Institute of Medical Research

Kuala Selangor, Malaysia

Institute of Medical Research

Kuala Selangor, Malaysia

Time filter

Source Type

News Article | May 10, 2017
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. The fresh-frozen tissue and blood samples analysed in the current study were obtained from Australian melanoma biospecimen banks, including the Melanoma Institute Australia (n = 160), Australasian Biospecimen Network-Oncology Cell Line Bank QIMR-Berghofer Institute of Medical Research (n = 15; all lines authenticated by DNA profiling and tested for mycoplasma contamination), Ludwig Institute for Cancer Research (n = 4) and Peter MacCallum Cancer Centre/Victorian (n = 4) biospecimen banks. All tissues and bloods form part of prospective collection of fresh-frozen samples accrued with written informed patient consent and institutional review board approval. Fresh surgical specimens were macro-dissected and tumour tissues were procured (with as little contaminating normal tissue as possible) and snap frozen in liquid nitrogen within 1 h of surgery. All samples were pathologically assessed before inclusion into the study, with samples requiring greater than 80% tumour content and less than 30% necrosis to be included. All samples were independently reviewed by melanoma pathologists (R.A.S., R.E.V.) to confirm the presence of melanoma and qualification of the above criteria. Samples requiring tumour enrichment underwent macrodissection or frozen tissue coring (Cryoxtract, Woburn, Massachusetts, USA) using a marked haematoxylin and eosin slide as a reference. The histopathology of all mucosal and acral samples was reviewed by R.A.S. to confirm the diagnosis. Acral melanomas were classified as occurring within acral skin of the palm of the hand, sole of the foot and under nail beds. The lack of hair follicles, thickened stratum corneum and clinical site was confirmed in all cases. Mucosal melanomas were defined as occurring in the mucosal membranes lining oral, respiratory, gastrointestinal and urogenital tracts. The haematoxylin and eosin slides of the primary melanomas were reviewed for all mucosal and acral samples, and any tumour that arose in the junction of the acral/mucosal and cutaneous skin was excluded. Occult/unknown primary melanomas were considered cutaneous, since their genome landscape is indistinguishable from that of melanomas arising in the skin40. Tumour DNA was extracted using DNeasy Blood and Tissue Kits (69506, Qiagen), according to the manufacturer’s instructions. Blood DNA was extracted from whole blood using Flexigene DNA Kits (51206, Qiagen). All samples were quantified using the NanoDrop (ND1000, Thermoscientific) and Qubit dsDNA HS Assay (Q32851, Life Technologies), and DNA size and quality were tested using gel electrophoresis. Samples with a concentration of less than 50 ng μl−1, or absence of a high molecular mass band in electrophoresis gels, were excluded from further analyses. WGS was performed on Illumina Hiseq 2000 instruments (Illumina, San Diego, California, USA) at three Australian sequencing facilities (Australian Genomic Research Facility, Ramaciotti Centre for Genomics, John Curtin School of Medical Research) and Macrogen (Geumcheon-gu, Seoul, South Korea). All facilities performed library construction using TruSeq DNA Sample Preparation kits (Illumina) according to the manufacturer’s instructions. The subsequent 100 base pair (bp) pair-end libraries were sequenced using Truseq SBS V3-HS kits to average depth 85× (range 43–219×) in the tumour sample and 64× (range 30–214×) in the matched normal. Sequence data were aligned to the GRCh37 assembly using multi-threaded BWA 0.6.2-mt, resulting in sorted lane level files in sequence alignment/mapping format which were compressed and converted to binary file (BAM) created by samtools 0.1.19. Sample-level merged BAMs, one each for matched germline and tumour samples, were produced by in-house tools and duplicate reads marked with Picard MarkDuplicates 1.97 (http://picard.sourceforge.net). Quality assessment and coverage estimation was performed by qProfiler and qCoverage (http://sourceforge.net/projects/adamajava). To test for the presence of sample or data swaps, all sequence data were assessed by qSignature for concordance at approximately 1.4 million polymorphic genomic positions including the genotyping array data where available. Somatic mutations and germline variants were detected using a dual calling strategy using qSNP41 and GATK42, and indels of 1–50 bp in length were called with Pindel43. All mutations were submitted to the International Cancer Genome Consortium44 Data Coordination Centre. Mutations were annotated with gene consequence using Ensembl gene annotation with SnpEff. Somatic genes that were significantly mutated were identified using two approaches: MutSigCV and OncodriveFML 1.1 (ref. 22) using a threshold of q < 0.1. Significant non-coding elements were detected using OncodriveFML 1.1 (ref. 22). Somatic copy number and ploidy were determined using the TITAN tool45. Structural variants were identified using the qSV tool and chromosomes containing highly significant non-random distributions of breakpoints were identified as previously described46. Chromosomes identified to have clustering of breakpoints were inspected against criteria for chromothripsis47 and the BFB cumulative rearrangement model48. Chromosomes with high numbers of translocations were identified with a minimum threshold of ten translocation breakpoints per chromosome following manual review. Mutational signatures were predicted in each sample using a published framework1. Essentially, the substitution mutations across the whole genome in all cases were analysed in context of the flanking nucleotides (96 possible trinucleotide combinations). Identified signatures were compared with other validated signatures and the frequency of each signature per megabase was determined. Statistical significance of recurrent non-coding mutations was estimated using a permutation test. A null distribution of recurrence was estimated by randomly shuffling all mutations within each sample and recording the number of recurrent mutations within the regions of interest. To take into account not only the varying mutation burden but also the different mutation signatures, we restricted the random shuffling such that the mutation in the middle of a trinucleotide, ABC, was only shuffled to the same trinucleotide. Promoters and UTRs likely to play a role in tumorigenesis were identified with OncodriveFML22, a framework able to detect signals of positive selection in both the coding and the non-coding regions of the genome by measuring the bias towards the accumulation of functional mutations. The functional impact of mutations in gene promoters was assessed using the CADD (Combined Annotation Dependent Depletion)49, TFBS creation and TFBS disruption scores. The CADD scores measure the deleteriousness of mutations, and are calculated by integrating multiple annotations into a single metric by contrasting variants that survived natural selection with simulated mutations. The scores for TFBS creation (motif gain) and disruption (motif break) were computed by following the steps described in ref. 50. The score value indicates the difference between position weight matrix matching scores of the germline and mutant alleles. The 5′ UTRs were analysed using the TFBS disruption scores while 3′ UTRs were analysed using the CADD scores. The statistical significance of promoters and UTRs was derived by comparing the average functional impact score of the mutations in the element with the functional impact scores obtained by permuting 100,000-fold the observed mutations, maintaining their trinucleotide context. In addition, since the rate of somatic mutations in melanoma is highly increased at active TFBS23, OncodriveFML was adapted (version 1.1) to perform a strictly local permutation in windows of 51 bp (25 nucleotides at each side of the mutation). This variation in the background model of OncodriveFML allowed us to better estimate whether the mutations observed in tumours disrupted or created TFBS more than expected by chance. The statistical significance of promoters and UTRs mutated in at least two samples was adjusted with the Benjamini–Hochberg correction for multiple testing. We also used miRanda version 3.3a to predict whether the recurrent 3′ UTR mutations alter (disrupt or create) microRNA (miRNA) binding sites. The 50-base sequence surrounding each 3′ UTR was used as input to miRanda. miRNAs that were predicted to hit either the wild-type or mutant sequence (but not both) were considered potential targets and further filtered as follows. We required a hit to perfectly align against the seed region of the miRNA (nucleotides 2–8), that the mutation lay within the seed and that the predicted binding energy was higher (lower ΔG) in the non-hit than in the hit. To estimate telomere length, we counted telomere motifs in the whole gene data using the quantitative-PCR-validated qMotif tool (https://sourceforge.net/p/adamajava/wiki/qMotif) implemented in JAVA using the Picard library (version 1.110). qMotif is driven by a single plain-text configuration file in the ‘Windows INI-file’ style and the input is a WGS BAM file that has been duplicate-marked and coordinate-sorted. Essentially, qMotif uses a two-stage matching system where the first stage is a quick-but-strict string match and the second stage is a slower but more flexible regular expression match; only reads that pass stage 1 go on to the much slower match in stage 2. For telomere quantification, a string representing three concurrent repeats of the canonical telomere motif (TTAGGGTTAGGGTTAGGG) was used as the stage 1 match, and a simple pattern match for stage 2 which captured any read with two or more concurrent occurrences of the telomeric repeat with variation allowed in the first three bases. The relative tumour telomere length was then estimated by comparing the tumour read counts with the matched normal sample. Telomere length was validated by quantitative PCR51. Direct PCR amplification and Sanger sequencing were performed using the primers hTERT_F ACGAACGTGGCCAGCGGCAG and hTERT_R CTGGCGTCCCTGCACCCTGG, which amplify a 474 bp region of the TERT promoter52. PCR was done in a 13 μl volume containing 1 μl of 20 ng μl−1 gDNA, 1.25 μl of 10× MgCl , 2.5 μl betaine, 1.25 μl deoxynucleotides (2.5 mM), 1 μl of 10 μM primers and 0.25 μl of PFU Turbo (600250, Agilent). PCR reactions were performed under the following conditions: 95 °C for 5 min, followed by four cycles of 95 °C for 30 s, annealing at 66 °C for 1 min and polymerization at 72 °C for 1 min. This was followed by 4 more cycles with a lowered annealing temperature of 64 °C for 1 min, followed by 28 cycles with annealing temperatures of 62 °C. Subsequent PCR products were sequenced on an AbiPrism 3130xl Genetic Analyzer (Applied Biosystems) and data analysed using Sequence Scanner Software 2 (Applied Biosystems) with reference to the sequences from the NCBI gene database, TERT (chr5:1295071–1295521). Illumina TruSeq Custom Amplicon V1.5 was used to validate 20 recurrent non-coding point mutations in the promoter (n = 11), 3′ UTR (n = 3) and 5′ UTR (n = 6) regions of genes with frequent non-coding mutations in 164 of the 183 samples. Illumina DesignStudio (Illumina, San Diego, California, USA) was used to design 250 bp sequences of the target regions. Sequencing libraries were prepared using the TruSeq Custom Amplicon Library Preparation Guide and the TruSeq Custom Amplicon Index Kit, and sequenced on a MiSeq Illumina sequencer V2 (Illumina). Sequences were aligned to the reference genome (GRCh37/hg19) using BWA 0.6.2-mt. A pileup approach was used to determine the base count at each position of interest. A mutation was considered verified if the mutant allele frequency was >10%. Exome capture was performed on 1 μg of DNA extracted from tumour and normal blood using an Illumina TruSeq Exome Library Prep Kit. Libraries were sequenced (paired-end sequencing) on an Illumina HiSeq2000 platform with a minimum coverage of 61× (normal) and 59× (tumour). Exome sequence data were produced for 53 patients in the cohort and used to validate coding mutations detected by WGS. Total RNA was extracted from fresh-frozen tissue using a mirVana miRNA Isolation Kit (Applied Biosystems, AM1560). RNA quality and presence of a small RNA fraction were measured using the Agilent 2100 RNA 6000 Nano and small RNA kits. RNA sequencing was performed using 1 μg of total RNA, which was converted into messenger RNA libraries using an Illumina mRNA TruSeq kit. RNA sequencing was performed using 2 × 75 bp paired-end reads on an Illumina Hiseq2000. Small RNA sequencing was performed using 1 μg of total RNA, which was converted into a small RNA libraries, size selection range 145–160 bp (RNA of 18–33 nucleotides) using Illumina’s TruSeq Small RNA Library Preparation Kit and sequenced on an Illumina Hiseq2000 using 50 bp single-read sequencing with 1% control spiked in. RNA sequence reads were aligned to transcripts corresponding to ensemble 70 annotations using RSEM53. RSEM data were normalized using TMM (weighted trimmed mean of M-values) as implemented in the R package ‘edgeR’. For downstream analyses, normalized RSEM data were converted to counts per million. Genes with at least 5 counts per million in at least two samples were considered expressed. Total numbers of SNV/indel and structural variants were compared according to primary melanoma body site, categorized into abdomen, acral hand, acral foot, back, lower arm, lower leg, mucosal, neck, shoulder, thorax, upper arm, upper leg, and face and scalp. Any samples with an unknown primary site or occult classification were excluded from analysis. Heat maps were produced in Spotfire-Tibco (version 6.0, http://spotfire.tibco.com) on the basis of the combined total number of SNV and indels, or by structural variants. A two-colour heat map (red high, blue low) was produced and colours were overlaid onto an adapted SVG human body diagram that was created using Adobe Illustrator CS6. The frequency of clinically actionable mutations was assessed by annotating genomic variants using the IntOGen Cancer Drivers Actionability database (2014), which identifies mutations that may confer sensitivity to therapeutic agents54. The database was used to assign an activating or loss-of-function role to mutated genes. Loss of heterozygosity, silent mutations, deletions to activating genes or amplifications to loss-of-function genes were not included in the analysis. Additionally, visual inspection using the Integrative Genome Viewer (IGV, Broad) was used to identify only high-confidence structural rearrangement breakpoints with clustered supporting reads with both discordant read pair and soft clipping evidence. Structural variants with a high incidence of random non-clustered background signal surrounding the breakpoints along with low numbers of supporting non-duplicate reads were excluded from analysis for this figure (Extended Data Fig. 10). The proportion of tumours with a mutation to a particular actionable gene was calculated and classified on the basis of mutation type into (1) SNV/indel, (2) SNV/indel and structural variant, (3) structural variant or (4) copy number variation only. A hand-curated list of commonly mutated tumour suppressor genes and oncogenes was created and analysed for the frequency of mutation (Fig. 4a). Mutations were defined as SNV/indel, structural variant, copy number amplifications and copy number deletions. Loss of heterozygosity, silent mutations, RNA mutations, deletions to oncogenes or amplifications to tumour suppressor genes were not included in the figure. Structural variant breakpoints were subjected to manual inspection using the Integrative Genome Viewer (IGV, Broad) and only events confirmed as somatic and predicted to alter transcription processing were considered further. We then overlaid the alterations from Fig. 4a onto pathways defined by Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) gene sets from MSigDB version 5.0. A pathway was considered altered in a given sample if at least one gene in the pathway contained an SNV/indel or structural variant. The pathways were then stratified according to cutaneous or non-cutaneous subtypes. A mutation file with sample identities and their mutated pathways was entered for analysis into the OncoPrinter tool (http://cbioportal.org). MAPK and PI3K pathway status was also assessed by multiplex-immunofluorescent staining for phosphorylated ERK and AKT (106/183). All immunohistochemical staining was performed on a Dako Autostainer Plus (Dako, Glostrup, Denmark) using a Dako Envision Flex detection kit (K8000, Dako) and OPAL 7-colour IHC Kit for visualization (NEL797B001KT, PerkinElmer). Consecutive staining rounds included p-AKT (1:100, NCL-L-Akt-Phos, Leica), p-ERK (1:1,600, CS4370, Cell Signalling) and SOX10 (1:800, ACI 3099A, Biocare). Multispectral quantitative image analysis was performed on a Vectra 3 slide scanner (PerkinElmer, USA). The captured multispectral images were analysed using the quantitative InForm image analysis software (PerkinElmer, USA). All somatic variants for this study have been deposited in the International Cancer Genome Consortium Data Coordination Centre and are publicly available at https://dcc.icgc.org. The BAM files have been deposited in the European Genome-phenome Archive (https://www.ebi.ac.uk/ega/) with accession number EGAS00001001552. Tools used in this publication that were developed in-house are available from the SourceForge public code repository under the AdamaJava project (http://sourceforge.net/projects/adamajava/). Source data are provided or are available from the corresponding author upon reasonable request.


News Article | May 24, 2017
Site: www.marketwired.com

SEATTLE, WA--(Marketwired - May 24, 2017) - CFN Media Group, the leading creative agency and digital media network dedicated to legal cannabis, announces the publication of an article discussing United Cannabis Inc.'s ( : CNAB) progress in initiating clinical trials to study its proprietary Prana Bio Medicinals cannabinoid compounds. Prana Bio Medicinals United Cannabis Corp.'s Prana Bio Medicinal products provide patients with a way to mix and match cannabinoids for their therapeutic purposes. Using a patent-pending technology, the company infuses cannabinoids, terpenes, and flavonoids without the use of any heat, solvents, or chemicals to produce 100% natural products. These products interact with the human endocannabinoid system, which has receptors throughout the body and is responsible for homeostasis (the maintenance of a stable internal environment). They are broken down into five color-coded categories and are available as capsules, sublinguals or topicals. "We pride ourselves on not using any chemical solvents (i.e. nButane, C02, Ethanol, Hexane) in our extraction process," states United Cannabis CTO Tony Verzura. "We utilize our patent-pending infusion process that extracts phytocannabinoids, terpenes, and flavonoids from raw flower material without the use of any heat. Heat 'activates' compounds and creates the hypnotic and euphoric feeling generally experienced with THC when paired with certain terpene profiles. "We have systematically created a wide variety of both raw and 'active' categories, delivery methods, and doses that makes it easy for educated patients, practitioners, or researchers to target the Endocannabinoid system. Our P1 thru P5 categories systematically classify chemotypes of cultivars that express different ratios of THC, CBD, and terpene profiles. We are the only company in the world providing both raw and active ingredients in a 100% plant-based hypoallergenic formula with multiple delivery methods ranging from 1 mg to 50 mg doses. "Additional to the products, we provide a complimentary program (A.C.T. Now) administered by professional practitioners to help patients personalize the medicine for their specific needs in a HIPAA compliant cloud-based Electronic Health Records software. The combination of our products currently being used in the biggest market in the United States serving thousands of patients, and our integrated approach to personalized patient care separates us from the competition." This A.C.T. Now Program helps patients assess their current medications and create a personalized plan with the help of a nurse. After undergoing a nurse-assisted assessment, patients can record their health conditions, schedule follow-ups, and fine-tune their medications via a robust and HIPAA-compliant cloud-based platform. The goal is to create an end-to-end treatment system for individuals suffering from many different medical conditions. Demonstrating Efficacy United Cannabis Corp.'s long-term goal is to develop its Prana products into a line of approved pharmaceutical drugs that physicians can prescribe to their patients. In order to do so, the company must undertake extensive clinical trials designed to prove both the safety and efficacy of cannabinoid-based compounds given that only a handful of synthetic compounds have been approved by government regulatory bodies thus far. In January, the company signed a letter of intent with the Caribbean Institute of Medical Research (CARIMER) -- a full-service global clinical research and development organization (CRO) -- to collaborate on advancing clinical research on medical cannabis. Under the LOI, the company will conduct studies evaluating its Prana P1 through P5 products under the supervision of the CARIMER team. The team will initially focus on pharmacokinetic and dose escalation safety studies, followed by clinical efficacy trials as it works towards regulatory approval. In time, the company hopes to develop its Prana product line into a pharmaceutical program that physicians can routinely use to prescribe cannabinoid-based therapeutics to their patients. This could unlock significant value for the company, given the high profit margins and even higher barriers-to-entry for pharmaceuticals. Please follow the link to read the full article: http://www.cannabisfn.com/united-cannabis-near-term-clinical-trials-catalyze-stock/ Learn how to become a CFN Media featured company, brand or entrepreneur: http://www.cannabisfn.com/become-featured-company/ Download the CFN Media iOS mobile app to access the world of cannabis from your smart phone: https://itunes.apple.com/us/app/cannabisfn/id988009247?ls=1&mt=8 Or visit our homepage and enter your mobile number under the Apple App Store logo to receive a download link text on your iPhone: http://www.cannabisfn.com About CFN Media CFN Media (CannabisFN) is the leading creative agency and media network dedicated to legal cannabis. We help marijuana businesses attract investors, customers (B2B, B2C), capital, and media visibility. Private and public marijuana companies and brands in the US and Canada rely on CFN Media to grow and succeed. Disclaimer: Except for the historical information presented herein, matters discussed in this release contain forward-looking statements that are subject to certain risks and uncertainties that could cause actual results to differ materially from any future results, performance or achievements expressed or implied by such statements. Emerging Growth LLC, which owns CFN Media and CannabisFN.com, is not registered with any financial or securities regulatory authority, and does not provide nor claims to provide investment advice or recommendations to readers of this release. Emerging Growth LLC may from time to time have a position in the securities mentioned herein and may increase or decrease such positions without notice. For making specific investment decisions, readers should seek their own advice. Emerging Growth LLC may be compensated for its services in the form of cash-based compensation or equity securities in the companies it writes about, or a combination of the two. For full disclosure please visit: http://www.cannabisfn.com/legal-disclaimer/.


The cannabis and legal marijuana industry continues to be a rapidly growing and very lucrative opportunity for a variety of companies, but a recent focus on intellectual property development and innovative services have emerged as companies go all-out to serve the thriving consumer demand where legally approved marijuana operations have been approved. Companies in the race to enhance production and quality as well as providing new advanced services in the industry include: Sugarmade, Inc. (OTC: SGMD), Cannabis Science, Inc. (OTC: CBIS), MassRoots, Inc. (OTC: MSRT), mCig, Inc. (OTC: MCIG), United Cannabis Corporation (OTC: CNAB). Sugarmade, Inc. (OTCQB: SGMD), announces the completion of an agreement allowing the Company to introduce a new and revolutionary set of intelligent and active packaging systems for cannabis transport and storage. These products will allow cultivators and retailers to preserve THC levels, protect trichomes and save terpenes, while helping to mitigate pathogen levels, all of which are critical to the marketing and enjoyment of high-quality cannabis flowers. "We plan to lead the market in advanced transport and storage for the fast growing cannabis industry," commented Jimmy Chan, CEO. "Currently, cannabis flowers have a very short shelf life. The trichomes that protect the cannabinoids, terpenoids and flavonoids are extremely sensitive to handling, atmosphere gases, humidity and light. Current methods of transport and storage are very unfriendly to trichome preservation, resulting in millions of dollars in lost profits for cultivators and retailers and reduced enjoyment by consumers. Our aim is to lead the market in fixing these problems for the fast growing cannabis marketplace." Read this and more news for SGMD at http://marketnewsupdates.com/news/sgmd.html Through the use of patent protected technologies, Sugarmade will offer transport and storage containers that will actively create the ultimate protective environment within transport and storage containers, while also applying food safe oxidizers to mitigate pathogens to make cannabis safer. Sugarmade and its licensor partner, Cannabis Active Packaging, Inc., are currently in the applications development process and are actively developing prototypes for testing in the laboratory environment. While the food industry has used modified atmosphere packaging for many years, recent advancements have given way to active and intelligent packaging. Active packaging is a smart system that involves interaction between packaging components and the internal gas atmosphere within the package. The intellectual property on which Sugarmade will base its new products takes active packaging one step further by adding intelligence to the packaging, which will allow for active feedback to the consumer and tracking throughout the entire supply chain. In other recent performances and developments in the marijuana markets: Cannabis Science, Inc. (OTC: CBIS) News: Crown Baus Capital Corp. (CBCA) announces the Company acquires 100-acre investment participation in the Cannabis Science, Inc. (CBIS) Property and Drug Development Projects spread across California and Nevada. The agreement includes cultivation, laboratory, and manufacturing capabilities. CBIS will receive 10 million common shares of CBCA as payment in kind. Mr. Dabney is the President, CEO, and Co-Founder of both CBCA and CBIS. MassRoots, Inc. (OTCQB: MSRT) closed up at $1.01 on Friday trading over 2.3 Million shares by the market close. MassRoots, one of the leading technology platforms for the cannabis industry, announced on last Friday a general business update on the Company and legal cannabis marketplace. Read the full update at: http://finance.yahoo.com/news/massroots-provides-business-company-outlook-140000927.html mCig, Inc. (OTCQB: MCIG) closed up over 7% on last Friday trading over 2.7 Million shares by the market close. mCig Inc., a diversified company servicing the legal cannabis, hemp, and CBD markets, earlier this month came into a significant agreement with several MCIG's major shareholders to reduce its common stock by 60 million shares by converting those shares into 6 million Series A Preferred Stock with a minimum 2 year lock up agreement. United Cannabis Corporation (OTCQB: CNAB) closed even last Friday at $2.00 trading over 1.5 Million shares by the market close. United Cannabis recently announced that it, along with its Jamaica-based subsidiary, Cannabis Research & Development ("CRD"), had signed a Letter of Intent with the Caribbean Institute of Medical Research to collaborate on advancing clinical research on medical cannabis. DISCLAIMER:  MarketNewsUpdates.com (MNU) is a third party publisher and news dissemination service provider, which disseminates electronic information through multiple online media channels. MNU is NOT affiliated in any manner with any company mentioned herein. MNU and its affiliated companies are a news dissemination solutions provider and are NOT a registered broker/dealer/analyst/adviser, holds no investment licenses and may NOT sell, offer to sell or offer to buy any security. MNU's market updates, news alerts and corporate profiles are NOT a solicitation or recommendation to buy, sell or hold securities. The material in this release is intended to be strictly informational and is NEVER to be construed or interpreted as research material. All readers are strongly urged to perform research and due diligence on their own and consult a licensed financial professional before considering any level of investing in stocks. All material included herein is republished content and details which were previously disseminated by the companies mentioned in this release. MNU is not liable for any investment decisions by its readers or subscribers. Investors are cautioned that they may lose all or a portion of their investment when investing in stocks. For current services performed MNU has been compensated three thousand nine hundred dollars for news coverage of the current press release issued by Sugarmade, Inc. by a non-affiliated third party. MNU HOLDS NO SHARES OF ANY COMPANY NAMED IN THIS RELEASE. This release contains "forward-looking statements" within the meaning of Section 27A of the Securities Act of 1933, as amended, and Section 21E the Securities Exchange Act of 1934, as amended and such forward-looking statements are made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. "Forward-looking statements" describe future expectations, plans, results, or strategies and are generally preceded by words such as "may", "future", "plan" or "planned", "will" or "should", "expected," "anticipates", "draft", "eventually" or "projected". You are cautioned that such statements are subject to a multitude of risks and uncertainties that could cause future circumstances, events, or results to differ materially from those projected in the forward-looking statements, including the risks that actual results may differ materially from those projected in the forward-looking statements as a result of various factors, and other risks identified in a company's annual report on Form 10-K or 10-KSB and other filings made by such company with the Securities and Exchange Commission. You should consider these factors in evaluating the forward-looking statements included herein, and not place undue reliance on such statements. The forward-looking statements in this release are made as of the date hereof and MNU undertakes no obligation to update such statements.


Chow Z.,Monash University | Banerjee A.,Institute of Medical Research | Hickey M.J.,Monash University
Immunology and Cell Biology | Year: 2015

Regulatory T cells have essential roles in regulating immune responses and limiting inappropriate inflammation. Evidence now indicates that to achieve this function, regulatory T cells must be able to migrate to the most appropriate locations within both lymphoid and non-lymphoid organs. This function is achieved via the spatiotemporally controlled expression of adhesion molecules and chemokine receptors, varying according to the developmental stage of the regulatory T cell and the location and environment where they undergo activation. In this Review, we summarise information on the roles of adhesion molecules and chemokine receptors in mediating regulatory T-cell migration and function throughout the body under homeostatic and inflammatory conditions. In addition, we review recent studies that have used in vivo imaging to examine the actions of regulatory T cells in vivo, in lymph nodes, in the microvasculature and in the interstitium of peripheral organs. These studies reveal that the capacity of regulatory T cells to undergo selective migration serves a critical role in their ability to suppress immune responses. As such, the cellular and molecular requirements of regulatory T-cell migration need to be completely understood to enable the most effective use of these cells in clinical settings. © 2015 Australasian Society for Immunology Inc. All rights reserved.


Goh P.,Hospital Selayang | Omar M.A.,Institute of Health Management | Yusoff A.F.,Institute of Medical Research
Singapore Medical Journal | Year: 2010

Introduction: Diabetic retinopathy (DR) is the commonest complication of diabetes mellitus (DM), and is the leading cause of blindness among working adults. Modification of the associated risk factors as well as early detection and treatment of sight-threatening DR can prevent blindness. Clinical practice guidelines recommend annual eye screening for patients with DM. The proportion of patients in Malaysia who adhere to this recommendation was initially unknown. Methods: The Malaysian National Health and Morbidity Survey is a population-based survey conducted once every decade on the various aspects of health, behaviour and diseases. The DM questionnaire on eye screening was administered as face-to-face interviews with 2,373 patients with known DM who were aged 18 years and older. Results: In all, 55 percent of patients with known DM had never undergone an eye examination. Among patients who had undergone eye examinations, 32.8 percent had the last examination within the last one year, 49.8 percent within the last one to two years, and 17.4 percent more than two years ago. A signifcantly lower proportion of younger patients and patients who received treatment for DM from non-government facilities had previously undergone eye examinations. Conclusion: The prevalence of DM observed among Malaysians aged 30 and above is 14.9 percent; thus, there is a signifcant number of people with potential blinding DR. Adherence to eye screening guidelines and the prompt referral of sight-threatening DR are essential in order to reduce the incidence of blindness among patients with DM.


Dixon C.M.,New Hill | Cedano E.R.,Clinica Canela | Mynderse L.A.,Mayo Medical School | Larson T.R.,Institute of Medical Research
Research and Reports in Urology | Year: 2015

Background: The purpose of this study was to assess the acute ablative characteristics of transurethral convective water vapor (steam) using the Rezūm® system in men with benign prostatic hyperplasia through histologic and radiographic studies. Methods: Seven patients were treated with transurethral intraprostatic injections of sterile steam under endoscopic visualization followed by previously scheduled adenectomies. The extirpated adenomas were grossly examined followed by whole mount sectioning and staining with triphenyl-tetrazolium chloride (TTC) to evaluate thermal ablation. Histology was performed after hematoxylin and eosin staining on one prostate. After review of results from the frst patient cohort, an additional 15 patients with clinical benign prostatic hyperplasia were treated followed by gadolinium-enhanced magnetic resonance imaging (MRI) at one week. Results: In the first patient cohort, gross examination of TTC-stained tissue showed thermal ablation in the transition zone. In addition, there was a distinct interface between viable and necrotic prostatic parenchyma. Histopathologic examination revealed TTC staining-outlined necrotic versus viable tissue. Gadolinium-enhanced MRIs in the cohort of 15 patients demonstrated lesion defects in all patients at 1 week post-procedure. Coalesced lesions were noted with a mean (± standard deviation) lesion volume of 9.6±8.5 cm3. The largest lesion volume was 35.1 cm3. Ablation using vapor was rapid and remained confined to the transition zone, consistent with the thermodynamic principles of convective thermal energy transfer. Conclusion: Thermal ablation was observed in all specimens. The resulting coalescing ablative lesions, as seen on MRI, were confned to the transition zone. These studies confrm the ablative capabilities of vapor, validate the thermodynamic principles of convective heating, and allow for further clinical studies. © 2015 Dixon et al.


Mohamed Saini S.,University of Kuala Lumpur | Nik Jaafar N.R.,University of Kuala Lumpur | Sidi H.,University of Kuala Lumpur | Midin M.,University of Kuala Lumpur | And 2 more authors.
Comprehensive Psychiatry | Year: 2014

Objectives The risk variants have been shown to vary substantially across populations and a genetic study in a heterogeneous population might shed a new light in the disease mechanism. This preliminary study aims to determine the frequency of the serotonin transporter gene polymorphism (5-HTTLPR) in the three main ethnic groups in Malaysia and its association with bipolar disorder. Methods This is a candidate gene association study of randomly selected forty five unrelated bipolar disorder probands and sixty six controls. Diagnosis was evaluated using the Mini International Neuropsychiatric Interview (M.I.N.I). The control group consisted of healthy volunteers without personal psychiatric history and family history of mood disorder. Patients' whole blood was collected for genotyping. Results This study revealed that the frequency of the short variant of 5-HTTLPR in healthy control group was highest in Indians (42.9%) followed by Malays (23.5%) and was absent in Chinese. The association between the homozygous ss genotype of the 5-HTTLPR polymorphism with bipolar disorder was not found in the pooled subjects (χ2 = 1.52, d.f. = 1, p = 0.218, OR = 4.67, 95% C.I. = 0.69-7.58) and after stratification into Malays (p = 0.315, OR = 2.03, 95% CI = 0.50-8.17), Indians (p = 0.310; OR = 0.44, 95% CI = 0.21-0.92) and Chinese. Conclusion The differences in the frequency of the short allele of 5-HTTLPR across the three main ethnic groups in Malaysia were noteworthy. The present study showed no significant association between the homozygous short variant of the 5-HTTLPR and bipolar disorder in the pooled subject and after stratification into the three main ethnic groups in Malaysia. © 2014 Elsevier Inc. All rights reserved.


Gompel A.,University of Paris Descartes | Burger H.,Institute of Medical Research
Climacteric | Year: 2015

The incidence of ovarian cancer is tenfold lower than that of breast cancer. The goal of the recently published meta-analysis by Beral and colleagues, using 'individual participant datasets from 52 epidemiological studies', was to provide an updated assessment of the effect of menopausal hormone therapy (MHT) on ovarian cancer risk. The relative risk generated from the cited prospective studies was significantly increased but the relative risk from the retrospective studies was not. This is quite unusual since retrospective studies usually display higher levels of relative risk. No further increase was observed with increasing duration. Moreover, a number of the studies could not be adjusted for important ovarian cancer risk factors. From the metaanalysis, it can be calculated that the absolute excess risk of 5 years of MHT for a 50-year-old UK woman is 1 in 10 000 per year, indicating a very low risk. We conclude that this meta-analysis mostly reflects the previously published data from the Million Women Study, from which the majority of this new publication is derived. © 2015 International Menopause Society.


Weinger J.G.,Yeshiva University | Davies P.,Yeshiva University | Davies P.,Institute of Medical Research | Acker C.M.,Yeshiva University | And 5 more authors.
Journal of Neuropathology and Experimental Neurology | Year: 2012

The abundant axonal microtubule-associated protein tau regulates microtubule and actin dynamics, thereby contributing to normal neuronal function. We examined whether mice deficient in tau (Tau -/-) or with high levels of human tau differ from wild-type (WT) mice in their susceptibility to neuroaxonal injury in experimental autoimmune encephalomyelitis, an animal model of multiple sclerosis. After sensitization with MOG 35-55, there was no difference in clinical disease course between human tau and WT mice, but Tau -/- mice had more severe clinical disease and significantly more axonal damage in spinal cord white matter than those in WT mice. Axonal damage in gray matter correlated with clinical severity in individual mice. By immunoblot analysis, the early microtubule-associated protein-1b was increased 2-fold in the spinal cords of Tau -/- mice with chronic experimental autoimmune encephalomyelitis versus naive Tau -/- mice. This difference was not detected in comparable WT animals, which suggests that there was compensation for the loss of tau in the deficient mice. In addition, levels of the growth arrest-specific protein 7b, a tau-binding protein that is stabilized when bound to tau, were higher in WT than those in Tau -/-spinal cord samples. These data indicate that loss of tau exacerbates experimental autoimmune encephalomyelitis and suggest that maintaining tau integrity might reduce the axonal damage that occurs in inflammatory neurodegenerative diseases such as multiple sclerosis. © 2012 by the American Association of Neuropathologists, Inc.


Waugh O.C.,Australian National University | Byrne D.G.,Australian National University | Nicholas M.K.,Institute of Medical Research
Journal of Pain | Year: 2014

Although persistent pain occurs in a sociocultural context, the influence of personal devaluation and invalidation is often neglected. As such, the present study sought to consider whether individuals' experience, perception, or anticipation of negative social reactions to their pain may become internalized and affect the self. To examine this issue, 92 adults with chronic pain responded to a questionnaire exploring the presence of internalized stigma and its association with a range of psychological consequences. As predicted, a large percentage of people with chronic pain (38%) endorsed the experience of internalized stigma. The results showed that internalized stigma has a negative relationship with self-esteem and pain self-efficacy, after controlling for depression. Internalized stigma was also associated with cognitive functioning in relation to pain, in terms of a greater tendency to catastrophize about pain and a reduced sense of personal control over pain. Overall, this study presents a new finding regarding the application of internalized stigma to a chronic pain population. It offers a means of extending our understanding of chronic pain's psychosocial domain. Implications are discussed in terms of the potential to inform clinical treatment and resiliency into the future. Perspective This article presents a novel finding regarding the presence of internalized stigma among people living with chronic pain. Internalized stigma is strongly associated with indicators of patient outcome. It presents an area for future work with the aim to improve our understanding and treatment of people living with pain. © 2014 by the American Pain Society.

Loading Institute of Medical Research collaborators
Loading Institute of Medical Research collaborators