modern-day plague with standard antibiotics. Without methods of treatment, easily treatable infections can become devastating again," he says. The research was published online today in the bioarchive bioRXIV, and is under review at the journal eLife. Explore further: Researchers reconstruct genome of the Black Death


News Article | November 23, 2016
Site: www.marketwired.com

The Patented Medicine Prices Review Board (PMPRB) is pleased to announce the reappointment of Dr. Mitchell Levine of Hamilton, Ontario as Vice-chairperson of the Board for a second five-year term. Dr. Levine was reappointed by His Excellency the Governor General in Council, on the recommendation of the Minister of Health, the Honourable Jane Philpott, following an open, transparent and merit-based selection process. Dr. Mitchell Levine, Professor in the departments of Medicine and Clinical Epidemiology and Biostatistics in the Faculty of Health Sciences at McMaster University and Director of the Centre for Evaluation of Medicines at St. Joseph's Healthcare in Hamilton, was first appointed Vice-chairperson of the Board in March 2011. "I am honoured to continue serving as Vice-chair of the Board and look forward to helping the PMPRB realize its vision of a sustainable pharmaceutical system where payers have the information they need to make smart reimbursement choices and Canadians can afford the patented medicines they need to live healthy and productive lives."


News Article | December 19, 2016
Site: www.scientificamerican.com

Growing a human being is no small feat—just ask any newly pregnant woman. Her hormones surge as her body undergoes a massive physical transformation, and the changes don’t end there. A study published Monday in Nature Neuroscience reveals that during pregnancy women undergo significant brain remodeling that persists for at least two years after birth. The study also offers preliminary evidence that this remodeling may play a role in helping women transition into motherhood. A research team at Autonomous University of Barcelona, led by neuroscientist Elseline Hoekzema of Leiden University, performed brain scans on first-time mothers before and after pregnancy and found significant gray matter changes in brain regions associated with social cognition and theory of mind—the same regions that were activated when women looked at photos of their infants. These changes, which were still present two years after birth, predicted women’s scores on a test of maternal attachment, and were so clear that a computer algorithm could use them to identify which women had been pregnant. One of the hallmarks of pregnancy is an enormous increase in sex steroid hormones such as progesterone and estrogen, which help a woman’s body prepare for carrying a child. There is only one other time when our bodies produce similarly large quantities of these hormones: puberty. Previous research has shown that during puberty these hormones cause dramatic structural and organizational changes in the brain. Throughout adolescence both boys and girls lose gray matter as the brain connections they don’t need are pruned, and their brains are sculpted into their adult form. Very little research has focused on anatomical brain changes during pregnancy, however. “Most women undergo pregnancy at some point in their lives,” Hoekzema says, “But we have no idea what happens in the brain.” Hoekzema and her colleagues performed detailed anatomical brain scans on a group of women who were trying to get pregnant for the first time. The 25 women who got pregnant were rescanned soon after they gave birth; 11 of them were scanned two years after that. (For comparison, the researchers also scanned men and women who were not trying to have a child as well as first-time fathers). During the postpartum period, the researchers also performed brain scans on the new mothers while they looked at photos of their infants. The scientists used a standard scale to rate the attachment between mother and infant. The researchers found that the new mothers experienced gray matter reductions that lasted for at least two years after birth. This loss, however, is not necessarily a bad thing (according to Hoekzema, “the localization was quite remarkable”); it occurred in brain regions involved in social cognition, particularly in the network dedicated to theory of mind, which helps us think about what is going on in someone else’s mind—regions that had the strongest response when mothers looked at photos of their infants. These brain changes could also be used to predict how mothers scored on the attachment scale. In fact, researchers were able to use a computer algorithm to identify which women were new mothers based solely on their patterns of gray matter loss. Gray matter loss was not seen in new fathers or nonparents. It is not entirely clear why women lose gray matter during pregnancy, but Hoekzema thinks it may be because their brains are becoming more specialized in ways that will help them adapt to motherhood and respond to the needs of their babies. The study offers some preliminary evidence to support this idea. Whereas the present study focuses primarily on documenting brain changes during pregnancy, she expects follow-up work to tackle more applied questions such as how brain changes relate to postpartum depression or attachment difficulties between mother and child. Ronald Dahl, a neuroscientist at the University of California, Berkeley, who was not involved in the work, says he had “a delightful ‘wow’ moment” on seeing the study. “This is a pioneering contribution that not only documents structural brain changes linked to pregnancy but also compellingly offers evidence that suggests these represent adaptive changes,” he wrote in an e-mail. Mel Rutherford, an evolutionary psychologist at McMaster University in Ontario, is also enthusiastic about the study—which, to his knowledge, is the first that uses neuroimaging to track brain changes during pregnancy. “Probably the most exciting thing is that they were able to follow up two years after the birth of the baby,” he says, “So they have the longest-term evidence that we've seen of changes in the brain after pregnancy.” The results mesh with Rutherford’s own research on cognitive changes during pregnancy, which he approaches from an evolutionary perspective. “As a parent, you're now going to be solving slightly different adaptive problems, slightly different cognitive problems than you did before you had children,” he explains. “You have different priorities, you have different tasks you're going to be doing, and so your brain changes.”


News Article | January 12, 2016
Site: www.sciencenews.org

When Elinor Sullivan was a postdoctoral fellow at Oregon Health & Science University in Portland, she set out to explore the influence of food and exercise habits on obesity. In one experiment, she and her colleagues fed a troop of macaque monkeys regular chow. Other macaques dined American-style, with a hefty 32 percent of calories from fat and ready access to peanut butter treats. Over time, the second group of monkeys grew noticeably fatter. Then they all had babies. Sullivan, now at the University of Portland, noticed odd behavior in the plump moms’ offspring. At playtime, they often slinked off by themselves. When handled by keepers, the infants tended to vocalize anxiously, and the males became aggressive. They were prone to repetitive habits, like pacing. In their carefully controlled world, the only difference between those monkeys and others at the facility was their mothers’ extra pounds and indulgent diet. The behavior was so striking that Sullivan changed the course of her research. “It made me start thinking about human children,” she says, and the twin epidemics of obesity and behavioral problems such as attention-deficit/hyperactivity disorder. Her research, published in 2010 in the Journal of Neuroscience, was one of the first studies to note that the progeny of female monkeys eating a high-fat diet were more likely to experience altered brain development and suffer anxiety. Not long after, researchers worldwide began compiling evidence linking the heaviness of human mothers to mental health in their children. One headline-grabbing study of more than 1,000 births, reported in 2012, found that autism spectrum disorders showed up more often in children of obese mothers than in normal-weight women (SN: 5/19/12, p. 16). Over the course of a generation, obesity rates among U.S. women have soared. Today, 38 percent of females in the population are obese (defined as a body mass index of 30 or higher). Among women of childbearing age, well over half are overweight or obese, with almost 8 percent considered extremely obese (a BMI of 40 or greater). Lucilla Poston, who is head of the division of women’s health at King’s College London, calls too much weight during pregnancy “the biggest problem in obstetrics at the moment.” of U.S. women are obese Within the body, obesity is not a passive state. Excess weight can inflame the immune system, upset the balance of hormones and even alter the microbial flora tucked inside the intestine. If shared by the fetus, any or all of these changes can affect the baby’s development in subtle but important ways. Further complicating matters, the fetus is probably being exposed to the effects of fattening, and perhaps inflammatory, foods. Only recently have researchers begun to understand what this physiological storm might mean for children. In part, obesity during pregnancy raises the odds that a baby will be born overly large, setting the stage for future health problems (SN: 5/31/14, p. 22). But when a mother is excessively overweight, risks persist even for newborns of normal size. One study published in 2013 in the journal BMJ analyzed medical records of more than 37,000 people born in Scotland between 1950 and 1976. After accounting for socioeconomic status, gender, weight at birth and many other variables, the researchers found that children born to obese mothers had a 35 percent higher mortality rate from birth to 2012. “Independent of birth weight, a child can grow up with increased blood pressure, obesity and risk of diabetes,” Poston says. The list doesn’t stop there. Perhaps most surprisingly, a mom’s metabolic state might compromise her child’s mental health—the very observation that changed Elinor Sullivan’s career. One study published in 2015 even raises the possibility that a child’s normal cognitive development might be slightly impaired by mom's high BMI. If there is a bright spot, it’s that unlike many threats during development, this one is preventable. As the risks of obesity during pregnancy emerge, researchers hope more young women on the verge of starting families see the importance of maintaining a healthy life—and that the culture around them will support efforts to do so. “Pregnancy is a good time to talk to people about lifestyle,” Poston says, “because they do care deeply about their babies.” Few research questions are easy, but epidemiologists studying maternal obesity face a particularly daunting challenge. They have to separate the effects of a mother’s weight from a multitude of other influences on children’s health. In the United States, obesity disproportionately affects low income and minority women. Children born in less affluent neighborhoods face obstacles to their well-being: more stress, heightened exposure to pollutants and less access to wholesome foods. Plus, the same food choices and lack of activity that drive a woman’s weight gain may also become the lifestyle adopted by her children. The data become even more difficult to tease apart when examining effects on the mind. Given the correlation of obesity with poverty, children of obese parents also might have educational disadvantages. Case in point: Studies have found that young children in poverty score lower on measures of school readiness, including motor-skill development, emotional health and social knowledge. That said, the latest studies—many published in recent months—attempt to overcome those biases. And they still find reason for concern. Lisa Bodnar, a nutritional epidemiologist at the University of Pittsburgh, describes a “small but growing literature” suggesting that obesity in a mother is associated with lower cognition and other mental health challenges in children. In 2015 in the Journal of Nutrition, Bodnar and her colleagues published a study of women on similar economic footing who were patients at Pittsburgh's Magee Women’s Hospital. The majority were unemployed, single mothers. The researchers nonetheless found that children of women who were obese at conception or gained excess weight during pregnancy scored slightly lower on tests of intelligence and executive function, a measure of the ability to plan, organize and adjust to new situations. Elinor Sullivan saw behavior differences between macaque infants born to mothers eating a high-fat diet versus those on normal chow. The stark distinctions made her shift her research focus and begin to look at diet and human development. Probably the most compelling data link maternal obesity with ADHD, says Sullivan, who continues her primate studies. Whether maternal obesity (or a fattening diet) can actually cause hyperactivity is unclear, but one study of rodents published in Molecular Psychiatry in 2012 described results that “point to a direct biological link between in utero exposure to maternal obesity and hyperactivity in the adult offspring.” Researchers from England and Sweden fed one group of female mice a high-fat diet that started six months before pregnancy and lasted until weaning, while another group ate regularly. The offspring of the obese mothers scored significantly higher on tests of hyperactivity. Another animal study, published in 2014 in the Journal of Neuroinflammation, found that female offspring of mice fed a high-fat diet had increased anxiety while the males were prone to hyperactivity. The study, from the Mayo Clinic in Rochester, Minn., and Oregon Health & Science University, also opened the door to prevention. When mother rats were given a healthier, less inflammatory diet while nursing, the mental health of the female pups improved, though the males still had issues. In November 2015, Sullivan and colleagues reviewed the evidence in Hormones and Behavior, making the grim prediction that, given persistent rates of obesity and pervasiveness of high-calorie foods, “the prevalence of neurodevelopmental and mental health disorders will continue to rise in future generations.” In December, researchers from George Washington University and Mathematica Policy Research announced that 12 percent of U.S. children and adolescents have been diagnosed with ADHD, a 43 percent increase since 2003. The field is still too new to explain biologically how obesity would impair fetal brain development, but Sullivan points to theoretical consequences of high glucose or the hormone leptin. Leptin inhibits appetite, but is often elevated in obese individuals and may affect brain development. Most commonly, however, researchers circle back to the effects of an agitated immune system on the brain. “We think of obesity as the state of chronic inflammation,” Sullivan says. “Many of the neurotransmitters in the brain are very sensitive [to inflammation] in early development.” The immune system isn’t the only part of body mechanics co-opted by obesity and diet. A compelling line of inquiry has linked the microbiome—specifically the microorganisms inside the digestive system— to body weight. For example, the microbiome of an obese person differs from the microbiome of someone of normal weight. In experiments involving lean mice with no intestinal microbes, transferring the microbiome of an obese person to a thin mouse is enough by itself to make the lean mouse pack on weight. Since a newborn gets its microbiome from mom, a baby could inherit microbes that want to hoard calories. In both human and animal studies, the microbiomes of offspring born to obese moms are different than in children born to lean moms, says Deborah Sloboda, a fetal physiologist at McMaster University in Hamilton, Ontario. “What we don’t know is whether it comes from transfer during pregnancy, transfer during birth or poor developmental environment altering how the gut forms.” The intestine is normally a fortress that does not like micro­organisms to escape. Several studies, however, have suggested that when under siege from a fast-food Western diet, the gut lining can become porous (SN: 5/30/15, p. 18). Perhaps bacteria slipping into the bloodstream during pregnancy could affect proper formation of the intestine. Other scenarios are also possible: The microbiome transferred during birth could, as it has in animal experiments, predispose a child to a microbiome that extracts more calories from a given amount of food. In Pediatric Research in 2015, Sloboda and colleagues reviewed research on obesity and the maternal microbiome. One theory holds, they noted,that the microbiomes of lean women remain stable during pregnancy; the microbiomes of obese women appear more volatile, experiencing a greater bloom of species associated with obesity. These women’s children may then start life with a microbiome inclined toward weight gain. Lean women generally carry a stable population of microbes in their intestines. In obese mothers, the microbes are out of balance, heavier on Firmicutes, bacteria linked to harvesting more energy from the diet. These changes can affect fetal gut development and future disease risk. Like researchers who study the brain, Sloboda and others suspect that inflammation—which also appears to be a consequence of the microbiome coping with junk food—lies at the heart of many risks conveyed to a developing fetus. “When you consider the spectrum of conditions that have been linked to maternal obesity,” says immunologist Ilhem Messaoudi of the University of California, Riverside, “one of the things that links all these diseases is inflammation.” In addition to the irritation that might come from the high-fat, high-sodium, high-calorie fare at the drive-through, adipose tissue itself provokes a mother’s immune system. In this state of overactivation, the normal cues for her baby’s immune formation might then become lost. “If you have to develop an immune system in the presence of inflammation, the programming of the immune system is going to change,” Messaoudi says. In an experiment published in 2015 in Pediatric Allergy and Immunology, she and her colleagues studied 39 pregnant women who were designated as lean, overweight or obese, based on their preconception body mass index, a measurement of body fat. The researchers extracted blood samples from the umbilical cords of the women’s newborns, and tested the reaction to antigens, molecules that are supposed to trigger an immune reaction. “The cord blood cells of babies born to obese moms did not respond to bacterial antigens,” she says. It was as if the immune system, put to its first real test, was stumped. “If your immune cells don’t know how to react, you’re going to be sick more often. You may not respond to vaccinations in the way your immune system is supposed to respond.” Although the research is still preliminary, studies are suggesting that a high-fat diet and obesity at conception and during a woman’s pregnancy could have lasting influences on her child’s mental health. Those findings may partially explain studies finding that children of obese mothers are more likely to develop disorders that arise from off-kilter immunity. In 2014, researchers who reviewed a dozen studies concluded in the journal Pediatrics that babies born to mothers with a high body mass index had a 20 to 30 percent greater risk of asthma and wheezing, though they noted that mechanisms remain unknown. Of all the possible consequences of maternal obesity, the data are most compelling in suggesting that overweight mothers tend to raise children who grow up to be overweight themselves. “It’s a very strong effect, and consistent, across all populations,” says Bodnar, from Pittsburgh. Chinese researchers writing in 2013 in PLOS ONE pooled the analysis of 45 studies examining whether children faced greater odds of being heavy based on mom’s size. Although studies have varied and genetics obviously play some role, the scientists concluded that having an obese mother roughly tripled the risk of obesity. In addition to a woman’s weight when she becomes pregnant, excessive weight gain during pregnancy, especially in the first months, is also linked to her child’s obesity risk. In one 2012 study comparing more than 6,600 Finnish mothers, those who put on more pounds during the first 20 weeks of gestation (compared with those who gained the least) had children who were 46 percent more likely to be overweight at age 16. Theories to explain the association are examining how increased glucose and hormonal balance affect fetal development, particularly in the brain. Leptin resistance, which leads to higher secretion of the hormone, can be a consequence of obesity. In the journal Acta Physiologica in 2014, Poston and her colleagues from King’s College pointed out that many studies have found that the presence of too much leptin can cause collateral damage to the developing hypothalamus, a key interface between the brain and the hormone-producing endocrine system. Animal studies suggest an altered hypothalamus could mean a child is born with difficulty regulating blood pressure and controlling appetite. “That particular part of the brain may become rewired, and a child may grow up eating more,” Poston says. With little sign that the obesity epidemic is abating, that theory and others are likely to take on increasing importance in medical research. This generation’s greatest health threat could leave an unexpected legacy. Scientists working in this field often worry that their research will be seen as solely finding fault with mothers. “I think it’s unfair to blame this on women,” Bodnar says. Obesity is a global problem. One starting point, she says, is for more doctors to speak with their patients about the importance of weight. Since half of all pregnancies are unplanned, those conversations should happen before a woman gets pregnant. Yet in a U.S. study published in 2014, overweight women of child-bearing age received diet and exercise advice during preventive medicine exams only 36 percent of the time. The number was even lower among pregnant women who were overweight. At the same time, Bodnar says, this is not going to be fixed in doctors’ offices. Women every day are offered cheap, calorie-dense food, pushed by companies with fat marketing budgets (McDonald’s alone spends about $900 million a year on advertising). “It’s not easy, in this environment, to lose weight,” Bodnar says. “We have to agree as a society that this matters.” Let’s not forget the father, whose size can alter sperm, perhaps in ways that affect a child’s risk of obesity, according to recent studies. In a study published online in December in Cell Metabolism, researchers compared sperm samples from 13 lean and 10 obese Danish men. Scientists from the University of Copenhagen looked for epigenetic differences — the chemical attachment of methyl groups to DNA that affects which genes are turned off or on. The researchers found significant differences depending on the men’s size. The obese men had more methylation in genes involved in metabolism and appetite control. Six of the obese men then underwent gastric bypass surgery and lost weight. A year later, their sperm had lost many of the epigenetic changes linked to obesity and appetite. The researchers caution, however, that the extent to which epigenetic changes affect a child’s appetite isn’t known. Other studies also suggest that overweight dads can harm a baby’s development. In September, a team of Australian researchers reported on a mouse experiment that found the offspring of two obese parents fared worse than if either parent alone was obese. The scientists found lower weights in the placenta and fetus, as well as cellular differences (such as impaired mitochondrial function) in the offspring of two obese mice. That study appeared in the American Journal of Physiology — Endocrinology and Metabolism. — Laura Beil This article appears in the January 23, 2016, issue of Science News under the headline, "Maternal Input: A mother's weight during pregnancy can shape her child's mental and physical health."


News Article | November 29, 2016
Site: www.eurekalert.org

LOS ALAMOS, N.M., Nov. 29, 2016 -- A new bioinformatics platform called Empowering the Development of Genomics Expertise (EDGE) will help democratize the genomics revolution by allowing users with limited bioinformatics expertise to quickly analyze and interpret genomic sequence data. Researchers at Los Alamos National Laboratory and their collaborators at the Naval Medical Research Center developed EDGE, which is described in a paper recently published in Nucleic Acids Research. "We realized that while next-generation sequencing instruments are becoming more widespread and more accessible to the average biologist or physician, the bioinformatics tools required to process and analyze the data were not as user-friendly or accessible," said Patrick Chain, of Los Alamos' Biosecurity and Public Health group and EDGE team lead. "Given the large number of applications where sequencing is now used, a robust bioinformatics platform that encapsulates a broad array of algorithms is required to help address questions a researcher may have. We sought to develop a web-based environment where non-bioinformatics experts could easily select what pipelines they need and rapidly obtain results and interact with their data." Stopping the spread of disease--from naturally occurring or manmade threats -- requires an in-depth understanding of pathogens and how they work. To this end, the ability to characterize organisms through accurately and rapidly comparing genomic data is an important part of Los Alamos' national security mission. Technology advancements have fueled the development of new sequencing applications and will flood current databases with raw data. A number of factors limit the use of these data, including the large number of associated software and hardware dependencies and the detailed expertise required to perform this analysis. To address these issues, Chain and his team have developed an intuitive web-based environment with a wide assortment of integrated and pioneering bioinformatics tools in pre-configured workflows, all of which can be readily applied to isolate genome sequencing projects or metagenomics projects. EDGE is a user-friendly and open-source platform that integrates hundreds of cutting-edge tools and helps reduce data analysis times from days or weeks to minutes or hours. The workflows in EDGE, along with its ease of use, provide novice next-generation sequencing users with the ability to perform many complex analyses with only a few mouse clicks. This bioinformatics platform is described as an initial attempt at empowering the development of genomics dxpertise, as its name suggests, for a wide range of applications in microbial research. EDGE has already helped streamline data analysis for groups in Thailand, Georgia, Peru, South Korea, Gabon, Uganda, Egypt and Cambodia, as well as within several government laboratories in the United States. The paper "Enabling the democratization of the genomics revolution with a fully integrated web-based bioinformatics platform" was published in Nucleic Acids Research in partnership with the Defense Threat Reduction Agency, the Naval Medical Research Center-Frederick and the Henry M. Jackson Foundation. Patrick Chain earned his master's of science in microbial genomics from McMaster University and his doctoral degree in molecular microbiology and molecular genetics at Michigan State University. He is currently leading the Bioinformatics and Analytics Team and the Metagenomics Program within the Biosecurity and Public Health group at Los Alamos National Laboratory. His background is in microbial ecology, evolution, genomics and bioinformatics, having spent the past 20 years using genomics to study various microbial systems, including the human microbiome, other environmental metagenomic communities, various isolate microbes or single cells, including bacterial and viral pathogens as well as fungal, algal, plant and animal systems. He currently leads a team of researchers whose charge is to devise novel methods, algorithms and strategies for the biological interpretation of massively parallel sequencing data. Los Alamos National Laboratory, a multidisciplinary research institution engaged in strategic science on behalf of national security, is operated by Los Alamos National Security, LLC, a team composed of Bechtel National, the University of California, BWXT Government Group, and URS, an AECOM company, for the Department of Energy's National Nuclear Security Administration. Los Alamos enhances national security by ensuring the safety and reliability of the U.S. nuclear stockpile, developing technologies to reduce threats from weapons of mass destruction, and solving problems related to energy, environment, infrastructure, health, and global security concerns.


Leontiadis G.I.,McMaster University | Molloy-Bland M.,McMaster University | Moayyedi P.,Oxford Research Evaluation Unit | Howden C.W.,Northwestern University
American Journal of Gastroenterology | Year: 2013

OBJECTIVES:By systematic review and meta-analysis, we sought to assess the impact of comorbidity on short-term mortality in patients with peptic ulcer bleeding (PUB).METHODS:We conducted systematic searches in PubMed and Embase (January 1989-January 2010). Relative risks (RRs) were pooled across selected studies and an analysis of diagnostic test accuracy was performed to validate the results further.RESULTS:Of 1,572 identified studies, 16 were eligible for inclusion. Only three had a low risk of bias and the overall quality of evidence was low. The risk of death (30-day or in-hospital mortality) was significantly greater in PUB patients with comorbidity than in those without (RR: 4.44; 95% confidence interval (CI): 2.45-8.04). The pooled sensitivity for comorbidity predicting death in patients with PUB was 0.86 (95% CI: 0.66-0.95) and the pooled specificity was 0.53 (95% CI: 0.40-0.65). PUB patients with three or more comorbidities had a greater risk of dying than those with one or two (RR: 3.46; 95% CI: 1.34-8.89). All individual comorbidities that we assessed significantly increased the risk of death associated with PUB. However, RRs were higher for hepatic, renal, and malignant disease (range: 4.04-6.33; no significant heterogeneity) than for cardiovascular and respiratory disease and diabetes (2.39, 2.45, and 1.63, respectively; no significant heterogeneity).CONCLUSIONS: Underlying comorbidity is consistently associated with increased mortality in patients with PUB. The number and type of comorbidities in patients with PUB should be carefully evaluated and factored into initial management strategies.


Kirpalani H.,Children's Hospital of Philadelphia | Kirpalani H.,McMaster University | Millar D.,Royal Maternity Hospital | Lemyre B.,University of Ottawa | And 3 more authors.
New England Journal of Medicine | Year: 2013

BACKGROUND: To reduce the risk of bronchopulmonary dysplasia in extremely-low-birth-weight infants, clinicians attempt to minimize the use of endotracheal intubation by the early introduction of less invasive forms of positive airway pressure. METHODS: We randomly assigned 1009 infants with a birth weight of less than 1000 g and a gestational age of less than 30 weeks to one of two forms of noninvasive respiratory support - nasal intermittent positive-pressure ventilation (IPPV) or nasal continuous positive airway pressure (CPAP) - at the time of the first use of noninvasive respiratory support during the first 28 days of life. The primary outcome was death before 36 weeks of postmenstrual age or survival with bronchopulmonary dysplasia. RESULTS: Of the 497 infants assigned to nasal IPPV for whom adequate data were available, 191 died or survived with bronchopulmonary dysplasia (38.4%), as compared with 180 of 490 infants assigned to nasal CPAP (36.7%) (adjusted odds ratio, 1.09; 95% confidence interval, 0.83 to 1.43; P = 0.56). The frequencies of air leaks and necrotizing enterocolitis, the duration of respiratory support, and the time to full feedings did not differ significantly between treatment groups. CONCLUSIONS: Among extremely-low-birth-weight infants, the rate of survival to 36 weeks of post-menstrual age without bronchopulmonary dysplasia did not differ significantly after noninvasive respiratory support with nasal IPPV as compared with nasal CPAP. Copyright © 2013 Massachusetts Medical Society.


Kay V.R.,McMaster University | Bloom M.S.,University at Albany | Foster W.G.,McMaster University
Critical Reviews in Toxicology | Year: 2014

Phthalate diesters are a diverse group of chemicals used to make plastics flexible and are found in personal care products, medical equipment, and medication capsules. Ubiquitous in the environment, human exposure to phthalates is unavoidable; however, the clinical relevance of low concentrations in human tissues remains uncertain. The epidemiological literature was inadequate for prior reviews to conclusively evaluate the effects of phthalates on male reproductive tract development and function, but recent studies have expanded the literature. Therefore, we conducted a systematic review of the literature focused on the effects of phthalate exposure on the developing male reproductive tract, puberty, semen quality, fertility, and reproductive hormones. We conclude that although the epidemiological evidence for an association between phthalate exposure and most adverse outcomes in the reproductive system, at concentrations to which general human populations are exposed, is minimal to weak, the evidence for effects on semen quality is moderate. Results of animal studies reveal that, although DEHP was the most potent, different phthalates have similar effects and can adversely affect development of the male reproductive tract with semen quality being the most sensitive outcome. We also note that developmental exposure in humans was within an order of magnitude of the adverse effects documented in several animal studies. While the mechanisms underlying phthalate toxicity remain unclear, the animal literature suggests that mice are less sensitive than rats and potentially more relevant to estimating effects in humans. Potential for chemical interactions and effects across generations highlights the need for continued study. © 2014 Informa Healthcare USA, Inc.


Kuperman V.,McMaster University | Estes Z.,Bocconi University | Brysbaert M.,Ghent University | Warriner A.B.,McMaster University
Journal of Experimental Psychology: General | Year: 2014

Emotion influences most aspects of cognition and behavior, but emotional factors are conspicuously absent from current models of word recognition. The influence of emotion on word recognition has mostly been reported in prior studies on the automatic vigilance for negative stimuli, but the precise nature of this relationship is unclear. Various models of automatic vigilance have claimed that the effect of valence on response times is categorical, an inverted U, or interactive with arousal. In the present study, we used a sample of 12,658 words and included many lexical and semantic control factors to determine the precise nature of the effects of arousal and valence on word recognition. Converging empirical patterns observed in word-level and trial-level data from lexical decision and naming indicate that valence and arousal exert independent monotonic effects: Negative words are recognized more slowly than positive words, and arousing words are recognized more slowly than calming words. Valence explained about 2% of the variance in word recognition latencies, whereas the effect of arousal was smaller. Valence and arousal do not interact, but both interact with word frequency, such that valence and arousal exert larger effects among low-frequency words than among high-frequency words. These results necessitate a new model of affective word processing whereby the degree of negativity monotonically and independently predicts the speed of responding. This research also demonstrates that incorporating emotional factors, especially valence, improves the performance of models of word recognition. © 2013 American Psychological Association.


Warkentin T.E.,McMaster University | Basciano P.A.,Cornell University | Knopman J.,Weill Cornell Medical Center | Bernstein R.A.,Northwestern University
Blood | Year: 2014

The existence of spontaneous heparin-induced thrombocytopenia (HIT) syndrome (or autoimmune HIT), defined as a transient prothrombotic thrombocytopenic disorder without proximate heparin exposure serologically indistinguishable from HIT, is controversial. We describe 2 new cases presenting with thrombotic stroke/thrombocytopenia: one following shoulder hemi-arthroplasty (performed without heparin) and the other presenting to the emergency room without prior hospitalization, heparin exposure, or preceding infection. Both patients tested strongly positive for anti-platelet factor 4 (PF4)/heparin immunoglobulin (Ig)Gin 2 different immunoassays and in the platelet serotonin-release assay.Crucially, both patients' sera also caused strong (>80%) serotonin release in the absence of heparin, a serologic feature characteristic of delayed-onset HIT (ie, where heparin use precedes HIT but is not required for subsequent development or worsening of thrombocytopenia). We propose that a rigorous definition of spontaneous HIT syndrome should include otherwise unexplained thrombocytopenia/thrombosis without proximate heparin exposure and with anti-PF4/heparin IgG antibodies that cause strong in vitro platelet activation even in the absence of heparin. © 2014 by The American Society of Hematology.


Tikhonov D.B.,RAS Sechenov Institute of Evolutionary Physiology and Biochemistry | Zhorov B.S.,McMaster University
Molecular Pharmacology | Year: 2012

The X-ray structure of the bacterial sodium channel NavAb provides a new template for the study of sodium and calcium channels. Unlike potassium channels, NavAb contains P2 helices in the outer-pore region. Because the sequence similarity between eukaryotic and prokaryotic sodium channels in this region is poor, the structural similarity is unclear. We analyzed it by using experimental data on tetrodotoxin block of sodium channels. Key tetrodotoxin-binding residues are outer carboxylates in repeats I, II, and IV, three positions downstream from the selectivity-filter residues. In a NavAb-based model of Nav1 channels derived from the sequence alignment without insertions/deletions, the outer carboxylates did not face the pore and therefore did not interact with tetrodotoxin. The hypothesis that the evolutionary appearance of Nav1 channels involved point deletions in an ancestral channel between the selectivity filter and the outer carboxylates allowed building of a NavAb-based model with tetrodotoxin-channel contacts similar to those proposed previously. This hypothesis also allowed us to reproduce in Nav1 the folding-stabilizing contacts between long-side chain residues in P1 and P2, which are seen in NavAb. The NavAb-based inner-pore model of Nav1 preserved major features of our previous KcsA-based models, including the access pathway for ligands through the repeat III/IV interface and their interactions with specific residues. Thus, structural properties of eukaryotic voltage-gated sodium channels that are suggested by functional data were reproduced in the NavAb-based models built by using the unaltered template structure but with adjusted sequence alignment. Sequences of eukaryotic calcium channels aligned with NavAb without insertions/deletions, which suggests that NavAb is a promising basis for the modeling of calcium channels. Copyright © 2012 The American Society for Pharmacology and Experimental Therapeutics.


Andrews P.W.,McMaster University | Bharwani A.,McMaster University | Lee K.R.,McMaster University | Fox M.,University of California at Irvine | Thomson J.A.,University of Virginia
Neuroscience and Biobehavioral Reviews | Year: 2015

The role of serotonin in depression and antidepressant treatment remains unresolved despite decades of research. In this paper, we make three major claims. First, serotonin transmission is elevated in multiple depressive phenotypes, including melancholia, a subtype associated with sustained cognition. The primary challenge to this first claim is that the direct pharmacological effect of most symptom-reducing medications, such as the selective serotonin reuptake inhibitors (SSRIs), is to increase synaptic serotonin. The second claim, which is crucial to resolving this paradox, is that the serotonergic system evolved to regulate energy. By increasing extracellular serotonin, SSRIs disrupt energy homeostasis and often worsen symptoms during acute treatment. Our third claim is that symptom reduction is not achieved by the direct pharmacological properties of SSRIs, but by the brain's compensatory responses that attempt to restore energy homeostasis. These responses take several weeks to develop, which explains why SSRIs have a therapeutic delay. We demonstrate the utility of our claims by examining what happens in animal models of melancholia and during acute and chronic SSRI treatment. © 2015 Elsevier Ltd.


Wystrach A.,University of Sussex | Schwarz S.,McMaster University
Current Biology | Year: 2013

Insect navigation is a fruitful system for analysing the ingenious and economical mechanisms that can underlie complex behaviour [1]. Past work has highlighted unsuspected navigational abilities in ants and bees, such as accurate path integration, long distance route following or homing from novel locations [2]. Here we report that ants can deal with one of the greatest challenges for any navigator: uncontrolled passive displacements. Foraging ants were blown by a jet of air over 3 meters into a dark pit. When subsequently released at windless unfamiliar locations, ants headed in the compass direction opposite to the one they had been blown away, thus functionally increasing their chance of returning to familiar areas. Ants do not appear to collect directional information during the actual passive displacement, but beforehand, while clutching the ground to resist the wind. During that time window, ants compute and store the compass direction of the wind. This is achieved by integrating the egocentric perception of the wind direction relative to their current body-axis with celestial compass information from their eyes. © 2013 Elsevier Ltd.


Spyropoulos A.C.,University of Rochester | Douketis J.D.,McMaster University
Blood | Year: 2012

The periprocedural management of patients receiving long-term oral anticoagulant therapy remains a common but difficult clinical problem, with a lack of highquality evidence to inform best practices. It is a patient's thromboembolic risk that drives the need for an aggressive periprocedural strategy, including the use of heparin bridging therapy, to minimize time off anticoagulant therapy, while the procedural bleed risk determines how and when postprocedural anticoagulant therapy should be resumed. Warfarin should be continued in patients undergoing selected minor procedures, whereas in major procedures that necessitate warfarin interruption, heparin bridging therapy should be considered in patients at high thromboembolic risk and in a minority of patients at moderate risk. Periprocedural data with the novel oral anticoagulants, such as dabigatran, rivaroxaban, and apixaban, are emerging, but their relatively short half-life, rapid onset of action, and predictable pharmacokinetics should simplify periprocedural use. This review aims to provide a practical, clinician-focused approach to periprocedural anticoagulant management. © 2012 by The American Society of Hematology.


Qiao H.,McMaster University | Agnew S.R.,University of Virginia | Wu P.D.,McMaster University
International Journal of Plasticity | Year: 2015

A recently developed crystal plasticity model for describing twinning and detwinning behavior is employed to simulate the behavior of extruded Mg alloy, ZK60A. Notably, accounting for the initial texture and calibrating the model using tension and compression along one direction permits prediction of the strength anisotropy, strength asymmetry, and strain hardening behavior along other directions, for cases for which the contribution of twinning is large, small and intermediate. The model discriminates between the stress required to initiate twinning and that required to grow (thicken) previously existing twins. This enables the model to simulate the unusual stress-strain hysteresis behavior during twinning (e.g., sharp yielding behavior) as well as that of detwinning (characterized by quite gradual yielding). The strain hardening plateau which occurs during both twinning and detwinning are captured, as are the rapid hardening induced by the exhaustion of these mechanisms. Finally, the modeling is validated using previously published in-situ neutron diffraction data. The predicted diffracted intensity evolution, which is indicative of the volume fraction of twinning compares well with the experimental data. For the first time, the lattice strain evolutions during cyclic loading (involving twinning and detwinning) of an extruded magnesium alloy are predicted. Most features of the experimentally observed internal strain evolution are well-described. In particular, the inflections which may be associated with the initiation of particular deformation mechanisms: basal and non-basal slips, as well as deformation twinning are predicted. Careful analysis of the lattice strains reveals greater than expected load sharing by the precipitate phase. © 2014 Elsevier Ltd.


Barto L.,McMaster University | Barto L.,Charles University | Kozik M.,Jagiellonian University
Proceedings of the Annual ACM Symposium on Theory of Computing | Year: 2012

An algorithm for a constraint satisfaction problem is called robust if it outputs an assignment satisfying at least (1-g(ε))-fraction of the constraints given a (1-ε)-satisfiable instance, where g(ε) → 0 as ε → 0, g(0)=0. Guruswami and Zhou conjectured a characterization of constraint languages for which the corresponding constraint satisfaction problem admits an efficient robust algorithm. This paper confirms their conjecture. © 2012 ACM.


Sana F.,McMaster University | Weston T.,York University | Cepeda N.J.,York University
Computers and Education | Year: 2013

Laptops are commonplace in university classrooms. In light of cognitive psychology theory on costs associated with multitasking, we examined the effects of in-class laptop use on student learning in a simulated classroom. We found that participants who multitasked on a laptop during a lecture scored lower on a test compared to those who did not multitask, and participants who were in direct view of a multitasking peer scored lower on a test compared to those who were not. The results demonstrate that multitasking on a laptop poses a significant distraction to both users and fellow students and can be detrimental to comprehension of lecture content. © 2012 Elsevier Ltd. All rights reserved.


Siegal D.,McMaster University | Yudin J.,McMaster University | Kaatz S.,Ford Motor Company | Douketis J.D.,McMaster University | And 2 more authors.
Circulation | Year: 2012

Background-: Periprocedural bridging with unfractionated heparin or low-molecular-weight heparin aims to reduce the risk of thromboembolic events in patients receiving long-term vitamin K antagonists. Optimal periprocedural anticoagulation has not been established. Methods and Results-: MEDLINE, EMBASE, and Cochrane databases (2001-2010) were searched for English-language studies including patients receiving heparin bridging during interruption of vitamin K antagonists for elective procedures. Data were independently collected by 2 investigators (κ=0.90). The final review included 34 studies with 1 randomized trial. Thromboembolic events occurred in 73 of 7118 bridged patients (pooled incidence, 0.9%; 95% confidence interval [CI], 0.0.0-3.4) and 32 of 5160 nonbridged patients (pooled incidence, 0.6%; 95% CI, 0.0-1.2). There was no difference in the risk of thromboembolic events in 8 studies comparing bridged and nonbridged groups (odds ratio, 0.80; 95% CI, 0.42-1.54). Bridging was associated with an increased risk of overall bleeding in 13 studies (odds ratio, 5.40; 95% CI, 3.00-9.74) and major bleeding in 5 studies (odds ratio, 3.60; 95% CI, 1.52-8.50) comparing bridged and nonbridged patients. There was no difference in thromboembolic events (odds ratio, 0.30; 95% CI, 0.04-2.09) but an increased risk of overall bleeding (odds ratio, 2.28; 95% CI, 1.27-4.08) with full versus prophylactic/intermediate-dose low-molecular-weight heparin bridging. Low-thromboembolic-risk and/or non-vitamin K antagonist patient groups were used for comparison. Study quality was poor with heterogeneity for some analyses. Conclusions-: Vitamin K antagonist-treated patients receiving periprocedural heparin bridging appear to be at increased risk of overall and major bleeding and at similar risk of thromboembolic events compared to nonbridged patients. Randomized trials are needed to define the role of periprocedural heparin bridging. © 2012 American Heart Association, Inc.


Belyk M.,McMaster University | Kraft S.J.,Wayne State University | Brown S.,McMaster University
European Journal of Neuroscience | Year: 2015

Stuttering is a speech disorder characterised by repetitions, prolongations and blocks that disrupt the forward movement of speech. An earlier meta-analysis of brain imaging studies of stuttering (Brown et al., 2005) revealed a general trend towards rightward lateralization of brain activations and hyperactivity in the larynx motor cortex bilaterally. The present study sought not only to update that meta-analysis with recent work but to introduce an important distinction not present in the first study, namely the difference between 'trait' and 'state' stuttering. The analysis of trait stuttering compares people who stutter (PWS) with people who do not stutter when behaviour is controlled for, i.e., when speech is fluent in both groups. In contrast, the analysis of state stuttering examines PWS during episodes of stuttered speech compared with episodes of fluent speech. Seventeen studies were analysed using activation likelihood estimation. Trait stuttering was characterised by the well-known rightward shift in lateralization for language and speech areas. State stuttering revealed a more diverse pattern. Abnormal activation of larynx and lip motor cortex was common to the two analyses. State stuttering was associated with overactivation in the right hemisphere larynx and lip motor cortex. Trait stuttering was associated with overactivation of lip motor cortex in the right hemisphere but underactivation of larynx motor cortex in the left hemisphere. These results support a large literature highlighting laryngeal and lip involvement in the symptomatology of stuttering, and disambiguate two possible sources of activation in neuroimaging studies of persistent developmental stuttering. © 2014 Federation of European Neuroscience Societies and John Wiley & Sons Ltd.


Grant
Agency: European Commission | Branch: FP7 | Program: CP-FP | Phase: HEALTH.2011.2.4.2-2;HEALTH.2011.2.4.3-3 | Award Amount: 7.93M | Year: 2011

Physical activity is a powerful lifestyle factor that on average reduces risk for development of diabetes and cardiovascular disease. Nevertheless, we have demonstrated that following supervised endurance exercise training, 20% of subjects show no change in fitness and 30% demonstrate no improvement in insulin sensitivity or worse-still an adverse response. Our concept is that by using molecular profiling of blood/muscle samples we will develop personalised lifestyle intervention tools. Further, revealing the biological basis for a variable metabolic or cardiovascular response to exercise will enable us to propose new targets and biomarkers for drug discovery efforts directly in humans. Using our established OMICS approaches (RNA, DNA and Metabo-) we will generate classifiers that predict the responses to exercise-therapy (fitness and insulin sensitivity). Classifier generation is a statistical strategy for diagnosis or prognosis. Critically, we have a large human tissue biobank, including subjects with insulin-resistance; young to elderly males and females, as well as twins. Our SME partners have significant intellectual property and capacity in the field of bio-prediction, with a proven track-record of collaboration with the team and product development. We will add to the diversity of our biobank by carrying-out an exercise intervention study using a novel time-efficient strategy that we have recently proven to be effective in reducing insulin resistance in sedentary young people and in middle aged obese subjects. A time-efficient protocol is a critical as lack-of-time is a key reason for not maintaining physical activity levels. Finally, we have a novel out-bred rodent model that replicates high and low exercise training responses and we will establish its suitability for future drug screening purposes. Because of these substantial pre-existing resources we believe that our project has a very high probability of delivering on its goals of improving the healthcare of European citizens


News Article | November 2, 2016
Site: marketersmedia.com

KIRKLAND LAKE, ON / ACCESSWIRE / November 2, 2016 / RJK Explorations Ltd. (TSXV: RJX.A) ("RJK" or the "Company") would like to announce that at its Annual and Special Shareholders Meeting, William ("Bill") E. MacRae M.Sc., P.Geo., was elected to the five-member board of the Company. Bill has over 40 years of varied experience in the mining industry, primarily in gold exploration and development, since graduating from McMaster University with a post graduate degree in Geology. Bill has worked for such companies as Noranda, Newmont, Kinross Gold, Placer Dome, the Geological Survey of Canada, the Ontario Geological Survey, along with several publicly-listed junior exploration companies, including acting as VP Exploration for one and a director of another. Bill has also taken executive positions with several volunteer boards (the Porcupine Prospectors and Developers - President, the Ontario Prospectors Association - Vice President, and the Timmins Economic Development Corporation (1991 to 2011). "We believe Bill will be an excellent addition to the Company and has already begun to contribute with his skill set on the corporate, exploration and development sides, particularly with the recent acquisition of the Maude Lake Gold Property," said Glenn Kasner, President of the Company. RJK is a junior exploration company primarily engaged in gold exploration with projects located in BC and Ontario. It's recently acquired 100 percent owned flagship "Maude Lake Gold Property" is an advanced project, located within the prolific Timmins- Matheson gold corridor. The project sits within Patented and Leased Mining Claims, containing a historic (non-compliant 43-101) high-grade gold resource historically delineated from over 49,000 meters of drilling, surface and underground development. This news release includes certain forward-looking statements, which may include, but are not limited to, statements concerning future mineral exploration and property option payments. Any statements contained herein that are not statements of historical facts may be deemed to be forward-looking, including those identified by the expressions "will", "anticipate", "believe", "plan", "estimate", "expect", "intend", "propose" and similar expressions. Forward-looking statements involve known and unknown risks and uncertainties that could cause actual results, performance, or achievements to differ materially from those expressed or implied in this news release. Factors that could cause actual results to differ materially from those anticipated in this news release include, but are not limited to, the financial resources of the Corporation being inadequate to carry out its stated plans. RJK assumes no obligation to update the forward-looking statements or to update the reasons why actual results could differ from those reflected in the forward-looking statements except as required by applicable law. KIRKLAND LAKE, ON / ACCESSWIRE / November 2, 2016 / RJK Explorations Ltd. (TSXV: RJX.A) ("RJK" or the "Company") would like to announce that at its Annual and Special Shareholders Meeting, William ("Bill") E. MacRae M.Sc., P.Geo., was elected to the five-member board of the Company. Bill has over 40 years of varied experience in the mining industry, primarily in gold exploration and development, since graduating from McMaster University with a post graduate degree in Geology. Bill has worked for such companies as Noranda, Newmont, Kinross Gold, Placer Dome, the Geological Survey of Canada, the Ontario Geological Survey, along with several publicly-listed junior exploration companies, including acting as VP Exploration for one and a director of another. Bill has also taken executive positions with several volunteer boards (the Porcupine Prospectors and Developers - President, the Ontario Prospectors Association - Vice President, and the Timmins Economic Development Corporation (1991 to 2011). "We believe Bill will be an excellent addition to the Company and has already begun to contribute with his skill set on the corporate, exploration and development sides, particularly with the recent acquisition of the Maude Lake Gold Property," said Glenn Kasner, President of the Company. RJK is a junior exploration company primarily engaged in gold exploration with projects located in BC and Ontario. It's recently acquired 100 percent owned flagship "Maude Lake Gold Property" is an advanced project, located within the prolific Timmins- Matheson gold corridor. The project sits within Patented and Leased Mining Claims, containing a historic (non-compliant 43-101) high-grade gold resource historically delineated from over 49,000 meters of drilling, surface and underground development. This news release includes certain forward-looking statements, which may include, but are not limited to, statements concerning future mineral exploration and property option payments. Any statements contained herein that are not statements of historical facts may be deemed to be forward-looking, including those identified by the expressions "will", "anticipate", "believe", "plan", "estimate", "expect", "intend", "propose" and similar expressions. Forward-looking statements involve known and unknown risks and uncertainties that could cause actual results, performance, or achievements to differ materially from those expressed or implied in this news release. Factors that could cause actual results to differ materially from those anticipated in this news release include, but are not limited to, the financial resources of the Corporation being inadequate to carry out its stated plans. RJK assumes no obligation to update the forward-looking statements or to update the reasons why actual results could differ from those reflected in the forward-looking statements except as required by applicable law.


News Article | November 10, 2016
Site: www.eurekalert.org

Hamilton, ON (Nov. 9, 2016) -- Middle-age adults living with a combination of arthritis, heart disease or diabetes, and depression are more likely to experience disability and limited involvement in society, new research from McMaster University has found. The study, published in the Journal of Epidemiology and Community Health, found that physical and mental chronic conditions, alone and in combination, were strongly associated with disability and social participation restrictions. However, the impact of these combinations of conditions differed by gender and age. The research was led by Lauren Griffith, an associate professor in the Department of Clinical Epidemiology and Biostatics and the holder of the McLaughlin Foundation Professorship in Population and Public Health. "These findings help us to better understand, at a population level, the biggest drivers of disability for middle-aged and older adults," said Griffith. "What this research shows is that depending on your age and sex, the specific chronic diseases most highly associated with disability in the population differ." To conduct the study, the research team analyzed population-based data from more than 15,000 participants in the Canadian Community Health Survey on Healthy Aging. The survey, which was conducted between 2008 and 2009, gathered information from adults aged 45 to 85 years old who were not institutionalized and living in one of 10 Canadian provinces. While the association between single chronic conditions and disability is well documented, there is little research examining the combination of both physical and mental chronic conditions on disability and social participation. The researchers concluded that knowing which chronic conditions are associated with greater disability and social participation limitations may help clinicians to target treatment strategies for patients. Similarly, for policy-makers, this information may help in the development of preventative health strategies for individual conditions, as well as clusters of diseases. "Oftentimes, when we are looking at disability, especially for chronic conditions, we are looking at the 65 and older age group," Griffith said. "But if we want to be able to develop interventions earlier to help prevent or slow down the progression of disability, we need to start looking at the impact of chronic conditions on younger age groups." A downloadable photo of Lauren Griffith may be found here: http://adobe. McMaster provides a high definition broadcast studio that can connect with any television broadcaster around the world. To book an interview, please contact:


News Article | April 27, 2016
Site: phys.org

Researchers at McMaster University's Stem Cell and Cancer Research Institute have made significant steps forward in understanding the stem cells of the human blood system after discovering how a key protein allows for better control and regeneration of these cells.


News Article | December 1, 2016
Site: www.newscientist.com

What can your face say about you? Face recognition technology can pick up on things like your age, gender and maybe even your mood. Now, two researchers say it could even tell whether you’re a criminal. They are claiming to have developed a system that, when shown a series of faces it has never encountered before, can pick out the ones belonging to convicted criminals. But other researchers have criticised the results, and say the work raises ethical questions over what face recognition technology can and should be used to detect. It’s clearly an “emotionally charged” subject, says Xiaolin Wu at McMaster University in Hamilton, Canada, who co-authored the study. He and his colleague Xi Zhang at Shanghai Jiao Tong University, China, had set out to disprove the idea that there could be a link between someone’s face and criminality – “so we were very surprised by the result”, says Wu. The researchers exploited machine learning, asking face recognition software to guess whether a person in an ID-style picture was a criminal or not, and then feeding it the correct answer. It learned to tell the difference, eventually achieving an accuracy of up to 90 per cent, they say. However, other face recognition experts question their methodology. One issue is that the criminal images came from a Chinese database of ID photos, whereas the non-criminal images were internet profile pictures belonging to Chinese citizens, meaning the system could have picked up on differences between the two sources rather than in people’s faces. Wu and Zhang tried to counteract this by standardising the images, for example making them the same size and turning them greyscale. But Jonathan Frankle from the Massachusetts Institute of Technology says that’s not enough. “The fact that the data comes from two different places is a fundamental flaw. Any differences will be picked up,” he says. It’s not a problem to ask a controversial question, says Francois Chollet, a deep learning researcher at Google, but the science has to be well founded. “It is not ethical to make a bad science argument,” he says. Mike Cook at Falmouth University, UK, says that this kind of research risks turning machine learning into the “phrenology of the 21st century”, like deducing a person’s traits from the bumps on their head. Seemingly impartial computer programs give an air of legitimacy to inaccurate or controversial interpretations. “Suddenly, the conclusions drawn by an algorithm have been cleaned up and made to look scientific,” he says. In fact, these systems are not objective and are often subject to the same biases as humans. “[They] are tools that are forged by being hammered with our own beliefs and observations,” says Cook. That’s not to say computers can’t make accurate observations about a person’s face, sometimes even better than humans. Face recognition software can already easily pick up things like the shape of a person’s nose or whether they are smiling. Researchers at the University of Rochester, New York, even claim to have developed an algorithm that can differentiate between the faces of Chinese, Japanese and Korean people with an accuracy of 75 per cent – significantly better than humans. But even where the science is sound, ethical questions arise over how these algorithms should be applied to real-world situations. Detecting someone’s ethnicity, for example, could be used to better target services, but it could also be used to discriminate. Last year, Microsoft released a web app that used machine learning to gauge someone’s age from their picture. It was intended as a “fun app”, but then some UK newspapers used the system on images of refugees in an attempt to detect adults taking advantage of concessions given to children, forcing Microsoft to respond that it was never meant to offer a definitive assessment of age. And when considering more complex or abstract characteristics than nose shape or age, it’s important to know the limits of what the technology can tell us. Alexander Todorov at Princeton University says you simply can’t glean someone’s general personality or behaviour from a snapshot of their face. It’s “super easy” to tell if a person is sleep-deprived based on paler skin and droopy eyes, he says – and this could even be used to prevent someone engaging in a task that requires alertness, such as operating dangerous machinery. “But if it is used to predict what the person is like in general, this is wrong.” Researchers do not always have control over how their work is used. Making findings public, as Wu and Zhang have done, means that anyone can scrutinise their validity, but it doesn’t have to be that way. “What would scare me more would be if a private company did this and sold it to a police department. There’s nothing to stop that from happening,” says Frankle. Earlier this year, Frankle and his colleagues found that the majority of US police departments using face recognition do little to ensure that the software is accurate. As the technology becomes more widely used, so does the urgency of weighing up the ethics of its use. Computer scientists are gaining increasing power over people’s lives, says Chollet, but they don’t have the ethical education to support that role. “This is something we have to fix.


News Article | November 8, 2016
Site: www.eurekalert.org

Hamilton, ON (Nov. 8, 2016) - Scientists at McMaster University's Stem Cell and Cancer Research Institute in collaboration with Sick Children's Hospital have discovered genetic alterations in the gene DIXDC1 in individuals with autism spectrum disorders (ASD). This gene was found to change the way brain cells grow and communicate. This finding, published today in Cell Reports, provides new insights into ASD that will guide identification of new medications for people with ASD. This is critical because ASD affects one in 68 individuals, and there are no medications that target the core symptoms of this complex disorder. The study was led by Karun Singh, a scientist with the Stem Cell and Cancer Research Institute (SCCRI) and an assistant professor of biochemistry and biomedical sciences at McMaster's Michael G. DeGroote School of Medicine. The researchers discovered an important 'on' button in DIXDC1 protein that instructs brain cells to form mature connections called synapses with other brain cells during development. Working with the leading geneticist Stephen Scherer from The Hospital for Sick Children and the University of Toronto, the team identified genetic changes that keep DIXDC1 turned "off" in a group individuals with autism, predicted to cause brain synapses to stay immature, and reduce brain activity. "Because we pinpointed why DIXDC1 is turned off in some forms of autism, my lab at the SCCRI, which specializes in drug discovery, now has the opportunity to begin the searching for drugs that will turn DIXDC1 back on and correct synaptic connections," said Singh. "This is exciting because such a drug would have the potential to be a new treatment for autism." While this discovery holds promise, mutations in DIXDC1 account for only a small number of individuals with autism and related psychiatric conditions, Singh said. "However, there is strong evidence that many other autism genes disrupt the development of synapses similar to DIXDC1; therefore, the key to a new treatment for autism will be to find safe medications that restores brain cell synapse growth and activity." Mick Bhatia, director of the SCCRI, said the discovery signifies the institute's strategic entry into the area of neural disease and genetic guided personalized drug development. "This is the first step of many ahead as the SCCRI continues to strive for near term impact on human health through stem cell research," he said, adding that the addition of Singh's team was enabled by the support from the David Braley Chair in Neural Stem Cell Research.


News Article | April 26, 2016
Site: www.biosciencetechnology.com

Could bacteria in your gut be used to cure or prevent neurological conditions such as post-traumatic stress disorder (PTSD), anxiety or even depression? Two researchers sponsored by the Office of Naval Research (ONR) think that's a strong possibility. Dr. John Bienenstock and Dr. Paul Forsythe--who work in The Brain-Body Institute at McMaster University in Ontario, Canada--are investigating intestinal bacteria and their effect on the human brain and mood. "This is extremely important work for U.S. warfighters because it suggests that gut microbes play a strong role in the body's response to stressful situations, as well as in who might be susceptible to conditions like PTSD," said Dr. Linda Chrisey, a program officer in ONR's Warfighter Performance Department, which sponsors the research. The trillions of microbes in the intestinal tract, collectively known as the gut microbiome, profoundly impact human biology--digesting food, regulating the immune system and even transmitting signals to the brain that alter mood and behavior. ONR is supporting research that's anticipated to increase warfighters' mental and physical resilience in situations involving dietary changes, sleep loss or disrupted circadian rhythms from shifting time zones or living in submarines. Through research on laboratory mice, Bienenstock and Forsythe have shown that gut bacteria seriously affect mood and demeanor. They also were able to control the moods of anxious mice by feeding them healthy microbes from fecal material collected from calm mice. Bienenstock and Forsythe used a "social defeat" scenario in which smaller mice were exposed to larger, more aggressive ones for a couple of minutes daily for 10 consecutive days. The smaller mice showed signs of heightened anxiety and stress--nervous shaking, diminished appetite and less social interaction with other mice. The researchers then collected fecal samples from the stressed mice and compared them to those from calm mice. "What we found was an imbalance in the gut microbiota of the stressed mice," said Forsythe. "There was less diversity in the types of bacteria present. The gut and bowels are a very complex ecology. The less diversity, the greater disruption to the body." Bienenstock and Forsythe then fed the stressed mice the same probiotics (live bacteria) found in the calm mice and examined the new fecal samples. Through magnetic resonance spectroscopy (MRS), a non-invasive analytical technique using powerful MRI technology, they also studied changes in brain chemistry. "Not only did the behavior of the mice improve dramatically with the probiotic treatment," said Bienenstock, "but it continued to get better for several weeks afterward. Also, the MRS technology enabled us to see certain chemical biomarkers in the brain when the mice were stressed and when they were taking the probiotics." Both researchers said stress biomarkers could potentially indicate if someone is suffering from PTSD or risks developing it, allowing for treatment or prevention with probiotics and antibiotics. Later this year, Bienenstock and Forsythe will perform experiments involving fecal transplants from calm mice to stressed mice. They also hope to secure funding to conduct clinical trials to administer probiotics to human volunteers and use MRS to monitor brain reactions to different stress levels. Gut microbiology is part of ONR's program in warfighter performance. ONR also is looking at the use of synthetic biology to enhance the gut microbiome. Synthetic biology creates or re-engineers microbes or other organisms to perform specific tasks like improving health and physical performance. The field was identified as a top ONR priority because of its potential far-ranging impact on warfighter performance and fleet capabilities.


News Article | November 23, 2016
Site: www.prweb.com

When using a flow cytometry core facility, researchers commonly evaluate how to process their cellular samples most efficiently, while also ensuring the highest quality and reproducibility of their data. In this webinar, sponsored by Miltenyi Biotec, case studies and examples will be presented on the how the Miltenyi Biotec line of instrumentation, including the gentleMACS™ Dissociator, autoMACS® Pro Separator and MACSQuant® Analyzer, has improved the performance and quality of research projects in a core facility setting. Participants of the webinar will learn best practices for optimizing sample preparation and experimental design for cell analysis that will help researchers get the most out of their flow analysis. Some key topics of discussion will include increased yield and reproducibility during tissue dissociation, efficient rare cell sorting through pre-enrichment and decreased time spent cleaning and maintaining instruments. Chris Spring, a flow cytometry core specialist at St. Michael’s Hospital Research Institute in Toronto, will be the speaker for this webinar. Spring received his Master of Science in cellular and molecular biology from McMaster University in Ontario. He has spent nearly 15 years working in cell biology, primarily working on analyzing the role of platelets in immunological and cardiovascular diseases. For the past six years, Spring has run a flow cytometry and cell sorting core facility serving nearly 45 laboratories and 500 scientists in the Keenan Research Centre for Biomedical Science at St. Michael’s Hospital. He also currently serves as the co-president of the Canadian Microscopy and Cytometry Association. LabRoots will host the webinar, with no cost for participants, beginning at 9 a.m. PT, 12 p.m. ET on November 30, 2016. To read full event details or to register for free, click here. About Miltenyi Biotec Miltenyi Biotec is a global provider of products and services that advance biomedical research and cellular therapy. The company’s innovative tools support research at every level, from basic research to translational research to clinical application. This integrated portfolio enables scientists and clinicians to obtain, analyze, and utilize the cell. Miltenyi Biotec’s technologies cover techniques of sample preparation, cell isolation, cell sorting, flow cytometry, cell culture, molecular analysis, and preclinical imaging. Their more than 25 years of expertise spans research areas including immunology, stem cell biology, neuroscience, and cancer, and clinical research areas like hematology, graft engineering, and apheresis. In their commitment to the scientific community, Miltenyi Biotec also offers comprehensive scientific support, consultation, and expert training. Today, Miltenyi Biotec has more than 1,500 employees in 25 countries – all dedicated to helping researchers and clinicians around the world make a greater impact on science and health. About LabRoots LabRoots is the leading scientific social networking website and producer of educational virtual events and webinars. Contributing to the advancement of science through content sharing capabilities, LabRoots is a powerful advocate in amplifying global networks and communities. Founded in 2008, LabRoots emphasizes digital innovation in scientific collaboration and learning, and is a primary source for current scientific news, webinars, virtual conferences, and more. LabRoots has grown into the world’s largest series of virtual events within the Life Sciences and Clinical Diagnostics community.


News Article | October 25, 2016
Site: phys.org

Research from the University of Sussex suggests that humans are unique among primates in being able to intentionally alter the frequencies of our voices to sound larger or smaller than we really are, a capacity that is likely to have evolved over many thousands of years. Body size is very important for many animals, including humans, in predicting social dominance, reproductive success and health. Because of this, communicating body size to others through vocal signals is important, and being able to alter ones voice to trick other members of the species is a useful evolutionary tool. Psychologists Dr Kasia Pisanski and Dr David Reby, in collaboration with researchers from the University of Havana, University of Wrocław, and McMaster University, have discovered that humans can intentionally lower or raise the frequencies of our voices to sound larger or smaller than we actually are. In the first study of its kind to focus exclusively on human vocal modulation of body size, the ability was demonstrated in men and women from three distinct cultures (Canada, Cuba and Poland). The researchers also found that men modulate their voices more than women, which supports the likelihood that exaggeration of body size was more important for men's social and reproductive success during human evolution. "Our results are really interesting when we compare ourselves to other animals," said Dr Pisanski, who worked on the research. "Nonhuman primates are far less capable than we are at modulating their voice pitch and resonances on demand, so we humans are special in this regard. This can provide clues into the evolution of nonverbal communication in humans. "Our results also compliment a growing number of studies that suggest that people might actually modulate their voices quite often in real life situations – changing their voice to sound more attractive on a first date, or to sound more dominant during a political debate, for example." The researchers' next step will be to fully test whether people can effectively "fake" their body size in modern life when interacting with other humans. More specifically, they will examine whether people are "tricked" by modulated vocal cues to body size, or rather, can detect that they are faked. "We are only just now beginning to explore the truly dynamic nature of the human voice as an everyday social tool," added Dr Pisanski. Explore further: Research reveals individual differences in adult male voices emerge long before puberty More information: Katarzyna Pisanski et al. Volitional exaggeration of body size through fundamental and formant frequency modulation in humans, Scientific Reports (2016). DOI: 10.1038/srep34389


News Article | December 8, 2016
Site: www.chromatographytechniques.com

Smallpox plagued humanity for centuries, claiming millions of lives, before vaccination eradicated it in 1980. Some theories place its scourge as far back as ancient Egypt and the peak of Rome. But DNA evidence in a 17th century mummy indicates smallpox may be a more modern disease than originally believed, according to a new study in the journal Current Biology. “Scientists don’t yet fully comprehend where smallpox came from and when it jumped into humans,” said Hendrik Poinar, senior author, from both McMaster University and the Michael G. DeGroote Institute of Infectious Disease Research. The smallpox DNA was collected from a child in Lithuania who had died in the middle of the 17th century – a time beset by smallpox outbreaks and rampant death. The DNA was heavily fragmented, but the scientists sequenced it. (Since none of the virus was live, it was not dangerous to handle). Many theories held that smallpox outbreaks had been the cause of widespread death as far back as ancient Egypt and the peak of the Roman Empire, all the way through to the 20th century. But the Lithuanian sample shows such similarities to the samples collected right before the 1980 eradication, that the evolutionary models showed it probably jumped to humans in just the last few centuries. “This study sets the clock of smallpox evolution to a much more recent time scale,” said Eddie Holmes, another author, from the University of Sydney. “Although it is still unclear what animal is the true reservoir of smallpox virus and when the virus first jumped into humans.” They also found that Variola virus evolved into two strains after the development of the first vaccines using dead forms of the virus at the end of the 18th century. The study raises further questions, especially whether the disease outbreaks among the people of Central and South America during Spanish colonization were indeed smallpox.


News Article | December 14, 2015
Site: news.mit.edu

On Nov. 29, a workshop was held at MIT to honor the career and achievements of Sow-Hsin Chen, emeritus professor of nuclear science and engineering, and to celebrate his 80th birthday. The one-day workshop on “Topics in Soft Condensed Matter” featured talks by 10 speakers from around the world and brought together his former collaborators, students, and other researchers in the field. “It is a great honor to have studied with Professor Chen as an MIT student many years ago,” said Yun Liu, a former graduate student, currently a professor at the University of Delaware. “We are very excited to celebrate his 80 birthday with this workshop. The breadth and depth of his scientific contribution to the neutron scattering field and soft condensed matter physics is tremendous and far-reaching.” Chen is a pioneer in using neutron scattering to study a wide range of scientific problems such as microemulsion, cement, proteins, surfactants, hydrogen storage materials, and water. He is especially well-known internationally for his contributions to understanding the dynamic properties of supercooled and interfacial water with the use of neutron-scattering techniques. His lifelong achievements have been recognized by the international community — as noted by many prestigious awards he has received. Of note, he won the 2008 Clifford G. Shull Prize for his seminal contributions to understanding the dynamical properties of supercooled and interfacial water, and the 2015 Guinier Prize for his scientific contributions to soft condensed-matter physics. Also as an educator, Chen has been recognized for his training of young scientists in the use of those same techniques. Chen received his BS in physics from National Taiwan University in 1956, and his MS in physics from National Tsing Hua University in 1958. He arrived in the U.S. under an International Atomic Energy Agency fellowship, and che ompleted an MS in nuclear science at the University of Michigan in 1962, and his PhD in physics at McMaster University in Canada in 1964 under the Nobel laureate Bertram N. Brockhouse. He joined the faculty of the MIT Department of Nuclear Engineering in 1968. Chen continues to be a valuable contributor and influencer in the field and the department.


News Article | April 28, 2016
Site: www.biosciencetechnology.com

Blood stem cells can be used as therapeutics for a range of blood-based disorders, such as leukemia, lymphoma and sickle cell disease, yet they are usually in short supply. A team of researchers from McMaster University’s Stem Cell and Cancer Research Institute have gained knowledge about a key protein that enables greater control and regeneration of these cells, leading to new strategies to control the growth of blood stem cells and making enhanced numbers for transplantation possible. Specifically, the team, led by Kristin Hope, assistant professor of biochemistry and biomedical sciences, examined stem cells from umbilical cord blood.  These types of stem cells have been proven to be effective for treating adult blood cancers, and unique properties such as accessibility and adaptability make them more appealing for transplantation.  However, they are not widely available as only five percent of all samples of individual cord blood samples contain enough cells for transplant. The findings, published April 27 in Nature, demonstrate how the protein known as Musashi-2 controls the function and development of these blood stem cells. “Most stem cell studies focus on proteins that bind DNA to control gene output,” co-corresponding author, Gene Yeo, associate professor at the University of California San Diego, said in a prepared statement. “The prominent role we found for Musashi-2, a protein that instead binds to RNA, also underscores an urgency to study this second layer of gene regulation in stem cells. In a university press release Hope said that by shining a light on the way these stem cells work, the researchers now have a new level of understanding as to how these cells operate, giving scientists a big advantage in deciding how to maximize the stem cells in therapeutics.  With the ability to control regeneration of the cells, more people will have access to necessary treatments. “Providing enhanced numbers of stem cells for transplantation could alleviate some of the current post-transplantation complications and allow for faster recoveries, in turn reducing overall health care costs and wait times for newly diagnosed patients seeking treatment,” Hope said. She noted that more donated samples could be used for transplants using the method demonstrated by the team.


News Article | February 23, 2017
Site: www.sciencenews.org

Even tiny brains can learn strange and tricky stuff, especially by watching tiny experts. Buff-tailed bumblebees got several chances to watch a trained bee roll a ball to a goal. These observers then quickly mastered the unusual task themselves when given a chance, researchers report in the Feb. 24 Science. And most of the newcomers even improved on the goal-sinking by taking a shortcut demo-bees hadn’t used, says behavioral ecologist Olli Loukola at Queen Mary University of London. Learning abilities of animals without big vertebrate brains often get severely underestimated, Loukola says. “The idea that small brains constrain insects is kind of wrong, or old-fashioned.” He and colleagues had previously challenged bees to learn, in stages, the not very beelike skill of pulling a string to reveal a hidden flower. Bees eventually succeeded. So the researchers devised an even more fiendish protocol to see how far insect learning could go. Loukola invented six-legged sort-of soccer (or football for bees in London) in which a Bombus terrestris rolls a yellow ball about the size of its own body down a trackway to a central goal, where researchers dispense sugary rewards. This time, there was no pampering, no working up in stages to full completion of the test. But bees could observe a trained ball roller, a ball moving on its own (thanks to a researcher sliding a magnet under the arena) or get no advance ball-movement hints at all. The 10 bees that saw an expert bee roll the ball and score three times before their own attempt succeeded in almost every trial at the task. Watching ghostly movement didn’t help as much, and only a few bees happened on the solution on their own. Social learning matters, but Loukola highlights the way bees changed the technique they watched. Most of the successful bees ignored the ball they had seen rolled and instead used one closer to the goal, doing less work for the same reward. “Fascinating,” says Dave Goulson of the University of Sussex in England, who studies bumblebees. Ball rolling may not be part of routine foraging behavior, but he notes that bees do drag around nesting material, moving backward as they do when playing soccer in the test. And they occasionally remove fat almost ball-like grubs from the nest with a similar technique. Exactly how the bees solved the problem remains a puzzle, says Bennett Galef of McMaster University in Hamilton, Canada, who has studied social learning. He would like to know more details, for instance, about how untrained bees react to a ball. Loukola often gets a different question: Could he train bumblebees to play a soccer match? He says he could certainly train some to score on one side of an arena and some on the opposite side. Then he might be able to study whether bumblebees could share a ball.


News Article | November 10, 2016
Site: www.sciencedaily.com

Scientists at McMaster University's Stem Cell and Cancer Research Institute in collaboration with Sick Children's Hospital have discovered genetic alterations in the gene DIXDC1 in individuals with autism spectrum disorders (ASD). This gene was found to change the way brain cells grow and communicate. This finding, published in Cell Reports, provides new insights into ASD that will guide identification of new medications for people with ASD. This is critical because ASD affects one in 68 individuals, and there are no medications that target the core symptoms of this complex disorder. The study was led by Karun Singh, a scientist with the Stem Cell and Cancer Research Institute (SCCRI) and an assistant professor of biochemistry and biomedical sciences at McMaster's Michael G. DeGroote School of Medicine. The researchers discovered an important 'on' button in DIXDC1 protein that instructs brain cells to form mature connections called synapses with other brain cells during development. Working with the leading geneticist Stephen Scherer from The Hospital for Sick Children and the University of Toronto, the team identified genetic changes that keep DIXDC1 turned "off" in a group individuals with autism, predicted to cause brain synapses to stay immature, and reduce brain activity. "Because we pinpointed why DIXDC1 is turned off in some forms of autism, my lab at the SCCRI, which specializes in drug discovery, now has the opportunity to begin the searching for drugs that will turn DIXDC1 back on and correct synaptic connections," said Singh. "This is exciting because such a drug would have the potential to be a new treatment for autism." While this discovery holds promise, mutations in DIXDC1 account for only a small number of individuals with autism and related psychiatric conditions, Singh said. "However, there is strong evidence that many other autism genes disrupt the development of synapses similar to DIXDC1; therefore, the key to a new treatment for autism will be to find safe medications that restores brain cell synapse growth and activity." Mick Bhatia, director of the SCCRI, said the discovery signifies the institute's strategic entry into the area of neural disease and genetic guided personalized drug development. "This is the first step of many ahead as the SCCRI continues to strive for near term impact on human health through stem cell research," he said, adding that the addition of Singh's team was enabled by the support from the David Braley Chair in Neural Stem Cell Research.


News Article | October 25, 2016
Site: www.chromatographytechniques.com

Research from the University of Sussex suggests that humans are unique among primates in being able to intentionally alter the frequencies of our voices to sound larger or smaller than we really are, a capacity that is likely to have evolved over many thousands of years. Body size is very important for many animals, including humans, in predicting social dominance, reproductive success and health. Because of this, communicating body size to others through vocal signals is important, and being able to alter ones voice to trick other members of the species is a useful evolutionary tool. Psychologists Kasia Pisanski and David Reby, in collaboration with researchers from the University of Havana, University of Wrocław and McMaster University, have discovered that humans can intentionally lower or raise the frequencies of our voices to sound larger or smaller than we actually are. In the first study of its kind to focus exclusively on human vocal modulation of body size, the ability was demonstrated in men and women from three distinct cultures (Canada, Cuba and Poland). The researchers also found that men modulate their voices more than women, which supports the likelihood that exaggeration of body size was more important for men's social and reproductive success during human evolution. "Our results are really interesting when we compare ourselves to other animals," said Pisanski, who worked on the research. "Nonhuman primates are far less capable than we are at modulating their voice pitch and resonances on demand, so we humans are special in this regard. This can provide clues into the evolution of nonverbal communication in humans. "Our results also compliment a growing number of studies that suggest that people might actually modulate their voices quite often in real life situations – changing their voice to sound more attractive on a first date, or to sound more dominant during a political debate, for example." The researchers' next step will be to fully test whether people can effectively "fake" their body size in modern life when interacting with other humans. More specifically, they will examine whether people are "tricked" by modulated vocal cues to body size, or rather, can detect that they are faked. "We are only just now beginning to explore the truly dynamic nature of the human voice as an everyday social tool," added Pisanski.


They were awarded a U.S. patent on Aug. 18 for their efforts. "Existing methods are already very effective at making hydrogen gas," said Bruce Logan, Evan Pugh Professor of Environmental Engineering. "The problem is that these methods consume fossil fuels in order to generate enough energy to create the hydrogen gas." In response to this dilemma, Logan, along with former graduate student Roland Cusick, assistant professor at the University of Illinois, and postdoctoral researcher Younggy Kim, assistant professor at McMaster University, in Hamilton, Ontario, discovered a new method for making hydrogen gas that does not require the use of fossil fuels. In this method, the researchers are able to effectively produce hydrogen gas using energy stored in ammonium bicarbonate (a heat regenerable salt) and solar heat or waste heat (like that available at power plants). "Since the new system runs on waste heat, it is effectively carbon neutral and fossil fuel neutral," Logan said. The patent, U.S. patent number 9,112,217, "Reverse electrodialysis supported microbial fuel cells and microbial electrolysis cells," describes the process. Ammonium bicarbonate and water are separated into high and low salt concentration streams using distillation, much like the process for distilling alcohol. Those streams are then fed into a reverse electrodialysis stack, which consists of a series of alternating charge (cation and anion) ion exchange membranes. This process creates an electrochemical reaction that splits the water forming both oxygen and hydrogen at the other electrode. That hydrogen can then be used on site, for example to make ammonia, or it can be compressed and containerized for a variety of other purposes. Previous similar systems have been designed to create electrical power from high and low salt concentration solutions, such as freshwater and seawater solutions. However, this is the first device created specifically for hydrogen gas production. "Many countries are limiting carbon emissions, and thus new carbon neutral methods are needed to produce transportable fuels," Logan said. "This process can help with both of those goals." The new method can be used on a large scale but is not yet economical due to the cost of the membranes. The researchers hope to find more economical solutions to this problem. "The next step is the development of very inexpensive membranes that can be produced in large amounts, similar to that done today for reverse osmosis membranes used for drinking water," Logan said. "The production of such low cost membranes could help stimulate a new industry in sustainable hydrogen gas production."


October 28, 2016 - How should plastic surgeons choose the best implant type and size for women undergoing breast augmentation surgery? Implant size selection systems based on breast tissue measurements may provide better outcomes, suggests a research review in the November issue of Plastic and Reconstructive Surgery®, the official medical journal of the American Society of Plastic Surgeons (ASPS). Tissue-based planning systems--using clinical guidelines to determine the optimal breast implant dimensions for individual patients--appear superior to approaches relying more on the patient's or surgeon's preference, according to the study by Drs. William P. Adams, Jr., of University of Texas Southwestern Medical Center, Dallas, and Daniel McKee of McMaster University, Hamilton, Ont., Canada. But further studies will be needed to clarify how breast implant size selection systems affect the outcomes of breast augmentation. The researchers performed a "data-driven review" of methods used by plastic surgeons to select the appropriate implant size for breast augmentation surgery. Breast augmentation is the most popular cosmetic plastic surgery procedure in the United States, with nearly 280,000 procedures performed in 2015, according to ASPS statistics. The review identified 33 articles on implant sizing systems. Studies evaluating TBP sizing systems were of higher quality than those in the other two categories. "The top ten studies based on methodological quality all used patients' breast dimensions before selecting final implant dimensions, and this should now be considered standard of practice based on our analysis," Drs. Adams and McKee write. The TBP studies reported low rates of repeat surgery, compared to industry standards and accepted research values. The researchers emphasize some major limitations of the available evidence on implant sizing systems. Just four out of 33 studies reported clinical outcomes that could be compared to any standard, while none of the studies compared two or more sizing systems. Overall, 60 percent of studies scored zero on the quality rating scale used--including some popular sizing systems that were "not grounded on any published data or evidence." The topic of implant selection can be an emotional one, with tension between the plastic surgeon's roles as "Artist" versus "Engineer." The researchers note that some TBP systems with the highest quality of evidence take a "middle-of-the-road" approach--based on measurements, but also considering the patient's aesthetic desires. Based on their data, Drs. Adams and McKee are evaluating a new "implant-specific" TBP system designed to guide the surgeon to a selection of manufactured implant styles and models. "Going forward," they write, "new published systems should [use] rigorous quantitative methods so that comparisons can be made in terms of patient outcomes." Plastic and Reconstructive Surgery® is published by Wolters Kluwer. Click here to read "Matching the Implant to the Breast: A Systematic Review of Implant Size Selection Systems for Breast Augmentation." Article: "Matching the Implant to the Breast: A Systematic Review of Implant Size Selection Systems for Breast Augmentation" (doi: 10.1097/PRS.0000000000002623) For more than 70 years, Plastic and Reconstructive Surgery® (http://www. ) has been the one consistently excellent reference for every specialist who uses plastic surgery techniques or works in conjunction with a plastic surgeon. The official journal of the American Society of Plastic Surgeons, Plastic and Reconstructive Surgery® brings subscribers up-to-the-minute reports on the latest techniques and follow-up for all areas of plastic and reconstructive surgery, including breast reconstruction, experimental studies, maxillofacial reconstruction, hand and microsurgery, burn repair, and cosmetic surgery, as well as news on medico-legal issues The American Society of Plastic Surgeons is the largest organization of board-certified plastic surgeons in the world. Representing more than 7,000 physician members, the Society is recognized as a leading authority and information source on cosmetic and reconstructive plastic surgery. ASPS comprises more than 94 percent of all board-certified plastic surgeons in the United States. Founded in 1931, the Society represents physicians certified by The American Board of Plastic Surgery or The Royal College of Physicians and Surgeons of Canada. Wolters Kluwer is a global leader in professional information services. Professionals in the areas of legal, business, tax, accounting, finance, audit, risk, compliance and healthcare rely on Wolters Kluwer's market leading information-enabled tools and software solutions to manage their business efficiently, deliver results to their clients, and succeed in an ever more dynamic world. Wolters Kluwer reported 2015 annual revenues of €4.2 billion. The group serves customers in over 180 countries, and employs over 19,000 people worldwide. The company is headquartered in Alphen aan den Rijn, the Netherlands. Wolters Kluwer shares are listed on Euronext Amsterdam (WKL) and are included in the AEX and Euronext 100 indices. Wolters Kluwer has a sponsored Level 1 American Depositary Receipt program. The ADRs are traded on the over-the-counter market in the U.S. (WTKWY). Wolters Kluwer Health is a leading global provider of information and point of care solutions for the healthcare industry. For more information about our products and organization, visit http://www. , follow @WKHealth or @Wolters_Kluwer on Twitter, like us on Facebook, follow us on LinkedIn, or follow WoltersKluwerComms on YouTube.


Tasker E.J.,McMaster University | Tasker E.J.,University of Florida
Astrophysical Journal | Year: 2011

We investigate the effect of star formation and diffuse photoelectric heating on the properties of giant molecular clouds (GMCs) formed in high-resolution (≲10pc) global (∼20kpc) simulations of isolated Milky-Way-type galaxy disks. The clouds are formed through gravitational fragmentation, and structures with densities n H,c>100 cm -3 are identified as GMCs. Between 1000 and 1500 clouds are created in the simulations with masses M>105 M 1 and 180-240 with masses M>106 M ⊙ in agreement with estimates of the Milky Way's population. We find that the effect of photoelectric heating is to suppress the fragmentation of the interstellar medium, resulting in a filamentary structure in the warm gas surrounding clouds. This environment suppresses the formation of a retrograde rotating cloud population, with 88% of the clouds rotating prograde with respect to the galaxy after 300Myr. The diffuse heating also reduces the initial star formation rate (SFR), slowing the conversation of gas into stars. We therefore conclude that the interstellar environment plays an important role in the GMC evolution. Our clouds live between 0 and 20Myr with a high infant mortality (t′ < 3Myr) due to cloud mergers and star formation. Other properties, including distributions of mass, size, and surface density, agree well with observations. Collisions between our clouds are common, occurring at a rate of ∼ 1/4 of the orbital period. It is not clear whether such collisions trigger or suppress star formation at our current resolution. Our SFR is a factor of 10 higher than observations in local galaxies. This is likely due to the absence of localized feedback in our models. © 2011. The American Astronomical Society. All rights reserved.

Loading McMaster University collaborators
Loading McMaster University collaborators