Jackson, CA, United States
Jackson, CA, United States

Time filter

Source Type

Animal experiments were performed according to procedures approved by the Institutional Animal Care and Use Committee of the Beth Israel Deaconess Medical Center. Unless otherwise stated, mice used were male C57BL/6J (8–12 weeks of age; Jackson Laboratories), and housed in a temperature-controlled (20–22 °C) room on a 12 h light/dark cycle. All compounds administered to mice in vivo were injected at the stated dose i.p. 10 min before subsequent interventions unless otherwise stated. Body temperature and cold exposure experiments were assessed using a mouse rectal probe (World Precision Instruments). When studying acute activation of thermogenesis, mice were housed from birth at 20–22 °C to allow for recruitment of thermogenic adipose tissue7. Before individual housing at 4 °C, mice were placed at thermoneutrality (30 °C) for 3 days which allows both for maintenance BAT UCP1 protein content31 and for measurement of acute induction of BAT thermogenesis upon cold exposure. Upon exposure to 4 °C, temperature was measured every 30 min. When studying body temperature after 4 °C acclimation, WT and Ucp1−/− mice (equal numbers of male and female mice in each group) were acclimated using established protocols: mice were individually housed for 1 week at 15 °C, 1 week at 10 °C, and 24 h at 4 °C before the experiment. Mice were individually restrained to limit non-shivering muscle activity and two EMG needle electrodes were inserted subcutaneously above the nuchal muscles in the back of the neck. EMG leads were connected to a computerized data acquisition system via a communicator. EMG was recorded at thermoneutrality to determine non-shivering basal nuchal muscle activity, before placement of mice at 4 °C. EMG data were collected and burst activity was determined as described previously32. Briefly, EMG data were collected from the implanted electrodes at a sampling rate of 2 kHz using LabChart 8 Pro Software (ADInstruments). The raw signal was converted to root mean square activity. Root mean square activity was analysed for shivering bursts in 10 s windows. Whole-body energy metabolism was evaluated using a Comprehensive Lab Animal Monitoring System (CLAMS, Columbia Instruments). For 6 h measurements, mice were acclimated in the metabolic chambers for 48 h before experiments to minimize stress from the housing change. CO and O levels were collected every 12 or 32 min for each mouse over the period of the experiment. For acute measurements, CO and O levels were collected every 10 s. CL 316,243 (Sigma-Aldrich; 1 mg kg−1) was injected i.p. into mice at the indicated times. Aconitase activity was measured as described previously33. In brief, after the relevant in vivo intervention mouse BAT was rapidly excised and homogenized in mitochondrial isolation buffer (250 mM sucrose, 2 mM EDTA, 10 mM sodium citrate, 0.6 mM MnCl , 100 mM Tris-HCl, pH 7.4) followed by mitochondrial isolation by differential centrifugation. Samples (1–2 mg mitochondrial protein) were added to a 96-well plate and 190 ml assay buffer (50 mM Tris-HCl (pH 7.4), 0.6 mM MnCl , 5 mM sodium citrate, 0.2 mM NADP+, 0.1% (v/v) Triton X-100, 0.4 U ml−1 ICDH). Absorbance was measured at 340 nm for 7 min at 37 °C. To control for mitochondrial content aconitase activity was normalized to citrate synthase activity34 and expressed the result as a percentage of control levels. Lipid hydroperoxide content in mouse BAT was estimated by rapid snap freezing of BAT tissue followed by lipid extraction and assessment using a modified ferric thiocyanate assay (Cayman Chemical Lipid Hyroperoxide Assay Kit) according to the manufacturer’s instructions. Cysteine redox status of Prx3 and UCP1 was measured as described previously16, 35. After the relevant in vivo intervention, mouse BAT was rapidly excised and homogenized in 100 mM NEM, 1 mM EGTA, 50 mM Tris-HCl, pH 7.4. Samples were incubated at 37 °C for 5 min before the addition of SDS (2% final) and further incubation at 37 °C for 10 min. Incubations at 37 °C proceeded in a thermomixer at 1,300 r.p.m. Samples were then precipitated in five volumes of ice-cold acetone to remove excess NEM before resuspension in 1 mM EGTA, 2% SDS, 10 mM TCEP, 50 mM Tris-HCl, pH 7.4 containing a polyelthylene glycol polymer conjugated to maleimide (50 mM PEG-Mal). Resuspended samples were incubated for 30 min at 37 °C before a second acetone precipitation to remove excess PEG-Mal before sample resuspension and immunoblot detection by standard methods described below. For UCP1 experiments, to ensure gel shift signals were specific to reversible cysteine oxidation, oxidized samples were separately treated with TCEP before differential labelling as described above. Calibrating the number of UCP1 cysteines oxidized was achieved by treating TCEP-reduced samples with increasing proportions of Peg-Mal:NEM to generate a cysteine-dependent ladder35. In addition, to ensure higher molecular mass signals were specific to UCP1, UCP1 antibody specificity was tested in BAT. It should be noted that while the UCP1 antibody used here is highly specific for UCP1 in BAT (Extended Data Fig. 4c), the same antibody applied to cultured brown adipocyte samples can generate non-specific signals at molecular mass >35 kDa. So, the UCP1 gel shift assay as described here is only compatible with in vivo tissue experiments. Reduced and oxidized glutathione were profiled in negative ionization mode by liquid chromatography tandem mass spectrometry (LC–MS) methods as described previously36. Data were acquired using an ACQUITY UPLC (Waters) coupled to a 5500 QTRAP triple quadrupole mass spectrometer (AB SCIEX). Tissue homogenates (30 μl) were extracted using 120 μl of 80% methanol containing 0.05 ng μl−1 inosine-15N , 0.05 ng μl−1 thymine-d , and 0.1 ng μl−1 glycocholate-d as internal standards (Cambridge Isotope Laboratories). The samples were centrifuged (10 min, 9,000g, 4 °C) and the supernatants (10 μl) were injected directly onto a 150 mm × 2.0 mm Luna NH2 column (Phenomenex). The column was eluted at a flow rate of 400 μl min−1 with initial conditions of 10% mobile phase A (20 mM ammonium acetate and 20 mM ammonium hydroxide (Sigma-Aldrich) in water (VWR)) and 90% mobile phase B (10 mM ammonium hydroxide in 75:25 v/v acetonitrile/methanol (VWR)) followed by a 10 min linear gradient to 100% mobile phase A. The ion spray voltage was −4.5 kV and the source temperature was 500 °C. Raw data were processed using MultiQuant 2.1 software (AB SCIEX) for automated peak integration. LC–MS data were processed and visually inspected using TraceFinder 3.1 software (Thermo Fisher Scientific). After the relevant in vivo intervention, mouse BAT was rapidly excised and homogenized in 20% (w/v) TCA to stabilize thiols. The homogenate was incubated on ice for 30 min and then pelleted for 30 min at 16,000g at 4 °C. The pellet was washed with 10% and 5% (w/v) TCA and then resuspended in 80 μl denaturing alkylating buffer (DAB; 6 M urea, 2% (w/v) SDS, 200 mM Tris-HCl, 10 mM EDTA, 100 μM DTPA, 10 μM neocuproine). The contents of one vial of iodoTMT reagent (Thermo Scientific) was added to each of three biological replicate samples to label reduced cysteine residues at 37 °C and 1,300 r.p.m. for 1 h. Sample protein was precipitated with five volumes of ice-cold acetone, incubated at −20 °C for 2 h, and pelleted at 4 °C and 16,000g for 30 min. The amount of protein to be processed was optimized to ensure saturation of thiol labelling by the iodoTMT reagent as per the manufacturer’s instructions. The pellet was washed twice with ice-cold acetone and then re-solubilized in 80 μl DAB containing 1 mM tris(2- carboxyethyl)phosphine (TCEP), reducing previously reversibly oxidised cysteine residues in the presence of a second, distinct iodoTMT reagent. Proteins were incubated at 37 °C and 1,400 r.p.m. for 1 h, precipitated and resuspended for protease digestion. After digestion, iodoTMT-labelled cysteine-containing peptides were enriched using the anti-TMT resin as per the manufacturer’s instructions. Proteins with cysteine thiols exhibiting differential redox status (defined as >10% shift in cysteine oxidation status upon cold exposure) were assessed for Gene Ontology (GO) term enrichment37. The total identified population of cysteine thiol containing proteins was used as the reference background. Enriched GO terms were filtered after benjamini-hochberg correction at an adjusted P value <0.1. All data analysis used R (R Core Team, Vienna, Austria, http://www.R-project.org). Tissue or cellular samples were prepared adapting a protocol used previously to stabilize endogenous protein sulfenic acids38. Briefly, samples were homogenized in 50 mM Tris base, containing 100 mM NaCl, 100 μM DTPA, 0.1% SDS, 0.5% sodium deoxycholate, 0.5% Triton-X 100, 5 mM dimedone. To minimize lysis-dependent oxidation, buffers were bubbled with argon before use. Samples were incubated for 15 min at room temperature, at which point SDS was added to a final concentration of 1% and samples were incubated for a further 15 min. After dimedone treatment, 10 mM TCEP and 50 mM NEM were added and samples were incubated for a further 15 min at 37 °C to reduce and alkylate all non-sulfenic acid protein cysteine residues. Protein sulfenic acids were then assessed by immunoblotting against dimedone (1:1,000 antibody dilution). After dimedone and NEM labelling of samples as described above, samples were resolved by SDS–PAGE and bands in the UCP1 containing region of the gel (30–35 kDa) were excised, destained with acetonitrile and subjected to dehydration by a speed vacuum concentrator. Gel bands were rehydrated with digestion buffer (75 μl of 50 mM HEPES and 500 ng of trypsin (Promega) and subjected to 12 h of digestion at 37 °C. Peptides were extracted and labelled with TMT 10 reagents (Thermo Fisher) as previously described39. Protein pellets were dried and resuspended in 8 M urea containing 50 mM HEPES (pH 8.5). Protein concentrations were measured by BCA assay (Thermo Scientific) before protease digestion. Protein lysates were diluted to 4 M urea and digested with LysC (Wako, Japan) in a 1/100 enzyme/protein ratio overnight. Protein extracts were diluted further to a 1.0 M urea concentration, and trypsin (Promega) was added to a final 1/200 enzyme/protein ratio for 6 h at 37 °C. Digests were acidified with 20 μl of 20% formic acid (FA) to a pH ~2, and subjected to C18 solid-phase extraction (Sep-Pak, Waters). All spectra were acquired using an Orbitrap Fusion mass spectrometer (Thermo Fisher) in line with an Easy-nLC 1000 (Thermo Fisher Scientific) ultra-high pressure liquid chromatography pump. Peptides were separated onto a 100 μM inner diameter column containing 1 cm of Magic C4 resin (5 μm, 100 Å, Michrom Bioresources) followed by 30 cm of Sepax Technologies GP-C18 resin (1.8 μm, 120 Å) with a gradient consisting of 9–30% (ACN, 0.125% FA) over 180 min at ~250 nl min−1. For all LC–MS/MS experiments, the mass spectrometer was operated in the data-dependent mode. We collected MS1 spectra at a resolution of 120,000, with an AGC target of 150,000 and a maximum injection time of 100 ms. The ten most intense ions were selected for MS2 (excluding 1 Z-ions). MS1 precursor ions were excluded using a dynamic window (75 s ± 10 ppm). The MS2 precursors were isolated with a quadrupole mass filter set to a width of 0.5Th. For the MS3 based TMT quantitation, MS2 spectra were collected at an AGC of 4,000, maximum injection time of 150 ms, and CID collision energy of 35%. MS3 spectra were acquired with the same Orbitrap parameters as the MS2 method except HCD collision energy was increased to 55%. Synchronous-precursor-selection was enabled to include up to six MS2 fragment ions for the MS3 spectrum. A compilation of in-house software was used to convert .raw files to mzXML format, as well as to adjust monoisotopic m/z measurements and erroneous peptide charge state assignments. Assignment of MS2 spectra was performed using the SEQUEST algorithm40. All experiments used the Mouse UniProt database (downloaded 10 April 2014) where reversed protein sequences and known contaminants such as human keratins were appended. SEQUEST searches were performed using a 20 ppm precursor ion tolerance, while requiring each peptide’s amino/carboxy (N/C) terminus to have trypsin protease specificity and allowing up to two missed cleavages. IodoTMT tags on cysteine residues residues (+329.226595 Da) was set as static modifications, while methionine oxidation (+15.99492 Da) was set as variable modifications. For targeted assessment of UCP1 cysteine sulfenylation, TMT tags on lysine residues and peptide N termini (+229.16293 Da), NEM on cysteine residues (+125.047679 Da) were set as static modifications and oxidation of methionine residues (+15.99492 Da) and dimedone on cysteine residues (+13.020401 Da versus NEM) as variable modifications. Determination of sulfenylation status of the Cys253 peptide was determined by comparing TMT reporter ion abundance of the dimedone-alkylated and NEM-alkylated peptides as a proportion of total precursor ion intensity. An MS2 spectra assignment false discovery rate of less than 1% was achieved by applying the target-decoy database search strategy41. Protein filtering was performed using an in-house linear discrimination analysis algorithm to create one combined filter parameter from the following peptide ion and MS2 spectra metrics: XCorr, ΔCn score, peptide ion mass accuracy, peptide length and missed-cleavages42. Linear discrimination scores were used to assign probabilities to each MS2 spectrum for being assigned correctly, and these probabilities were further used to filter the data set to a 1% protein-level false discovery rate. For quantification, a 0.03m/z window centred on the theoretical Th value of each reporter ion was used for the nearest signal intensity. Reporter ion intensities were adjusted to correct for the isotopic impurities from the different TMT reagents (manufacturer specifications). The signal to noise values for all peptides were summed within each TMT channel. For each peptide, a total minimum sum signal to noise value of 200 and an isolation purity greater than 70% was required43. Percentage cysteine oxidation status of protein thiols was calculated as the percentage of the cysteine containing peptide (total or mitochondrial) labelled with iodoTMT (129, 130, 131) for each condition over the sum of the reduced peptide labelled with iodoTMT (126, 127, 128) plus reversibly oxidized labelled peptide (129, 130, 131): (oxidized peptide 129, 130, 131)/(reduced peptide 126, 127, 128 + oxidized peptide 129, 130, 131) × 100. Interscapular brown adipose stromal vascular fraction was obtained from 2- to 6-day-old pups as described previously44. Interscapular brown adipose was dissected, washed in PBS, minced, and digested for 45 min at 37 °C in PBS containing 1.5 mg ml−1 collagenase B, 123 mM NaCl, 5 mM KCl, 1.3 mM CaCl , 5 mM glucose, 100 mM HEPES, and 4% essentially fatty-acid-free BSA. Tissue suspension was filtered through a 40 μm cell strainer and centrifuged at 600g for 5 min to pellet the SVF. The cell pellet was resuspended in adipocyte culture medium and plated. Primary brown pre-adipocytes were counted and plated in the evening, 12 h before differentiation at 15,000 cells per well of a seahorse plate. Pre-adipocyte plating was scaled according to surface area. The following morning, brown pre-adipocytes were induced to differentiate for 2 days with an adipogenic cocktail (1 μM rosiglitazone, 0.5 mM IBMX, 5 μM dexamethasone, 0.114 μg ml−1 insulin, 1 nM T3, and 125 μM Indomethacin) in adipocyte culture medium. Two days after induction, cells were re-fed every 48 h with adipocyte culture medium containing 1 μM rosiglitazone and 0.5 μg ml−1 insulin. Cells were fully differentiated by day 5 after induction. Cellular OCR of primary brown adipocytes was determined using a Seahorse XF24 Extracellular Flux Analyzer. Adipocytes were plated and differentiated in XF24 V7 cell culture microplates. Before analysis adipocyte culture medium was changed to DMEM respiration medium lacking NaHCO (Sigma), and including 1.85 g l−1 NaCl, 3 mg l−1 phenol red, 2% fatty-acid-free BSA, 1 mM sodium pyruvate, pH 7.4. Basal respiration was determined to be the OCR in the presence of substrate alone. ATP-synthase-independent respiration was determined after addition of 2.5 μM oligomycin. Unless otherwise stated, leak respiration was determined after addition of 2.5 μM oligomycin and 100 nM noradrenaline. Maximal respiration was determined after addition of 2 μM FCCP. To determine OCR after plasma membrane permeabilization, cells were treated with 50 μg ml−1 saponin, and sequestration of free fatty acids after permeabilization was achieved through addition of 2% fatty-acid-free BSA. RNA from murine BAT was reverse-transcribed and used as template for PCR of Ucp1. Sequences for Ucp1 amplification were as follows: sense, CAC CAT GGT GAA CCC GAC AAC TTC C; antisense, TTA TGT GGT ACA ATC CAC TG. PCR fragments were gel-purified and cloned into the pENTR/D-TOPO entry vector according to the manufacturer’s instructions (Invitrogen; K2400). Cloned Ucp1 was shuttled into the pAd/CMV/V5-DEST Gateway vector, and confirmed by sequencing. Cysteine mutants were generated using the Quik-Change site-directed mutagenesis kit (Stratagene). Primers for generating mutants were as follows: Ucp1 C24A forward 5′-AGCCGGAGTTTCAGCTGCCCTGGCAGATATCATC-3′, reverse 5′-GATGATATCTGCCAGGGCAGCTGAAACTCCGGCT-3′; Ucp1 C188A forward 5′-TGAGAAATGTCATCATCAATGCTACAGAGCTGGTAACATATG-3′, reverse 5′-CATATGTTACCAGCTCTGTAGCATTGATGATGACATTTCTCA-3′; UCP1 C213A forward 5′-TGGCAGATGACGTCCCCGCCCATTTACT GTCAGCTC-3′, reverse 5′-GAGCTGACAGTAAATGGGCGGGGACG TCATCTGCCA-3′; Ucp1 C224A forward 5′-TCTTGTTGCCGGGTT TGCCACCACACTCCTGGCC-3′, reverse 5′-GGCCAGGAGTGTGGTG GCAAACCCGGCAACAAGA-3′; Ucp1 C253A forward 5′-CCCAAGC GTACCAAGCGCTGCGATGTCCATGTAC-3′, reverse 5′-GTACATGGAC ATCGCAGCGCTTGGTACGCTTGGG-3′; Ucp1 C287A forward 5′-GGAAC GTCATCATGTTTGTGGCCTTTGAACAGCTGAAAAAAG-3′, reverse 5′-CTTTTTTCAGCTGTTCAAAGGCCACAAACATGATGACGTTCC-3′; Ucp1 C304A forward 5′-CAGACAGACAGTGGATGCTACCACATAAGGATCC-3′, reverse 5′-GGATCCTTATGTGGTAGCATCCACTGTCTGTCTG-3′. pAd/CMV/V5-DEST/Ucp1 was linearized with PacI and transfected (3 μg) into 293A cells with lipofectamine 2000 (Invitrogen). Crude adenovirus was generated according to the manufacturer’s instructions (Invitrogen; V493-20). Crude adenovirus was amplified by infecting 293A cells, and purified using the Fast Trap Adenovirus Purification and Concentration Kit (EMD Millipore). Virus was quantified by examining viral DNA. Briefly, viral particles were treated with Proteinase K and DNA was isolated with phenol and chloroform/isoamylalcohol (24:1). Preliminary experiments with titrations of viral transductions in Ucp1−/− adipocytes were used to determine the amount of virus yielding a Ucp1 messenger RNA (mRNA) and protein level similar to the level detected from Ucp1+/+ adipocytes. For subsequent experiments, primary brown adipocytes were transduced with purified adenovirus in the evening of day 3 after differentiation with medium replacement the following morning. Adipocytes were used for experiments on day 5 after differentiation. A comparative model of UCP1 was built by using the structure of the bovine AAC19. This structure corresponds to the ‘c-state’ of the carrier—open to the mitochondrial inner membrane. The protein sequence of human UCP1 was taken from UniProt. To align the AAC and UCP1 sequences, MUSCLE45 and manual editing in Jalview46 were used. To improve the quality of the comparative models, the alignments were edited to remove the N- and C-terminal residues of the UCP1 sequences that did not align with resolved residues in the AAC structure, and to place gaps in the UCP1 sequences so as to minimize the distance between these residues in the initial target structure. Fifty comparative models of human UCP1 were built from the AAC structure and the sequence alignment by using MODELLER. The structure with the lowest MODELLER energy score was taken as the best representative structure. The cardiolipin molecules of the AAC were added to the modelled UCP1 structure by aligning the two structures, and copying the lipid molecules21, 22, 47. This structure was examined and figures produced by using the PyMOL molecular visualization system (PyMOL Molecular Graphics System, version 1.4.1, Schrödinger). ROS production was estimated by oxidation of DHE and ratiometric assessment as described previously33. Cells were plated and differentiated onto 96-well plates suitable for fluorescence analysis. Before imaging, cell media was removed and replaced with imaging buffer (156 mM NaCl, 1.25 mM KH PO , 3 mM KCl, 2 mM MgCl , 10 mM HEPES, pH 7.4) supplemented with 1 mM sodium pyruvate. Cells were loaded with 5 μM DHE (Invitrogen), which remained present throughout the time course. DHE was excited at 355 nm and the emitted signal was acquired at 460 nm. Oxidized DHE was excited at 544 nm and emission was acquired at 590 nm. Mitochondrial membrane potential was measured in permeabilized cells using TMRM (Life Technologies) in dequench mode. In this mode, mitochondrial depolarization causes redistribution of a high concentration of signal quenched TMRM from mitochondria to the cytosol, such that the lower concentration results in dequenching and an increase in fluorescence48. Cells were pre-loaded at room temperature with imaging buffer containing 1 μM TMRM. TMRM fluorescence was excited at 544 nm and emission was collected at 590 nm. Total RNA was extracted from frozen tissue using TRIzol (Invitrogen), purified with RNeasy Mini spin columns (QIAGEN) and reverse transcribed using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). The resultant complementary DNA (cDNA) was analysed by quantitative PCR with reverse transcription (qRT–PCR). Briefly, 20 ng cDNA and 150 nmol of each primer were mixed with SYBR GreenER qPCR SuperMix (Applied Biosystems). Reactions were performed in a 384-well format using an ABI PRISM 7900HT real time PCR system (Applied Biosystems). Relative mRNA levels were calculated using the comparative CT method and normalized to cyclophilin mRNA. The following primers were used in these studies: Cyclophilin forward 5′-GGAGATGGCACAGGAGGAA-3′, reverse 5′-GCCCGTAGTGCTTCAGCTT-3′; Ucp1 forward 5′-ACTGCCACACCTCCAGTCATT-3′, reverse 5′-CTTTGCCTCACTCAG GATTGG-3′; Dio2 forward 5′-CAGTGTGGTGCACGTCTCCAATC-3′, reverse 5′-TGAACCAAAGTTGACCACCAG-3′; Pgc1α forward 5′-CCCTGCCATTGTTAAGACC-3′, reverse 5′-TGCTGCTGTTCCTGTTTTC-3′; PPAR-γ forward 5′-TGAAAGAAGCGGTGAACCACTG-3′, reverse 5′-TGGCATCTCTGTGTCAACCATG-3′; Pgc1β forward 5′-CTGACGT GGACGAGCTTTCA-3′, reverse 5′-CGTCCTTCAGAGCGTCAGAG-3′; Nrf2 forward 5′-CCAGCTACTCCCAGGTTGCC-3′, reverse 5′-GGGA TATCCAGGGCAAGCGA-3′; Ap2 5′-AAGGTGAAGAGCATCATAACCCT-3′, reverse 5′-TCACGCCTTTCATAACACATTCC-3′. Adipocytes were incubated in respiration medium absent BSA and treated with indicated concentrations of noradrenaline for 2 h before collection of medium and quantification of glycerol using free glycerol reagent (Sigma-Aldrich) relative to glycerol standard and normalized to protein content. Immunodetection after SDS–PAGE used the following antibodies: UCP1 (Abcam ab10983), Prx3 (Abcam ab16751), Dimedone (Millipore 07-2139), Vinculin (Sigma V9264), ATP5A and NDUFB8 (Abcam ab110413), ATGL (CST 2138), ATGL pS406 (Abcam ab135093), HSL (CST 4107), HSL pS660 (CST 4126), pPKA substrate (CST 9624 s), PPAR-γ (CST 2435S). Data were expressed as mean ± s.e.m. and P values were calculated using two-tailed Student’s t-test for pairwise comparisons, one-way ANOVA for multiple comparisons, and two-way ANOVA for multiple comparisons involving two independent variables. ANOVA analyses were subjected to Bonferroni’s post hoc test. Sample sizes were determined on the basis of previous experiments using similar methodologies. For in vivo studies, mice were randomly assigned to treatment groups. Mass spectrometric analyses were blinded to experimental conditions.


News Article | March 30, 2016
Site: www.nature.com

The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. The ScaI/HindIII linearized hArl13b–mCherry–GECO1.2 pCAG vector (chicken actin promoter) was gel-purified and injected into the pronucleus of C57BL6/6J oocytes at the transgenic animal core facility at Boston Children’s Hospital (Boston, Massachusetts). The integration site for the Arl13b–mCherry–GECO1.2 transgene was determined by genomic walking (Bio S&T). The genotype of transgenic animals was determined by PCR: primers 372-up, ACATGGCCTTTCCTGCTCTC; 372-down, TTCAACATTTCCGTGTCGCC; and 944-down, GACATCTGTGGGAGGAGTGG. PCR product for the wild-type genomic sequence: ~600 bp; transgene PCR product ~400 bp. All animal procedures of this study were approved by the IACUCs of Boston Children’s Hospital and Harvard Medical School (Boston, MA). Animals were maintained according to ARCH standards at Boston Children’s Hospital and euthanized using CO . Arl13b–mCherry–GECO1.2tg: mIMCD cells were isolated as described31. Briefly, ten kidneys isolated from P14–P21 Arl13b–mCherry–GECO1.2tg mice were cut longitudinally with fine scissors and the outer and inner medulla removed. The tissue was cut into small pieces with a razor blade and digested in collagenase (2 mg ml−1) and hyaluronidase (1 mg ml−1) for 1 h at 37 °C in L-15 medium (Life Technologies). After trituration of the homogenate, cells were washed twice in phosphate-buffered saline (PBS) and plated on laminin-coated dishes (Life Technologies). Cells were grown in DMEM (adjusted to 600 mOsm with urea and NaCl), containing 200 μM dibutyryl-cAMP (db-cAMP), unless stated otherwise. After 2 days, cells were split on laminin-coated coverslips (NeuVitro) and imaged after culturing for an additional 1–2 days to allow confluent cell growth. For side-view imaging, cells were grown on 24 mm Transwell inserts (Corning) until they reached confluency. The membrane was excised with a scalpel and folded before imaging. Where indicated, mIMCD cells were serum starved in DMEM containing 0.2% BSA for 24 h or 48 h. Imaging solutions: L-15 medium (1.3 mM Ca2+) or HEPES-containing solution buffered to 50 nM [Ca2+] (see ‘Calibration of the ratiometric Arl13b–mCherry–GECO1.2 sensor’ for buffer composition). Microdissection was performed as described previously32 with modifications. In brief, 1-mm thick transverse slices of P14–P21 kidneys were incubated with collagenase (1 mg ml−1) and hyaluronidase (1 mg ml−1) for 30 min at 37 °C in L-15 medium (Life Technologies), or gently dissected without prior treatment. The cortex was removed with fine forceps and bundles of tubules were isolated at the transition of inner (white) and outer (red) medulla (Extended Data Fig. 5c). Thick-walled individual tubules with luminal fluorescent cilia were microdissected and mounted on glass or plastic coverslips coated with Cell-Tak (Corning). Under ×4 magnification (upright Nikon NiE), a micromanipulator-mounted 20° micro-knife (Minitool) was used to cut individual tubules from the bundles. A second micromanipulator held a long-tapered micropipette (bent ~20° to ensure the tip of the pipette was parallel to the surface of the coverslip, Extended Data Fig. 5). Under higher magnification (×100/1.1 numerical aperture or ×60/1.0 numerical aperture water dipping lenses), the micropipette was gently inserted into the tubule lumen and the pressure stimulus applied. Regions of the tubule with no direct micropipette contact were used for Ca2+ imaging. In some experiments a third micromanipulator was used to deliver digitonin (20 μM) to the tubules (direct injection into the tubule lumen or external application). Cilia from kidney tubule perfusion experiments were collected from three independent microdissections. GCaMP6f (B6;129S-Gt(ROSA)26Sortm95.1(CAG-GCaMP6f)Hze/J) and E2a-Cre (Tg(EIIa-cre)C5379Lmgd) transgenic animals were obtained from Jackson Laboratories. Embryo isolation was performed as described previously33. Timed pregnancies resulting from mating wild-type C57BL6/6J, Arl13b–mCherry–GECO1.2tg/- or Arl13b–mCherry–GECO1.2tg/tg females with Arl13b–mCherry–GECO1.2tg/tg or GCaMP6ftg/tg:E2a-Cretg/tg males yielded embryos that were then selected for the appropriate developmental stages34. Embryos expressing motile cilia in the embryonic node at stages critical for asymmetric gene expression35 (starting at developmental stages ‘early allantoic bud’ up to two-somite stage) were used for experiments. Embryos were mounted with the embryonic node facing up in a custom-designed embryo mounting plate (Extended Data Fig. 10b–d). Laser cut holes (diameters 0.5–1.2 mm) in 0.8 mm Delrin ensured a good fit of the embryo into the holding well (Extended Fig. 10b, c). All embryonic node imaging was performed in DMEM/F12 with 10% fetal calf serum (Invitrogen). A similar mating strategy was used to obtain Arl13b–mCherry–GECO1.2tg:GCaMP6ftg:E2a-Cretg E14 embryos. Mouse embryonic fibroblasts were isolated from E14 embryos as described previously17. Where indicated, MEF cells were serum starved in DMEM containing 0.2% BSA for up to 48 h. To visualize cytoplasmic Ca2+ oscillations, Arl13b–mCherry–GECO1.2tg: GCaMP6ftg:E2a-Cretg embryos from late allantoic bud to late headfold stage were used. In brief, embryos were mounted in the upright position as described above and imaged for 4–6 min at a frame rate of 0.5 Hz on an upright FV1000 confocal system (Olympus, ×60/1.1 numerical aperture water dipping lens) at either 36 °C or 22 °C (room temperature). Cytoplasmic Ca2+ oscillations were quantified using ImageJ as described previously33 with slight modifications: in brief, fluorescence of all frames was averaged and individual frames were divided by average intensity to generate ΔF/F. Images were thresholded to exclude cells with ΔF/F less than 30%. Furthermore, only regions with area greater than 90 square pixels and circularities greater than 0.6 were used to define cells with cytoplasmic Ca2+ oscillations. All Ca2+ oscillations within 50 µm surrounding the embryonic node were analysed for occurrence on the left versus the right side of the node. The following reagents were used: mouse anti-acetylated tubulin (Sigma-Aldrich; T7451); CF 405M phalloidin to stain filamentous actin (Biotium; 00034); goat anti-PC2 (Santa Cruz; G-20 sc-10376), rat anti-mCherry (Life Technologies; M11240), chicken anti-EGFP (Aves Labs; GFP-1020). Cells or embryos were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked by 10% donkey serum in PBS. Cells were labelled with the indicated antibody followed by secondary donkey anti-rabbit, anti-goat, or anti-mouse fluorescently labelled immunoglobulin-G (IgG) (Life Technologies) and Hoechst 33342 (Life Technologies). Confocal images were obtained using an inverted Olympus FV1000 (×60 1.2 numerical aperture water immersion objective lens) and images processed using ImageJ (NIH). Fixed (4% paraformaldehyde) 15 μm frozen tissue sections were permeabilized with 0.5% TX100/PBS (pH 7.4) for 15 min and blocked with PBS containing 5% goat serum, 1% BSA, 0.1% fish gelatin, 0.1% TX-100, and 0.05% Tween20. For primary antibodies raised in mice, endogenous mouse IgGs were blocked by incubating sections with the unconjugated Fab fragment goat anti-mouse IgG for 1 h at room temperature. For goat primary antibodies, donkey serum and donkey secondary antibodies were used. Sections were washed twice in PBS-T, and incubated with primary antibodies in blocking solution overnight at 4 °C. Slides were washed twice in PBS-T and goat anti-rabbit/anti-mouse fluorescent-labelled secondary antibodies applied at room temperature for 1 h with Hoechst 33342 (nuclear) dye. Sections were washed twice in PBS-T, mounted in Prolong Gold Antifade (Life Technologies), and imaged (inverted Olympus FV1000; ×60, 1.2 numerical aperture water immersion objective). Images were further processed with ImageJ (NIH). Arl13b–mCherry–GECO1.2-expressing cilia were observed under an upright Nikon NiE microscope (×100, 1.1 numerical aperture, 2.5 working distance) equipped with an Opterra swept-field confocal imaging system (Bruker Nano Technologies) and a Photometrics Evolve 128 liquid-cooled EMCCD camera (128 pixels × 128 pixels, 120 nm effective pixel size). This system enables fast imaging of up to 500–1,000 frames per second (f.p.s.) in low-light conditions. In most cases, tissue was illuminated sequentially by 488 nm (GECO1.2) and 561 nm (mCherry) laser light, and imaged using the full CCD chip (15 ms exposure per channel; 33 f.p.s.). To increase light delivery to the camera and avoid excessive photobleaching, swept-field confocal imaging was performed in slit mode (35 μm). mIMCD and MEF cells isolated from Arl13b–mCherry–GECO1.2tg mice were seeded in an IBIDI μ-Slide VI 0.4 flow chamber coated with laminin (see IBIDI Application Note 11; for this chamber, apical membrane shear stress is τ = η ×131.6 × Φ, where η is dynamic viscosity (0.01 dyn s−1 cm−2) and Φ is flow rate in millilitres per minute. A syringe pump (Harvard Apparatus) delivered steady flow via 10 ml syringes containing L-15 medium. Z-stacks of primary cilia were recorded on an inverted Olympus FV1000 (×60, 1.2 numerical aperture water immersion objective). The bend angle was measured between ciliary base and tip18. Fluid velocities were measured by imaging the flow of the solution supplemented with 300 nm green fluorescent beads (Sicastar greenF, Micromod) at the focal plane corresponding to ciliary tips at rest. Images were acquired as line scans (2 ms per line) or in continuous scanning mode (64 or 128 ms per frame) and particles tracked using an ImageJ plugin. Calibration was performed using an inverted Olympus FV1000 (×60, 1.2 numerical aperture water immersion objective) as described previously17. In brief, standard solutions of [Ca2+] (ranging from 50 nM to 50 μM) were prepared by adjusting the ratio of EGTA and CaCl (MaxChelator) in 137 mM NaCl, 5.4 mM KCl, 10 mM HEPES. After isolation, mIMCD cells were plated onto 12 mm laminin-coated glass coverslips (Neuvitro) and cultured for 3–4 days to allow cilia formation. For controls, digitonin membrane permeabilization (3 min) was followed by image acquisition in multiple fields of view. Ratios were obtained by dividing the average F (per ROI, corresponding to a single cilium) by the average F . The average ratios were plotted as a function of free [Ca2+] fitted to a sigmoid curve: y = A  + (A  − A )/{1 + exp[(x − x )/dx]}, where A  = 0.15 ± 0.03, A  = 1.58 ± 0.06, x  = 442 ± 25, dx = 114 ± 20, with x  = K (the dissociation constant). The K of bacterially expressed/purified GECO1.2 was 1.1 μM (ref. 36), about twice the K measured for our GECO1.2 fusion construct in mammalian cells in situ. [Ca2+] in embryonic node primary cilia was estimated from an R - and R -adjusted calibration curve, where both values were calculated from images collected on swept-field confocal imaging system. Late bud to late headfold embryos were permeabilized with 20 μM digitonin (5 min) in either 50 nM or 5 μM [Ca2+]. Resting values for nodal primary cilia were measured in DMEM/F12 + 10% FCS using the same imaging settings used to calculate and R . Ratios were converted to [Ca2+] using the adjusted Ca2+ calibration curve. Primary cilia and stereocilia bundle deflections were performed using a custom-made fluid-jet system. Briefly, the micropipette pressure at the back of the pipette could be rapidly changed to a desired value by supplying vacuum and/or pressurized air via feedback-controlled solenoid valves (5–10 ms rise time for the pressure step stimulus). The micropipette was filled with bath solution and the pressure at the mouth of the pipette carefully adjusted before approaching to the cilium, ensuring that there was no flow applied to the cilium before the onset of the stimulus. Depending on the experimental design, digitonin was applied to the cells either using the fluid-jet pipette, or via an additional pipette positioned near the cilium and connected to an IM-9C microinjector (Narishige). For kinocilium deflection experiments, organ of Corti explants were acutely dissected and mounted on a coverslip coated with CellTak, or immobilized with tungsten minutien pins (FST). All hair cell imaging experiments were performed at room temperature in L-15 cell culture medium (Invitrogen), containing in mM: NaCl (138), KCl (5.3), CaCl (1.3), MgCl (1.0), Na HPO (1.0), KH PO (0.44), MgSO (0.81). For stereocilia bundle Ca2+ imaging experiments, organ of Corti explants were dissected at P5 in L-15 medium and placed in culture in DMEM/F12 supplemented with 5% FBS and 10 mg l−1 ampicillin at 37 °C (10% CO ). Explants were cultured for 3 days to increase the number of cells with sufficient sensor in stereocilia bundles. All images were analysed using a custom-made MATLAB tracking algorithm (described below), ImageJ (NIH), and Origin 8 (OriginLab). Osteocyte-like cell lines MLO-Y4 and Ocy454 (ref. 37) were tested for authenticity in the laboratories that supplied them (see Acknowledgements) and for mycoplasma contamination by our laboratory. Both cell types were transfected with a plasmid encoding Arl13b–mCherry–GECO1.2 using electroporation (LONZA, solution V, program T-20), as described previously38. Cells were seeded on coverslips after transfection and cultured at 37 °C. Cells were used after a primary cilium was visible. Embryonic node cilia were deflected with either a fast fluid-jet stimulus (described above) or with a ramp of slow, physiological level flow, delivering up to ~10 μm s−1 velocities: fluid flowed from a gravity-fed open-ended syringe to the micropipette. Flow rates were calibrated using 100 nm fluorescent beads (Sicastar-greenF, Micromod) and adjusted by gently lifting the syringe up 5–10 mm using a coarse micromanipulator. Perfusion fluid contained 100 nm fluorescent beads at 10 μg ml−1 and was applied directly to the node via micropipette (pipette opening 4–6 μm in diameter) that was 4–6 μm away from the imaging area. Flow rates were adjusted manually as described above such that there was no net flow at the beginning of the experiment and ~10–12 μm s−1 velocity at the end of the 15 s imaging experiment. Bead velocities and tracks were quantified and visualized using the ‘manual tracking’ plugin in ImageJ. Pipette flow was calibrated using 300 nm fluorescent beads (Sicastar-greenF, Micromod) re-suspended at 0.5 mg ml−1 in DMEM/F12 10% FCS and loaded into micropipettes following sonication. A pressure stimulus was applied to the back of the pipette and steady flow imaged at 1,000 f.p.s. to ensure accurate frame-by-frame reading for each bead position while exiting the pipette and during its travel across the imaging area (~15 μm). The 1-ms time resolution of the calibration experiment was sufficient to resolve and calibrate the range of velocities used. Cultured mIMCD cells were fixed for 1 h at room temperature with 2.5% glutaraldehyde (Electron Microscopy Sciences) in 0.1 M sodium cacodylate buffer (pH 7.4), supplemented with 2 mM CaCl , and stored in distilled water. Organ of Corti explants were fixed following Ca2+ imaging experiments, or the entire cochlea was fixed, microdissected in distilled water and prepared for scanning electron microscopy as previously described39. Briefly, specimens were dehydrated in ethanol, critical point dried from liquid CO , mounted on a carbon tape, sputter-coated with 5 nm platinum, and imaged on a Hitachi S-4800 field emission scanning electron microscope. All images were analysed using a custom-made MATLAB tracking algorithm (described below), ImageJ (NIH), and Origin 8 (OriginLab). In stereocilia we observed a 2.9 ± 1.05 (mean ± s.d.) -fold change (effect size d = 2.76) in F /F after activation of a Ca2+-conducting mechanosensor. Assuming a one-sided, paired t-test conducted at the 0.05 level of significance, a minimum of 12 cells would be required to detect an effect size of d = 1 in mechanosensitive [Ca2+] increase post-stimulation with 95% power. Customized image analyses were developed using MATLAB to automatically process the large volume of ratiometric time-lapse data to improve quantitation and objectivity. The analysis was divided into three steps: channel alignment, object detection, and object tracking over time, with subsequent ratio calculations. Channel alignment. Two factors contribute to misalignment of two channels during image acquisition: chromatic aberration from the optics and time delay due to sequential acquisition. For chromatic aberration, the two channels from each frame of a given time-lapse image were aligned using a translational transformation. A global translational transformation, derived from the individual frame transformations, was applied to all frames. Object detection. Frame-by-frame superimposed images of both channels were created. When cilia motion was faster than acquisition time, channels were significantly misaligned. To create a combination image, two channels were added and smoothed using a Gaussian filter. Local image background was subtracted from the combination image, and Otsu thresholding used to detect objects. Small objects (less than three pixels) were filtered as noise. Object tracking with ratio calculations. Different cilia in the same image vary with relative orientation. During flow application, many cilia undergo large deflections and even cross one another, further complicating the tracking of individual cilia. A tracking algorithm based on object overlap was implemented. It included features such as splitting of crossed cilia, linking cilia with no spatial overlap, and closing gaps over a given number of time frames. Once an individual cilium was tracked, the analysis code measured the signal of the cilium from both channels, calculated the ratio, and plotted it against time or spatial displacement. The algorithms were developed in MATLAB in open-source, and are available upon request.


We studied eight subjects in the United States with previous or recent ZIKV infection (Extended Data Table 2). The studies were approved by the Institutional Review Board of Vanderbilt University Medical Center; samples were obtained after informed consent was obtained by the Vanderbilt Clinical Trials Center. Two subjects (972 and 973) were infected with an African lineage strain in 2008 (one subject while working in Senegal, the second acquired the infection by sexual transmission from the first, as previously reported24). The other six subjects were infected during the current outbreak of an Asian lineage strain, following exposure in Brazil, Mexico or Haiti. Peripheral blood mononuclear cells (PBMCs) from heparinized blood were isolated with Ficoll-Histopaque by density gradient centrifugation. The cells were used immediately or cryopreserved in the vapour phase of liquid nitrogen until use. Ten million PBMCs were cultured in 384-well plates (Nunc) using culture medium (ClonaCell-HY Medium A, StemCell Technologies) supplemented with 8 μg ml−1 of the TLR agonist CpG (phosphorothioate-modified oligodeoxynucleotide ZOEZOEZZZZZOEEZOEZZZT, Invitrogen), 3 μg ml−1 of Chk2 inhibitor (Sigma), 1 μg ml−1 of cyclosporine A (Sigma), and clarified supernatants from cultures of B95.8 cells (ATCC) containing Epstein–Barr virus. After 7 days, cells from each 384-well culture plate were expanded into four 96-well culture plates (Falcon) using ClonaCell-HY Medium A containing 8 μg ml−1 of CpG, 3 μg ml−1 of Chk2 inhibitor, and 107 irradiated heterologous human PBMCs (Nashville Red Cross) and cultured for an additional 4 days. Supernatants were screened in ELISA (described below) for reactivity with various ZIKV E proteins, which are described below. The minimal frequency of ZIKV E-reactive B cells was estimated based on the number of wells with E protein-reactive supernatants compared with the total number of lymphoblastoid cell line colonies in the transformation plates (calculation: E-reactive B-cell frequency = (number of wells with E-reactive supernatants) divided by (number of LCL colonies in the plate) × 100). The ectodomains of ZIKV E (H/PF/2013; GenBank Accession KJ776791) and the fusion-loop mutant E-FLM (containing four mutations: T76A, Q77G, W101R, L107R) were expressed transiently in Expi293F cells and purified as described previously7. ZIKV DIII (residues 299–407 of strain H/PF/2013), WNV DIII (residues 296–405 of strain New York 1999) and DENV-2 DIII (residues 299-410 of strain 16681) were expressed in BL21 (DE3) as inclusion bodies and refolded in vitro25. Briefly, inclusion bodies were denatured and refolded by gradual dilution into a refolding buffer (400 mM l-arginine, 100 mM Tris (pH 8.3), 2 mM EDTA, 5 and 0.5 mM reduced and oxidized glutathione) at 4 °C. Refolded proteins were purified by size-exclusion chromatography using a Superdex 75, 16/60 (GE Healthcare). Cells from wells with transformed B cells containing supernatants that exhibited reactivity to ZIKV E protein were fused with HMMA2.5 myeloma cells (gift from L. Cavacini) using an established electrofusion technique26. After fusion, hybridomas were suspended in a selection medium containing 100 μM hypoxanthine, 0.4 μM aminopterin, 16 μM thymidine (HAT Media Supplement, Sigma), and 7 μg ml−1 ouabain (Sigma) and cultured in 384-well plates for 18 days before screening hybridomas for antibody production by ELISA. After fusion with HMMA2.5 myeloma cells, hybridomas producing ZIKV E-specific antibodies were cloned biologically by single-cell fluorescence-activated cell sorting. Hybridomas were expanded in post-fusion medium (ClonaCell-HY Medium E, STEMCELL Technologies) until 50% confluent in 75-cm2 flasks (Corning). For antibody production, cells from one 75-cm2 flask were collected with a cell scraper and expanded to four 225-cm2 flasks (Corning) in serum-free medium (Hybridoma-SFM, Life Technologies). After 21 days, supernatants were clarified by centrifugation and filtered using 0.45-μm pore size filter devices. HiTrap Protein G or HiTrap MabSelectSure columns (GE Healthcare Life Sciences) were used to purify antibodies from filtered supernatants. Total cellular RNA was extracted from pelleted cells from hybridoma clones, and an RT–PCR reaction was performed using mixtures of primers designed to amplify all heavy-chain or light-chain antibody variable regions27. The generated PCR products were purified using AMPure XP magnetic beads (Beckman Coulter) and sequenced directly using an ABI3700 automated DNA sequencer. The variable region sequences of the heavy and light chains were analysed using the IMGT/V-Quest program28, 29. Wells of microtitre plates were coated with purified, recombinant ectodomain of ZIKV E, DIII, DIII-LR mutants (DIII containing A310E and T335K mutations) or DIII of related flaviviruses DENV-2 or WNV and incubated at 4 °C overnight. In ELISA studies with purified mAbs, we used recombinant ZIKV E protein ectodomain with His tag produced in Sf9 insect cells (Meridian Life Sciences R01635). Plates were blocked with 5% skimmed milk in PBS-T for 1 h. B-cell culture supernatants or purified antibodies were added to the wells and incubated for 1 h at ambient temperature. The bound antibodies were detected using goat anti-human IgG (γ-specific) conjugated with alkaline phosphatase (Southern Biotech) and pNPP disodium salt hexahydrate substrate (Sigma). In ELISAs that assessed binding of mAbs to DIII and DIII LR mutants, we used previously described murine mAbs ZV-2 and ZV-54 (ref. 7) as controls. A goat anti-mouse IgG conjugated with alkaline phosphatase (Southern Biotech) was used for detection of these antibodies. Colour development was monitored at 405 nm in a spectrophotometer (Biotek). For determining EC , microtitre plates were coated with ZIKV E or E-FLM that eliminated interaction of fusion-loop specific antibodies. Purified antibodies were diluted serially and applied to the plates. Bound antibodies were detected as above. A nonlinear regression analysis was performed on the resulting curves using Prism (GraphPad) to calculate EC values. Fetal head and placental tissues were collected at E13.5 from groups treated with ZIKV-117 or PBS (as a negative control), homogenized in PBS (250 μl) and stored at −20 °C. ELISA plates were coated with ZIKV E protein, and thawed, clarified tissue homogenates were applied undiluted in triplicate. Bound antibodies were detected using goat anti-human IgG (Fc-specific) antibody conjugated with alkaline phosphatase. The quantity of antibody was determined by comparison with a standard curve constructed using purified ZIKV-117 in a dilution series. His -tagged ZIKV E protein was immobilized on anti-His coated biosensor tips (Pall) for 2 min on an Octet Red biosensor instrument. After measuring the baseline signal in kinetics buffer (PBS, 0.01% BSA, and 0.002% Tween 20) for 1 min, biosensor tips were immersed into the wells containing first antibody at a concentration of 10 μg ml−1 for 7 min. Biosensors then were immersed into wells containing a second mAb at a concentration of 10 μg ml−1 for 7 min. The signal obtained for binding of the second antibody in the presence of the first antibody was expressed as a percentage of the uncompeted binding of the second antibody that was derived independently. The antibodies were considered competing if the presence of first antibody reduced the signal of the second antibody to less than 30% of its maximal binding and non-competing if the signal was greater than 70%. A level of 30–70% was considered intermediate competition. Epitope mapping was performed by shotgun mutagenesis essentially as described previously6. A ZIKV prM/E protein expression construct (based on ZIKV strain SPH2015) was subjected to high-throughput alanine scanning mutagenesis to generate a comprehensive mutation library. Each residue within prM/E was changed to alanine, with alanine codons mutated to serine. In total, 672 ZIKV prM/E mutants were generated (100% coverage), sequence confirmed, and arrayed into 384-well plates. Each ZIKV prM/E mutant was transfected into HEK-293T cells and allowed to express for 22 h. Cells were fixed in 4% (v/v) paraformaldehyde (Electron Microscopy Sciences), and permeabilized with 0.1% (w/v) saponin (Sigma-Aldrich) in PBS plus calcium and magnesium (PBS++). Cells were incubated with purified mAbs diluted in PBS++, 10% normal goat serum (Sigma), and 0.1% saponin. Primary antibody screening concentrations were determined using an independent immunofluorescence titration curve against wild-type ZIKV prM/E to ensure that signals were within the linear range of detection. Antibodies were detected using 3.75 μg ml−1 of AlexaFluor488-conjugated secondary antibody (Jackson ImmunoResearch Laboratories) in 10% NGS/0.1% saponin. Cells were washed three times with PBS++/0.1% saponin followed by two washes in PBS. Mean cellular fluorescence was detected using a high-throughput flow cytometer (HTFC, Intellicyt). Antibody reactivity against each mutant prM/E clone was calculated relative to wild-type prM/E protein reactivity by subtracting the signal from mock-transfected controls and normalizing to the signal from wild-type prM/E-transfected controls. Mutations within clones were identified as critical to the mAb epitope if they did not support reactivity of the test MAb, but supported reactivity of other ZIKV antibodies. This counter-screen strategy facilitates the exclusion of prM/E mutants that are locally misfolded or have an expression defect. This study was carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocols were approved by the Institutional Animal Care and Use Committee at the Washington University School of Medicine (Assurance number A3381-01). Inoculations were performed under anaesthesia induced and maintained with ketamine hydrochloride and xylazine, and all efforts were made to minimize animal suffering. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. ZIKV strain H/PF/2013 (French Polynesia, 2013) was obtained from X. de Lamballerie (Aix Marseille Université). ZIKV Brazil Paraiba 2015 was provided by S. Whitehead (Bethesda) and originally obtained from P. F. C. Vasconcelos (Instituto Evandro Cargas). ZIKV MR 766 (Uganda, 1947), Malaysia P6740 (1966), and Dakar 41519 (Senegal, 1982) were provided by the World Reference Center or Emerging Viruses and Arboviruses (R. Tesh, University of Texas Medical Branch). Nicaraguan DENV strains (DENV-1 1254-4, DENV-2 172-08, DENV-3 N2845-09, and DENV-4 N703-99) were provided generously by E. Harris (University of California, Berkeley). Virus stocks were propagated in C6/36 Aedes albopictus cells (DENV) or Vero cells (ZIKV). ZIKV Dakar 41519 (ZIKV-Dakar) was passaged twice in vivo in Rag1−/− mice (M. Gorman and M. Diamond, unpublished data) to create a mouse-adapted strain. Virus stocks were titrated by focus-forming assay (FFA) on Vero cells. All cell lines were checked regularly for mycoplasma contamination and were negative. Cell lines were authenticated at acquisition with short tandem repeat method profiling; Vero cells, though commonly misidentified in the field, were used as they are the standard cell line for flavivirus titration. Serial dilutions of mAbs were incubated with 102 FFU of different ZIKV strains (MR 766, Dakar 41519, Malaysia P6740, H/PF/2013, or Brazil Paraiba 2015) for 1 h at 37 °C. The mAb–virus complexes were added to Vero cell monolayers in 96-well plates for 90 min at 37 °C. Subsequently, cells were overlaid with 1% (w/v) methylcellulose in MEM supplemented with 4% heat-inactivated FBS. Plates were fixed 40 h later with 1% PFA in PBS for 1 h at room temperature. The plates were incubated sequentially with 500 ng ml−1 mouse anti-ZIKV (ZV-16, E.F. and M.S.D., unpublished data) and horseradish-peroxidase-conjugated goat anti-mouse IgG in PBS supplemented with 0.1% (w/v) saponin (Sigma) and 0.1% BSA. ZIKV-infected cell foci were visualized using TrueBlue peroxidase substrate (KPL) and quantitated on an ImmunoSpot 5.0.37 macroanalyzer (Cellular Technologies). C6/36 Aedes albopictus cells were inoculated with a MOI 0.01 of ZIKV (H/PF/2013) or different DENV serotypes (Nicaraguan strains DENV-1 1254-4, DENV-2 172-08, DENV-3 N2845-09, DENV-4 N703-99). At 120 h post infection, cells were fixed with 4% PFA diluted in PBS for 20 min at room temperature and permeabilized with HBSS supplemented with 10 mM HEPES, 0.1% saponin and 0.025% NaN for 10 min at room temperature. 50,000 cells were transferred to U-bottom plates and incubated for 30 min at 4 °C with 5 μg ml−1 of anti-ZIKV human mAbs or negative (hCHK-152)12, or positive (hE60)30 isotype controls. After washing, cells were incubated with Alexa-Fluor-647-conjugated goat anti-human IgG (Invitrogen) at 1:500, fixed in 1% PFA in PBS, processed on MACSQuant Analyzed (Miltenyi Biotec), and analysed using FlowJo software (Tree Star). Total RNA was extracted from hybridoma cells and genes encoding the VH and VL domains were amplified in RT–PCR using IgExp primers31. The PCR products were directly cloned into antibody expression vectors containing the constant domains of wild-type γ1 chain, LALA mutant (leucine (L) to alanine (A) substitution at positions 234 and 235) γ1 chain for the VH domains, and wild-type κ chain for the VL domain in an isothermal amplification reaction (Gibson reaction)32. Plasmids encoding the heavy and light chain were transfected into 293F cells and full-length recombinant IgG was secreted into transfected cell supernatants. Supernatants were collected and IgG purified using Protein G chromatography and eluted into PBS. The functional abrogation of the binding of the LALA variant IgG was confirmed in an ELISA binding assay with recombinant human FcγRI. The binding of wild-type ZIKV-117 or LALA antibody to FcγRI was evaluated, in comparison with the binding pattern of control antibodies (human mAb CKV063 (ref. 33) LALA mutated IgG). C57BL/6 male mice (4–5-week-old, Jackson Laboratories) were inoculated with 103 FFU of mouse-adapted ZIKV-Dakar by subcutaneous route in the footpad. One-day before infection, mice were treated with 2 mg anti-Ifnar1 mAb (MAR1-5A3, Leinco Technologies) by intraperitoneal injection. ZIKV-specific human mAb (ZIKV-117) or an isotype control (hCHK-152) was administered as a single dose at day +1 (100 μg) or day +5 (250 μg) after infection through an intraperitoneal route. Animals were monitored for 21 days. Wild-type C57BL/6 mice were bred in a specific pathogen-free facility at Washington University School of Medicine. (1) Ifnar1−/− dams, prophylaxis studies: Ifnar1−/− female and wild-type male mice were mated; at E5.5, dams were treated with a single 250 μg dose of ZIKV mAb or isotype control by intraperitoneal injection. At E6.5, mice were inoculated with 103 FFU of ZIKV Brazil Paraiba 2015 by subcutaneous injection in the footpad. (2) Wild-type dams, prophylaxis studies: wild-type female and male mice were mated; at embryonic days E5.5, dams were treated with a single 250 μg dose of ZIKV mAb or isotype control by intraperitoneal injection as well as a 1 mg injection of anti-Ifnar1 (MAR1-5A3). At E6.5, mice were inoculated with 103 FFU of mouse-adapted ZIKV-Dakar by subcutaneous injection in the footpad. At E7.5, dams received a second 1 mg dose of anti-Ifnar1 through an intraperitoneal route. (3) Wild-type dams, therapy studies: wild-type female and male mice were mated; at embryonic days E5.5, dams were treated with a 1 mg injection of anti-Ifnar1 (MAR1-5A3). At E6.5, mice were inoculated with mouse-adapted 103 FFU of ZIKV-Dakar by subcutaneous injection in the footpad. At E7.5, dams received a second 1 mg dose of anti-Ifnar1 as well as a single 250 μg dose of ZIKV mAb or isotype control through an intraperitoneal route. All animals were euthanized at E13.5, and placentas, fetuses and maternal tissues were collected. Fetus size was measured as the crown-rump length × occipitofrontal diameter of the head. ZIKV-infected tissues were weighed and homogenized with stainless steel beads in a Bullet Blender instrument (Next Advance) in 200 μl of PBS. Samples were clarified by centrifugation (2,000g for 10 min). All homogenized tissues from infected animals were stored at −20 °C. Tissue samples and serum from ZIKV-infected mice were extracted with RNeasy 96 Kit (tissues) or Viral RNA Mini Kit (serum) (Qiagen). ZIKV RNA levels were determined by TaqMan one-step quantitative reverse transcriptase PCR (qRT–PCR) on an ABI7500 Fast Instrument using published primers and conditions34. Viral burden was expressed on a log scale as viral RNA equivalents per g or ml after comparison with a standard curve produced using serial tenfold dilutions of ZIKV RNA. RNA in situ hybridization was performed with RNAscope 2.5 (Advanced Cell Diagnostics) according to the manufacturer’s instructions. PFA-fixed paraffin embedded placental sections were deparaffinized by incubation for 60 min at 60 °C. Endogenous peroxidases were quenched with H O for 10 min at room temperature. Slides were boiled for 15 min in RNAscope Target Retrieval Reagents and incubated for 30 min in RNAscope Protease Plus before probe hybridization. The probe targeting ZIKV RNA was designed and synthesized by Advanced Cell Diagnostics (catalogue number 467771). Negative (targeting bacterial gene dapB) control probes were also obtained from Advanced Cell Diagnostics (catalogue number 310043). Tissues were counterstained with Gill’s haematoxylin and visualized with standard bright-field microscopy. Collected placentas were fixed in 10% neutral buffered formalin at room temperature and embedded in paraffin. At least three placentas from different litters with the indicated treatments were sectioned and stained with haematoxylin and eosin to assess morphology. Surface area and thickness of placenta and different layers were measured using Image J software. For immunofluorescence staining on mouse placentas, deparaffinized tissues were blocked in blocking buffer (1% BSA, 0.3% Triton, PBS) for 2 h and incubated with anti-vimentin antibody (1:500, rabbit, Abcam ab92547). Secondary antibody conjugated with Alexa 488 (1:500 in PBS) was applied for 1 h at room temperature. Samples were counterstained with DAPI (4′6′-diamidino-2-phenilindole, 1:1,000 dilution). All virological data were analysed with GraphPad Prism software. Kaplan–Meier survival curves were analysed by the log rank test, and viraemia was compared using an ANOVA with a multiple comparisons test. P < 0.05 indicated statistically significant differences. All relevant data are included with the manuscript; source data for each of the main text figures is provided.


Wild-type male C57BL/6 mice and B6.129S4–PDGFRαtm11(EGFP)Sor/J mice (Jackson strain number 007669), which contain an H2B–eGFP fusion protein knocked into the Pdgfra locus, were obtained from Jackson Laboratories. Young adult mice were 6–8 weeks of age; aged mice were 22–24 months of age. Mice were housed and maintained in the Veterinary Medical Unit at the Veterans Affairs Palo Alto Health Care System. Animal protocols were performed in accordance with the policies of the Administrative Panel on Laboratory Animal Care of Stanford University. Mice were anaesthetized using isoflurane. To assess muscle regeneration, 50 μl of a 1.2% barium chloride (BaCl ) solution (Sigma-Aldrich) was injected into tibialis anterior muscles as described previously5. To isolate activated FAPs for western blot analysis and FACS analysis, 50 μl of 1.2% BaCl or 50% (v/v) glycerol/water was injected throughout the lower hindlimb muscles. For induction of fibrosis, 30 μl of 50% (v/v) glycerol or 30 μl 1.2% BaCl solution was injected into tibialis anterior muscles. Muscles were dissected from mice and dissociated mechanically. All hindlimb muscles were used except in experiments where FAPs were isolated from VMOs injected into tibialis anterior muscles. In this case, only the tibialis anterior muscle was dissected. The muscle suspension was digested using collagenase II (760 U ml−1; Worthington Biochemical Corporation) in Ham’s F10 medium (Invitrogen) with 10% horse serum (Invitrogen) for 90 min at 37 °C with agitation. The suspension was then washed and digested in collagenase II (152 U ml−1; Worthington Biochemical Corporation) and dispase (2 U ml−1; Invitrogen) for 30 min at 37 °C with agitation. The resultant mononuclear cells were then stained with the following antibodies: VCAM-1-biotin (clone 429; BioLegend, 105704), CD31-APC (clone MEC 13.3; BioLegend, 102510), CD45-APC (clone 30-F11; BioLegend, 103112) and Sca-1-Pacific Blue (clone D7; BioLegend, 108120) at 1:75. Streptavidin-PE-Cy7 (BioLegend, 405206) at 1:75 was used to amplify the VCAM-1 signal. FAPs were collected according to the following sorting criteria: CD31−CD45−Sca-1+. FACS was performed using BD-FACS Aria II and BD-FACS Aria III cell sorters equipped with 488 nm, 633 nm and 405 nm lasers. The cell sorters were carefully optimized for purity and viability and sorted cells were subjected to FACS analysis immediately after sorting to confirm FAP purity. FAPs were isolated from uninjured C57BL/6 mice as described above and lysed. RNA was prepared with the RNeasy Mini Kit as per the manufacturer’s instructions (Qiagen). A 3′ blocking reaction was performed using a poly(A) tailing kit (Ambion) and 3′-dATP (Jena Bioscience) and the reaction mixture was incubated at 37 °C for 30 min. RNA was hybridized to flow cell surfaces for direct RNA sequencing as previously described18. Raw direct RNA sequencing reads were filtered using the Helicos-developed pipeline, Helisphere, to eliminate reads less than 25 nucleotides long or of low quality. These reads were then mapped to the mouse genome (NCBI37/mm9) using an IndexDPgenomic module and reads with a score above 4.3 were allowed. To avoid artefacts from mispriming, reads mapping to regions in the genome where more than four consecutive adenines were coded immediately 3′ to the mapping sequence were excluded from further analysis. Reads were viewed using the Integrative Genomics Viewer32, 33. Total RNA was extracted from FAPs isolated from uninjured C57BL/6 mice using TRIzol (Invitrogen) as per the manufacturer’s instructions. To identify the polyadenylation sites, the sample was reverse transcribed using the SMARTer RACE cDNA amplification kit (Clontech) according to the manufacturer’s instructions using the primers listed in Extended Data Table 1. The amplified fragments were subcloned into pGEM-T-Easy (Promega) and sequenced. Sequencing data were visualized with 4Peaks. To assess levels of the intronic variant and UTR variants, primers were designed to span the Pdgfra transcript (Extended Data Table 2). Variant expression was normalized to Gapdh using the comparative C method27 and reported relative to the average of control-treated samples. A construct corresponding to In-PDGFRα (DNAFORM, AK035501, RIKEN clone 9530057A20) was obtained. This construct was subcloned into the pMXs-IRES-GFP retroviral backbone (Cell BioLabs, Inc.) to generate pMXs-I-Pα. Replication-incompetent retroviral particles were generated by transfection of the 293T human embryonic kidney cell-derived Phoenix helper cell line (gift from G. Nolan). Viral supernatant was filtered through 0.45-μm polyethersulfone filters, concentrated using PEG precipitation and stored at −80 °C. FAPs were plated in 6-well plates and grown in DMEM supplemented with 10% fetal bovine serum (FBS). When cells reached 70% confluency, viral supernatant and polybrene (at a final concentration of 4 μg ml−1) were added to the medium. For overexpression experiments, FAPs were incubated with the viral supernatant for 48 h before analysis. For signalling assays, FAPs were incubated with the viral supernatant for 24 h. Afterwards the medium was changed to serum-free DMEM containing viral supernatant and the cells were incubated for an additional 24 h. The FAPs were then treated with 1 ng ml−1 PDGF-AA for 15 min, after which the cells were used for western blot analysis. A peptide with the sequence GKSAHAHSGKYDLSVV, which represents the unique C-terminal region of In-PDGFRα protein, was generated (Thermo Scientific Pierce, OE0726). To generate In-PDGFRα rabbit polyclonal antibodies directed against In-PDGFRα, New Zealand white rabbits that were specific pathogen free were immunized with 0.25 mg of the peptide in Complete Freund’s Adjuvant. The rabbits received three boosters of antigen consisting of 0.10 mg in Incomplete Freund’s Adjuvant at days 14, 42 and 56 after immunization. Serum was collected at days 70 and 72 (Thermo Scientific Pierce). Cells and homogenized tissues were lysed with RIPA lysis buffer supplemented with protease and phosphatase inhibitors (Roche). The lysates were run on Criterion SDS–PAGE gels (Bio-Rad), transferred to nitrocellulose membranes (Fisher Scientific), and analysed by western blot using the following rabbit antibodies: PDGFRα polyclonal (1:1,000, Cell Signaling, 3174), PDGFRα centre (1:100, Abgent, AP14254c), In-PDGFRα custom (1:1,000), pPDGFRαTyr754 polyclonal (1:1,000, Cell Signaling, 4547), Akt polyclonal (1:1,000, Cell Signaling, 9272), pAkt polyclonal (1:1,000, Cell Signaling, 9271), PLCγ polyclonal (1:1,000, Cell Signaling, 5690), pPLCγ polyclonal (1:1,000, Cell Signaling, 2821), ERK polyclonal (1:2,000, Cell Signaling, 4695), pERK polyclonal (1:2,000, Cell Signaling, 4370), SMAD2/3 monoclonal (1:1,000, Cell Signaling, 8685), and pSMAD2Ser465/Ser467/SMAD3Ser423/Ser425 monoclonal (1:1,000, Cell Signaling, 8828). Membranes were incubated in horseradish-peroxidase-labelled secondary antibodies and bands were visualized with enhanced chemiluminescence (Advansta). siRNAs were designed using the Dharmacon siDESIGN Center for knockdown of In-PDGFRα and FL-PDGFRα (Extended Data Table 2). To knockdown either In-PDGFRα or FL-PDGFRα in FAPs, approximately 8 × 104 cells were plated in a 12-well plate containing DMEM supplemented with 10% FBS and grown to 70–80% confluence. Cells were incubated in 200 nM of either PDGFRα or control siRNAs using Lipofectamine 2000 (Invitrogen). To assess knockdown, cells were collected at 24 h for qPCR analysis. For western blot analyses, 3 × 105 cells were plated in 6-well plates and incubated in Ham’s F10 medium (Invitrogen) supplemented with 10% horse serum (Invitrogen) for 24 h. The medium was then replaced with serum-free Ham’s F10 (Invitrogen) supplemented with 200 nM siRNA and incubated for an additional 24 h. Morpholinos were designed to target two polyadenylation sites on the intronic variant (pA : 5′-TGATTACATTATATCTGTCTTTATT-3′ and pA : 5′-AGCAAAGACCATCATAGCAGAATGA-3′) and the upstream 5′ splice site of the intron (5′ss: 5′-ATGGGCACTTTTACCTAGCATGGAT-3′) (Gene Tools, LLC). For in vitro treatment, cells were grown to 70–80% confluency in DMEM (Invitrogen) supplemented with 10% FBS (Atlanta Biologicals). Cells were incubated in 10 μM of the indicated morpholino using the Endo-Porter transfection reagent (Gene Tools, LLC). Cells were collected at 24 h for qPCR analysis with RNA isolated using the RNeasy Plus Mini kit with on-column DNase digestion as per manufacturer’s instructions (Qiagen). For western blot analysis, cells were transfected for 24 h in Ham’s F10 medium (Invitrogen) supplemented with 10% horse serum (Invitrogen). The medium was then replaced with serum-free Ham’s F10 (Invitrogen) and incubated for an additional 24 h. For signalling assays, cells were then incubated for 15 min with PDGF-AA (Peprotech) at 0.1 ng ml−1 or 20 ng ml−1 for cells treated with pA-AMOs or 5′ss-AMO, respectively, and lysed for western blot analysis as described above. For AMO treatment, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice and seeded at 1 × 105 cells per well in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). Cells were transfected with 10 μM AMO using Endoporter (Gene Tools) and expanded for 2 days in Ham’s F10 (Invitrogen) supplemented with 10% horse serum (Invitrogen). The medium was then replaced with Opti-MEM supplemented with 2 ng ml−1 PDGF-AA ligand and 10 μm EdU (Invitrogen). Cells were fixed in 4% paraformaldehyde (Sigma-Aldrich) after 24 h. For siRNA treatment, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice and seeded at 2 × 105 cells per well in poly-d-lysine coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). The medium was supplemented with 200 nM siRNA and transfected using Lipofectamine 2000 (Invitrogen). After 24 h, the medium was replaced with Opti-Mem and the cells were re-transfected with 200 nM siRNA and 50 ng ml−1 PDGF-AA. In siRNA-treated samples, EdU was not included in this medium. Rather, after 20 h the medium was replaced with Opti-Mem containing 10 μm EdU (Invitrogen). Cells were fixed 4 h later. For retroviral overexpression of In-PDGFRα, FAPs were isolated from uninjured hindlimbs of C57BL/6 mice and seeded at 2 × 105 cells per well in poly-d-lysine coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). FAPs were cultured in DMEM supplemented with 10% FBS along with viral supernatant and 4 μg ml−1 polybrene. After 24 h, the medium was replaced with serum-free DMEM containing viral supernatant and 20 ng ml−1 PDGF-AA. Twenty hours later, the medium was replaced with Opti-MEM containing 10 μM EdU. Cells were fixed after 4 h. For EdU incorporation experiments, cells were stained using the Click-iT EdU Imaging Kit (Invitrogen). Cells were analysed on a Zeiss Observer Z1 fluorescent microscope (Carl Zeiss) equipped with a Hamamatsu Orca-ER camera (Hamamatsu) and Improvision Volocity software (Perkin Elmer). Cells isolated by FACS from uninjured hindlimb muscles were seeded at a density of 3.5 × 104 cells per well in 96-well plates in Ham’s F10 medium supplemented with 2% horse serum. After 48 h, cells were nearly confluent and the medium was changed to Ham’s F10 with 2% horse serum and 20 ng ml−1 PDGF-AA. A wound was made by scratching a 200-μl pipette tip across the monolayer of cells. The initial scratch area was determined immediately and set to 100%. Images were taken at regular intervals and the scratch area at each time point was measured and calculated as a percentage of the initial scratch area. Scratch closure is defined as the inverse of the cell-free area as a percentage of total area. For in vitro microarray analysis, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice. Cells were plated at 1 × 106 cells per well in 12-well plates. Cells were grown for 2.5 days in DMEM supplemented with 10% FBS. The medium was switched to Ham’s F10 supplemented with 10% horse serum and transfected with 10 μM AMO as indicated for 48 h. The medium was then replaced with Opti-Mem and cells were re-transfected with 10 μM AMO. After 48 h, the cells were lysed and RNA was prepared with the RNeasy Mini Kit as per the manufacturer’s instructions (Qiagen). For in vivo microarray analysis, tibialis anterior muscles were injured with 30 μl of glycerol each and injected with the indicated VMO after 3 days. FAPs were then isolated from the muscles 2 days after VMO injection. Cells were pelleted and RNA prepared from samples as indicated above. The microarray data were obtained using Affymetrix Mouse 1.0 ST. For gene set enrichment analysis (GSEA), the samples were normalized and processed using GenePattern ExpressionFileCreator and PreProcessData set modules. Expression data were analysed and visualized with GSEA28 and GENE-E (http://www.broadinstitute.org/cancer/software/GENE-E/). For ingenuity pathway analysis, including causal network analysis, the samples were normalized using Affymetrix Expression Console Software and analysed for enrichment using IPA (Ingenuity Systems, http://www.ingenuity.com). Array data were deposited into Gene Expression Omnibus (Accessions GSE60099 and GSE81744). Vivo-morpholinos were designed to target two polyadenylation sites on the intronic variant (pA -VMO: 5′-TGATTACATTATATCTGTCTTTATT-3′ and pA -VMO: 5′-AGCAAAGACCATCATAGCAGAATGA-3′) and the upstream 5′ splice site of the intron (5′ss-VMO: 5′-ATGGGCACTTTTACCTAGCATGGAT-3′) (Gene Tools, LLC). For treatment in vitro, cells were isolated from hindlimb muscles of C57BL/6 mice and grown to 70–80% confluency in DMEM (Invitrogen) supplemented with 10% FBS (Atlanta Biologicals). Cells were incubated in the 10 μM of the indicated morpholino (Gene Tools, LLC). Cells were collected at 24 h for qPCR analysis. For in vivo qPCR analysis, tibialis anterior muscles were injured with glycerol as described above and injected with 250 ng of the indicated VMO at the site of injury 3 days later. FAPs were sorted by FACS 7 days after VMO injection for qPCR analysis. For ex vivo proliferation and scratch assays, tibialis anterior muscles were injured with glycerol and injected with 250 ng of the indicated VMO 3 days after injury. FAPs were isolated 2 days later by FACS. In EdU incorporation studies, cells were seeded at 4 × 104 cells per well in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). Cells were incubated in 10 ng ml−1 PDGF-AA (Peprotech) and 10 μM EdU (Invitrogen) for 24 h. The cells were fixed and stained. In the ex vivo proliferation studies as well as the in vivo proliferation studies described below, the proliferation index was used to denote the percentage EdU incorporation normalized to control. In the scratch assays, cells were seeded and treated as described above. For in vivo proliferation studies, tibialis anterior muscles were injected with 150 ng of the indicated VMO at 0 and 24 h. FAPs were isolated at 48 h via FACS. To assess in vivo proliferation, the cells were exposed to 10 μM EdU immediately after muscle isolation and incubated in 10 μM EdU ex vivo during the collagenase, collagenase/dispase, and antibody incubations as described above. The cells were plated in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich), fixed 1 h after plating, and stained using the Click-iT EdU Imaging Kit (Invitrogen). For histological analysis, tibialis anterior muscles were injured with glycerol or BaCl and injected at the site of injury with 250 ng of the indicated VMO. After 7 days, the muscles were snap frozen in isopentane cooled in liquid nitrogen immediately after dissection. Muscles sections were stained with Gomori-trichrome (Richard-Allan Scientific) per manufacturer’s instructions or oil red O (Sigma-Aldrich) as previously described29. The fibrotic index was calculated as the area of fibrosis divided by total area of muscle normalized to control-treated muscle. The fibro–adipose index was defined as the area of fibrosis plus the area of adiposis (as detected by oil red O staining) divided by total area of muscle, normalized to control. Major factors in determining sample size included the level of the effect and the inherent variability in measurements obtained. No statistical methods were used to predetermine sample size. Animals were excluded from the study only if their health status was compromised, such as occurred when animals had visible wounds from fighting. Samples were not specifically randomized or blinded. However, mouse identifiers were used when possible to blind evaluators to experimental conditions, and all samples within experiments were processed identically for measurement quantification using automated tools as specified. The sequencing data were deposited into the NCBI Sequence Read Archive (accession number SRP079186). Array data were deposited into Gene Expression Omnibus (accession numbers GSE60099 and GSE81744).


Animals were treated in strict accordance with the guidelines outlined by the Canadian Council on Animal Care (http://www.ccac.ca/), and experiments adhered to protocols approved by the Facility Animal Care Committee of McGill University (protocol no. 1190). Long–Evans rats (80−150 g) and C57/B6 mice (60−90 d) were obtained from Charles River Laboratories. VP-Cre (VP-IRES2-Cre-D) knock-in mice were bred in our colony with either ChETA (R26-CAG-LSL-2XChETA-tdTomato) or ArchT mice (Ai40D; obtained from Jackson Laboratories). V1aR knock-out (V1aR−/−) mice were bred in our colony (obtained from J. N. Crawley)27. All experiments were performed on male animals, except for one experiment (Extended Data Fig. 8) where a female was used. In vitro experiments were performed on mice aged 2−4 months, experiments on rats were done on animals weighing 80−150 g, and in vivo mouse experiments were done on animals aged 2−3 months. Animals were subjected to a strict 12 h:12 h light:dark cycle. C57/B6 mice were individually housed in computer-interfaced metabolic Oxylet cages from PanLab (Harvard Apparatus) to measure water intake. Animals were placed in cages and allowed to habituate to the cages for 4−6 days. To obtain the average circadian profile of water intake, we obtained hourly averages from each subject between ZT6.5 and ZT6.5 on the following day. Data files were analysed using Metabolism (version 2.1.04; PanLab) and Microsoft Excel. Statistical analysis was performed in Sigmaplot (Version 12.3, Systat Software). Since we cannot obtain serial measures of serum osmolality in individual C57/B6 mice, we used a group approach whereby data were collected from multiple (3−18) subjects that were killed at each time point tested. To this end, mice were anaesthetized with isoflurane and rapidly decapitated to obtain blood samples, core body temperature using a digital thermometer, and haematocrit using a ZipCombo Centrifuge from LW Scientific. Blood samples were placed on ice and allowed to clot at 2−4  C for 60 min, after which they were centrifuged for 5 min, and serum osmolality was measured in duplicate using a micro-osmometer (Advanced Instruments). The objective of this experiment (Fig. 1c, d), was to deny the surge in water intake, while preserving water intake levels during the AP equivalent to levels during the BP. Because water intake between ZT21.5 and ZT22.5 is equivalent to water intake between ZT19.5 and ZT21.5 (BP), we allowed water intake to proceed until ZT22.5 before removing access to water. Water was removed from C57/B6 mouse cages at either ZT22.5 (no AP surge allowed) or ZT23.5 (AP surge allowed). Access to water overnight was denied to prevent compensatory drinking and allow a specific evaluation of the impact of the AP surge alone. Animals were then killed at ZT10 and blood samples were collected to measure serum osmolality and haematocrit as explained above. Horizontal hypothalamic slices containing the OVLT and SCN were prepared from 2−4-month-old male ArchT or ChETA mice. These animals were not subjected to any behavioural or optogenetic experiments before slice preparation. Mice anaesthetized with isoflurane were killed by decapitation at ZT18–18.5. The brain was rapidly removed and immersed in near-freezing (0–4 °C) oxygenated (95% O , 5% CO ) artificial mouse cerebrospinal fluid (AMCSF) composed of the following (in mM): 128 NaCl, 3 KCl, 1.23 NaH PO , 1.48 MgCl , 2 CaCl , 25.95 NaHCO and 10 d-glucose (all obtained from Sigma except for NaCl and CaCl , which were purchased from Fisher Scientific). A trimmed block of brain was glued, cortex down with the rostral pole facing upwards, to a mounting block angled at 34° relative to the horizontal plane. A single 350-μm slice was then obtained (Extended Data Fig. 2) and transferred dorsal side up to a beaker containing warmed (32 °C) oxygenated AMCSF and allowed to incubate for 60 min. The slice was then transferred dorsal side up to a recording chamber where it was perfused with warmed (32 °C) oxygenated AMCSF at a rate of 2–3 ml min−1. Cells were observed on a black and white monitor using an Olympus BX51WI upright microscope coupled to a video camera. Electrodes were visually guided to the cell using a motorized micromanipulator (s.d. Instruments) and cell-attached recordings were made using a MultiClamp 700B amplifier (Molecular Devices). Membrane voltage was digitized via a Digidata 1440A interface coupled to a personal computer running Clampex 10.3 software (Molecular Devices). A band-pass filter was applied during cell-attached recordings (800 Hz–1.8 kHz). Patch pipettes were back-filled with AMCSF and their resistance in the bath was 5.5−7.5 MΩ. Cell-attached recordings for firing rates of OVLT neurons during the BP were performed from ZT19.5 to ZT21.5 and during the AP from ZT21.5 to ZT23.5. Cell-attached recordings from OVLT neurons were obtained by making a loose seal. If cells did not fire during the recording, a brief zap of 25 μs was delivered at the end of the recording to evoke firing in order to confirm they were indeed silent cells that were otherwise capable of firing detectable action potentials. The average firing rate was calculated by dividing the total number of spikes recorded by the duration of the recording period (60 s). One cell was excluded from this analysis because its firing rate was more than four times greater than the standard deviation of the group. Evans blue was used to evaluate the boundaries of the OVLT in mice as previously reported for rat28. Briefly, mice were anaesthetized with isoflurane and injected intravenously with 0.2 ml of 1% Evans blue dissolved in PBS. After 15 min, the animals were transcardially perfused with 20 ml PBS, and then the brain was extracted and fixed by immersion for at least 48 h in 4% paraformaldehyde (PFA) dissolved in PBS. Serial sections (50 μm thick) were cut and mounted onto slides, and Evans blue fluorescence was visualized using RS Image (version 1.9.2; Roper Scientific) using a 10× objective (na = 0.4) attached to an Olympus BX51WI upright microscope and a CoolSnap HQ camera (Photometrics). Fluorescence was observed at 700 nm and excited at 650 nm using an X-Cite XLED1 system (Lumen Dynamics, Excelitas Canada) and a BrightLine Pinkel filter set (DA/FI/TR/Cy5-4X-B-OMF; Semrock). C57/B6 mice (60 d) were anaesthetized with isoflurane and stereotaxically injected with FluoSpheres (0.04 μm, yellow-green fluorescent 488 nm, 5% solids, azide free; ThermoFisher Scientific) into the OVLT (100−200 nl; from Bregma with a 7° vertical angle, X: 1.2 mm, Y: 0 mm, Z: −4.6 or −4.7; Extended Data Fig. 3) with a Neuros syringe (0.5 μl, 32 gauge, Hamilton) over 5−10 min. The spheres were allowed to be retrogradely transported for 7 days, after which the animals were anaesthetized with isoflurane and perfused via the heart with 10 ml PBS followed by 300 ml PBS containing 4% PFA. The brains were extracted and postfixed by immersion for 48 h in 4% PFA in PBS. A vibratome was used to obtain serial coronal tissue sections (50 μm thick). Sections were blocked with 10% normal goat serum (in PBS containing 0.3% Triton-X100) and incubated overnight at 4 °C with primary antibodies. Following wash, sections were incubated for 1 h with fluorescently labelled secondary antibodies. Sections were then washed and mounted on coverslips using Prolong Gold Antifade reagent (Life Technologies). All images were acquired using a confocal microscope (FV1000, Olympus Canada). The following primary antibodies were used: PS41 anti-VP neurophysin mouse monoclonal antibody (1:50), and VA4 anti-VP neurophysin rabbit polyclonal antibody (1:1000) developed and contributed by H. Gainer (National Institutes of Health, Bethesda, MD). Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (568 nm and 647 nm; Life Technologies; 1:500). Brains were extracted from wild-type and V1aR−/− mice at ZT21.5–22 (for BP analysis) and ZT23.5–24 (for AP analysis) and immersion fixed in 4% PFA. Tissue sections (50 μm thick) from wild-type and V1aR−/− mice were processed using a rabbit polyclonal c-Fos antibody (EMD Millipore; 1:5,000) with a chicken anti-NeuN (Hexaribonucleotide Binding Protein-3a) polyclonal antibody (ABN91, 1:500; EMD Millipore; in OVLT), or with PS41 (as above) in the SCN. Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (488 nm, 568 nm, and 647 nm; Life Technologies; 1:500). Cells were considered c-Fos-positive if they were >100% above background. For OVLT analysis, cells were counted in a 200 × 200 μm field centred over the nucleus. For SCN, density was assessed over the entire nucleus. Sample size (n) refers to the number of sections analysed, which were obtained from 2 animals in each group. Coronal 300-μm slices were obtained from mouse brain as described above. These animals were not subjected to any behavioural or optogenetic experiments before slice preparation. Cell-attached recordings were obtained from visually identified fluorescent VP cells (see Extended Data Fig. 4). Green fluorescence in ArchT mice was detected using EN GFP 41017 filter cube (Chroma Technology) and red fluorescence in ChETA mice was detected using 49004 (Chroma Technology). Firing rate was assessed as described above. One cell was excluded from this analysis because its firing rate was more than four times greater than the standard deviation of the group. Horizontal hypothalamic slices were obtained from male rats as previously described29. Briefly, rats were killed by decapitation using a small rodent guillotine. The brain was rapidly removed and immersed in near-freezing (0–4 °C) oxygenated (95% O , 5% CO ) artificial rat cerebrospinal fluid (ARCSF) composed of the following (in mM) 120 NaCl, 3 KCl, 1.23 NaH PO , 1.48 MgCl , 2 CaCl , 25.95 NaHCO and 10 d-glucose. A trimmed block of brain was glued cortex-down with the rostral pole facing upwards to a mounting block angled at 38° relative to the horizontal plane. The assembly was then placed in a vibratome and a first cut was made to discard the tissue lying anterior and ventral to the optic tracts and most of the optic chiasma. A single 400-μm slice was then obtained and transferred dorsal side up to a beaker containing warmed (32 °C) oxygenated ARCSF and allowed to rest for 60 min. Slices were then placed in a warmed (32 °C) recording chamber perfused at a rate of 2–3 ml min−1. HEK293 cells (gift from Sal Carbonetto; not tested for mycoplasma) were kept in DMEM (Wysent) at 37 °C and 5% CO . The co-transfection of pGP-CMV-avp 6m (AddGene) and the human V1aR (provided by M. Bouvier, University of Montreal, QC) (2.5 μg each) was done using Lipofectamine 3000 (Invitrogen). 24 to 48 h after transfection the cultures were treated with trypsin and cells were lifted and plated over recently cut rat horizontal brain slices resting in beakers as explained above. Preparations were allowed to rest for 2 h, allowing cells to attach to the slice before starting the experiment. Experiments were completed during the subjective BP (ZT19.5−21.5) when VP release was low. Slices were carefully placed in the recording chamber, and a bipolar electrical stimulating electrode (pair of 65 μm o.d. platinum wires) was placed in the SCN. Electrical pulses (20–80 μA, 0.1−0.5 ms; 10 Hz, 40 s) were delivered via an isolated stimulator (DS2, Digitimer) triggered via a programmable digital timer (D4030, Digitimer). Fluorescence of GCaMP6m in HEK293 cells was observed using the EN GFP 41017 filter cube. Images were collected using Imaging Workbench 6.0 (INDEC BioSystems) at a rate of 1 image every 5 s (exposure 0.2 s). In control conditions, only pGP-CMV-GCaMP6m was transfected and not V1aR. Dose–response analysis and specificity were assessed on HEK293 cells plated on glass coverslips (Extended Data Fig. 5). VP dissolved in water (0.1 mM) was kept frozen until required. All images were analysed using Fiji30. Fluorescence in regions of interests (HEK cells) was corrected for bleaching determined by fitting a single exponential. Background fluorescence was subtracted from all values. Values of fluorescence at various time points were expressed relative to baseline. Changes in fluorescence relative to baseline (average of 30 s before stimulation) were determined from the average of values observed during a 30-s period following the onset of the response. Slices were obtained as mentioned above. Bicuculline was dissolved directly into the ARCSF at the required concentration (10 μM). Kynurenate was first dissolved into a small volume (<0.5 ml) of 1 N NaOH and subsequently diluted into a larger volume of ARCSF at the required concentration (3 mM). All whole-cell experiments were performed in the presence of kynurenate and bicuculline. All recordings were made during subjective night (ZT5−11). Whole-cell recordings from OVLT neurons were made using patch pipettes prepared from glass capillary tubes (1.2-mm outer diameter, A-M Systems) filled with the appropriate internal solution. Pipette resistance in the bath was 3.5−5.5 MΩ. Series resistance was 10−30 MΩ. A bipolar stimulating electrode was placed in the SCN at the beginning of each recording session. Electrical pulses (20–80 μA, 0.1−0.5 ms; 10Hz, 30 s) were delivered as described above. For gap-free whole-cell current clamp recordings, pipettes were back-filled with a solution containing the following (in mM): 140 K+-gluconate, 2 MgCl , 10 HEPES, 2 ATP(Na ), 0.4 GTP(Na ) (pH adjusted to 7.25 with NaOH). Baseline average firing rates were calculated over a window of 60 s immediately preceding SCN stimulation, and the corresponding voltage was obtained from the peak of an all-points voltage histogram. SCN stimulation evoked firing rates were calculated over a window of 60 s during the maximal firing response within 2 min of the end of stimulation. Post-stimulation voltage was obtained during the corresponding period. Current clamp analysis (Fig. 3f) was restricted to cells maintained by current injection between −35 and −50 mV (values not corrected for liquid junction). Aliquots of SR49059 dissolved in DMSO (10 mM) were diluted into ARCSF to achieve a final concentration of 10 μM. For whole-cell voltage clamp experiments, steady state current–voltage (I−V) relations were obtained from the current responses induced by slow voltage ramps (−110 to +10 mV; 2 s, V −50mV). Pipettes were backfilled with solutions corresponding to the experiment in question. K+ internal solutions were composed of the following (in mM): 140 K+-gluconate, 2 MgCl , 10 HEPES, 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Cs+ internal solutions were composed of the following (in mM): 140 CsMeS, 10 HEPES, 2 MgCl , 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Cl− internal solutions were composed of the following (in mM): 100 CsMeS, 40 CsCl, 10 HEPES, 2 MgCl , 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Currents induced in OVLT neurons induced by SCN stimulation were evaluated as the difference current obtained by subtracting the average of two I−V curves taken 1 min after SCN stimulation from the average of two I−V curves recorded preceding SCN stimulation. When required, a lowpass filter was applied to the difference current trace (lowpass 80−200 Hz). SCN-induced changes in membrane conductance were quantified as the slope of the difference current I−V curve, measured over a range of 20 mV below the reversal potential. In the analysis of Fig. 3i, j, two cells were excluded because SCN-induced currents did not show a reversal potential. VP release caused by light-induced depolarization of SCN VP axons was performed using co-transfected HEK293 cells prepared as described above, in horizontal slices prepared from ChETA mice. Blue light (473 nm DPSS Laser system, Laserglow Technologies) was delivered over the OVLT (50 ms, 22 mW, 5 Hz) for 30 s through a fibre-optic probe (slim titanium magnetic receptacle, 200 μm fibre optic diameter/240 μm diameter with coating/5.5 mm length numerical aperture 0.22, Doric Lenses), connected to a mono fibre-optic patchcord (2 m) via a fibre-optic rotary joint. Horizontal slices were prepared from either ChETA or ArchT mice. Cell-attached recordings were performed as previously described. Blue light was delivered over the OVLT as previously described (50 ms, 22 mW, 5 Hz) for 30−60 s in ChETA slices during the BP (ZT19.5−21.5). Additional light intensities were used to determine threshold sensitivity (Extended Data Fig. 9). Yellow light (589 nm, 13 mW, constant light, DPSS laser system, Laserglow Technologies) was delivered over the OVLT in ArchT slices during the AP (ZT21.5−23.5). SR49059 (10 μm) was bath-applied during experiments as noted. Firing rates were calculated by counting the number of spikes during 30−60 s. Firing rates were normalized to the average baseline firing of the time period in question. Coronal slices were prepared from ChETA or ArchT male or female mouse brains. Cell-attached recordings were performed on identified VP neurons as previously described. Once sufficient baseline was recorded (2–3 min), blue light (for ChETA) or yellow light (for ArchT) was delivered to the slice. Analysis of light-induced changes in firing rate was performed by comparing firing rates averaged during 30−60 s periods recorded before and during light stimulation. ChETA and ArchT male mice (60–90 d) were stereotaxically implanted with a slim magnetic receptacle fibre-optic cannulas (5.5 mm, Doric Lenses) above the OVLT (from bregma with a 7° vertical angle, X: 1.18 mm, Y: 0 mm, Z: –4.5; ref. 31). Cannulas were initially glued to the brain using Metabond (C&B Metabond, Parkell), allowed to dry, then covered with a generous coat of dental cement (Stoelting). Animals recovered for 7 days, after which they were handled for one week to allow habituation to handling and to the fibre-optic patchcord. For testing, animals were placed in metabolic cages on Thursday afternoons. On Mondays, the animals were trained by being connected to the patchcord during the appropriate test period (2.5 h), 1 h post-handling rest, 1 h baseline, 30 min test. Testing started on the following Tuesday. ChETA mice were tested from ZT18.5 to ZT21, and ArchT mice were tested from ZT20.5 to ZT23. During the test period they received either blue light (22 mW continuous or 50 ms, 22 mW, 5 Hz), or yellow light (13 mW continuous) on separate days. Water intake analysis was performed as described above. Following the last day of testing, animals were anaesthetized and decapitated. Optical implants were removed and brains were fixed by immersion for at least 48 h in 4% PFA dissolved in PBS. Serial coronal sections (50 μm thick) were cut to determine the position of the tip of the fibre-optic cannula. Experiments were rejected if the fibre-optic tip terminated rostral or caudal to the OVLT, or more than 200 μm dorsal from the dorsal surface of the OVLT. Serial coronal sections (50 μm thick) were cut from an ArchT mouse brain to analyse the expression of GFP in VP neurons. Sections were processed for immunohistochemistry as described above. A chicken anti-GFP primary antibody (1:1,000, AB13970, Abcam) was used to enhance detection of the fluorescence reporter and the PS41 mouse monoclonal anti-VP neurophysin antibody (1:50; H. Gainer, NIH32, 33) was used to detect VP. Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (568 nm, and 647 nm; Life Technologies; 1:500). Images were analysed using ImageJ 1.50a (NIH) to count the number of VP-labelled SCN neurons and anti-GFP-labelled SCN neurons. As previously described34, single OVLT neurons were aspirated from the slice using large autoclaved micropipettes (1−2 MΩ), which were backfilled with 1.5 μl of a solution containing RNaseIN (10 U μl−1; Life Technologies). Upon contact and gigaseal formation, cells that fired action potentials (neurons) were sucked by negative pressure to collect cytoplasm, then lifted and completely suctioned into the electrode. The contents were then expelled by positive pressure into a 250-μl microcentrifuge tube containing 0.5 μl DNase I (1 U μl−1; Fisher Scientific) and 1 × MgCl buffer and stored over dry ice. Tubes were incubated at 37 °C for 30 min, and the reaction was stopped by adding 1 μl EDTA (25 mM) and incubated at 65 °C for 10 min. The RT reaction was then performed by adding 1 μl 50 μM Random Hexamer primers (Life Technologies), 0.25 μl RNaseIN (10 U μl−1), 1 μl 0.1M DTT, 1 μl 50 mM MgCl2, 1 μl 10 mM (each) dNTPs mix (QIAGEN), 2 μl 5 × First Strand Buffer, and 0.25 μl SuperscriptIII (200 U μl−1; ThermoFisher). The mix was incubated at 50 °C for 2 h and then the cDNA was stored at −20 °C. Nested PCR and nested multiplex single-cell PCR were performed using the following primers: Avpr1a ForOUT3 5′ATCCCATCCAAAACCACTCTGAGCG3′; Avpr1a RevOUT3 5′GGTAACACTTGGAAGAAGGCGACCG3′; Avpr1a ForIN3 5′GAAGAGAGCGAGGTAAGGAAGGACGG3′; Avpr1a RevIN3 5′TGCGGGATGTCTTGCGTGGC3′; V1v ForOUT 5′ATGTGGTAGACATGAGGGAGCTAGAGGC3′; V1v RevOUT 5′AATCTTCCCACTGCTGGCAGCC3′; V1v ForIN 5′TCCAGGGACTAGCCTCATTGGTGGG3′; V1v RevIN 5′TGAGTTCTTCTAGCTTCAGTGTGGGGTG3′. All group data are reported or displayed as means ± s.e.m. and the exact sample size is provided for each experimental group or condition either in the text or as indicated within or below bar graphs. Information about sample collection is also provided where relevant (for example, number of trials per animals, or sections per brain). Differences between groups (two-sided) were compared using Sigmaplot 12.0 (Systat Software). The software first assessed normality of the data distribution. In all cases where the normality test failed, a suitable non-parametric test was performed. All tests used for comparisons are specified in the text. No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.


News Article | October 12, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. When relevant (such as experiments requiring multiple trials), randomization was carried out. Behavioural trial experiments were randomized. There was blinding of initial allocation of animals into groups, but not thereafter. Cell counts were blinded. All animals used in this study were treated in compliance with US Department of Health and Human Services and Baylor College of Medicine IACUC guidelines. For the studies reported here, both male and female mice were considered for analyses. Standard pellet mouse chow (Harlan, 2920X) was used for all experiments, and all animals were maintained on a normal 12-h light–dark cycle. Chat-cre (B6;129S6-Chattm2(cre)Lowl/J), Pomc-EGFP (C57BL/6J-Tg(Pomc-EGFP)1Low/J), Npy-hrGFP (B6.FVB-Tg(Npy-hrGFP)1Lowl/J), ChatloxP/loxP (B6.129-Chattm1Jrs/J), R26LSL-tdTomato (B6.Cg-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J), and Vgat-cre (Slc32a1tm2(cre)Lowl/J) mice were originally purchased and are available from Jackson Laboratories. Chat-cre+/−; R26LSL-tdTomato/+ mice were generated by crossing heterozygous male Chat-cre+/− mice with female homozygous R26LSL-tdTomato mice. ChatloxP/loxP animals were bred and maintained as homozygotes. A Vgat-cre homozygous male was crossed to female C57BL/6J mice to generate heterozygous Vgat-cre+/− animals. Chat-cre+/−, Pomc-EGFP+/− and Npy-hrGFP+/− mice used in this study were maintained as heterozygotes and bred to wild-type C57BL/6J female mice. Genotyping for ChatloxP/loxP, Pomc-EGFP, and Npy-hrGFP animals was done according to available Jackson Laboratory protocols for these strains. Genotyping for Cre was done using primers for Cre recombinase detection (forward primer: 5′-GCATTTCTGGGGATTGCTTA-3′, reverse primer: 5′-GTCATCCTTAGCGCCGTAAA-3′). Animals were deeply anaesthetized using isoflurane and were transcardially perfused with PBS followed by 10% neutral buffered formalin (NBF, Azer Scientific). Brains were dissected and post-fixed in 10% NBF overnight at 4 °C. Brains were cryoprotected in a 20% sucrose/PBS solution at 4 °C for one day, followed by a 30% sucrose/PBS solution at 4 °C for one more day. Brains were then embedded and frozen in OCT and stored at −80 °C. Brains visualized using endogenous or virally-expressing fluorescent reporters were cut using a cryostat (Leica CM1860) in coronal sections at 25–30 μm. For ChAT and β-endorphin immunohistochemistry, 40 μm free-floating sections were blocked for 1 h at room temperature in 10% horse serum blocking solution, made in PBS-TC (1× PBS, 0.5% Triton-X 100, 0.1 mM CaCl , pH 7.35). Sections were then incubated overnight at 4 °C at a 1:200 dilution of block solution containing goat anti-ChAT primary antibody (Millipore, AB144P) or rabbit anti-β-endorphin primary antibody (Phoenix Pharmaceuticals, H-022-33). Sections were then washed 4 times, 30 min each in plain PBS-TC. Sections were then incubated in secondary antibody (donkey anti-goat Alexafluor-488 or Alexafluor-555, Life Technologies) at a 1:200 dilution for 3 h at room temperature. Sections were then washed 4 times for 30 min each in PBS-TC. All sections were mounted using DAPI Fluoromount-G (Southern Biotech, 0100-20). Detection of fluorescent expression was performed using a Leica TCS SPE confocal microscope under a 10× or 20× objective. For all stereotaxic injections, mice were anesthetized using a ketamine/dormitore mixture and were maintained under anaesthesia using vaporized isoflurane with O . All injections were performed using a stereotaxic apparatus synced to Angle Two software for coordinate guidance. For DTR-mediated cell death of cholinergic neurons, female Chat-cre+/− or Chat-cre+/−; R26LSLtdTomato/+ mice (8–10 weeks old) were bilaterally injected into the horizontal limb of the diagonal band of Broca (HDB, right hemisphere, from bregma: AP = +0.14, DV = −5.80, ML = −1.29; left hemisphere, from bregma: AP = +0.14, DV = −5.74, ML = +1.17) with 500 nl per hemisphere of a Cre-dependent AAV-EF1α-FLEX-DTR-P2A-EYFP-WPRE-hGHpA, serotype DJ/8. For conditional Chat knockout experiments, ChatloxP/loxP animals (8–10 weeks old) were bilaterally injected into the HDB with 300 nl per hemisphere of AAV-EF1α-EGFP-P2A-CRE-WPRE-hGHpA for experimental animals, or AAV-EF1α-EGFP-WPRE-hGHpA for control animals (serotype DJ/8 for both AAVs). For synaptophysin tracing experiments using the EGFP variant, Chat-cre+/− mice (8–16 weeks old) were injected bilaterally into the HDB with 500 nL per hemisphere of a Cre-dependent AAV-EF1α-FLEX-Syn::EGFP-WPRE-hGHpA, serotype DJ/8. For synaptophysin tracing experiments using the mRuby2 variant, Chat-cre+/; Pomc-EGFP+/− mice (12 weeks old) were injected bilaterally into the HDB with 500 nl per hemisphere of a Cre-dependent AAV-EF1α-FLEX-Syn::mRuby2-WPRE-hGHpA, serotype DJ/8. Lastly, for in vivo ChR2 behaviour experiments, male Chat-cre+/− mice (12–14 weeks old) were bilaterally injected into the HDB with 500 nl per hemisphere of a Cre-dependent AAV-EF1α-DIO-hChR2(H134R)-EYFP-WPRE-hGHpA (Addgene, plasmid number 20298) serotype 2/9. Male wild-type animals were fasted overnight before being presented with standard pellet mouse chow (Harlan, 2920X) for 3 h the following morning (fed group), while a second group of mice was fasted overnight but not presented with chow (fasted group). Mice were then immediately euthanized and perfused with PBS and 10% NBF. Brains were fixed overnight in 10% NBF before two overnight fixations in 20% and 30% sucrose/PBS solutions. Brains were frozen in OCT cutting compound and cryosectioned at 35 μm. Sections were then blocked for 1 h at room temperature in 10% horse serum blocking solution, made in PBS-TC (1× PBS, 0.5% Triton-X 100, 0.1 mM CaCl , pH 7.35). Sections were then incubated overnight at 4 °C at a 1:200 dilution of block solution containing goat anti-ChAT primary antibody (Millipore, AB144P) and 1:500 dilution of rabbit anti-c-Fos antibody (Calbiochem, PC38). Sections were then washed 4 times for 30 min each in plain PBS-TC. Sections were then incubated in secondary antibodies (donkey anti-goat Alexafluor-488, and donkey anti-rabbit Alexafluor-546) at a 1:200 dilution each for 3 h at room temperature. Sections were then washed 4 times for 30 min each in PBS-TC. All sections were mounted using DAPI Fluoromount-G (Southern Biotech, 0100-20). Detection of fluorescent expression was performed using a Leica TCS SPE confocal microscope under a 20× objective. After allowing 10–14 days for conditional viral expression (injections and viral construct described previously), mice were intraperitoneally (i.p.) injected 3 times daily for 5 days with 800 ng (4 ng μl−1 working solution) of diphtheria toxin (Sigma, D0564) for optimal cell death of targeted cholinergic neurons. Female Chat-cre+/−; R26LSL-tdTomato/+ mice were used initially to validate DTR-mediated cell death by visualizing DBB cholinergic cell loss. For remaining experiments, female Chat-cre+/− animals were used. For controls, age- and gender-matched Chat-cre+/− mice (stereotaxically injected identically into the DBB with AAV-FLEX-DTR-P2A-EYFP) were injected with equal volume (200 μl per injection) of sterile saline. Body weights and daily food intake were measured and averaged per group for each time point presented. For Chat conditional knockout assays, ChatloxP/loxP mice were injected bilaterally into the HDB as previously described with either AAV-EF1α-EGFP-P2A-CRE-WPRE-hGHpA for conditional knockout animals or AAV-EF1α-EGFP-WPRE-hGHpA for controls. Body weights and daily food intake were measured and averaged per group for each time point presented. For cell counts after Chat conditional knockout, 3 mice from each group were euthanized and brains were sectioned at 40 μm for ChAT immunohistochemistry. 10 sections representing the anterior, central, and posterior areas of the DBB were chosen, and blinded, total cell counts based on ChAT immunoreactivity were tallied. A count from all 10 sections from a single mouse brain were totalled and averaged for each group of 3 mice. Data were normalized to control levels of expression and represented as a mean percentage ± s.e.m. Activity (reported as time active per day), O consumption, and metabolic blood assays were performed by the Baylor College of Medicine Mouse Metabolism Core before obesity phenotypes (3 days after diphtheria toxin (DT) treatment), during early stages of obesity and hyperphagia (3 weeks post-DT treatment), and at late stages of obesity and hyperphagia (3 months post-DT treatment). Activity and O consumption assays were performed using the Oxymax Comprehensive Laboratory Animal Monitoring System (CLAMS, Columbus instruments). Lean mass and body fat content was assessed using quantitative MRI. Blood panel assays for cholesterol, leptin, insulin, and glucose were also performed by the Baylor College of Medicine Mouse metabolism core. Blood was collected via the tail vein. Mice were fasted for 4 h before measuring blood glucose. Paired feeding assays were performed with individually-housed, male DT-treated (DBB-ablated) and saline-treated (non-ablated) animals. Assays for determining the contribution of food intake on maintaining obesity were conducted on animals 12-weeks post-ablation. First, daily body weight and ad libitum food intake for all animals was recorded for 7 days to establish baselines for all animals. Then 1 control mouse and 1 experimental mouse were then randomly paired. All food from experimental cages was removed and only an equivalent amount of food consumed the previous day by a mouse’s respective control partner was introduced to the cage. This restrictive period was done for 21 days. Afterwards, all experimental mice were allowed to resume to feed ad libitum once again and food intake and body weight were measured daily for 2 weeks. Change in body weight over time was normalized as a percentage of day 1 initial starting weight for each individual animal. For paired feeding conducted on animals used for Agrp and Pomc transcript analysis, assays were performed 3 days post-ablation to prevent significant weight gain from hyperphagia. A restrictive feeding period was conducted for 21 days, after which mice were euthanized on the morning after the final day, and hypothalamic tissue was harvested for RNA purification and subsequent qRT–PCR (see below). Concurrent with AAV-EF1α-DIO-hChR2(H134R)-EYFP-WPRE-hGHpA injections (as described previously), male Chat-cre+/− mice were bilaterally implanted with 200 μm silica fibre optic implants made in-house (Thor Labs, TS1249968); 230 μm ferrules (Precision Fibre Products, MM-FER2007C-2300) and situated 0.1 mm above the viral injection site. Fibre optic implants were held in place by a cap made from adhesive cement (C&B Metabond Quick! Cement System (Parkell)) for initial base, and crosslinked flash acrylic (Yates-Motloid, 44115 and 44119) for headcap. Mice were allowed at least two weeks for recovery and expression of the virus before assays were performed. For prolonged 2-day stimulation, each mouse was allowed 48 h to acclimate in a behaviour box with free access to food and water (days 1 and 2: acclimation). In addition, acclimation occurred while tethered to a dual fibre optic cord (Doric Lenses) attached to a 473 nm laser source (CrystaLaser CL-2005). After the 48-h acclimation period, a pre-measured amount of food was placed into the chamber and weighed once every 24 h for two days without stimulation (days 3 and 4: pre-stimulation). Over the next 48 h, food was weighed once each day while mice were chronically stimulated with trains of blue light (5 mW, 10 ms pulses, 20 Hz, 5 s trains, 30 s intervals) (days 5 and 6: stimulation). Finally, food was weighed once every 24 h for two final days with no blue light stimulation (days 7 and 8: post-stimulation). As a control group, non-ChR2-expressing mice were injected and implanted in the identical way used for experimental mice. Control mice were acclimated identically and were subsequently subjected to a mock stimulation for 48 h, and food intake was measured each day. For comparisons between pre-stimulation, stimulation, and post-stimulation conditions, paired Student’s t-tests were used. For comparisons between experimental conditions and the control (mock-stimulation) condition, unpaired Student’s t-tests were used. For short-term 2-h stimulation experiments, mice were given 48 h to acclimate in their behaviour chamber. After acclimation, mice were fasted overnight and subsequently presented with a pre-measured amount of food in the morning. For control conditions, mice were not stimulated and food intake was recorded every 30 min for 2 h total. For experimental conditions, mice were stimulated with trains of blue light (5 mW, 10 ms pulses, 20 Hz, 5 s trains, 30 s intervals) for 15 min before presentation of pre-measured chow, and food intake was recorded every 30 min for 2 h total in presence of continued blue light illumination. Trials were randomized and conducted one week apart on the same animals. For experiments targeted at terminal stimulation in the arcuate nucleus of the hypothalamus, male animals were bilaterally injected into the HDB with AAV-EF1α-DIO-hChR2(H134R)-EYFP-WPRE-hGHpA, and a single fibre optic was implanted into the third ventricle at the level of the arcuate (from bregma: AP = −1.70, DV = −5.75, ML = 0.00). For behavioural assays, animals were first allowed 48 h to acclimate to their behaviour cage while tethered to a fibre optic cord. After acclimation, mice were fasted overnight. In the morning, mice were presented with standard pre-measured pellet chow and food intake was recorded every 30 min for 2 h total either under conditions of light stimulation (5 mW, 10 ms pulses, 20 Hz, 5 s trains, 30 s intervals) or no stimulation. Trials were randomized and conducted one week apart on the same animals. Paired statistics were used to compare ‘stim’ and ‘no-stim’ conditions on these animals. As a control group, Cre-negative male littermates were injected with virus and implanted in the same way as experimental mice. Behavioural assays on these mice were done the same way under conditions of light illumination. Comparisons between mock-stimulated and experimental cohorts were done using unpaired statistics. For terminal stimulation experiments in the presence of mecamylamine (Tocris, catalogue number 2843), mice were fasted overnight and presented with a pre-measured amount of chow in the morning. Mecamylamine was administered by i.p. injection at 1 mg per kg 15 min before the start of a 2-h feeding in the presence or absence of blue light illumination. Control (sterile 1× PBS i.p. injections) and experimental trials were conducted 1 week apart. Brain slices containing the hypothalamic arcuate nucleus were prepared from 6–8-week-old Pomc-EGFP+/− or Npy-hrGFP+/− transgenic mice of either gender. For ChR2 stimulation and hM4d-mediated inhibition, brain slices containing the DBB were prepared from 12–16-week-old male animals expressing either ChR2::EYFP or hM4D–EGFP in the DBB, respectively. Animals were anaesthetized with isoflurane and brains were rapidly removed and transferred into sucrose-based cutting solution, containing (in mM): 250 sucrose, 25 NaHCO , 1.25 NaH PO , 2.5 KCl, 1.5 MgCl , 2 CaCl , 10 glucose, and continuously bubbled with 5% CO / 95% O . 300-μm-thick coronal brain slices were prepared using a Leica VT 1200 vibratome and placed for recovery in a 5% CO / 95% O bubbled regular ACSF solution, containing (in mM): 128 NaCl, 24 NaHCO , 1 NaH PO , 3 KCl, 1 MgCl , 1.6 CaCl , 8 glucose. After at least 1-h recovery and 20–30 min before recording, slices were transferred into a recording chamber continuously perfused at 2 ml min−1 with aforementioned ACSF at 24 °C. POMC-, NPY-, ChR2::EYFP-, and hM4D-expressing neurons were identified by transmitted light DIC and EGFP fluorescent imaging using a Slicescope Pro 6000 optical setup (Scientifica), equipped with a CoolLED pE-100 470 nm excitation light source, 49002- ET-EGFP (FITC/Cy2) emission filter (Chroma Technology), and optiMOS camera (QImaging). Electrical activity of neurons was recorded in whole-cell current clamp mode using a Multiclamp 700b amplifier and a 1440a Digidata interface (Molecular Devices). Pipette solution contained (in mM): 10 KCl, 120 K gluconate, 1 MgCl , 10 HEPES, 1 EGTA, 5 Na2-ATP, 0.01 Na-GTP, pH 7.2. To test the cholinergic effects on POMC and NPY neurons, baseline neuronal activity was prerecorded for at least 10 min to assure a stable firing rate, after which acetylcholine (Sigma-Aldrich, A6625) was added to the bath perfusion at 100 μM. For ChR2 stimulation, 12 consecutive trains of blue light were given at 30 s intervals. Each train lasted for 5 s with 10 ms light pulses delivered at 20 Hz. For recordings from hM4D-expressing cells, we recorded 90 s baseline sweeps and delivered 5 s current injections at 2 pA and 10 pA, spaced 25 s apart. This protocol was repeated again 6 min after CNO bath application. For all recordings, neuronal firing activity was analysed offline using the event detection feature of Clampfit 10.3 software (Molecular Devices). Repeated measures ANOVA with Holm–Sidak multiple comparison, and Sigma Plot 11.0 software (Systat Software) were used for statistical analyses of data, where applicable. For acute acetylcholine responses, a localized 2 s application of acetylcholine (100 mM, Sigma-Aldrich, A6625) was applied near a patched POMC-EGFP neuron (held at −70 mV) using a FemtoJet (Eppendorf). Each recording was performed using a 20-s sweep with an inter-trial interval of 1 min and repeated for 5 sweeps each for baseline, synaptic blockers (10 μM CNQX (Tocris), 20 μM APV (Tocris), 50 μM GABAzine (Tocris), and nicotinic blockers (10 μM mecamylamine (Tocris), 0.1 μM methyllycaconitine citrate (Tocris), and 10 μM dihydro-β-erythroidine hydrobromide (Tocris). R26LSL-tdTomato animals were stereotaxically injected bilaterally with 70 nl of CAV-Cre virus (purchased from the vector core at the Institut de Génétique Moléculaire de Montpellier) targeted to the arcuate nucleus (from bregma: AP = −1.70, DV = −5.80, ML =  ±0.20). Sections through the DBB were obtained and stained for ChAT using the identical ChAT IHC protocol detailed previously. All sections were mounted using DAPI Fluoromount-G (Southern Biotech, 0100-20). Detection of fluorescent expression was performed using a Leica TCS SPE confocal microscope under a 10× or 20× objective. 12-week-old, male Chat-cre+/− mice were sterotaxically injected bilaterally into the DBB (500 nl per hemisphere) with an hM4D–EGFP-expressing AAV (AAV-CBA-FLEX-hM4Di-P2A-EGFP-WPRE-sv40pA, serotype 2/9, Addgene, plasmid number 52536). After a two-week recovery, mice were fasted overnight in their home cage, and food was presented in the morning. Food intake was measured every 30 min for 2 h total, in the presence or absence of CNO. For control experiments, mice were injected i.p. with sterile saline and allowed to wait 15 min before food presentation. For experimental conditions, mice were injected i.p. with CNO (5 mg per kg) and allowed to wait 15 min before food presentation and measurement, which was recorded for 2 h in total. Trials were randomized and conducted one week apart on the same animals. Paired statistics were used to compare ‘saline’ and ‘CNO’ conditions on these animals. For Agrp and Pomc transcript analysis from the arcuate nucleus, 4 DBB-ablated mice and 4 non-ablated mice were euthanized in the morning and their brains were immediately dissected. For AChR transcript analysis, 4 wild-type male mice were taken and brains dissected and processed identically. Small sections of the ventral hypothalamus containing the arcuate nucleus were dissected out and RNA was isolated following the TRIzol (Life Technologies, 15596-018) protocol for tissue homogenization and RNA isolation. In brief, tissue was placed in 1 ml of TRIzol reagent and homogenized using a 1.5 ml pre-sterilized pestle. Homogenized samples were allowed to incubate at room temperature for 5 min. 0.2 ml of chloroform was added, and the tube was shaken vigorously by hand for 15 s. The sample was again incubated at room temperature for 2 min and centrifuged at 12,000g for 15 min at 4 °C. The upper aqueous phase was pipetted into a new tube, 0.5 ml of isopropanol was added, and the mixture was incubated at room temperature for 10 min. The tube was centrifuged at 12,000g for 10 min at 4 °C. The supernatant was removed and the RNA pellet was washed with 1 ml of 75% ethanol. The sample was vortexed and centrifuged at 7,500g for 5 min at room temperature. The pellet was air-dried for 15 min and resuspended in 40 μl RNase-free water at 60 °C. RNA was DNase-digested using the manufacturer’s protocol (Promega). DNase was inactivated via phenol-chloroform extraction. Purified RNA was quantified using a NanoDrop (Wilmington, DE), and first-strand cDNA was synthesized using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Negative controls did not contain reverse transcriptase. Transcripts were amplified using standard PCR conditions (95 °C for 120 s, 95 °C for 20 s, 60 °C for 20 s, 72 °C for 20 s, 34 cycles, 7 °C for 300 s, 4 °C until storage at −20 °C). Amplified products were run on 2% agarose gels, imaged, and quantified using ImageJ software. AChR primer sequences were as follows (forward primer first, reverse primer second, in 5′–3′orientation), CHRNA1: GTCCAATAACGCCGCTGAGG, CTAGCGATGGCTATGGCTGG; CHRNA2: GACTCTTCGGTGAAGGAAGATTG, AGAGCAGAAGATGGTTGTCCAG; CHRNA3: GCCAAAGAGATTCAAGATGATTGG, TCTGGGGCTATTGAGAAAGTGC; CHRNA4: GACTTCTCGGTGAAGGAGGAC, GGAAGATGTGGGTGACTGACG; CHRNA5: CGTCCGCGAGGTTGTTGAAG, AGCTGCTTGACTGCTCACTAAG; CHRNA6: CAAACGAGGTATAAGACGACTG, TCTTGTGGGGCTAGCTCGG; CHRNA7: CCTAAGTGGACCAGGATCATTC, ATGTAGAGCAGGTTGCCATTGC; CHRNA9: GTCCCTCTGATAGGAAAATACTAC, CTAAGGCAGCTCTCACCCAC; CHRNA10: ACTCATCGGAAAGTACTATATGGC, GACTCTAATGGCTTGGACTGTC; CHRNB1: ACCAGATGCAGGAGAGAAGATG, GAGCGATGATGCAGGTTGAGG; CHRNB2: TGACCAGAGTGTGAGGGAGG, AGCTGCAAATGAGAGACCTCAC; CHRNB3: ACTTCATCAGTCAGGTTGTTCAAG, CTAGGTGGGATTCTCTCTATGTG; CHRNB4: ATCAGAGTGTCATCGAGGACTG, CACTAGGCTGCTCATATCATCC; CHRM1: GCCAAGGTGATGCCCTTACTC, TGCCTGTCACTGTAGCCAGAG; CHRM2: AGAGCCCTGAAGTCGCAGATC, CTCCCTGGATCTGGCTTTCAG; CHRM3: GGCTTCCTGGCATTGGTGAC, GCCAGAGGTCACAGGCTAAG; CHRM4: TGACTGGTTCCCTGAGCCTG, AGTAGCCCTTGATGATGTATAAGG; CHRM5: ACTATTACCTGCTCAGCTTGGC, GTAACGATCAAAGCTAATCACCAG. AgRP products were quantified by qPCR using the following primer pair: GCGGAGGTGCTAGATCCACAGAA and AGGACTCGTGCAGCCTTACAC. POMC products were quantified by qPCR using the following primer pair: AGAACGCCATCATCAAGAAC and AAGAGGCTAGAGGTCATCAG. Actin was used as a reference control using the following primer pair: GCAAGCAGGAGTACGATGAG and TAACAGTCCGCCTAGAAGCA. For quantitative transcript analysis, all reactions were done in triplicates with no reverse transcriptase negative control samples. Samples were prepared according to the BIO-RAD iQ SYBR Green Supermix instructions. Briefly, cDNA was diluted to 1 ng μl−1 and primers were diluted to 2.5 μM stock of combined forward and reverse primers. Reactions were set up in 15 μl total volume per sample (7.5 μl SYBR Green Supermix, 5 μl cDNA, 1.5 μl forward and reverse primer mix, 1 μl water) in Applied Biosystems Advanced Studio 3 compatible 96-well plates. Plates were sealed with adhesive film and mixed thoroughly before amplification. Amplification occurred on the Applied Biosystems Advanced Studio 3 qPCR machine on its standard amplification protocol. All transcript analysis was standardized to the amplification curve of actin for each sample, and a Student’s t-test was performed to analyse differences in transcript expression among samples. With the exception of electrophysiological-based experiments (previously described), all other statistical analyses were performed using GraphPad Prism 6 software (GraphPad), accounting for appropriate distribution and variance to ensure proper statistical parameters were applied. Experimental sample sizes were chosen according to minimal accepted norms within the field. With regards to experimental randomization for cell ablation, Chat conditional knockout, and optogenetic behaviour assays, mice were randomly separated into two groups before manipulation by an independent, blinded assistant not involved in experimentation or experimental design. For quantification of Chat conditional knockout in the DBB, DBB images were acquired by an independent assistant not involved in the experimentation and cell counts were then objectively tallied by a second assistant without knowledge of the experimental groups. Statistical methods used are described in figure legends for the respective experiments.


Adult male C57BL/6J mice (Jackson Laboratories) or Ai9 reporter mice (Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)HzeIJ; Jackson Laboratories) were group housed (25–35 g; 6–8 weeks old) with littermates until surgery. For all experiments, mice underwent surgery during which they were anaesthetized with 0.8–1.5% isoflurane vaporized in pure oxygen (1 l min−1) and placed within a stereotactic frame (David Kopf Instruments). Ophthalmic ointment (Akorn) and a topical anaesthetic (2% lidocaine; Akorn) were applied during surgeries, and subcutaneous injections of sterile saline (0.9% NaCl in water) were administered to prevent dehydration. During surgeries, virus injections were administered unilaterally (for two-photon microscopy experiments) or bilaterally (for optogenetics or anatomical experiments) targeting dorsal medial PFC (specifically prelimbic cortex; 500 nl per side; relative to bregma: AP, +1.85 mm; ML, ±0.60 mm; DV, −2.50 mm), bilaterally targeting NAc (500 nl per side; relative to bregma: AP, +1.42 mm; ML ±0.73 mm; DV, −4.80 mm), and/or on the midline targeting PVT (300 nl; relative to bregma: AP, −1.46 mm; ML, −1.13 mm; DV, −3.30 mm; 20° angle). The UNC Vector Core packaged all viruses except canine adenovirus 2 encoding Cre (Cav2-Cre; Institut de Génétique Moléculaire de Montpellier). For two-photon imaging experiments, an optical cannula (Inscopix) was implanted above the PFC injection site (relative to bregma: AP, +1.85 mm; ML, −0.8 mm; DV, −2.2 mm; see ref. 29 for details of using similar surgical protocols for imaging experiments). For optogenetic experiments, custom-made optical fibres30 were implanted bilaterally approximately 0.5 mm above the PFC injection sites (relative to bregma: AP, +1.85 mm; ML, ±0.83 mm; DV, −1.93 mm; 10° angle). For experiments involving head-fixed behaviour, a custom-made ring (stainless steel; 5 mm ID, 11 mm OD) was attached to the skull during surgery to allow head fixation (see Fig. 1a). Following surgeries, mice received acetaminophen in their drinking water for two days, and were allowed to recover with access to food and water ad libitum for at least 21 days. After recovery, mice were water restricted (water bottles taken out of the cage), and 0.6 ml of water was delivered every day to a dish placed within each home cage. Behavioural experiments began when mice weighed less than 90% of free drinking weight (around 10 days for all experiments). To ensure good health and weight maintenance, mice were weighed and handled daily. This protocol resulted in weight stabilization between 85–90% of free-drinking weight during each experiment. No mouse was given more or less than 0.6 ml of water for weight concerns during water restriction procedures, nor did any health problems related to dehydration arise at any point from these protocols. All experimental procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals (National Institutes of Health), and were approved by the Institutional Animal Care and Use Committee at the University of North Carolina prior to experiments commencing. Following recovery from surgery, mice were habituated to head fixation for 3 days, during which unpredictable drops of sucrose (10% sucrose in water; 2.0–2.5 μl) were delivered intermittently for one hour (approximately 60 drops per hour) through a gravity-driven, solenoid-controlled lick tube. Once the mice displayed sufficient licking (>1,000 licks per session), they underwent Pavlovian conditioning. During each conditioning session, two cues (3 kHz pulsing or 12 kHz constant tones, 2 s, 70 dB) were randomly presented 50 times before the delivery of sucrose (CS+, 10% sucrose in water; 2.0–2.5 μl) or no sucrose (CS−), such that there was a one second trace interval between delivery of the CS+ and sucrose (see Fig. 1b). The cue contingencies were counterbalanced across cohorts of mice to ensure that mice acquired conditioned licking in response to either tone when paired with sucrose. The inter-trial interval between the previous reward delivery (CS+) or withholding time (CS−) and the next cue was chosen as a random sample from a uniform distribution bounded by 40 s and 80 s. Cue discrimination was quantified using the area under a receiver operating characteristic (auROC) formed by the number of baseline-subtracted licks during the CS+ versus CS− trace intervals. For both two-photon and optogenetic behavioural experiments, we classified sessions as ‘early’ or ‘late’ in learning, defined by both behavioural performance (early, auROC < 0.65; late, auROC > 0.66) and session number (early, sessions 1–5; late, sessions 7 or later). These criteria were used as post hoc analysis revealed that an auROC > 0.66 approximates high performance in a phase space formed by behavioural performance across sessions. Finally, behavioural data are displayed and analysed throughout the manuscript as the change in lick rate between each 3-s cue period and 1-s baseline period (baseline period is immediately before each cue). In addition, we show raw lick rates during both the cue and baseline periods for all imaging experiments (see Extended Data Fig. 1). Baseline lick rates remained relatively low across all experiments, and therefore for optogenetic studies only the change in lick rate is shown and analysed (see Figs 4, 5 and Extended Data Figs 8 and 9). Experimental design. Two-photon microscopy was used to visualize activity dynamics of PFC neurons in vivo. A virus encoding the calcium indicator GCaMP6s18 (AAVdj-CaMK2a-GCaMP6s; 5.3 × 1012 infectious units per ml) was injected into PFC (see Subjects and surgery). For imaging projection-specific neurons, a virus encoding the Cre-dependent calcium indicator GCaMP6s (AAVdj-ef1α-DIO-GCaMP6s; 3.1 × 1012 infectious units per ml; from Karl Deisseroth) was injected into PFC, and the retrogradely transported canine adenovirus encoding Cre-recombinase31, 32 was injected into either NAc or PVT (Cav2-Cre; 4.2 × 1012 infectious units per ml). After a minimum of 8 weeks to allow virus transport and infection, mice underwent Pavlovian conditioning, during which GCaMP6s-expressing neurons were visualized using two-photon microscopy. Data acquisition, signal extraction, and analysis. A two-photon microscope (FVMPE-RS) was equipped with the following to allow imaging of PFC in vivo: a hybrid scanning core set with galvanometers and fast resonant scanners (allows up to 30 Hz frame-rate acquisition; set to 2.5 Hz), multi-alkali PMT and GaAsP-PMT photo detectors with adjustable voltage, gain, and offset features, a single green/red NDD filter cube, a long working distance 20× air objective designed for optical transmission at infrared wavelengths (Olympus, LCPLN20XIR, 0.45 NA, 8.3 mm WD), a software-controlled modular xy stage loaded on a manual z-deck, and a tunable Mai-Tai Deep See laser system (Spectra Physics, laser set to 955 nm, ~100 fs pulse width) with automated four-axis alignment. Before each conditioning session, a particular field of view (FOV) was selected by adjusting the imaging plane (z-axis), and each FOV was spaced at least 50 μm from one another to prevent visualization of the same cells across multiple FOVs. During each conditioning session, two-photon scanning was triggered for each trial 7 s before cue delivery, and a 20 s video was then collected for each trial. Data were both acquired and processed using a computer equipped with FluoView (Olympus, FV1200) and cellSens (Olympus) software packages. Following data acquisition, videos were motion corrected using a planar hidden Markov model (SIMA v1.3)33 and regions of interest (ROIs) were hand drawn around each cell using the standard deviation projection of the motion-corrected video using ImageJ. Next, calcium transient time series data were extracted with SIMA and analysed using custom Python data analysis pipelines written in the laboratory (by V.M.K.N.). For analysis, data were split into two groups (early and late) that were defined based on behavioural performance and the day of conditioning (see Head-fixed behaviour). Next, each recorded neuron was defined as having an excitatory response, inhibitory response, or no response. Significant responses represent significant two-tailed auROC comparing average fluorescence (Δf/f) of the trace interval (1 s after CS offset) versus baseline (1 s before CS onset) where P < 0.05 after Benjamini–Hochberg false discovery rate correction. Each P value for auROC was defined by calculating the P values for the corresponding Mann–Whitney U statistic. χ2 tests were then used to compare the number of CS+ responders to CS− responders for each group. For additional decoding analysis (for example, Fig. 2f, l), we tested whether the identity of the cue on any given trial could be decoded from the mean trace interval response on that trial using support vector machines. To this end, we used the Python module, scikitlearn, with GridSearchCV and a support vector classification (SVC) estimator with a radial basis function kernel, optimizing across the following parameters: γ: {10−2, 10−1, 100, 101, 102}, C: {10−2, 10−1, 100, 101, 102}. Quantification of performance was done using tenfold validation34. For each neuron, the highest accuracy score across these parameters was used as the metric of accuracy. In order to determine whether the population of accuracy scores across all neurons was significantly different from that expected by chance, we performed a single shuffle per neuron by randomizing the cue identity on every trial. The population of shuffled accuracy scores across one shuffle was then compared to the population of unshuffled accuracy scores using a two-tailed Welch’s t-test. Note that since the metric of accuracy was optimized across parameters, the mean accuracy score expected by chance is not 0.5, but is instead closer to 0.55 (Fig. 2f, l and Extended Data Fig. 4d). We also further tested whether the mean activity during the trace interval on a given trial for one neuron could be used to decode the number of licks in the trace interval. This was performed using support vector regression (SVR) in scikitlearn with GridSearchCV with a radial basis function kernel, optimizing across the following parameters: C: 5 logarithmically equidistant points between 10−3 and 103 {10−3, 3.16 × 10−2, 100, 3.16 × 102, 103}, ε: 5 logarithmically equidistant points between 10−3 and 103 {10−3, 3.16 × 10−2, 100, 3.16 × 102, 103}, γ: 10 logarithmically equidistant points between 10−6 and 106 {10−6, 2.15 × 10−5, 4.64 × 10−4, 10−2, 2.15 × 10−1, 4.64, 102, 2.15 × 103, 4.64 × 104, 106}. Quantification of performance was done using tenfold validation of the R2 metric (note that this metric can be infinitely negative, indicating arbitrarily poor performance, but is bounded on the positive end at 1, indicating perfect decoding). We found that as a population, the number of anticipatory licks during the trace interval could not be decoded in the late sessions in CaMK2a-expressing neurons (mean R2 = −1.21), PFC–NAc neurons (mean R2 = −0.92) or PFC–PVT neurons (mean R2 = −0.39). These negative numbers reflect the absence of a relationship between licking and calcium activity in each cell population. Behavioural optogenetics were performed as described in detail previously30. In brief, during surgery a virus encoding Cre-inducible channelrhodopsin-2 (AAV5-ef1α-DIO-hChR2(H134R)-eYFP; 5.0 × 1012 infectious units per ml), halorhodopsin (AAV5-ef1α-eNpHR3.0-eYFP; 8.0 × 1012 infectious units per ml), or control (AAV5-ef1α-eYFP; 6.0 × 1012 infectious units per ml) was injected into PFC; and Cav2-Cre (refs 31, 32) (4.2 × 1012 infectious units per ml) was injected into either NAc or PVT. After a minimum of 8 weeks to allow sufficient virus transport and infection, mice underwent Pavlovian conditioning. For acquisition experiments (for example, Fig. 4), mice underwent eight daily conditioning sessions with laser followed by a test session (no laser). For photoactivation manipulations in ChR2 or control mice, the laser (473 nm; 8–10 mW) was turned on for 5-ms pulses (20 Hz) during 80% of the cue trials, starting at the cue onset and ending at the reward delivery. For photoinhibition manipulations in eNpHR3.0 or control mice, the laser (532 nm; 8–10 mW) did not pulse. Because the laser had no effect in the control mice, these data were collapsed across PFC–NAc and PFC–PVT groups. For expression experiments (for example, Fig. 5), after mice reached high performance criterion (late, auROC > 0.66), they underwent six daily conditioning sessions. Furthermore, every other session was selected for optogenetic manipulations, during which the laser was presented for 3 s during either the cue and trace interval or at random time epochs outside of cue or reward delivery. Because there was no effect of laser in the ChR2 or eNpHR3.0 control mice, these data were collapsed for PFC–NAc groups and PFC–PVT groups. In addition, for expression experiments subsets of control mice were used twice, once as ChR2 controls (blue light), and again as eNpHR3.0 controls (green light). Following experiments, histological verification of fluorescence and optical fibre placements were performed as described previously35. Behavioural data (change in lick rate, see above) was analysed based on a priori comparisons of interest (effect of laser on ChR2/eNpHR3.0 animals versus effect of laser in eYFP animals). For acquisition experiments (Fig. 4; Extended Data Fig. 8a–f), we analysed data from the no-laser test day only, and specifically compared the change in lick rate between the ChR2 or eNpHR3.0 groups versus the eYFP group. To correct for the double comparison (ChR2 or eNpHR3.0 versus eYFP), we performed a Benjamini–Hochberg multiple comparisons correction. For expression experiments (Fig. 5; Extended Data Figs 8 g–l and 9), in each pair of sessions (no laser, laser) we calculated the difference in mean lick rate between the two in order to obtain a statistical measure of the ‘effect of laser’ per session pair. Next, we compared the effects of laser from the ChR2 or eNpHR3.0 groups versus the corresponding effect of laser in the eYFP group. To correct for the double comparison (ChR2 or eNpHR3.0 versus eYFP), we again performed a Benjamini–Hochberg multiple comparisons correction. Considering this, for optogenetic experiments all P values (which are two-tailed throughout the manuscript) have been corrected for multiple comparisons. The anatomy and electrophysiological properties of PFC–NAc and PFC–PVT neurons were evaluated through retrograde tracing36. Specifically, during surgeries the retrograde tracer cholera toxin subunit B conjugated to Alexa Fluor (CtB-488, CtB-594; Molecular Probes) was injected bilaterally into NAc (500 nl per side) and on the midline in PVT (300 nl; colour counterbalanced across mice). Ten days following surgery, animals were killed for histology (n = 3 mice) or slice electrophysiology (n = 3 mice). For anatomical experiments, a student blind to all experiments (E.P.M.) and conditions counted the number of CtB-488 positive, CtB-594 positive, and double-positive neurons in prelimbic medial prefrontal cortex (a subregion of dorsal medial PFC). The distance of each cell from the midline and the layer specificity of each cell were then measured using ImageJ. For electrophysiological experiments, mice were euthanized ten days following surgery for patch-clamp recordings ex vivo (see below for details). The monosynaptic afferents to PFC–NAc and PFC–PVT neurons were identified using a glycoprotein-deleted rabies strategy37 in combination with Cav2-Cre targeting of projection-specific neuron populations. Specifically, during the first surgery a cocktail containing the Cre-dependent starter viruses encoding the G-protein and TVA were injected into PFC (3:1 of AAV5-FLEX-RG and AAV5-FLEX-TVA-mCherry; 300 nl per side), and Cav2-Cre was injected into either NAc (500 nl per side) or PVT (300 nl). Five weeks later, mice were given a second surgery in which the G-deleted rabies virus was injected into PFC (1:5 diluted EnvA-rabies-GFP). Finally, 8 days after the rabies injection each mouse (n = 3 per group) was euthanized for histology and cell quantification. Our rabies protocol led to sparse labelling of PFC-projection neurons, allowing quantification of individual cells in each brain section (40 μm thick). Each ROI was selected based on previous PFC tracing experiments38, as well as the fluorescence intensity observed in our experiments. Next, out of all tissue collected for each ROI in each mouse, we selected the three sections containing the most cells per region, and used confocal microscopy to get cellular-resolution images of all cells in each of those sections. For each section, we quantified all individual input neurons (GFP+) and starter cells (both GFP+ and mCherry+). Considering that the anterior cingulate cortex (ACC) was close to the PFC injection site, some sections containing ACC also had starter cell labelling. Thus, because we were interested in long-range inputs from ACC only, only sections that did not have mCherry labelling were used for ACC input quantification. Finally, rabies-tracing data were analysed by comparing the number of cells in each section across groups (raw neuron count), and by comparing the percentage of input neurons per starter cell for each particular mouse. Mice were anaesthetized with pentobarbital (50 mg kg−1) before transcardial perfusion with ice-cold sucrose cutting solution containing the following (in mM): 225 sucrose, 119 NaCl, 1.0 NaH PO , 4.9 MgCl , 0.1 CaCl , 26.2 NaHCO , 1.25 glucose, 305 mOsm. Brains were then rapidly removed, and coronal sections 300 μm thick were made using a vibratome (Leica, VT 1200). Sections were then incubated in aCSF (32 °C) containing the following (in mM): 119 NaCl, 2.5 KCl, 1.0 NaH PO , 1.3 MgCl, 2.5 CaCl , 26.2 NaHCO , 15 glucose, approximately 306 mOsm. After an hour of recovery, slices were constantly perfused with aCSF (32 °C) and visualized using differential interference contrast through a 40× water-immersion objective mounted on an upright microscope (Olympus BX51WI). Whole-cell recordings were obtained using borosilicate pipettes (3–5 MΩ) back-filled with internal solution containing the following (in mM): 130 K gluconate, 10 KCl, 10 HEPES, 10 EGTA, 2 MgCl , 2 ATP, 0.2 GTP (pH 7.35, 270–285 mOsm). Current-clamp recordings were obtained from GCaMP6s-expressing neurons to identify how action potential frequency correlated with GCaMP6s fluorescence. Specifically, to determine how elevations in action potential frequency influence GCaMP6s fluorescence, a 1 s train of depolarizing pulses (2 nA, 2 ms) was applied at a frequency of 1, 2, 5, 10 or 20 Hz. To determine how attenuations in action potential frequency influence GCaMP6s fluorescence, a 3 s pause was applied after a 10 s baseline train of depolarizing pulses (2 nA, 2 ms; 1, 2, 5, 10 or 20 Hz). Finally, to determine if hyperpolarization influences GCaMP6s fluorescence in the absence of action potential frequency modulation, a 3 s hyperpolarizing step (150 pA) was applied in neurons that were held either below or above resting membrane potential. During electrophysiological recordings, GCaMP6s fluorescence dynamics were visualized using a mercury lamp (Olympus, U-RFL-T) and microscope-mounted camera (QImaging, optiMOS). Imaging data were acquired using Micro-Manager, and extracted through hand-drawn ROIs for each recorded neuron using ImageJ. Current-clamp recordings were also obtained to identify the intrinsic properties of PFC–NAc and PFC–PVT neurons in retrograde tracing experiments, as previously described39. First, action potential firing was examined by applying a series of long depolarizing sweeps (800 ms) at +25 pA steps (0–450 pA). Next, rheobase (the minimum amount of current required for an action potential to fire) was measured by applying a series of short depolarizing sweeps (50 ms) at +10 pA steps (starting at 0 pA) until the recorded neuron fired an action potential. For all patch-clamp experiments, data acquisition occurred at 1 kHz sampling rate through a MultiClamp 700B amplifier connected to a Digidata 1440A digitizer (Molecular Devices). Data were analysed using Clampfit 10.3 (Molecular Devices). The nature of all imaging and behavioural experiments yields high-power datasets, as we can test responses to reward-predictive cues hundreds of times within a single session. Thus, although the experiments themselves require rigorous experimentation, the number of mice that are required for each experiment is generally 3–6 per group, depending on the effect size (which was not predetermined for these experiments). Mice were randomly picked for each group in each experiment, by alternating the surgery for each mouse in a cage. During data collection, investigators were only blind to the conditions for rabies tracing cell counting and CtB cell counting. The only mice excluded from final analysis were those that died before or during the experiments (n = 3). For optogenetic experiments, mice were excluded if histology confirmed ectopic virus expression outside of PFC (n = 1), or if optical-fibre placements were not in dorsomedial PFC (n = 0). For data analysis, equal variance was not assumed for behavioural optogenetics or imaging datasets. Equal variance was assumed for cell counting experiments and electrophysiological experiments. We used Python (codes written by V.M.K.N.) to analyse imaging and optogenetic datasets included in this manuscript (see Figs 1, 2, 3, 4, 5). That data, as well as the codes used for analysis, are openly available online (https://github.com/stuberlab). All other data are available upon request from the corresponding author.


A 465 kHz sinusoidal signal was provided by a signal generator and applied through an amplifier (both Ultraflex) to a 2-turn solenoid coil with a radius of 2.5 cm to produce an electromagnetic field. The field strengths tested were 31 mT, 27 mT and 23 mT. Samples were placed within the solenoid. A static magnetic field for imaging experiments was produced using a neodymium-iron-boron permanent magnet (0.25 × 1 inch, axially magnetized, K&J Magnetics). This was able to produce a magnetic flux density of over 5 kilogauss at the magnet surface. Field strengths of 280 mT and 130 mT were generated by increasing the distance from the cells to the magnet surface (2 mm and 5 mm, respectively). A N52 grade neodymium magnet (0.06 × 0.25 inch, axially magnetized, K&J Magnetics) was used for electrophysiological studies. The magnetic field for in vivo studies was generated by the superconducting electromagnetic MRI field from a GE 3.0 Tesla Excite HDx MRI Scanner (GE Healthcare). The field strength was measured and regions with strengths of 0.5–1 T or 0.2–0.5 T were used for in vivo studies. Anti-GFP nanobody-TRPV1–2A–GFP ferritin in pEGFPN1 and MSCV-hygro were generated as previously described1. Mutation of residue I679K in TRPV1 was performed by site-directed mutagenesis using QuikChange XL Site-Directed Mutagenesis Kit (Agilent). These sequences were cloned into pVQ Ad CMV KNpA for generation of replication deficient adenovirus. To construct Cre- activated recombinant adenovirus vectors, a DNA construct with two pairs of incompatible lox sites, loxN and lox2722, was synthesized and Anti-GFP nanobody-TRPV1–2A–GFP ferritin was cloned between the two pairs in the antisense orientation. The floxed inverted Anti-GFP nanobody-TRPV1–2A–GFP ferritin cassette was then cloned into pVQ Ad CMV KNpA for generation of replication deficient adenovirus. The fidelity of PCR products and cloning was confirmed by DNA sequencing. The recombinant adenoviruses (Ad-CMV-GFP, Ad-CMV-anti-GFP-TRPV1/GFP-ferritin, Ad-FLEX-anti-GFP-TRPV1/GFP-ferritin and Ad-FLEX-anti-GFP-TRPV1mutant/GFP-ferritin were packaged by Viraquest. The final titre was 4 × 1010 plaque-forming units (p.f.u.) per ml. AAV-EF1a-DIO-hChR2(H134R)-eYFP was purchased from UNC Viral Core. Human embryonic kidney (HEK 293T) cells (ATCC CRL-3216), mycoplasma testing and STR profiling for authentication performed by ATCC) were cultured in DMEM with 10% fetal bovine serum (FBS; Gibco) at 37 °C and 5% CO . HEK cells have been reported to be among cell lines that are commonly misidentified. We used HEK 293T cells obtained from and authenticated by ATCC. HEK 293T cells are readily transfected and express transgene products at high levels. Transfected cells were used to examine the sites of TRPV1 and GFP-tagged ferritin expression, to generate stable cells to determine calcium responses to RF and magnetic stimulation and for electrophysiology studies. These studies were also performed in additional cell lines such as N38 (calcium responses), examined in vivo (protein expression) or in ex vivo slices (electrophysiology). Phoenix ecotropic packaging cells (Stanford University, no authentication or mycoplasma testing) were grown in DMEM with 10% FBS (Gibco) at 37 °C and 5% CO . Embryonic mouse hypothalamic N38 cells (Cellutions Biosystems Inc., no authentication, mycoplasma testing performed by Cellultions Biosystems Inc.) were grown in DMEM with 10% FBS at 37 °C and 5% CO . Stable cell lines were produced by retroviral infection of N38 cells using the Phoenix system. Briefly, Phoenix eco cells (2 × 106 cells per 6-cm dish) were transfected with MSCV-hygro anti-GFP-TRPV1/GFP-ferritin or MSCV-hygro anti-GFP-TRPV1mutant/GFP-ferritin. After 24 h, the medium was replaced and the cells placed at 32 °C. Medium was aspirated after a further 24 h and spun to remove cell debris. The Phoenix cell supernatant was added to N38 cells (plated at 1 × 106 cells per 6-cm dish) using a 1:2 dilution in DMEM/10% FBS with polybrene (4 μg ml−1, Sigma-Aldrich). Cells were incubated at 32 °C for a further 24 h before replacing the medium with DMEM/10% FBS. Selection medium was added 48 h after infection. Stably transfected N38 cells were maintained at 32 °C. For immunocytochemistry, electrophysiology, RF and magnet studies, stably transfected N38 cells or HEK cells were cultured on 12-mm cover glass (Fisher Scientific) coated with fibronectin (10 mg ml−1, Sigma). HEK cells were transfected with appropriate constructs 24 h after plating using lipofectamine 2000 (Invitrogen). Culture medium was replaced 18 h after transfection and holotransferrin (2 mg ml−1, Sigma) was added to the cells. Cells were studied 72–96 h after transfection or subculture. Effect of RF or magnet on pCREB and c-Fos. 24 h before the study, cells were placed in 1% FBS in optimem medium at 32 °C to ensure minimal activation of TRPV1 and calcium-dependent pathways. On the day of study, cells were incubated in 500 μl of calcium imaging buffer at room temperature (control) or in a RF field (31 mT) at room temperature. For magnet treatment, cells were treated with a static magnetic field (280 mT) for 5 s every 2 min for 1 h at room temperature. After 60 min, the cells were placed on ice, the supernatant removed and cells lysed with RIPA buffer (40 µl for western blot) or lysis buffer (100 µl Agilent Absolutely RNA microprep kit) and frozen at −80 °C until assay or RNA purification. Each study was repeated on three occasions each with four replicates. Control studies with N38 cells alone were performed on two occasions with four replicates. TRPV1 is a non-selective cation channel with relatively high permeability to divalent cations, particularly calcium (Ca2+ > Mg2+ > Na+ ≈ K+ ≈ Cs+)27. For studies examining the effects of RF (31 mT) or magnet (280 mT) with and without ruthenium red, stably transfected cells were washed three times in PBS then loaded with Fluo-4 3 μM (Invitrogen) in the presence of sulfinpyrazone 500 μM (Sigma) for 45–60 min at room temperature. Cells were washed again in PBS then incubated for 15–30 min in sulfinpyrazone in PBS. Cells were washed and then imaged in calcium imaging buffer. Imaging was performed using a Deltavision personal DV imaging system (Applied Precision) equipped with a custom-made ceramic lens. Images were acquired every 3 s for 3 min. Cells were imaged without treatment (eight occasions), before and during RF treatment (nine occasions), before and during application of a neodymium magnet (for 45 s, three occasions) or before and after treatment with 200 μM 2-APB (two occasions). Imaging was repeated in the presence of ruthenium red (100 μM) (two occasions for each condition). Images were analysed using ImageJ software. For studies to examine the effects of increasing RF or magnet field strength, to assess the effects of short RF treatment (10 s) on calcium responses and to examine the kinetics of the calcium response, cells were loaded with FluoForte 20 μM (Enzo Life Sciences) in the presence of Pluronic F-127 (0.02% vol/vol) and sulfinpyrazone 500 μM. Cells were washed and then imaged in calcium imaging buffer. Imaging was performed as above with images acquired every second for 1 min. Cells were imaged without treatment (four occasions), before and during RF treatment at 31, 27 and 23 mT (four occasions each), before and during application of a neodymium magnet at 280 or 130mT (magnet 2 mm or 5 mm from the cells, respectively, four occasions each) and before, during and after 10 s treatment with RF (31 mT) (four occasions). Images were analysed using ImageJ software. Stably transfected cells were washed with Krebs-HEPES buffer three times then loaded with MQAE (5 mM, Invitrogen) for 60 min at room temperature. The cells were washed with Krebs-HEPES buffer and then incubated in buffer for 15 min before imaging. Imaging was performed using LSM 510 NLO inverted multiphoton and confocal system (Zeiss) using a 40× objective with two photon excitation at 750 nm. Cells were imaged without treatment (four occasions), before and during application of a neodymium magnet (280 mT) for 20 s (on six occasions), before and after treatment with 200 μM 2-APB (two occasions). Imaging was repeated in the presence of ruthenium red (100 μM) (two occasions for each condition). Images were analysed using ImageJ software. Immunocytochemistry (ICC) and immunohistochemistry (IHC) were used to detect expression of TRPV1, GFP and Flag-tagged ferritin, to localize c-Fos expression and to quantify apoptosis in cells and tissue. Cells were washed twice in PBS and then fixed for 15 min in 2% paraformaldehyde (Electron Microscopy Services). Tissue was fixed in 10% formalin (Sigma) at 4 °C overnight and 40-μm sections cut on a vibrating microtome. Fixed cells or tissue sections were washed then incubated for 1 h in blocking buffer (3% BSA (Sigma) and 2% goat serum (Sigma) in PBS with 0.1% Triton-X (Sigma)). Cells and tissues were then incubated in primary antibody (rabbit anti-TRPV1 1:500 (AB95541, Chemicon), mouse anti-Flag 1:1,000 (Flag-tag mouse monoclonal antibody #F3165, Sigma28), chicken anti-GFP 1:1,000 (ab139701, Abcam), rabbit anti-activated-caspase-3 1:250 (G7481, Promega1) or rabbit anti-c-Fos 1:5,000 (PC38, Calbiochem2)) diluted in blocking buffer overnight at 4 °C. Cells or tissue were washed three times in PBS/0.1% Triton-X before incubation in secondary antibody (goat anti-rabbit 594 (A1012) or goat anti-rabbit 488 (A11008), goat anti-chicken 488 (A11039), goat anti-mouse 350 (A11045), all 1:1,000) diluted in blocking buffer for 2 h. To stain for cell membrane, Alexa 594 conjugated to wheat germ agglutinin (Invitrogen, 5 µg ml−1) was included in the blocking buffer with secondary antibodies. The cells or tissue were washed a further three times in PBS/0.1% Triton-X before mounting using Fluoromount (Southern Biotech). Images were acquired using confocal microscopy (LSM 510 laser scanning confocal microscope; Carl Zeiss MicroImaging, Inc.). Confocal fluorescence images were acquired on a scanning laser microscope using a 20×/0.70 NA objective or 100×/1.4 NA objective. To quantify GFP-positive and activated-caspase-3-positive cells, a 1,280 µm section of the brain with the injection site taken as the centre was imaged by taking tiled, serial stack images covering a depth of 40 µm every 320 µm. Quantification of GFP and activated-caspase-3 immunostaining was performed by an investigator blinded to the treatment group using Imaris 3D quantification software. The image analysis software calculated the number of GFP- or activated-caspase-3-positive cells per volume by thresholding immunoreactivity above background levels. Confocal images to examine co-localization of TRPV1, GFP and Flag-tagged ferritin were acquired with a 40× objective. Mouse brains were perfused by 4% PFA and sectioned at 50 μm by vibratome (Leica VT 100S). The sections were blocked by 4% BSA and 0.15% saponin in 20 mM Tris buffer (pH 7.4) for 2 h at room temperature, then incubated with anti-GFP (1:1,000) (#1020, Aves Lab Inc.29) overnight at 4 °C, followed by biotinylated anti-chicken incubation (1:1,000, Vector Laboratories, Inc.), with Nanogold streptavidin (1:100, Nanoprobes), and treated with GoldEhance EM (#2114 Nanoprobes). Negative control was done with the same procedure, except for omitting the primary antibody incubation. The tissue sections underwent fixation with 2% glutaraldehyde in sodium cacodylate buffer, light osmication (0.5% osmium tetroxide) for 15 min and en bloc staining with 1% uranium acetate for 30 min. Subsequently tissues were dehydrated through an ethanol series followed by incubation with Eponate12 (Ted Pella Inc.) The samples were embedded in the resin and polymerized at 60 °C for 48 h. Ultrathin (70 nm) sections were cut and examined under a JEOL JEM 100CX transmission electron microscope in the electron microscopy centre in The Rockefeller University. For double immuno-electron microscopy studies, HEK cells with stable expression of TRPV1 without fixation were subjected to high-pressure freezing (Leica EMPAC2) and freeze substitution in 0.2% uranyl acetate in 95% acetone and 5% water. Subsequently they were embedded in Lowicryl HM20 at −40 °C and cut into ultrathin sections. They were incubated with 4% BSA and 0.15% saponin, 0.15% cold fish skin gelatin in 20 mM TBS (pH 7.4) for 2 h at room temperature, a mixture of anti-GFP raised in chicken (1:300) (Aves Lab Inc.) and anti-TRPV1 raised in rabbit (1:300) (EMD Millipore Corp) overnight at 4 °C. Antigen–antibody complexes were recognized by biotinylated anti-chicken antibody and streptavidin tagged with 5 nm colloidal gold (1:20, Nanoprobes), or anti-rabbit tagged with 12 nm colloidal gold (Jackson Immuno Research Lab Inc.) for 2 h at room temperature. Electron microscopy was used to demonstrate ferritin in transfected HEK cells. Cells were fixed in 2% paraformaldehyde/2.5% glutaraldehyde/0.1 M cacodylate buffer, pH 7.4, for 15 min before pelleting and further fixation for 1 h. Cells were then treated with 1% osmium tetroxide (1 h, on ice) and 0.5% uranyl acetate (1 h) before dehydration with graded ethanol and treatment with propylene oxide (2 × 15 min). The cells were infiltrated with 50% EPON epoxy resin (Miller-Stephenson) and 50% propylene oxide overnight then 100% EPON (2 × 2 h) before curing at 60 °C for 2 days. Blocks were cut with a diamond knife on a Leica UltracutE and ultrathin (~70 nm) sections were collected on uncoated 200-mesh grids and stained with uranium and lead. Grids were viewed with a Tecnai SpiritBT Transmission Electron Microscope (FEI) at 80 kV and pictures were taken with Gatan 895 ULTRASCAN Digital Camera in the electron microscopy centre in The Rockefeller University. Cell culture. Whole-cell voltage clamp recordings were made at room temperature at −60 mV from cultured HEK cells and N38 cells expressing anti-GFP–TRPV1/GFP–ferritin or anti-GFP–TRPV1mutant/GFP–ferritin construct. Neurons expressing GFP were visualized using epifluorescence on an upright Zeiss Axioskop 2FS Plus microscope equipped with a Hamamatsu CCD camera. External solution contained (in mM): 140 NaCl, 2.8 KCl, 2 CaCl , 1 MgCl , 1 HEPES, 10 glucose, pH 7.4. Patch pipettes pulled from borosilicate glass (World Precision Instruments) had tip resistances of 5–10 MΩ and were filled with K-gluconate internal containing (in mM): 135 potassium gluconate, 4 KCl, 0.05 EGTA, 10 HEPES, 4 MgATP, 10 Na-phosphocreatine, pH adjusted to 7.3 with KOH, 290 OSM unless otherwise stated, in which case a CsCl internal solution was used containing (in mM):125 CsCl, 10 HEPES, 10 EGTA, 4 MgATP, 0.5 CaCl , 2-APB (200 µM) was prepared from a 10 mM DMSO stock and was perfused though the bath when stated. I–V relationships were obtained by measuring current responses to increasing 5-mV steps in the presence of 200 µM 2-APB. Cells were held at −60 mV. Magnetic activation was applied by bringing a permanent magnet within 500 μm of the recorded cell for 5 s with a micromanipulator. Recordings were acquired with an Axopatch 200B amplifier, filtered to 2 kHz and digitized at 10 kHz (pClamp10 software, Molecular Devices). Data were analysed using IGOR Pro (Wavemetrics) and NeuroMatic (http://www.neuromatic.thinkrandom.com/). Series resistance was monitored and not compensated for. If there was more than a 20% change in series resistance the recording was excluded. Slice electrophysiology. Glucokinase–Cre Rosa–tdTomato, injected with Ad-anti-GFP-TRPV1/GFP-ferritin or Ad-anti-GFP-TRPV1mutant/GFP-ferritin in the VMH were deeply anaesthetized with isoflurane before decapitation and removal of the entire brain to be immediately submerged in ice-cold ‘slicing’ solution containing (in mM): 85 NaCl, 2.5 KCl, 0.5 CaCl , 4 MgCl , 25 NaHCO , 1.25 NaH PO , 64 sucrose, 25 glucose and 0.02 d-2-amino-5-phosphonopentanoic acid (d-AP5, Tocris Bioscience). This was bubbled with 95% O and 5% CO , pH 7.4. Coronal hypothalamic slices (200 µm) were made with a moving blade microtome (VT1000S, Leica). The slices were kept at 32 °C for 40 min in recording solution containing (in mM) 125 NaCl, 2.5 KCl, 1.25 NaH PO , 26 NaHCO , 10 glucose, 2 CaCl and 1 MgCl , pH 7.4 when bubbled with 95% O and 5% CO . Whole-cell current-clamp patch-clamp recordings were made at room temperature from neurons in the VMH expressing both tdTomato indicating GK–Cre expression and GFP indicating expression of the anti-GFP–TRPV1/GFP–ferritin or anti-GFP–TRPV1mutant/GFP–ferritin construct. Neurons were visualized and recorded from as described above. In order to observe neuronal activation, neurons were hyperpolarized to below threshold. Baseline characteristic for hypothalamic neurons are as follows. Mean series resistance for neurons expressing the construct was 18.4 ± 1.1 MΩ (n = 37) and did not differ significantly from hypothalamic neurons that did not express the construct (18.0 ± 1, n = 7). The mean capacitance was 5.1 ± 0.55 pF and did not differ significantly from neurons not expressing the channel (6.7 ± 0.8) The mean resting membrane potential in naive hypothalamic neurons was −48.21 ± 4.7 mV (n = 15) and in cells expressing the construct before manipulation was −52 ± 1.9 mV (n = 37), P > 0.5. Input resistances did not significantly differ in hypothalamic neurons; control neuron (without construct expression) = 703 ± 128 MΩ (n = 13), wild-type channel neuron = 555 ± 110 MΩ (n = 7), mutant neuron = 866 ± 220 MΩ (n = 14). Male and female C57Bl6 mice (8–9-weeks-old, Jackson Laboratories), Nestin cre (8–9-weeks-old, Jackson Labs), Rosa lox-stop-lox tdTomato (8–10-weeks-old, Jackson Labs) and GK-cre (8–16-weeks-old) mice were used and housed under controlled light conditions (12 h light/12 h dark) and temperature (22 °C), single-caged, and fed ad libitum on standard mouse chow. Animal care and experimental procedures were performed with the approval of the Animal Care and Use Committee of Rockefeller University (protocols 12561 and 14712) under established guidelines. In all cases, mice were randomized according to body weight. The investigator was not blinded to the treatment group. The sample size required was estimated to be n = 8–10 per group on the basis of previous studies examining the effects of RF treatment on gene expression and protein release. No statistical methods were used to predetermine sample size. All surgeries were performed under aseptic conditions. Mice were anaesthetized using 1.5% isoflurane and the top of the head was shaved then cleaned with 70% ethanol. An incision was made in the midline and small craniotomies were made using a dental drill. Study 1. Wild-type mice underwent stereotacic injection into the striatum (coordinates: +1 mm AP, +2.3 mm ML, −3.3 mm DV) with Ad-CMV-GFP or Ad-CMV-anti-GFP-TRPV1/GFP-ferritin (4 × 108 p.f.u. per injection) over 10 min. The needle remained in position for a further 5 min before being withdrawn. Mice also received a lateral ventricle injection of iron dextran (4 μl, coordinates: −0.4 mm AP, +1.2 mm ML, −2.0 mm DV). After 1 week or 4 weeks, mice injected with Ad-CMV-anti-GFP-TRPV1/GFP-ferritin were randomized to RF or no RF treatment (n = 4 per time point and per treatment group). All mice treated with Ad-CMV-GFP were treated with RF (n = 4 per time point). Mice were anaesthetized with tribromoethanol (200 mg kg−1) and after 15 min mice were treated with RF (Ad-GFP and Ad-CMV-anti-GFP-TRPV1/GFP-ferritin, RF-treated group) for 30 min by placing in the RF solenoid. Ad-CMV-anti-GFP-TRPV1/GFP-ferritin, untreated group were anaesthetized and 15 min after the induction of anaesthesia were placed in the RF solenoid without power for 30 min. One hour after the being placed in the solenoid, mice were perfused, brains removed and tissue processed for GFP and activated-caspase-3 immunostaining as described above. Unilateral striatal injections were used to test our construct primarily because we thought that either basal activity in the absence of RF or significant toxicity and apoptosis would result in motor changes that are readily detectable. In addition, striatum does not express TRPV1 and we wanted to ensure any effect was the result of expressing our construct rather than a result of an effect of endogenous TRPV1. Finally, for RF treatment the mice needed to be anaesthetized and in pilot studies we found that anaesthetics often led to high levels of c-Fos activation in many central nervous system regions but not in the striatum. Thus, to minimize the possibility that the anaesthetic was contributing to either toxicity or non-specific staining, we used striatal injections in addition to assessing the VMH. Study 2. Nestin–Cre or wild-type mice received striatal injections of Ad-FLEX-anti-GFP-TRPV1/GFP-ferritin (4 × 108 p.f.u. per injection) and ICV iron dextran as described above. After 1 week, mice were anaesthetized, treated with RF for 30 min and perfused after 1 h as described above. Tissue was processed for GFP and c-Fos immunostaining as described above. Study 3. Glucokinase–Cre or wild-type mice were anaesthetized with isofluorane and underwent stereotactic injection of iron dextran into the lateral ventricle (as above) and unilateral injection of Ad-FLEX-anti-GFP-TRPV1/GFP-ferritin (4 × 108 p.f.u. per injection) into the VMH (coordinates: −0.9 mm AP, +0.32 mm ML and −5.48 mm DV). We performed unilateral injections of Cre-dependent adenovirus into the dorsomedial VMH of glucokinase–Cre mice. Construct expression was seen in this subdivision and in additional subdivisions of the VMH on the injected side. Virus expression is Cre-dependent as we did not see GFP expression in wild-type mice. After 1 week, half the mice in each group were studied using RF stimulation (31 mT) and half remained untreated. One week later, the previously treated mice were assessed without RF treatment and the previously untreated mice were treated with RF. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of RF treatment. After an additional week, mice were treated as described above but at 60 min after the onset of RF treatment, mice were killed and blood taken by cardiac puncture for hormone assessment and hepatic tissue was harvested and snap-frozen in liquid nitrogen for later assessment of gluconeogenic enzyme expression. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 4. GK–Cre mice were anaesthetized and injected with AAV-EF1a-DIO-hChR2(H134R)-EYFP (1 μl) into the VMH using the coordinates above. An optic fibre was then placed 200 nm above the injection site and fixed with adhesive cement followed by dental cement then the scalp was sealed back using tissue adhesive. After 4 weeks, half the mice were treated with 473 nm laser stimulation (5 Hz, 15 ms pulse width) for 30 min and half were attached to the optical cable but without light stimulation. One week later, the previously treated mice were assessed without light treatment and the previously untreated mice were treated with light. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of light treatment. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 5. GK–Cre or wild-type mice were anaesthetized with isofluorane and underwent stereotactic injection of iron dextran into the lateral ventricle (as above) and Ad-FLEX-anti-GFP-TRPV1mutant/GFP-ferritin (4 × 108 p.f.u. per injection) into the VMH. After one week, half the mice in each group were studied using RF stimulation (31 mT) and half remained untreated. One week later, the previously treated mice were assessed without RF treatment and the previously untreated mice were treated with RF. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of RF treatment. After a further 3 days, mice were anaesthetized and at time 0 were treated with 2-deoxyglucose (400 mg kg−1, intraperitoneal) then treated with RF for 45 min. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of RF treatment. One week later, mice were anaesthetized and RF treated (31 mT) and at 60 min after the onset of RF treatment, they were killed and blood taken by cardiac puncture for hormone assessment and hepatic tissue was harvested and snap frozen in liquid nitrogen for later assessment of gluconeogenic enzyme expression. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 6. GK–Cre or wild-type mice were anaesthetized with isofluorane and underwent stereotactic injection of iron dextran into the lateral ventricle and Ad-FLEX-anti-GFP-TRPV1/GFP-ferritin (4 × 108 p.f.u. per injection) into the VMH (as above). After one week, mice were placed in a plastic chamber in a low-strength magnetic field (<0.005 T) for a 15 min acclimation period, then half the mice were moved to a high-strength magnetic field (>0.5 T) for 30 min and half remained in the low-strength field. After 30 min, all mice were placed in a low-strength field for a further 30 min. Tail vein samples for blood glucose were taken at −5, 0, 15, 30, 45 and 60 min after the acclimation period. One week later, groups were crossed so the mice previously treated with high-strength magnetic field were treated with low-strength field and mice previously treated with low-strength field were treated with high-strength magnetic field. At the end of the study, mice were sacrificed and perfused. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 7. GK–Cre or wild-type mice were injected and recovered as in study 6. After one week, the effect of magnetic field stimulation on food intake was examined. After a 4-h fast, mice were acclimated to their chamber for 20 min then food intake was assessed after 20 min at low-strength magnetic field. Food intake was then measured for 20 min with half the mice in high-strength magnetic field (0.5–1 T) and half at low-strength magnetic field. Food intake was measure for a final 20 min period at low-strength magnetic field. One week later, the groups were crossed so mice previously treated with high-strength magnetic field were treated with low-strength field and mice previously treated with low-strength field were treated with high-strength magnetic field. At the end of the study, mice were sacrificed and perfused. Brains were fixed, sectioned and stained with GFP to check injection placement. Mice with injection sites outside the VMH were excluded from the analysis. Study 8. GK–Cre mice underwent stereotactic injection as described in study 3. After one week, mice were anaesthetized and 15 min after the induction of anaesthesia were placed in the RF solenoid without power for 30 min (no RF treatment). After 3 days, the mice were divided into two equal groups, one group was treated with a field strength of 27 mT for 30 min and the other group with a field strength of 23 mT for 30 min. After a further 4 days, the treatment groups were reversed. A week later, the first group of mice were treated with RF (31 mT) for 20 min and the second group of mice with RF (31 mT) for 10 min. After a further 3 days, the treatment groups were reversed. Tail vein samples for blood glucose were taken at −5, 0, 5, 10, 20, 30, 45, 60 and 90 min after the onset of RF treatment for all studies. After an additional week, half the mice were treated with RF (31 mT) for 30 min and half the mice remained untreated. At 60 min after the onset of RF treatment, mice were sacrificed and brains were fixed, sectioned and stained for GFP and activated-caspase-3 to assess apoptosis in the VMH. Study 9. GK–Cre mice underwent stereotactic injection as described in study 3. After 2 weeks, the effects of lower magnetic strength (0.2–0.5 mT) on food intake were assessed. After a 4-h fast, mice were acclimated to their chamber for 20 min and then food intake was assessed after 20 min at low-strength magnetic field followed by food intake measurement after 20 min treatment with a 0.2–0.5 T magnetic field. Food intake was measure for a final 20 min period at low-strength magnetic field. At the end of the study, mice were sacrificed and perfused. Brains were fixed, sectioned and stained with GFP to check injection placement. Study 10. GK–Cre mice underwent stereotactic injection as described in study 5 but with bilateral injection of Ad-FLEX-anti-GFP-TRPV1mutant/GFP-ferritin into the VMH. After a week, food intake was assessed in response to low-strength magnetic field treatment. After a 4-h fast, mice were acclimated to their chamber for 20 min and then food intake was measured for three periods of 20 min at low field strength. One week later, the study was repeated with a 20 min acclimation period then food intake was measured for mice were treated with high strength magnetic field (0.5–1 T) for 20 min. Food intake was measured for a further two 20-min periods at low magnetic field strength. At the end of the study, mice were sacrificed and perfused. Brains were fixed, sectioned and stained with GFP to check injection placement. Study 11. GK–Cre/Rosa–tdTomato mice underwent stereotactic surgery as described in study 3. After one week, three mice were anaesthetized and 15 min after the induction of anaesthesia were treated with RF (31 mT) for 30 min. At 60 min after the onset of RF treatment, mice were sacrificed. Brains from three mice were fixed, sectioned and stained for GFP and c-Fos. The fourth mouse was perfused without RF treatment and the brain was used for immune-electron microscopy. Study 12. GK–Cre (n = 4) underwent stereotactic surgery as described in study 3. After one week, the mice were anaesthetized and perfused. Brains were fixed, sectioned and stained for GFP. Tiled z-stack images were taken using confocal microscopy (20× objective) and images analysed using Imaris 3D quantification software. The image analysis software calculated the number of GFP-positive cells per volume by thresholding immunoreactivity above background levels. Using this method the average number of GFP-positive cells was 2,436 ± 841 cells per brain. Blood glucose was determined using a Breeze 2 glucometer (Bayer). Blood was spun for 10 min and plasma was collected. Plasma levels of insulin (Mercodia) and glucagon (Mercodia) were determined by ELISA. Protein was isolated by lysis in RIPA buffer and centrifugation at 16,000 r.p.m., 4 °C for 5 min before addition of 4× Laemelli buffer. Samples were denatured for 5 min at 95 °C and frozen at −20 °C before assay. Samples (15 μl) were run on a 4–15% gel then transferred to PVDF membrane. Membranes were blocked (3% dried milk in TBST buffer) for 1 h at room temperature then incubated in primary antibody (pCREB (Ser133) (87G3) rabbit monoclonal antibody (1:1,000) or β-actin rabbit antibody (1:1,000), Cell Signaling) in TBST overnight at 4 °C. Membranes were washed three times in TBST then incubated in secondary antibody (goat anti-rabbit IgG-HRP, 1:5,000, Santa Cruz) in TBST for 2 h at room temperature. The membrane was washed a further five times then developed in substrate for 5 min (Supersignal West Femto maximum sensitivity substrate, Life Technologies) and imaged (C-DiGit blot scanner, Licor). The pCREB density signal was corrected for any variation in protein loading by dividing by the density signal for the housekeeping gene, actin. Total RNA was isolated by homogenizing tissue in TRIzol reagent (Invitrogen) or cells in buffer RLT and purifying the RNA using Absolutely RNA microprep kit (Agilent). Complimentary DNA was synthesized using QIAGEN omniscript RT kit. Real-time PCR was performed using the TaqMan system (Applied Biosystems) according to the manufacturer’s protocol. Data over 2 s.d. outside the mean were excluded from further analysis as determined before the studies. All data were tested for Gaussian distribution and variance. Data with normal distribution and similar variance were analysed for statistical significance using two-tailed, unpaired Student’s t-tests unless otherwise indicated. Data with normal variation and unequal variance were analysed by two-tailed Welch’s t-tests. Paired data were analysed by paired t-tests. Data with more than two groups were analysed by one-way ANOVA with post-hoc Tukey’s analysis for parametric data. Data which were not normally distributed were analysed by two-tailed Mann–Whitney U-tests or Kruskal–Wallis tests with post-hoc Dunn’s correction. P values are as indicated. Time course data were analysed by two-way ANOVA with Sidak’s multiple comparisons or repeated measures two-way ANOVA with Sidak’s multiple comparisons for paired data. Data are shown as mean ± s.e.m. unless otherwise stated.


News Article | April 20, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment C57BL/6 (CD45.2) mice were purchased from Harlan Laboratories (Rehovot, Israel). B6.SJL (CD45.1) mice were bred in-house. Transgenic Ly6a(Sca-1)-EGFP mice and transgenic ROSA26-eYFP (EndoYFP) reporter mice were purchased from Jackson Laboratories. Transgenic nestin-GFP mice were kindly provided by G. N. Enikolopov (Cold Spring Harbour Laboratory, USA). Transgenic c-Kit-EGFP mice were kindly provided by S. Ottolenghi (University of Milano-Bicocca, Italy). Transgenic VE-cadherin (Cdh5, PAC)-CreERT2 mice were kindly provided by R. H. Adams (Max Planck Institute for Molecular Biomedicine, Germany). Conditional mutants carrying loxP-flanked Cxcr4 were provided by D. Scadden (Harvard University, Cambridge, USA). Conditional mutants carrying loxP-flanked Fgfr1 and Fgfr2 (Fgfr1/Fgfr2lox/lox) mice were provided by S. Werner (Institute of Cell Biology, Switzerland) and by D. Ornitz (Washington University School of Medicine, USA). To induce endothelial-specific Cre activity and gene inactivation/expression, adult VE-cadherin(Cdh5, PAC)-CreERT2 mice interbred with Cxcr4lox/lox (EndoΔCxcr4) or Fgfr1/2lox/lox (EndoΔFgfr1/2) or with ROSA26-eYFP mice (EndoYFP) were injected intraperitoneally (i.p.) with Tamoxifen (Sigma, T5648) at 1 mg per mouse per day for 5 days. Mice were allowed to recover for 4 weeks after tamoxifen injections, before euthanasia and experimental analysis. Mice carrying only VE-cadherin (Cdh5, PAC)-CreERT2 transgene or the Cxcr4lox/lox/Fgfr1/2lox/lox mutations were used as wild-typecontrols to exclude non-specific effects of Cre activation or of floxed alleles mutation. The endothelial Fgfr1/2 deletion was confirmed by qRT–PCR measurements of Cxcr4 and Fgfr1/2 mRNA from isolated BMECs. Male and female mice at 8–12 weeks of age were used for all experiments. All mouse offspring from all strains were routinely genotyped using standard PCR protocols. Sample size was limited by ethical considerations and background experience in stem cell transplantation (bone marrow transplantation) which exists in the laboratory for many years and other published manuscripts in the stem cell field, confirming a significant difference between means. No randomization or blinding was used to allocate experimental groups and no animals were excluded from analysis. All mutated or transgenic mouse strains had a C57BL/6 background. All experiments were done with approval from the Weizmann Institute Animal Care and Use Committee. Mice that were maintained at the Weizmann Institute of Science were bred under defined flora conditions. Two-photon in vivo microscopy procedures that were performed in Harvard Medical School were approved by the Institutional Animal Care and Use Committee at Massachusetts General Hospital. AMD3100 (Sigma-Aldrich) 5 mg per kg was used to treat mice by subcutaneous (s.c.) injection. Mice were euthanized 30 min later. Recombinant murine FGF-2 (ProSpec) 200 μg per kg was used to treat mice by i.p. injections for seven consecutive days. Neutralizing rat anti-VE-cadherin antibodies or rat IgG (eBioscience) at 50 μg per mouse per day were used to treat mice by intravenous (i.v.) injections for 2 or 5 days. Neutralizing mouse anti-CXCR4 antibodies (12G5 clone) or mouse IgG (eBioscience) at 50 μg per mouse were administered twice, with a 30 min interval, by intravenous (i.v.) injections. To inhibit ROS production, the antioxidant N-acetyl-l-cysteine (NAC; Sigma-Aldrich) was administered by i.p. injection of 130 mg per kg for 2, 5 or 7 days. Mice were euthanized 2–4 h following the final injection. For standard and confocal fluorescent microscopy, femurs were fixed for 2 h in 4% paraformaldehyde, which was replaced and then the samples were washed with 30% sucrose, embedded in optimum cutting temperature compound, and then snap-frozen in N-methylbutane chilled in liquid nitrogen. Sections (5–10 μm) were generated with a CM1850 Cryostat (Leica) at −25 °C with a tungsten carbide blade (Leica) and a CryoJane tape transfer system (Instrumedics), and were mounted on adhesive-coated slides (Leica), fixed in acetone and air-dried. Sections were stained by incubation overnight at 4 °C with primary antibodies, followed by 1 h incubation of secondary antibody at room temperature and in some cases also nuclei labelling by Hoechst 33342 (Molecular Probes) for 5 min at room temperature. Standard analysis (5–6 μm sections) was performed with Olympus BX51 microscope and Olympus DP71 camera. Confocal analysis (10 μm sections) was performed using a Zeiss LSM-710 microscope. In some cases, for BMBV morphological and phenotypical confocal analysis, femurs and tibias were fixed for 2 h in 4% paraformaldehyde, decalcified with 0.5 M EDTA at 4 °C with constant shaking, immersed into 20% sucrose and 2% polyvinylpyrrolidone (PVP) solution for 24 hours, then embedded and frozen in 8% gelatin (porcine) in presence of 20% sucrose and 2% PVP. Sections (80–300 μm) were generated using low-profile blades on a CM3050 cryostat (Leica). Bone sections were air-dried, permeabilized for 10 min in 0.3% Triton X-100, blocked in 5% donkey serum at room temperature for 30 min, and incubated overnight at 4 °C with primary antibodies. Confocal analysis was performed using a Zeiss LSM-780 microscope. Z-stacks of images were processed and 3D-reconstructed with Imaris software (version 7.00, Bitplane). As previously described4, tile scan images were produced by combining the signal of multiple planes along the Z-stalk of bone sections to allow visualization of the distinct types of bone marrow blood vessels and the cells in their surroundings. For the quantifications of blood vessel diameters, a region of 600–700 μm from the growth plate towards the caudal region was selected and diameters for arterial and sinusoidal blood vessels were calculated using ImageJ software on the high-resolution confocal images. Primary and secondary antibodies and relevant information about them are indicated in Supplementary Table 1. For in vivo ROS detection in bone marrow sections, mice were injected i.p. with hydroethidine (Life Technologies) 10 mg per kg, 30 min before euthanasia. For in vivo LDL-uptake detection in bone marrow sections, mice were i.v. injected with Dil-Ac-LDL (BTI) 20 μg per mouse, 4 h before euthanasia. Femurs were immediately collected and processed as mentioned earlier. Bone marrow section analysis for scoring ROShigh cells was performed using ImageJ software (Extended Data Fig. 1). Multiple sections (>16 per mouse) were generated and analysed from at least 4 mice per group of experimental procedure, in order to confirm biological repeats of the observed data. In some cases, images were processed to enhance the contrast in order to allow better evaluation of co-localization of cellular borders and markers. Imaris, Volocity (Perkin Elmer), Photoshop and Illustrator (Adobe) software were used for image processing. For blood vessel imaging in the calvarium of Sca-1-EGFP and nestin-GFP mice, we used a microscope (Ultima Multiphoton; Prairie Technologies) incorporating a pulsed laser (Mai Tai Ti-sapphire; Newport Corp.). A water-immersed 20× (NA 0.95) or 40× (NA 0.8) objective (Olympus) was used. The excitation wavelength was set at 850–910 nm. For intravital imaging, mice were anaesthetized with 100 mg ketamine, 15 mg xylazine and 2.5 mg acepromazine per kg. During imaging, mice were supplied with oxygen and their core temperature was maintained at 37 °C with a warmed plate. The hair on the skullcap was trimmed and further removed using urea-containing lotion and the scalp was incised at the midline. The skull was then exposed and a small steel plate with a cut-through hole was centred on the frontoparietal suture, glued to the skull using cyanoacrylate-based glue and bolted to the warmed plate. To visualize blood vessels, mice were injected i.v. with 2 μl of a 2 μM non-targeted nanoparticles solution (Qtracker 655, Molecular Probes). In some cases, mice were i.v. injected with Dil-Ac-LDL (BTI) 40 μg per mouse, 2 h before their imaging. We typically scanned a 50 μm-thick volume of tissue at 4 μm Z-steps. Movies and figures based on two-photon microscopy were produced using Volocity software (Perkin Elmer). For live imaging of blood vessels permeability and leukocyte bone marrow trafficking, a previously described experimental procedures and a home built laser-scanning multiphoton imaging system29, were used with some modifications. Anaesthesia was slowly induced in mice via inhalation of a mixture of 1.5–2% isoflurane and O . Once induced, the mixture was reduced to 1.35% isoflurane. By making a U-shaped incision on the scalp, calvarial bone was exposed for imaging and 2% methocellulose gel placed on it for refractive index matching. For bone marrow blood vessel permeability studies, mice were positioned in heated skull stabilization mount which allowed access to the eye for on-stage retro-orbital injection of 40–60 μl of 10 mg ml−1 70 kDa rhodamine-dextran (Life Technologies). Nestin-GFP (excited at 840 nm) and confocal reflectance (at 840 nm) signals were used to determine a region of interest within the mouse calvarial bone marrow for measurement of permeability. Rhodamine-dextran was injected and was continuously recorded (30 frames per second) for the first 10 min after injection. After video acquisition, mice were removed from the microscope and euthanasized with CO . In some cases, following dextran clearance, the same mice were used for homing experiments to monitor leukocyte cell trafficking in regions and blood vessels that were defined as less or more permeable. For cell homing studies, mice were injected with 2 × 106 DiD-labelled (Life Technologies) lineage depleted immature haematopoietic progenitor cells (Miltenyi depletion) and with 2 × 106 DiI-labelled (Life Technologies) bone marrow MNC isolated from age matched C57BL/6 mice along with 150 μl of 2 nmol per 100 μl Angiosense 750EX (Perkin Elmer) fluorescent blood pool imaging agent, immediately before mounting the mice on a heated stage of a separate confocal/multiphoton microscope. Intravital images of the mouse bone marrow were collected for up to the first 3 h after injection of the cells. After imaging, the mice were removed from the microscope and euthanized with CO . Permeability, blood flow/shear rates and homing experiments were repeated, n = 3 mice each, measuring multiple blood vessels and events, each mouse regarded as an independent experiment, in order to confirm biological repeats of the observed data. The contrast and brightness settings of the images in the figures were adjusted for display purposes only. For permeability studies, the RGB movies were separated into red (Rhodamine-Dextran), green (nestin-GFP), and blue (reflectance) grayscale image stacks. An image registration algorithm (Normalized Correlation Coefficient, Template Matching) was performed on the red stack using ImageJ (v. 1.47p) to minimize movement artefacts within the image stack. Manual selection of regions of interest (ROI) was performed immediately next to individual vessels within the focus. Permeability of the vessels was calculated using the following equation: P is the permeability of the vessel, V is the volume of the ROI next to the vessel, A is the fractional surface area of the vessel corresponding to the ROI, dI/dt is the intensity of the dye in the ROI as a function of time, I is the intensity of the dye inside the corresponding vessel at the beginning of measurement, and I is the intensity of the dye in the ROI at the beginning of measurement. To calculate dI/dt for a given vessel, the change in intensity was measured within the ROI over time and linearly fit the first ~5–40 s of the data. The slope of this linear fit is dI/dt. The ROI intensity curve is only linear for the first 30–40 s, after which it begins to plateau. For cell homing, the number of stationary cells from the calvarial bone marrow images was counted and categorized into two groups: adherent and extravasated. We categorized both cells within the lumen of the vessel and cells in the process of transmigration in the adherent category. Maximum intensity projections of multiple z-stacks of images were used to count the number of cells in the two categories. When there was a gap between cells and vessels in the two-dimensional projection image, those cells were categorized as extravasated. If any part of a cell overlapped a vessel in the projection image, the corresponding three dimensional z-stack was viewed to determine if the cell had undergone extravasation. When it was unclear if a cell had extravasated, it was always categorized as adherent. For the flow speed measurement, red blood cells (RBCs) were labelled with 15 μM CFSE for 12 min at 37 °C in PBS supplemented with 1 g per litre of glucose and 0.1% BSA. About 0.6 billion RBCs were injected (i.v). 40 μl of rhodamineB-dextran 70 kDa (10 mg ml−1) was retro-orbitally injected immediately before imaging for visualizing bone marrow vasculature. Videos of confocal images of blood vessel (RhodamineB, excitation: 561 nm, emission: 573–613 nm) and labelled RBCs (CFDA-SE, excitation: 491 nm, emission: 509–547 nm) were taken with the speed of 120 frames per second. Individual RBCs were traced over a couple of frames. Total displacement of the RBCs was measured by ImageJ and the speed of blood flow was calculated by: To calculate the shear rate, we assumed that the vessels were straight (straight cylinder) and the blood is an ideal Newtonian fluid with constant viscosity. Under these conditions, the shear rate (du/dr) can be calculated by du/dr = 8×u/d (u is the average blood flow speed which was measured by tracing labelled RBCs and d is the diameter of the blood vessel as measured using ImageJ). Immunostaining signal intensity was analysed with MacsQuant (Miltenyi, Germany) or with a FACS LSRII (BD Biosciences) with FACSDiva software, data were analysed with FlowJo (Tree Star). Data of the expression of molecules by cells was analysed and presented as MFI (mean fluorescent intensity). To acquire single bone marrow cell suspensions, freshly isolated bones were cleaned, flushed and crushed using liver digestion medium (LDM, Invitrogen) supplemented with 0.1% DNaseI (Roche) and further digested for 30 min at 37 °C, under shaking conditions. Following the incubation time, cells were filtered and washed extensively. To isolate and acquire mononuclear cells (MNC) from the peripheral blood PB, blood was collected from the heart using heparinized syringes and MNC were separated using Lymphoprep (Axis-Shield) according to the manufacturer’s instructions. Isolated bone marrow and peripheral blood MNC cells underwent red blood cell lysis (Sigma) before staining. Cells were stained for 30 min at 4 °C in standard flow cytometry buffer with primary antibodies and, where indicated, with secondary antibodies. Information about the primary and secondary antibodies can be found in the antibody information (Supplementary Table 1). For antigens that required intracellular staining, cell surface staining was followed by cell fixation and permeabilization with the Cytofix/Cytoperm kit following the manufacturer’s instructions (BD Biosciences). In case of internal GFP labelled cells, cells were fixed for 20 min with 4% PFA at room temperature, washed and incubated at room temperature for 1 h in 30% sucrose. Cells were washed with flow cytometry buffer and further permeabilized. For intracellular ROS detection, cells were incubated for 10 min at 37 °C with 2 μM hydroethidine (Life Technologies). For glucose uptake detection, cells were incubated for 30 min at 37 °C with the glucose analogue 2-NBDG (Life Technologies). For detection of apoptotic cells, cells were resuspended in annexinV binding buffer (BioLegend) and stained with Pacific Blue AnnexinV (BioLegend). Bone marrow cells were enriched for the lineage negative population, prepared as indicated for flow cytometry and analysed using an ImageStreamX (Amnis) machine. Samples were visualized and analysed for the expression of markers and antigens with IDEAS 4.0 software (Amnis). Single-stained control cells were used to compensate fluorescence between channel images. Cells were gated for single cells with the area and aspect ratio features or, for focused cells, with the Gradient RMS feature. Cells were then gated for the selection of positively stained cells only with their pixel intensity, as set by the cutoff with IgG and secondary antibody control staining. At least 5 samples from 5 mice were analysed to confirm biological repeats of observed data. Detection of mouse calcitonin (Cusabio) and mouse PTH (Cloud-Clone Corp.) levels in bone marrow supernatants was performed according to the manufacturer’s instructions. CFU-GM and CFU-F assays were previously described34. For CFU-Ob assay (also known as mineralized nodule formation assay), CFU-F medium was supplemented with 50 μg ml−1 ascorbic acid and with 10 mM β-glycerophosphate. After 3 weeks, cultures were washed, fixed and stained using Alizarin red for mineralized matrix. The area of mineralized nodules per cultured well was quantified based on image analysis using ImageJ. Bone marrow cells were isolated after sterile bone flushing, crushing and digestion (as previously described). After washing, total bone marrow cells were incubated in medium supplemented with or without 25% blood plasma or supplemented with 20 ng ml−1 TGF-β1 (ProSpec) for 2 h. Plasma was isolated and collected from the upper fraction acquired from the peripheral blood after 5 min centrifugation at 1,500 r.p.m. Bone marrow vascular endothelial barrier function was assessed using the Evans Blue Dye (EBD) assay. Evans Blue (Sigma-Aldrich) 20 mg per kg was injected i.v. 4 h before mice were euthanized. In each experiment, a non-injected mouse was used for control blank measurements. Subsequently, mice were perfused with PBS via the left ventricle to remove intravascular dye. Femurs were removed and formamide was used for bone flushing, crushing and chopping. EBD was extracted in formamide by incubation and shaking of flushed and crushed fractions, overnight at 60 °C. After 30 min centrifugation at 2,000g, EBD in bone marrow supernatants was quantitated by dual-wavelength spectrophotometric analysis at 620 nm and 740 nm. This method corrects the specimen’s absorbance at 620 nm for the absorbance of contaminating haem pigments, using the following formula: corrected absorbance at 620 nm = actual absorbance at 620 nm – (1.426(absorbance at 740) + 0.03). Samples were normalized by subtracting control measurements. Levels of EBD bone marrow penetration per femur were expressed as OD /femur and the fold change in EBD bone marrow penetration was calculated by dividing the controls OD /femur from the treated OD /femur in each experiment. Finally, values were normalized per total protein extract as determined by Bradford assay per sample. For competitive LTR assay, B6.SJL (CD45.1) recipient mice were lethally irradiated (1,000 cGy from a caesium source) and injected 5 h later with 2 × 105 donor-derived (C57BL/6 background, CD45.2) bone marrow cells or with 500 μl of donor-derived whole blood together with 4 × 105 recipient derived (CD45.1) bone marrow cells. Recipient mice were euthanized 24 weeks after transplantation to determine chimaerism levels using flow cytometry analysis. For calculation of competitive repopulating units (CRU), recipient mice were transplanted with limiting dilutions of donor derived bone marrow cells (2.5 × 104 to 2 × 105) together with 2 × 105 recipient derived bone marrow cells. Mice were euthanized after 24 weeks and multi-lineage myelo-lymphoid donor derived contribution in the peripheral blood was assessed using flow cytometry analysis. HSC-CRU frequency and statistical significance was determined using ELDA software (http://bioinf.wehi.edu.au/software/elda/). Lineage negative cells were enriched from total bone marrow cells, taken from c-Kit-EGFP mice, using mouse lineage depletion kit (BD) according to the manufacturer’s instructions. Non-irradiated recipient mice were transplanted by i.v. injection with 2 × 106 c-Kit-EGFP-labelled Lin− cells. Recipient mice were euthanized 4 h after transplantation. Bone marrow cells were isolated from femurs and stained for flow cytometry as described above. Femur cellularity was determined in order to calculate the number of homed CD34−/LSK HSPC per femur. For magnetic isolation of BMECs, freshly recovered bones were processed under sterile conditions as described for BMECs flow cytometry analysis, and post-digestion incubated with biotin rat anti-mouse CD31 antibodies (BD pharmigen) for 30 min at 4 °C. Next, cells were washed and incubated with streptavidin particles plus (BD IMag) for 30 min at 4 °C. Positive selection was performed using BD IMagnet (BD) according to the manufacturer’s instructions (BD Biosciences). BD IMag buffer (BD) was used for washing and for antibodies dilution. Isolated cells were seeded on fibronectin (Sigma-Aldrich) coated wells and cultured overnight in EBM-2 medium (Lonza) supplemented with EGM-2 SingleQuots (Lonza) at 37 °C 5% CO . Non-adhesive cells were removed and adherent cells were collected using accutase (eBioscience). Flow cytometry was applied to confirm endothelial identity and >90% purity of recovered cells. BMEC were further processed to isolate RNA. Total RNA was isolated using TRI-Reagent (Sigma-Aldrich) according to the manufacturer’s protocol. An aliquot of 2 μg of total RNA was reverse-transcribed using Moloney murine leukaemia virus reverse transcriptase (Promega, Madison, WI) and oligo-dT primers (Promega). Quantitative reverse transcribed–polymerase chain reaction (qRT–PCR) was done using the ABI 7000 machine (Applied Biosystems, Foster City, CA) with SYBR Green PCR Master Mix (Applied Biosystems). Comparative quantization of transcripts was assessed relative to hypoxanthine phosphoribosyl transferase (Hprt) levels and amplified with appropriate primers. Primer sequences used were as follows (mouse genes): Cxcr4 forward 5′- ACGGCTGTAGAGCGAGTGTT-3′; reverse 5′- AGGGTTCCTTGTTGGAGTCA-3′; Fgfr1 forward 5′-CAACCGTGTGACCAAAGTGG-3′; reverse 5′-TCCGACAGGTCCTTCTCCG-3′; Fgfr2 forward 5′-ATCCCCCTGCGGAGACA-3′; reverse 5′-GAGGACAGACGCGTTGTTATCC-3′; Hprt forward 5′-GCAGTACAGCCCCAAAATGG-3′; reverse 5′-GGTCCTTTTCACCAGCAAGCT-3′. All statistical analyses were conducted with Prism 4.0c version or Excel (*P < 0.05, **P < 0.01, ***P < 0.005; NS, not significant). All data are expressed as mean ± standard error (s.e.m) and all n numbers represent biological repeats. Unless indicated otherwise in figure legends, a Student’s two-tailed unpaired t-test was used to determine the significance of the difference between means of two groups. One-way ANOVA or two-way ANOVA was used to compare means among three or more independent groups. Bonferroni post-hoc tests were used to compare all pairs of treatment groups when the overall P value was <0.05. A normal distribution of the data was tested using the Kolmogorov–Smirnov test if the sample size allowed. If normal-distribution or equal-variance assumptions were not valid, statistical significance was evaluated using the Mann–Whitney test and the Wilcoxon signed rank test. Animals were randomly assigned to treatment groups. Tested samples were assayed in a blinded fashion.


News Article | December 14, 2016
Site: www.nature.com

Somatic mitochondrial DNA (mtDNA) mutations accumulate within various tissues with age1, 2, however evidence directly showing the influence of mtDNA natural variations on ageing has been limited to date. Recently, Latorre-Pellicer et al. demonstrated that polymorphisms within mtDNA affect reactive oxygen species (ROS) levels, body mass, ageing score, tumour incidence and lifespan of conplastic mice3. Here we show that similarly generated conplastic strains, which carry a nuclear Nnt mutation, do not show any alterations in these parameters, demonstrating the relevance of specific mitonuclear interactions in determining mammalian healthspan through increased production of ROS. Latorre-Pellicer et al.3 compared a conplastic mouse strain that they developed from a C57BL/6JOlaHsd nuclear genome and NZB/OlaHsd mtDNA (BL/6NZB) mice carrying various mutations in the mitochondrial genome with the original C57BL/6JOlaHsd carrying unaltered mtDNA (BL/6C57). Despite the increased levels of ROS at a young age, BL/6NZB mice showed a delayed ageing phenotype, including reduced tumour incidence culminating in an extended lifespan, which is consistent with previously published findings in invertebrates4. In this study4, it was shown that metabolic induction of mitochondrial ROS formation promotes longevity in the nematode Caenorhabditis elegans, and that quenching this ROS signal by antioxidants abrogates the increase in lifespan. C57BL/6J mice (Jackson Laboratories, JAX no. 000664) are known to harbour a mutation in a nuclear gene encoding the mitochondrially located nicotinamide nucleotide transhydrogenase (NNT) protein that renders the enzyme undetectable, resulting in reduced cytosolic antioxidant capacity and increased production of hydrogen peroxide5 as well as impaired glucose tolerance6, independent of any additional mitochondrial variation. We generated conplastic C57BL/6J-mtNZB/BnlJ (mtNZB/BlnJ)7 and C57BL/6J (mtC57BL/6J) mice similar to the design used by Latorre-Pellicer et al.3. Notably, we did not observe an extension of the median or maximum lifespan of our conplastic mtNZB/BlnJ mice (P = 0.251, log-rank test; P = 0.943, Gehan test; Fig. 1a and Extended Data Table 1a–d) despite our large cohort size (n = 155, mtC57BL/6J; n = 131, mtNZB/BlnJ) resulting in high statistical power (>99% for the Gehan test, which places higher weight on early deaths; and as used by Latorre-Pellicer et al.3). Furthermore, we did not observe any differences in body mass, ageing score, tumour incidence (Fig. 1b–d) or spontaneous locomotor activity (Extended Data Fig. 1a, b). In addition, ROS levels, electron transport chain complex activity, and energy expenditure between our two strains showed no significant differences. An independent survival analysis with a log-rank test (which weights all subjects equally) also did not reveal any effect of the introduction of conplastic mtDNA on the lifespan of Nnt-deficient mice. Given that the published BL/6NZB line and our mtNZB/BlnJ mice harbour essentially the same mtDNA mutations (Extended Data Table 2), the simplest interpretation for the different results obtained by Latorre-Pellicer et al.3 and us is that the absence of NNT protein negates the effects of mitochondrial variation on healthspan. Together with the data from Latorre-Pellicer et al.3, our findings indicate that mtDNA mutations that increase ROS levels on a functional NNT background are associated with an increased healthspan3, whereas unaltered ROS levels prevent this effect on the progression of ageing (Fig. 1), both consistent with findings on mitohormesis4. As demonstrated in a variety of biological systems including humans8, low-dose increases in mitochondrial ROS promote health and longevity, whereas higher doses cause the opposite effect by causing cellular and systemic damage, reflecting a nonlinear, that is, hormetic, response to a mitochondrial stressor, namely ROS9, 10. The median and maximum lifespans in Latorre-Pellicer et al.3 are reduced compared with those in our study (published median lifespan in BL/6C57, 741 days; our median in mtC57BL/6J, 841 days). The reported lifespan of Jackson Laboratory C57BL/6J mice without Nnt is longer than the C57BL/6JNNia mice with the Nnt gene. However, other differences that are known to affect lifespan, such as environmental influences (including housing conditions, diet, handling and microbiota), cannot be excluded at present. In summary, we consider the use of conplastic animals an important approach for the investigation of the putative effect of mtDNA on mammalian physiology. Nevertheless, and besides the potential impact of environmental conditions, we assume that the pronounced differences outlined here can be largely attributed to the Nnt mutation in the nuclear genome of the Jackson C57BL/6J sub-strain used here. Accordingly, further experimental studies involving the same and additional strains should be performed to study the impact of mtDNA variations and mitochondrial ROS signalling to increase our knowledge of the related pathways responsible for the control of mammalian healthspan.

Loading Jackson Laboratories collaborators
Loading Jackson Laboratories collaborators