Montreal, Canada
Montreal, Canada

McGill University is a public research university in Montreal, Canada, officially founded by royal charter in 1821. The University bears the name of James McGill, a prominent Montreal merchant from Scotland and alumnus of Glasgow University, whose bequest in 1813 formed precursory McGill College.McGill's main campus is set at the foot of Mount Royal in Downtown Montreal with the second campus, situated near fields and forested lands in Sainte-Anne-de-Bellevue, 30 kilometres west of the downtown campus on the Montreal Island. All the academic units are organized into 11 main Faculties and Schools, and the institution is one of the two members of Association of American Universities located outside the United States. Valued at $33,421 per student, the University maintains one of the largest endowments among Canadian universities on a per-student basis.McGill offers degrees and diplomas in over 300 fields of study. Most students are enrolled in five larger Faculties, namely Arts, Science, Medicine, Engineering, and Management, with the highest entering grade of any Canadian university. Tuition fees vary significantly between in-province, out-of-province, and international students, and the scholarships are very generous yet highly competitive and relatively difficult to attain, compared to other Canadian universities.McGill counts among its alumni 12 Nobel laureates and 138 Rhodes Scholars, both the most in the country, as well as three astronauts, two Canadian prime ministers, 13 justices of the Canadian Supreme Court, four foreign leaders, 28 foreign ambassadors, nine Academy Award winners, three Pulitzer Prize winners, and 28 Olympic medalists. Throughout its long history, McGill alumni were also instrumental in inventing or initially organizing football, basketball, and ice hockey and founding several other universities, including the Universities of British Columbia, Victoria, and Alberta, and the Johns Hopkins School of Medicine. Wikipedia.


Time filter

Source Type

Patent
McGill University | Date: 2015-04-17

The present invention provides novel cancer therapeutics for treating pancreatic cancer, and novel diagnostic methods for detecting chronic pancreatitis and pancreatic cancer. The invention pertains to antagonists of dopamine receptors that inhibit the growth of pancreatic cancer cells. The invention in particular offers new therapy options based on the inhibition of the activity or expression of dopamine receptor D2 (DRD2). Diagnostic methods of the invention comprise the detection of the expression of DRD2 in pancreatic tissue. Diagnostic kits are also comprised.


Patent
McGill University | Date: 2016-06-09

Methods of reducing AMPA/NMDA ratio in D1-type medium spiny neurons (MSN) and/or reducing development of behavioural sensitization or suppressing drug induced behavioural sensitization in a subject, optionally a subject that is afflicted with an addiction, the method comprising administering to the subject in need thereof an effective amount of a Toll-like receptor 4 (TLR4) agonist or a composition comprising said TLR4 agonist, preferably wherein the TLR4 agonist is a monophosphoryl lipid A (MPLA).


Patent
McGill University | Date: 2016-09-30

This present technology relates to the use of inflammation-enabling polypeptides (or their coding sequences) to screen for agents useful for the prevention, treatment and/or alleviations of symptoms associated with an inflammatory disorder, to identify individuals susceptible of developing an exacerbated inflammatory response as well as to determine if a therapeutic regimen is capable of preventing, treating or alleviating the symptoms associated to an inflammatory disorder in an individual. The present technology also provides methods for preventing, treating and/or alleviating the symptoms associated to an inflammatory condition based on the inhibition of expression or activity of the inflammation-enabling targets.


A method for producing an arene with an aromatic CN bond ortho to an aromatic CO bond from a hydroxy arene comprising said aromatic CO bond is provided. This method comprising the steps a) ortho-oxygenating the hydroxy arene to produce an ortho-quinone, b) condensating the ortho-quinone with a nitrogen nucleophile to generate a compound of Formula (IVa) or (IVb), and c) allowing 1,5-hydrogen atom shift of the compound of Formula (IVa) or (IVb), thereby producing arenes with a CN bond ortho to a CO bond of Formula (Va) and (Vb), respectively:


Patent
The Regents Of University Of California and McGill University | Date: 2015-03-03

Provided herein are Mcl-1 antagonist compositions and methods of treating g the compositions described herein.


Patent
Hong Kong Polytechnic University and McGill University | Date: 2016-10-18

A triazole bridged flavonoid dimer compound library was efficiently constructed via the cycloaddition reaction of a series of flavonoid-containing azides (Az 1-15) and alkynes (Ac 1-17). These triazole bridged flavonoid dimers and their precursor alkyne- and azide-containing flavonoids were screened for their ability to modulate multidrug resistance (MDR) in P-gp-overexpressed cell line (LCC6MDR), MRP1-overexpressed cell line (2008/MRP1) and BCRP-overexpressed cell line (HEK293/R2 and MCF7-MX100). Generally, they displayed very promising MDR reversal activity against P-gp-, MRP1- and BCRP-mediated drug resistance. Moreover, they showed different levels of selectivity for various transporters. Overall, they can be divided into mono-selective, dual-selective and multi-selective modulators for the P-gp, MRP1 and BCRP transporters. The EC_(50 )values for reversing paclitaxel resistance (141-340 nM) of LCC6MDR cells, DOX (78-590 nM) and vincristine (82-550 nM) resistance of 2008/MRP1 cells and topotecan resistance (0.9-135 nM) of HEK293/R2 and MCF7-MX100 cells were at nanomolar range. Importantly, a number of compounds displayed EC_(50 )at or below 10 nM in BCRP-overexpressed cell lines, indicating that these bivalent triazoles more selectively inhibit BCRP transporter than the P-gp and MRP1 transporters. Most of the dimers are notably safe MDR chemosensitizers as indicated by their high therapeutic index values.


Patent
McGill University | Date: 2016-09-08

It is provided a chitosan sponge for bone regeneration in a subject, comprising chitosan; a purine compound such as guanosine 5-diphosphate (GDP); and at least one of a growth factor and a pyrophosphatase. Preferably the growth factor is BMP-7. The sponge is formed when the chitosan and the growth factor and/or pyrophosphatase is mixed with the purine compound such as guanosine 5-diphosphate.


Patent
The Administrators Of The Tulane Educational Fund and McGill University | Date: 2014-10-02

The invention provides methods for treatment, prevention or management of obesity, obesity related disorders, diabetes mellitus, and metabolic syndrome in a subject by administering a ghrelin O-acyltransferase (GOAT) inhibitor and/or a ghrelin receptor antagonist to the subject. The invention also provides ghrelin receptor antagonists of formula (VII): A^(11)-A^(12)-A^(13)-Gly-Ser-A^(14)-Phe-Leu-A^(15)-A^(16)-A^(17)-A^(18), wherein each of A^(11), A^(12), and A^(13 )is independently absent, an amino acid, or an amino protecting group; each of A^(15), A^(16), A^(17), and A^(18 )is independently absent or an amino acid; and A^(14 )is a serine conjugated with a C(O)C_(1)-C_(20)alky or a diaminopropionic acid conjugated with a C(O)C_(1)-C_(20)alkyl group, provided that at least one of A^(11), A^(12), or A^(13 )is present.


A building product is made from granular material and a binder that includes steel slag. A process for making the building product includes combining the granular material and the binder and then curing the combined granular material and binder with carbon dioxide. A building material includes a mixture of steel slag and a silica-rich material. The steel slag and silica-rich material is treated by heating. The silica-rich material may be waste glass and/or fly ash. A process for making the building material includes mixing the steel slag and silica-rich material and further heating the mixture.


Patent
McGill University | Date: 2015-04-28

Mining provides our society with many of minerals, metals, and gemstones for a wide variety of applications from mundane items through to expensive jewelry. But the mining operations generate waste and large empty shafts and stopes within the ground. It would beneficial to provide a lightweight material for backfill which can provide safer working conditions for miners as well as advantages in respect of weight reduction, reducing water consumption, rheology improvement and cost minimization. Equally, it would be beneficial for the lightweight backfill material to include mining tailings to reduce the impact external to the mine. However, the inclusion of mine tailings into a foam is counter-intuitive as mine tailings are generally characterized by a high proportion of small particles with sharp edges. However, embodiments of the invention provide just such a foam based mine backfill material.


Schwabe L.,Ruhr University Bochum | Pruessner J.C.,McGill University
Biological Psychiatry | Year: 2014

The processes of memory formation and storage are complex and highly dynamic. Once memories are consolidated, they are not necessarily fixed but can be changed long after storage. In particular, seemingly stable memories may re-enter an unstable state when they are retrieved, from which they must be re-stabilized during a process known as reconsolidation. During reconsolidation, memories are susceptible to modifications again, thus providing an opportunity to update seemingly stable memories. While initial demonstrations of memory reconsolidation came mainly from animal studies, evidence for reconsolidation in humans is now accumulating as well. Here, we review recent advances in our understanding of human memory reconsolidation. After a summary of findings on the reconsolidation of human fear and episodic memory, we focus particularly on recent neuroimaging data that provide first insights into how reconsolidation processes are implemented in the human brain. Finally, we discuss the implications of memory modifications during reconsolidation for the treatment of mental disorders such as posttraumatic stress disorder and drug addiction. © 2014 Society of Biological Psychiatry.


Fabian M.R.,McGill University | Sonenberg N.,McGill University | Filipowicz W.,Friedrich Miescher Institute for Biomedical Research
Annual Review of Biochemistry | Year: 2010

MicroRNAs (miRNAs) are small noncoding RNAs that extensively regulate gene expression in animals, plants, and protozoa. miRNAs function posttranscriptionally by usually base-pairing to the mRNA 3â€- untranslated regions to repress protein synthesis by mechanisms that are not fully understood. In this review, we describe principles of miRNA-mRNA interactions and proteins that interact with miRNAs and function in miRNA-mediated repression. We discuss the multiple, often contradictory, mechanisms that miRNAs have been reported to use, which cause translational repression and mRNA decay. We also address the issue of cellular localization of miRNA-mediated events and a role for RNA-binding proteins in activation or relief of miRNA repression. © 2010 by Annual Reviews. All rights reserved.


de Mazancourt C.,McGill University | Schwartz M.W.,University of California at Davis
Ecology Letters | Year: 2010

Resource ratio theory predicts that two species may coexist in the presence of two limiting nutrients provided that each species is limited by the resource it is least able to deplete. We modify this classical competition model to allow interspecific cooperation through trading. We show that resource trade expands the realm of stable coexistence, and that optimal trading partners competitively invade and exclude any other trading or non-trading strategy. We show that natural selection favours evolution towards establishment of a trading relationship so long as partners can establish long-term associations even though cooperation may result in a decrease in abundance of one species. This theory substantively expands traditional applications of resource competition models and suggests additional empirical experimentation. © 2010 Blackwell Publishing Ltd/CNRS.


Patent
McGill University and University of Oregon | Date: 2014-02-11

5-triposphate oligoribonucleotides, pharmaceutical compositions comprising said 5-triposphate oligoribonucleotides, and methods of using said 5-triposphate oligoribonucleotides to treat viral infections are disclosed.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-IP | Phase: HEALTH-2007-2.1.1-2 | Award Amount: 16.31M | Year: 2008

ENGAGE (European Network for Genetic and Genomic Epidemiology) has, as its central objective, the translation of the wealth of data emerging from large-scale research efforts in molecular epidemiology into information of direct relevance to future advances in clinical medicine. ENGAGE will do this through the integration of very large-scale genetic and phenotypic data already available from a substantial number of large and well-characterised European (and other) sample sets of various types. The initial focus will be an integrated analysis of >80,000 genomewide association scans available to the consortium, thereby identifying the large number of novel disease-susceptibility variants undetectable in individual studies. Early studies will concentrate on metabolic and cardiovascular phenotypes, with subsequent expansion to apply the methods developed and lessons learned in other disease areas. The ENGAGE framework has been designed to be adaptable to advances that enable global analyses of other sources of genomic variation (eg structural and epigenetic variants), and to broadening of the phenotypic spectrum (to genomic endophenotypes in particular). The clinical and public health relevance of the novel disease- and trait-susceptibility variants we identify will be evaluated using the breadth and diversity of ENGAGE cohorts (DNAs and serum/plasma samples from over 600,000 individuals). The final step will be to effect responsible clinical translation of our major findings. As well as advances in the understanding of disease pathogenesis which may underpin novel therapeutic advances, we expect to provide clear proof-of-principle that genetic and genomic discoveries can be translated into diagnostic indicators for common diseases with the capacity to stratify risk, monitor disease progression and predict and monitor therapeutic response. ENGAGE has assembled the best researchers, clinical samples and statistical and technical expertise in Europe to realise these goals.


Patent
Sant'Anna School of Advanced Studies and McGill University | Date: 2013-06-10

Scalability and energy efficiency are key issues in data centers imposing tight constraints on the networking infrastructure connecting the servers. Optical interconnection mitigates electronic limitations but the additional flexibility offered by WDM and datarate across a data center interconnection network requires architectural design, photonic technologies, and operating strategies be selected and optimized to meet power consumption requirements. Multi-plane architectures based upon space-wavelength domain architectures have been proposed to overcome scalability limitations. It would be beneficial to extend space and time switching domains with the wavelength domain for additional capacity to increase throughput as well as providing same electro-optic interface. Accordingly, the inventors have established space-time domain interconnection network architectures with wavelength domain overlay overcoming power consumption issues, especially at low utilization, by exploiting all-optical implementations with active elements which act simultaneously as a switch and an amplifier, and the possibility to remain in an idle state when unused.


Patent
Imperial Innovations Ltd, University of Quebec at Chicoutimi, President And Fellows Of Harvard College, University of Swansea and McGill University | Date: 2015-01-27

A method of identifying a subject falling within a new patient population characterised by eosinophil IgE mediated allergic inflammation, involving analysing the level of methylation in a DNA sample obtained from the subject for one or more promoter regions associated with one or more genes. Individuals within this new patient population are expected to be likely to respond to therapies for eosinophil IgE mediated inflammation, such as inhibitors of IL-5, IL-13, IgE or M1 prime activity and other therapies directed towards eosinophils.


Labonne J.,French National Institute for Agricultural Research | Hendry A.P.,McGill University
American Naturalist | Year: 2010

The standard predictions of ecological speciation might be nuanced by the interaction between natural and sexual selection. We investigated this hypothesis with an individual-based model tailored to the biology of guppies (Poecilia reticulata). We specifically modeled the situation where a high-predation population below a waterfall colonizes a low-predation population above a waterfall. Focusing on the evolution of male color, we confirm that divergent selection causes the appreciable evolution of male color within 20 generations. The rate and magnitude of this divergence were reduced when dispersal rates were high and when female choice did not differ between environments. Adaptive divergence was always coupled to the evolution of two reproductive barriers: viability selection against immigrants and hybrids. Different types of sexual selection, however, led to contrasting results for another potential reproductive barrier: mating success of immigrants. In some cases, the effects of natural and sexual selection offset each other, leading to no overall reproductive isolation despite strong adaptive divergence. Sexual selection acting through female choice can thus strongly modify the effects of divergent natural selection and thereby alter the standard predictions of ecological speciation. We also found that under no circumstances did divergent selection cause appreciable divergence in neutral genetic markers. © 2010 by The University of Chicago.


Grant
Agency: Cordis | Branch: FP7 | Program: CPCSA | Phase: ICT-2013.9.9 | Award Amount: 72.73M | Year: 2013

Understanding the human brain is one of the greatest challenges facing 21st century science. If we can rise to the challenge, we can gain profound insights into what makes us human, develop new treatments for brain diseases and build revolutionary new computing technologies. Today, for the first time, modern ICT has brought these goals within sight. The goal of the Human Brain Project, part of the FET Flagship Programme, is to translate this vision into reality, using ICT as a catalyst for a global collaborative effort to understand the human brain and its diseases and ultimately to emulate its computational capabilities. The Human Brain Project will last ten years and will consist of a ramp-up phase (from month 1 to month 36) and subsequent operational phases.\nThis Grant Agreement covers the ramp-up phase. During this phase the strategic goals of the project will be to design, develop and deploy the first versions of six ICT platforms dedicated to Neuroinformatics, Brain Simulation, High Performance Computing, Medical Informatics, Neuromorphic Computing and Neurorobotics, and create a user community of research groups from within and outside the HBP, set up a European Institute for Theoretical Neuroscience, complete a set of pilot projects providing a first demonstration of the scientific value of the platforms and the Institute, develop the scientific and technological capabilities required by future versions of the platforms, implement a policy of Responsible Innovation, and a programme of transdisciplinary education, and develop a framework for collaboration that links the partners under strong scientific leadership and professional project management, providing a coherent European approach and ensuring effective alignment of regional, national and European research and programmes. The project work plan is organized in the form of thirteen subprojects, each dedicated to a specific area of activity.\nA significant part of the budget will be used for competitive calls to complement the collective skills of the Consortium with additional expertise.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-IP-SICA | Phase: KBBE.2010.1.3-01 | Award Amount: 12.38M | Year: 2011

Livestock production efficiency is impaired by helminth infection which is ubiquitous in cattle, sheep and goats world-wide. It causes severely debilitating gastro-intestinal, respiratory and hepatic disorders, dependent on the infecting species. The treatment and prevention of helminth parasitism in livestock continues to rely almost exclusively on the use of anthelmintic drugs, an approach threatened by the global emergence of anthelmintic resistance. An alternative approach is vaccination. Members of the present consortium (from the EU and Switzerland, North and South America, North and South Africa, Australia, 2 SMEs and 1 major animal health company) have developed prototype vaccines with the predicted required efficacy to control major gastro-intestinal nematode infections of livestock, notably Ostertagia ostertagi in cattle and Haemonchus contortus in sheep, the liver fluke Fasciola hepatica in sheep and cattle with leading positions in subunit vaccine development against Cooperia onchophora, Dictyocaulus viviparus in cattle and the tapeworm Echinococcus granulosus in dogs. This proposal aims to deliver at least one prototype vaccine to the point of uptake by the commercial sector or through government/philanthropic agencies and this will be addressed by 1) Developing effective native or synthetic vaccines, the latter using novel, molecular expression systems. 2) Defining the protective immune responses induced by these vaccines to order to optimise the structure of the antigens and the method of their delivery. 3) Defining vaccine efficacy with trials in both housed and grazing livestock 4) Providing a platform for training and knowledge exchange which includes participation in training programmes, short exchanges of staff, workshops,and web site provision. 5) Interacting closely with computer modellers, the animal health industry, farmer organisations and other stakeholders to define required vaccine characteristics. 6) Knowledge exchange/dissemination to policy makers, scientists, government departments and the general public.


Grant
Agency: Cordis | Branch: FP7 | Program: CSA-SA | Phase: HEALTH.2013.4.1-4 | Award Amount: 645.12K | Year: 2013

The Health Directorate of the European Commissions DG Research and Innovation recently stated that Personalized Medicine is one of the most innovative areas in the future of health research with a high potential for patients, citizens and the economy. However, today the full potential can not be developed due to fragmented activities, insufficient communication and lack of generic solutions in the different areas of Personalized Medicine.The implementation of Personalized Medicine is, therefore, a major challenge in Europe and beyond. It calls for appropriate governance strategies at the European and global level as it challenges the way in which healthcare systems worldwide are set up. Thus, the EC itself, EuroBioForum, the European Health Forum Gastein (EHFG) and others have organized conferences to tackle these challenges. Furthermore, key European organizations and institutions have come up with reports, guidelines, roadmaps aiming to give guidance in this emerging and important health research field amongst others the European Science Foundation (ESF) Forward Look, the Manifesto of the European Alliance for Personalised Medicine (EAPM), the European Best Practice Guidelines of the Public Health Genomics European Network (PHGEN), the Roche report on Personalized Medicine or the report of the European Hospital and Healthcare Federation (HOPE). Based on these initiatives European and national decision-makers and funding bodies not only have expressed the urgent need for a CSA, but also initiated this specific CSA to step up coordination efforts between the European key stakeholders to allow synergies and avoid duplication or competition, to ensure maximum transparency and openness preparing Europe for leading the global way.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-SICA | Phase: NMP.2012.2.2-6 | Award Amount: 5.12M | Year: 2012

Limpid aims at generating new knowledge on photocatalytic materials and processes in order to develop novel depollution treatments with enhanced efficiency and applicability. The main goal of LIMPID is to develop materials and technologies based on the synergic combination of different types of nanoparticles (NPs) into a polymer host to generate innovative nanocomposites which can be actively applied to the catalytic degradation of pollutants and bacteria, both in air or in aqueous solution. Single component nanocomposites including TiO2 NPs are already known for their photocatalytic activities. LIMPID will aim at going one big step further and include, into one nanocomposite material, oxide NPs and metal NPs in order to increase the photocatalytic efficiency and allow the use of solar energy to activate the process. One of the main challenge of LIMPID is to design host polymers, such as hybrid organic inorganic and fluorinated polymers, since photocatalysts can destroy the organic materials. The incorporation of NPs in polymers will allow to make available the peculiar nano-object properties and to merge the distinct components into a new original class of catalysts. At the same time nanocomposite formulation will also prevent NPs to leach into water and air phase, thus strongly limiting the potential threat associated to dispersion of NPs into the environment. Therefore nanocomposites developed in LIMPID will be used as coating materials and products for the catalytic degradation of pollutants and bacteria in water and air, i.e. deposited onto re-usable micro-particles, or in pollutant degradation reactors, and even onto large surfaces, as a coating or paint. In addition such new class of nanocomposites will be also exploited for the fabrication of porous membranes for water treatment. In order to fulfill its objectives, the LIMPID consortium has been designed to combine leading industrial partners with research groups from Europe, ASEAN Countries and Canada.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-FP | Phase: SSH-2007-2.1-01 | Award Amount: 2.27M | Year: 2009

Coping with economic uncertainty while seeking security is a central dilemma of public policy in a globalising economy. A complex set of deals and conflicts are involved in the process of distributing the gains and the burdens of that uncertainty, and various forms of employment contracts and labour and social policies express their outcome. This project is concerned with the study of that process and its implications for societal models. In the course of conflict a number of different institutions engage in new practices; and there is a new diversity of employment forms and tenures. Social policy becomes increasingly integrated with employment and industrial relations practices, while both the sustainability of the institutions themselves and their impact on the natural environment require consideration. Challenges are also presented by the different forms of governance at work in the various policy fields. The crisis of the Keynesian model was often seen as a crisis for associational governance (or neo-corporatism), and an advance for reliance on market governance (usually assisted by strong elements of government intervention). Since then, policy-making by individual large corporations often seems to be replacing associational governance as well as government policy-making in fields of employment categories and rights, pay determination, and the determination of pensions. However, the public goods issues raised by uncertainty and environmental damage bring again into question the adequacy of governance by the market and individual firms. We should expect to find radical changes in the societal models that we have become accustomed to using in the analysis of social policy. There is a search for new modes of governance, or new combinations of old ones.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-IP | Phase: NMP-2010-1.3-1 | Award Amount: 13.15M | Year: 2011

The growing development, production and use of engineered nanomaterials and associated products will increase exposure of both humans and ecosystems to these new materials. However, current knowledge is still incomplete and established test methods are as yet inappropriate to reliably assess the extent of exposure and risk of materials at the nano-scale. There is an urgent need to develop methods to overcome the current limitations of existing hazard and risk assessment schemes and to generate the body of reference data needed as the basis for regulative requirements and for measures to safeguard production, application and the disposal of nanomaterials. The proposed project will mobilize the critical mass of international scientific knowledge and technical expertise required to address these questions. Current analytical and toxicity test methods and models will be put to test and subjected to rigorous intercalibration and validation. Where necessary, methods and test materials will be modified, adapted and validated, and new reliable reference methods developed, in cooperation with international standardisation bodies and the concerned industry, to support both pre and co-normative activities and to make the applicability of existing RA and LCA schemes to ENPs more reliable. The feasibility of validated measurement, characterization and test methods will be assessed by selected case studies to help the significant improvement of the performance of existing exposure monitoring systems as well as the development of new risk management and reduction strategies.


Patent
French National Institute for Agricultural Research and McGill University | Date: 2012-10-18

The present invention relates to the use of avermectin derivative as a drug for the treatment of parasitic infections. The avermectin derivative is represented by the formula (I) wherein: (i) R_(1 )is chosen from the group constituted of CH(CH_(3))_(2), CH(CH_(3))CH_(2)CH_(3), or cyclohexyle, (ii) X represents CH_(2)CH_(2), or CHCH, (iii) R_(2 )is chosen from the group constituted of or OH group, (iv) R_(3 )is OH or NOH, (v) represents a single bond when R_(3 )is OH, or a double bond when R_(3 )is NOH, as an inhibitor of a membrane-bound protein which transports exogenous compounds out of target cells.


NEWTOWN, PENNSYLVANIA--(Marketwired - Feb. 9, 2017) - Helius Medical Technologies, Inc. (TSX:HSM)(TSX:HSM.S)(OTCQB:HSDT) ("Helius") is pleased to announce that the clinical results from its Multiple Sclerosis (MS)-Pilot Study, performed at the Montreal Neurological Institute, were published in the peer reviewed journal Multiple Sclerosis Journal: Experimental, Translational and Clinical, January-March 2017:p1-9. The publication, "Non-invasive tongue stimulation combined with intense cognitive and physical rehabilitation induces neuroplastic changes in patients with multiple sclerosis: a multimodal neuroimaging study," can be accessed online at http://journals.sagepub.com/doi/pdf/10.1177/2055217317690561. "We would like to thank Drs. Leonard, Ptito and their team at the Montreal Neurological Institute for their work on this important study and congratulate them on this peer reviewed publication," said Dr. Jonathan Sackier, Helius' Chief Medical Officer. "Understanding the additional, positive effects we are seeing with the investigational PoNS™ therapy compared to physiotherapy alone, is core to our clinical development. This publication should prove insightful to two key care givers, the physician and the therapist." The Portable Neuromodulation Stimulator (PoNS™) is an investigational non-invasive device designed to deliver neurostimulation through the tongue. PoNS™ Therapy combines the use of the device with physical therapy and is currently being evaluated in a multicenter clinical trial for the treatment of balance disorder for subjects with mild to moderate Traumatic Brain Injury. Helius Medical Technologies is a medical technology company focused on neurological wellness. Helius seeks to develop, license and acquire unique and non-invasive platform technologies that amplify the brain's ability to heal itself. Helius intends to file for FDA clearance for the PoNS™ device. For more information, please visit www.heliusmedical.com. The Montreal Neurological Institute and Hospital - ("The Neuro") is a world-leading destination for brain research and advanced patient care. Since its founding in 1934 by renowned neurosurgeon Dr. Wilder Penfield, The Neuro has grown to be the largest specialized neuroscience research and clinical center in Canada, and one of the largest in the world. The seamless integration of research, patient care, and training of the world's top minds make The Neuro uniquely positioned to have a significant impact on the understanding and treatment of nervous system disorders. The Montreal Neurological Institute is a McGill University research and teaching institute. The Montreal Neurological Hospital is part of the Neuroscience Mission of the McGill University Health Centre. The Toronto Securities Exchange has not reviewed and does not accept responsibility for the adequacy or accuracy of the content of this news release. Certain statements in this news release are not based on historical facts and constitute forward-looking statements or forward-looking information within the meaning of the U.S. Private Securities Litigation Reform Act of 1995 and Canadian securities laws ("forward-looking statements"). All statements other than statements of historical fact included in this news release are forward-looking statements that involve risks and uncertainties. Such forward-looking statements include, among others, statements regarding ongoing or planned clinical research, expected future development timelines, regulatory approvals, business initiatives and objectives and use of proceeds from financings or other business initiatives. Forward-looking statements are often identified by terms such as "will", "may", "should", "anticipate", "expects" and similar expressions. There can be no assurance that such statements will prove to be accurate and actual results and future events could differ materially from those anticipated in such statements. Important factors that could cause actual results to differ materially from the Company's expectations include the failure of the Company to achieve its business objectives and other risks detailed from time to time in the filings made by the Company with securities regulators. The reader is cautioned that assumptions used in the preparation of any forward-looking statements may prove to be incorrect. Events or circumstances may cause actual results to differ materially from those predicted, as a result of numerous known and unknown risks, uncertainties, and other factors, many of which are beyond the control of the Company. The reader is cautioned not to place undue reliance on any forward-looking statement. Such information, although considered reasonable by management at the time of preparation, may prove to be incorrect and actual results may differ materially from those anticipated. Forward-looking statements contained in this news release are expressly qualified by this cautionary statement. Risks and uncertainties about the Company's business are more fully discussed in the Company's disclosure materials, including the short form prospectus filed in connection with the Offering, its Annual Report on Form 10-K filed with the United States Securities and Exchange Commission and the Canadian securities regulators and which can be obtained from either at www.sec.gov or www.sedar.com. The forward-looking statements contained in this news release are made as of the date of this news release and the Company assumes no obligation to update any forward-looking statement or to update the reasons why actual results could differ from such statements except to the extent required by law.


News Article | February 15, 2017
Site: www.nature.com

Polybrene, bafilomycin A, nocodazole and cyclohexamide were purchased from Sigma. CLAAAP (protease inhibitor cocktail) and PhosStop (phosphatase inhibitor) were purchased from Roche. Cytochalasin D was obtained from Fluka. Each antibody was obtained as follows: α-tubulin (B-5-1-2, Santa Cruz Biotechnology), AIF (sc-13116, Santa Cruz Biotechnology), β-actin (AC-74, Sigma), calnexin (ADI-SPA-860, ENZO Life Sciences), catalase (219010, Millipore), Drp1 (611113, BD Transduction Laboratories), FLAG (M2, Sigma), GFP for western blots (JL-8, Clontech), GFP (anti FP) for electron microscopy and immunoprecipitation (A6455, Life Technology), IP R1 (8568, Cell Signalling), KDEL (ab50601, Abcam), Lamp1b (H5G11, Santa Cruz Biotechnology), MCU (HPA016480, Sigma), MUL1 (HPA017681, Sigma), myc (4A6, Upstate), PEX14 (ABC142, Millipore), PMP70 (sab4200181, Sigma), PRDX3 (ref. 30), Tom20 (FL-145, Santa Cruz Biotechnology), ubiquitin (P4D1-A11, Millipore), VDAC1 (20B12AF2, Abcam), Vps35 (2D3, Novus). The human peroxisomal biogenesis-deficient fibroblast cell line PBD400-T1 was derived from a patient with Zellweger syndrome carrying a single nucleotide insertion (c542insT) leading to a premature stop codon in the core peroxin gene PEX3 (called Pex3mut), a gift from P. Kim (Univ. Toronto, Canada). Pex16mut cells were derived from a patient with Zellweger syndrome carrying a terminating mutation in PEX16, R176ter (GM06231 cells, Coriell Institute, called Pex16mut), which were immortalized as described in ref. 31. Control human fibroblasts (cell line MCH64) were obtained from Montreal Children’s Hospital. The cell lines were validated using qRT–PCR to confirm the loss of Pex3 or Pex16 (data shown in Extended Data Fig. 1a). Cells were maintained in DMEM (GIBCO) supplied with 10% fetal bovine serum (Wisent Bio Products) and non-essential amino acids (GIBCO) in 5.0% CO at 37 °C. Cells were tested for mycoplasma contamination using MycoAlert Mycoplasma Detection kit (Lonza). Transfection with plasmid DNA or siRNA was performed with Lipofectamine 3000, Nucleofector (Lonza) or RNAiMAX (Invitrogen) following the manufacturer’s instructions. Addition of drugs to monitor peroxisome biogenesis was performed using the following conditions: 0.02% DMSO, 20 nM bafilomycin A, 2 μM MG132, 1 μM cytochalasin D or 1.5 μM nocodazole for 14 h. Series of ON-TARGETplus siRNAs were purchased from Dharmacon. Non-targeting control pool (D-001810-10), targeted sequences are as follows: ON-TARGETplus DNML1 siRNA smart pool (J-012092-09 – 12, GUUAACCCGUGGAUGAUAA, CGUAAAAGGUUGCCUGUUA, CAUCAGAGAUGUUUACCA, GGAGCCAGCUAGAUAUUAA), ON-TARGETplus smart pool siVps35 (GAACAUAUUGCUACCAGUA, GAAAGAGCAUGAGUUGUUA, GUUGUAAACUGUAGGGAUG, GAACAAAUUUGGUGCGCCU), ON-TARGETplus siPEX19 (J-012594-05, J-012594-06, J-012594-07, J-012594-08) C-terminal YFP-fused Pex3 (UniProtKB: P56589) and Pex16 (UniprtoKB: Q9Y5Y5) (obtained from P. Kim12, GFP tag switched for YFP using standard procedures) were subcloned into D2-MCS viral vector (BioVector) under the control of a CMV promoter. Ad-GFP, Ad-Pex3–YFP and Ad-Pex16–YFP were used to infect cells at 50, 500 and 200 pfu per cell, respectively, in the presence of 4 μg/ml polybrene. Medium was replaced 1 day after infection. Cells were fixed with pre-warmed 5% PFA that was added directly to cells just after removing the culture medium without PBS wash. After incubation at 37 °C for 15 min, PFA was quenched with 50 mM NH Cl/PBS for 10 min at room temperature. Cells were permeabilized with 0.1% Triton X-100/PBS (v/v) for 10 min at room temperature and blocked with 5% FBS/PBS for 10 min at room temperature. Cells were incubated with appropriate primary antibodies for 2 h. After the wash with PBS, cells were incubated with secondary antibodies for 1 h. Cells were observed with spinning confocal microscopy (Olympus IX81 with Andor/Yokogawa spinning disk system (CSU-X), sCMOS camera and 100× or 60× objective lenses (NA1.4)). For quantification analysis, more than 30 cells in each condition were randomly chosen and counted based on the definitions on main figures (stages of de novo synthesis: Fig. 1a; localization of Pex3–YFP: Fig. 2b, left). Cells plated in a glass-bottom cell culture dish (MatTek) were infected with adenoviruses. Twenty-four hours after infection, cells were incubated with 100 nM MitoTracker Deep Red FM (Molecular Probes) for 20 min at 37 °C. Cells were washed in DMEM and observed in DMEM containing no phenol red (31053028, GIBCO) supplied with 10% FBS and 2 mM l-glutamine, NEAA and 10 mM HEPES pH 7.4 using a spinning disk confocal microscope (described above) with a 100× objective and EMCCD camera. For long-term imaging (40–48 h), infected cells in phenol red-free medium were monitored with Viva View FL Incubator microscope fitted with a 40× objective (Olympus) beginning 24 h after initial infection. Pex3mut and Pex16mut cells were transfected with Pex16–mRFP and infected with Ad-Pex3–YFP. Sixteen hours later, cells were trypsinized and co-plated into a glass bottom cell culture dish (MatTek). One day after that, cells were fused with 50% (w/v) PEG (Fluka, MW: 1,500 Da) in MEM (Invitrogen) containing medium for 1 min. After extensive washing (5×) with DMEM, cells were monitored with the spinning disk confocal microscope beginning 1 h after whole-cell fusion32. Cells prepared for electron microscopy were infected as indicated for 1 day before processing to capture the early events in peroxisomal biogenesis. As previously described33, cells were fixed with 5% PFA and 1.6% glutaraldehyde (GA) in 0.1 M sodium cacodylate buffer (pH 7.4) for 10 min at room temperature, then further fixed at 4 °C in the same buffer overnight. After washing with 0.1 M cacodylate buffer, cells were fixed with 1% osmium tetroxide for 60 min at 4 °C. Cells were washed with water, stained with saturated aqueous uranyl acetate for 45 min at room temperature, and then gradually dehydrated with a series of increasing concentrations of ethanol (70–100%). After dehydrating with 100% acetone, cells were gradually embedded in Spurr’s resin, and polymerized for 48 h at 60 °C. Samples were sectioned to a 100-nm thickness and sections were mounted on 200-mesh copper grids. Sections were imaged at 120 kV using a FEI Tecnai 12 TEM outfitted with an AMT XR80C CCD Camera System, housed in the Facility for Electron Microscopy Research (FEMR) at McGill University. The sizes of pre-peroxisomes on mitochondria were measured with ImageJ (NIH). For immuno-gold labelling, cells infected with Ad-Pex3–YFP or Ad-Pex16–YFP for 24 h were fixed in 5% PFA and 0.1% GA in PBS for 15 min at 37 °C. After washing with PBS, aldehydes were quenched with 50 mM glycine in PBS. Cells were permeabilized with 0.1% saponin and 5% BSA in PBS for 30 min at room temperature. Cells were incubated with anti GFP-antibody for 1 h at room termperature. After washing with 1% BSA in PBS, cells were incubated with 1.4 nm nanogold-conjugated goat anti-rabbit IgG for one hour at room temperature. After washing with PBS, cells were post-fixed with 1.6% GA in PBS for 10 min at room temperature. Cells were washed with water, then nanogold particles were enhanced using the HQ Silver Enhancement Kit (Nanoprobes) according to the manufacturer’s instructions. Cells were stored in 1.6% GA in 0.1 M sodium cacodylate at 4 °C overnight and processed as for conventional TEM (described above). Cells resuspended in ice-cold homogenization buffer (HB, 10 mM HEPES-KOH pH 7.4, 220 mM manitol, 70 mM sucrose, protease inhibitor cocktail) were homogenized with a 27-G needle (BD). Post-nuclear supernatants after centrifugation at 800g for 10 min were centrifuged at 2,300g for 10 min. Supernatants were further centrifuged at 23,000g for 15 min and at 100,000g for 1 h. After each centrifugation, pellets were resuspended in HB. Protein concentrations were measured by the Bradford method and analysed by immunoblotting. Twenty-five micrograms of 2.3 K for mitochondrial or 23 K for peroxisomal fractions suspended in 40 μl of mitochondrial isolation buffer (MIB, 10 mM HEPES pH 7.4, 68 mM sucrose, 80 mM KCl, 0.5 mM EDTA, 2 mM Mg(CH COO) ) containing varying amounts of trypsin (Sigma) were incubated on ice for 20 min. Digestion was terminated by adding soybean trypsin inhibitor (2.5 mg/ml, Sigma). For alkaline carbonate extraction, 50 μg of each fraction suspended in 50 μl of 0.1 M Na CO pH 11.5 was incubated on ice for 30 min. Soluble and membrane fractions were separated by centrifugation at 200,000g for 15 min at 4 °C. Cell-free mitochondrial import assays were performed as previously described34, with some modifications. In brief, Pex3– and Pex16–myc-His inserted into pCDNA3.1 myc-His (-) B (Invitrogen) were linearized by AglII restriction enzyme (NEB) before in vitro transcription. Capped RNA was synthesized in vitro using T7 polymerase (Promega). For the co-translational import assay, synthesized RNA was incubated with rabbit reticulocyte lysate (RRL, Promega) and 14.4 μg of canine pancreas microsomes35, 36 for 30 min at 30 °C. Microsomes were collected by centrifugation at 100,000g for 15 min after washing with MIB twice. For post-translational import into isolated mitochondria, synthesized RNA was incubated with RRL for 30 min at 30 °C. Reaction products were incubated with 50 μg mitochondria isolated from mouse heart34 in 50 μl reaction mix (10 mM HEPES pH 7.4, 110 mM Mannitol, 68 mM sucrose, 80 mM KCl, 0.5 mM EGTA, 2 mM Mg(CH COO) , 0.5 mM GTP, 2 mM K HPO , 1 mM ATP (K+), 0.08 mM ADP, 5 mM sodium succinate) for 30 min at 30 °C. Mitochondria were washed with MIB twice and subjected to further analysis for suborganellular localization as described above or directly analysed by immunoblotting. Pex3mut cells infected with Ad-GFP or Ad-Pex3–YFP for 10 h were further treated with or without 500 nM MG132 for 14 h. Cells were lysed with 0.1% SDS lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 5 mM EDTA, 0.1% SDS, 1% Triton-X 100, protease inhibitor cocktail and PhosStop). Soluble fractions were obtained by centrifugation at 20,000g for 20 min at 4 °C. Non-specific binding proteins were removed by rotating with protein-G sepharose (GE Healthcare) for 1 h at 4 °C. Lysates were subjected to immunoprecipitation using rabbit polyclonal anti-GFP antibodies (Invitrogen). Immmunoprecipitates were eluted by adding SDS–PAGE sample buffer and analysed by immunoblotting. Total RNA was isolated from each cell using RNeasy kit (QIAGEN). qRT–PCR and data analysis were performed at IRIC Genomics Platform (University de Montreal). Primers are as follows: ACTB (endogenous control) (Fw: attggcaatgagcggttc, Rv: tgaaggtagtttcgtggatgc), GAPDH (endogenous control) (Fw: agccacatcgctcagacac, Rv: gcccaatacgaccaaatcc), Pex19 (Fw: gcaagtcggaggtagcaaga, Rv: ctttatcgaaatcatcaagagcac), Pex3 (Fw: aaccagaggacttgcaatatgac, Rv: tgctgcattaaggcctctct), Pex16 (Fw: aggtgtggggtgaagtgg, Rv: caggagcatccgcagtaca). The means of each condition were calculated from three independent experiments, counting at least 30 cells per condition to generate enough power for statistical significance. P values for data comparison were calculated by Student’s t-test. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. All data shown here have been reproduced at least three times by the authors. All data supporting the findings of this study are available within the paper and the supplementary information files.


News Article | February 21, 2017
Site: www.eurekalert.org

Recent advice on depression screening from the US Preventive Services Task Force (USPSTF) may lead to overtesting and overtreatment, according to some experts. The advice - to screen all children aged 12 years and older and all adults for depression - contrasts with Britain and Canada which recommend against routine screening, and is one of several recommendations issued by the task force in the past few years that are far more liberal in promoting interventions. In a special report published today, The BMJ Associate Editor Jeanne Lenzer asks whether the task force - widely respected for its independent, objective guidance on preventive services - is still a voice of caution. For example, Brett Thombs, professor of psychiatry at McGill University told The BMJ: "In the absence of any trial evidence that screening would benefit patients, there is real concern that these recommendations may lead to more harm than good." However, Kirsten Bibbins-Domingo, current USPSTF chair and professor at the University of California, San Francisco, said: "We evaluate the available evidence around preventive services by assessing a variety of valid trial designs and rigorously examining studies for potential bias." A second concern, says Lenzer, stems from the fact that USPSTF recommendations have been based on evidence reviews that have not always included unpublished data. She acknowledges that many systematic reviews, even outside USPSTF, do not include unpublished data from regulators and manufacturers, but points to research by Erick Turner, a psychiatrist and former FDA reviewer, highlighting the dangers of omitting unpublished data. Albert Siu, immediate past chair of the task force, defended its reliance on published data, saying peer review "can address many sources of potential bias and methodological limitations." Although others reject this logic. Lenzer also points to USPSTF's outsourcing of evidence reviews to evidence based practice centres (EPCs), which she says "raises questions of whether financial conflicts could affect task force recommendations." Although The BMJ found that both USPSTF members and the individual EPC researchers selected to work on reviews were almost entirely free of financial conflicts, several EPCs receive industry funding, raising questions of potential institutional conflicts of interest. Finally, some experts contacted by The BMJ said that the USPSTF's advice for depression screening will lead to inappropriate treatment. Allen Frances, a well known critic of overdiagnosis, told The BMJ that current services for severely mentally ill people were already strained to bursting point, saying "we don't need to create an army of mislabeled healthy people." Others say that before making population based screening and prevention recommendations, independent researchers should analyse more forms of raw data such as clinical study reports and patient level data - and when such rigorous analyses are not possible it is important to acknowledge the resulting uncertainty. "What we need are fewer recommendations and more high quality evidence to base decisions on," argues Carl Heneghan, professor of evidence based medicine at the University of Oxford. "Currently we seem to be seeing the exact opposite." Lenzer included a similar review of the task force recommendation on statins for primary prevention of heart disease.


News Article | February 16, 2017
Site: www.prweb.com

CarraShield Labs, Inc. reported today that Rutgers University New Jersey Medical School and Albert Einstein College of Medicine are performing a National Cancer Institute-funded study on a revolutionary way of blocking the transmission of the human papillomavirus (HPV) from person to person using Divine 9® personal lubricant. Divine 9 is made with a unique formulation of natural seaweed extracts called CarraShield® . Divine 9 with CarraShield has been shown in previous in vitro (laboratory) and in vivo (mouse) studies conducted by the National Cancer Institute to act as an HPV blocking agent. These past results were important factors that led the research team to select Divine 9 with CarraShield for this new study. Funded through a grant by the National Cancer Institute, the Rutgers and Einstein study is a combined clinical trial and translational research project to determine how well CarraShield protects against HPV. One hundred sexually active women are being recruited and then are randomly assigned to receive either Divine 9 with CarraShield as a blocking agent or an ordinary personal lubricant as a placebo. Both the Divine 9 and placebo lubricants are packaged in single-use applicators. The women are asked to use an applicator before, during or within twelve hours after a sexual encounter. Each participant is tested monthly for a wide range of HPV types to determine if CarraShield is able to protect against acquiring new HPV infections. The principal investigator for the study is Dr. Mark Einstein, Chair of the Department of OB/GYN & Women’s Health and Assistant Dean of the Clinical Research Unit at Rutgers New Jersey Medical School. In 2015, Dr. Einstein launched the initial study on CarraShield at the Albert Einstein College of Medicine (AECOM) in conjunction with the Montefiore Medical Center in New York City. Dr. Einstein is collaborating with a distinguished group of experts from AECOM including Robert Burk, M.D., Vice Chair for Translational Research and Professor of Pediatrics, and Professor of Microbiology & Immunology, of Obstetrics & Gynecology and Women’s Health, and of Epidemiology & Population Health. Dr. Burk is an expert on detecting and characterizing HPV in clinical samples. According to the World Health Organization (WHO), HPV is the cause of essentially all cervical cancers (>99%) and cervical cancer is the second most common cancer in women worldwide by age-standardized incidence rate. More than 85% of cervical cancer deaths are in developing countries, where it accounts for 13% of all female cancers. WHO also estimates that HPV causes 90% of anal cancer cases. In a separate study on HPV and throat cancer, AECOM found that the presence of an HPV type in the mouth increases the odds of developing head and neck cancer by twenty-two times. HPV is also the underlying cause of all genital warts. Current approaches to HPV prevention have limitations. While great strides have been made in creating HPV vaccines, most adults are not able to benefit because they are approved only for those aged 26 and younger. The vaccines can also be too expensive for widespread distribution in developing countries. Unfortunately, condoms are not always effective in preventing HPV infection due to the fact that HPV is transferred through skin to skin contact. A safe, effective product in the form of a personal lubricant that can be applied before, during or after sexual activity would allow people to protect themselves in a pleasant and unobtrusive fashion. “People around the world need an accessible and affordable way to protect themselves from the misery and heartache that HPV infections can cause,” stated Dean Fresonke, CEO of CarraShield Labs. “With a successful outcome from this study, we will have made significant progress toward an entirely new approach to helping prevent cervical cancer, genital warts and the other health issues caused by HPV.” CarraShield Labs, Inc., combines nature with science to create products that improve sexual well-being. Intensive research has led to the company’s proprietary, naturally-derived sea algae concentrate called CarraShield®. Divine 9® personal lubricant, made with CarraShield, was shown to block transmission of cancer-causing HPV infection in National Cancer Institute laboratory studies and is now undergoing clinical trials on women and men at McGill University. With the announcement of the new studies at Rutgers Medical School and Albert Einstein College of Medicine, the only studies in the world on HPV prevention with a personal lubricant use Divine 9 with CarraShield. While the health benefits of CarraShield are being studied, consumers can enjoy the exotic, sensual feel of Divine 9 personal lubricant today. Look for Divine 9 and other products made with CarraShield in health conscious stores and websites. Learn more at http://www.CarraShieldLabs.com.


News Article | March 3, 2017
Site: www.marketwired.com

MONTREAL, QUEBEC--(Marketwired - March 2, 2017) - Beaufield Resources Inc. ("Beaufield" or the "Corporation") (TSX VENTURE:BFD) announces today the following changes to its Board of Directors and management. The Board of Directors increased the number of Directors to four and appointed Ronald W. Stewart as a new Director. Jens Hansen has resigned, effective immediately, as President, Chief Executive Officer and Director and the Board of Directors filled the board seat vacancy by appointing Robert P. Wares as Director. Finally, the Board of Directors appointed Robert P. Wares as Chairman of the Board of Directors and Ronald W. Stewart as interim President and Chief Executive Officer. Mr. Stewart is a mining professional with over 30 years of international experience in exploration, project development, operations and the capital markets. In December 2016, Mr. Stewart was appointed President and CEO of Eros Resources Corp., a junior resource exploration company focused on the acquisition, exploration and development of resource projects in the Americas. Prior to that, Mr. Stewart spent eight years in the capital markets industry as a top ranked equity analyst and investment banker: From December 2015 to November 2016, Managing Director, Mining Research at Dundee Capital Markets; from July 2014 to November 2015, Managing Director, Mining Equity Research at Macquarie Capital Markets (Canada) Ltd.; from January 2013 to June 2014, Managing Director, Investment Banking at Clarus Securities Inc.; and from September 2008 to December 2012 Senior Mining Analyst at Dundee Capital Markets. He also served as President and CEO of Verena Minerals Ltd. which later was renamed Belo Sun Mining. Prior to that he worked as Executive Vice President of Exploration for Kinross Gold Corp. for over five years following a sixteen year career with Placer Dome Inc. Mr. Stewart is a member of the Association of Professional Geoscientists of Ontario. Mr. Robert P. Wares is a Professional Geologist and has been Executive Vice-President of Exploration and Resource Development at Osisko Mining Inc. since October 2016. Mr. Wares currently serves as the President of l'Ordre des géologues du Québec and is a member of the mining advisory board to the Autorités des marchés financiers du Québec. Mr. Wares is a co-founder of Osisko and is responsible for the discovery of the Canadian Malartic gold deposit which was developed into Canada's biggest gold mine by Osisko Mining. He has 35 years of experience in mineral exploration and research. He served as Chief Geologist of Osisko Gold Royalties Ltd. until August 31, 2016. Mr. Wares served as the Chief Executive Officer and President of Niogold Mining Corp. from September 2014 to March 2016. He served as a Senior Vice President of Exploration & Resource Development at Osisko Mining Corporation from February 2014 to August 2014 and earlier from February 2011 to October 2012. He served as Chief Operating Officer and Executive Vice President of Brett Resources Inc. (Osisko Hammond Reef Gold Ltd.) from June 2010 to June 2014. He served as an Executive Vice President and Chief Operating Officer of Osisko Mining Corporation from March 2006 to February 2011. He served as the President and Chief Executive Officer at Osisko Exploration Ltd. from August 1998 to March 2006 and served thereafter as its Executive Vice President.. He has been Chairman of the Board and Director of Komet Resources Inc. since March 2014. He has been a Director of Osisko Mining Inc. since January 15, 2013. He has been an Independent Director of Bowmore Exploration Ltd. since December 22, 2008. He was an Independent Director of Augusta Resource Corp. from April 1999 to June 2014 has been independent Director of Arizona Mining Inc. since May 5, 2006. Mr. Wares has a B.Sc. in Geology and Honorary Doctorate in Science from McGill University. With the closing of the $6 million private placement announced on February 21, 2017, Beaufield is now well positioned to further explore its Urban property. Drilling resumed on the property in January 2017 and is ongoing. Twelve holes totaling 2,330 metres have been completed on the Rouleau Gold zone and drilling has begun on the Golden Retriever area located next to Osisko Mining's Black Dog Property (Reference press release January 25, 2017). "The Board of Directors would like to thank Mr. Hansen for his significant contributions to the Corporation over the past 20 years and for the energy he has devoted in acquiring and developing an excellent portfolio of mineral properties. Jens built a very strong company and leaves it in excellent condition" said Robert Wares, chairman of the Board of Directors. Mr. Hansen will continue to contribute to Beaufield by remaining as Special Advisor to the Board. Beaufield is a mineral exploration corporation with its exploration activity focused in Québec and Ontario. Please refer to Beaufield's website to view the Corporation's properties (Urban, Eleonore-Opinaca, Tortigny and Hemlo). The Corporation is actively exploring, well financed with approximately $8 million in cash, has no debt and has excess work credits on its properties. Please visit our website for regular updates at www.beaufield.com. Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) has reviewed or accepts responsibility for the adequacy or accuracy of this Release.


News Article | February 15, 2017
Site: cerncourier.com

At a ceremony held on 19 December at IPN Orsay, the French Physical Society awarded the 2015 Prix Joliot Curie for experimental particle physics to Marteen Boonekamp of the Institut de recherche sur les lois fondamentales de l̉Univers (IRFU) at Saclay. The prize, awarded every two years, recognised Boonekamp’s contributions to the measurement of the W mass at the LHC’s ATLAS experiment, of which he has been a member since 2001. The event also saw the French Physical Society present the Paul Langevin Prize, which recognises distinguished theorists and has not been awarded for the past few years. The winners of the 2015 Langevin Prize are François Gelis of the Institut de Physique Théorique Saclay, for his work on quantum field theory in the strong-field regime and its applications to the non-equilibrium evolution of quark–gluon plasma, and Ubirajara van Kolck of the Institut de Physique Nucléaire Orsay, for his formulation of effective field theories in nuclear physics. The 2017 Wolf Prize in Physics has been awarded to Michel Mayor and Didier Queloz of the University of Geneva, for the discovery of an exoplanet orbiting a solar-type star. The pair made the discovery of “51 Pegasi b” in 1995 following continuous improvement of cross-correlation spectrographs over a period of 20 years. The prize citation says that the team led by Mayor and Queloz, who is also at the University of Cambridge in the UK, contributed to the discovery of more than 250 additional exoplanets and sparked a revolution in the theory of planetary systems. Giovanni Passaleva of the Istituto Nazionale di Fisica Nucleare (INFN) Firenze, Italy, has been appointed as the next spokesperson of the LHCb experiment, taking over from Guy Wilkinson. Passaleva, who will become the new spokesperson in July, completed his PhD on the L3 experiment at LEP in 1995 and has been a member of the LHCb collaboration since 2000. His research interests include electroweak and flavour physics, as well as solid-state and gaseous tracking detectors, while his detector responsibilities include project leader of the LHCb muon system. On 20 January, CERN Director-General Fabiola Gianotti took part in a panel discussion at the 2017 World Economic Forum in Davos, at which delegates addressed the top issues on the global science agenda. Gianotti reinforced the importance of fundamental research in driving technology and as a force for peaceful collaboration, and emphasised the need for open science. “Scientists have made good progress over the last years to engage the public, but we have to do more to reach out to people at all levels using the tools we have,” she said. “Knowledge belongs to mankind, it does not belong to the scientists.” On 19 January, the Institut Laue-Langevin (ILL) in Grenoble marked 50 years of providing beams of neutrons for scientific users across a range of disciplines. The ILL was founded by the governments of France and Germany in 1967 with the aim of creating an intense, continuous source of neutrons devoted exclusively to civil fundamental research. Its first neutron beams were produced in 1971, and two years later the UK joined as the ILL’s third associate member. Today, the institute has 10 scientific members: Spain, Switzerland, Austria, Italy, the Czech Republic, Sweden, Belgium, Slovakia, Denmark and Poland. Research at the ILL covers fundamental physics to materials science and biology. The facility, which has an annual budget of around €100 million and almost 2000 user visits per year, has played a role in 21,000 scientific publications so far during its lifetime and is expected to operate well into the 2020s. Boris Johnson, secretary of state for foreign and commonwealth affairs, United Kingdom of Great Britain and Northern Ireland, visited CERN on 13 January, during which he took in the ATLAS control room and the LHC tunnel. Following the formal ascension of India as an associate Member State of CERN, Indian ambassador Amandeep Singh Gill visited CERN on 16 January. Here he is pictured with CERN Director-General Fabiola Gianotti holding the signed documents that will enable greater collaboration between India and CERN. Bernard Bigot, director-general of the ITER Organisation, which is responsible for the international fusion experiment under construction in France, visited CERN on 16 January. Bigot, who has a PhD in chemistry and has held several senior scientific roles in the French government, toured both CMS and ATLAS in addition to the LHC tunnel. Here he is pictured signing the guestbook with Frédérick Bordry, CERN’s director for accelerators and technology. Chief scientist of Quebec in Canada, Rémi Quirion, visited CERN on 22 January, during which he toured the LHC tunnel and experiments. Quirion received a PhD in pharmacology from Université de Sherbrooke in 1980 and was previously a professor at McGill University and scientific director of the Douglas Hospital Research Centre. On 23–26 January, more than 230 members of the international Deep Underground Neutrino Experiment (DUNE) collaboration met at CERN to discuss the project’s status and plans. A main focus of the meeting was to coordinate the assembly of prototype modules for the vast DUNE detector, which are being constructed in a new facility on the CERN site (see "ProtoDUNE revealed"). DUNE will comprise four detector modules with a total of 68,000 tonnes of liquid argon to detect neutrinos and look for rare subatomic phenomena such as proton decay. It will be situated 1.5 km underground at Sanford Underground Research Facility (SURF) in South Dakota, US. The experiment will be the target for intense beams of neutrinos and antineutrinos produced by a new facility to be built at Fermilab 1300 km away, and will address specific puzzles such as the neutrino mass hierarchy and CP violation in the neutrino sector. CERN is playing a significant role in the DUNE programme via its recently established neutrino platform (CERN Courier July/August 2016 p21). A collaboration agreement was signed between CERN and the US in December 2015, in which CERN committed to the construction of prototype DUNE detectors and the delivery of one cryostat for the experiment in the US. Two large “protoDUNE” detectors are now taking shape in a new building in the north area of the CERN site. DUNE aims to be for the neutrino what the LHC is for the Higgs boson, and enormous progress has been made in the past two years. Formed in early 2015, the collaboration now comprises 945 scientists and engineers from 161 institutions in 30 nations and is still growing, with about 60% of the collaborating institutions located outside the US. In September 2016, the US Department of Energy approved the excavation of the first caverns for DUNE, with preparatory work expected to begin at SURF this summer. A small, 3 × 1 × 1 m3 dual-phase demonstrator module constructed at CERN is also ready for filling and operation. One of the highlights of the CERN meeting was a tour of the construction site for the large protoDUNE detectors. The vessel for the cryostat of the 6 × 6 × 6 m3 single-phase liquid-argon prototype module is almost complete, and the construction of an identical cryostat for a dual-phase detector will start soon. Preparing for the installation of liquid-argon time-projection-chamber (TPC) detector components, which will start this summer, was one of the main focuses of the meeting. Both single- and dual-phase protoDUNE detectors are scheduled to be operational and take data with the tertiary charged-particle beam from the Super Proton Synchrotron in 2018. The DUNE collaboration is also starting to prepare a Technical Design Report (TDR) for the large underground detectors at SURF, and is working on the conceptual design for the DUNE near detector that will be placed about 55 m underground at the Fermilab site to measure neutrino interactions close to the source before the neutrinos start to oscillate. Discussions about the responsibilities for building the vast number of detector components for the DUNE far detectors have begun, and additional scientists and institutions are welcome to join the collaboration. The goal is to finish the TDR for review in 2019 and to begin the construction of the far-detector components in 2021, with the first detector modules at SURF operational in 2024. From 24 to 27 October 2016, accelerator experts from around the world gathered in Daresbury, UK, to discuss the status, challenges and future of circular high-luminosity electron-positron factories. Organised under ICFA and co-sponsored by the EuCARD-2 accelerator network, the “eeFACT2016” workshop attracted 75 participants from China, France, Germany, Italy, Japan, Russia, Switzerland, the UK and the US. Circular colliders have been a frontier technology of particle physics for half a century, providing more than a factor 10 increase in luminosity every 10 years. Several lower-energy factories are in operation: BEPC-II at IHEP Beijing, DAFNE at INFN Frascati and VEPP-2000 at BINP Novosibirsk. The SuperKEKB facility currently under commission in Japan (CERN Courier September 2016 p32) will mark the next step up in luminosity. Among other future projects, a super-charm-tau factory is being developed in Russia, while two ambitious high-energy circular Higgs-Z-W (and top) factories are being designed: the Circular Electron Positron Collider (CEPC) in China and the electron-positron version of the Future Circular Collider (FCC) at CERN. Despite 50 years of experience and development of the e+e– landscape, in the past couple of years several game-changing schemes have been introduced, such as colliding beams with a crab waist, large Piwinski angle and extremely low emittance. The crab-waist concept has already demonstrated its great merits at DAFNE. Other novel concepts include: the use of a double ring or partial double ring; magnet tapering; top-up injection; cost-effective two-in-one magnets; ultra-low beta function; “virtual crab waist”; and asymmetric interaction-region optics. Upcoming colliders like SuperKEKB and the upgraded VEPP-2000 collider will test the limits of these new schemes. In parallel, much progress is being made in the design and operation of storage-ring light sources, which exhibit numerous topics of common interest with the collider world. There is also a powerful synergy between a future large circular high-energy lepton collider such as CEPC or FCC-ee and a subsequent hadron collider installed in the same tunnel, called SPPC and FCC-hh, respectively. The projected performance of the future factories is further lifted by dramatic progress in accelerator technology such as superconducting radiofrequency (RF) systems, the efficiency of which have been revolutionised by novel production schemes such as nitrogen doping and thin-film Nb Sn coating. Several novel klystron concepts are on track to boost the power-conversion efficiency of RF power generators, which will make the next generation of colliders truly green facilities. With the performance of future factories being pushed so hard, subtleties that were unimportant in the past now arise – in particular concerning beam–beam effects. Large future collider concepts such as FCC-ee and CEPC build on recent innovations and would greatly advance progress in fundamental physics at the precision frontier. At the same time new ideas for compact low-energy crab-waist colliders are emerging, which might offer attractive alternative paths for research and science. The first international workshop on Hadronic Contributions to New Physics Searches (HC2NP 2016) was held on 25–30 September 2016 in Tenerife, Spain, inaugurating a new series aimed at hadronic effects that interfere in beyond-the-Standard-Model (SM) searches. A multidisciplinary group of 50 physicists attended the event to review four timely topics: muon g-2, flavour anomalies, sigma-terms in dark-matter searches, and the proton radius puzzle. The anomalous magnetic moment of the muon (g-2) provides one of the most precise tests of the SM, and theory currently stands at 3.3 standard deviations from the experimental measurements. Updates on the new measurements starting in 2017 at Fermilab and J-PARC were presented, with prospects to reduce the current experimental uncertainties by a factor of four within the next few years. Several ways to improve the theoretical uncertainty, especially on the hadronic side, were discussed – including new lattice-QCD calculations of the vacuum polarization contribution – and prospects for new experimental measurements at BESIII were also reviewed. Anomalies in weak flavour transitions in hadrons are a hot topic, especially the B-meson decay anomalies measured at LHCb and the tantalising hints of lepton-universality violation in the so-called RK and RD* ratios. These signals should be validated by other B-decay modes, which requires new lattice calculations of form factors. Since new physics might not constrain itself to one flavour sector, decays of other mesons such as pions, kaons and baryons are also being scrutinized. Regarding dark matter, the sigma terms (nucleon form factors of fundamental interest) are one of the main uncertainties when interpreting direct searches. Old tensions in the values of these quantities persist, as seen in the mild discrepancy between the results of lattice QCD and those obtained using effective field theory or dispersive methods from experimental data. Recent developments in effective field theories now enable the subsequent bounds from the direct searches to be interpreted in the context of dark-matter searches at ATLAS and CMS. Finally, HC2NP addressed the proton charge radius puzzle – the five-standard-deviation discrepancy between the value measured for muonic versus normal hydrogen (CERN Courier October 2016 p7). Results from electron–proton scattering have become controversial because different values of the radius are extracted from different fits to the same data, while lattice calculations of the proton charge radius so far do not provide the required accuracy. Recent chiral perturbation theory calculations of proton polarisability effects in muonic hydrogen show that this effect is relatively small, and new experiments on muonic deuterium and helium show that the same discrepancy exists for the deuterium but not the helium. With PSI due to perform a new experiment on the ground-state hyperfine splitting of muonic hydrogen, we require a factor 10 improvement in our understanding of proton-structure effects. Given the success of the meeting, a new edition of HC2NP covering a selection of timely subtopics will be organised in Tenerife during 2018. Some 400 theorists and experimentalists convened in Thessaloniki, Greece, from 29 August to 3 September 2016 for the 12th Quark Confinement and the Hadron Spectrum conference. Initiated in 1994, the series has become one of the most important and well attended forums in strong-interaction physics. The event (which this year included 40 plenary talks, 267 parallel talks and 33 posters) is organised in eight parallel sections: vacuum structure and confinement; emergent gauge fields and chiral fermions; light quarks; heavy quarks; deconfinement; QCD and new physics; nuclear and astroparticle physics; and strongly coupled theories. Two additional parallel sessions devoted to statistical methods and instrumentation were also included this year. The event brought together physicists working on approaches ranging from lattice field theory to higher-order perturbative and resummation methods; from phenomenology to experiments; from the mechanisms of confinement to deconfinement in heavy-ion physics; and from effective field theories of QCD to physics beyond the Standard Model. Only a brief summary of the wealth of results presented can be mentioned here. Of particular interest was a talk exploring the connections between gravitational-wave results from LIGO and hadron physics: the gravitational-wave signature for neutron-star mergers depends strongly on the QCD equation of state (EOS) and different assumptions about the EOS lead to uncertainties on the merger time, wave amplitude, peak frequency and radiated energy. Fortunately, there are other ways of exploring the QCD EOS at high density, such as upcoming experiments at the new FAIR facility in Germany, RHIC in the US and NICA in Russia, which also complement studies of the low-density regime of the EOS with heavy-ion collisions at the LHC. Several talks placed an emphasis on anomalies with respect to the Standard Model. The chiral anomaly in the background magnetic field of heavy-ion collisions, for example, has also been observed in condensed-matter physics in “Dirac semimetals”. Other talks addressed flavour anomalies and whether they could be a signal of new physics or be described by standard QCD effects. The status of heavy-flavour production from protons to ions was presented and the quarkonium production mechanism was emphasised, including the production of charmonium-like exotics. A number of talks were dedicated to physics on the scale of the nucleon rather than the nucleus, including new approaches to the parton distributions in the proton from lattice QCD, field theories and global analyses, incorporating results from JLab and the LHC. The status of the proton radius puzzle also generated lively discussions. The conference was followed by a satellite workshop on new accelerator-based facilities that will provide precision measurements of confinement and deconfinement physics, demonstrating the health of the field.


If the United States and its fellow Paris Agreement signatories are to meet global climate targets, they’re going to have to make serious commitments that attack the problem on multiple fronts, including reducing coal use, raising renewable energy, accelerating carbon-capture technologies and electrifying more of our automotive fleet, a new analysis shows. A study last week in Nature Climate Change has developed a measurement tool that can be used to assess each nation’s performance, helping to keep them accountable while also pinpointing the economic and policy changes they can make to meet the those climate targets. “Many key indicators are currently broadly consistent with emission scenarios that keep temperatures below 2◦ C, but the continued lack of large-scale carbon capture and storage threatens 2030 targets and the longer-term Paris ambition of net-zero emissions,” the study authors wrote. The Paris Agreement, signed by 192 states plus the European Union and ratified by 128 of those parties, marked a historic first – committing practically every country to slashing the greenhouse gas emissions that are responsible for climate change. The goal of the agreement is to keep global temperatures from rising no more than 2 degrees Celsius (3.6 degrees Fahrenheit) by 2100, in order to avoid the worst of climate change’s most catastrophic impacts. Each nation can pursue its own efforts to reach that goal. For example, President Obama committed the United States to reducing its greenhouse gas emissions by 26% to 28% (compared to 2005 levels) by the year 2025. But how can scientists measure whether individual nations are holding up their end of the bargain and truly doing their best to reduce their effect on global warming? Without knowing what’s working and what isn’t, it’s hard to craft effective policy. Figuring this out is actually a really tricky problem, said study coauthor Robert Jackson, an Earth scientist at Stanford University and co-chair of the Global Carbon Project. “Countries report and even collect data in different forms; it’s not always easy to compare what different countries are doing,” he explained. Individual nations can include different parts of their greenhouse gas budgets in different places, for example. Additionally, “some countries use land use change and other countries don’t. Some countries just use carbon dioxide; other countries use a broader suite of greenhouse gases. ” The new analysis consolidates that information by using what’s known as the Kaya Identity, an equation used by the Intergovernmental Panel on Climate Change to make climate change projections based on greenhouse gas scenarios. Here, though, Jackson and his colleagues applied their methods on an individual country-level basis, sifting through and incorporating information from each nation. The Kaya Identity links carbon emissions to their causes, including population, economic growth per capita, and improvements in energy efficiency and ‘low-carbon’ energy, for example. The scientists found that the recent slowdown in global emissions growth is due in large part to the reduction in the growth of coal use since 2011 – first in China, and then the United States. In the last two years in the U.S., Jackson said, electricity generated by coal has dropped by roughly a quarter – a shift powered in large part by natural gas. “This last year, 2016, was the first year ever that we produced more electricity using natural gas than with coal,” Jackson said. “That’s the first time that’s ever happened in the United States.” Wind and solar power growth, driven in part by policy, has also helped, he added. “Renewable portfolio standards in more than 30 states that are prompting record build-out in wind and solar,” he said. Much of the improvements have been due to better efficiency standards both for buildings and in industry. If the U.S. is going to make those Paris goals, however, it will probably need to pick up the pace, Jackson said. “Even in countries where those emissions are dropping like in the U.S., they need to drop faster if we’re to reach our Paris commitment,” he said. The U.S. will have to “electrify” more of its vehicles – which altogether produce more than a quarter of the country’s greenhouse gas emissions. The more that natural gas is able to replace coal, the better.  And it will have to bring affordable large-scale carbon capture and storage technologies to the market – though whether that is truly feasible remains to be seen, Christopher Green, an economics professor at McGill University who was not involved in the study, wrote in a commentary. “Whether current trends are real or lasting, the elephant in the room is whether they can be levered up substantially without numerous energy technology breakthroughs,” Green wrote. Green also pointed out that the study’s first author, Glen Peters, also led a study in 2015 that found that even if the U.S. and EU cut emissions by 80% or more by 2050, and if China takes a deep bite out of its emissions from 2030 to 2050, this would still not leave much, if anything, in the 2-degree-Celsius global emissions budget for the rest of the world’s nations. The 2015 Paris conference, he added, “ignored these warnings.” “Is the world currently on track to meet the global climate challenge? It is difficult to be sanguine,” Green wrote. “Globally, the increase (from very low levels) in the relative share of non-hydro renewable energies (from 0.55% to 2.77% between 2000 and 2015) has been almost wholly offset by a 2.0 percentage point reduction in the share contributed by nuclear power. As a result, the share of fossil (carbon emitting) energy in global energy consumption has remained between 86% and 87%.” Jackson was a little more hopeful, although he noted that in the near term, efforts to combat climate change could be hindered by a Trump White House. “I’m an optimist; I guess you can tell that by now,” he said. “On the other hand, there are many things the current administration can and is likely to do to slow our progress to the Paris accord.”


News Article | February 27, 2017
Site: globenewswire.com

VANCOUVER, British Columbia, Feb. 27, 2017 (GLOBE NEWSWIRE) -- Mobetize Corp. (OTCQB:MPAY), a provider of mobile financial services (“MFS”) technology for the multi-billion dollar business to business (B2B) segment of the Fintech as a Service (“FaaS”) sector is pleased to announce that Adam Atlas was recently appointed to Mobetize’s Board of Advisors. Mr. Atlas leads the firm Adam Atlas Attorney at Law http://adamatlas.com. His firm advises principally on matters of law pertinent to electronic payments and merchant transactions. Mr. Atlas holds a Bachelor of Civil Law, Bachelor of Common Law and a Bachelor of Arts in Political Science, with Honors, from McGill University and has been a member of the New York State Bar and the Province of Quebec Bar since 1998. His professional memberships include the American Bar Association and the New York State Bar Association. Prior to forming his own boutique payments practice in 2003, Mr. Atlas practiced corporate law at Stikeman Elliott, an international business law firm. He has also served as an early director of leading payments companies, Versapay Corporation and Payfirma Corporation. Mr. Atlas provides open source legal information concerning U.S. payments compliance at http://fintech.law. He is also the founder of http://msbstatus.com, a Regulatory Technology (“RegTech”) start-up that provides comprehensive MSB licensure and registration information. Mr. Atlas also provides legislative review and updates for The Money Services Business Association or MSBA, a U.S. trade association focused on the non-bank money services industry. The MSBA was started to establish an industry led organization to support the non-bank financial services industry. Today the MSBA encourages innovation and development in the payments industry while promoting education and communication with Federal and State Regulators. “There is a gap in the market today between the abundant creativity of Fintech start-ups and the conventional mechanisms of banks. As the rails of the financial system, banks are entitled to demand a certain level of technical security and sophistication from their Fintech start-up partners. Mobetize fills that gap. Having supported hundreds of Fintech start-ups, it’s a pleasure for me to advise Mobetize, an important link between Fintech business and traditional financial infrastructure,” said Adam Atlas on accepting his advisory role. "As Mobetize experiences growing global demand for its FaaS platform http://mobetize.com/fintech-news/, Adam is a key addition to our team of industry thought leaders who will ensure that we implement agile RegTech standards to manage risk and automate compliance requirements for Mobetize clients and partners," stated Ajay Hans, Chief Executive Officer. Mobetize Corp. (OTCQB:MPAY) has developed a global B2B Fintech as a Service (FaaS) Supermarket. Mobetize digitizes bricks and mortar financial services to deliver mobile money services to leading telecommunications companies and financial institutions. Mobetize ensures end-to-end integration for services such as prepaid air-time top ups, data gifting, mobile lending, international money transfers, P2P transfers, Visa™/MasterCard™ programs and mobile bill payments. Mobetize seamlessly integrates and white labels its secure mobile money platform services for customers who then offer the services to millions of users. Mobetize experts help telecom and banking providers discover new revenues, new customer relationships and navigate the emerging Fintech ecosystem. For more information, visit http://www.mobetize.com This press release includes statements that are not historical in nature and may be characterized as "forward-looking statements," including those related to future financial and operating results, benefits, and synergies of the combined companies, statements concerning Mobetize's outlook, pricing trends, and forces within the industry, the completion dates of capital projects, expected sales growth, cost reduction strategies, and their results, long-term goals of Mobetize and other statements of expectations, beliefs, future plans and strategies, anticipated events or trends, and similar expressions concerning matters that are not historical facts. All predictions as to future results contain a measure of uncertainty and, accordingly, actual results could differ materially. Among the factors which could cause a difference are: changes in the general economy; changes in demand for Mobetize's products or in the supplier costs; the actions of its competitors; the success of our customers; technological change; changes in employee relations; government regulations; litigation, including its inherent uncertainty; difficulties in plant operations and materials; transportation, environmental matters; and other unforeseen circumstances. A number of these factors are discussed in Mobetize's previous filings with the Securities and Exchange Commission. Mobetize disclaims any intention or obligation to update any forward-looking statements as a result of developments occurring after the date of this press release.


News Article | February 21, 2017
Site: globenewswire.com

HOUSTON, Feb. 21, 2017 (GLOBE NEWSWIRE) -- Bio-Path Holdings, Inc., (NASDAQ:BPTH), a biotechnology company leveraging its proprietary DNAbilize™ liposomal delivery and antisense technology to develop a portfolio of targeted nucleic acid cancer drugs, today announced the appointment of D. Craig Hooper, Ph.D., to its Scientific Advisory Board (SAB). “It is with great pleasure we welcome Dr. Hooper to our SAB. His extensive experience in the neuroimmunology field will be extremely valuable to Bio-Path as we seek to advance our liposomal RNAi antisense platform to deliver a safe and systemic brain cancer immunotherapy,” said Peter Nielsen, President and Chief Executive Officer of Bio-Path. “Bio-Path is developing a truly innovative platform that has the potential to transform antisense drug delivery,” commented Dr. Hooper. “I’m honored to join Bio-Path’s SAB and look forward to working with my esteemed colleagues to help advance DNAbilize™ and offer meaningful new immunotherapy treatments to patients.” D. Craig Hooper, Ph.D., is a Professor of Cancer Biology and Neurological Surgery at Thomas Jefferson University. Dr. Hooper has published over 140 papers in peer-reviewed journals and serves on the editorial boards of the Journal of Immunology Research, Scientific Reports and the Journal of Immunology. In 2016 he was inducted into the National Academy of Inventors (NAI). Dr. Hooper received his Ph.D. in Immunology and B.Sc. in Physiology from McGill University. He completed his post-doctoral research fellowship at the University of Bristol. Bio-Path is a biotechnology company focused on developing therapeutic products utilizing DNAbilize™, its proprietary liposomal delivery and antisense technology, to systemically distribute nucleic acid drugs throughout the human body with a simple intravenous transfusion. Bio-Path’s lead product candidate, prexigebersen (BP1001, liposomal Grb2 antisense), is in a Phase II study for blood cancers and in preclinical studies for solid tumors. Bio-Path’s second drug candidate, also a liposomal antisense drug, is ready for the clinic where it will be evaluated in lymphoma and solid tumors. For more information, please visit the Company's website at http://www.biopathholdings.com.


Shore G.C.,McGill University | Papa F.R.,University of California at San Francisco | Oakes S.A.,University of California at San Francisco
Current Opinion in Cell Biology | Year: 2011

Inability to meet protein folding demands within the endoplasmic reticulum (ER) activates the unfolded protein response (UPR), a signaling pathway with both adaptive and apoptotic outputs. While some secretory cell types have a remarkable ability to increase protein folding capacity, their upper limits can be reached when pathological conditions overwhelm the fidelity and/or output of the secretory pathway. Irremediable 'ER stress' induces apoptosis and contributes to cell loss in several common human diseases, including type 2 diabetes and neurodegeneration. Researchers have begun to elucidate the molecular switches that determine when ER stress is too great to repair and the signals that are then sent from the UPR to execute the cell. © 2010 Elsevier Ltd.


Ghayesh M.H.,University of Wollongong | Farokhi H.,McGill University
International Journal of Engineering Science | Year: 2015

In this paper, the nonlinear dynamics of a microplate is investigated based on the modified couple stress theory. The von Kármán plate theory is employed to model the system by retaining in-plane displacements and inertia. The equations of motion are derived via an energy method based on the Lagrange equations, yielding a set of second-order nonlinear ordinary differential equations with coupled terms. These equations are recast into a set of first-order nonlinear ordinary differential equations and the resulting equations are solved by means of the pseudo-arclength continuation technique. The nonlinear dynamics is examined through plotting the frequency-response and force-response curves of the system. The influence of system parameters on the resonant responses is highlighted. The differences in the response amplitude of the system modelled based on the modified couple stress theory and the classical one are discussed. © 2014 Elsevier Ltd. All rights reserved.


Papadopoulos V.,McGill University | Miller W.L.,University of California at San Francisco
Best Practice and Research: Clinical Endocrinology and Metabolism | Year: 2012

Adrenal gonadal, placental and brain mitochondria contain several steroidogenic enzymes, notably the cholesterol side chain cleavage enzyme, P450scc, which is the enzymatic rate-limiting step in steroidogenesis which determines cellular steroidogenic capacity. Even before this step, the access of cholesterol to this enzyme system is both rate-limiting and the site of acute regulation via the steroidogenic acute regulatory protein (StAR) which interacts with a complex multi-component 'transduceosome' on the outer mitochondrial membrane (OMM). The components of the transduceosome include the 18 kDa translocator protein (TSPO), the voltage-dependent anion channel (VDAC-1), TSPO-associated protein 7 (PAP7, ACBD3 for acyl-CoA-binding-domain 3), and protein kinase A regulatory subunit 1α (PKAR1A). The precise fashion in which these proteins interact and move cholesterol from the OMM to P450scc, and the means by which cholesterol is loaded into the OMM, remain unclear. Human deficiency diseases have been described for StAR and for P450scc. Mitochondria also contain several 'downstream' steroidogenic enzymes. © 2012 Elsevier Ltd. All rights reserved.


Brent Richards J.,McGill University | Brent Richards J.,King's College London | Zheng H.-F.,McGill University | Spector T.D.,King's College London
Nature Reviews Genetics | Year: 2012

Osteoporosis is among the most common and costly diseases and is increasing in prevalence owing to the ageing of our global population. Clinically defined largely through bone mineral density, osteoporosis and osteoporotic fractures have reasonably high heritabilities, prompting much effort to identify the genetic determinants of this disease. Genome-wide association studies have recently provided rapid insights into the allelic architecture of this condition, identifying 62 genome-wide-significant loci. Here, we review how these new loci provide an opportunity to explore how the genetics of osteoporosis can elucidate its pathophysiology, provide drug targets and allow for prediction of future fracture risk. © 2012 Macmillan Publishers Limited. All rights reserved.


Lukacs G.L.,McGill University | Verkman A.S.,University of California at San Francisco
Trends in Molecular Medicine | Year: 2012

Cystic fibrosis (CF), the most common lethal genetic disease in the Caucasian population, is caused by loss-of-function mutations of the CF transmembrane conductance regulator (CFTR), a cyclic AMP-regulated plasma membrane chloride channel. The most common mutation, deletion of phenylalanine 508 (ΔF508), impairs CFTR folding and, consequently, its biosynthetic and endocytic processing as well as chloride channel function. Pharmacological treatments may target the ΔF508 CFTR structural defect directly by binding to the mutant protein and/or indirectly by altering cellular protein homeostasis (proteostasis) to promote ΔF508 CFTR plasma membrane targeting and stability. This review discusses recent basic research aimed at elucidating the structural and trafficking defects of ΔF508 CFTR, a prerequisite for the rational design of CF therapy to correct the loss-of-function phenotype. © 2011.


Sakai T.,University of Electro - Communications | Belyakov A.,Belgorod State University | Kaibyshev R.,Belgorod State University | Miura H.,University of Electro - Communications | Jonas J.J.,McGill University
Progress in Materials Science | Year: 2014

The evolution of the new microstructures produced by two types of dynamic recrystallization is reviewed, including those brought about by severe plastic deformation (SPD). The microstructural changes taking place under these conditions and the associated mechanical behaviors are described. During the conventional discontinuous dynamic recrystallization (dDRX) that takes place at elevated temperatures, the new grains evolve by nucleation and growth in materials with low to medium stacking fault energies (SFE). On the other hand, new ultrafine grains can be produced in any material irrespective of the SFE by means of SPD at relatively low temperatures. These result from the gradual transformation of the dislocation sub-boundaries produced at low strains into ultrafine grains with high angle boundaries at large strains. This process, termed in situ or continuous dynamic recrystallization (cDRX), is still not perfectly understood. This is because many SPD methods provide data concerning the microstructural changes that take place but little information regarding the flow stress behavior. By contrast, multi-directional forging (MDF) provides both types of data concurrently. Recent studies of the deformation behavior of metals and alloys under SPD conditions, carried out using MDF as well as other SPD methods, are synthesized and the links between the microstructural and mechanical observations are examined carefully. Some models for grain formation under SPD conditions are discussed. Next, the post-dynamic recrystallization behavior, i.e. that of annealing after both dDRX and cDRX, is described. The differing annealing behaviors result from the differences in the natures of the deformed microstructures. Finally, an integrated recrystallization model for these phenomena, i.e. dynamic and static recrystallization of both the continuous and discontinuous types, is presented and discussed. © 2013 Elsevier Ltd. All rights reserved.


Schenke B.,Brookhaven National Laboratory | Jeon S.,McGill University | Gale C.,McGill University
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2011

The results on pT-differential elliptic flow in √s=2.76 TeV Pb + Pb collisions at the Large Hadron Collider (LHC) reported by the ALICE Collaboration are remarkably similar to those for s=200 GeV gold-gold collisions at the Relativistic Heavy Ion Collider (RHIC). This result is surprising, given the expected longer lifetime of the system at the higher collision energies. We show that it is nevertheless consistent with (3+1)-dimensional viscous event-by-event hydrodynamic calculations, and demonstrate that elliptic flow at both RHIC and LHC is built up mostly within the first ~5 fm/c of the evolution. We conclude that an "almost perfect liquid" is produced in heavy-ion collisions at the LHC. Furthermore, we present predictions for triangular flow as a function of transverse momentum for different centralities. © 2011 Elsevier B.V.


Woolley S.C.,McGill University | Kao M.H.,University of California at San Francisco
Neuroscience | Year: 2015

Many motor behaviors, from walking to speaking, are acquired through experience, in particular, through trial-and-error learning. The acquisition and maintenance of such motor behaviors in a wide range of species, including humans, appear to depend on cortical-basal ganglia circuits. In this review, we discuss recent studies in songbirds that have been pivotal in informing our current understanding of motor learning and cortical-basal ganglia function. Songbirds are important ethological model systems for the study of motor learning because young songbirds naturally develop and refine their songs through trial-and-error learning. In addition, reinforcement mechanisms are hypothesized to be important for the maintenance and plasticity of structured adult song. Computational and experimental studies highlight the importance of vocal motor variability as the substrate upon which reinforcement mechanisms could operate to shape developing song and to maintain adult song. Recent studies in songbirds indicate that this vocal motor variability is actively generated and modulated by a highly specialized cortical-basal ganglia circuit evolved for a single behavior, song. We argue that these and other recent findings illustrate how the tight association between a specialized neural circuit and a natural behavior make songbirds a unique and powerful model in which to investigate the neural substrates of motor learning and plasticity. © 2014 IBRO.


Pelletier J.,McGill University | Graff J.,Eli Lilly and Company | Ruggero D.,University of California at San Francisco | Sonenberg N.,McGill University
Cancer Research | Year: 2015

Elevated protein synthesis is an important feature of many cancer cells and often arises as a consequence of increased signaling flux channeled to eukaryotic initiation factor 4F (eIF4F), the key regulator of the mRNA-ribosome recruitment phase of translation initiation. In many cellular and preclinical models of cancer, eIF4F deregulation results in changes in translational efficiency of specific mRNA classes. Importantly, many of these mRNAs code for proteins that potently regulate critical cellular processes, such as cell growth and proliferation, enhanced cell survival and cell migration that ultimately impinge on several hallmarks of cancer, including increased angiogenesis, deregulated growth control, enhanced cellular survival, epithelial-tomesenchymal transition, invasion, and metastasis. By being positioned as the molecular nexus downstream of key oncogenic signaling pathways (e.g., Ras, PI3K/AKT/TOR, and MYC), eIF4F serves as a direct link between important steps in cancer development and translation initiation. Identification of mRNAs particularly responsive to elevated eIF4F activity that typifies tumorigenesis underscores the critical role of eIF4F in cancer and raises the exciting possibility of developing new-in-class small molecules targeting translation initiation as antineoplastic agents. ©2014 AACR


Schenke B.,Brookhaven National Laboratory | Jeon S.,McGill University | Gale C.,McGill University
Physical Review C - Nuclear Physics | Year: 2012

We present event-by-event viscous hydrodynamic calculations of the anisotropic flow coefficients v 2 to v 5 for heavy-ion collisions at the Relativistic Heavy-Ion Collider (RHIC). We study the dependence of different flow harmonics on shear viscosity and the morphology of the initial state. v 3 and higher flow harmonics exhibit a particularly strong dependence on both the initial granularity and shear viscosity. We argue that a combined analysis of all available flow harmonics has the potential to determine η/s of the quark gluon plasma more precisely than previously. Presented results strongly hint at a value ( η/s)QGP<2/4π at RHIC. Furthermore, we demonstrate the effect of shear viscosity on pseudorapidity spectra and the mean transverse momentum as a function of rapidity. © 2012 American Physical Society.


Zhou X.,McGill University | Kollias P.,McGill University | Lewis E.R.,Brookhaven National Laboratory
Journal of Climate | Year: 2015

The recent ship-based Marine ARM GCSS Pacific Cross-Section Intercomparison (GPCI) Investigation of Clouds (MAGIC) field campaign with the marine-capable Second ARM Mobile Facility (AMF2) deployed on the Horizon Lines cargo container M/V Spirit provided nearly 200 days of intraseasonal high-resolution observations of clouds, precipitation, and marine boundary layer (MBL) structure on multiple legs between Los Angeles, California, and Honolulu, Hawaii. During the deployment, MBL clouds exhibited a much higher frequency of occurrence than other cloud types and occurred more often in the warm season than in the cold season. MBL clouds demonstrated a propensity to produce precipitation, which often evaporated before reaching the ocean surface. The formation of stratocumulus is strongly correlated to a shallow MBL with a strong inversion and a weak transition, while cumulus formation is associated with a much weaker inversion and stronger transition. The estimated inversion strength is shown to depend seasonally on the potential temperature at 700 hPa. The location of the commencement of systematic MBL decoupling always occurred eastward of the locations of cloud breakup, and the systematic decoupling showed a strong moisture stratification. The entrainment of the dry warm air above the inversion appears to be the dominant factor triggering the systematic decoupling, while surface latent heat flux, precipitation, and diurnal circulation did not play major roles. MBL clouds broke up over a short spatial region due to the changes in the synoptic conditions, implying that in real atmospheric conditions the MBL clouds do not have enough time to evolve as in the idealized models. © 2015 American Meteorological Society.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-IP | Phase: HEALTH-2009-2.1.1-2 | Award Amount: 13.75M | Year: 2010

The International Cancer Genome Consortium (ICGC) has the goal of obtaining a comprehensive description of genomic, transcriptomic and epigenomic changes in 50 different tumour types and/or subtypes, with the aim of elucidating the genomic changes present in the many forms of cancers that contribute to the burden of disease throughout the world. We present a proposal for a European contribution to this effort through application of state-of-the-art approaches to the genomics of the most common form of renal cell cancer (RCC). RCC is of particular importance within Europe where the highest global incidence rates are observed. Disease incidence has increased over the last two decades, and it is now the 8th most common cancer in the EU. CAGEKID brings clinical and epidemiological resources that are unique worldwide together with the necessary genetics and genomics expertise required for this effort. In the first phase of the study, we will provide a full genomic characterisation of 100 matched pairs of DNA extracted from the tumour and constitutional samples. DNA will be completely sequenced, and the data brought together with those from whole genome transcript and methylation analyses. Follow-up studies of potential targets will be made in further samples. The results acquired will be relied to targeted protein analyses. The primary data will be made available to the scientific community, and the programme will contribute to establishing norms for the manipulation and storage of biological samples. CAGEKID will provide the first systematic analysis of this tumour site providing new insights into disease aetiology with application for diagnosis and treatment. It addresses a major need to identify new biological markers for renal cell cancer, one of very few tumour types for which there are currently no biological markers in routine clinical use. Renal cancer is not yet supported by any of the members of the ICGC.


Grant
Agency: Cordis | Branch: FP7 | Program: CP | Phase: ICT-2009.1.2 | Award Amount: 4.72M | Year: 2010

The next generation of Platforms as a Service (PaaS) for cloud providers demand consistency, availability, and simpler programming abstractions, such as transactional consistency. Obtaining these three properties simultaneously is, however, a significant challenge. In CumuloNimbo, we propose to achieve this goal by building a stackable and modular execution platform that can be installed as a service and provides the same degree of consistency as current service-oriented platforms, however, at much higher, Internet-level, scale. Current PaaS systems sacrifice data consistency for scalability, thus increasing the complexity of building applications on top of such platforms when strong consistency guarantees are necessary.\nProviding such guarantees at the application level requires hiring highly-skilled programmers, which is often costly and prohibitive, especially for SMEs. As a result, many newly developed applications are unable to guarantee consistency appropriately, which quickly becomes visible to end users as flaws in the application.\n\nCumuloNimbo will develop a new Platform as a Service that will provide high scalability, at the 100\ service-nodes level, without sacrificing data consistency and simple programming abstractions. The targeted PaaS will be a transactional multi-tier software stack for cloud computing providing the same functionality to current, software multi-tier stacks, such as Java EE. Providing scalability without sacrificing consistency is a major breakthrough that will enable European stakeholders in service platforms to position in the cloud computing market with a competitive advantage.


TORONTO--(BUSINESS WIRE)--Enigma Biomedical Group today announced a clinical research agreement with McGill University Research Centre for Studies in Aging in Montreal to support multiple projects over the next several years. These research projects are for studies of an early stage imaging agent (MK-6240) to be used in Positron Emission Tomography (PET) scans for assessing the status and progression of neurofibrillary tangles (NFTs) in the brain. NFTs made up of aggregated tau protein are a hallmark of several neurodegenerative diseases, including Alzheimer’s disease. As part of the agreement, Enigma will provide funding for various research projects, and through its US entity Cerveau Technologies, Inc., will supply the MK-6240 precursor needed for the initiatives. Lee Anne Gibbs, President of Enigma Biomedical Group said, “We are proud to partner with McGill University Research Centre for Studies in Aging, one of the premier institutions in the world. This is another important step in our ongoing and long-term relationship with McGill.” Dr. Pedro Rosa-Neto, Director of McGill University Research Centre for Studies in Aging said, “These research projects will provide valuable insight into the status and progression of NFTs in healthy subjects, subjects with mild cognitive impairment and confirmed Alzheimer’s Disease. We appreciate the support of Enigma Biomedical Group and value our ongoing relationship.” Dr. Serge Gauthier, Director of the AD & Related Disorders Research Unit of the McGill University Research Center for Studies in Aging said: “The ability to visualize and quantify tau in the brain will facilitate therapeutic research in the field of Alzheimer's disease.” “At Cerveau, we are focused on providing information and technologies to researchers and clinicians to improve brain health,” said Rick Hiatt, President of Cerveau Technologies, Inc., and CEO of Enigma Biomedical Group. “We are excited by the opportunity to work with McGill and the pharmaceutical industry in providing access to this novel imaging agent to the broader scientific community." Toronto based Enigma Biomedical Group (EBG) enhances access to key technologies with a focus on molecular imaging and medicine. EBG offers a suite of services to the pharmaceutical industry and clinical research community to accelerate drug development and global access. EBG partners with academic institutions and universities to foster and broaden access to novel research. More information can be found at http://www.enigmabiomedicalgroup.com/. Cerveau Technologies, Inc. is a partnership between Enigma Biomedical Group, Inc. and Sinotau Pharmaceutical Group. Cerveau's vision is to globally develop diagnostics and technology that positively impact patients with neurodegenerative disorders including Alzheimer's disease.


SAN CARLOS, Calif.--(BUSINESS WIRE)--In advance of the first-ever National Heart Valve Disease Awareness Day, the Lipoprotein(a) Foundation is highlighting a number of studies that demonstrate the impact of elevated Lp(a) and its significance as an independent, genetic risk factor for early cardiovascular disease. Recently published research has shown that elevated Lp(a) is the strongest independent genetic risk factor for heart valve disease and individuals with high Lp(a) may also be susceptible to earlier and more aggressive valve disease. The Lipoprotein(a) Foundation has partnered with the Alliance for Aging Research to promote National Heart Valve Disease Awareness Day on February 22, during National Heart Month. The Lipoprotein(a) Foundation recently issued an Infographic to raise awareness about aortic valve disease, including aortic stenosis, the most common form of valve disease in the Western world. More than 5 million adults in the U.S. are estimated to have some form of aortic valve disease and some 15,000 die every year.1 For more information about patients with high Lp(a) and valve disease, visit www.TESTLpa.org. George Thanassoulis, MD MSc FRCP(C), Director of Preventive and Genomic Cardiology at the McGill University Health Center and Associate Professor at McGill University, Montreal, and a member of the Lipoprotein(a) Foundation’s Scientific Advisory Board, has been involved in three recent studies linking elevated levels of Lp(a) and aortic valve disease. The study “Estimating the Population Impact of Lp(a) Lowering on the Incidence of Myocardial Infarction and Aortic Stenosis,” was recently published in the American Heart Association journal, Arteriosclerosis, Thrombosis, and Vascular Biology. With potent Lp(a)-lowering therapies on the horizon, researchers sought to estimate the potential population impact of Lp(a) lowering that may be achieved by these therapies in primary prevention. Results showed that reducing high Lp(a) could potentially prevent up to 1 in 14 cases of myocardial infarction and 1 in 7 cases of aortic valve stenosis. “These data demonstrate that among those with high Lp(a), nearly one third of heart attacks and half of all cases of aortic stenosis can be attributed to high Lp(a) and may be preventable with Lp(a) lowering therapy. Lowering Lp(a) could significantly reduce the impact of cardiovascular disease,” said Dr Thanassoulis. In “Lipoprotein (a) in calcific aortic valve disease: from genomics to novel drug target for aortic stenosis,” published in the Journal of Lipid Research (DOI: 10.1194/jlr.R051870) and “Lipoprotein(a): new insights from modern genomics,” published in the January issue of Current Opinion in Lipidology (DOI:10.1097/MOL.0000000000000392), Dr Thanassoulis and colleagues identify Lipoprotein(a) as the strongest independent genetic risk factor for both myocardial infarction and aortic stenosis. According to Dr Thanassoulis, “With mounting epidemiological and genetic findings in support of Lp(a)-mediated valve disease, it is critical to discuss potential mechanisms underlying this observation, and outline the steps to translate this discovery to a much needed novel therapeutic strategy for AV disease. With novel therapies on the horizon, Lp(a) is poised to gain significant clinical relevance and its lowering could have a significant impact on the burden of CVD.” Dr Thanassoulis also announced that he just received a Research Project Grant (RO1) from the National Institutes of Health/ National Heart, Lung, and Blood Institute (NHLBI). The purpose of the grant, titled, “Genetic and molecular epidemiology of Lp(a)-mediated calcific aortic valve disease,” is to extend discovery of the role of Lp(a) in aortic stenosis. The objectives are to better understand the molecular determinants of Lp(a) mediated valve calcification and identify causal disease pathways that may be targeted by novel therapeutics. One in 5 people globally have inherited high Lp(a) - 63 million in the U.S.4 - and Lp(a) is currently the strongest monogenetic risk factor for coronary heart disease and aortic stenosis.2,3 Lp(a) concentrations can be measured by a simple blood test and could be the first step in preventing up to 120,000 cardiovascular events every year;1,5 however, it is not included in most standard lipid panel tests that check cholesterol levels.1 “There is a growing body of research that links high lipoprotein(a) to heart attacks, strokes and now aortic stenosis and heart valve disease. Studies likes the ones conducted by Dr Thanassoulis continue to demonstrate that high Lp(a) is the strongest independent genetic risk factor for many cardiac conditions and therapies under development could have tremendous impact. We are proud to support education and awareness of Heart Valve Disease and will continue to empower patients and prevent cardiovascular events due to high Lipoprotein(a) through proper testing and diagnosis,” said Sandra Revill Tremulis, founder of Lipoprotein(a) Foundation. Because approximately 63 million Americans have high Lipoprotein(a) and are at risk of premature cardiovascular disease, the vision for the foundation is: To live in a world where high Lipoprotein(a) is routinely diagnosed, treated and family screened. The mission is to prevent cardiovascular events due to high Lipoprotein(a) by diagnosing this inherited risk for cardiovascular disease; educating and empowering patients and saving lives. Our goal is to save lives by increasing awareness, advocating for routine testing, and supporting research that will lead to a specific treatment for elevated Lipoprotein(a). Based in San Carlos, California, the Lipoprotein(a) Foundation is a patient-founded, 501(c)3 non-profit organization. Learn more about Aortic Valve Disease and high Lp(a) visit: www.TESTLpa.org


News Article | February 16, 2017
Site: www.rdmag.com

A new diagnostic method has correctly predicted autism in 80 percent of high-risk infants, according to a new study. Researchers at the University of North Carolina have developed a method using magnetic resonance imaging (MRI) in infants with older siblings with autism to correctly predict whether infants would later meet the criteria for autism at two years old. “Our study shows that early brain development biomarkers could be very useful in identifying babies at the highest risk for autism before behavioral symptoms emerge,” Dr. Joseph Piven, the Thomas E. Castelloe Distinguished Professor of Psychiatry at UNC and senior author of the paper, said in a statement. “Typically, the earliest an autism diagnosis can be made is between ages two and three. But for babies with older autistic siblings, our imaging approach may help predict during the first year of life which babies are most likely to receive an autism diagnosis at 24 months.” It is estimated that one out of every 68 children develop Autism Spectrum Disorder (ASD) in the U.S. The patients have characteristic social deficits and demonstrate a range of ritualistic, repetitive and stereotyped behaviors. Despite extensive research, it has been impossible to identify those at ultra-high risk for autism prior to two-years old, which is the earliest time when the hallmark behavioral characteristics of ASD can be observed and a diagnosis made in most children. In the study, the researchers conducted MRI scans of infants at six, 12 and 24 months old. The researchers found that the babies who developed autism experienced a hyper-expansion of brain surface area from six to 12 months, as compared to babies who had an older sibling with autism but did not themselves show evidence of the condition at 24 months of age. They also found that increased growth rate of surface area in the first year of life was linked to increased growth rate of overall brain volume in the second year, which is tied to the emergence of autistic social deficits in the second year. The next step was to take the data—MRI’s of brain volume, surface area, cortical thickness at six and 12 months of age and the sex of the infants—and used a computer program to identify a way to classify babies most likely to meet criteria for autism at two-years old. The computer program developed an algorithm that the researchers applied to a separate set of study participants. The researchers concluded that brain differences at six and 12 months in infants with older siblings with autism correctly predicted eight of 10 infants who would later meet criteria for autism at two-years old in comparison to those with older ASD siblings who did not meet the criteria at two years old. “This means we potentially can identify infants who will later develop autism, before the symptoms of autism begin to consolidate into a diagnosis,” Piven said. This test could be helpful to parents who have a child with autism and have a second child, where they could intervene ‘pre-symptomatically’ before the emergence of the defining symptoms of autism. Researchers could then begin to examine the effect of interventions on children during a period before the syndrome is present and when the brain is most malleable. “Putting this into the larger context of neuroscience research and treatment, there is currently a big push within the field of neurodegenerative diseases to be able to detect the biomarkers of these conditions before patients are diagnosed, at a time when preventive efforts are possible,” Piven said. “In Parkinson’s for instance, we know that once a person is diagnosed, they’ve already lost a substantial portion of the dopamine receptors in their brain, making treatment less effective.” The research, which was led by researchers at the Carolina Institute for Developmental Disabilities (CIDD) at the University of North Carolina, where Piven is director, included hundreds of children from across the country. The project’s other clinical sites included the University of Washington, Washington University in St. Louis and The Children’s Hospital of Philadelphia. Other key collaborators are McGill University, the University of Alberta, the University of Minnesota, the College of Charleston and New York University. “This study could not have been completed without a major commitment from these families, many of whom flew in to be part of this,” first author Heather Hazlett, Ph.D., assistant professor of psychiatry at the UNC School of Medicine and a CIDD researcher, said in a statement.


News Article | February 21, 2017
Site: www.medicalnewstoday.com

Does the biological clock in cancer cells influence tumour growth? Yes, according to a study conducted by Nicolas Cermakian, Director of the Laboratory of Molecular Chronobiology at the Douglas Mental Health University Institute, one of the research centres of the CIUSSS de l'Ouest-de-l'Île-de-Montréal. Published in the journal BMC Biology, these results show for the first time that directly targeting the biological clock in a cancerous tumour has an impact on its development. Most of the cells in the human body have an internal clock that sets a rhythm for the activities of our organs according to the time of the day. Cancer cells, however, often have a non-functioning or malfunctioning clock. "There were indications suggesting that the malfunctioning clock contributed to rapid tumour growth, but this had never been demonstrated. Thanks to the use of a chemical or a thermic treatment, we succeeded in 'repairing' these cells' clock and restoring it to its normal functioning. In these conditions, tumour growth drops nearly in half", explains Cermakian, a Full Professor in McGill University's Department of Psychiatry. Although this preclinical demonstration was done on mice, this important discovery provides a glimpse of potential new ways to treat cancer in humans. "Activating the biological clock in tumours could become an innovative approach in slowing their growth or that of metastases. This would give people more time to use more conventional treatment modalities, such as surgery or chemotherapy", says Cermakian. It now remains to be shown that we can target the clocks in human tumours the same way." For this study, Silke Kiessling, a postdoctoral fellow on Nicolas Cermakian's team, successfully adjusted the gears of the internal clocks in two types of cancer cells skin and colon to make them function properly. This repair, which was tested in mice and tissue cultures, slowed cancerous tumour growth. After about a week, the tumour treated in this manner was two-thirds smaller than the control tumour. While it is difficult to say at this point what types of cancer might be amenable to such an approach, this new concept could lead to an improvement in human cancer treatment in the long term, the researchers say. This research was funded by the Canadian Institutes of Health Research (CIHR) and the Fonds de la recherche du Québec-Santé (FRQ-S).


News Article | February 16, 2017
Site: www.eurekalert.org

Does the biological clock in cancer cells influence tumour growth? Yes, according to a study conducted by Nicolas Cermakian, a professor in McGill University's Department of Psychiatry. Published in the journal BMC Biology, these results show for the first time that directly targeting the biological clock in a cancerous tumour has an impact on its development. Most of the cells in the human body have an internal clock that sets a rhythm for the activities of our organs according to the time of the day. Cancer cells, however, often have a non-functioning or malfunctioning clock. "There were indications suggesting that the malfunctioning clock contributed to rapid tumour growth, but this had never been demonstrated. Thanks to the use of a chemical or a thermic treatment, we succeeded in 'repairing' these cells' clock and restoring it to its normal functioning. In these conditions, tumour growth drops nearly in half", explains Cermakian, who is also Director of the Laboratory of Molecular Chronobiology at the Douglas Mental Health University Institute, one of the research centres of the CIUSSS de l'Ouest-de-l'Île-de-Montréal. Although this preclinical demonstration was done on mice, this important discovery provides a glimpse of potential new ways to treat cancer in humans. "Activating the biological clock in tumours could become an innovative approach in slowing their growth or that of metastases. This would give people more time to use more conventional treatment modalities, such as surgery or chemotherapy", says Cermakian. It now remains to be shown that we can target the clocks in human tumours the same way." For this study, Silke Kiessling, a postdoctoral fellow on Nicolas Cermakian's team, successfully adjusted the gears of the internal clocks in two types of cancer cells ? skin and colon ? to make them function properly. This repair, which was tested in mice and tissue cultures, slowed cancerous tumour growth. After about a week, the tumour treated in this manner was two-thirds smaller than the control tumour. While it is difficult to say at this point what types of cancer might be amenable to such an approach, this new concept could lead to an improvement in human cancer treatment in the long term, the researchers say. This research was funded by the Canadian Institutes of Health Research (CIHR) and the Fonds de la recherche du Québec-Santé (FRQ-S). The article "Enhancing circadian clock function in cancer cells inhibits tumor growth" was published in the journal BMC Biology on February 14, 2017. DOI: 10.1186/s12915-017-0349-7 Nicolas Cermakian (PhD) is the director of the Laboratory of Molecular Chronobiology at the Douglas Mental Health University Institute and a Full Professor at McGill University's Department of Psychiatry. He is currently the president of the Canadian Society for Chronobiology. The work done in his laboratory focuses on maximizing our understanding of "the gears in the biological clock" and their impacts on physiology. He also studies the consequences of dysfunctional clocks on health including psychiatric disorders, infectious diseases and cancer. Silke Kiessling worked as a postdoctoral fellow in the team of Dr. Cermakian. She is currently a researcher at the Technical University of Munich. The Centre intégré universitaire de santé et de services sociaux (CIUSSS) de l'Ouest-de-l'Île-de-Montréal is made up of the CSSS de l'Ouest-de-l'Île, the CSSS de Dorval-Lachine-LaSalle, St. Mary's Hospital, St. Anne's Hospital, Douglas Mental Health University Institute, West Montreal Readaptation Centre, Grace Dart Extended Care Centre, and Batshaw Youth and Family Centres. The Douglas Mental Health University Institute is a world-class institute affiliated with McGill University and the World Health Organization. It treats people suffering from mental illness and offers them both hope and healing. Its teams of specialists and researchers are constantly increasing scientific knowledge, integrating this knowledge into patient care, and sharing it with the community in order to educate the public and eliminate prejudices surrounding mental health.


News Article | February 28, 2017
Site: www.businesswire.com

BOSTON--(BUSINESS WIRE)--GE (NYSE:GE) announced today the appointment of seven new company officers. Adrian Button has been promoted in his current role to Vice President of Supply Chain for Industrial Solutions, GE Energy Connections. Adrian joined GE in 1998 as a Quality Engineer and has held several operations leadership positions with GE Aviation, Unison Industries and GE Oil & Gas. Prior to joining GE Energy Connections, Adrian served as General Manager of Turbo Machinery Solutions for GE Oil & Gas covering the Middle East and North Africa region and General Manager of the Global Operations team. Adrian earned his bachelor’s degree in mechanical engineering from the University of Glamorgan in the United Kingdom. Buckmaster “Buck” de Wolf has been promoted to Chief Intellectual Property Counsel for GE and General Counsel for GE Global Research. Buck has been at GE for more than eleven years in senior legal roles at GE Corporate and GE Global Research. Prior to joining GE, Buck was a Partner at Howrey in San Francisco, CA. He earned his bachelor’s degree in economics from Middlebury College and his juris doctorate from Boston College. Danny Di Perna has been appointed Vice President, Global Sourcing for GE Power. Prior to joining GE, Danny was Pratt & Whitney’s Senior Vice President of Operations, responsible for new product development, sourcing, manufacturing, supply chain, supplier quality and production engine assembly. Danny has more than 27 years of experience within the aerospace industry, including 24 years with United Technologies Corporation. He earned his bachelor’s degree in mechanical engineering from Concordia University and his master’s in business administration from McGill University. Amit Phadnis has been appointed Vice President, Chief Technology Officer- Imaging, GE Healthcare. In this role, Amit will drive digitization, software and cross modality initiatives across the Imaging business. Amit joins GE from Cisco Systems where, most recently, he was the India Site Leader and Senior Vice President of Engineering for the Core Software Group. Prior to working at Cisco Systems, Amit held leadership roles at Motorola, Tata Elxsi and Silcom Automation Systems. Amit earned his master’s degree in electronics & communication from the Indian Institute of Science. Pascal Schweitzer has been appointed Vice President, Global Services at GE Transportation. Pascal joined GE in 2015 after GE’s acquisition of Alstom’s power and grid businesses, and was appointed General Manager for GE Power Services in Europe. Prior to joining GE, Pascal spent eight years at Alstom where he held several leadership positions, leading Gas Turbine global services in his most recent role. Pascal earned his master’s degree in finance from HEC Paris. Maria Sferruzza has been promoted to Vice President, Global Services for Turbomachinery Solutions at GE Oil & Gas. With more than twenty years of experience at GE Oil & Gas, Maria has held a variety of leadership roles in operations, sales, marketing, and services. Maria earned her master’s degree in industrial engineering from the Universita’ di Palermo, Italy. Anup Sharma has been promoted to Vice President, Chief Information Officer and Chief Application Architect at GE Digital. With twenty years of experience at GE, Anup has held Chief Information Officer roles at GE Power and GE Oil & Gas before his current position at GE Digital. Anup earned his bachelor’s degree in management information systems and business management from Huntington University in Indiana. GE (NYSE:GE) is the world’s Digital Industrial Company, transforming industry with software-defined machines and solutions that are connected, responsive and predictive. GE is organized around a global exchange of knowledge, the "GE Store," through which each business shares and accesses the same technology, markets, structure and intellect. Each invention further fuels innovation and application across our industrial sectors. With people, services, technology and scale, GE delivers better outcomes for customers by speaking the language of industry. www.ge.com


News Article | February 15, 2017
Site: www.eurekalert.org

This first-of-its-kind study used MRIs to image the brains of infants, and then researchers used brain measurements and a computer algorithm to accurately predict autism before symptoms set in CHAPEL HILL, NC - Using magnetic resonance imaging (MRI) in infants with older siblings with autism, researchers from around the country were able to correctly predict 80 percent of those infants who would later meet criteria for autism at two years of age. The study, published today in Nature, is the first to show it is possible to identify which infants - among those with older siblings with autism - will be diagnosed with autism at 24 months of age. "Our study shows that early brain development biomarkers could be very useful in identifying babies at the highest risk for autism before behavioral symptoms emerge," said senior author Joseph Piven, MD, the Thomas E. Castelloe Distinguished Professor of Psychiatry at the University of North Carolina-Chapel Hill. "Typically, the earliest an autism diagnosis can be made is between ages two and three. But for babies with older autistic siblings, our imaging approach may help predict during the first year of life which babies are most likely to receive an autism diagnosis at 24 months." This research project included hundreds of children from across the country and was led by researchers at the Carolina Institute for Developmental Disabilities (CIDD) at the University of North Carolina, where Piven is director. The project's other clinical sites included the University of Washington, Washington University in St. Louis, and The Children's Hospital of Philadelphia. Other key collaborators are McGill University, the University of Alberta, the University of Minnesota, the College of Charleston, and New York University. "This study could not have been completed without a major commitment from these families, many of whom flew in to be part of this," said first author Heather Hazlett, PhD, assistant professor of psychiatry at the UNC School of Medicine and a CIDD researcher. "We are still enrolling families for this study, and we hope to begin work on a similar project to replicate our findings." People with Autism Spectrum Disorder (or ASD) have characteristic social deficits and demonstrate a range of ritualistic, repetitive and stereotyped behaviors. It is estimated that one out of 68 children develop autism in the United States. For infants with older siblings with autism, the risk may be as high as 20 out of every 100 births. There are about 3 million people with autism in the United States and tens of millions around the world. Despite much research, it has been impossible to identify those at ultra-high risk for autism prior to 24 months of age, which is the earliest time when the hallmark behavioral characteristics of ASD can be observed and a diagnosis made in most children. For this Nature study, Piven, Hazlett, and researchers from around the country conducted MRI scans of infants at six, 12, and 24 months of age. They found that the babies who developed autism experienced a hyper-expansion of brain surface area from six to 12 months, as compared to babies who had an older sibling with autism but did not themselves show evidence of the condition at 24 months of age. Increased growth rate of surface area in the first year of life was linked to increased growth rate of overall brain volume in the second year of life. Brain overgrowth was tied to the emergence of autistic social deficits in the second year. Previous behavioral studies of infants who later developed autism - who had older siblings with autism -revealed that social behaviors typical of autism emerge during the second year of life. The researchers then took these data - MRIs of brain volume, surface area, cortical thickness at 6 and 12 months of age, and sex of the infants - and used a computer program to identify a way to classify babies most likely to meet criteria for autism at 24 months of age. The computer program developed the best algorithm to accomplish this, and the researchers applied the algorithm to a separate set of study participants. The researchers found that brain differences at 6 and 12 months of age in infants with older siblings with autism correctly predicted eight out of ten infants who would later meet criteria for autism at 24 months of age in comparison to those infants with older ASD siblings who did not meet criteria for autism at 24 months. "This means we potentially can identify infants who will later develop autism, before the symptoms of autism begin to consolidate into a diagnosis," Piven said. If parents have a child with autism and then have a second child, such a test might be clinically useful in identifying infants at highest risk for developing this condition. The idea would be to then intervene 'pre-symptomatically' before the emergence of the defining symptoms of autism. Research could then begin to examine the effect of interventions on children during a period before the syndrome is present and when the brain is most malleable. Such interventions may have a greater chance of improving outcomes than treatments started after diagnosis. "Putting this into the larger context of neuroscience research and treatment, there is currently a big push within the field of neurodegenerative diseases to be able to detect the biomarkers of these conditions before patients are diagnosed, at a time when preventive efforts are possible," Piven said. "In Parkinson's for instance, we know that once a person is diagnosed, they've already lost a substantial portion of the dopamine receptors in their brain, making treatment less effective." Piven said the idea with autism is similar; once autism is diagnosed at age 2-3 years, the brain has already begun to change substantially. "We haven't had a way to detect the biomarkers of autism before the condition sets in and symptoms develop," he said. "Now we have very promising leads that suggest this may in fact be possible." For this research, NIH funding was provided by the Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD), the National Institute of Mental Health (NIMH), and the National Institute of Biomedical Imaging and Bioengineering. Autism Speaks and the Simons Foundation contributed additional support.


News Article | February 16, 2017
Site: www.biosciencetechnology.com

Using magnetic resonance imaging (MRI) in infants with older siblings with autism, researchers from around the country were able to correctly predict 80 percent of those infants who would later meet criteria for  autism at two years of age. The study, published today in Nature, is the first to show it is possible to identify which infants – among those with older siblings with autism – will be diagnosed with autism at 24 months of age. “Our study shows that early brain development biomarkers could be very useful in identifying babies at the highest risk for autism before behavioral symptoms emerge,” said senior author Joseph Piven, MD, the Thomas E. Castelloe Distinguished Professor of Psychiatry at the University of North Carolina-Chapel Hill. “Typically, the earliest an autism diagnosis can be made is between ages two and three. But for babies with older autistic siblings, our imaging approach may help predict during the first year of life which babies are most likely to receive an autism diagnosis at 24 months.” This research project included hundreds of children from across the country and was led by researchers at the Carolina Institute for Developmental Disabilities (CIDD) at the University of North Carolina, where Piven is director. The project’s other clinical sites included the University of Washington, Washington University in St. Louis, and The Children’s Hospital of Philadelphia. Other key collaborators are McGill University, the University of Alberta, the University of Minnesota, the College of Charleston, and New York University. “This study could not have been completed without a major commitment from these families, many of whom flew in to be part of this,” said first author Heather Hazlett, PhD, assistant professor of psychiatry at the UNC School of Medicine and a CIDD researcher. “We are still enrolling families for this study, and we hope to begin work on a similar project to replicate our findings.” People with Autism Spectrum Disorder (or ASD) have characteristic social deficits and demonstrate a range of ritualistic, repetitive and stereotyped behaviors. It is estimated that one out of 68 children develop autism in the United States. For infants with older siblings with autism, the risk may be as high as 20 out of every 100 births. There are about 3 million people with autism in the United States and tens of millions around the world. Despite much research, it has been impossible to identify those at ultra-high risk for autism prior to 24 months of age, which is the earliest time when the hallmark behavioral characteristics of ASD can be observed and a diagnosis made in most children. For this Nature study, Piven, Hazlett, and researchers from around the country conducted MRI scans of infants at six, 12, and 24 months of age. They found that the babies who developed autism experienced a hyper-expansion of brain surface area from six to 12 months, as compared to babies who had an older sibling with autism but did not themselves show evidence of the condition at 24 months of age. Increased growth rate of surface area in the first year of life was linked to increased growth rate of overall brain volume in the second year of life. Brain overgrowth was tied to the emergence of autistic social deficits in the second year. Previous behavioral studies of infants who later developed autism – who had older siblings with autism –revealed that social behaviors typical of autism emerge during the second year of life. The researchers then took these data – MRIs of brain volume, surface area, cortical thickness at 6 and 12 months of age, and sex of the infants – and used a computer program to identify a way to classify babies most likely to meet criteria for autism at 24 months of age. The computer program developed the best algorithm to accomplish this, and the researchers applied the algorithm to a separate set of study participants. The researchers found that brain differences at 6 and 12 months of age in infants with older siblings with autism correctly predicted eight out of ten infants who would later meet criteria for autism at 24 months of age in comparison to those infants with older ASD siblings who did not meet criteria for autism at 24 months. “This means we potentially can identify infants who will later develop autism, before the symptoms of autism begin to consolidate into a diagnosis,” Piven said. If parents have a child with autism and then have a second child, such a test might be clinically useful in identifying infants at highest risk for developing this condition. The idea would be to then intervene ‘pre-symptomatically’ before the emergence of the defining symptoms of autism. Research could then begin to examine the effect of interventions on children during a period before the syndrome is present and when the brain is most malleable.  Such interventions may have a greater chance of improving outcomes than treatments started after diagnosis. “Putting this into the larger context of neuroscience research and treatment, there is currently a big push within the field of neurodegenerative diseases to be able to detect the biomarkers of these conditions before patients are diagnosed, at a time when preventive efforts are possible,” Piven said. “In Parkinson’s for instance, we know that once a person is diagnosed, they’ve already lost a substantial portion of the dopamine receptors in their brain, making treatment less effective.” Piven said the idea with autism is similar; once autism is diagnosed at age 2-3 years, the brain has already begun to change substantially. “We haven’t had a way to detect the biomarkers of autism before the condition sets in and symptoms develop,” he said. “Now we have very promising leads that suggest this may in fact be possible.”


News Article | February 15, 2017
Site: phys.org

Bird surveys provide crucial data for environmental management, but they have limitations—some areas are difficult to access, and surveyors vary in their skills at identifying birds. Using audio recordings made by unmanned aerial vehicles (UAVs) can help to combat both of these pitfalls, as hard-to-reach sites can be flown over and multiple people can review the resulting recordings. Andrew Wilson of Gettysburg College and his colleagues tested the feasibility of this approach by using fishing line to suspend an audio recorder from a simple "drone," first in trial runs on college athletic fields and then in real bird surveys on Pennsylvania State Game Lands. The experiments on state game lands directly compared UAV data with traditional ground-based surveys of the same areas. A few bird species were undercounted by the UAV technique, such as Mourning Doves, whose extremely low-frequency calls weren't picked up by the recorder, and Gray Catbirds, which occurred at such high densities that counting individual birds in the recordings was difficult. Overall, however, there were few significant differences between the results produced by the two methods. "The inspiration for the study came while I was surveying forests in the Appalachian Mountain in Pennsylvania for Cerulean Warblers," says Wilson. "All of our survey work was done from roadsides or hiking trails, for logistical reasons and to maximize survey efficiency, but I was always aware that our sample locations were very biased and that we were missing key areas such as steep forested slopes." He notes that the drone and audio recorder used in this experiment were inexpensive, commercially available models, making this technique within reach even for those with limited funding. "I recall my vocal reaction upon hearing their oral presentation during a session I chaired on emerging technologies to study birds at the 2016 North American Ornithology Conference last August, where I exclaimed, 'What an amazingly simplistic but useful application of a drone for bird research—I wish I had thought of it!'" says McGill University's David Bird, founding editor of the Journal of Unmanned Vehicle Systems. "This unique study provides a significant first step toward the inevitable common use of unmanned vehicle systems for monitoring songbird populations both during the breeding season and on migration." More information: "The feasibility of counting songbirds using unmanned aerial vehicles" The Auk: Ornithological Advances, February 15, 2017, at americanornithologypubs.org/doi/full/10.1642/AUK-16-216.1


News Article | February 15, 2017
Site: www.eurekalert.org

Pain is a signal of actual or potential damage to the body, so it is natural to think of it as a localized sensation: knee pain in the knee, back pain in the back and so on. However, research has demonstrated that pain is an experience constructed in the brain. A knee doesn't "feel" anything. Instead, it sends signals to the brain. Input from the body is important, but a person's pain experience also depends on the brain's interpretation of what the input signal means. Scientists are just beginning to study these complex cerebral processes, and in a promising step forward, University of Colorado Boulder researchers have developed a functional MRI-based model that identifies brain activity patterns involved in varied pain experience, even when the input from the body is held constant. "Pain is more than just a passive response to stimuli. The brain actively contributes to pain, constructing it through various neural systems," said Choong-Wan Woo, lead author and a post-doctoral researcher in CU Boulder's Institute of Cognitive Science when the research was completed. "Thus, we wanted to build a brain-based model to predict pain using variables beyond the painful stimuli." For the study, researchers began by aggregating data from six independent brain imaging studies, deliberately choosing those with differing methodologies. In all of the studies, participants had been exposed to several seconds' worth of a painful stimulus and asked to rate their pain while inside an MRI scanner that recorded brain activity. From the data, the researchers were able to identify common markers in the brain that were predictive of a participant's different pain experiences when external stimuli are matched on intensity, resulting in fine-grained mapping of both positively correlated ("pro-pain") and negatively correlated ("anti-pain") brain sub-regions. Comprising part of the new model, those markers several brain regions that are not classically considered important for pain. However, the regions -- which include the ventromedial prefrontal cortex, nucleus accumbens, and hippocampus -- are involved in the brain's assessment of the meaning of painful and non-painful events alike. The researchers named their telltale brain pattern the Stimulus Intensity Independent Pain Signature-1 (SIIPS1), a preliminary roadmap that can now be tested and refined in future studies. "We now have a model that can be applied to other basic and clinical pain research in the field," said Woo, who is now beginning an Assistant Professorship at Sungkyunkwan University in South Korea. "We deliberately added the number one to the name because we don't think this is the only brain signature related to pain and expect that more will be developed." The SIIPS1 may provide researchers with a new understanding of chronic pain and hypersensitivity to pain, potentially paving the way for the development of clinical applications and more effective treatments. "There is increasing evidence that chronic pain often involves changes in brain areas identified in our model," said Tor Wager, a professor in CU Boulder's Department of Psychology and Neuroscience and the study's senior author. "The SIIPS1 provides a template for systematic evaluation of how these areas are altered in chronic pain. We hope that it will improve our understanding of chronic pain and lead to the development of new options for preventing and treating this complex disease." The study was published today in the journal Nature Communications. In addition to Woo and Wager, co-authors of the new research include Liane Schmidt of Ecole Normale Supérieure (France); Anjali Krishnan of Brooklyn College of the City University of New York; Marieke Jepma of Leiden University (Netherlands); Mathieu Roy of McGill University (Canada); Martin Lindquist of Johns Hopkins University; and Lauren Atlas of the National Center for Complementary and Integrative Health and the National Institute on Drug Abuse.


News Article | February 15, 2017
Site: www.eurekalert.org

Forget delivering packages or taking aerial photographs--drones can even count small birds! A new study from The Auk: Ornithological Advances tests this new approach to wildlife monitoring and concludes that despite some drawbacks, the method has the potential to become an important tool for ecologists and land managers. Bird surveys provide crucial data for environmental management, but they have limitations--some areas are difficult to access, and surveyors vary in their skills at identifying birds. Using audio recordings made by unmanned aerial vehicles (UAVs) can help to combat both of these pitfalls, as hard-to-reach sites can be flown over and multiple people can review the resulting recordings. Andrew Wilson of Gettysburg College and his colleagues tested the feasibility of this approach by using fishing line to suspend an audio recorder from a simple "drone," first in trial runs on college athletic fields and then in real bird surveys on Pennsylvania State Game Lands. The experiments on state game lands directly compared UAV data with traditional ground-based surveys of the same areas. A few bird species were undercounted by the UAV technique, such as Mourning Doves, whose extremely low-frequency calls weren't picked up by the recorder, and Gray Catbirds, which occurred at such high densities that counting individual birds in the recordings was difficult. Overall, however, there were few significant differences between the results produced by the two methods. "The inspiration for the study came while I was surveying forests in the Appalachian Mountain in Pennsylvania for Cerulean Warblers," says Wilson. "All of our survey work was done from roadsides or hiking trails, for logistical reasons and to maximize survey efficiency, but I was always aware that our sample locations were very biased and that we were missing key areas such as steep forested slopes." He notes that the drone and audio recorder used in this experiment were inexpensive, commercially available models, making this technique within reach even for those with limited funding. "I recall my vocal reaction upon hearing their oral presentation during a session I chaired on emerging technologies to study birds at the 2016 North American Ornithology Conference last August, where I exclaimed, 'What an amazingly simplistic but useful application of a drone for bird research--I wish I had thought of it!'" says McGill University's David Bird, founding editor of the Journal of Unmanned Vehicle Systems. "This unique study provides a significant first step toward the inevitable common use of unmanned vehicle systems for monitoring songbird populations both during the breeding season and on migration." "The feasibility of counting songbirds using unmanned aerial vehicles" will be available February 15, 2017, at http://americanornithologypubs. (issue URL). About the journal: The Auk: Ornithological Advances is a peer-reviewed, international journal of ornithology that began in 1884 as the official publication of the American Ornithologists' Union, which merged with the Cooper Ornithological Society in 2016 to become the American Ornithological Society. In 2009, The Auk was honored as one of the 100 most influential journals of biology and medicine over the past 100 years.


News Article | February 28, 2017
Site: en.prnasia.com

BUFFALO, New York, March 1, 2017 /PRNewswire/ -- Athenex announced today that Mr. J. Nick Riehle has agreed to serve as Chief Financial Officer of the company effective upon approval of the Company's Board of Directors.  He will report to Athenex's Chief Executive Officer, Dr. Johnson Lau. Mr. Riehle is highly experienced in the biopharmaceutical sector, having served as Chief Financial Officer of Chelsea Therapeutics from its inception in 2004 until 2014 when it was sold to Lundbeck.  He was a key member of the leadership team alongside Chelsea's former Chief Executive Officer, Dr. Simon Pedder, who is also currently an officer of Athenex.  Mr. Riehle previously served as the Chief Financial Officer of HAHT Commerce from 1996 to 2003, and held numerous senior finance and marketing roles at Nortel Networks from 1979 to 1996. Dr. Johnson Lau, Chief Executive Officer and Board Chairman, stated, "Nick is a veteran in the biopharmaceutical sector and brings the invaluable experience of having been CFO of a publicly traded pharmaceutical company.  During the eight years I served as a Board member of Chelsea Therapeutics, including as Chairman of the Audit and Risk Management Committee and as a member of the Nominating and Corporate Governance Committee, I witnessed first-hand Nick's high standards and strong work ethic. We are delighted to have someone with Nick's extensive credentials joining our senior management team, and we warmly welcome him." Mr. Riehle stated, "I am delighted to be a member of the Athenex team and look forward to making significant contributions to its continued growth." Mr. Riehle obtained a Bachelor of Commerce degree from McGill University in Montreal, Quebec, a Master of Business Administration from York University in Toronto, Ontario, and the Certified Management Accountant designation from the Society of Management Accountants of Ontario. Founded in 2003, Athenex, Inc. is a global clinical stage biopharmaceutical company dedicated to becoming a leader in the discovery and development of next generation drugs for the treatment of cancer. Athenex is organized around three platforms including an Oncology Innovation Platform, a Commercial Platform and an Global Supply Chain Platform. Our Oncology Innovation Platform generates clinical candidates through an extensive understanding of kinases, including novel binding sites, human absorption biology and through the application of our proprietary research and selection processes in the lab. Our current clinical pipeline is derived from two different platform technologies we call Orascovery and Src Kinase Inhibition. The Orascovery platform is based on the novel oral P-glycoprotein pump inhibitor molecule HM30181A, through which we are able to facilitate oral absorption of traditional cytotoxics, which we believe may offer improved patient tolerability and efficacy as compared to IV administration of the same cytotoxics. The Src Kinase Inhibition platform refers to novel small molecule compounds that have multiple mechanisms of action, including the inhibition of the activity of Src Kinase and the inhibition of tubulin polymerization during cell division. We believe the combination of these mechanisms of action provide a broader range of anti-cancer activity as compared to either mechanism of action alone.. Athenex's employees worldwide are dedicated to improving the lives of cancer patients by creating more active and tolerable treatments. Athenex has offices in Buffalo and Clarence, New York, Cranford, New Jersey, Houston, Texas, Chicago, Illinois, Hong Kong, Taipei Taiwan, and multiple locations in Chongqing, China.


News Article | February 15, 2017
Site: www.marketwired.com

- Revenue of $682.7 million, up 11% from $616.3 million in prior year - EPS from continuing operations of $0.25 ($0.26 before specific items(1)) vs. $0.21 ($0.22 before specific items) in prior year MONTREAL, CANADA--(Marketwired - Feb. 14, 2017) - (NYSE:CAE)(TSX:CAE) - CAE today reported revenue of $682.7 million for the third quarter of fiscal year 2017 compared with $616.3 million last year. Third quarter net income attributable to equity holders from continuing operations was $67.6 million ($0.25 per share) compared to $57.9 million ($0.21 per share) last year. Third quarter net income before specific items(3) was $69.6 million, or $0.26 per share, which on the same basis, compares to $59.4 million ($0.22 per share) last year. "Our strong performance in the third quarter was led by Civil, with robust growth and order activity, and higher utilization of our training centres," said Marc Parent, CAE's President and Chief Executive Officer. "In addition to the continued solid progress in Civil, I am pleased to see that our strategy in Defence, to pursue a pipeline of comprehensive programs as a Training Systems Integrator, is bearing fruit. As testimony to CAE's vision to be the recognized global training partner of choice, Defence orders this quarter, including options, were more than $1 billion. And for CAE overall, we reached a new record $7.4 billion order backlog, further augmenting the Company's substantial base of recurring business." Third quarter Civil revenue was $412.8 million, up 23% compared to the same quarter last year, and segment operating income was $71.4 million (17.3% of revenue), up 29% compared to the third quarter last year. The third quarter includes the impact of a change in revenue recognition arising from the standardization of certain types of commercial aircraft simulators. Civil revenue and segment operating income, if adjusted (6)(7) for the impact of this change would have been $418.8 million and $73.4 million, respectively. Third quarter Civil training centre utilization(8) was 76%. During the quarter, Civil signed a series of training solutions contracts valued at $362.7 million, including training services for airline and business aviation customers, and the sale of 12 full-flight simulators (FFSs) to airlines including Southwest Airlines and China's Xiamen Airlines. Subsequent to the end of the quarter, Civil sold an additional six FFSs, bringing the total number of FFS sales announced fiscal year to date to 39. Civil also signed new long-term services agreements with customers, including Jetstar Airways Japan for crew resourcing and with Jet Airways for Boeing 737NG pilot training. The Civil book-to-sales(9) ratio was 0.88x for the quarter and 1.14x for the last 12 months. The Civil backlog at the end of the quarter was $3.3 billion. Third quarter Defence revenue was $243.7 million, down 4% compared to the same quarter last year, and segment operating income was $30.0 million (12.3% of revenue), up 1% compared to $29.7 million (11.7% of revenue) in the third quarter last year. During the quarter, Defence booked orders for $600.5 million and received another $656.6 million in contract options. Notable wins include a contract from new customer, Babcock France, to provide flight simulators for the French Air Force. Orders on enduring platforms include Airbus Defence & Space for a C295 transport aircraft FFS and simulator upgrades and training support services on the MH-60 Seahawk helicopter for both the U.S. Navy and Royal Australian Navy. In Training Systems Integration, Defence received a contract to extend the Royal Canadian Air Force NATO Flying Training in Canada program. Defence also won a long-term contract to train and qualify new Army helicopter pilots under the U.S. Army's Initial Entry Rotary-Wing training program. Following the end of the quarter, Defence was awarded a contract by Airbus for a comprehensive C295W training solution for Canada's Fixed-Wing Search and Rescue program, which has an expected value, including options, of more than $300 million over 26 years. Total Defence orders of $600.5 million this quarter, represent a book-to-sales ratio of 2.46x. The ratio for the last 12 months was 1.41x. The Defence backlog, including options and CAE's interest in joint ventures, at the end of the quarter reached a record $4.1 billion. This compares to $3.3 billion in the prior year period. Third quarter Healthcare revenue was $26.2 million compared to $28.3 million in the same quarter last year, and segment operating income was nil compared to $1.6 million in the third quarter last year. During the quarter, Healthcare was awarded orders including a contract for simulators and training centre management solutions for the CEGEP pre-university college system in Quebec. Healthcare also hosted its first Human Patient Simulation Network conferences in China and India to expand its potential global customer base. And more recently, at the International Meeting on Simulation in Healthcare in Orlando, Healthcare announced the release of CAE VimedixAR, an ultrasound training simulator integrated with the Microsoft HoloLens. CAE Healthcare will be the first company to bring a commercial Microsoft HoloLens mixed reality application to the medical simulation market and is one of only a few authorized resellers of the Microsoft HoloLens worldwide. Specific items this quarter of $2.0 million (net after-tax) involve restructuring, integration and acquisition costs related to the purchase of Lockheed Martin Commercial Flight Training (LMCFT). Free cash flow(11) from continuing operations was $124.7 million for the quarter compared to $194.4 million in the third quarter last year. Free cash flow year to date was $167.5 million compared to $234.9 million in the same period last year. Income taxes this quarter were $11.0 million, representing an effective tax rate of 14%, compared to 13% for the third quarter last year. The tax rate this quarter was higher compared to the third quarter last year, mainly due to the benefit of certain U.S. tax incentives last year. This quarter the rate was impacted by an audit settlement in Canada and a change in the mix of income from various jurisdictions. Excluding the effect of the settlement, the income tax rate this quarter would have been 16%. Net debt(13) ended the third quarter at $853.8 million for a net debt-to-total capital ratio(14) of 29.7%. This compares to net debt of $922.7 million and a net debt-to-total capital ratio of 32.1% at the end of the last quarter. Return on capital employed(15) (ROCE) was 11.0% in the third quarter compared to 10.7% last quarter. CAE will pay a dividend of 8 cents per share effective March 31, 2017 to shareholders of record at the close of business on March 15, 2017. During the three months ended December 31, 2016, CAE repurchased and cancelled a total of 307,900 common shares under the Normal Course Issuer Bid (NCIB), at a weighted average price of $19.12 per common share, for a total consideration of $5.9 million. On February 14, 2017, CAE received approval from its Board of Directors for the renewal of its NCIB to purchase up to 5,366,756 of its issued and outstanding common shares (approximately 2% of its outstanding shares) during the period from February 23, 2017 to no later than February 22, 2018. CAE continues to expect revenue and operating income growth in all segments in fiscal year 2017, led primarily by Civil, which is expected to have higher annual utilization of its training network and low double-digit percentage operating income growth. The Company continues to expect modest growth in Defence and now anticipates lower than expected growth in Healthcare this year, which was previously expected to deliver a double-digit percentage increase over last year. CAE expects the level of total capital expenditures in fiscal 2017 to remain relatively stable with the prior year ($117.8 million), with the exception of the addition of approximately $100 million capital investment for the U.S. Army Fixed-Wing Flight Training program. This program will become operational for training in the current fourth quarter. Management's expectations are based on the prevailing positive market conditions and customer receptivity to CAE's training solutions as well as material assumptions contained in this press release, quarterly MD&A and in CAE's fiscal year 2016 MD&A. CAE is pleased to announce that François Olivier has joined its Board of Directors, effective February 14, 2017. Mr. Olivier has been President and Chief Executive Officer of TC Transcontinental since 2008 where he has led a transformation and consolidation in the printing and media industry. He is now heading the diversification strategy of TC Transcontinental, driving the growth of its flexible packaging division. His deep financial acumen and strategic planning experience make him a strong addition to CAE's Board. Mr. Olivier holds a B.Sc. from McGill University and is a graduate of the Program for Management Development at Harvard Business School. Impact of the standardization of certain types of simulators on revenue recognition CAE's process improvement program results in the standardization of certain types of commercial aircraft simulators. For standardized simulators, percentage-of-completion (POC) accounting is no longer appropriate and thus the Company began recognizing revenue upon completion for such simulators in fiscal 2017. To facilitate performance comparability, management has provided the quarterly impact of this change on Civil revenue (Civil revenue - adjusted(6)), Civil segment operating income (Civil segment operating income - adjusted(7)), and EPS (EPS before specific items and adjusted for the impact of the standardization of simulators on revenue recognition(16)). This is a non-GAAP measure. We calculate the impact of the change in revenue recognition arising from the standardization of certain types of simulators by adjusting for the recognition of Civil revenue, Civil segment operating income and EPS upon completion for these simulators versus the Civil revenue, Civil segment operating income and EPS that would have otherwise been recognized under POC accounting. Readers are strongly advised to view a more detailed discussion of our results by segment in the Management's Discussion and Analysis (MD&A) and CAE's consolidated interim financial statements which are posted on our website at www.cae.com/investors. CAE's consolidated interim financial statements and MD&A for the quarter ended December 31, 2016 have been filed with the Canadian Securities Administrators on SEDAR (www.sedar.com) and are available on our website (www.cae.com). They have also been filed with the U.S. Securities and Exchange Commission and are available on their website (www.sec.gov). CAE President and CEO, Marc Parent; Sonya Branco, Vice President, Finance, and CFO; and Andrew Arnovitz, Vice President, Strategy and Investor Relations will conduct an earnings conference call today at 1:00 p.m. ET. The call is intended for analysts, institutional investors and the media. Participants can listen to the conference by dialling + 1 877 586 3392 or +1 416 981 9024. The conference call will also be audio webcast live for the public at www.cae.com. CAE is a global leader in training for the civil aviation, defence and security, and healthcare markets. Backed by a 70-year record of industry firsts, we continue to help define global training standards with our innovative virtual-to-live training solutions to make flying safer, maintain defence force readiness and enhance patient safety. We have the broadest global presence in the industry, with 8,000 employees, 160 sites and training locations in over 35 countries. Each year, we train more than 120,000 civil and defence crewmembers and thousands of healthcare professionals worldwide. This summary earnings press release contains limited information meant to assist the reader in assessing CAE's performance but it is not a suitable source of information for readers who are unfamiliar with CAE and is not in any way a substitute for the Company's financial statements, notes to the financial statements, and MD&A reports. Certain statements made in this press release are forward-looking statements. These statements include, without limitation, statements relating to our fiscal 2017 financial guidance (including revenues, capital investment and margins) and other statements that are not historical facts. Forward-looking statements are typically identified by future or conditional verbs such as anticipate, believe, expect, and may. All such forward-looking statements are made pursuant to the 'safe harbour' provisions of applicable Canadian securities laws and of the United States Private Securities Litigation Reform Act of 1995. Forward-looking statements, by their very nature, are subject to inherent risks and uncertainties and are based on several assumptions, both general and specific, which give rise to the possibility that actual results or events could differ materially from our expectations expressed in or implied by such forward-looking statements and that our business outlook, objectives, plans and strategic priorities may not be achieved. As a result, we cannot guarantee that any forward-looking statement will materialize and we caution you against relying on any of these forward-looking statements. The forward-looking statements contained in this press release describe our expectations as of February 14, 2017 and, accordingly, are subject to change after such date. Except as may be required by Canadian securities laws, we do not undertake any obligation to update or revise any forward-looking statements contained in this news release, whether as a result of new information, future events or otherwise. Except as otherwise indicated by CAE, forward-looking statements do not reflect the potential impact of any special items or of any dispositions, monetizations, mergers, acquisitions, other business combinations or other transactions that may occur after February 14, 2017. The financial impact of these transactions and special items can be complex and depends on the facts particular to each of them. We therefore cannot describe the expected impact in a meaningful way or in the same way we present known risks affecting our business. Forward-looking statements are presented in this press release for the purpose of assisting investors and others in understanding certain key elements of our expected fiscal 2017 financial results and in obtaining a better understanding of our anticipated operating environment. Readers are cautioned that such information may not be appropriate for other purposes. The value of capital investments expected to be made by CAE in FY2017 assumes that capital investments will be made in accordance with our current annual plan. However, there can be no assurance that such investment levels will be maintained with the result that the value of actual capital investments made by CAE during such period could materially differ from current expectations. A number of economic, market, operational and financial assumptions were made by CAE in preparing its forward-looking statements for fiscal 2017 contained in this news release, including, but not limited to certain economic and market assumptions including: modest economic growth and interest rates to remain largely unchanged in fiscal 2017; a sustained level of competition in civil, defence & healthcare markets; no material financial, operational or competitive consequences of changes in regulations affecting our business; and a relatively stable defence market. A number of assumptions concerning CAE's business were also made in the preparation of its forward-looking statements for fiscal 2017 contained in this news release, including, but not limited to factors including: productivity and efficiency gains to lower CAE's manufacturing costs and cycle times; maintenance of CAE's market share in civil simulator sales in the face of price competition; and higher Civil training network utilization. The foregoing assumptions, although considered reasonable by CAE on February 14, 2017, may prove to be inaccurate. Accordingly, our actual results could differ materially from our expectations as set forth in this news release. Important risk factors that could cause our assumptions and estimates to be inaccurate and actual results or events to differ materially from those expressed in or implied by our forward-looking statements, including our fiscal 2017 financial guidance, are set out in CAE's MD&A for the year ended March 31, 2016 filed by CAE with the Canadian Securities Administrators (available at www.sedar.com) and with the U.S. Securities and Exchange Commission (available at www.sec.gov). The fiscal year 2016 MD&A is also available at www.cae.com. The realization of our forward-looking statements, including our ability to meet our fiscal 2017 outlook, essentially depends on our business performance which, in turn, is subject to many risks. Accordingly, readers are cautioned that any of the disclosed risks could have a material adverse effect on our forward-looking statements. We caution that the disclosed list of risk factors is not exhaustive and other factors could also adversely affect our results. Non-GAAP and other financial measures This press release includes non-GAAP and other financial measures. Non-GAAP measures are useful supplemental information but may not have a standardized meaning according to GAAP. These measures should not be confused with, or used as an alternative for, performance measures calculated according to GAAP. They should also not be used to compare with similar measures from other companies. Management believes that providing certain non-GAAP measures provides users with a better understanding of our results and trends and provides additional information on our financial and operating performance. (1) Earnings per share before specific items is a non-GAAP measure calculated by excluding the effect of restructuring, integration and acquisition costs and one-time tax items from the diluted earnings per share from continuing operations attributable to equity holders of the Company. The effect per share is obtained by dividing the restructuring, integration and acquisition costs, net of tax, and one-time tax items by the average number of diluted shares. We track it because we believe it provides a better indication of our operating performance on a per share basis and makes it easier to compare across reporting periods. (2) Total backlog is a non-GAAP measure that includes obligated backlog, joint venture backlog and unfunded backlog. Obligated backlog represents the expected value of orders we have received but have not yet executed. Joint venture backlog is obligated backlog that represents the expected value of our share of orders that our joint ventures have received but have not yet executed. Unfunded backlog represents firm Defence and Security orders we have received but have not yet executed and for which funding authorization has not yet been obtained. We include unexercised negotiated options which we view as having a high probability of being exercised, but exclude indefinite-delivery/indefinite-quantity (IDIQ) contracts. (3) Net income before specific items is a non-GAAP measure we use as an alternate view of our operating results. We calculate it by taking our net income attributable to equity holders of the Company from continuing operations and adding back restructuring, integration and acquisition costs, net of tax, and one-time tax items. We track it because we believe it provides a better indication of our operating performance and makes it easier to compare across reporting periods. (4) Total segment operating income is a non-GAAP measure and is the sum of our key indicator of each segment's financial performance. Segment operating income gives us an indication of the profitability of each segment because it does not include the impact of any items not specifically related to the segment's performance. We calculate total segment operating income by taking the operating profit and excluding the impact of restructuring, integration and acquisition costs. (5) Operating profit is an additional GAAP measure that shows us how we have performed before the effects of certain financing decisions, tax structures and discontinued operations. We track it because we believe it makes it easier to compare our performance with previous periods, and with companies and industries that do not have the same capital structure or tax laws. (6) Civil revenue - adjusted is a non-GAAP measure we present to facilitate performance comparability that takes into account the impact of the change in revenue recognition arising from the standardization of certain types of simulators. We calculate this by taking our Civil revenue and adjusting for the impact of the recognition of revenue upon completion for these simulators versus the revenue that would have otherwise been recognized under POC accounting. (7) Civil segment operating income - adjusted is a non-GAAP measure we present to facilitate performance comparability that takes into account the impact of the change in revenue recognition arising from the standardization of certain types of simulators. We calculate this by taking our Civil segment operating income and adjusting for the impact of the recognition of segment operating income upon completion for these simulators versus the segment operating income that would have otherwise been recognized under POC accounting. (8) Utilization rate is an operating measure we use to assess the performance of our Civil simulator training network. We calculate it by taking the number of training hours sold on our simulators during the period divided by the practical training capacity available for the same period. (9) The book-to-sales ratio is the total orders divided by total revenue in a given period. (10) Simulator equivalent unit (SEU) is an operating measure we use to show the total average number of FFSs available to generate earnings during the period. (11) Free cash flow is a non-GAAP measure that shows us how much cash we have available to invest in growth opportunities, repay debt and meet ongoing financial obligations. We use it as an indicator of our financial strength and liquidity. We calculate it by taking the net cash generated by our continuing operating activities, subtracting maintenance capital expenditures, investment in other assets not related to growth and dividends paid and adding proceeds from the disposal of property, plant and equipment, dividends received from equity accounted investees and proceeds, net of payments, from equity accounted investees. (12) Maintenance capital expenditure is a non-GAAP measure we use to calculate the investment needed to sustain the current level of economic activity. Growth capital expenditure is a non-GAAP measure we use to calculate the investment needed to increase the current level of economic activity. (13) Net debt is a non-GAAP measure we use to monitor how much debt we have after taking into account liquid assets such as cash and cash equivalents. We use it as an indicator of our overall financial position, and calculate it by taking our total long-term debt, including the current portion of long-term debt, and subtracting cash and cash equivalents. (14) Net debt-to-capital is calculated as net debt divided by the sum of total equity plus net debt. (15) Return on capital employed (ROCE) is a non-GAAP measure we use to evaluate the profitability of our invested capital. We calculate this ratio over a rolling four-quarter period by taking net income attributable to equity holders of the Company excluding net finance expense, after tax, divided by the average capital employed. (16) EPS before specific items and adjusted for the impact of the standardization of simulators on revenue recognition is a non-GAAP measure calculated by excluding the effect of restructuring, integration and acquisition costs, one-time tax items and the impact of the standardization of certain types of simulators from the diluted earnings per share from continuing operations attributable to equity holders of the Company. The effect per share is obtained by dividing restructuring, integration and acquisition costs, net of tax, one-time tax items as well as the impact of the recognition of net income upon completion for these simulators versus the net income that would have otherwise been recognized under POC accounting by the average number of diluted shares. We track it because we believe it makes it easier to compare across reporting periods. For a detailed reconciliation of these measures as well as other non-GAAP and other financial measures monitored by CAE, please refer to CAE's MD&A filed with the Canadian Securities Administrators available on our website (www.cae.com) and on SEDAR (www.sedar.com). Consolidated Statement of Changes in Equity


Foulkes W.D.,McGill University | Smith I.E.,Royal Marsden Hospital | Reis-Filho J.S.,Institute of Cancer Research
New England Journal of Medicine | Year: 2010

A PUBMED SEARCH OF THE MEDICAL LITERATURE SHOWS THAT THE FIRST mention of "triple-negative" breast cancer was in October 2006; since then, the term has appeared in more than 600 publications.1 This increase reflects the growing recognition of the importance of triple-negative breast cancer (see the Glossary for this and other key terms) by oncologists, pathologists, and geneticists, as well as by the approximately 12 to 17% of women with breast cancer who have triple-negative breast cancer. As a group, patients with triple-negative tumors have a relatively poor outcome and cannot be treated with endocrine therapy or therapies targeted to human epidermal growth factor receptor type 2 (HER2). A close cousin of triple-negative breast cancer is basal-like breast cancer (synonymous terms include "basal-type," "basal-epithelial phenotype," "basal breast cancer," and "basaloid breast cancer"). This molecular subtype of breast cancer is characterized by a gene-expression profile that is similar to that of the basal-myoepithelial layer of the normal breast. 2 Immunohistochemical markers have been used as a surrogate for this profile. The multiplicity of names reflects an underlying uncertainty as to the true nature of this entity. Copyright © 2010 Massachusetts Medical Society.


Cole R.W.,New York State Department of Health | Jinadasa T.,McGill University | Brown C.M.,McGill University
Nature Protocols | Year: 2011

This protocol outlines a procedure for collecting and analyzing point spread functions (PSFs). It describes how to prepare fluorescent microsphere samples, set up a confocal microscope to properly collect 3D confocal image data of the microspheres and perform PSF measurements. The analysis of the PSF is used to determine the resolution of the microscope and to identify any problems with the quality of the microscope's images. The PSF geometry is used as an indicator to identify problems with the objective lens, confocal laser scanning components and other relay optics. Identification of possible causes of PSF abnormalities and solutions to improve microscope performance are provided. The microsphere sample preparation requires 2-3 h plus an overnight drying period. The microscope setup requires 2 h (1 h for laser warm up), whereas collecting and analyzing the PSF images require an additional 2-3 h. © 2011 Nature America, Inc. All rights reserved.


Grant
Agency: Cordis | Branch: FP7 | Program: CSA-SA | Phase: HEALTH.2013.4.1-2 | Award Amount: 559.84K | Year: 2013

This proposal aims at collecting and analysing facts and figures in order to assess the current legislation on the therapeutic use of somatic cells, and to bridge it with the research infrastructure capacity building. Although EU has adopted 3 Directives on Tissues and cells between 2004 and 2006 to harmonise the procurement, storage and use of cells for therapeutic use in Europe, countries have implemented these directives in very different ways. Furthermore, research has been partially covered by the initial regulation, calling into question the match between regulation and practices that will develop in the near future, in particular with the emergence of European research infrastructures. Finally many changes have occurred in the scientific, legal and institutional environment of cell use, leading to a necessary update of this regulation with regards to its implementation in national legislation and its impact on research practice and innovation. Two domains are at stake: research (infrastructures) and medical practice/public health measures (cells). The therapeutic use of cells is regulated by EU law whereas its research counterpart is mainly depending on national laws and regulations. This gap calls for a coordinated action in order to optimize the translational process, since the full pipeline is not coherently taken into account in current legislations. To achieve these objectives, our project relies on a coherent consortium of experts in the fields of cells therapies, cells banks and translational biomedicine, having strong expertise in law and/ or in governance issues. After 36 months the project will deliver evidence about the contemporary practices around cells and will design a picture of the market and its distribution between the public and private sector. The project will thus help the Commission in the regulatory choices covering the use of human cells for therapeutic purposes and to foster the innovation potential of related research activities.


Grant
Agency: GTR | Branch: NERC | Program: | Phase: Research Grant | Award Amount: 278.08K | Year: 2011

The Earth is a truly remarkable planet. In addition to the physical processes driving plate tectonics, climate and ocean-atmospheric exchange, it supports an extraordinary diversity of living organisms, from microbes to mammals and everything in between. Such wasnt always the case, however, and it is clear that both the planet and its biosphere have evolved - indeed, co-evolved - over deep time. In the past two billion years, by far the most fundamental shift in this co-evolutionary process occurred during the Neoproterozoic (1000 to 542 million years ago), a planetary revolution that culminated in the modern Earth system. The Neoproterozoic begins with a biosphere populated almost exclusively by microbes, and ends in the midst of its greatest ever evolutionary radiation - including the diverse macroscopic and biomineralizing organisms that define the modern biosphere. At the same time, it witnessed the greatest climatic and biogeochemical perturbations that the planet has ever experienced, alongside major palaeogeographic reconfigurations and a deep ocean that is becoming oxygenated for the first time. There is no question that these phenomena are broadly interlinked, but the tangle of causes, consequences and co-evolutionary feedbacks has yet to be convincingly teased apart. In order to reconstruct the Neoproterozoic revolution, we propose a multidisciplinary programme of research that will capture its evolving geochemical and biological signatures in unprecedented detail. Most significantly, these collated data will be assessed and modeled in the context of a co-evolving Earth system, whereby developments in one compartment potentially facilitate and escalate those in another, sometimes to the extent of deriving entirely novel phenomena and co-evolutionary opportunities. Our approach will be guided by three general hypotheses, testable against accruing data and theory: H1) that the enhanced weathering associated with land-dwelling eukaryotes was initiated in the early Neoproterozoic leading to major environmental change, including extreme glaciations and stepwise increase(s) in atmospheric oxygen concentration; H2) that major environmental changes in the mid Neoproterozoic triggered the emergence of animals; and H3) that the late Neoproterozoic-Cambrian radiations of animals and biomineralization were themselves responsible for much of the accompanying biogeochemical perturbation. Primary data for this project will be assembled from field studies of key geological sections in the UK and North China, along with contributed sample sets from Namibia, Spitsbergen and various archived collections. Together, these offer close to comprehensive coverage of the Neoproterozoic - not least, spectacular new surfaces of Ediacaran macrofossils from Charnwood Forest. Collected samples will be analysed to assess associated weathering and climate (Sr, C, O and S isotopes), oceanic redox conditions (Fe speciation and trace metals), nutrient dynamics (P speciation and trace metals) and biological constituents (microfossils, macrofossils and biomarker molecules). These data will be integrated and interrogated through the development of heuristic, spatial and evolutionary models. Beyond its integrative approach, the strength of this proposal lies in the diversity of the contributing researchers. Alongside our own expertise in biogeochemistry, palaeobiology and Earth system modelling, we are very pleased to have attracted world-class project partners in Neoproterozoic stratigraphy, geochronology and biomarker analysis. Further insight will come from our contingent of two PDRAs and three PhD students working across the range of topics and linked via a schedule of regular team meetings. Taken together, we anticipate a fundamentally improved understanding of the Neoproterozoic Earth system and the co-evolutionary interplay between the biosphere and planet.


News Article | February 15, 2017
Site: www.prweb.com

Adam Bergman, President of the IRA Financial Group, authored two articles on the IRA fiduciary rules for Forbes.com in February 2017. The Forbes IRA Financial Group articles discuss President Trump’s decision to use a memorandum to ask the labor secretary to consider rescinding a rule, better known as the fiduciary rules, set to go into effect in April 2017 that orders retirement advisers, overseeing about $3 trillion in assets, to act in the best interest of their clients. According to Mr. Bergman, “President Trump seemingly sided with the financial and securities industry that the fiduciary rules were overly burdensome and would limit investment options for IRA holders. In the end, it appears that President Trump was not convinced that any lower consumer costs associated with the enactment of the fiduciary rule would be enough to overcome its perceived shortfalls.” Adam Bergman is the President and founder of the IRA Financial Group and IRA Financial Trust Company, the market's leading provider of Self-Directed IRA LLC and Solo 401(k) plans. Mr. Bergman is also the managing partner of the law firm The Bergman Law Group, LLC. In addition, Mr. Bergman is a recognized expert on IRAs and 401(k) Plans and is the founder of the BergmanIRAReport.com and the Bergman401KReport.com. Mr. Bergman is also a frequent contributor to Forbes.com on the topic of self-directed retirement plans. Adam Bergman, IRA Financial Group partner, has written six books the topic of self-directed retirement plans, including, “The Checkbook IRA,” “Going Solo,” Turning Retirement Funds into Start-Up Dreams, Solo 401(k) Plan in a Nutshell, Self-Directed IRA in a Nutshell, and in God We Trust in Roth We Prosper. Mr. Bergman has been quoted in a number of major publications on the area of self-directed retirement plans. Mr. Bergman has been interviewed on CBS News and has been quoted in Businessweek, CNN Money, Forbes, Dallas Morning News, Daily Business Review, Law.com, San Francisco Chronicle, U.S. Tax News, the Miami Herald, Bloomberg, Arizona Republic, San Antonio Express, Findlaw, Smart Money, USA Today, Houston Chronicle, Morningstar, and American Lawyer on the area of retirement tax planning. Prior to joining the IRA Financial Group, LLC, Mr. Bergman worked as a tax and ERISA attorney at White & Case LLP, Dewey LeBoeuf LLP, and Thelen LLP, three of the most prominent corporate law firms in the world. Throughout his career, Mr. Bergman has advised thousands of clients on a wide range of tax and ERISA matters involving limited liability companies and retirement plans. Mr. Bergman received his B.A. (with distinction) from McGill University and his law degree (cum laude) from Syracuse University College of Law. Mr. Bergman also received his Masters of Taxation (LL.M.) from New York University School of Law. IRA Financial Group is the market's leading provider of self-directed IRA retirement plans. IRA Financial Group has helped thousands of clients take back control over their retirement funds while gaining the ability to invest in almost any type of investment, including real estate without custodian consent. Founded by top law firm tax attorneys, IRA Financial Group, has helped over 12,000 clients self-direct their retirement funds and invest over $3.8 billion in alternative assets, such as real estate and precious metals. To learn more about the IRA Financial Group please visit our website at http://www.irafinancialgroup.com or call 800-472-0646.


NOT FOR DISTRIBUTION IN THE UNITED STATES OR TO U.S. NEWSWIRE SERVICES Comstock Metals Ltd. (TSX VENTURE: CSL)("Comstock" or the "Company") is pleased to announce that at its Annual General Meeting of Shareholders held on Monday February 27, 2017, incumbent directors David Terry, Doug Turnbull, Steven Goldman and Rasool Mohammad were re-elected to the Board of Directors of the Company, and Ken Kuchling and Jeffrey Gregory were elected as new directors. At the Meeting, Shareholders also approved the number of directors, approved and ratified the Company's stock option plan, and re-appointed Dale Matheson Carr-Hilton LaBonte LLP, Chartered Accountants, as auditor of the Company. The Company is also pleased to announce that it has closed its previously announced non-brokered private of units ("Units") and flow-through units ("FT Units"). Pursuant to the offering the Company issued a total of 13,344,157 Units and 3,563,900 FT Units raising aggregate gross proceeds of $2,643,125.65. President and CEO David Terry stated ""I am very pleased to have Ken Kuchling and Jefferson Gregory join the board of directors of Comstock. Their vast experience and knowledge will be instrumental in assisting the Company as it moves forward." Mr. Kuchling brings with him over 35 years' experience in mine engineering, mining operations and consulting across a variety of commodities including precious metals, base metals, bauxite, iron ore, tungsten, molybdenum as well as diamonds and potash. Throughout his consulting career he has had direct involvement in scoping and feasibility studies, project management, 43-101 technical reports, economic modelling, mine design, and environmental permitting. Mr Kuchling has project experience working in various regions in Canada, Alaska, Mexico, Panama, Argentina, Suriname, Russia, South Korea, Italy, Spain, and Senegal. He was involved in the design stage and environmental permitting of the Diavik Diamond Project in the Northwest Territories and has experience with tropical to Arctic mining conditions. Mr. Kuchling is a mining engineering graduate from McGill University and holds a Masters of Mine Engineering from University of British Columbia. He is also a member of Professional Engineers Ontario (PEO) and currently lives in Toronto Ontario. Mr. Gregory is a businessman and investor specializing in the pharmaceutical sector. Throughout his career he has been involved in founding and operating a number successful companies, including NYSE-listed King Pharmaceuticals, Inc. between 1993 and 2004 and Graceway Pharmaceuticals LLC from 2006-2011. Mr. Gregory is the listed inventor on numerous awarded USPTO patents and he serves, or has served, as a member of the Board of Directors of multiple pharmaceutical, academic and charity organizations. Mr. Gregory or his transactions in the pharmaceutical industry have won numerous business awards and have been featured on multiple occasions in, among others, The Wall Street Journal, Forbes Magazine, Smart Money Magazine, Business Week, and CNBC. His strategies and methods have been taught as case studies at The Wharton School at The University of Pennsylvania. Mr. Gregory graduated from the University of Maryland in 1979 with a BS degree in Pharmacy and from the University of Maryland in 1985 with a Juris Doctorate Degree. He also holds an honorary Doctor of Laws degree conferred upon him by King University, TN. Each Unit was issued at a price $0.15 and consists of one common share in the capital of the Company (a "Share") and one common share purchase warrant (a "Warrant"). Each Warrant entitles the holder thereof to purchase one additional common share of the Company (a " Share") at an exercise price of $0.20 per Share for a period of 24 months from the Closing Date. Each FT Unit was issued at a price $0.18 and consists of one flow-through common share in the capital of the Company (a "FT Share") and one-half of one common share purchase warrant (each whole warrant a "FT Warrant"). Each FT Warrant entitles the holder thereof to purchase one additional non flow-through common share of the Company (a "Share") at an exercise price of $0.20 per Share for a period of 24 months from the Closing Date. The Warrants and FT Warrants include an acceleration clause, whereby, if the weighted average trading price of the Company's common shares on the TSX Venture Exchange (or such other exchange on which the common shares may trade) is at a price equal to or greater than $0.40 for a period of 20 consecutive trading days, the Company will have the right to accelerate the expiry date of the Warrants and FT Warrants. If the Company exercises such right, it will give written notice to the holders of the Warrants and FT Warrants that such warrants will expire 30 days from the date of notice to the warrant holders. Such notice by the Company to the holders of the Warrants and FT Warrants may not be given until 4 months and one day after the Closing Date. In connection with the closing of the financing, the Company paid finders an aggregate commission of $58,318.81 and issued an aggregate of 352,898 compensation options. Each compensation option entitles the holder thereof to acquire one Unit at a price of $0.15 per Unit for a period of 24 months from the Closing Date. The Company will use the gross proceeds of the offering of FT Units for eligible exploration expenditures, which will constitute "Canadian Exploration Expenses" ("CEE") that are "Flow-Through mining expenditures", as defined in the Income Tax Act (Canada) which can be renounced to purchasers of the FT Units for the 2017 taxation year in the aggregate amount of not less than the total amount of the gross proceeds raised from the flow-through offering. The CEE shall be incurred no later than December 31, 2018. The proceeds from the offering of Units will be used to fund exploration on the Company's mineral properties and for general working capital. The securities issued under the offerings have not been, and will not be, registered under the U.S. Securities Act or any U.S. state securities laws, and may not be offered or sold in the United States or to, or for the account or benefit of, U.S. persons absent registration or any applicable exemption from the registration requirements of the U.S. Securities Act and applicable U.S. state securities laws. The securities issued in this financing are subject to a hold period that expires on June 28, 2017. Comstock Metals Ltd. is a Canadian-focussed mineral exploration company with two 100% owned resource-stage gold projects. Additional Assets: Comstock also owns the early stage Old Cabin gold project in Ontario and uranium claims in the Patterson Lake area of Saskatchewan and has optioned out its Corona property in Mexico (see Comstock's news release dated January 28, 2016). David A. Terry, Ph.D., P.Geo., a Qualified Person as defined by National Instrument 43-101, has reviewed and approved the scientific and technical disclosure in this news release. This news release includes forward-looking information and statements, which may include, but are not limited to, information and statements regarding or inferring the future business, operations, financial performance, prospects, and other plans, intentions, expectations, estimates, and beliefs of the Company. Such statements include statements regarding the use of proceeds resulting from the financing. Forward-looking information and statements involve and are subject to assumptions and known and unknown risks, uncertainties, and other factors which may cause actual events, results, performance, or achievements of the Company to be materially different from future events, results, performance, and achievements expressed or implied by forward-looking information and statements herein. The assumptions on which the forward looking statements contained herein rely include the ability to complete the proposed financing. Although the Company believes that any forward-looking information and statements herein are reasonable, in light of the use of assumptions and the significant risks and uncertainties inherent in such information and statements, there can be no assurance that any such forward-looking information and statements will prove to be accurate, and accordingly readers are advised to rely on their own evaluation of such risks and uncertainties and should not place undue reliance upon such forward-looking information and statements. Any forward-looking information and statements herein are made as of the date hereof, and except as required by applicable laws, the Company assumes no obligation and disclaims any intention to update or revise any forward-looking information and statements herein or to update the reasons that actual events or results could or do differ from those projected in any forward looking information and statements herein, whether as a result of new information, future events or results, or otherwise, except as required by applicable laws. Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this Release.


Hollywood, Feb. 14, 2017 (GLOBE NEWSWIRE) -- Earth Science Tech, Inc. (OTC PINK: ETST) ("ETST" or "the Company"), an innovative biotech company focused on hemp cannabinoid research and development, through its wholly owned subsidiary, Cannabis Therapeutics, Inc., recently signed a joint venture with Smart Medicines GMP, which will allow the companies to explore synergies in researching and developing new CBD-based nutraceuticals and pharmaceutical compounds based on Earth Science Tech’s International Application (PCT) for its Provisional Patent named “Cannabidiol Compositions Including Mixtures and Uses Thereof” which was filed on October 8th, 2015 in regards to its Cannabis Hemp CBD (Cannabidiol) Oil. Smart Medicines is equipped with a state-of-the-art laboratory and research facilities with high tech equipment and botanical extraction units. Smart Medicines will focus heavily on the research and development tasks associated with new product development. This partnership will help position Cannabis Therapeutics to be a global leader in the cannabis industry and in cannabinoid research and development. Cannabis Therapeutics’ imminent new developments and efforts have the potential to expedite our numerous upcoming cannabis cannabinoid-based therapeutic products to help aid people with certain conditions and disorders worldwide, in the later part of 2017. We are focused on cannabinoid-based therapeutic drugs, functional foods and nutraceuticals (retail consumer markets worldwide). Smart Medicines is run by Dr. Domenico Fuoco, who recently joined the Advisory Board of Cannabis Therapeutics, Inc. (an Earth Science Tech subsidiary). Dr. Fuoco has over 16 years of extensive experience in developing innovative solutions for the pharmaceutical and nutraceutical industries in addition to his current status as a professional formulator. Dr. Fuoco and company’s expertise are expected to be of great benefit to Earth Science tech in its new product creation. View Dr. Fuoco’s full biography below. Smart Medicines and Earth Science Tech have close ties with CQIB (http://www.cqib.org/home.html), a biotech and life sciences incubator. They will work closely with CQIB to improve upon and further develop their patents while developing a stronger product portfolio. This relationship will further provide both companies access to top-of-the-line research and development equipment and laboratories to provide the most accurate of results. “We are excited to be getting so heavily involved with Dr. Domenico Fuoco and his company, Smart Medicines GMP,” said CEO Michael Aube, “We are working hard to establish a new line of strong nutraceutical and other CBD-based products, and we think this joint venture will be very lucrative for all parties.” Cannabis Therapeutics will work with Smart Medicines to invent and launch two new cannabinoid-based pharmaceutical drugs and three new advanced cannabinoid-based nutraceutical products using Earth Science Tech’s existing Cannabis CBD patent, IP, inventions, technology, and future technology. Cannabis Therapeutics’ primary goal is to discover solutions for conditions for which there is presently no effective treatment as well as other medical disorders with the application of known and novel cannabis cannabinoid-based products. Some of the R&D that Cannabis Therapeutics will target will be treatments for the conditions and disorders of: Pain, Chronic Pain, PTSD, Breast Cancer, Brain Cancer, Anxiety, Depression, Glaucoma, Crohn’s disease, Fatty Liver Diseases, Diabetes, Parkinson' s Disease, Alzheimer's Disease, Attention Deficit Hyperactivity Disorder (ADHD), and Drug Addictions among other things. ETST has chosen to target diseases for which, the benefits of Cannabinoids and/or CBD (Cannabidiol) have already been demonstrated by different groups of researchers around the world. However, it is through ETST’s in vitro study with the University of Central Oklahoma and DV Biologics that results confirm the positive effectiveness of Earth Science Tech’s CBD (Canabidiol) on breast cancer, immune cell function, and human brain cells by acting as a neuroprotectant as shown in its International Application (PCT) for its Provisional Patent. Thus, as a result by mixing natural molecules and generic pharmaceutical drugs with Cannabinoids and/or CBD (Cannabidiol) we intend to increase the effectiveness of Cannabinoids and/or CBD (Cannabidiol) and improve the treatment of different diseases. Dr. Domenico Fuoco, PhD.Domenico Fuoco, Ph.D., has joined the Cannabis Therapeutics Inc. Advisory Board. Dr. Fuoco has over 16 years’ experience in the research and development of innovative solutions for the pharmaceutical industry. Dr. Fuoco trained at the prestigious Department of Oncology of McGill University Health Centre (MUHC) in Montreal, from 2012 to 2015. During this time, Dr. Fuoco worked on the next generation of medications for AVEO Oncology and Helsinn Therapeutics. Prior to this, Dr. Fuoco obtained his PhD and Post-Doc training in medicinal chemistry and drug discovery at the University of Perugia in Italy with further studies at the University of Salamanca School of Pharmacy in Spain. Dr. Fuoco is recognized for the transdisciplinary approach of his work. In 2010, Dr. Fuoco was Principal Scientist of the Italian Mission in Amazonia, Bogotà, Colombia.  Dr. Fuoco’s publications cover a wide-range of chemical fields, from functional foods to autoimmune diseases. In 2015, Dr. Fuoco was honored with the prestigious Dr. Henry Shibata Fellowship from the Cedar Cancer Foundation for his work in the field of palliative care. Dr. Fuoco is an active member of the Italian Canadian Community Foundation and is very active within his community.  He is also the chairman from Smart Medicines Consortium for the advancement of health care. Dr. Fuoco’s expertise in human health and functional foods are highly valued as strategic assets by Cannabis Therapeutics Inc. and ETST. About Earth Science Tech: (www.earthsciencetech.com) is a publicly traded (ETST) unique Science based Biotechnology company focused on cutting edge Nutraceuticals, Bioceuticals, and Phytoceuticals for the Health, Wellness and Alternative Medicine Markets to help improve the quality of life for Consumers Worldwide. ETST is also dedicated to providing Natural Alternatives to prescription medications through the use of its cutting edge Nutritional and Dietary Supplements. This may include products such as its High-Grade Hemp CBD (Cannabidiol) Oil, Vitamins, Minerals, Herbs, Botanicals, Personal Care Products, Homeopathies, Functional Foods and other products. These products may be in various formulations and delivery systems including (but not limited to) capsules, tablets, soft gels, chewables, liquids, creams, sprays, powders, and whole herbs. ETST is focused on researching and developing innovative Hemp extracts and to make them accessible Worldwide. ETST plans to be the premier supplier of the highest quality and purity of High Grade Hemp CBD (Cannabidiol) Oil. ETST's primary goal is to advance different High Quality Hemp extracts with a broad profile of Cannabinoids and additional natural molecules found in Industrial Hemp and to identify their distinct properties. The company is dedicated in offering its consumers the finest and purest quality All Natural-Organic Hemp CBD Oil while never compromising on quality. ETST High Grade Hemp CBD (Cannabidiol) Oil is classified as "food based" and therefore perfectly permissible in all 50 states and more than 40 countries. Cannabinoids (Cannabidiol/CBD) are natural constituents of the Hemp plant and CBD is derived from Hemp stalk and seed. Hemp oil is a well-known dietary supplement and the naturally occurring CBD possesses no psychoactive qualities and presents a continuing stream of overwhelming evidence of significant Wellness benefits. With no psychoactive ingredient, Hemp CBD Oil is a ready-for-market Hemp-basedNutraceutical. The United States Food and Drug Administration (FDA) currently considers non-THC hemp based cannabinoids, including CBD, to be "food based" and therefore salable. These new non-psychoactive CBD-rich hemp oil products that ETST has geared up to market and distribute are beyond reproach. CBD (Cannabidiol), a naturally occurring constituent of the Industrial Hemp plant, promotes and supports the nutritional health of aging bodies in particular. Source: US Government Patent #6,630,507 "Cannabinoids as antioxidants and neuroprotectants." ETST does not grow, sell or distribute any substances that violate United States Law or the controlled substance act. ETST does sell and distribute cannabis industrial hemp based products. About Cannabis Therapeutics: Cannabis Therapeutics, Inc. is a wholly owned subsidiary of Earth Science Tech, Inc (ETST). Cannabis Therapeutics, Inc. was formed as an emerging biotechnology company poised to become a world leader in cannabinoid research and development for a broad line of cannabis cannabinoid-based pharmaceuticals, nutraceuticals as well as other products & solutions. Cannabis Therapeutics mission it to help change the healthcare landscape by introducing their proprietary cannabis-cannabinoid based products made for both the pharmaceutical and retail consumer markets worldwide. The company is currently working on finishing the launch of its new corporate website at www.Cannabisthera.com About Earth Science Pharmaceutical: Earth Science Pharmaceutical, Inc. is a wholly owned subsidiary of Earth Science Tech, Inc (ETST). Earth Science Pharmaceutical is focused on becoming a world leader in the development of low cost, non-invasive diagnostic tools, medical devices, testing processes and vaccines for STIs (Sexually Transmitted Infections and/or Diseases). Earth Science Pharmaceutical CEO, Dr. Michel Aubé, a renowned scientist, is committed to help grow ETST in the medical and pharmaceutical industry. The company is currently working on finishing the launch of its new corporate website at www.Earthsciencepharmaceutical.com FOOD AND DRUG ADMINISTRATION (FDA) DISCLOSURE: These statements and products have not been evaluated by the FDA and are not intended to diagnose, treat or cure any disease. Always check with your physician before starting a new dietary supplement program. The FDA has not evaluated the validity or truthfulness of these claims; therefore, we encourage you to review published researches relating to the benefits and properties of CBD hemp oils and other CBD products. SAFE HARBOR ACT: Forward-Looking Statements are included within the meaning of Section 27A of the Securities Act of 1933, and Section 21E of the Securities Exchange Act of 1934, as amended. All statements regarding our expected future financial position, results of operations, cash flows, financing plans, business strategy, products and services, competitive positions, growth opportunities, plans and objectives of management for future operations, including words such as "anticipate," "if," "believe," "plan," "estimate," "expect," "intend," "may," "could," "should," "will," and other similar expressions are forward-looking statements and involve risks, uncertainties and contingencies, many of which are beyond our control, which may cause actual results, performance, or achievements to differ materially from anticipated results, performance, or achievements. We are under no obligation to (and expressly disclaim any such obligation to) update or alter our forward-looking statements, whether as a result of new information, future events or otherwise.


LONGUEUIL, CANADA--(Marketwired - Feb. 22, 2017) - Highland Copper Company Inc. (TSX VENTURE:HI) (the "Company") is pleased to announce that, effective immediately, Mr. Denis Miville-Deschênes has joined the Company as President and CEO and a member of the Board of Directors of the Company. Mr. Miville-Deschênes is a mining engineer with over 30 years of experience in the design, development and construction of mines as well as closure and rehabilitation of sites. He was Senior Vice President at Iamgold, responsible for development, project construction and technical services from 2006 to 2014. During his career which started with Falconbridge Copper and then with Cambior and Iamgold, Mr. Miville-Deschênes has worked on numerous technical studies and fourteen underground or open pit mining projects in North America, South America and Africa. He is recognized for his ability to establish dynamic work teams and operating at high standards. Mr. David Fennell who has been acting as President and CEO on an interim basis will continue as Chairman of the Company. Mr. Fennell commented on the appointment of Mr. Miville-Deschênes: "we are very happy to welcome Denis as President and CEO of Highland Copper and to the Board. Denis will be the driving force behind the initiatives to advance our projects in the Upper Peninsula, Michigan, towards production, with the goal of developing the mineral resources in a responsible manner and with a deep respect for our workers, neighboring communities and the environment." The Company also announces the appointment of Mr. David Charles as Manager, Investor Relations and Business Development. David Charles brings close to 30 years of experience in the financial services industry in Canada primarily as a senior mining equity analyst. During his career Mr. Charles has worked for BMO Capital Markets, GMP Securities and Dundee Capital Markets and analysed mines and projects in North and South America, Europe and Africa. Mr. Charles holds a bachelor's degree in geology from Trinity College Dublin, an MSc. (applied) in Mineral Exploration from McGill University and is a CFA charter holder. Mr. Charles does not currently have any direct or indirect interest in the Company. He will provide his services under a consulting agreement with the Company. David Charles' mandate is to develop the Company's investor communications and market awareness efforts, assisting management in developing a strategy to enhance and expand the Company's exposure in the financial markets. The appointments of Messrs. Denis Miville-Deschênes and David Charles are subject to the TSX Venture Exchange approval. Highland Copper Company Inc. is a Canadian exploration company focused on exploring and developing copper projects in the Upper Peninsula of Michigan, U.S.A. More information about the Company is available on the Company's website at www.highlandcopper.com and on SEDAR at www.sedar.com. Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release.


LONGUEUIL, CANADA--(Marketwired - Feb. 10, 2017) - Reunion Gold Corporation (TSX VENTURE:RGD) (the "Company") is pleased to announce, effective immediately, the appointment of Mr. Réjean Gourde, as President and CEO of the Company and Mr. David Charles as Manager, Investor Relations and Business Development. Mr. David Fennell, who has been acting as President and CEO on an interim basis will continue as Chairman of the Company. The Company is also pleased to announce that Ms. Elaine Bennett has been appointed to the Company's Board of Directors effective immediately. Appointment of Réjean Gourde as President and CEO Mr. Réjean Gourde, a Reunion Gold board member since 2011, has been appointed President and CEO of the Company. Mr. Gourde has more than three decades of experience in the mining industry. From 1994 to 2006, Mr. Gourde was SVP of the Guiana Shield Division at Cambior Inc. (now IAMGOLD). In that role he was responsible for the operation of Omai Gold Mines in Guyana, Rosebel Gold Mines in Suriname and other projects in the Guiana Shield. Since 2007, Mr. Gourde has worked as a mining consultant on several mining projects including the Essakane and Bomboré projects in West Africa, and other projects in Guyana and Peru. Mr. Gourde holds a Bachelor of Science Degree in Mining Engineering from Ecole Polytechnique at the Universite of Montreal and is a registered Professional Engineer in Quebec. Mr. David Fennell, who remains as Chairman of Reunion Gold, commented on the appointment of Mr. Gourde: "we are very happy to welcome Réjean as President and CEO of Reunion Gold. Réjean brings with him unparalleled experience in the Guiana Shield both from the perspective of advancing projects from feasibility to development and mine operation. With the Company's strategic shift to focus its attention on gold projects located in the Guiana Shield of South America, Réjean will be a key member of the team that will construct the project portfolio. Appointment of Elaine Bennett to the Board The Company is also pleased to report that the board of directors of the Company has appointed Ms. Elaine Bennett as director and member of the audit committee of the board, subject to TSX Venture approval. "We are delighted that Elaine has accepted to join the board of Reunion Gold. Her experience in the financial and mining business will be of significant benefit to the Company" said David Fennell, the Company's Chairman. Since 2008, Ms. Bennett has been Vice President Finance and CFO for Sabina Gold & Silver Corp., an advanced exploration and development company listed on the TSX. Prior to joining Sabina, Ms. Bennett was VP Finance and CFO for Miramar Mining Corporation which was acquired by Newmont in 2007. With more than 25 years of experience in the mining industry, Ms. Bennett has experience in financial reporting, mergers and acquisitions, corporate reorganizations, mine construction, accounting and information technology. Ms. Bennett has also been director and chair of the audit committee of three junior exploration company listed on the TSXV having activities abroad. Ms. Bennett is a Chartered Professional Accountant. David Charles brings close to 30 years of experience in the financial services industry in Canada primarily as a mining equity analyst. During his career Mr. Charles has worked for BMO Capital Markets, GMP Securities and Dundee Capital Markets as a senior analyst and visited mines and projects in North and South America, Europe and Africa. Mr. Charles holds a bachelor's degree in geology from Trinity College Dublin, an MSc. (applied) in Mineral Exploration from McGill University and is a CFA charter holder. David Charles' mandate is to develop the Company's investor communications and market awareness efforts, assisting management in developing a strategy to enhance and expand the Company's exposure in North America and Europe. In exchange for Investor Relations services, subject to TSX Venture Exchange approval, the Company will pay a monthly fee of C$4,167 and grant stock options to purchase up to 400,000 common shares of the Company at an exercise price of $0.07 per common share for a period of five years. Mr. Charles' options will be vesting over two years in accordance with vesting and termination provisions pursuant to the Company's Stock Option Plan and TSX Venture Exchange policies. David Charles does not currently have any direct or indirect interest in the Company. Rejean Gourde, the Company's President and CEO, stated: "Mr. Charles will be a valuable addition to our team, particularly in assisting with investor communications. I welcome David to our team." The Company also announces that, subject to regulatory approval, it has approved the grant of an aggregate of 8,645,000 incentive stock options to directors, officers, employees and consultants of the Company. The options are exercisable for a period of five years at an exercise price of $0.07 and will be vesting over a period of two years. Reunion has recently sold its manganese project in Guyana and entered into option agreements to acquire an interest in two gold projects in French Guiana. The options are subject to a number of conditions. Reunion will be conducting due diligence on the projects and seeking the necessary approvals. Information about Reunion is available on SEDAR (www.sedar.com) and its website (www.reuniongold.com). Neither the TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this press release.


News Article | February 23, 2017
Site: www.prnewswire.co.uk

The Victor Dahdaleh Foundation - the charitable organisation of Canadian entrepreneur and philanthropist Victor Dahdaleh - has signed a formal agreement to donate £5 million to the British Lung Foundation to fund mesothelioma research in the UK. The donation, which matches government funding announced last year, was made official at a signing ceremony in the House of Lords today. It is the largest ever made to the BLF. The funding will support the development of new treatments for the disease by a combined research team from the University of Leicester, Papworth Hospital NHS Foundation Trust in Cambridge, and the government-funded National Mesothelioma Research Centre at Imperial College in London. Today's ceremony was attended by a number of eminent peers and academics, including the sociologist Lord Giddens; entrepreneur Lord Borwick; and Professor Stephen Spiro, formerly head of respiratory medicine at UCLH. Speaking at the ceremony, Victor Dahdaleh said the Foundation was confident that the team would be able to deliver tangible benefits for patients. "We are delighted to be working in coordination with the British Lung Foundation, the UK Department of Health, and the research team to support the quest for new treatments for this terrible disease. "The UK already has leading expertise in mesothelioma research, and we believe that by working together in this way we can do even more. The professionalism we have already seen from everyone involved has been second-to-none." In an additional move towards greater collaboration between research centres, the British Lung Foundation has formed a Mesothelioma Research Network, involving the programmes at Leicester, Papworth and Imperial together with other specialist mesothelioma centres across the UK. Mesothelioma, a type of cancer commonly affecting the chest or abdomen, is on the rise in the UK, with 2,500 people dying from it each year. The disease is most closely associated with asbestos exposure and often kills with alarming speed. Dr Penny Woods, chief executive of the British Lung Foundation, said: "It is hugely exciting for all of us here to be officially marking the start of a new chapter in research into mesothelioma. Along with the government funding announced last year, this generous support from the Victor Dahdaleh Foundation will enable us to coordinate a network of highly skilled researchers and greatly increase the size and scope of clinical trials. "We are also confident that this donation will prompt further funding and allow us to continue to expand the programme. We will not rest until we find a cure." The Victor Dahdaleh Foundation has a long history of supporting health-related causes around the world. In 2015, the organisation funded the Dahdaleh Institute for Global Health - a state-of-the-art research facility at York University in Toronto, Canada. Also in Canada, the Foundation last year financed neuroscientific research at McGill University in Montreal into diseases including multiple sclerosis and Alzheimer's. In the UK, the Foundation is a long-standing supporter of research into cardiovascular disease, and has backed a range of studies carried out by teams at Imperial College and Royal Brompton Hospital. As well as healthcare, the Victor Dahdaleh Foundation promotes access to education by funding scholarships programmes that give young people from disadvantaged backgrounds the opportunity to study at top universities around the world. Victor Dahdaleh is the owner and chairman of Dadco, a privately owned investment, manufacturing and trading group established in 1915. A lifelong champion of close ties between Canada and the UK, he served as president of the Canada-United Kingdom Chamber of Commerce from 2004 to 2009. For more information on the Victor Dahdaleh Foundation, visit victordahdalehfoundation.com.


Hollywood, Feb. 09, 2017 (GLOBE NEWSWIRE) -- Earth Science Tech, Inc. (OTC PINK: ETST) ("ETST" or "the Company"),   an innovative biotech company, which focuses on cannabis-industrial hemp, cannabinoid research and development, nutraceuticals and pharmaceuticals is proud to announce that four new scientists and doctors have joined the company’s Advisory Board. ETST strategy of recruiting industry experts to help expand and increase the Development of Cannabinoids' Therapeutic Indications, R&D, Technology, IP and Treatments. These Four Distinguished Scientists and Doctors will serve on the board of advisory for Earth Science Tech and or its two (2) wholly owned subsidiaries, Cannabis Therapeutics Inc., and Earth Science Pharmaceutical Inc. Dr. Laurent Azoulay, PhD. Laurent Azoulay, Ph.D., has joined both the Cannabis Therapeutics Inc. and Earth Science Pharmaceutical Inc. Advisory Boards. He is an Associate Professor of Oncology at McGill University, where he actively researches cancer pharmacoepidemiology, which includes evaluating the safety of cancer drugs at a societal level. After receiving his PhD in 2007 from the Université de Montréal, he completed a postdoctoral fellowship in pharmacoepidemiology at the Department of Epidemiology, Biostatistics and Occupational Health, McGill University. He then joined the Gerald Department of Oncology as an Assistant Professor in 2009. In 2016, he was promoted to the rank of Associate Professor with a cross-appointment with the Department of Epidemiology, Biostatistics and Occupational Health. Dr. Chandra Panchal, PhD. Chandra Panchal, Ph.D., has joined the Cannabis Therapeutics Inc., Earth Science Pharmaceutical Inc., and Earth Science Tech Inc. Advisory Boards. He is a serial entrepreneur with a wealth of expertise acquired from 28 years of experience in the biotech/pharmaceutical sector. Dr. Panchal founded Axcelon in 2001 and was a co-founder of Procyon Biopharma Inc., a publicly traded biotechnology company involved in the development of wound healing, cancer therapeutic, and diagnostic products. Now known as Ambrilia BioPharma Inc., the company listed on the Alberta Stock Exchange in 1998 and the TSX in 2000. He served as Procyon Biopharma Inc.’s Chairman, President, and CEO; and Ambrilia Biopharma Inc.’s Senior Executive Vice-President, Business Development, Licensing, and Intellectual Property in charge of both out-licensing, in-licensing and M&A activities. He retired from Ambrilia Biopharma Inc. in February 2008. Since then, Dr. Panchal has been actively involved in Axcelon.  Prior to founding Procyon Biopharma Inc., Dr. Panchal was a senior scientist/group leader supervising activities related to yeast genetics, fermentations, and product development at John Labatt Ltd., a multinational food and beverage company. Dr. Panchal sits on the board of directors of several public and private companies.  He has authored/co-authored over 60 scientific papers and has edited a book entitled Yeast Strain Selection. Dr. Panchal has been an Adjunct Professor at the University of Western Ontario where he obtained his Ph.D. in biochemical engineering. Dr. Domenico Fuoco, PhD. Domenico Fuoco, Ph.D., has joined the Cannabis Therapeutics Inc. Advisory Board. Dr. Fuoco has over 16 years’ experience in the research and development of innovative solutions for the pharmaceutical industry. Dr. Fuoco trained at the prestigious Department of Oncology of McGill University Health Centre (MUHC) in Montreal, from 2012 to 2015. During this time, Dr. Fuoco worked on the next generation of medications for AVEO Oncology and Helsinn Therapeutics.  Prior to this, Dr. Fuoco obtained his PhD and Post-Doc training in medicinal chemistry and drug discovery at the University of Perugia in Italy with further studies at the University of Salamanca School of Pharmacy in Spain. Dr. Fuoco is recognized for the transdisciplinary approach of his work. In 2010, Dr. Fuoco was Principal Scientist of the Italian Mission in Amazonia, Bogotà, Colombia.  Dr. Fuoco’s publications cover a wide-range of chemical fields, from functional foods to autoimmune diseases. In 2015, Dr. Fuoco was honored with the prestigious Dr. Henry Shibata Fellowship from the Cedar Cancer Foundation for his work in the field of palliative care. Dr. Fuoco is an active member of the Italian Canadian Community Foundation and is very active within his community.  He is also the chairman from Smart Medicines Consortium for the advancement of health care. Dr. Fuoco’s expertise in human health and functional foods are highly valued as strategic assets by ETST. Calvin Higgins, M.D. Calvin Higgins, M.D., has joined the Earth Science Tech Inc. Advisory Board. Dr. Calvin Higgins is board-certified in internal medicine. Diplomate of the American Board of Internal Medicine. He was born in Kingston, Jamaica. He came to the United States in 1979. He attended Cornell Medical School and graduated in 1985. In 1998, he completed his residency at Lenox Hill Medical Center in Manhattan, New York in Internal Medicine. In 1998 he moved to Florida and completed 3 years in office-based medicine. He then moved onto hospital-based medicine in 2001 to present. Dr. Higgins is affiliated with Memorial Hospital Miramar, Memorial Hospital Pembroke, Memorial Hospital West and Memorial Regional Hospital. Dr. Higgins has a great core for alternative medicine. He always encourages his patients to seek lifestyle changes in diet, exercise, meditation and mental wellness, just to name a few. “We are very excited to have so much new talent joining our Advisory Boards,” said President, Director, and COO Nickolas Tabraue, “We are well on our way to developing top-notch treatments to some of the most common health problems people face, and bringing on such esteemed talent to advise us will only get us there quicker.” About Earth Science Tech: (www.earthsciencetech.com) is a publicly traded (ETST) unique Science based Biotechnology company focused on cutting edge Nutraceuticals, Bioceuticals, and Phytoceuticals for the Health, Wellness and Alternative Medicine Markets to help improve the quality of life for Consumers Worldwide. ETST is also dedicated to providing Natural Alternatives to prescription medications through the use of its cutting edge Nutritional and Dietary Supplements. This may include products such as its High-Grade Hemp CBD (Cannabidiol) Oil, Vitamins, Minerals, Herbs, Botanicals, Personal Care Products, Homeopathies, Functional Foods and other products. These products may be in various formulations and delivery systems including (but not limited to) capsules, tablets, soft gels, chewables, liquids, creams, sprays, powders, and whole herbs. ETST is focused on researching and developing innovative Hemp extracts and to make them accessible Worldwide. ETST plans to be the premier supplier of the highest quality and purity of High Grade Hemp CBD (Cannabidiol) Oil. ETST's primary goal is to advance different High Quality Hemp extracts with a broad profile of Cannabinoids and additional natural molecules found in Industrial Hemp and to identify their distinct properties. The company is dedicated in offering its consumers the finest and purest quality All Natural-Organic Hemp CBD Oil while never compromising on quality. ETST High Grade Hemp CBD (Cannabidiol) Oil is classified as "food based" and therefore perfectly permissible in all 50 states and more than 40 countries. Cannabinoids (Cannabidiol/CBD) are natural constituents of the Hemp plant and CBD is derived from Hemp stalk and seed. Hemp oil is a well-known dietary supplement and the naturally occurring CBD possesses no psychoactive qualities and presents a continuing stream of overwhelming evidence of significant Wellness benefits. With no psychoactive ingredient, Hemp CBD Oil is a ready-for-market Hemp-basedNutraceutical. The United States Food and Drug Administration (FDA) currently considers non-THC hemp based cannabinoids, including CBD, to be "food based" and therefore salable. These new non-psychoactive CBD-rich hemp oil products that ETST has geared up to market and distribute are beyond reproach. CBD (Cannabidiol), a naturally occurring constituent of the Industrial Hemp plant, promotes and supports the nutritional health of aging bodies in particular. Source: US Government Patent #6,630,507 "Cannabinoids as antioxidants and neuroprotectants." ETST does not grow, sell or distribute any substances that violate United States Law or the controlled substance act. ETST does sell and distribute cannabis industrial hemp based products. About Cannabis Therapeutics: Cannabis Therapeutics, Inc. is a wholly owned subsidiary of Earth Science Tech, Inc (ETST). Cannabis Therapeutics, Inc. was formed as an emerging biotechnology company poised to become a world leader in cannabinoid research and development for a broad line of cannabis cannabinoid-based pharmaceuticals, nutraceuticals as well as other products & solutions. Cannabis Therapeutics mission it to help change the healthcare landscape by introducing their proprietary cannabis-cannabinoid based products made for both the pharmaceutical and retail consumer markets worldwide. The company is currently working on finishing the launch of its new corporate website at www.Cannabisthera.com About Earth Science Pharmaceutical: Earth Science Pharmaceutical, Inc. is a wholly owned subsidiary of Earth Science Tech, Inc (ETST). Earth Science Pharmaceutical is focused on becoming a world leader in the development of low cost, non-invasive diagnostic tools, medical devices, testing processes and vaccines for STIs (Sexually Transmitted Infections and/or Diseases). Earth Science Pharmaceutical CEO, Dr. Michel Aubé, a renowned scientist, is committed to help grow ETST in the medical and pharmaceutical industry. The company is currently working on finishing the launch of its new corporate website at www.Earthsciencepharmaceutical.com FOOD AND DRUG ADMINISTRATION (FDA) DISCLOSURE: These statements and products have not been evaluated by the FDA and are not intended to diagnose, treat or cure any disease. Always check with your physician before starting a new dietary supplement program. The FDA has not evaluated the validity or truthfulness of these claims; therefore, we encourage you to review published researches relating to the benefits and properties of CBD hemp oils and other CBD products. SAFE HARBOR ACT: Forward-Looking Statements are included within the meaning of Section 27A of the Securities Act of 1933, and Section 21E of the Securities Exchange Act of 1934, as amended. All statements regarding our expected future financial position, results of operations, cash flows, financing plans, business strategy, products and services, competitive positions, growth opportunities, plans and objectives of management for future operations, including words such as "anticipate," "if," "believe," "plan," "estimate," "expect," "intend," "may," "could," "should," "will," and other similar expressions are forward-looking statements and involve risks, uncertainties and contingencies, many of which are beyond our control, which may cause actual results, performance, or achievements to differ materially from anticipated results, performance, or achievements. We are under no obligation to (and expressly disclaim any such obligation to) update or alter our forward-looking statements, whether as a result of new information, future events or otherwise.


News Article | February 15, 2017
Site: www.prweb.com

Adam Bergman, President of the IRA Financial Group, was featured in the South Florida Business Journal on January 27, 2017. The executive profile detailed how Mr. Bergman moved from practicing tax law for almost ten years to starting IRA Financial Group and IRA Financial Trust Company, the leading self-directed IRA trust company. Adam Bergman is the President and founder of the IRA Financial Group and IRA Financial Trust Company, the markets leading provider of Self-Directed IRA LLC and Solo 401(k) plans. Mr. Bergman is also the managing partner of the law firm The Bergman Law Group, LLC. In addition, Mr. Bergman is a recognized expert on IRAs and 401(k) Plans and is the founder of the BergmanIRAReport.com and the Bergman401KReport.com. Mr. Bergman is also a frequent contributor to Forbes.com on the topic of self-directed retirement plans. Adam Bergman,IRA Financial Group partner, has written six books the topic of self-directed retirement plans, including, “The Checkbook IRA”, “Going Solo,” Turning Retirement Funds into Start-Up Dreams, Solo 401(k) Plan in a Nutshell, Self-Directed IRA in a Nutshell, and in God We Trust in Roth We Prosper. Mr. Bergman has been quoted in a number of major publications on the area of self-directed retirement plans. Mr. Bergman has been interviewed on CBS News and has been quoted in Businessweek, CNN Money, Forbes, Dallas Morning News, Daily Business Review, Law.com, San Francisco Chronicle, U.S. Tax News, the Miami Herald, Bloomberg, Arizona Republic, San Antonio Express, Findlaw, Smart Money, USA Today, Houston Chronicle, Morningstar, and American Lawyer on the area of retirement tax planning. Prior to joining the IRA Financial Group, LLC, Mr. Bergman worked as a tax and ERISA attorney at White & Case LLP, Dewey LeBoeuf LLP, and Thelen LLP, three of the most prominent corporate law firms in the world. Throughout his career, Mr. Bergman has advised thousands of clients on a wide range of tax and ERISA matters involving limited liability companies and retirement plans. Mr. Bergman received his B.A. (with distinction) from McGill University and his law degree (cum laude) from Syracuse University College of Law. Mr. Bergman also received his Masters of Taxation (LL.M.) from New York University School of Law. IRA Financial Group is the market's leading provider of self-directed IRA retirement plans. IRA Financial Group has helped thousands of clients take back control over their retirement funds while gaining the ability to invest in almost any type of investment, including real estate without custodian consent. Founded by top law firm tax attorneys, IRA Financial Group, has helped over 12,000 clients self-direct their retirement funds and invest over $3.8 billion in alternative assets, such as real estate and precious metals. To learn more about the IRA Financial Group please visit our website at http://www.irafinancialgroup.com or call 800-472-0646.


News Article | February 15, 2017
Site: www.eurekalert.org

Neurological research is advancing too slowly according to Dr. Guy Rouleau, director of the Montreal Neurological Institute (MNI) of McGill University. To speed up discovery, MNI has become the first ever Open Science academic institution in the world. In a five-year experiment, MNI is opening its books and making itself transparent to an international group of social scientists, policymakers, industrial partners, and members of civil society. They hope, by doing so, to accelerate research and the discovery of new treatments for patients with neurological diseases, and to encourage other leading institutions around the world to consider a similar model. A team led by McGill Faculty of Law's Professor Richard Gold will monitor and evaluate how well the MNI Open Science experiment works and provide the scientific and policy worlds with insight into 21st century university-industry partnerships. At this workshop, Rouleau and Gold will discuss the benefits and challenges of this open-science initiative. Genomic and health-related data are collected and stored separately at the moment. But Professor Bartha Knoppers from McGill University and the other members of the Global Alliance for Genomics and Health (GA4GH) believe that if this information were shared it could lead both to targeted new therapies and better allocation and management of resources by governments. Given this context, they argue that global data sharing should be viewed as a human rights issue, and that citizens' groups should be able to hold their governments accountable for slowing down or impeding certain forms of data sharing that would be of benefit to all. The Alliance has developed a framework for responsible genomic and health-related data sharing that ensures that people's right to privacy will not be put at risk. The legalization of marijuana remains a topic of intense debate. The majority of U.S. states have legalized some form of medical marijuana use, and nearly 2 million people are registered medical marijuana users. That number is rising rapidly because of both increased access to medical marijuana and promulgation of its potential therapeutic effects. This week, at the annual meeting of the American Association for the Advancement of Science (AAAS) in Boston, Dr. Mark Ware of the Research Institute of the McGill University Health Centre will present an overview of the data generated from the Quebec Cannabis Registry. The innovative project, the first of its kind in the world, was established by the Research Institute of the MUHC and the Canadian Consortium for the Investigation of Cannabinoids (CCIC), to help physicians manage medical cannabis use and generate a database for the use of the international scientific community. Key implications of data sharing in pediatric genomics and clinical care Background: Genomic testing using next generation sequencing technologies has revolutionized our ability to identify disease-causing mutations for many conditions. This holds particularly true for children, in whom many (rare) genetic diseases first appear during childhood and optimal clinical management requires early diagnosis and treatment. Interpreting the results of such tests requires genotypic and phenotypic comparisons to reference data that must be obtained from both healthy populations and other affected individuals. The sensitivity and specificity of genomic testing undergird ethical safeguards against informational risk. They furthermore outline how, and under what circumstances data may be shared. Current pediatric data sharing practices have until now subscribed to siloed ethics norms/guidelines that apply either to the research or clinical contexts separately. Appropriate sharing of linked genotypic and phenotypic data in pediatric populations has, in turn, received sparse empirical and policy attention.


News Article | February 23, 2017
Site: www.marketwired.com

MONTREAL, QUÉBEC--(Marketwired - Feb. 23, 2017) - Knight Therapeutics Inc. (TSX:GUD) ("Knight") announced today (i) the resignation of Ed Schutter and (ii) the appointment Dr. Sarit Assouline to Knight's Board of Directors. "I thank Ed for his meaningful contributions to Knight since joining in early 2015," said Jonathan Ross Goodman, CEO of Knight. "In his place, we welcome Dr. Sarit Assouline, a Hematologist at the Jewish General Hospital and associate professor of Medicine and Oncology at McGill University, to our leadership team. Dr. Assouline is a well published clinician adding another level of scientific diligence to Knight as we in-license innovative pharmaceuticals that touch the lives of patients." Following her training in hematology and oncology at McGill University, Dr Assouline completed a Master's program in clinical epidemiology and biostatistics at McGill University, and a CIHR funded drug development fellowship at the National Cancer Institute of Canada Clinical Trials Group. Since 2005, she has been involved in the design and conduct of numerous clinical trials testing novel therapies in patients with leukemia and lymphoma. These therapies include novel targeted monoclonal antibody therapies, proteasome inhibitors, histone deacetylase inhibitors, and drugs targeting protein translation. Dr. Assouline is the Director of the Chronic Myelogenous Leukemia Clinic of the Jewish General Hospital and, in this capacity, has contributed to epidemiological research into the outcome of patients treated with tyrosine kinase inhibitors. Knight Therapeutics Inc., headquartered in Montreal, Canada, is a specialty pharmaceutical company focused on acquiring or in-licensing innovative pharmaceutical products for the Canadian and select international markets. Knight Therapeutics Inc.'s shares trade on TSX under the symbol GUD. For more information about Knight Therapeutics Inc., please visit the company's web site at www.gud-knight.com or www.sedar.com. This document contains forward-looking statements for Knight Therapeutics Inc. and its subsidiaries. These forward looking statements, by their nature, necessarily involve risks and uncertainties that could cause actual results to differ materially from those contemplated by the forward-looking statements. Knight Therapeutics Inc. considers the assumptions on which these forward-looking statements are based to be reasonable at the time they were prepared, but cautions the reader that these assumptions regarding future events, many of which are beyond the control of Knight Therapeutics Inc. and its subsidiaries, may ultimately prove to be incorrect. Factors and risks, which could cause actual results to differ materially from current expectations are discussed in Knight Therapeutics Inc.'s Annual Report and in Knight Therapeutics Inc.'s Annual Information Form for the year ended December 31, 2015. Knight Therapeutics Inc. disclaims any intention or obligation to update or revise any forward-looking statements whether as a result of new information or future events, except as required by law.


News Article | February 24, 2017
Site: www.businesswire.com

Gecina’s (Paris:GFC) Board of Directors of February 23rd, 2017 decided to submit to the general meeting on April 26th, 2017 to appoint Mrs Laurence Danon as an independent director. The Board of Directors also warmly thanked Mr Rafael Gonzalez de la Cueva for his contribution to the Board’s work. Mr Rafael Gonzalez de la Cueva has indicated that he does not wish to renew his office as a director when it expires at the end of the general meeting on April 26th, 2017. Besides, Mr William R. C. Tresham is the permanent representative of Ivanhoé Cambridge Inc., replacing Mrs Nathalie Palladitcheff since January 3rd, 2017. Bernard Michel, Chairman stated: “Our Board of Directors would be able to benefit from Mrs Laurence Danon’s recognized expertise in the industry, retail and investment banking sectors. In addition, Gecina would keep its alignment with governance best practices for listed companies, with 50% independent directors and 50% women on board”. Mrs Laurence Danon is an Ecole des Mines engineer and former CEO of Printemps and Bostik. She has pursued her career in finance as Chairwoman of the Executive Board at Edmond de Rothschild Corporate Finance, then Chairwoman of the Board of Directors of the investment bank Leonardo & Co., before joining her family office Primerose. Among her other offices, Laurence Danon is an independent director and chairwoman of the strategic committee at Amundi, and also an independent director and chairwoman of the audit committee at TF1. Mr William R. C. Tresham is President at Ivanhoé Cambridge and is responsible for investment, operations and development activities. He has held senior executive roles with leading companies for a number of years. He joined the Montréal office of Trizec Properties Inc. in 1995 as Vice President, Asset Management. He was appointed Senior Vice President in 1997, before serving as Executive Vice President and Chief Operating Officer from 2004 to 2006. He then joined Callahan Capital Partners as Partner and Chief Operating Officer, in its Chicago office. Mr Tresham graduated from Princeton University and holds a law degree from McGill University (Canada). Gecina owns, manages and develops property holdings worth 12.1 billion euros at end-2016 with nearly 97% located in the Paris Region. The Group is building its business around France’s leading office portfolio and a diversification division with residential assets and student residences. Gecina has put sustainable innovation at the heart of its strategy to create value, anticipate its customers' expectations and invest while respecting the environment, thanks to the dedication and expertise of its staff. Gecina is a French real estate investment trust (SIIC) listed on Euronext Paris, and is part of the SBF 120, Euronext 100, FTSE4Good, DJSI Europe and World, Stoxx Global ESG Leaders and Vigeo indices. In line with its commitments to the community, Gecina has created a company foundation, which is focused on protecting the environment and supporting all forms of disability.


Therapeutic immunization has been proposed as an approach that might help limit the need for lifelong combined antiretroviral therapy (cART). One approach for therapeutic vaccination which has been explored during the last few years is the administration of autologous monocyte-derived DCs (MD-DCs) loaded ex vivo with a variety of antigens. It has been shown in experimental murine models as well as in cancer patients and in patients with chronic infections that this approach can induce and potentiate antigen-specific T-cell response (and to induce a potent protective immunity). Contrary to the wide experience with this strategy in cancer, in HIV-1 infection the experience is limited and the design of the clinical trials varies greatly between groups. This variability affects all the steps of the process, from preparation of immunogen and DCs to clinical trial design and immune monitoring. Although both the study designs and the DC preparation (the maturation stimuli and the identity and source of HIV-1 antigens used to pulse DCs) varied in most of the studies that were published so far, overall the results indicate that DC immunotherapy elicits some degree of immunological response. To address this situation and to allow comparison between trials a panel of experts working in DC-based clinical trials in HIV-1 infection met in Barcelona at the end of 2010. During this meeting, the participants shared the data of their current research activities in this field in order to unify criteria for the future. This report summarizes the present situation of the field and the discussions and conclusions of this meeting. © 2011 Elsevier Ltd.


McCaffrey L.M.,McGill University | Montalbano J.,University of Virginia | Mihai C.,McGill University | Macara I.G.,Vanderbilt University
Cancer Cell | Year: 2012

Loss of epithelial organization is a hallmark of carcinomas, but whether polarity regulates tumor growth and metastasis is poorly understood. To address this issue, we depleted the Par3 polarity gene by RNAi in combination with oncogenic Notch or Ras61L expression in the murine mammary gland. Par3 silencing dramatically reduced tumor latency in both models and produced invasive and metastatic tumors that retained epithelial marker expression. Par3 depletion was associated with induction of MMP9, destruction of the extracellular matrix, and invasion, all mediated by atypical PKC-dependant JAK/Stat3 activation. Importantly, Par3 expression is significantly reduced in human breast cancers, which correlates with active aPKC and Stat3. These data identify Par3 as a regulator of signaling pathways relevant to invasive breast cancer. © 2012 Elsevier Inc.


Casey J.R.,University of Alberta | Grinstein S.,Hospital for Sick Children | Orlowski J.,McGill University
Nature Reviews Molecular Cell Biology | Year: 2010

Protons dictate the charge and structure of macromolecules and are used as energy currency by eukaryotic cells. The unique function of individual organelles therefore depends on the establishment and stringent maintenance of a distinct pH. This, in turn, requires a means to sense the prevailing pH and to respond to deviations from the norm with effective mechanisms to transport, produce or consume proton equivalents. A dynamic, finely tuned balance between proton-extruding and proton-importing processes underlies pH homeostasis not only in the cytosol, but in other cellular compartments as well.


McCaffrey L.M.,McGill University | Macara I.G.,University of Virginia
Trends in Cell Biology | Year: 2011

Epithelial cells comprise the foundation for the majority of organs in the mammalian body, and are the source of approximately 90% of all human cancers. Characteristically, epithelial cells form intercellular adhesions, exhibit apical/basal polarity, and orient their mitotic spindles in the plane of the epithelial sheet. Defects in these attributes result in the tissue disorganization associated with cancer. Epithelia undergo self-renewal from stem cells, which might in some cases be the cell of origin for cancers. The PAR polarity proteins are master regulators of epithelial organization, and are closely linked to signaling pathways such as Hippo, which orchestrate proliferation and apoptosis to control organ size. 3D ex vivo culture systems can now faithfully recapitulate epithelial organ morphogenesis, providing a powerful approach to study both normal development and the initiating events in carcinogenesis. © 2011 Elsevier Ltd.


Lesk C.,McGill University | Rowhani P.,University of Sussex | Ramankutty N.,McGill University | Ramankutty N.,University of British Columbia
Nature | Year: 2016

In recent years, several extreme weather disasters have partially or completely damaged regional crop production. While detailed regional accounts of the effects of extreme weather disasters exist, the global scale effects of droughts, floods and extreme temperature on crop production are yet to be quantified. Here we estimate for the first time, to our knowledge, national cereal production losses across the globe resulting from reported extreme weather disasters during 1964-2007. We show that droughts and extreme heat significantly reduced national cereal production by 9-10%, whereas our analysis could not identify an effect from floods and extreme cold in the national data. Analysing the underlying processes, we find that production losses due to droughts were associated with a reduction in both harvested area and yields, whereas extreme heat mainly decreased cereal yields. Furthermore, the results highlight ∼7% greater production damage from more recent droughts and 8-11% more damage in developed countries than in developing ones. Our findings may help to guide agricultural priorities in international disaster risk reduction and adaptation efforts. © 2016 Macmillan Publishers Limited. All rights reserved.


Henn B.M.,State University of New York at Stony Brook | Botigue L.R.,State University of New York at Stony Brook | Bustamante C.D.,Stanford University | Clark A.G.,Cornell University | Gravel S.,McGill University
Nature Reviews Genetics | Year: 2015

Next-generation sequencing technology has facilitated the discovery of millions of genetic variants in human genomes. A sizeable fraction of these variants are predicted to be deleterious. Here, we review the pattern of deleterious alleles as ascertained in genome sequencing data sets and ask whether human populations differ in their predicted burden of deleterious alleles-a phenomenon known as mutation load. We discuss three demographic models that are predicted to affect mutation load and relate these models to the evidence (or the lack thereof) for variation in the efficacy of purifying selection in diverse human genomes. We also emphasize why accurate estimation of mutation load depends on assumptions regarding the distribution of dominance and selection coefficients-quantities that remain poorly characterized for current genomic data sets. © 2015 Macmillan Publishers Limited. All rights reserved.


Lovejoy S.,McGill University | Schertzer D.,University Paris Est Creteil
Geophysical Research Letters | Year: 2012

Climate sensitivity () is usually defined as a deterministic quantity relating climate forcings and responses. While this may be appropriate for evaluating the outputs of (deterministic) GCM's it is problematic for estimating sensitivities from empirical data. We introduce a stochastic definition where it is only a statistical link between the forcing and response, an upper bound on the deterministic sensitivities. Over the range 30 yrs to 100 kyrs we estimate this using temperature data from instruments, reanalyses, multiproxies and paleo spources; the forcings include several solar, volcanic and orbital series. With the exception of the latter-we find that is roughly a scaling function of resolution t: t H, with exponent 0 < t H < 0.7. Since most have t H > 0, the implied feedbacks must generally increase with scale and this may be difficult to achieve with existing GCM's. © 2012 American Geophysical Union. All Rights Reserved.


Tallon P.P.,Charles University | Pinsonneault A.,McGill University
MIS Quarterly: Management Information Systems | Year: 2011

Strategic information technology alignment remains a top priority for business and IT executives. Yet with a recent rise in environmental volatility, firms are asking how to be more agile in identifying and responding to market-based threats and opportunities. Whether alignment helps or hurts agility is an unresolved issue. This paper presents a variety of arguments from the literature that alternately predict a positive or negative relationship between alignment and agility. This relationship is then tested using a model in which agility mediates the link between alignment and firm performance under varying conditions of IT infrastructure flexibility and environmental volatility. Using data from a matched survey of IT and business executives in 241 firms, we uncover a positive and significant link between alignment and agility and between agility and firm performance. We also show that the effect of alignment on performance is fully mediated by agility, that environmental volatility positively moderates the link between agility and firm performance, and that agility has a greater impact on firm performance in more volatile markets. While IT infrastructure flexibility does not moderate the link between alignment and agility, except in a volatile environment, we reveal that IT infrastructure flexibility has a positive and significant main effect on agility. In fact, the effect of IT infrastructure flexibility on agility is as strong as the effect of alignment on agility. This research extends and integrates the literature on strategic IT alignment and organizational agility at a time when both alignment and agility are recognized as critical and concurrent organizational goals.


McCaffrey L.M.,McGill University | Macara I.G.,University of Virginia
Cold Spring Harbor Perspectives in Biology | Year: 2012

A key function of signal transduction during cell polarization is the creation of spatially segregated regions of the cell cortex that possess different lipid and protein compositions and have distinct functions. Polarity can be initiated spontaneously or in response to signaling inputs from adjacent cells or soluble factors and is stabilized by positive-feedback loops. A conserved group of proteins, the Par proteins, plays a central role in polarity establishment and maintenance in many contexts. These proteins generate and maintain their distinct locations in cells by actively excluding one another from specific regions of the plasma membrane. The Par signaling pathway intersects with multiple other pathways that control cell growth, death, and organization. © 2012 Cold Spring Harbor Laboratory Press; all rights reserved.


Sugarman J.,McGill University | Colvin C.,Health-U | Moran A.C.,Health-U | Oxlade O.,McGill University
The Lancet Global Health | Year: 2014

Background: The estimated number of maternal deaths in 2013 worldwide was 289 000, a 45% reduction from 1990. Non-obstetric causes such as infectious diseases including tuberculosis now account for 28% of maternal deaths. In 2013, 3·3 million cases of tuberculosis were estimated to occur in women globally. During pregnancy, tuberculosis is associated with poor outcomes, including increased mortality in both the neonate and the pregnant woman. The aim of our study was to estimate the burden of tuberculosis disease among pregnant women, and to describe how maternal care services could be used as a platform to improve case detection. Methods: We used publicly accessible country-level estimates of the total population, distribution of the total population by age and sex, crude birth rate, estimated prevalence of active tuberculosis, and case notification data by age and sex to estimate the number of pregnant women with active tuberculosis for 217 countries. We then used indicators of health system access and tuberculosis diagnostic test performance obtained from published literature to determine how many of these cases could ultimately be detected. Findings: We estimated that 216 500 (95% uncertainty range 192 100-247 000) active tuberculosis cases existed in pregnant women globally in 2011. The greatest burdens were in the WHO African region with 89 400 cases and the WHO South East Asian region with 67 500 cases in pregnant women. Chest radiography or Xpert RIF/MTB, delivered through maternal care services, were estimated to detect as many as 114 100 and 120 300 tuberculosis cases, respectively. Interpretation: The burden of tuberculosis disease in pregnant women is substantial. Maternal care services could provide an important platform for tuberculosis detection, treatment initiation, and subsequent follow-up. Funding: United States Agency for International Development. © 2014 Sugarman et al. Open Access article distributed under the terms of CC BY-NC-SA.


Saleh M.,McGill University | Elson C.,University of Alabama at Birmingham
Immunity | Year: 2011

Inflammatory bowel disease appears to result from an abnormal host immune response to the intestinal microbiota. Experimental models have allowed the dissection of the complex dialog between the host and its microbiota. Through genetic manipulation of the host genome the immune compartments, cells, molecules, and genes that are critical for maintenance of intestinal homeostasis are being identified. Genetic association studies in humans have identified over 100 susceptibility loci. Although there is remarkable coherence between the experimental model and the human genetic data, a full understanding of the mechanisms involved in genetic susceptibility to IBD and of gene-gene and gene-environmental interactions will require a " next generation" of experimental models. © 2011 Elsevier Inc.


Koski L.,McGill University | Koski L.,Allan Memorial Institute
Cerebrovascular Diseases | Year: 2013

Cognitive impairment is common among patients with stroke or other cerebrovascular disease and influences long-term outcome, including occupational functioning. Recognition and monitoring of mild cognitive impairment is thus essential to good patient care. The Montreal Cognitive Assessment (MoCA) has been suggested as a brief screening test of vascular cognitive impairment. This paper presents a critical review of the research literature evaluating the validity and utility of this test with the aim of informing future clinical and research practice. A total of 30 papers employing the MoCA in the context of cerebrovascular disease were identified. Reporting of the methods and results of such studies tended to fall short of the established reporting guidelines. Under-specification of the exclusion criteria applied and their impact make it difficult to assess the potential impact of sampling bias and loss to follow-up. Nevertheless, content validity evidence suggests that the MoCA covers most of the domains that represent cognitive impairment in cerebrovascular disease, with mixed evidence for its preferential sensitivity to the type of cognitive impairment encountered in the context of vascular disease. Evidence clearly supports the need to establish norms and cut-offs for the MoCA that are culturally appropriate and that are matched to the range of cognitive impairment that is present in the population being assessed. Recent modifications of the MoCA have been developed for assessing patients with visual impairment or restricted mobility, which may reduce the impact of 'untestability' on cognitive screening in the clinic or research context. The MoCA correlates well with other measures of cognitive and functional abilities in patients with cerebrovascular disease, and may also predict future response to rehabilitation and long-term occupational outcome. Further research is needed to provide evidence for the validity of the MoCA in longitudinal studies. However, it compares favourably to the Mini Mental State Examination as a screening test that is sensitive to the milder forms of cognitive impairment that often accompany cerebrovascular disease. © 2013 S. Karger AG, Basel.


Aeschbach-Hertig W.,University of Heidelberg | Gleeson T.,McGill University
Nature Geoscience | Year: 2012

Groundwater - the world's largest freshwater resource - is critically important for irrigated agriculture and hence for global food security. Yet depletion is widespread in large groundwater systems in both semi-arid and humid regions of the world. Excessive extraction for irrigation where groundwater is slowly renewed is the main cause of the depletion, and climate change has the potential to exacerbate the problem in some regions. Globally aggregated groundwater depletion contributes to sea-level rise, and has accelerated markedly since the mid-twentieth century. But its impacts on water resources are more obvious at the regional scale, for example in agriculturally important parts of India, China and the United States. Food production in such regions can only be made sustainable in the long term if groundwater levels are stabilized. To this end, a transformation is required in how we value, manage and characterize groundwater systems. Technical approaches - such as water diversion, artificial groundwater recharge and efficient irrigation - have failed to balance regional groundwater budgets. They need to be complemented by more comprehensive strategies that are adapted to the specific social, economic, political and environmental settings of each region. © 2012 Macmillan Publishers Limited. All rights reserved.


Li M.,CAS Institute of Theoretical Physics | Wang Y.,McGill University
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2010

We investigate the implications of the entropic force formalism proposed by Verlinde. We show that an UV/IR relation proposed by Cohen et al., as well as an uncertainty principle proposed by Hogan can be derived from the entropic force formalism. We show that applying the entropic force formalism to cosmology, there is an additional term in the Friedmann equation, which can be identified as holographic dark energy. We also propose an intuitive picture of holographic screen, which can be thought of as an improvement of Susskind's holographic screen. © 2010 Elsevier B.V. All rights reserved.


Sakata J.T.,McGill University | Vehrencamp S.L.,Cornell University
Journal of Experimental Biology | Year: 2012

Recent experiments in divergent fields of birdsong have revealed that vocal performance is important for reproductive success and under active control by distinct neural circuits. Vocal consistency, the degree to which the spectral properties (e.g. dominant or fundamental frequency) of song elements are produced consistently from rendition to rendition, has been highlighted as a biologically important aspect of vocal performance. Here, we synthesize functional, developmental and mechanistic (neurophysiological) perspectives to generate an integrated understanding of this facet of vocal performance. Behavioral studies in the field and laboratory have found that vocal consistency is affected by social context, season and development, and, moreover, positively correlated with reproductive success. Mechanistic investigations have revealed a contribution of forebrain and basal ganglia circuits and sex steroid hormones to the control of vocal consistency. Across behavioral, developmental and mechanistic studies, a convergent theme regarding the importance of vocal practice in juvenile and adult songbirds emerges, providing a basis for linking these levels of analysis. By understanding vocal consistency at these levels, we gain an appreciation for the various dimensions of song control and plasticity and argue that genes regulating the function of basal ganglia circuits and sex steroid hormones could be sculpted by sexual selection. © 2012. Published by The Company of Biologists Ltd.


Patent
McGill University and The Administrators Of The Tulane Educational Fund | Date: 2011-06-16

The present invention provides novel peptides that can modulate the ghrelin receptor (growth hormone secretagogue receptor, GHS-R1a and sub-types, isoforms and variants thereof). These peptides are useful as antagonists of the ghrelin receptor as well as inverse agonist, partial agonist or a combination of these activities as medicaments for treatment and prevention of a range of medical conditions including, but not limited to, metabolic and/or endocrine disorders, gastrointestinal disorders, cardiovascular disorders, obesity and obesity-associated disorders, diabetes, central nervous system disorders, genetic disorders, and hyperproliferative disorders.


Patent
McGill University, Hong Kong Polytechnic University and Wayne State University | Date: 2010-12-15

Synthetic polyphenolic compounds of formula (I), their modes of synthesis, and pharmaceutical compositions thereof are provided herein. Use of the compounds and compositions described herein for inhibiting proteasomal activity and for treating cancer is also provided.


Patent
Hong Kong Polytechnic University, McGill University, University of South Florida and Wayne State University | Date: 2015-09-15

A method of reducing tumor cell growth, the method including administering an effective amount of a compound having the formula:


Patent
Hong Kong Polytechnic University, McGill University, University of South Florida and Wayne State University | Date: 2014-03-28

A method of reducing tumor cell growth, the method including administering an effective amount of a compound having the formula:


Patent
McGill University and The Administrators Of The Tulane Educational Fund | Date: 2010-05-12

The invention provides methods for treatment, prevention or management of obesity, obesity related disorders, diabetes mellitus, and metabolic syndrome in a subject by administering a ghrelin O-acyltransferase (GOAT) inhibitor and/or a ghrelin receptor antagonist to the subject. The invention also provides ghrelin receptor antagonists of formula (VII): A^(11)-A^(12)-A^(13)-Gly-Ser-A^(14)-Phe-Leu-A^(15)-A^(16)-A^(17)-A^(18), wherein each of A^(11), A^(12), and A^(13 )is independently absent, an amino acid, or an amino protecting group; each of A^(15)-A^(16)-A^(17), and A^(18 )is independently absent or an amino acid; and A^(14 )is a serine conjugated with a C(O)C_(1)-C_(20)alky or a di-aminopropionic acid conjugated with a C(O)C_(1)-C_(20)alkyl group, provided that at least one of A^(11), A^(12), or A^(13 )is present.


Patent
Hong Kong Polytechnic University, McGill University, University of South Florida and Wayne State University | Date: 2012-03-09

A method of reducing tumor cell growth, the method including administering an effective amount of a compound having the formula:


Grant
Agency: Cordis | Branch: FP7 | Program: CP | Phase: ICT-2007.8.0 | Award Amount: 2.63M | Year: 2010

Current designs of neurally inspired computing systems rely on learning rules that appear to be insufficient to port the superior adaptive and computational capabilities of biological neural systems into large-scale recurrent neural hardware system. This is not surprising, since most of these learning rules had to be extrapolated from results of neurobiological experiments in vitro. New experimental techniques in neurobiology - such as 2-photon laser-scanning microscopy, optogenetic cell activation, and dynamic clamp techniques - make it now possible to record the changes that really take place in the intact brain during learning. First results indicate that the rules for synaptic plasticity have in fact to be rewritten. In particular, it appears that local synaptic plasticity is gated in multiple ways by global factors such as neuromodulators and network states. One primary goal of this project is to apply and extend new cutting-edge experimental techniques to produce a set of rules for synaptic plasticity and network reorganisation that describe the actual adaptive processes that take place in the living brain during learning.\nThese new rules will be analysed by computational neuroscience experts and their consequences for learning in simulated large-scale networks of neurons and neurally inspired computing systems will be ascertained. The goal of this project is to port essential aspects of learning in the intact brain into current and next-generation neuromorphic hardware. New interchangeable software tools, that have recently been developed in the FP6 project FACETS, will be employed to carry out these investigations. Open questions that arise in these modelling studies will be addressed by changes in experimental protocols of the neuroscientists, building on long standing interdisciplinary collaborations among the partners.


Patent
Wayne State University, McGill University and Hong Kong Polytechnic University | Date: 2012-06-15

Synthetic polyphenolic compounds of formula (I), their modes of synthesis, and pharmaceutical compositions thereof are provided herein. Use of the compounds and compositions described herein for treating cancer and for treating metabolic disorders is also provided.


News Article | February 15, 2017
Site: www.marketwired.com

MONTREAL, QUEBEC--(Marketwired - Feb. 10, 2017) - Relevium Technologies Inc. (TSX VENTURE:RLV)(FRANKFURT:6BX) (the "Company" or "Relevium") a consolidator of e-commerce assets in Health and Wellness in conjunction with its board of directors, is pleased to announce the addition of Dr. Tina Sampalis to the Company's Board of Directors. Tina Sampalis, M.D., Ph.D., is an oncology surgeon trained in physiology at McGill University in Montreal, medicine at the University of Patras (Greece), dermatology at Göttingen University (Germany) and Marselisborg University (Denmark), pediatric, general and oncology surgery at the University of Athens (Greece), graduate training (Ph.D.) in Surgical Research at the University of Athens and a second Ph.D. in Epidemiology and Experimental Surgery at McGill University. Dr. Sampalis' leading work in Nutraceuticals includes Neptune Technologies & Bioressources, where she discovered one of the primary reasons krill oil is so beneficial to human health: Phospholipids. Dr. Sampalis is the named inventor of Neptune's composition and application patents. As the former President of Acasti Pharma Inc. she led the development of a novel patented active pharmaceutical ingredient targeting the prevention and treatment of hypertriglyceridemia and cardio metabolic-disorders. She is the Founder and President of the AGOO Children's Health & Wellness Center, a state-of-the-art multidisciplinary comprehensive, pediatric-adolescent medical center and accredited McGill University teaching site in Quebec. Dr. Sampalis has received several international scholarships and awards for her work on the clinical implementation of retinols for skin and breast cancer, including the Helen Hutchison Award for geriatric medicine. Her work on scintimammography resulted in her appointment at the International Educational Speakers Bureau, the Canadian and U.S. Faculty of Medical Speakers for Breast Imaging. As an international scholar, Dr. Sampalis leads the development and implementation of innovative micro-invasive and stereotactic robotic surgical techniques for breast cancer, for which a U.S. and Canadian patent application has been filed. She is a member of the American Association of Naturopathic Medicine. Dr. Sampalis has published papers in multiple peer-reviewed publications. She was named one of the 10 most successful women in Quebec (Les Affaires, 18-24 September 2010) and one of the 100 most successful globally by the Princeton Global Network. Relevium Technologies Inc. (TSX.V - "RLV") President and CEO, Aurelio Useche, stated, "We are very honored to have Dr. Sampalis join our Company. The addition of Dr. Sampalis closes the value chain by providing deep expertise in scientific and evidence based nutraceutical and medical trends, which can be leveraged through the consolidation of e-commerce assets such as BioGanix as announced on December 22, 2016." Relevium is a TSX Venture listed issuer focused on growth through the acquisition of businesses, products and/or technologies with a focus on e-commerce in the growing health and wellness sector, specifically under three important verticals: Pain Relief, Recovery and Performance. Relevium Technologies Inc. currently holds patented intellectual property for application of static magnetic fields on direct-to-consumer devices, which aid in decreasing pain, improving recovery time and enhancing overall physical performance. BioGanix (http://www.bioganix.com/) was founded with customer results in mind, to provide the best quality, best researched, and most potent formulas at competitive prices, while providing excellent and personal customer care. BioGanix puts our customers first, and do everything we can to keep them happy. BioGanix prides itself on using only the best and purest ingredients in our manufacturing processes. BioGanix only provides premium quality products, and doesn't cut any corners in manufacturing processes. All BioGanix products have been 3rd Party Laboratory tested and verified, and are manufactured in GMP Certified and FDA inspected facilities in the USA. BioGanix currently has over 16 of the best-selling dietary supplement products available, varying from trending weight loss products, to proven health supporting supplements that supports various processes in the body, including digestive health, heart health, brain health, blood sugar, as well as anti-aging supplements. Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. This release includes certain statements and information that may constitute forward-looking information within the meaning of applicable Canadian securities laws or forward-looking statements within the meaning of the United States Private Securities Litigation Reform Act of 1995. All statements in this news release, other than statements of historical facts, including statements regarding future estimates, plans, objectives, assumptions or expectations of future performance, including the timing and completion of the proposed acquisitions, are forward-looking statements and contain forward-looking information. Generally, forward-looking statements and information can be identified by the use of forward-looking terminology such as "intends" or "anticipates", or variations of such words and phrases or statements that certain actions, events or results "may", "could", "should", "would" or "occur". Forward-looking statements are based on certain material assumptions and analysis made by the Company and the opinions and estimates of management as of the date of this press release, including the assumptions that the Company will obtain stock exchange approval of the Offering, the proposed acquisition will occur as anticipated, that the Company will raise sufficient funds, and that the Company will obtain all requisite approvals of the acquisition. These forward-looking statements are subject to known and unknown risks, uncertainties and other factors that may cause the actual results, level of activity, performance or achievements of the Company to be materially different from those expressed or implied by such forward-looking statements or forward-looking information. Important factors that may cause actual results to vary, include, without limitation, the risk that the proposed acquisitions may not occur as planned; the timing and receipt of requisite approvals and failure to raise sufficient funds under the Offering. Although management of the Company has attempted to identify important factors that could cause actual results to differ materially from those contained in forward-looking statements or forward-looking information, there may be other factors that cause results not to be as anticipated, estimated or intended. There can be no assurance that such statements will prove to be accurate, as actual results and future events could differ materially from those anticipated in such statements. Accordingly, readers should not place undue reliance on forward-looking statements and forward-looking information. Readers are cautioned that reliance on such information may not be appropriate for other purposes. The Company does not undertake to update any forward-looking statement, forward- looking information or financial outlook that are incorporated by reference herein, except in accordance with applicable securities laws. We seek safe harbor. On Behalf of the Board of Directors


News Article | February 15, 2017
Site: www.nature.com

As the Arctic slipped into the half-darkness of autumn last year, it seemed to enter the Twilight Zone. In the span of a few months, all manner of strange things happened. The cap of sea ice covering the Arctic Ocean started to shrink when it should have been growing. Temperatures at the North Pole soared more than 20 °C above normal at times. And polar bears prowling the shorelines of Hudson Bay had a record number of run-ins with people while waiting for the water to freeze over. It was a stark illustration of just how quickly climate change is reshaping the far north. And if last autumn was bizarre, it's the summers that have really got scientists worried. As early as 2030, researchers say, the Arctic Ocean could lose essentially all of its ice during the warmest months of the year — a radical transformation that would upend Arctic ecosystems and disrupt many northern communities. Change will spill beyond the region, too. An increasingly blue Arctic Ocean could amplify warming trends and even scramble weather patterns around the globe. “It’s not just that we’re talking about polar bears or seals,” says Julienne Stroeve, a sea-ice researcher at University College London. “We all are ice-dependent species.” With the prospect of ice-free Arctic summers on the horizon, scientists are striving to understand how residents of the north will fare, which animals face the biggest risks and whether nations could save them by protecting small icy refuges. But as some researchers look even further into the future, they see reasons to preserve hope. If society ever manages to reverse the surge in greenhouse-gas concentrations — as some suspect it ultimately will — then the same physics that makes it easy for Arctic sea ice to melt rapidly may also allow it to regrow, says Stephanie Pfirman, a sea-ice researcher at Barnard College in New York City. She and other scientists say that it’s time to look beyond the Arctic’s decline and start thinking about what it would take to restore sea ice. That raises controversial questions about how quickly summer ice could return and whether it could regrow fast enough to spare Arctic species. Could nations even cool the climate quickly through geoengineering, to reverse the most drastic changes up north? Pfirman and her colleagues published a paper1 last year designed to kick-start a broader conversation about how countries might plan for the regrowth of ice, and whether they would welcome it. Only by considering all the possibilities for the far future can the world stay one step ahead of the ever-changing Arctic, say scientists. “We’ve committed to the Arctic of the next generation,” Pfirman says. “What comes next?” Pfirman remembers the first time she realized just how fast the Arctic was unravelling. It was September 2007, and she was preparing to give a talk. She went online to download the latest sea-ice maps and discovered something disturbing: the extent of Arctic ice had shrunk past the record minimum and was still dropping. “Oh, no! It’s happening,” she thought. Although Pfirman and others knew that Arctic sea ice was shrinking, they hadn’t expected to see such extreme ice losses until the middle of the twenty-first century. “It was a wake-up call that we had basically run out of time,” she says. In theory, there’s still a chance that the world could prevent the total loss of summer sea ice. Global climate models suggest that about 3 million square kilometres — roughly half of the minimum summer coverage in recent decades — could survive if countries fulfil their commitments to the newly ratified Paris climate agreement, which limits global warming to 2 °C above pre-industrial temperatures. But sea-ice researchers aren’t counting on that. Models have consistently underestimated ice losses in the past, causing scientists to worry that the declines in the next few decades will outpace projections2. And given the limited commitments that countries have made so far to address climate change, many researchers suspect the world will overshoot the 2 °C target, all but guaranteeing essentially ice-free summers (winter ice is projected to persist for much longer). In the best-case scenario, the Arctic is in for a 4–5 °C temperature rise, thanks to processes that amplify warming at high latitudes, says James Overland, an oceanographer at the US National Oceanic and Atmospheric Administration in Seattle, Washington. “We really don’t have any clue about how disruptive that’s going to be.” The Arctic’s 4 million residents — including 400,000 indigenous people — will feel the most direct effects of ice loss. Entire coastal communities, such as many in Alaska, will be forced to relocate as permafrost melts and shorelines crumble without sea ice to buffer them from violent storms, according to a 2013 report3 by the Brookings Institution in Washington DC. Residents in Greenland will find it hard to travel on sea ice, and reindeer herders in Siberia could struggle to feed their animals. At the same time, new economic opportunities will beckon as open water allows greater access to fishing grounds, oil and gas deposits, and other sources of revenue. People living at mid-latitudes may not be immune, either. Emerging research4 suggests that open water in the Arctic might have helped to amplify weather events, such as cold snaps in the United States, Europe and Asia in recent winters. Indeed, the impacts could reach around the globe. That’s because sea ice helps to cool the planet by reflecting sunlight and preventing the Arctic Ocean from absorbing heat. Keeping local air and water temperatures low, in turn, limits melting of the Greenland ice sheet and permafrost. With summer ice gone, Greenland’s glaciers could contribute more to sea-level rise, and permafrost could release its stores of greenhouse gases such as methane. Such is the vast influence of Arctic ice. “It is really the tail that wags the dog of global climate,” says Brenda Ekwurzel, director of climate science at the Union of Concerned Scientists in Cambridge, Massachusetts. But Arctic ecosystems will take the biggest hit. In 2007, for example, biologists in Alaska noticed something odd: vast numbers of walruses had clambered ashore on the coast of the Chukchi Sea. From above, it looked like the Woodstock music festival — with tusks — as thousands of plump pinnipeds crowded swathes of ice-free shoreline. Normally, walruses rest atop sea ice while foraging on the shallow sea floor. But that year, and almost every year since, sea-ice retreat made that impossible by late summer. Pacific walruses have adapted by hauling out on land, but scientists with the US Fish and Wildlife Service worry that their numbers will continue to decline. Here and across the region, the effects of Arctic thawing will ripple through ecosystems. In the ocean, photosynthetic plankton that thrive in open water will replace algae that grow on ice. Some models5 suggest that biological productivity in a seasonally ice-free Arctic could increase by up to 70% by 2100, which could boost revenue from Arctic fisheries even more. (To prevent a seafood gold rush, five Arctic nations have agreed to refrain from unregulated fishing in international waters for now.) Many whales already seem to be benefiting from the bounty of food, says Sue Moore, an Arctic mammal specialist at the Pacific Marine Environmental Laboratory. But the changing Arctic will pose a challenge for species whose life cycles are intimately linked to sea ice, such as walruses and Arctic seals — as well as polar bears, which don’t have much to eat on land. Research6 suggests that many will starve if the ice-free season gets too long in much of the Arctic. “Basically, you can write off most of the southern populations,” says Andrew Derocher, a biologist at the University of Alberta in Edmonton, Canada. Such findings spurred the US Fish and Wildlife Service to list polar bears as threatened in 2008. Ice-dependent ecosystems may survive for longest along the rugged north shores of Greenland and Canada, where models suggest that about half a million square kilometres of summer sea ice will linger after the rest of the Arctic opens up (see ‘Going, going …’). Wind patterns cause ice to pile up there, and the thickness of the ice — along with the high latitude — helps prevent it from melting. “The Siberian coastlines are the ice factory, and the Canadian Arctic Archipelago is the ice graveyard,” says Robert Newton, an oceanographer at Columbia University’s Lamont–Doherty Earth Observatory in Palisades, New York. Groups such as the wildlife charity WWF have proposed protecting this ‘last ice area’ as a World Heritage Site in the hope that it will serve as a life preserver for many Arctic species. Last December, Canada announced that it would at least consider setting the area aside for conservation, and indigenous groups have expressed interest in helping to manage it. (Before he left office, then-US president Barack Obama joined Canadian Prime Minister Justin Trudeau in pledging to protect 17% of the countries’ Arctic lands and 10% of marine areas by 2020.) But the last ice area has limitations as an Arctic Noah’s ark. Some species don’t live in the region, and those that do are there in only small numbers. Derocher estimates that there are less than 2,000 polar bears in that last ice area today — a fraction of the total Arctic population of roughly 25,000. How many bears will live there in the future depends on how the ecosystem evolves with warming. The area may also be more vulnerable than global climate models suggest. Bruno Tremblay, a sea-ice researcher at McGill University in Montreal, Canada, and David Huard, an independent climate consultant based in Quebec, Canada, studied the fate of the refuge with a high-resolution sea-ice and ocean model that better represented the narrow channels between the islands of the Canadian archipelago. In a report7 commissioned by the WWF, they found that ice might actually be able to sneak between the islands and flow south to latitudes where it would melt. According to the model, Tremblay says, “even the last ice area gets flushed out much more efficiently”. If the future of the Arctic seems dire, there is one source of optimism: summer sea ice will return whenever the planet cools down again. “It’s not this irreversible process,” Stroeve says. “You could bring it back even if you lose it all.” Unlike land-based ice sheets, which wax and wane over millennia and lag behind climate changes by similar spans, sea ice will regrow as soon as summer temperatures get cold enough. But identifying the exact threshold at which sea ice will return is tricky, says Dirk Notz, a sea-ice researcher at the Max Planck Institute for Meteorology in Hamburg, Germany. On the basis of model projections, researchers suggest that the threshold hovers around 450 parts per million (p.p.m.) — some 50 p.p.m. higher than today. But greenhouse-gas concentrations are not the only factor that affects ice regrowth; it also depends on how long the region has been ice-free in summer, which determines how much heat can build up in the Arctic Ocean. Notz and his colleagues studied the interplay between greenhouse gases and ocean temperature with a global climate model8. They increased CO from pre-industrial concentrations of 280 p.p.m. to 1,100 p.p.m. — a bit more than the 1,000 p.p.m. projected by 2100 if no major action is taken to curtail greenhouse-gas emissions. Then they left it at those levels for millennia. This obliterated both winter and summer sea ice, and allowed the ocean to warm up. The researchers then reduced CO concentrations to levels at which summer ice should have returned, but it did not regrow until the ocean had a chance to cool off, which took centuries. By contrast, if the Arctic experiences ice-free summers for a relatively short time before greenhouse gases drop, then models suggest ice would regrow much sooner. That could theoretically start to happen by the end of the century, assuming that nations take very aggressive steps to reduce carbon dioxide levels1, according to Newton, Pfirman and their colleagues. So even if society cannot forestall the loss of summer sea ice in coming decades, taking action to keep CO concentrations under control could still make it easier to regrow the ice cover later, Notz says. Given the stakes, some researchers have proposed global-scale geoengineering to cool the planet and, by extension, preserve or restore ice. Others argue that it might be possible to chill just the north, for instance by artificially whitening the Arctic Ocean with light-coloured floating particles to reflect sunlight. A study9 this year suggested installing wind-powered pumps to bring water to the surface in winter, where it would freeze, forming thicker ice. But many researchers hesitate to embrace geoengineering. And most agree that regional efforts would take tremendous effort and have limited benefits, given that Earth’s circulation systems could just bring more heat north to compensate. “It’s kind of like walking against a conveyor the wrong way,” Pfirman says. She and others agree that managing greenhouse gases — and local pollutants such as black carbon from shipping — is the only long-term solution. Returning to a world with summer sea ice could have big perks, such as restoring some of the climate services that the Arctic provides to the globe and stabilizing weather patterns. And in the region itself, restoring a white Arctic could offer relief to polar bears and other ice-dependent species, says Pfirman. These creatures might be able to weather a relatively short ice-free window, hunkered down in either the last ice area or other places set aside to preserve biodiversity. When the ice returned, they could spread out again to repopulate the Arctic. That has almost certainly happened during past climate changes. For instance, researchers think the Arctic may have experienced nearly ice-free summers during the last interglacial period, 130,000 years ago10. But, one thing is certain: getting back to a world with Arctic summer sea ice won’t be simple, politically or technically. Not everyone will embrace a return to an ice-covered Arctic, especially if it’s been blue for several generations. Companies and countries are already eyeing the opportunities for oil and gas exploration, mining, shipping, tourism and fishing in a region hungry for economic development. “In many communities, people are split,” Pfirman says. Some researchers also say that the idea of regrowing sea ice seems like wishful thinking, because it would require efforts well beyond what nations must do to meet the Paris agreement. Limiting warming to 2 °C will probably entail converting huge swathes of land into forest and using still-nascent technologies to suck billions of tonnes of CO out of the air. Lowering greenhouse-gas concentrations enough to regrow ice would demand even more. And if summer sea ice ever does come back, it’s hard to know how a remade Arctic would work, Derocher says. “There will be an ecosystem. It will function. It just may not look like the one we currently have.”


News Article | February 18, 2017
Site: www.eurekalert.org

BOSTON, USA -- The Global Alliance for Genomics and Health (GA4GH) is an international coalition of academic, industry, and patient groups that aims to foster a culture of data-sharing between researchers and clinicians. On 18 February 2017 at 1:00pm, GA4GH will host a symposium in the Medical Sciences and Public Health track of the 2017 Annual Meeting of the American Association for the Advancement of Science (AAAS). The session, "Genomic and Health Data: Global Sharing and Local Governance," will consider how funding agencies, journals, regulators, health payers, and patient groups are moving to influence data-sharing policy, while simultaneously calibrating the notion of who "owns" genomic data. The theme of the 2017 AAAS meeting is "serving society through science policy." This means, in part, addressing ways that policy can be used to advance the practice of science. In 2017, genomic and health-related data from millions of individuals stand to improve human health and medicine considerably, especially as health care systems around the globe engage in ever more ambitious sequencing initiatives. But in many cases, the data produced in research and clinical settings around the globe are locked in silos due to incompatible formats and challenging jurisdictional barriers. Only by developing forward-looking international sharing policies can the community benefit from promise of these data. The GA4GH session will host lectures from three leading researchers in the genomic policy field: Bartha Knoppers (McGill University) will discuss the human rights foundation for global data sharing, Robert Cook-Deegan (Arizona State University) will discuss policies to promote data sharing 21 years after the Bermuda principles, and Meg Doerr (Sage Bionetworks) will discuss honesty, choice, and accountability in data sharing. One means by which GA4GH is working to advance data sharing policy is by offering practicalframeworks that can be tailored and implemented by institutions around the globe. For instance, the Regulatory and Ethics Working Group developed the Framework for Responsible Sharing of Genomic and Health-Related Data, which balances individual privacy, recognition for researchers, and the right of citizens to benefit from the progress of science in order to promote both open and tiered consent to sharing. "The Framework goes against the traditional presumption that biomedical research is somehow harmful and instead focuses on the human right to benefit from scientific progress as outlined in the Universal Declaration of Human Rights of 1948" said Knoppers. "We now need to work out the practical applications of that foundation, and begin to mobilize the policies, tools, and political will to inspire governments to respect this right and thereby foster and facilitate international data sharing." The hope, Knoppers said, is that by taking this approach, GA4GH will be able to overcome the policy and legal roadblocks to sharing, which present perhaps a greater hurdle than technology. Since 1996, genomic data sharing has been loosely governed by the principles set forth at the International Strategy Meeting on Human Genome Sequencing in Bermuda. "But the landscape has become significantly more complex since Bermuda," said Cook-Deegan. "Data sources are numerous and varied, ranging from the commercial sector to the clinic and from institutions around the world. Data users aren't just scientists anymore, but also consumers and clinicians. This all means we that we now need to expand on the Bermuda principles to promote a data sharing ecosystem that can account for all this diversity." "It also requires a rethinking of participant consent and researcher accountability," said Doerr. "At Sage, we're using our experiences in mobile health research to think of new processes for enabling participant choice and for granting researchers access to data they wish to analyze. This is just one answer to the many pressing policy questions that remain as we work to build this new ecosystem." Doerr, Cook-Deegan, and Knoppers will present in Room 309 of the Hynes Convention Center in Boston, Mass. from 1:00pm to 2:30pm on Saturday, 18 February 2017. The Global Alliance for Genomics and Health is an international, non-profit alliance formed to accelerate the potential of genomic medicine to advance human health. Bringing together over 450 leading organizations working in healthcare, research, disease and patient advocacy, life science, and information technology, GA4GH Members are working together to create a common framework of tools, methods, and harmonized approaches and supporting demonstration projects to enable the responsible, voluntary, and secure sharing of genomic and clinical data. Learn more at: http://genomicsandhealth. .


News Article | February 17, 2017
Site: www.marketwired.com

VANCOUVER, BC--(Marketwired - February 16, 2017) - Sirona Biochem Corp. (TSX VENTURE: SBM) ( : ZSB) ( : ZSB) announces that the Company has terminated Attila Hajdu's employment by mutual agreement. The Company is pleased to announce the addition of Aleksandra Kasikovic to its team in a new role of Manager, Commercial Development. Aleksandra holds a Master's of Science degree in Biotechnology from McGill University and an undergraduate degree in Biology and Marketing. Her strong work ethic and capacity for commercially evaluating science will be a valuable asset for Sirona. Dr. Howard Verrico, CEO of Sirona Biochem, said: "Attila has been instrumental in leading the negotiations towards a global licensing agreement for our skin lightening compound, TFC-1067. We would like to thank Attila for his hard work and want to wish him the very best in his future endeavors." "In the fall 2016, a team consisting of members of management, key board members and legal counsel at McMillian LLP was established to oversee licensing negotiations. All members have successfully negotiated definitive licensing agreements in the past and their combined skills cover depth and breadth needed for success. This team is now taking the lead in finalizing a licensing agreement for our superior skin lightening compound, TFC-1067. We anticipate the aforementioned changes will have a positive impact on current partnering activities and anticipated timelines", he added. Sirona Biochem is a cosmetic ingredient and drug discovery company with a proprietary platform technology. Sirona specializes in stabilizing carbohydrate molecules with the goal of improving efficacy and safety. New compounds are patented for maximum revenue potential. Sirona's compounds are licensed to leading companies around the world in return for licensing fees, milestone fees and ongoing royalty payments. Sirona's laboratory, TFChem, is located in France and is the recipient of multiple French national scientific awards and European Union and French government grants. For more information, please visit www.sironabiochem.com. Neither TSX Venture Exchange nor its Regulation Services Provider (as that term is defined in policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release. Sirona Biochem cautions you that statements included in this press release that are not a description of historical facts may be forward-looking statements. Forward-looking statements are only predictions based upon current expectations and involve known and unknown risks and uncertainties. You are cautioned not to place undue reliance on these forward-looking statements, which speak only as of the date of release of the relevant information, unless explicitly stated otherwise. Actual results, performance or achievement could differ materially from those expressed in, or implied by, Sirona Biochem's forward-looking statements due to the risks and uncertainties inherent in Sirona Biochem's business including, without limitation, statements about: a third party potential licensees of TFC-1067 may not deliver a term sheet to the company in Q1 2017 or at all; the company may not be able to negotiate a license agreement with a potential licensees of TFC-1067 on terms acceptable to Sirona Biochem; the progress and timing of its clinical trials are uncertain; difficulties or delays in development, testing, obtaining regulatory approval, producing and marketing products; unexpected adverse side effects or inadequate therapeutic efficacy of the company's or licensed products that could delay or prevent product development or commercialization; the scope and validity of patent protection for the company's or licensed products; competition from other pharmaceutical or biotechnology companies; and its ability to obtain additional financing to support its operations. Sirona Biochem does not assume any obligation to update any forward-looking statements except as required by law.


News Article | February 15, 2017
Site: www.eurekalert.org

Dr. Kurt Gottfried, a recognized leader in the scientific community on missile defense and nuclear terrorism, has been awarded the 2016 Scientific Freedom and Responsibility Award from the American Association for the Advancement of Science (AAAS). Dr. Gottfried, currently a professor emeritus of physics at Cornell University, was honored by AAAS "for his long and distinguished career as a 'civic scientist,' through his advocacy for arms control, human rights, and integrity in the use of science in public policy making." In 1969, Dr. Gottfried helped to found the Union of Concerned Scientists (UCS), acting on his concerns about the militarization of scientific research and the Vietnam War. He was among the first to publicly raise concerns about missile defense strategies, AAAS noted, developing a draft treaty to ban space weapons and presenting it to the U.S. Senate Foreign Relations Committee. The UCS grew to include concerned citizens, as well as scientists, and expanded its work to address environmental issues. The organization began a petition to urge government support of the Kyoto Protocols. Nobel Prize-winning scientist Dr. Harold Varmus has said that the UCS "has set a high standard in fearlessly providing reliable, if often controversial, advice to the public and government." Dr. Gottfried has also worked as a human rights advocate, traveling to the Soviet Union during the Cold War to meet with dissidents. He served on the executive committee of Scientists for Andrei Sakharov, Yuri Orlov and Natan Sharansky. Dr. Gottfried later helped Orlov find employment as a professor at Cornell, after Orlov's release from prison. Dr. Gottfried co-founded American Physical Society's Committee on International Freedom of Scientists, and served as its first chair. Dr. Gottfried was also dedicated to alerting the public when the government distorted science for political goals. AAAS noted that while he understood that scientific information is seldom the only consideration in government decision-making, he spoke out when those decisions were not scientifically sound. He recruited 62 preeminent scientists to help draft and release a statement titled "Restoring Scientific Integrity in Policy Making" in February 2004. The document charged President George W. Bush's administration with "[manipulating] the process through which science enters into its decisions." One of the signatories of that statement was Dr. Neal Lane, Senior Fellow at Rice University's Baker Institute for Public Policy, who nominated Dr. Gottfried for the Scientific Freedom and Responsibility Award. Dr. Lane previously served as assistant to the president for science and technology during the Clinton administration, and director of the National Science Foundation. In his nomination letter, Dr. Lane described Dr. Gottfried is "richly deserving of this prestigious award," and wrote that he "has encouraged fellow scientists to become involved in public policy, speak out on issues at the interface of science, technology and society, and hold governments accountable." Dr. Lane concluded his letter by writing that Dr. Gottfried "is an icon for what many of us have come to call the 'civic scientist.'" Dr. Gottfried completed his undergraduate degree in Engineering Physics at McGill University in Montreal, QBC, Canada in 1951, and his Ph.D. in theoretical physics at the Massachusetts Institute of Technology in 1955. He has served as a physics professor at Cornell University since 1964. AAAS also noted that Dr. Gottfried has served on the senior staff of the European Center for Nuclear Research. The AAAS Scientific Freedom and Responsibility Award was established in 1980. The award honors scientists, engineers or their organizations whose exemplary actions have served to foster scientific freedom and responsibility. Such achievements can include acting to protect the public's health, safety or welfare; focusing public attention on important issues related to scientific research, education, and public policy by their responsible participation in public debates; or establishing important new precedents in carrying out the social responsibilities or in defending the professional freedom of scientists and engineers. The award includes a $5,000 prize and a commemorative plaque. The AAAS Scientific Freedom and Responsibility Award will be bestowed upon Dr. Gottfried during the 183rd AAAS Annual Meeting in Boston, Mass., February 16-20, 2017. The AAAS Awards Ceremony and Reception will be held at 6:30 p.m. on Friday, February 17, in the Republic Ballroom of the Sheraton Boston Hotel. The American Association for the Advancement of Science (AAAS) is the world's largest general scientific society and publisher of the journal Science as well as Science Translational Medicine, Science Signaling, a digital, open-access journal, Science Advances, Science Immunology, and Science Robotics. AAAS was founded in 1848 and includes nearly 250 affiliated societies and academies of science, serving 10 million individuals. Science has the largest paid circulation of any peer-reviewed general science journal in the world. The non-profit AAAS is open to all and fulfills its mission to "advance science and serve society" through initiatives in science policy, international programs, science education, public engagement, and more. For the latest research news, log onto EurekAlert!, the premier science-news Web site, a service of AAAS. See http://www. . For more information on AAAS awards, see http://www. .


Fougeray S.,McGill University | Pallet N.,Service de Biochimie
Nature Reviews Nephrology | Year: 2015

Autophagy degrades pathogens, altered organelles and protein aggregates, and is characterized by the sequestration of cytoplasmic cargos within double-membrane-limited vesicles called autophagosomes. The process is regulated by inputs from the cellular microenvironment, and is activated in response to nutrient scarcity and immune triggers, which signal through a complex molecular network. Activation of autophagy leads to the formation of an isolation membrane, recognition of cytoplasmic cargos, expansion of the autophagosomal membrane, fusion with lysosomes and degradation of the autophagosome and its contents. Autophagy maintains cellular homeostasis during stressful conditions, dampens inflammation and shapes adaptive immunity. A growing body of evidence has implicated autophagy in kidney health, ageing and disease; it modulates tissue responses during acute kidney injuries, regulates podocyte homeostasis and protects against age-related renal disorders. The renoprotective functions of autophagy in epithelial renal cells and podocytes are mostly mediated by the clearance of altered mitochondria, which can activate inflammasomes and apoptosis, and the removal of protein aggregates, which might trigger inflammation and cell death. In translational terms, autophagy is undoubtedly an attractive target for developing new renoprotective treatments and identifying markers of kidney injury. © 2015 Macmillan Publishers Limited. All rights reserved.


Cadotte M.,University of Toronto | Albert C.H.,CNRS Alpine Ecology Laboratory | Albert C.H.,McGill University | Walker S.C.,University of Montréal
Ecology Letters | Year: 2013

Species enter and persist in local communities because of their ecological fit to local conditions, and recently, ecologists have moved from measuring diversity as species richness and evenness, to using measures that reflect species ecological differences. There are two principal approaches for quantifying species ecological differences: functional (trait-based) and phylogenetic pairwise distances between species. Both approaches have produced new ecological insights, yet at the same time methodological issues and assumptions limit them. Traits and phylogeny may provide different, and perhaps complementary, information about species' differences. To adequately test assembly hypotheses, a framework integrating the information provided by traits and phylogenies is required. We propose an intuitive measure for combining functional and phylogenetic pairwise distances, which provides a useful way to assess how functional and phylogenetic distances contribute to understanding patterns of community assembly. Here, we show that both traits and phylogeny inform community assembly patterns in alpine plant communities across an elevation gradient, because they represent complementary information. Differences in historical selection pressures have produced variation in the strength of the trait-phylogeny correlation, and as such, integrating traits and phylogeny can enhance the ability to detect assembly patterns across habitats or environmental gradients. © 2013 John Wiley & Sons Ltd/CNRS.


Heijman J.,University of Duisburg - Essen | Voigt N.,University of Duisburg - Essen | Nattel S.,Montreal Heart Institute | Nattel S.,McGill University | Dobrev D.,University of Duisburg - Essen
Circulation Research | Year: 2014

Atrial fibrillation (AF) is the most common clinically relevant arrhythmia and is associated with increased morbidity and mortality. The incidence of AF is expected to continue to rise with the aging of the population. AF is generally considered to be a progressive condition, occurring first in a paroxysmal form, then in persistent, and then long-standing persistent (chronic or permanent) forms. However, not all patients go through every phase, and the time spent in each can vary widely. Research over the past decades has identified a multitude of pathophysiological processes contributing to the initiation, maintenance, and progression of AF. However, many aspects of AF pathophysiology remain incompletely understood. In this review, we discuss the cellular and molecular electrophysiology of AF initiation, maintenance, and progression, predominantly based on recent data obtained in human tissue and animal models. The central role of Ca-handling abnormalities in both focal ectopic activity and AF substrate progression is discussed, along with the underlying molecular basis. We also deal with the ionic determinants that govern AF initiation and maintenance, as well as the structural remodeling that stabilizes AF-maintaining re-entrant mechanisms and finally makes the arrhythmia refractory to therapy. In addition, we highlight important gaps in our current understanding, particularly with respect to the translation of these concepts to the clinical setting. Ultimately, a comprehensive understanding of AF pathophysiology is expected to foster the development of improved pharmacological and nonpharmacological therapeutic approaches and to greatly improve clinical management. © 2014 American Heart Association, Inc.


Turecki G.,McGill University | Brent D.A.,Western Psychiatric Institute and Clinic
The Lancet | Year: 2016

Summary Suicide is a complex public health problem of global importance. Suicidal behaviour differs between sexes, age groups, geographic regions, and sociopolitical settings, and variably associates with different risk factors, suggesting aetiological heterogeneity. Although there is no effective algorithm to predict suicide in clinical practice, improved recognition and understanding of clinical, psychological, sociological, and biological factors might help the detection of high-risk individuals and assist in treatment selection. Psychotherapeutic, pharmacological, or neuromodulatory treatments of mental disorders can often prevent suicidal behaviour; additionally, regular follow-up of people who attempt suicide by mental health services is key to prevent future suicidal behaviour. © 2016 Elsevier Ltd.


Ricciardi A.,McGill University | Hoopes M.F.,Mount Holyoke College | Marchetti M.P.,St. Mary's College | Lockwood J.L.,Rutgers University
Ecological Monographs | Year: 2013

A predictive understanding of the ecological impacts of nonnative species has been slow to develop, owing largely to an apparent dearth of clearly defined hypotheses and the lack of a broad theoretical framework. The context dependency of impact has fueled the perception that meaningful generalizations are nonexistent. Here, we identified and reviewed 19 testable hypotheses that explain temporal and spatial variation in impact. Despite poor validation of most hypotheses to date, evidence suggests that each can explain at least some impacts in some situations. Several hypotheses are broad in scope (applying to plants and animals in virtually all contexts) and some of them, intriguingly, link processes of colonization and impact. Collectively, these hypotheses highlight the importance of the functional ecology of the nonnative species and the structure, diversity, and evolutionary experience of the recipient community as general determinants of impact; thus, they could provide the foundation for a theoretical framework for understanding and predicting impact. Further substantive progress toward this goal requires explicit consideration of within-taxon and across-taxa variation in the per capita effect of invaders, and analyses of complex interactions between invaders and their biotic and abiotic environments. © 2013 by the Ecological Society of America.


Winnik F.M.,University of Montréal | Winnik F.M.,Japan International Center for Materials Nanoarchitectonics | Maysinger D.,McGill University
Accounts of Chemical Research | Year: 2013

The dramatic increase in the use of nanoparticles (NP) in industry and research has raised questions about the potential toxicity of such materials. Unfortunately, not enough is known about how the novel, technologically- attractive properties of NPs correlate with the interactions that may take place at the nano/bio interface. The academic, industrial, and regulatory communities are actively seeking answers to the growing concerns on the impact of nanotechnology on humans. In this Account we adopt quantum dots (QDs) as an illustrative example of the difficulties associated with the development of a rational science-based approach to nanotoxicology.The optical properties of QDs are far superior to those of organic dyes in terms of emission and absorption bandwidths, quantum yield, and resistance to photobleaching. Moreover, QDs may be decorated with targeting moieties or drugs and, therefore, are candidates for site-specific medical imaging and for drug delivery, for example in cancer treatment. Earlier this year researchers demonstrated that QD-based imaging using monkeys caused no adverse effects although QDs accumulated in lymph nodes, bone marrow, liver, and spleen for up to 3 months after injection. Such persistence of QDs in live animals does, however, raise concerns about the safety of using QDs both in the laboratory and in the clinic.Researchers anticipate that QDs will be increasingly used not only in clinical applications but also in various manufactured products. For example, QD-solar cells have emerged as viable contenders to complement or replace dye-sensitized solar cells; CdTe/CdS thin film cells have already captured approximately 10 percent of the global market, and in addition, QDs can serve as components of sensors and as emitting materials in LEDs. Given the clear indications that QDs will inevitably become components of a wide range of manufactured and consumer products, researchers and policy makers need to understand the possible health risks associated with exposure to QDs.In this Account, we initially review the known mechanisms by which QDs can damage cells, including oxidative stress elicited by reactive oxygen species (ROS). We discuss lesser-known impairments induced in cells by nanomolar to picomolar concentrations of QDs, which imply that cadmium-containing QDs can exert genotoxic, epigenetic, and metalloestrogenic effects. These observations strongly suggest that minute concentrations of QDs could be sufficient to cause long lasting, even transgenerational, effects. We also consider various modes by which humans could be exposed to QDs in their work or through the environment. Although considerable advances have been made in enhancing the stability and overall quality of QDs, over time they can partially degrade in the environment or in biological systems, and eventually cause small, but cumulative undesirable effects.A combination of toxicological, genetic, epigenetic and imaging approaches is required to create comprehensive guidelines for evaluating the nanotoxicity of nanomaterials, including QDs. Prior to biological investigations with these materials, an indispensible step must be the full characterization of NPs by complementary techniques. Specifically, the concentration, size, charge, and ligand stability of NPs in biological media must be known if we are to understand fully how the properties of nanoparticles and of their biological environment contribute to cytotoxicity. © 2012 American Chemical Society.


Grant
Agency: Cordis | Branch: H2020 | Program: ERC-STG | Phase: ERC-StG-2014 | Award Amount: 1.44M | Year: 2015

Enhancers control the correct spatio-temporal activation of gene expression. A comprehensive characterization of the properties and regulatory activities of enhancers as well as their target genes is therefore crucial to understand the regulation and dysregulation of differentiation, homeostasis and cell type specificity. Genome-wide chromatin assays have provided insight into the properties and complex architectures by which enhancers regulate genes, but the understanding of their mechanisms is fragmented and their regulatory targets are mostly unknown. Several factors may confound the inference and interpretation of regulatory enhancer activity. There are likely many kinds of regulatory architectures with distinct levels of output and flexibility. Despite this, most state-of-the-art genome-wide studies only consider a single model. In addition, chromatin-based analysis alone does not provide clear insight into function or activity. This project aims to systematically characterize enhancer architectures and delineate what determines their: (1) restricted spatio-temporal activity; (2) robustness to regulatory genetic variation; and (3) dynamic activities over time. My work has shown enhancer transcription to be the most accurate classifier of enhancer activity to date. This data permits unprecedented modeling of regulatory architectures via enhancer-promoter co-expression linking. Careful computational analysis of such data from appropriate experimental systems has a great potential for distinguishing the different modes of regulation and their functional impact. The outcomes have great potential for providing us with new insights into mechanisms of transcriptional regulation. The results will be particularly relevant to interpretation of regulatory genetic variations. Ultimately, knowing the characteristics and conformations of enhancer architectures will increase our ability to link variation in non-coding DNA to phenotypic outcomes like disease susceptibility.


News Article | January 27, 2017
Site: www.techtimes.com

Starting schools later could help teenagers from Canada benefit from better sleep. This could translate in a better chance for success among this category of children, according to new research. The study, published, Jan. 24, in the Journal of Sleep Research, by researchers from McGill University, addresses the issue of insufficient sleep and its associated harms. The scientists discovered that students who are enrolled in schools that start earlier sleep less, thus being less likely to meet the national sleep recommendations for their ages. "Students slept an average of 8:36 h on weekdays and 69% met sleep duration recommendations, but 60% reported feeling tired in the morning. Every 10-min delay in school start time corresponded with 3.2 additional minutes of sleep, a 1.6% greater probability of sufficient sleep and a 2.1% smaller probability of feeling tired at school in the morning," noted the research. This means that these students are more likely to be tired in the morning. According to the research, one in three students don't get enough sleep for their age, and there is a scientific explanation for this phenomenon. "As teenagers go through puberty, their circadian clock gets delayed by two to three hours. By the time they reach junior high, falling asleep before 11 p.m. becomes biologically difficult, and waking up before 8 a.m. is a struggle. Adolescents are fighting biology to get to school on time," noted lead author Geneviève Gariépy, a post-doctoral student at McGill's Institute of Health and Social Policy. Prior research showed that sleep-deprived teenagers perform worse in school. They are prone to developing more health issues and are also vulnerable to conditions such as anxiety, depression, and behavioral problems. The current research employed data from 30,000 students, part of 362 schools across Canada. The data was gathered from a cross-national survey, carried out once every four years, in more than 40 countries. After assessing the number of sleeping hours that children in this age group make, the researchers then investigated the school programs of the 362 institutions, whose first class ranged from 8:00 to 9:30. After a cross-examination of the data, a strong causality was found between the class starting late and the better performance and well-being of the students. However, teenagers in Canada are not the only ones to have sleeping problems in both the patterns and the quantity of their night's sleep. According to the United States National Sleep Foundation, most of the teenagers in the United States also don't get enough sleep. "Teens need about 8 to 10 hours of sleep each night to function best. Most teens do not get enough sleep - one study found that only 15% reported sleeping 8 1/2 hours on school nights. Teens tend to have irregular sleep patterns across the week - they typically stay up late and sleep in late on the weekends, which can affect their biological clocks and hurt the quality of their sleep," noted the foundation's data. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.


News Article | February 23, 2017
Site: www.eurekalert.org

A new mouse model with a working immune system could be used in laboratory research to improve understanding of Zika virus infection and aid development of new treatments, according to a study published in PLOS Pathogens. The ongoing Zika pandemic has caused infection in millions of people in the Americas and spurred new research using laboratory animals to study the virus. However, most of this research has been performed in mice with defective immune systems, resulting in limited understanding of the immune response to Zika virus and slowing efforts to develop potential vaccines and antiviral treatments. Researchers are working to develop Zika virus models in mice with functioning immune systems. In the new study, a team led by Dr. Martin Richer and Dr. Selena Sagan at McGill University successfully caused Zika infection in adult mice with healthy immune systems and studied the immune response to infection. The scientists employed a mouse strain called C57BL/6, which is often used to study other diseases. They showed that adult C57BL/6 mice could be infected with Zika virus, with most mice experiencing mild symptoms--similar to most infected humans. Like other viruses, Zika virus caused an innate and adaptive immune response in the mice. The researchers used a technique known as the "surrogate marker" approach to indirectly track how immune system cells called T cells responded to infection. This approach led to identification of a specific portion ("epitope") of a Zika virus protein that is recognized by mouse T cells. The new mouse model could be used in further research to investigate the immune response to Zika virus. In particular, the newly identified Zika virus epitope could point the way to specific molecular strategies for studying T cell responses to infection and could aid vaccine development. "Our findings are particularly exciting because we now know that we can study the immune response to Zika virus in mice with a normal immune system," the authors explain. "Importantly, this model, as well as the discovery of a specific part of the virus recognized by mouse T cells, provides us with tools that will allow us to advance the understanding of this emerging human pathogen." In your coverage please use this URL to provide access to the freely available article in PLOS Pathogens: http://dx. Citation: Pardy RD, Rajah MM, Condotta SA, Taylor NG, Sagan SM, Richer MJ (2017) Analysis of the T Cell Response to Zika Virus and Identification of a Novel CD8+ T Cell Epitope in Immunocompetent Mice. PLoS Pathog 13(2): e1006184. doi:10.1371/journal.ppat.1006184 Funding: This work was supported by start-up funds from McGill University (SMS and MJR) as well as operating funds from the Fonds de Recherche du Québec Nature et Technologies (SMS) (#189120, http://www. ). SMS is a Tier II Canada Research Chair in RNA Biology and Viral Infections. MJR received salary support from the Fonds de Recherche du Québec Santé - Chercheurs-Boursiers Junior 1 (#32807, http://www. ). MMR would like to thank the McGill University Faculty of Medicine Max E. Binz Fellowship for graduate training. RDP would like to thank the Natural Sciences and Engineering Research Council of Canada (NSERC) Canada Graduate Scholarship - Masters (CGS-M) for graduate support (http://www. ). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist.


News Article | February 15, 2017
Site: www.eurekalert.org

A study published today in the journal Nature is the first to show that it is possible to predict within the first year of life, whether some infants will go on to develop autism. The ability to identify autism risk during infancy could set the stage for developing very early preventive treatments when the brain is most malleable. Earlier detection also provides opportunities for early treatment--and earlier intervention is known to be associated with better long term outcomes. Researchers used magnetic resonance imaging (MRI) technology to capture brain images of infants who are considered at high risk for developing autism spectrum disorder (ASD) by virtue of having an older sibling with ASD. The research team took different measurements of the child's brain at 6 and 12 months of age, including overall volume, surface area and thickness of the cerebral cortex in particular regions. A computer-generated algorithm was used to combine these measurements and was able to predict which babies would develop autism by age two with more than 90 percent accuracy. The Center for Autism Research (CAR) at Children's Hospital of Philadelphia (CHOP) was a major study site in the multicenter research project. The study's lead site was based at University of North Carolina-Chapel Hill. "The results of this study are a real breakthrough for early diagnosis of autism," said Robert T. Schultz, PhD, who directs the Center for Autism Research and led the CHOP study site. "While we have known for some time that autism emerges in subtle, gradual ways over the first few years of life, this study offers the first firm evidence before a child's first birthday predicting whether certain high-risk children are likely to be diagnosed with autism." Despite extensive research, it has been impossible until now to identify these children before the second year of life, when behaviors typical of autism emerge. "Our study shows that early brain development biomarkers could be very useful in identifying babies at the highest risk for autism before behavioral symptoms emerge," said the study's senior author, Joseph Piven, MD, of the Carolina Institute for Developmental Disabilities (CIDD) at the University of North Carolina. Autism Spectrum Disorder (or ASD) is a complex developmental disability characterized by difficulties in social interaction, verbal and nonverbal communication, and repetitive behaviors or interests. Behavioral symptoms usually become evident between ages two and four, and research has shown that children who receive the earliest treatment tend to reap the most benefits. It is estimated that one in 68 school-aged children are diagnosed with autism. In infants who have older siblings with autism, the risk of developing ASD may be as high as 20 out of every 100 births. There are about 3 million people with autism in the United States and tens of millions around the world. For this Nature study, Piven, Schultz, and researchers from across North America conducted MRI scans of 106 high-risk infants and 42 low-risk infants at six, 12, and 24 months of age. They found that the babies who developed autism experienced much more rapid growth of the brain's surface area from six to 12 months than babies who did not show evidence of autism at 24 months of age. The study team also found a link between increased growth rate of surface area in the first year of life and an increased growth rate of overall brain volume in the second year of life. Extensive prior research has identified enlarged brain size as a risk factor for autism. This most recent study shows this pattern of rapid growth originates in specific brain regions long before brain size itself shows significant enlargement. In addition, brain overgrowth correlated with the severity of social deficits that emerged by age two. The researchers made measurements of cortical surface areas and cortical thickness at 6 and 12 months of age and studied the rate of growth between 6 and 12 months of age. These measurements, combined with brain volume and sex of the infants predicted with a high degree of accuracy who would develop autism by age 24 months. To generate these predictive results, the team drew on machine learning, a statistical approach that uses pattern recognition to make very detailed predictions. The brain differences at 6 and 12 months of age in infants with older siblings with autism correctly predicted eight out of ten infants who would later meet criteria for autism at 24 months of age in comparison to those infants with older ASD siblings who did not meet criteria for autism at 24 months. This analytic approach was also almost perfect in predicting which high-risk babies would not develop autism by age 2 years. The authors emphasize that the effectiveness of the algorithm needs to be reproduced in future studies in order to be ready for clinical use. "If we are able to replicate these results in further studies, these findings promise to change how we approach infant and toddler screening for autism, making it possible to identify infants who will later develop autism before the behavioral symptoms of autism become apparent," Schultz said. For example, if parents have a child with autism and then have a second child, such a test might be clinically useful in identifying infants at highest risk for developing this condition. The idea would be to then intervene 'pre-symptomatically' before the defining symptoms of autism emerge. The study also has implications for developing new autism treatments, said Schultz, a pediatric neuropsychologist. "Using brain imaging, we were able to pinpoint areas of the brain where atypical development contributes to autism. Understanding these neural mechanisms may guide us in developing opportunities for early treatment--possibly, before the symptoms of autism become outwardly visible." The same collaborators published a related study last month using functional MRI scans to identify brain networks involved in a key social behavior called initiation of joint attention. In this behavior--often impaired in ASD--a baby focuses on an object and draws another person's attention to that object. This study is the earliest known description of how functional brain systems underlie an important social behavior. In addition to adding to the neurobiology of how social behavior develops, those findings may inform efforts to design new treatments. "Putting this into the larger context of neuroscience research and treatment, there is currently a big push within the field to be able to detect the biomarkers of these conditions before patients are diagnosed, at a time when preventive efforts are possible," Piven added. "In Parkinson's, for instance, we know that once a person is diagnosed, they've already lost a substantial portion of the dopamine receptors in their brain, making treatment less effective." Piven said the idea with autism is similar; once autism is diagnosed at age two to three years, the brain has already begun to change substantially. "We haven't had a way to detect the biomarkers of autism before the condition sets in and symptoms develop," he said. "Now we have very promising leads that suggest this may in fact be possible." The National Institutes of Health (grants HD055741, EB005149, HD003110 and MH093510) funded this study. This research was led by researchers at the Carolina Institute for Developmental Disabilities (CIDD) at the University of North Carolina, which is directed by the study's senior author, Joseph Piven, MD, the Thomas E. Castelloe Distinguished Professor of Psychiatry at the University of North Carolina-Chapel Hill. Other clinical sites included Children's Hospital of Philadelphia, the University of Washington, and Washington University in St. Louis. Other key collaborators are McGill University, the University of Alberta, the College of Charleston, and New York University. Heather Cody Hazlett, et al "Early Brain Development in Infants at High Risk for Autism Spectrum Disorder" Nature, in print Feb. 16, 2017. http://doi. About Children's Hospital of Philadelphia: Children's Hospital of Philadelphia was founded in 1855 as the nation's first pediatric hospital. Through its long-standing commitment to providing exceptional patient care, training new generations of pediatric healthcare professionals, and pioneering major research initiatives, Children's Hospital has fostered many discoveries that have benefited children worldwide. Its pediatric research program is among the largest in the country. In addition, its unique family-centered care and public service programs have brought the 535-bed hospital recognition as a leading advocate for children and adolescents. For more information, visit http://www.


News Article | February 22, 2017
Site: www.prweb.com

The ability to wade through volumes of data, and quickly identify misinformation to make sound business decisions, is crucial to the success of any organization. Critical Thinking: Judgement and Decision Making in the Information Age helps leaders separate fact from fiction- allowing them to focus on the data vital to the success of their business. In this three-day program, Faculty Director Levitin teaches executives “how to distinguish misinformation, pseudo-facts, distortions, and outright lies from reliable information.” Participants will learn to see through visual manipulations of data, question how data is collected, reported, and held. They will understand how to avoid the brain’s mind traps, and learn Levitin’s Seven Steps Toward Better Critical Thinking. “This program is a hands-on work out for your brain. You’ll use real-life examples, business case studies, and data from your own company to build analysis skills and give you and your company a unique competitive edge,” says Levitin. “In a time of increasing misinformation, we are excited to offer a program that helps identify reliable data in order to make sound business decisions,” says Mike Rielly, CEO of UC Berkeley Executive Education. “We are thrilled Dr. Daniel Levitin is joining us to share his knowledge and expertise in the area of critical thinking and decision making,” adds Rielly. Dr. Daniel Levitin is Dean of the College of Social Sciences at the Minerva Schools at KGI, the James McGill Professor of psychology and behavioral neuroscience at McGill University, and was recently named Distinguished Faculty Fellow at the Haas School of Business. He has written extensively, both in scientific journals and mainstream press, and has appeared frequently on national media, including The Today Show, Good Morning America, CBS This Morning, Fox News Channel, PBS Newshour, and various NPR programs. Dr. Levitin is the author of the #1 best-seller This Is Your Brain On Music (Dutton/Penguin, 2006), which was published in nineteen languages and spent more than one year on the New York Times Bestseller list. His second book, The World in Six Songs (Dutton/Penguin, 2008) hit the bestseller lists in its first week of release. His next book was another #1 best-seller, The Organized Mind: Thinking Straight in the Age of Information Overload (Dutton/Penguin 2014). His newest book is currently an international best-seller, A Field Guide to Lies: Critical Thinking in the Information Age (Dutton 2016) and is being re-released in paperback on March 6 under the new title Weaponized Lies: How to Think Critically in the Post-Truth Era.


VOORHEES, N.J.--(BUSINESS WIRE)--American Water has named Robert MacLean senior vice president of its Eastern Division and president of New Jersey American Water, effective March 1, 2017. MacLean replaces William Varley, who was recently appointed senior vice president of American Water’s Midwest Division, encompassing Missouri, Illinois, Indiana and Iowa. MacLean has served as president of California American Water since 2009 and president of Hawaii American Water since 2011. California American Water provides high-quality and reliable water and/or wastewater services to more than 660,000 people throughout the state. Hawaii American Water provides wastewater service to more than 30,000 Hawaiians. “We are so pleased to bring Rob back to New Jersey and proud of all the work Bill has accomplished during his time leading New Jersey American Water,” said American Water’s chief operating officer Walter Lynch. “With more than 20 years of experience in the water business, Rob is 100 percent committed to excellent customer service, and I know he will bring that passion to our customers in the Garden State. His past experience working in New Jersey makes him a great fit for this new role.” MacLean joined American Water in 1999. Prior to his current position, he was the director of Field Operations for New Jersey American Water. Before joining New Jersey American Water, he served in various other roles within the American Water organization. He worked for American Water’s market-based business, serving as vice president of Contract Operations where he was responsible for managing more than 30 large contract operations and directed approximately 750 employees in both the United States and Canada. MacLean co-chairs the board of the National Utilities Diversity Council, a national nonprofit organization focusing on the growth of diversity in the utilities industry. He serves as a board member of the California Chamber of Commerce and was previously co-chair of the chamber's Water Committee. MacLean also serves on the board of the Health Transformation Alliance, an organization representing close to 40 of the nation's leading corporations dedicated to providing better health care outcomes for six million Americans. MacLean earned his master’s degree in applied science in civil engineering from Polytechnique University in Montreal and his bachelor’s degree in chemical engineering from McGill University in Montreal. In 2014, he attended the Stanford Executive Program at the Stanford Graduate School of Business. New Jersey American Water, a subsidiary of American Water (NYSE: AWK), is the largest investor-owned water utility in the state, providing high-quality and reliable water and/or wastewater services to approximately 2.7 million people. With a history dating back to 1886, American Water is the largest and most geographically diverse U.S. publicly traded water and wastewater utility company. The company employs more than 6,800 dedicated professionals who provide regulated and market-based drinking water, wastewater and other related services to an estimated 15 million people in 47 states and Ontario, Canada. More information can be found by visiting www.amwater.com.


News Article | February 22, 2017
Site: www.prweb.com

There’s something BIG going on in Plant City on Friday, March 3 … REALLY, REALLY BIG!  In fact, it’s GUINNESS WORLD RECORDS BIG!   Cabot Creamery Co-operative is joining forces with the Florida Strawberry Festival to create the Largest strawberry yogurt smoothie – all to benefit United Food Bank of Plant City and Feeding Tampa Bay.   When we say REALLY, REALLY BIG, we’re not kidding! The Cabot Smoothie prep team, led by Cabot Chef Jimmy Kennedy, will be hard at work beginning at 10am on March 3 during the 2017 Florida Strawberry Festival in Plant City, FL blending a healthy and delicious smoothie made from more than 250 gallons of Cabot Vanilla Bean Greek Yogurt, that represents more than 1,100 two-pound tubs of Cabot Greek Yogurt for every one of Cabot’s 1,100 farm families, 2,000 pounds of fresh Florida strawberries, 3,375 pounds of ice and 265 pounds of Cabot Whey protein powder. “The Florida Strawberry Festival is pleased to host Cabot’s GUINNESS WORLD RECORDS attempt to recapture the record by creating the World’s Largest Strawberry Yogurt Smoothie to benefit United Food Bank of Plant City and Feeding Tampa Bay. Featuring Florida strawberries in this world record attempt showcases our amazing 87th Annual Festival and brings more awareness to Plant City’s rightful claim as the ‘Winter Strawberry Capital of the World,’” said Paul Davis, Florida Strawberry Festival general manager. The Cabot Smoothie team previously set the GUINNESS WORLD RECORDS mark of more than 400 US gallons of smoothie on Friday, May 3, 2013 at the Bike Expo New York event held at Pier 36 in Basketball City in New York City. That record has been eclipsed several times since 2013. The current GUINNESS WORLD RECORDS mark for the Largest smoothie is held by McGill University of Montreal, Canada and stands at 825 US gallons. “We are excited to attempt to establish a new Guinness World Record for the World’s Largest Smoothie to benefit United Food Bank of Plant City and Feeding Tampa Bay,” said Roberta MacDonald, Senior Vice President of Marketing for Cabot Creamery Co-operative. “The 1,100 farm families who own Cabot Creamery are dedicated to supporting communities where we sell our dairy products, and raising money for United Food Bank of Plant City and Feeding Tampa Bay is one of the many ways our farm families give back to those in need.” The record attempt will take place at the Cabot Tent located on the north side of the Life Storage Carriage House just inside the Amscot Main Ticket Gate at the Festival. Blending will commence at 10am and is estimated to take four to six hours. Once completed, all proceeds from the sale of the record setting Smoothie - sold in commemorative cups for a suggested donation of $1.00 – go directly to United Food Bank of Plant City. In keeping with Guinness World Records’ zero food waste policy, any remaining Smoothie will go directly to Feeding Tampa Bay and will be distributed to Food Banks and Pantries throughout the greater Tampa Bay area for consumption by those in need. "We are grateful to be the recipient for this record-breaking event with our partners at Cabot. The enormity of this record reminds us of the enormity of the hunger issue in our community, with 700,000 of our neighbors not having stable access to food. The fresh and healthy ingredients used in this smoothie are perfectly aligned with Feeding Tampa Bay’s goal to deliver more fresh, nutritious foods to those in need every year,” said Thomas Mantz, Executive Director of Feeding Tampa Bay. Can we do it again? We don’t want to brag, but our track record speaks for itself! Cabot established and still holds the GUINNESS WORLD RECORDS titles for the Largest grilled cheese sandwich, 320 pounds) set on November 4, 2000 in Everglades City, FL, and The World’s Largest Mac & Cheese (2,469 pounds) set in 2010 in New Orleans – all for charities! This year the Cabot Smoothie team doesn’t want to simply surpass the current record. They plan to shatter it by blending a whopping 1,000 gallons of strawberry yogurt smoothie. Cabot’s famous Greek Yogurt took home top honors as “Best In Class” in the competition’s first-ever High-Protein Dairy category at the 2016 World Championship Cheese contest in Madison, WI. Available in convenient two-pound tubs, Cabot Greek Yogurt can be used for baking, and Cabot Plain Greek Yogurt makes a great substitute for sour cream or cream, or as a base for dips and sauces. Also included in the recipe are enough Plant City Strawberries - 2,000 pounds in all - to fill nearly 25 household bathtubs. “We are extremely pleased to be part of this event and to have fresh Florida strawberries the featured fruit in making the world’s largest strawberry smoothie. This is a record we are proud to be part of and we hope that the record stands for many years,” said Kenneth Parker, Executive Director, Florida Strawberry Growers Association. The Smoothie will be made using two human-powered Vitamix Bicycle Blenders as well as four Commercial and eight residential Vitamix blenders, and continuously poured into a 1,000 gallon food-grade holding vessel packed in ice. “Vitamix is excited to partner with Cabot Creamery to regain the Guinness World Book Record for the world’s largest smoothie,” said Vitamix Marketing Programs Manager Wendy Manfredi. With Vitamix equipment doing the blending, we can promise that the smoothie will not only be the largest but also the smoothest!  This will please everyone who will be making a donation and tasting this record-breaking smoothie.  Vitamix is proud to support the efforts of Cabot to provide a generous donation to United Food Bank of Plant City and Feeding Tampa Bay because we support similar organizations in our headquarters home town of Cleveland, Ohio and recognize the importance of providing healthy meals to those in need. ABOUT CABOT CREAMERY CO-OPERATIVE: Cabot Creamery Co-operative has been in continuous operation in Vermont since 1919 and makes a full line of cheeses, yogurt, sour cream, cottage cheese and butter. Best known as makers of “The World’s Best Cheddar and The World’s Best Lowfat Cheddar,” Cabot is owned by 1100 dairy farm families throughout New England and Upstate New York. For additional information on Cabot Creamery Co-operative, please visit http://www.cabotcheese.coop


Foulkes W.D.,McGill University | Priest J.R.,Minneapolis | Duchaine T.F.,McGill University
Nature Reviews Cancer | Year: 2014

Dicer is central to microRNA-mediated silencing and several other RNA interference phenomena that are profoundly embedded in cancer gene networks. Most recently, both germline and somatic mutations in DICER1 have been identified in diverse types of cancer. Although some of the mutations clearly reduce the dosage of this key enzyme, others dictate surprisingly specific changes in select classes of small RNAs. This Review reflects on the molecular properties of the Dicer enzymes in small RNA silencing pathways, and rationalizes the newly discovered mutations on the basis of the activities and functions of its determinants. © 2014 Macmillan Publishers Limited. All rights reserved.


Lawler P.R.,McGill University | Lawler J.,Beth Israel Deaconess Medical Center
Cold Spring Harbor Perspectives in Medicine | Year: 2012

Thrombospondins TSP-1 and TSP-2 are potent endogenous inhibitors of angiogenesis. They inhibit angiogenesis through direct effects on endothelial cell migration, proliferation, survival, and apoptosis and by antagonizing the activity of VEGF. Several of the membrane receptor systems and signal transduction molecules that mediate the effects of TSP-1 and TSP-2 have been elucidated. TSP-1 and TSP-2 exert their direct effects through CD36, CD47, and integrins. Recent data indicate that CD36 and β1 integrins collaborate to transmit the signals that are initiated by TSP-1 and TSP-2. Furthermore, these receptors appear to associate with VEGFR2 to form a platform for the integration of positive and negative signals for angiogenesis. Cross talk between pro- and antiangiogenic signal transduction pathways may enable TSP-1 and TSP-2 to inhibit angiogenesis by antagonizing survival pathways while also activating apoptotic pathways. CD36 and CD47 are both involved in the suppression of nitric oxide (NO). Advances in understanding of the molecular regulation of angiogenesis by TSP have paved the way for innovations in experimental treatment of cancers and will likely continue to offer vast avenues for discovery in other disease processes as well. © 2012 Cold Spring Harbor Laboratory Press.all rights reserved.


Jaccard S.L.,ETH Zurich | Galbraith E.D.,McGill University
Geophysical Research Letters | Year: 2013

Despite its tremendous size, the deep North Pacific has received relatively little attention by paleoceanographers. It was recently suggested that the deep North Pacific was directly ventilated by dense waters formed in the subarctic Pacific during Heinrich Stadial 1 (HS1) of the early deglaciation. Here we present new redox-sensitive trace metal data from a sediment core at 2393 m in the subarctic Pacific, in comparison with previously published data from elsewhere in the region. The combined picture shows no sign of ventilation during the early deglaciation in any available core from water depths of 2393 m and deeper, while the deepest core to display clear signs of enhanced ventilation during HS1 was raised from 1366m water depth. Thus, it appears likely that, although the North Pacific was well ventilated to intermediate depths during HS1, the deep ocean did not receive a significant input of dense waters from a local source, but remained isolated from the surface waters above. Sample unit level copyright. © 2013. American Geophysical Union. All Rights Reserved.


Han K.,McGill University | Mithas S.,University of Maryland University College
MIS Quarterly: Management Information Systems | Year: 2013

Does information technology outsourcing reduce non-IT operating costs? This study examines this question and also asks whether internal IT investments moderate the relationship between IT outsourcing and non-IT operating costs. Using a panel data set of approximately 300 U.S. firms from 1999 to 2003, we find that IT outsourcing has a significant negative association with firms' non-IT operating costs. However, this finding does not imply that firms should completely outsource their entire IT function. Our results suggest that firms benefit more in terms of reduction in non-IT operating costs when they also have higher levels of complementary investments in internal IT, especially IT labor. Investments in internal IT systems can make business processes more amenable to outsourcing, and complementary investments in internal IT staff can facilitate monitoring of vendor performance and coordination with vendors. We discuss the implications of these findings for further research and for practice. Copyright © 2013 by the Management Information Systems Research Center (MISRC) of the University of Minnesota.


Karangelos E.,University of Manchester | Bouffard F.,McGill University
IEEE Transactions on Power Systems | Year: 2012

This paper proposes a security-constrained forward market clearing algorithm within which the inherent characteristics of demand flexibility are acknowledged when the provision of reserve from the demand side is considered. In the proposed formulation, we co-optimize the cost of scheduling the appropriate resources to guarantee the security of the system and the expected cost of operating under any credible system state. In addition, we consider that consumers can offer to provide spinning reserve capacity deployable by voluntary load reductions in response to contingencies. Due to the load recovery effect (i.e., since energy usage is essentially postponed when demand-side reserve is deployed), in post-contingency states, any voluntary reduction in the load has to be accompanied by a subsequent increase in demand from the initial forecast. We demonstrate that the marginal value of the reserve provided by the demand can only be calculated taking into account the cost of supplying the recovery consumption. Flexible consumers can reduce their payments on average if energy is settled through real-time prices. © 2006 IEEE.


Jaccard S.L.,ETH Zurich | Galbraith E.D.,McGill University
Nature Geoscience | Year: 2012

During the last glacial termination, the solubility of gases in the ocean decreased as ocean temperatures rose. However, marine sediments have not unanimously recorded ocean deoxygenation throughout this time. Some records show increasing oxygenation since the Last Glacial Maximum, particularly in the deep sea, while many document abrupt oxygenation changes, often associated with apparent changes in the formation rate of North Atlantic Deep Water. Here we present a global compilation of marine sediment proxy records that reveals remarkable coherency between regional oxygenation changes throughout deglaciation. The upper ocean generally became less oxygenated, but this general trend included pauses and even reversals, reflecting changes in nutrient supply, respiration rates and ventilation. The most pronounced deoxygenation episode in the upper ocean occurred midway through the deglaciation, associated with a reinvigoration of North Atlantic Deep Water formation. At this time, the upper Indo-Pacific Ocean was less oxygenated than today. Meanwhile, the bulk of the deep ocean became more oxygenated over the deglaciation, reflecting a transfer of respired carbon to the atmosphere. The observed divergence from a simple solubility control emphasizes the degree to which oxygen consumption patterns can be altered by changes in ocean circulation and marine ecosystems. © 2012 Macmillan Publishers Limited. All rights reserved.


Pencina M.J.,Duke University | Navar-Boggan A.M.,Duke University | D'Agostino Sr. R.B.,Boston University | Williams K.,KenAnCo Biostatistics | And 3 more authors.
New England Journal of Medicine | Year: 2014

BACKGROUND: The 2013 guidelines of the American College of Cardiology and the American Heart Association (ACC-AHA) for the treatment of cholesterol expand the indications for statin therapy for the prevention of cardiovascular disease. METHODS: Using data from the National Health and Nutrition Examination Surveys of 2005 to 2010, we estimated the number, and summarized the risk-factor profile, of persons for whom statin therapy would be recommended (i.e., eligible persons) under the new ACC-AHA guidelines, as compared with the guidelines of the Third Adult Treatment Panel (ATP III) of the National Cholesterol Education Program, and extrapolated the results to a population of 115.4 million U.S. adults between the ages of 40 and 75 years. RESULTS: As compared with the ATP-III guidelines, the new guidelines would increase the number of U.S. adults receiving or eligible for statin therapy from 43.2 million (37.5%) to 56.0 million (48.6%). Most of this increase in numbers (10.4 million of 12.8 million) would occur among adults without cardiovascular disease. Among adults between the ages of 60 and 75 years without cardiovascular disease who are not receiving statin therapy, the percentage who would be eligible for such therapy would increase from 30.4% to 87.4% among men and from 21.2% to 53.6% among women. This effect would be driven largely by an increased number of adults who would be classified solely on the basis of their 10-year risk of a cardiovascular event. Those who would be newly eligible for statin therapy include more men than women and persons with a higher blood pressure but a markedly lower level of low-density lipoprotein cholesterol. As compared with the ATP-III guidelines, the new guidelines would recommend statin therapy for more adults who would be expected to have future cardiovascular events (higher sensitivity) but would also include many adults who would not have future events (lower specificity). CONCLUSIONS: The new ACC-AHA guidelines for the management of cholesterol would increase the number of adults who would be eligible for statin therapy by 12.8 million, with the increase seen mostly among older adults without cardiovascular disease. (Funded by the Duke Clinical Research Institute and others.) Copyright © 2014 Massachusetts Medical Society. All rights reserved.


Patent
University of Angers, French Institute of Health, Medical Research and McGill University | Date: 2016-08-05

The present invention provides a new drug to treat malignant glioma, which is the most prevalent type of primary tumor of the central nervous system (CNS). The present invention indeed shows that the isolated NFL-TBS_(40-63 )peptide is highly specific for glioma cells, in which it triggers apoptosis. It is therefore presented here for use in a method for treating malignant glioma. The present invention further relates to the use of the NFL-TBS_(40-63 )peptide for detecting specifically glioma cells either in vivo, or in vitro, or for addressing chemical compounds to said tumor cells.


Patent
National Research Council Canada and McGill University | Date: 2014-03-27

A technique for separating components of a microfluid, comprises a self-intersecting micro or nano-fluidic channel defining a cyclic path for circulating the fluid over a receiving surface of a fluid component separating member; and equipment for applying coordinated pressure to the channel at a plurality of pressure control areas along the cyclic path to circulate the fluid over the receiving surface, applying a pressure to encourage a desired transmission through the separating member, and a circulating pressure to remove surface obstructions on the separating member. The equipment preferably defines a peristaltic pump. Turbulent microfluidic flow appears to be produced.


Patent
University of Angers, French Institute of Health, Medical Research and McGill University | Date: 2011-06-15

The present invention provides a new drug to treat malignant glioma, which is the most prevalent type of primary tumor of the central nervous system (CNS). The present invention indeed shows that the isolated NFL-TBS_(40-63) peptide is highly specific for glioma cells, in which it triggers apoptosis. It is therefore presented here for use in a method for treating malignant glioma. The present invention further relates to the use of the NFL-TBS_(40-63) peptide for detecting specifically glioma cells either in vivo, or in vitro.


Grant
Agency: Cordis | Branch: FP7 | Program: CPCSA | Phase: INFRA-2011-1.2.1. | Award Amount: 4.31M | Year: 2011

Unprecedented growth in the accessibility of imaging data of persons with brain diseases has led to the development of computational infrastructures offering scientists access to image databases and e-Science services. FP7 neuGRID is the leading e-Infrastructure where neuroscientists can find core services and resources for brain image analysis. neuGRID for Users (N4U) will provide an e-Science environment by further developing and deploying the neuGRID infrastructure to deliver a Virtual Laboratory offering neuroscientists access to a wide range of datasets and algorithm pipelines, access to computational resources, services, and support. The laboratory will be developed for imaging neuroscientists but designed to be adaptable to other user communities. While neuGRID has mainly developed the lower layers of the infrastructure, N4U will concentrate on the upper user-facing levels. N4U will (i) integrate and augment the neuGRID service provision with intuitive and customizable image analysis services and more robust computational resources making use of Grid, Cloud and HPC; (ii) expand the scientific coverage of neuGRID to meet the requirements of new research communities; (iii) design, develop, and deploy user-centred, friendly, and customizable interfaces for the daily use of N4U by end-users (Science Gateway and portal); and (iv) develop a Specific Support Center including active learning, training, support, and education. Captivating applications and dissemination tools to attract students and lay persons will be developed making use of augmented reality technology; syntactic and semantic interoperability with the major related international initiatives will build on Internet2, CAnet and GEANT connectivity; open standard technology will include an API to access Open Cloud Computing Interface; licensing schemes for the future sustainability of N4U will leverage on Open Source Software.


Grant
Agency: Cordis | Branch: FP7 | Program: CP-IP | Phase: HEALTH.2010.1.1-1 | Award Amount: 15.65M | Year: 2010

Given contemporary understanding of the complexity of the causal architecture of common chronic diseases, the next stage of bioclinical scientific progress will depend critically on large-scale pooled analyses of high quality data from many biobanks and bioclinical studies. Such analyses will only be possible if we are able to harmonise and standardise the collection, storage, and management of data and bio-samples across biobanking studies. Recent consortium-based meta-analyses of genome-wide association studies (GWAS) have clearly demonstrated that it is possible to pool and analyse genomic data with broad indicators of disease status. But if health care science is to move quickly towards the exciting goals that have been envisaged for public health, clinical science, and personalised medicine a far greater challenge must now be overcome. That is, the standardization and harmonization of data and key measures of life-style, social circumstances and environment, as well as critical sub-components of the phenotypes associated with common complex diseases. This is the mission of BioSHaRE-EU. BioSHaRE-EU will work hand-in-hand with BBMRI (Biobanking and Bio-molecular Resources Research Infrastructure) and P3G (Public Population Project in Genomics), to build directly on extensive precursor work in the field of harmonisation and standardisation. The project will deliver tools to harmonize phenotypes of complex diseases, as well as lifestyle and environmental factors. In addition, it provides statistical methods and biostatistical tools for meta-analysis of large scale studies. These tools and methods will be developed and implemented in five large partner-biobanks: HUNT, KORA, LifeGene, LifeLines, UK-biobank. BioSHaRE-EU will also implement these in additional disease consortia of clinical biobanks, and other population-based biobanks.


Patent
McGill University and National Research Council Canada | Date: 2012-12-14

There are described herein novel soluble IGF receptor Fc fusion proteins and compositions and methods of use thereof for treating angiogenesis associated disorders and malignant disease, such as cancer and metastasis, wherein the fusion proteins bind specifically to IGF-1 or IGF-2.


Hollywood, Feb. 28, 2017 (GLOBE NEWSWIRE) -- Earth Science Tech, Inc. (OTC PINK: ETST) ("ETST" or "the Company"), an innovative biotech company focused on cannabis (industrial hemp) and cannabinoid research and development, nutraceuticals, pharmaceuticals, and medical devices, and its subsidiary Cannabis Therapeutics Inc. are proud to announce that Dr. Moutih Rafei, PhD, has joined the company’s Advisory Board and that three out of the five distinguished scientists and doctors who were recently nominated to the companies’ Advisory Board will meet on Tuesday, February 28th at Le Centre Québecois d’Innovation en Biotechnologie (CQIB) in Laval, Québec, (http://www.cqib.org). There will be a press availability and photo op. Dr. Chandra Panchal, Dr. Domenico Fuoco, and Dr. Moutih Rafei will meet at the biotech business incubator to review and discuss ETST’s ongoing R&D projects and chart the direction of the company’s research and development initiative for near future. Missing from the gathering will be Dr. Laurent Azoulay and Dr. Calvin Higgins, M.D. who cannot leave their current work at this time. Also in attendance will be Dr. Michel Aubé, PhD, CEO and Chief Scientific Officer of ETST and Cannabis Therapeutics, Inc. At this meeting, the company will also formally launch its R&D partnership with Smart Medicine, Inc. who will provide laboratory and technical services to ETST in their facility at CQIB. ESTS R&D is focused on the development and manufacturing of nutraceutical products, generic drugs, and cannabiniod-based medicine. The company’s goal is to market its new generic drug formulations and to find new applications for those generic drugs. The development of new improved formulations of existing generic drugs will aid in the discovery of treatment for diseases that are not currently treated with those generic drugs. It is commonly known in the pharmacology community that most drugs act on biological targets that differ from those they were designed to treat. Drug repurposing is the name given to the process of finding new uses for existing drugs. Drug repurposing can be a very quick and economical way to bring a new, profitable drug to market. This is an important step for ETST. Existing drugs have been identified as potential ligands for the cannabinoid receptor 2 (CB2), in which ETST has a great deal of interest. Targeting CB2 with an existing drug can open up many new opportunities for the use of these existing generic drugs. This important meeting will set the direction of ETST and Cannabis Therapeutics, Inc. and is of major interest to investors contemplating the coming cannabis investment boom. The meeting will also be the first occasion for Dr. Moutih Rafei, the newest addition to the Advisory Board, to meet with other members. Dr. Moutih Rafei has been an Assistant Professor in the Department of Pharmacology & Physiology of the Université de Montréal since 2013. He completed a PhD in Experimental Medicine at McGill University and his post-doctoral training in Immunobiology at the Université de Montréal. During his training, Dr. Rafei accumulated profound knowledge and insight in the fields of T-cell development and stem cell biology, cancer immunotherapy, and autoimmune diseases. He is also actively involved in the discovery and development of small molecules that may stimulate or inhibit the immune system for the treatment of certain catastrophic illnesses. About Earth Science Tech, Inc. (ETST): Earth Science Tech (www.earthsciencetech.com) is a publicly traded (ETST) unique Science based Biotechnology company focused on cutting edge Nutraceuticals, Bioceuticals, Phytoceuticals and Cosmeceuticals for the Health, Wellness and Alternative Medicine Markets to help improve the quality of life for Consumers Worldwide. ETST is also dedicated to providing Natural Alternatives to prescription medications through the use of its cutting edge Nutritional and Dietary Supplements. This may include products such as its High-Grade Hemp CBD (Cannabidiol) Oil, Vitamins, Minerals, Herbs, Botanicals, Personal Care Products, Homeopathies, Functional Foods and other products. These products may be in various formulations and delivery systems including (but not limited to) capsules, tablets, soft gels, chewables, liquids, creams, sprays, powders, and whole herbs. ETST is focused on researching and developing innovative Hemp extracts and to make them accessible Worldwide. ETST plans to be the premier supplier of the highest quality and purity of High Grade Hemp CBD (Cannabidiol) Oil. ETST's primary goal is to advance different High Quality Hemp extracts with a broad profile of Cannabinoids and additional natural molecules found in Industrial Hemp and to identify their distinct properties. The company is dedicated in offering its consumers the finest and purest quality All Natural-Organic Hemp CBD Oil while never compromising on quality. ETST High Grade Hemp CBD (Cannabidiol) Oil is classified as "food based" and therefore perfectly permissible in all 50 states and more than 40 countries. Cannabinoids (Cannabidiol/CBD) are natural constituents of the Hemp plant and CBD is derived from Hemp stalk and seed. Hemp oil is a well-known dietary supplement and the naturally occurring CBD possesses no psychoactive qualities and presents a continuing stream of overwhelming evidence of significant Wellness benefits. With no psychoactive ingredient, Hemp CBD Oil is a ready-for-market Hemp-based Nutraceutical. The United States Food and Drug Administration (FDA) currently considers non-THC hemp based cannabinoids, including CBD, to be "food based" and therefore saleable. These new non-psychoactive CBD-rich hemp oil products that ETST has geared up to market and distribute are beyond reproach. CBD (cannabidiol), a naturally occurring constituent of the Industrial Hemp plant, promotes and supports the nutritional health of aging bodies in particular. Source: US Government Patent #6,630,507 "Cannabinoids as antioxidants and neuroprotectants." ETST does not grow, sell or distribute any substances that violate United States Law or the controlled substance act. ETST does sell and distribute cannabis industrial hemp based products. About Cannabis Therapeutics: Cannabis Therapeutics, Inc. is a wholly owned subsidiary of Earth Science Tech, Inc (ETST). Cannabis Therapeutics, Inc. was formed as an emerging biotechnology company poised to become a world leader in cannabinoid research and development for a broad line of cannabis cannabinoid-based pharmaceuticals, nutraceuticals as well as other products & solutions. Cannabis Therapeutics mission it to help change the healthcare landscape by introducing their proprietary cannabis-cannabinoid based products made for both the pharmaceutical and retail consumer markets worldwide. The company is currently working on finishing the launch of its new corporate website at www.Cannabisthera.com  FOOD AND DRUG ADMINISTRATION (FDA) DISCLOSURE: These statements and products have not been evaluated by the FDA and are not intended to diagnose, treat or cure any disease. Always check with your physician before starting a new dietary supplement program. The FDA has not evaluated the validity or truthfulness of these claims; therefore, we encourage you to review published researches relating to the benefits and properties of CBD hemp oils and other CBD products. SAFE HARBOR ACT: Forward-Looking Statements are included within the meaning of Section 27A of the Securities Act of 1933, and Section 21E of the Securities Exchange Act of 1934, as amended. All statements regarding our expected future financial position, results of operations, cash flows, financing plans, business strategy, products and services, competitive positions, growth opportunities, plans and objectives of management for future operations, including words such as "anticipate," "if," "believe," "plan," "estimate," "expect," "intend," "may," "could," "should," "will," and other similar expressions are forward-looking statements and involve risks, uncertainties and contingencies, many of which are beyond our control, which may cause actual results, performance, or achievements to differ materially from anticipated results, performance, or achievements. We are under no obligation to (and expressly disclaim any such obligation to) update or alter our forward-looking statements, whether as a result of new information, future events or otherwise.


Glass L.,McGill University | Siegelmann H.T.,University of Massachusetts Amherst
Current Opinion in Genetics and Development | Year: 2010

Logical models provide insight about key control elements of biological networks. Based solely on the logical structure, we can determine state transition diagrams that give the allowed possible transitions in a coarse grained phase space. Attracting pathways and stable nodes in the state transition diagram correspond to robust attractors that would be found in several different types of dynamical systems that have the same logical structure. Attracting nodes in the state transition diagram correspond to stable steady states. Furthermore, the sequence of logical states appearing in biological networks with robust attracting pathways would be expected to appear also in Boolean networks, asynchronous switching networks, and differential equations having the same underlying structure. This provides a basis for investigating naturally occurring and synthetic systems, both to predict the dynamics if the structure is known, and to determine the structure if the transitions are known. © 2010 Elsevier Ltd.


Grodzinsky Y.,McGill University | Grodzinsky Y.,Hebrew University of Jerusalem | Nelken I.,Hebrew University of Jerusalem
Science | Year: 2014

How does a certain pattern of vibration in the air reliably represent a meaningful speech sound?


Huang X.,Princeton University | Cumming A.,McGill University
Astrophysical Journal | Year: 2012

We present models of ohmic heating in the interiors of hot Jupiters in which we decouple the interior and the wind zone by replacing the wind zone with a boundary temperature Tiso and magnetic field Bφ0. Ohmic heating influences the contraction of gas giants in two ways: by direct heating within the convection zone and by heating outside the convection zone, which increases the effective insulation of the interior. We calculate these effects and show that internal ohmic heating is only able to slow the contraction rate of a cooling gas giant once the planet reaches a critical value of internal entropy. We determine the age of the gas giant when ohmic heating becomes important as a function of mass, Tiso, and induced B φ0. With this survey of parameter space complete, we then adopt the wind zone scalings of Menou and calculate the expected evolution of gas giants with different levels of irradiation. We find that, with this prescription of magnetic drag, it is difficult to inflate massive planets or those with strong irradiation using ohmic heating, meaning that we are unable to account for many of the observed hot Jupiter radii. This is in contrast to previous evolutionary models that assumed that a constant fraction of the irradiation is transformed into ohmic power. © 2012. The American Astronomical Society. All rights reserved..


Mueller N.D.,University of Minnesota | Gerber J.S.,University of Minnesota | Johnston M.,University of Minnesota | Ray D.K.,University of Minnesota | And 2 more authors.
Nature | Year: 2012

In the coming decades, a crucial challenge for humanity will be meeting future food demands without undermining further the integrity of the Earth's environmental systems. Agricultural systems are already major forces of global environmental degradation, but population growth and increasing consumption of calorie-and meat-intensive diets are expected to roughly double human food demand by 2050 (ref. 3). Responding to these pressures, there is increasing focus on 'sustainable intensification' as a means to increase yields on underperforming landscapes while simultaneously decreasing the environmental impacts of agricultural systems. However, it is unclear what such efforts might entail for the future of global agricultural landscapes. Here we present a global-scale assessment of intensification prospects from closing 'yield gaps' (differences between observed yields and those attainable in a given region), the spatial patterns of agricultural management practices and yield limitation, and the management changes that may be necessary to achieve increased yields. We find that global yield variability is heavily controlled by fertilizer use, irrigation and climate. Large production increases (45% to 70% for most crops) are possible from closing yield gaps to 100% of attainable yields, and the changes to management practices that are needed to close yield gaps vary considerably by region and current intensity. Furthermore, we find that there are large opportunities to reduce the environmental impact of agriculture by eliminating nutrient overuse, while still allowing an approximately 30% increase in production of major cereals (maize, wheat and rice). Meeting the food security and sustainability challenges of the coming decades is possible, but will require considerable changes in nutrient and water management. © 2012 Macmillan Publishers Limited. All rights reserved.


Seufert V.,McGill University | Ramankutty N.,McGill University | Foley J.A.,University of Minnesota
Nature | Year: 2012

Numerous reports have emphasized the need for major changes in the global food system: agriculture must meet the twin challenge of feeding a growing population, with rising demand for meat and high-calorie diets, while simultaneously minimizing its global environmental impacts. Organic farming-a system aimed at producing food with minimal harm to ecosystems, animals or humans-is often proposed as a solution. However, critics argue that organic agriculture may have lower yields and would therefore need more land to produce the same amount of food as conventional farms, resulting in more widespread deforestation and biodiversity loss, and thus undermining the environmental benefits of organic practices. Here we use a comprehensive meta-analysis to examine the relative yield performance of organic and conventional farming systems globally. Our analysis of available data shows that, overall, organic yields are typically lower than conventional yields. But these yield differences are highly contextual, depending on system and site characteristics, and range from 5% lower organic yields (rain-fed legumes and perennials on weak-acidic to weak-alkaline soils), 13% lower yields (when best organic practices are used), to 34% lower yields (when the conventional and organic systems are most comparable). Under certain conditions-that is, with good management practices, particular crop types and growing conditions-organic systems can thus nearly match conventional yields, whereas under others it at present cannot. To establish organic agriculture as an important tool in sustainable food production, the factors limiting organic yields need to be more fully understood, alongside assessments of the many social, environmental and economic benefits of organic farming systems. © 2012 Macmillan Publishers Limited. All rights reserved.


Doane T.L.,Case Western Reserve University | Chuang C.-H.,Case Western Reserve University | Hill R.J.,McGill University | Burda C.,Case Western Reserve University
Accounts of Chemical Research | Year: 2012

Figure Persented: For over half a century, alternating electric fields have been used to induce particle transport, furnishing the ζ-potential of analytes with sizes ranging from a few nanometers to several micrometers. Concurrent advances in nanotechnology have provided new materials for catalysis, self-assembly, and biomedical applications, all of which benefit from a thorough understanding of particle surface charge.Therefore, the measurement of the ζ-potential via electrophoretic light scattering (ELS) has become essential for nanoparticle (NP) research. However, the interpretation of NP electrophoretic mobility, especially that of ligand-coated NPs, can be a complex undertaking. Despite the inherent intricacy of these data, key concepts from colloidal science can help to distill valuable information from ELS.In this Account, we adopt PEGylated Au NPs as an illustrative example to explore extensions of the classical theories of Smoluchowski, Hückel, and Henry to more contemporary theories for ligand-coated NP systems such as those from Ohshima, and Hill, Saville, and Russel. First, we review the basic experimental considerations necessary to understand NP electrophoretic mobility, identifying when O'Brien and White's numerical solution of the standard electrokinetic model should be adopted over Henry's closed-form analytical approximation. Next, we explore recent developments in the theory of ligand-coated particle electrophoresis, and how one can furnish accurate and meaningful relationships between measured NP mobility, ζ-potential, and surface charge. By identifying key ligand-coated NP parameters (e.g., coating thickness, permeability, molecular mass, and hydrodynamic segment size), we present a systematic method for quantitatively interpreting NP electrophoretic mobility.In addition to reviewing theoretical foundations, we describe our recent results that examine how the unique surface curvature of NPs alters and controls their properties. These data provide guidelines that can expedite the rational design of NPs for advanced uses, such as heterogeneous catalysis and in vivo drug delivery. As a practical demonstration of these concepts, we apply the ligand-coated theory to a recently developed noncovalent PEGylated Au NP drug-delivery system. Our analysis suggests that anion adsorption on the Au NP core may enhance the stability of these NP-drug conjugates in solution.In addition to providing useful nanochemistry insights, the information in this Account will be useful to biomedical and materials engineers, who use ELS and ζ-potentials for understanding NP dynamics. © 2011 American Chemical Society.


Cline J.M.,McGill University | Frey A.R.,University of Winnipeg
Physical Review D - Particles, Fields, Gravitation and Cosmology | Year: 2014

Tentative evidence of a 3.5 keV x-ray line has been found in the stacked spectra of galaxy clusters, individual clusters, the Andromeda galaxy and the Galactic center, leading to speculation that it could be due to decays of metastable dark matter such as sterile neutrinos. However, searches for the line in other systems such as dwarf satellites of the Milky Way have given negative or ambiguous results. We reanalyze both the positive and negative searches from the point of view that the line is due to inelastic scattering of dark matter to an excited state that subsequently decays - the mechanism of excited dark matter (XDM). Unlike the metastable dark matter scenario, XDM gives a stronger signal in systems with higher velocity dispersions, such as galaxy clusters. We show that the predictions of XDM can be consistent with null searches from dwarf satellites, while the signal from the closest individual galaxies can be detectable having a flux consistent with that from clusters. We discuss the impact of our new fits to the data for two specific realizations of XDM. © 2014 American Physical Society.


Reisner W.,McGill University | Pedersen J.N.,Technical University of Denmark | Pedersen J.N.,Princeton University | Austin R.H.,Princeton University
Reports on Progress in Physics | Year: 2012

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement - including the effect of varying ionic strength - and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1nm to 100m range. © 2012 IOP Publishing Ltd.


Cline J.M.,McGill University | Frey A.R.,University of Winnipeg
Physics Letters, Section B: Nuclear, Elementary Particle and High-Energy Physics | Year: 2012

Hints of direct dark matter detection coming from the DAMA, CoGeNT experiments point toward light dark matter with isospin-violating and possibly inelastic couplings. However an array of astrophysical constraints are rapidly closing the window on light dark matter. We point out that if the relic density is determined by annihilation into invisible states, these constraints can be evaded. As an example we present a model of quasi-Dirac dark matter, interacting via two U(1) gauge bosons, one of which couples to baryon number and the other which kinetically mixes with the photon. Annihilation is primarily into "dark neutrinos" that do not mix with the SM, but which could provide an extra component of dark radiation. The model could soon be tested by several experiments searching for such light gauge bosons, and we predict that both could be detected. The model also requires a fourth generation of quarks, whose existence might increase the production cross section of Higgs bosons at the Tevatron and LHC. © 2011 Elsevier B.V.


Dunn-Sigouin E.,McGill University | Son S.-W.,Seoul National University
Journal of Geophysical Research: Atmospheres | Year: 2013

Northern Hemisphere (NH) blocking climatology is examined using a subset of climate models participating in the Coupled Model Intercomparison Project phase 5 (CMIP5). Both historical and Representative Concentration Pathway (RCP) 8.5 integrations are analyzed to evaluate the performance of the CMIP5 models and to identify possible changes in NH blocking frequency and duration in a warmer climate. Comparison with reanalysis data reveals that CMIP5 models can reproduce the NH blocking climatology reasonably well, although the frequency of Euro-Atlantic blockings, particularly those with relatively short duration, is significantly underestimated during the cold season. In most models, overestimation of the Pacific blocking frequency is also evident for all durations throughout the year. In comparison to historical integrations, RCP 8.5 integrations show significant decreases in blocking frequency over both the North Pacific and north Atlantic regions, with a hint of increasing blocking frequency over western Russia. However, there is no noticeable change in the duration of individual blocking events for all durations. Key PointsCMIP5 models underestimate Euro-Atlantic blocking frequencyCMIP5 models overestimate North Pacific blocking frequencyBoth Atlantic and Pacific blocking frequencies would decrease in a warm climate ©2013. American Geophysical Union. All Rights Reserved.


Kurylyk B.L.,University of New Brunswick | MacQuarrie K.T.B.,University of New Brunswick | McKenzie J.M.,McGill University
Earth-Science Reviews | Year: 2014

Climate change is expected to increase regional and global air temperatures and significantly alter precipitation regimes. These projected changes in meteorological conditions will likely influence subsurface thermal regimes. Increases in groundwater and soil temperatures could impact groundwater quality, harm groundwater-sourced ecosystems, and contribute to the geotechnical failure of critical infrastructure. Furthermore, permafrost thaw induced by rising subsurface temperatures will likely alter surface and subsurface hydrology in high altitude and/or latitude regions and exacerbate the rate of anthropogenic climate change by releasing stored carbon into the atmosphere.This contribution discusses the theory and development of subsurface heat transport equations for cold and temperate regions. Analytical solutions to transient forms of the conduction equation and the conduction-advection equation with and without freezing are detailed. In addition, recently developed groundwater flow and heat transport models that can accommodate freezing and thawing processes are briefly summarized. These models can be applied to simulate climate change-induced permafrost degradation and dormant aquifer activation in cold regions.Several previous reviews have focused on the impact of climate change on subsurface hydraulic regimes and groundwater resources, but this is the first synthesis of studies considering the influence of future climate change on subsurface thermal regimes in cold and temperate regions. The current gaps in this body of knowledge are highlighted, and recommendations are made for improving future studies by linking atmospheric global climate models to subsurface heat transport models that consider heat advection via groundwater flow. © 2014 Elsevier B.V.


Grant
Agency: Cordis | Branch: FP7 | Program: ERC-AG | Phase: ERC-AG-SH2 | Award Amount: 2.50M | Year: 2012

A well-functioning democracy implies that political actors are aware of the real problems in society, their potential solutions, and the associated preferences of citizens. This requires information about the real world. This project examines how individual political actors process information coming out of society. Its goal is to lay bare the patterns whereby exposure to certain types of information regarding problems lead to specific forms of attention to that information triggering particular kinds of action by political actors. For the first time, this project tackles the information-processing of political actors in a direct, encompassing and comparative manner. Drawing on previous work on agenda-setting, on bounded rationality and on representation the project first develops a theory of individual political actors dealing with information. Information-processing depends on properties of the source of information, of the message itself, and of the receiver of the information. Laying bare the information streams and information-processing of political actors is complex. The study assesses the behavior of political actors in three countries (Belgium, Canada and Israel) and across actors different institutional positions (MPs, ministers, party leaders). I expect to find differences between institutional position of actors and between nations. In fact, the countries under study have very different political systems which should lead to a different information-processing behavior of elites. The heart of the empirical part of the project is an in-depth, almost ethnographic study of the information-processing of fifty politicians in each country. These actors are observed relying on (a) time-budgeting, (b) participatory observation, and (c) interviews. Apart from this sample of fifty actors, the entire population (or a large sample) of political actors will be scrutinized using (d) surveys, (e) experiments, and (f) behavioral records.


Gallouzi I.E.,McGill University | Wilusz J.,Colorado State University
EMBO Journal | Year: 2013

Regulated degradation plays a major role in determining the levels of both non-coding (miRNA) and coding (mRNA) transcripts. Thus, insights into the factors and pathways that influence this process have broad, interdisciplinary implications. New findings by Malecki et al (2013), Lubas et al (2013), and Chang et al (2013) identify the protein Dis3L2 as a major player in the 30-50 exonucleolytic decay of transcripts. Furthermore, they demonstrate a strong connection between terminal uridylation of the RNA substrate and enzymatic activity. © 2013 European Molecular Biology Organization.


News Article | February 27, 2017
Site: www.eurekalert.org

It is 2012 and Smiley, a young woman in her early 20s, lives in a single room occupancy (SRO) building in Vancouver. She wants to hang out with her friends in her room, where she feels safe, but the SRO only allows one visitor at a time. "I don't like it. It's their rules. It's really annoying," Smiley said. "It sucks, because I'm not a crackhead or a junkie. They shouldn't put me in places like that." Smiley has been diagnosed with psychosis, a mental disorder where people show signs of delusions and hallucinations. She's one of 17 young people between the ages of 18 to 24 in Metro Vancouver recruited for a study at the University of British Columbia. All participants have experienced symptoms of psychosis in the past three years. "Our study provides a window into what young people think about the mental health services they receive and what they feel helps and hinders their well-being," said lead author Shalini Lal, an assistant professor at the University of Montreal's school of rehabilitation and a researcher at the University of Montreal's Hospital Research Centre (CRCHUM). Lal conducted the study as part of her PhD work at UBC's faculty of medicine within the graduate programs of rehabilitation sciences. Through interview excerpts with the youth from November 2010 to March 2012, the study highlights the impacts of mental health services on these young people, including their interactions with psychiatrists, case managers, social workers and supports for housing, recreation, and employment. "Eliciting young people's feedback will lead to better planning and coordination of services that they will find engaging, meaningful and effective," said Lal. The study identifies many different types of supports the youth found helpful, including group therapy and positive interactions with peers and peer support workers. "The groups were very helpful for getting me to acknowledge that I actually had an illness," said Kevin, one of the youth. "(The peer support worker) explained that with the right combination of medications or professional help, you could actually treat the symptoms and live a normal life... a good role model to see that you could recover from it," said Jake, another youth involved in the study. Other types of support the youth identified as helpful were accompaniment to appointments, providing help in completing employment assistance forms and facilitating the process of returning to school. Youth also appreciated emotional support like signs of genuine kindness, hope and encouragement from service providers. "Even small gestures were seen as helpful, ones we may take for granted, like a care manager shaking their hand when they walked in the door," said Lal. "That gesture of respect has a lot of meaning for someone stigmatized by mental illness." When it came to hindrances, some youth felt pigeonholed by their mental illness, being offered services that didn't reflect an identity outside their disorder. A young man named Nelson, who had acting aspirations, told Lal about his disappointment when his job counselor connected him to a theatre company dedicated to "people affected by mental illness." "The most annoying thing is that everything is for mental health reasons and I just don't want this," he said. "If it's a film thing, I don't want it to be just for mentally ill, and just to address stuff like that. I want it to be, just normal." Darren, a 20-year-old living in a downtown youth shelter, didn't own a cellphone and could not receive calls directly from the shelter. His sense of independence and social life were negatively impacted by the shelter's rules of no Facebook access, which was his main way of staying in touch with friends and family. Lal said in some cases the youth also interacted with outreach workers online, which proved useful to providing support to people who would not otherwise receive it any other way. Some youth felt "ghettoized" by their housing situation, only being able to access SROs that housed many others living with mental health and substance abuse issues. Philip, a young man struggling with substance abuse in addition to his psychosis, said living in such an environment threatened his sobriety. "Every time you walk down the street you see someone on a crack pipe, a crystal meth pipe, a pot pipe or drinking alcohol every block you walk here," he said. "And it's nothing but trigger after trigger here, so it's not the right environment for people trying to stay sober. Just being around these kinds of people, it's not the right place for me." The last hindrance was how impersonal the youth felt some of their encounters could be with different support workers, including doctors or therapists. "It was always kind of detached, and I always felt like we were on the clock and not really supported to talk about things like that [relationships]... It just wasn't an environment where I felt comfortable with it," said Kevin. Lal said she has seen more funding and attention being paid to the mental health needs of young people in Canada, especially over the past five years. Lal also said more effort is needed in using tools and resources that cater to youth, including the use of technology to provide support. As well, different sectors of the community, including housing, employment and mental health, need to work more closely together, so people don't feel bounced around. "People often think that it's up to individuals alone to overcome adversity, to deal with a mental illness," Lal said. "For young people, their resiliency largely depends on their ability to navigate and negotiate towards resources, which are all too often substandard, inconsistent or not tailored to their needs." "We learned from this study that when services do match young people's needs and preferences, they can really make a positive impact on their well-being." The study, Impact of Mental Health Services on Resilience in Youth with First Episode Psychosis: A Qualitative Study, was published in print this year in Administration and Policy in Mental Health and Mental Health Services Research. Lal's co-authors are Michael Ungar at Dalhousie University, Ashok Malla at McGill University and Carl Leggo and Melinda Suto at UBC. The 17 youth involved in the study had an average age of 22 and 71 per cent were male. The youth were white, First Nations, Asian and Latin American. Seven of the youth had less than a high school education, five had completed high school, four had some university-level education, and one had completed a bachelor's degree. Names in this study were changed to protect the youths' identities and were chosen by the youth themselves. They are not available for interviews.


News Article | February 6, 2017
Site: www.techtimes.com

Antarctica's ice sheet is the largest single mass of ice on the planet covering an area of almost 14 million square kilometers. It contains 30 million cubic kilometers of ice. The ice sheet contains about 90 percent of fresh water on Earth's surface. Scientists already know a great deal about Antarctica but much about the oldest, coldest, driest and windiest continent in the world remains unknown particularly how it formed so rapidly about 34 million years ago. Two competing theories attempt to explain how the continent was formed. The first theory lies on the idea of a global climate change. The level of atmospheric carbon dioxide dropped steadily since the start of the Cenozoic Era 66 million years ago, and once the gas dropped below a critical threshold, the cooler temperatures allowed the formation of Antarctica's ice sheets. The second theory, which is about the dramatic changes in ocean circulation patterns, posits that when the Drake Passage that lies between Antarctica and the southern tip of South America deepened dramatically, the phenomenon set off a complete reorganization of the ocean circulation. The theory suggests that the increased separation of South America and the Antarctic land mass helped create the powerful Antarctic Circumpolar Current that served as a sort of water barrier which prevented the warmer waters from the Central Pacific and North Atlantic from going toward the Antarctic land mass. The isolation of Antarctica and the lowered temperature helped in the formation of ice sheets. Now, a new study links these two theories. In the new paper published in Nature Geoscience, researchers argued that the changes in the Drake Passage led to a sort of domino effect. The warmer waters were initially pushed north which resulted in more rainfall about 35 million years ago since a warmer atmosphere can contain more moisture compared with a cooler one. All the excess rain resulted in lowered carbon dioxide levels in the atmosphere which can be attributed to increased plant and tree growth, further made possible by a process known as silicate weathering, where carbon dioxide is trapped inside newly formed limestone. The levels of carbon dioxide eventually dropped low enough to allow the rapid formation of ice sheets in Antarctica. "We suggest that this mechanism illustrates another way in which ocean-atmosphere climate dynamics can introduce nonlinear threshold behaviour through interaction with the geologic carbon cycle," wrote study researcher Galen Halverson, from McGill University's Dept. of Earth and Planetary Sciences, and colleagues in a study published online on Jan. 30. The researchers think that they are the first to consider combining the two theories since the time scales of the ideas are vastly different. The changes in the ocean circulation occurred over a period of thousand years while global silicate weathering occurred over hundreds of thousands of years. Scientists have been monitoring the Antarctic ice sheet as the melting ice can serve as indicator of a warming world. Late last year, scientists reported finding a lake of freshwater underneath the Roi Baudouin ice shelf in East Antarctica, which hints that climate change has impacted the region. The phenomenon raised concern about the broken masses of ice melting more easily in the sea. © 2017 Tech Times, All rights reserved. Do not reproduce without permission.

Loading McGill University collaborators
Loading McGill University collaborators