Redwood City, CA, United States
Redwood City, CA, United States

Time filter

Source Type

The generation and characterization of Ercc1∆/+ and Ercc1+/−mice have been previously described16. Ercc1∆/− mice were obtained by crossing Ercc1∆/+ (in a pure C57BL6J or FVB background) with Ercc1+/− mice (in a pure FVB or C57BL6J background respectively) to yield Ercc1∆/− offspring with a genetically uniform F1 C57BL6J/FVB hybrid background (see ref. 6 for motivation). Wild-type F1 littermates were used as controls. Xpg−/− mice have been characterized previously6 and were generated by crossing Xpg+/− (in a pure C57BL6J background) with Xpg+/− mice (in a pure FVB background). Hence, all animals used in the studies described here were of the same F1 C57BL6J/FVB hybrid background. Typical unfavourable characteristics, such as blindness in an FVB background or deafness in a C57BL6J background, do not occur in this hybrid background. Mice were weighed, visually inspected weekly, and scored in a blinded fashion for gross morphological and motor abnormalities. Since the Ercc1∆/− and Xpg−/− mice were smaller, food was administered within the cages and water bottles with long nozzles were used from around two weeks of age. Animals were maintained in a controlled environment (20–22 °C, 12 h light:12 h dark cycle) and were housed in individual ventilated cages under specific pathogen free conditions. Animals were individually housed at the EMC location and group housed at the RIVM location. Experiments were performed in accordance with the Principles of Laboratory Animal Care and with the guidelines approved by the Dutch Ethical Committee in full accordance with European legislation. For the lifespan studies the indicated number of mice per group for ad libitum and 30% dietary restriction were generated. Additionally, several cross-sectional cohorts were generated. For Ercc1∆/− mice we generated groups which were killed at 7, 11, 16 or 30 weeks of age. The 7-week group consisted only of ad libitum-fed animals while the 30-week group consisted only of dietary restriction-treated mice. For wild-type mice, ad libitum-fed and dietary restriction-treated groups were sacrificed at 11, 16 or 20 weeks. Sample size of the lifespan cohorts were based on power analysis. No statistical methods were used to predetermine sample size of cross-sectional cohorts. Animals were divided randomly over all groups to prevent selection bias. All mice were clinically diagnosed daily in a blinded manner and, when moribund, killed, after which necropsy was performed. Animals from cross-sectional cohorts were killed when necropsy age was reached. Organs were stored at −80°C for molecular analysis or (perfusion) fixated in (para)formaldehyde for pathological examinations. Statistics was performed with survival curve analysis using the product-limit method of Kaplan and Meier in GraphPad Prism. All animals were bred and maintained on AIN93G synthetic pellets (Research Diet Services B.V.; gross energy content 4.9 kcal/g dry mass, digestible energy 3.97 kcal/g). The initial lifespan cohort, shown in Fig. 1a, were fed standard AIN93G pellets containing 2.5 g/kg choline bitartrate. To avoid potential formation of bladder and kidney stones, we replaced choline bitartrate with choline chloride in all subsequent experiments. The amount of dietary restriction was determined in a prior pilot study and food intake of the ad libitum-fed mice was continuously monitored. On average, Ercc1∆/− and Xpg−/− mice ate 2.3 g food per day. Dietary restriction was initiated at 7 weeks of age with 10% food reduction (2.1 g/day), when animals reached almost-maximum bodyweight and development was completed. Dietary restriction was increased weekly by 10%, until it reached 30% dietary restriction (1.6 g/day) from 9 weeks of age onward. Temporary dietary restriction was initiated directly with 30% food reduction at 6 weeks of age. These mice received ad libitum food again from 12 weeks onward. Wild-type mice ate on average 3.0 g food per day, resulting in 2.1 g/day for 30% dietary restriction. Food was given to the animals just before the start of the dark (active) period to avoid alteration of the biological clock. Representative sections from the liver, kidneys, sciatic nerve, testes and femur were processed, stained with haematoxylin and eosin, and microscopically examined in a blinded manner by two board-certified pathologists (SAY, AdB) for the presence of histopathologic lesions. The severity score of lesions was semi-quantitatively assessed. Scores were given as absent (0), subtle (1), mild (2), moderate (3), severe (4), and massive (5). Digital images from the kidneys and femur cortical bone at mid-shaft area were taken for morphometric analysis using Labsense image analysis software (Olympus). Ageing characteristics were assessed in >5 animals per group per sex. Groups were compared with nonparametric Mann–Whitney U and Kruskal–Wallis tests. Polyploidy levels were assessed based on propidium iodide (PI) fluorescence using FACS analysis31, 32. A small part of the left lobe (approximately 5 mm3) was dissected from ad libitum- and dietary restriction-treated Ercc1∆/− mice (7, 11, 16 and 30 weeks, n = 5) and wild-type mice (11 weeks, n = 5), cut into small fragments and suspended in 800 μl PBS using a syringe (21G). 300 μl homogenate was added to 300 μl 100% ethanol for fixation. Samples were stored for at least 24 h before further processing. After fixation the liver homogenate was washed with ice-cold PBS and subsequently incubated with a pepsin solution for 20 min. After washing in PBS/Tween-20, cells were collected in 500 μl PBS supplemented with 5 μg/ml PI and 250 μg/ml RNase and samples were measured using the FACS (FACSCalibur, Becton Dickinson). Differences between groups were assessed with a two-way ANOVA, with age and diet as fixed factors. Ad libitum- and diet-restricted mice were killed by cervical dislocation at scheduled ages, femora were excised and non-osseous tissue was removed. Two days after fixation in 4% formalin, the right femora were scanned using Skyscan 1076 in vivo X-Ray computed tomography (Bruker microCT) with a voxel size of 8.88 μm. Osseous tissue was distinguished from non-osseous tissue by segmenting the reconstructed grayscale images with an automated algorithm using local thresholds33. The region of interest (ROI) (the distal metaphysis of the femora) was selected using 3D data analysis software. To compensate for bone length differences, the length of each ROI was determined relative to the largest specimen femur of the cohort. The cortex and trabeculae of the metaphysis were separated using automated software developed in-house. The thickness of the trabeculae and cortices were assessed using 3D analysis software as described34 using the CT analyser software package (Bruker microCT). A bone specimen with known bone morphometrics was included within each scan as a quantitative control. Statistical significance was calculated using one-way Anova with Bonferroni’s multiple comparison test. The responses of isolated aortic tissue were ex vivo measured in small-wire myograph organ baths containing oxygenated Krebs-Henseleit buffer at 37 °C. After preconstriction with 30 nmol/l U46619, relaxation concentration–response curves to acetylcholine were constructed35. Single-cell suspensions were prepared from spleen by passing the cells through a cell strainer with HEPES-buffered saline solution (HBSS) supplemented with 2% FBS and washed. Erythrocytes were eliminated with ACK buffer. For CD4+CD25+Foxp3+ staining, cells were first stained for the expression of cell surface markers and then fixed, permeabilised, and stained using the Foxp3 kit (eBiosciences) according to the manufacturer’s instructions. FACS analysis was performed using FACS (Becton Dickinson) and analysed with FlowJo Software (TreeStar). Mice were killed by CO asphyxiation and blood was immediately collected from the heart. Glucose levels were measured using a Freestyle mini blood glucose metre. Insulin and albumin levels were measured in blood plasma using an ultrasensitive mouse insulin Elisa (Mercodia AB) or mouse albumin ELISA kit (Immunology Consultants Laboratory, Inc.), respectively. Insulin levels were determined after overnight fasting. Glucose levels were determined after feeding, at the beginning of the dark period. Euthanasia of moribund or cross-sectional animals was performed by intramuscular injection of a ketamine–rompun mixture, followed by exsanguination3. IgA immunoglobulin was measured in blood serum using the commercially available bead-based multiplexed panel Mouse Immunoglobulin Isotyping (Millipore Corporation). Standard analysis protocols were followed and all samples were analysed at least in duplo. The mice were weighed and visually inspected weekly, and were scored in a blinded manner by two experienced research technicians (R.M.C.B. and S.B.) for the onset of various phenotypical parameters. Clasping was measured by suspending mice by their tails for 20 s. A clasping event was scored when retraction of both hind limbs towards the body was observed for at least 5 s. Whole-body tremor was scored if mice were trembling for a combined total of at least 10 s when put on a flat surface for 20 s. Impaired balance was determined by observing the mice walking on a flat surface for 20 s. Mice that had difficulties in maintaining an upright orientation during this period were scored as having imbalance. If mice showed a partial loss of function of the hind limbs, they were scored as having paresis. Statistics were performed with survival-curve analysis using the product-limit method of Kaplan and Meier in GraphPad Prism. Rotarod performance was assessed by measuring the average time spent on an accelerating rotarod (Ugo Basile). All animals were given four consecutive trials of a maximum of 5 min with inter-trial intervals of 1 h. For weekly monitoring, the motor coordination performance was measured with two consecutive trials of a maximum of 5 min. Grip strength was determined by placing mice with forelimbs or all limbs on a grid attached to a force gauge, and steadily pulling the mice by their tail. Grip strength is defined as the maximum strength produced by the mouse before releasing the grid. For each value the test was performed in triplicate. To quantify apoptotic cells in the retina, eyes were fixed overnight in 10% phosphate-buffered formalin (JT Baker), paraffin-embedded, sectioned at 5 mm, and mounted on Superfrost Plus slides. Paraffin sections were employed for TdT-mediated dUTP nick-end labelling (TUNEL) assay using an Apoptag Plus Peroxidase in situ apoptosis detection kit (Millipore). Sections were deparaffinised and incubated as described by the manufacturer. Statistical differences were calculated with a t-test. Primary antibodies (supplier; catalogue number; dilutions) used in this study were as follows: rabbit anti-ATF3 (Santa Cruz; sc-188; 1:2,000), goat anti-ChAT (Millipore; AB144P; 1:500); rabbit anti-GFAP (DAKO; Z0334; 1:8,000); mouse anti-GM130 (BD Transduction; 610823; 1:100); rabbit anti-Iba-1 (Wako; 019-19741; 1:5,000); rat anti-Mac2 (Cedarlane; CL8942AP; 1:2,000); mouse anti-NeuN (Millipore; MAB377; 1:1,000); rabbit anti-p53 (Leica; NCL-p53-CM5p; 1:1,000); mouse anti-γH2AX (Millipore; 05-636; 1:4,000). For avidin-biotin-peroxidase immunocytochemistry biotinylated secondary antibodies from Vector Laboratories, diluted 1:200 were used. Alexa488-, Cy3-, and Cy5-conjugated secondary antibodies raised in donkey (Jackson ImmunoResearch) diluted at 1:200 were used for confocal immunofluorescence. Mice were anaesthetized with pentobarbital and perfused transcardially with 4% paraformaldehyde. The brain and spinal cord were carefully dissected out, post-fixed for 1 h in 4% paraformaldehyde, cryoprotected, embedded in 12% gelatin, rapidly frozen, and sectioned at 40 μm using a freezing microtome or stored at −80 °C until use. Frozen sections were processed free floating using the ABC method (ABC, Vector Laboratories) or single-, double-, and triple-labelling immunofluorescence. Immunoperoxidase-stained sections were analysed and photographed using an Olympus BX40 microscope. Immunofluorescence sections were analysed using a Zeiss LSM700 confocal microscope. Mean intensities were quantified using Fiji. Statistical differences were calculated with a t-test. Total RNA was extracted using QIAzol lysis Reagent from mouse tissue specimens. For increased purity, miRNAeasy Mini Kits (QIAGEN) were used. Addition of wash buffers RPE and RWT (QIAGEN) was done mechanically by using the QIAcube (QIAGEN) via the miRNeasy program and tissue was stored at −80 °C. The concentration of RNA was measured by Nanodrop (Thermo Fisher Scientific). Gene expression analyses were performed with gene-specific real-time PCR primers (see below) using SYBR Green (Sigma-Aldrich) and Platinum Taq polymerase (Life Technologies) on a Bio-Rad CFX96 thermocycler or with pre-designed TaqMan Gene Expression Assays (given below) with a 7500 Fast Real-Time PCR System (Applied Biosystems). Relative gene expressions were calculated as previously described6. For SYBR Green method the following primers were used (forward primer 5′ to 3′; reverse primer 5′ to 3′): Gsta1 (CTTCTGACCCCTTTCCCTCT; ATCCATGGGAGGCTTTCTCT), Nqo1 (GGTAGCGGCTCCATGTACTC; GAGTGTGGCCAATGCTGTAA), Nfe2l2 (AGGACATGGAGCAAGTTTGG; TCTGTCAGTGTGGCTTCTGG), Gstt2 (CGAGCAATTCTCCCAGGTGA; TATTCGTGGACTTGGGCACG), Fkbp5 (TGTTCAAGAAGTTCGCAGAGC; CCTTCTTGCTCCCAGCTTT), Srxn1 (TGAGCAGCTCCTCTGATGTG; GCTGAGGTGACAATTGACTATGG), Gsta4 (TCGATGGGATGATGCTGAC; CATCTGCATACATGTCAATCCTG), Gclm (TGGAGCAGCTGTATCAGTGG; CAAAGGCAGTCAAATCTGGTG), Hmox1 (CAGGTGATGCTGACAGAGGA; ATGGCATAAATTCCCACTGC), Gclc (AGATGATAGAACACGGGAGGAG; TGATCCTAAAGCGATTGTTCTTC), Ephx1 (GAGTGGAGGAACTGCACACC; AGCACAGAAGCCAGGATGA), Mgst1 (CTCGGCAGGACAACTTGC; CCATGCTTCCAATCTTGGTC), TubG2 (CAGACCAACCACTGCTACAT; AGGGAATGAAGTTGGCCAGT), Hprt (TGATAGATCCATTCCTATGACTGTAGA; AAGACATTCTTTCCAGTTAAAGTTGAG), Rps9 (ATCCGCCAACGTCACATTA; TCTTCACTCGGCCTGGAC). As pre-designed TaqMan assays we used (order number; sequence 5′ to 3′): Ghr (Mm00439093_m1; GACAAGCTGCAAGAATTGCTCATGA), Igf1r (Mm00802831_m1; GGCCAGAAGTGGAGCAGAATAATCT), HPRT-E2_3 (HPRT-E2_3_F; GCCGAGGATTTGGAAAAAGTGTTTA, HPRT-E2_3_R; TTCATGACATCTCGAGCAAGTCTTT, HPRT-E2_3_M; CAGTCCTGTCCATAATCA), POLR2A-E2_3 (POLR2A-E2_3F; GCAGTTCGGAGTCCTGAGT, POLR2A-E2_3R; CCCTCTGTTGTTTCTGGGTATTTGA, POLR2A-E2_3M2; CATCCGCTTCAATTCAT). RNA quality was assessed using the 2100 Bio-Analyzer (Agilent Technologies) following the manufacturer’s instructions. The quality of the RNA is expressed as the RNA integrity number (RIN, range 0–10). Samples with a RIN below 8 were excluded from analysis. Hybridization to Affymetrix HT MG-430 p.m. Array Plates was performed at the Microarray Department of the University of Amsterdam according to Affymetrix protocols. Quality control and normalization were performed using the pipeline at the www.arrayanalysis.org website (Maastricht University). The same total RNA extracts were used as extracted for mRNA analysis (above). miRNA expression levels were assessed using a miRNA micro-array (miRCURY LNA microRNA Array (7th Gen.), Exiqon). All probes with more than three calls were selected for assessing differential expression between groups. Differences in mean expression were compared using a one-way ANOVA. Probes with a FDR of 5% were considered as significantly differentially expressed. RNA expression analysis was also performed with the next-generation sequencing approach on one animal per treatment as described in ref. 36. Raw data (CEL files) were normalized by robust multichip average (RMA) in the oligo BioConductor package, which summarizes perfect matches through median polish and collapses probes into core transcripts based on.CDF annotation file provided by Affymetrix using the R open statistical package (http://www.r-project.org/). All data files have been submitted to the NCBI gene expression omnibus under accession number GSE77495. Principal component analysis (PCA) was performed using all the probe sets in the array. A graphical representation was generated to show the relationship among the different samples. PCA is a linear projection method that defines a new dimensional space to capture the maximum information present in the initial data set. It is an unsupervised exploratory technique used to remove noise, reduce dimensionality and identify common/dominant signals oriented to try to find biological meaning37. The two principal components with the highest amount of variance were plotted. PCA was performed using the prcomp package and the plot was drawn with gplots, both from the Bioconductor project (https://www.bioconductor.org/). The linear model from Limma38 implemented in R was used to identify the DEGs. Pairwise comparisons for each genotype between ad libitum and dietary restriction samples were applied to calculate the fold change (FC), P value and false discovery rate (FDR) for each probe in the microarray. Cut-off values for a DEG were put at FDR < 5% with FC ≥ |1.5|. For all mouse analyses, differentially expressed probes were considered as DEGs. Overlap between lists of DEGs was identified looking by the intersection between pair of lists. To determine if the overlap was higher than expected by chance the hypergeometric distribution was used as is implemented in phyper function in R. Additionally the factor of enrichment was calculated with the formula: EF = nAB/((nA × nB)/nC). Where: nA = Number of DEG in experimental group A; nB = Number of DEG in experimental group B; nC = Number of total genes in the microarray; nAB = Number of common DEG between A and B. Pathway enrichment analysis was conducted via overrepresentation analysis (ORA). ORA was performed in the Interactive pathway analysis (IPA) of complex genomics data software (Ingenuity Systems, Qiagen) by employing a pre-filtered list of differentially expressed genes. Genes were selected as differentially expressed if they had a fold change ≥ 1.5 and an FDR lower than 0.05. The over-represented canonical pathways were generated based on information in the Ingenuity Pathways Knowledge Base. A pathway was selected as deregulated when the P value in the Fisher test was lower than 0.01. Additionally, IPA transcription factor (TF) analysis was performed to identify the cascade of upstream transcriptional regulators that can explain the observed gene expression changes in the different lists of DEGs. To do this, data stored in the Ingenuity Knowledge Base, with prior information on the expected effects between TF and their target genes, were used. The analysis examines how many known targets of each TF are present in the list of DEGs, and also compares their direction of change to what is expected from the literature, in order to predict likely relevant transcriptional regulators. If the observed direction of change is mostly consistent with a particular activation state of the transcriptional regulator (‘activated’ or ‘inhibited’), then a prediction is made about that activation state. For each TF two statistical measures are computed (overlap P value and activation z-score). The overlap P value labels upstream regulators based on significant overlap between data set genes and known targets regulated by a TF. The activation z-score is used to infer the likely activation states of upstream regulators based on comparison with a model that assigns random regulation directions. Overlap P value lower than 0.05 and z-score higher than |2| were selected as thresholds to identify a TF as relevant. Limma was used to identify the DEGs among ALWT samples compared with the other experimental conditions (DRWT, ALErcc1 and DRErcc1). Next, probe-sets in the Affymetrix array with multiple gene annotation were filtered out. BiomaRt39 was used to retrieve the gene length for the remaining probe sets (32,930 probe-sets from 45,142 probe-sets in the original microarray). Differentially expressed genes were selected using an FDR of <0.05 and a linear fold change of ±1.5. The Shapiro–Wilk test was applied to contrast the normality of the distribution of gene length in the different lists of DEGs. Because most of the distributions were not normal, a Mann–Whitney test for non-paired samples test was used to evaluate whether the distributions of DEGs were different between the different comparisons. Finally, a relative frequency (kernel density) plot of gene length and probability density for DEG in each comparison was drawn using the density function implemented in R. Kernel density estimates are related to histograms, but with the possibility to smooth and continuity by using a kernel function. The y axis represents the density probability for a specific range of values in the x axis. Liver extracts from ad libitum- and dietary restriction-treated Ercc1∆/− and wild type mice (n = 6, 11 weeks) were prepared by mechanical disruption in lysis buffer (150 mM NaCl, 1% Triton X-100, 50 mM Tris), which was supplemented with mini complete protease inhibitor (Roche Diagnostics) and phosphate inhibitors (5 mM NaF, 1 mM Na-orthovanadate). After mechanical disruption, lysates were incubated on ice for 1 h and subsequently centrifuged at 4 °C for 20 min. Lysate (25–50 μg) was loaded on a 10% SDS–PAGE gel (Life Technologies LTD) and transferred to a PVDF transfer membrane (GE-Healthcare Life Sciences). Levels of S6 (#2217S Lot5; 1:2,000), S6(Ser240/244; #2215 Lot14; 1:500), Akt (#9272 Lot25; 1:500), Akt(Ser473; #9271S Lot13; 1:250) and Akt(Thr308; #9275S Lot19; 1:500) were detected (Cell Signaling Technology), semi-quantified using the ImageJ software package (http://rsb.info.nih.gov/ij/index.html) and phosphorylated:total ratios relative to ad libitum samples were calculated. Differences between groups were assessed with a t-test. β-Actin was used as loading control (Sigma; A5441 Lot064M4789V; 1:25,000).


Wild-type male C57BL/6 mice and B6.129S4–PDGFRαtm11(EGFP)Sor/J mice (Jackson strain number 007669), which contain an H2B–eGFP fusion protein knocked into the Pdgfra locus, were obtained from Jackson Laboratories. Young adult mice were 6–8 weeks of age; aged mice were 22–24 months of age. Mice were housed and maintained in the Veterinary Medical Unit at the Veterans Affairs Palo Alto Health Care System. Animal protocols were performed in accordance with the policies of the Administrative Panel on Laboratory Animal Care of Stanford University. Mice were anaesthetized using isoflurane. To assess muscle regeneration, 50 μl of a 1.2% barium chloride (BaCl ) solution (Sigma-Aldrich) was injected into tibialis anterior muscles as described previously5. To isolate activated FAPs for western blot analysis and FACS analysis, 50 μl of 1.2% BaCl or 50% (v/v) glycerol/water was injected throughout the lower hindlimb muscles. For induction of fibrosis, 30 μl of 50% (v/v) glycerol or 30 μl 1.2% BaCl solution was injected into tibialis anterior muscles. Muscles were dissected from mice and dissociated mechanically. All hindlimb muscles were used except in experiments where FAPs were isolated from VMOs injected into tibialis anterior muscles. In this case, only the tibialis anterior muscle was dissected. The muscle suspension was digested using collagenase II (760 U ml−1; Worthington Biochemical Corporation) in Ham’s F10 medium (Invitrogen) with 10% horse serum (Invitrogen) for 90 min at 37 °C with agitation. The suspension was then washed and digested in collagenase II (152 U ml−1; Worthington Biochemical Corporation) and dispase (2 U ml−1; Invitrogen) for 30 min at 37 °C with agitation. The resultant mononuclear cells were then stained with the following antibodies: VCAM-1-biotin (clone 429; BioLegend, 105704), CD31-APC (clone MEC 13.3; BioLegend, 102510), CD45-APC (clone 30-F11; BioLegend, 103112) and Sca-1-Pacific Blue (clone D7; BioLegend, 108120) at 1:75. Streptavidin-PE-Cy7 (BioLegend, 405206) at 1:75 was used to amplify the VCAM-1 signal. FAPs were collected according to the following sorting criteria: CD31−CD45−Sca-1+. FACS was performed using BD-FACS Aria II and BD-FACS Aria III cell sorters equipped with 488 nm, 633 nm and 405 nm lasers. The cell sorters were carefully optimized for purity and viability and sorted cells were subjected to FACS analysis immediately after sorting to confirm FAP purity. FAPs were isolated from uninjured C57BL/6 mice as described above and lysed. RNA was prepared with the RNeasy Mini Kit as per the manufacturer’s instructions (Qiagen). A 3′ blocking reaction was performed using a poly(A) tailing kit (Ambion) and 3′-dATP (Jena Bioscience) and the reaction mixture was incubated at 37 °C for 30 min. RNA was hybridized to flow cell surfaces for direct RNA sequencing as previously described18. Raw direct RNA sequencing reads were filtered using the Helicos-developed pipeline, Helisphere, to eliminate reads less than 25 nucleotides long or of low quality. These reads were then mapped to the mouse genome (NCBI37/mm9) using an IndexDPgenomic module and reads with a score above 4.3 were allowed. To avoid artefacts from mispriming, reads mapping to regions in the genome where more than four consecutive adenines were coded immediately 3′ to the mapping sequence were excluded from further analysis. Reads were viewed using the Integrative Genomics Viewer32, 33. Total RNA was extracted from FAPs isolated from uninjured C57BL/6 mice using TRIzol (Invitrogen) as per the manufacturer’s instructions. To identify the polyadenylation sites, the sample was reverse transcribed using the SMARTer RACE cDNA amplification kit (Clontech) according to the manufacturer’s instructions using the primers listed in Extended Data Table 1. The amplified fragments were subcloned into pGEM-T-Easy (Promega) and sequenced. Sequencing data were visualized with 4Peaks. To assess levels of the intronic variant and UTR variants, primers were designed to span the Pdgfra transcript (Extended Data Table 2). Variant expression was normalized to Gapdh using the comparative C method27 and reported relative to the average of control-treated samples. A construct corresponding to In-PDGFRα (DNAFORM, AK035501, RIKEN clone 9530057A20) was obtained. This construct was subcloned into the pMXs-IRES-GFP retroviral backbone (Cell BioLabs, Inc.) to generate pMXs-I-Pα. Replication-incompetent retroviral particles were generated by transfection of the 293T human embryonic kidney cell-derived Phoenix helper cell line (gift from G. Nolan). Viral supernatant was filtered through 0.45-μm polyethersulfone filters, concentrated using PEG precipitation and stored at −80 °C. FAPs were plated in 6-well plates and grown in DMEM supplemented with 10% fetal bovine serum (FBS). When cells reached 70% confluency, viral supernatant and polybrene (at a final concentration of 4 μg ml−1) were added to the medium. For overexpression experiments, FAPs were incubated with the viral supernatant for 48 h before analysis. For signalling assays, FAPs were incubated with the viral supernatant for 24 h. Afterwards the medium was changed to serum-free DMEM containing viral supernatant and the cells were incubated for an additional 24 h. The FAPs were then treated with 1 ng ml−1 PDGF-AA for 15 min, after which the cells were used for western blot analysis. A peptide with the sequence GKSAHAHSGKYDLSVV, which represents the unique C-terminal region of In-PDGFRα protein, was generated (Thermo Scientific Pierce, OE0726). To generate In-PDGFRα rabbit polyclonal antibodies directed against In-PDGFRα, New Zealand white rabbits that were specific pathogen free were immunized with 0.25 mg of the peptide in Complete Freund’s Adjuvant. The rabbits received three boosters of antigen consisting of 0.10 mg in Incomplete Freund’s Adjuvant at days 14, 42 and 56 after immunization. Serum was collected at days 70 and 72 (Thermo Scientific Pierce). Cells and homogenized tissues were lysed with RIPA lysis buffer supplemented with protease and phosphatase inhibitors (Roche). The lysates were run on Criterion SDS–PAGE gels (Bio-Rad), transferred to nitrocellulose membranes (Fisher Scientific), and analysed by western blot using the following rabbit antibodies: PDGFRα polyclonal (1:1,000, Cell Signaling, 3174), PDGFRα centre (1:100, Abgent, AP14254c), In-PDGFRα custom (1:1,000), pPDGFRαTyr754 polyclonal (1:1,000, Cell Signaling, 4547), Akt polyclonal (1:1,000, Cell Signaling, 9272), pAkt polyclonal (1:1,000, Cell Signaling, 9271), PLCγ polyclonal (1:1,000, Cell Signaling, 5690), pPLCγ polyclonal (1:1,000, Cell Signaling, 2821), ERK polyclonal (1:2,000, Cell Signaling, 4695), pERK polyclonal (1:2,000, Cell Signaling, 4370), SMAD2/3 monoclonal (1:1,000, Cell Signaling, 8685), and pSMAD2Ser465/Ser467/SMAD3Ser423/Ser425 monoclonal (1:1,000, Cell Signaling, 8828). Membranes were incubated in horseradish-peroxidase-labelled secondary antibodies and bands were visualized with enhanced chemiluminescence (Advansta). siRNAs were designed using the Dharmacon siDESIGN Center for knockdown of In-PDGFRα and FL-PDGFRα (Extended Data Table 2). To knockdown either In-PDGFRα or FL-PDGFRα in FAPs, approximately 8 × 104 cells were plated in a 12-well plate containing DMEM supplemented with 10% FBS and grown to 70–80% confluence. Cells were incubated in 200 nM of either PDGFRα or control siRNAs using Lipofectamine 2000 (Invitrogen). To assess knockdown, cells were collected at 24 h for qPCR analysis. For western blot analyses, 3 × 105 cells were plated in 6-well plates and incubated in Ham’s F10 medium (Invitrogen) supplemented with 10% horse serum (Invitrogen) for 24 h. The medium was then replaced with serum-free Ham’s F10 (Invitrogen) supplemented with 200 nM siRNA and incubated for an additional 24 h. Morpholinos were designed to target two polyadenylation sites on the intronic variant (pA : 5′-TGATTACATTATATCTGTCTTTATT-3′ and pA : 5′-AGCAAAGACCATCATAGCAGAATGA-3′) and the upstream 5′ splice site of the intron (5′ss: 5′-ATGGGCACTTTTACCTAGCATGGAT-3′) (Gene Tools, LLC). For in vitro treatment, cells were grown to 70–80% confluency in DMEM (Invitrogen) supplemented with 10% FBS (Atlanta Biologicals). Cells were incubated in 10 μM of the indicated morpholino using the Endo-Porter transfection reagent (Gene Tools, LLC). Cells were collected at 24 h for qPCR analysis with RNA isolated using the RNeasy Plus Mini kit with on-column DNase digestion as per manufacturer’s instructions (Qiagen). For western blot analysis, cells were transfected for 24 h in Ham’s F10 medium (Invitrogen) supplemented with 10% horse serum (Invitrogen). The medium was then replaced with serum-free Ham’s F10 (Invitrogen) and incubated for an additional 24 h. For signalling assays, cells were then incubated for 15 min with PDGF-AA (Peprotech) at 0.1 ng ml−1 or 20 ng ml−1 for cells treated with pA-AMOs or 5′ss-AMO, respectively, and lysed for western blot analysis as described above. For AMO treatment, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice and seeded at 1 × 105 cells per well in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). Cells were transfected with 10 μM AMO using Endoporter (Gene Tools) and expanded for 2 days in Ham’s F10 (Invitrogen) supplemented with 10% horse serum (Invitrogen). The medium was then replaced with Opti-MEM supplemented with 2 ng ml−1 PDGF-AA ligand and 10 μm EdU (Invitrogen). Cells were fixed in 4% paraformaldehyde (Sigma-Aldrich) after 24 h. For siRNA treatment, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice and seeded at 2 × 105 cells per well in poly-d-lysine coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). The medium was supplemented with 200 nM siRNA and transfected using Lipofectamine 2000 (Invitrogen). After 24 h, the medium was replaced with Opti-Mem and the cells were re-transfected with 200 nM siRNA and 50 ng ml−1 PDGF-AA. In siRNA-treated samples, EdU was not included in this medium. Rather, after 20 h the medium was replaced with Opti-Mem containing 10 μm EdU (Invitrogen). Cells were fixed 4 h later. For retroviral overexpression of In-PDGFRα, FAPs were isolated from uninjured hindlimbs of C57BL/6 mice and seeded at 2 × 105 cells per well in poly-d-lysine coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). FAPs were cultured in DMEM supplemented with 10% FBS along with viral supernatant and 4 μg ml−1 polybrene. After 24 h, the medium was replaced with serum-free DMEM containing viral supernatant and 20 ng ml−1 PDGF-AA. Twenty hours later, the medium was replaced with Opti-MEM containing 10 μM EdU. Cells were fixed after 4 h. For EdU incorporation experiments, cells were stained using the Click-iT EdU Imaging Kit (Invitrogen). Cells were analysed on a Zeiss Observer Z1 fluorescent microscope (Carl Zeiss) equipped with a Hamamatsu Orca-ER camera (Hamamatsu) and Improvision Volocity software (Perkin Elmer). Cells isolated by FACS from uninjured hindlimb muscles were seeded at a density of 3.5 × 104 cells per well in 96-well plates in Ham’s F10 medium supplemented with 2% horse serum. After 48 h, cells were nearly confluent and the medium was changed to Ham’s F10 with 2% horse serum and 20 ng ml−1 PDGF-AA. A wound was made by scratching a 200-μl pipette tip across the monolayer of cells. The initial scratch area was determined immediately and set to 100%. Images were taken at regular intervals and the scratch area at each time point was measured and calculated as a percentage of the initial scratch area. Scratch closure is defined as the inverse of the cell-free area as a percentage of total area. For in vitro microarray analysis, FAPs were isolated from the uninjured hindlimb muscles of C57BL/6 mice. Cells were plated at 1 × 106 cells per well in 12-well plates. Cells were grown for 2.5 days in DMEM supplemented with 10% FBS. The medium was switched to Ham’s F10 supplemented with 10% horse serum and transfected with 10 μM AMO as indicated for 48 h. The medium was then replaced with Opti-Mem and cells were re-transfected with 10 μM AMO. After 48 h, the cells were lysed and RNA was prepared with the RNeasy Mini Kit as per the manufacturer’s instructions (Qiagen). For in vivo microarray analysis, tibialis anterior muscles were injured with 30 μl of glycerol each and injected with the indicated VMO after 3 days. FAPs were then isolated from the muscles 2 days after VMO injection. Cells were pelleted and RNA prepared from samples as indicated above. The microarray data were obtained using Affymetrix Mouse 1.0 ST. For gene set enrichment analysis (GSEA), the samples were normalized and processed using GenePattern ExpressionFileCreator and PreProcessData set modules. Expression data were analysed and visualized with GSEA28 and GENE-E (http://www.broadinstitute.org/cancer/software/GENE-E/). For ingenuity pathway analysis, including causal network analysis, the samples were normalized using Affymetrix Expression Console Software and analysed for enrichment using IPA (Ingenuity Systems, http://www.ingenuity.com). Array data were deposited into Gene Expression Omnibus (Accessions GSE60099 and GSE81744). Vivo-morpholinos were designed to target two polyadenylation sites on the intronic variant (pA -VMO: 5′-TGATTACATTATATCTGTCTTTATT-3′ and pA -VMO: 5′-AGCAAAGACCATCATAGCAGAATGA-3′) and the upstream 5′ splice site of the intron (5′ss-VMO: 5′-ATGGGCACTTTTACCTAGCATGGAT-3′) (Gene Tools, LLC). For treatment in vitro, cells were isolated from hindlimb muscles of C57BL/6 mice and grown to 70–80% confluency in DMEM (Invitrogen) supplemented with 10% FBS (Atlanta Biologicals). Cells were incubated in the 10 μM of the indicated morpholino (Gene Tools, LLC). Cells were collected at 24 h for qPCR analysis. For in vivo qPCR analysis, tibialis anterior muscles were injured with glycerol as described above and injected with 250 ng of the indicated VMO at the site of injury 3 days later. FAPs were sorted by FACS 7 days after VMO injection for qPCR analysis. For ex vivo proliferation and scratch assays, tibialis anterior muscles were injured with glycerol and injected with 250 ng of the indicated VMO 3 days after injury. FAPs were isolated 2 days later by FACS. In EdU incorporation studies, cells were seeded at 4 × 104 cells per well in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich). Cells were incubated in 10 ng ml−1 PDGF-AA (Peprotech) and 10 μM EdU (Invitrogen) for 24 h. The cells were fixed and stained. In the ex vivo proliferation studies as well as the in vivo proliferation studies described below, the proliferation index was used to denote the percentage EdU incorporation normalized to control. In the scratch assays, cells were seeded and treated as described above. For in vivo proliferation studies, tibialis anterior muscles were injected with 150 ng of the indicated VMO at 0 and 24 h. FAPs were isolated at 48 h via FACS. To assess in vivo proliferation, the cells were exposed to 10 μM EdU immediately after muscle isolation and incubated in 10 μM EdU ex vivo during the collagenase, collagenase/dispase, and antibody incubations as described above. The cells were plated in poly-d-lysine-coated 8-well chamber slides (BD Biosciences) coated with ECM gel (Sigma-Aldrich), fixed 1 h after plating, and stained using the Click-iT EdU Imaging Kit (Invitrogen). For histological analysis, tibialis anterior muscles were injured with glycerol or BaCl and injected at the site of injury with 250 ng of the indicated VMO. After 7 days, the muscles were snap frozen in isopentane cooled in liquid nitrogen immediately after dissection. Muscles sections were stained with Gomori-trichrome (Richard-Allan Scientific) per manufacturer’s instructions or oil red O (Sigma-Aldrich) as previously described29. The fibrotic index was calculated as the area of fibrosis divided by total area of muscle normalized to control-treated muscle. The fibro–adipose index was defined as the area of fibrosis plus the area of adiposis (as detected by oil red O staining) divided by total area of muscle, normalized to control. Major factors in determining sample size included the level of the effect and the inherent variability in measurements obtained. No statistical methods were used to predetermine sample size. Animals were excluded from the study only if their health status was compromised, such as occurred when animals had visible wounds from fighting. Samples were not specifically randomized or blinded. However, mouse identifiers were used when possible to blind evaluators to experimental conditions, and all samples within experiments were processed identically for measurement quantification using automated tools as specified. The sequencing data were deposited into the NCBI Sequence Read Archive (accession number SRP079186). Array data were deposited into Gene Expression Omnibus (accession numbers GSE60099 and GSE81744).


News Article | March 23, 2016
Site: www.nature.com

All studies with mice were reviewed and approved by the Institutional Animal Use and Care Committee of Beth Israel Deaconess Medical Center (BIDMC). Pgc1α−/− (stock no. 008597), Pax8-rtTA (no. 007176) and TRE-PGC1α (no. 012387) mice were all obtained from Jackson Laboratories and bred at BIDMC. The parental strains were generated on a mixed C57 background with further backcrossing into C57BL/6J as described by the manufacturer, except for the TRE-PGC1α mouse, which was generated on and is maintained on FVB. Primers for genotyping have been described elsewhere31,32. All experiments were performed with genetically appropriate littermate controls. Ischaemia-reperfusion injury (IRI) was performed on 8–12-week-old males through two small paramedial dorsal incisions by applying a microvascular clamp to each renal pedicle for 20 min. Mice were anaesthetized with isoflurane for the duration of surgery and warmed to 37 °C using a servo-controlled heating pad. Incisions were closed in two layers and mice were revived with 1 ml warm saline injected intraperitoneally. All chemicals were purchased from Sigma-Aldrich unless otherwise noted. NAM was given by intraperitoneal injection of 400 mg−1 kg−1 day−1 for 4 days in saline, with the final dose an hour before IRI surgery. In rescue experiments, the same dose was administered once 18 h after reperfusion. Indomethacin was given by intraperitoneal injection of 10 mg kg−1 in 0.1 M sodium carbonate/saline an hour before IRI. The HCAR2 inhibitor, mepenzolate bromide, was given by intraperitoneal injection of 10 mg kg−1 in saline an hour before IRI33, 34, 35. LPS (E.coli serotype O111:B4) was given by intraperitoneal injection of 25 mg kg−1 in saline. Cisplatin was given by intraperitoneal injection of 25 mg kg−1 as previously described36. Unless otherwise stated, blood and kidneys were collected 24 h after the AKI model. The experiments were not randomized. All measurements were performed in a blinded fashion by an independent facility. Creatinine was analysed by LC/MS-MS at the University of Alabama Birmingham O’Brien Core Center for Acute Kidney Injury Research (NIH P30-DK079337). This method adds the accuracy of MS to the LC method of creatinine measurement endorsed by a renal investigative consortium (diacomp.org). The coefficient of variation was 6% indicating high assay precision. For metabolomics measurements, snap frozen kidneys were cut to equal weights (20 mg per specimen) and mechanically homogenized into four volumes of ice-cold water. Metabolites were assayed as previously described37. In brief, amino acids, amines, acylcarnitines, nucleotides, and other cationic polar metabolites were measured in 10 μl of kidney homogenate using hydrophilic interaction liquid chromatography coupled with non-targeted, positive ion mode MS analysis on an Exactive Plus Orbitrap MS (Thermo Scientific). Polar and non-polar lipids were measured in 10 μl of kidney homogenate using C8 chromatography and non-targeted, positive ion mode MS analysis on a Q Exactive MS (Thermo Scientific). Identification of known metabolites was achieved by matching retention times and mass-to-charge ratio (m/z) to synthetic mixtures of reference compounds and characterized pooled plasma reference samples. Results were analysed in MetaboAnalyst (http://www.metaboanalyst.ca). LC–MS assays were developed for multiplex quantification of NAM, NAD, and β-OHB from cellular experiments. NAD measurements reflect total NAD+ plus NADH. In brief, conditioned medium was extracted with methanol (80% methanol final concentration) spiked with isotopic standards for NAM and β-OHB (CDN Isotopes, Inc.). Precipitated proteins were removed by centrifugation, and supernatants were analysed directly. For analysis of cell lysates, cells were washed with ice-cold PBS, scraped and lysed on dry ice into methanol containing isotopic standards. After extraction, cell and media supernatants were analysed by LC–MS/MS using reverse-phase chromatography (NAM and NAD/NADH) or hydrophilic interaction chromatography (β-OHB) coupled to tandem mass spectrometry using an API 5000 triple quadruple mass spectrometer. Analytes were quantified by multiple reaction monitoring using the following m/z transitions: β-OHB 103.1 > 59, β-OHB IS 105.1 > 60, NAM 123.3 > 80.2, NAM IS 127.3 > 84.2, NAD/NADH 664.2 > 542.0. Eluting peaks were quantified by area under the curve (AUC). Raw AUC values were divided by the mean value of the control group for each experiment, thus the results are presented as relative concentrations to the control group. All assays were performed in triplicate and replicate measurements demonstrated a CV < 5%. Poly(A)-enriched RNA was isolated from whole kidneys and checked for quality by denaturing agarose gel as well as an Agilent Bioanalyzer. Sequencing libraries were generated from the double-stranded cDNA using the Illumina TruSeq kit according to the manufacturer’s protocol. Library quality control was checked using the Agilent DNA High Sensitivity Chip and qRT–PCR. High quality libraries were sequenced on an Illumina HiSeq 2000. To achieve comprehensive coverage for each sample, we generated ~25–30 million single-end reads. Raw results were passed through quality controls steps and alig ned to the mouse genome. Gene expression measurement was performed from aligned reads by counting the unique reads. The read count based gene expression data was normalized on the basis of library complexity and gene variation. The normalized count data was compared among groups using a negative binomial model to identify differentially expressed genes. The differentially expressed genes were identified on the basis of raw P value and fold change. Genes were considered significantly differentially expressed if the multiple test corrected P value was <0.05 and absolute fold change >2. Ingenuity Pathway Analysis (IPA 8.0, Qiagen) was used to identify the functions that are significantly affected by significantly differentially expressed genes from different comparisons. The knowledge base of this software consists of functions, pathways, and network models derived by systematically exploring the peer reviewed scientific literature. A detailed description of IPA analysis is available at the Ingenuity Systems’ website (http://www.ingenuity.com). A P value is calculated for each function according to the fit of the user’s data to the IPA database using one-tailed Fisher exact test. The functions with multiple-test-corrected P values <0.01 were considered significantly affected. Kidney lysate preparation, gel electrophoresis, transfer, immunoblotting, detection, and image acquisition were performed as previously described31. Antibodies against PGC1α (Cayman Chemical), cytochrome c oxidase subunit IV (Cell Signaling Technology), and Transcription Factor A Mitochondrial, TFAM (Abcam) were used as previously described31, 38. Total RNA extraction and cDNA synthesis were performed as previously described31. PCR reactions were performed in duplicate using the ABI 7500 Fast Real-Time PCR and TaqMan gene expression assays (Applied Biosystems). The following TaqMan gene probes were used: Ppargc1a, Ndufs1, Cycs, Atp5o, Nrf1, Tfam, Vegfa, Nos1, Nos3 and Hcar2. Of the four known Ppargc1a transcripts (1–4), Ppargc1a1 (Taqman Mm00447183_m1) was studied in all gene expression analyses39. Mouse Ido2, Afmid, Kynu, Kmo, Haao, Qprt, Naprt and Nmnat1 for SYBR Green PCR have been described elsewhere40, 41. Mouse Nampt SYBR primers were designed using PrimerQuest Tool (Integrated DNA Technologies). Relative expression levels were determined using the comparative threshold method. Total DNA was extracted from mouse kidneys using the DNeasy Blood and Tissue Kit (Qiagen) with on-column RNase digestion per manufacturer’s instructions. Gene expression of mitochondrial-encoded NADH dehydrogenase 1 (mt-Nd1) relative to nuclear 18S rRNA was used to determine mitochondrial DNA copy number as previously described42. Formalin-fixed, paraffin-embedded blocks were sectioned and stained with H & E, PAS, and Masson trichrome. Ten random high-power fields in the cortex and ten random high-power fields in the outer stripe of the outer medulla were viewed and graded for tubular necrosis—defined as the loss of the proximal tubular brush border, blebbing of apical membranes, tubular necrosis/apoptosis and epithelial cell detachment from the basement membrane or intraluminal aggregation of necrotic debris. Each high-power field was separately scored on a scale (0, no necrosis; 1, rare single necrotic cells; 2, frequent single necrotic cells; 3, groups of necrotic cells; and 4, confluent tubular necrosis) and the average score was compiled for each specimen and then used for between-group comparisons. All scoring was performed by a single operator blinded to genotype and experimental model (IES). Enzyme histochemistry to detect cytochrome c oxidase (COX) activity was performed on 6-μm snap-frozen sagittal sections as previously described31. Functional electron microscopy used in the cisplatin kidney injury model was described earlier36. The complete method is previously described31. In brief, kidneys were fixed with 1.25% glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4) and cut into 1-μm sections in both sagittal and transverse planes for image analysis. After drying the sections, slides were stained at 65 °C for 20 min in 0.1% Toluidine blue in 1% sodium borate, cooled to room temperature, washed in distilled water, cleaned in xylene, and mounted in Permount sections for light microscopy. Subsequent ultrathin sections (0.5 μm) were examined by transmission electron microscopy (JEOL 1011, JEOL Corp.) with Orca-HR Digital Camera (Hamamatsu Corp.), and Advanced Microscopy Technique Corporation image capture system. Oil-Red-O solution was prepared by dissolving 0.5 g Oil-Red-O (Poly Scientific) in 100 ml isopropanol. Frozen sections were cut to 5 μm and natively stained in Oil-Red-O solution for 20 min at room temperature, then rinsed in running tap water for 2 min. Haematoxylin counter-staining was performed without differentiation in HCl–ethanol and sections were rinsed with water, then mounted with VectaMount AQ Aqueous Mounting medium (Vector Labs). All studies were approved by the Institutional Review Board at BIDMC. Control specimens came from normal tissue sections of nephrectomies. CKD diagnoses included focal segmental glomerulosclerosis, chronic allograft nephropathy, chronic interstitial nephritis, and chronic IgA nephropathy. AKI diagnoses included acute ischaemic injury, post-transplant delayed graft function attributable to ischaemia-reperfusion injury, and acute interstitial nephritis. PGC1α antibody (Abcam ab54481) was used at a dilution of 1:100 and developed with horseradish peroxidase (ImmPRESS polymer staining kit, Vector Labs). The peptide immunogen SKYDSLDFDSLLKEAQRSLRR (synthesized by the Biopolymers Lab, Koch Institute at MIT) was pre-incubated in 100-fold excess of the PGC1α antibody to confirm antibody specificity in human IHC studies. Ten randomly selected high-powered fields were viewed per specimen, with each field scored on a 4-point scale (1, weakest; 4, strongest) based on the intensity of staining, specifically in non-necrotic areas and unscarred areas and avoiding obvious collecting ducts. The average score of each specimen was then used for between-group comparisons. All scoring was performed by a single operator blinded to the underlying diagnosis (IES). The full method is previously described31. In brief, mice were lightly anaesthetized, secured to a heat-controlled stage, and continuously monitored for respiration, ECG, and core temperature. A high-frequency, high-resolution digital imaging platform with linear array technology and equipped with a high-frequency linear array probe MS550D (22–55 MHz) was used throughout the study (Vevo 2100 Visual Sonics). The flow volume was modelled as a circular cylinder of length equal to the average velocity time integral and diameter measured empirically (n = 3 cardiac cycles), then multiplied by the heart rate (b.p.m.), then converted from mm3 min−1 to ml min−1. All measurements and analyses were performed by a single blinded operator (EVK). Mouse inner medullary collecting duct (IMCD3) cells were obtained from ATCC. Please refer to their website for validation and mycoplasma testing (http://www.atcc.org/Products/All/CRL-2123.aspx). Cells were transfected with siRNA targeting mouse PGC1α, HCAR2 or a negative control siRNA (Qiagen) for 24 h. Niacin, mepenzolate bromide, β-hydroxybutyrate, the NAMPT inhibitor FK866 (ref. 43), and NAM were diluted to the indicated concentrations in serum-free cell culture medium. Prostaglandin E2 (PGE ) was measured in the conditioned media 24–72 h after treatment. Cystatin C in mouse serum (1:200 dilution) was measured by ELISA (R&D Systems). The full method is described elsewhere44. In brief, male C57BL/6J mice (Jackson Laboratories) were given a single bolus injection of 5%-FITC-inulin (3.74 μl per g body weight). Clearance kinetics of FITC-inulin post-injection was measured by serial blood collection at specified time points from 3 through 70 min post-injection. Blood samples were centrifuged and resulting plasma was buffered to pH 7.4 with 500 mM HEPES. Fluorescence in the buffered plasma samples was determined with 485 nm excitation, 538 nm emission. Glomerular filtration rate (GFR) was calculated from the two-phase exponential decay model outlined previously. PGE was measured in mouse kidney tissue by ELISA (Cayman Chemical). β-OHB (Cayman Chemical) and total NAD (BioVision) were measured in mouse kidney tissue by colorimetric assays. These assays were performed on kidneys used for metabolomics and lipidomics in order to compare coordinated changes in metabolism and downstream signalling. NAD measurements reflect total NAD+ plus NADH. Comparisons between continuous characteristics of subject groups were analysed with Mann–Whitney U-tests or Student’s t-test. Survival was analysed by log-rank test. For comparisons among more than two groups, ANOVA with Bonferroni’s correction was used where indicated. Associations between micro-ultrasound measurements and other functional parameters were analysed with Spearman’s rank correlation coefficients. Sample size determination was guided by power calculations and prior experience. The following sample calculation was used to guide creatinine studies in mice: serum creatinine of 1.6 (±0.3 s.d.) mg dl−1 versus 1.0 (±0.2 s.d.) requires n = 5 mice per condition to achieve an α-error <5% and power 96%. Mice were randomized to experimental intervention versus control. Two-tailed P values < 0.05 were considered significant. Results are presented as mean ± s.e.m. and were prepared in GraphPad Prism.


Kramer A.,Ingenuity Systems | Green J.,Ingenuity Systems | Pollard J.,Sanofi S.A. | Tugendreich S.,Ingenuity Systems
Bioinformatics | Year: 2014

Motivation: Prior biological knowledge greatly facilitates the meaningful interpretation of gene-expression data. Causal networks constructed from individual relationships curated from the literature are particularly suited for this task, since they create mechanistic hypotheses that explain the expression changes observed in datasets.Results: We present and discuss a suite of algorithms and tools for inferring and scoring regulator networks upstream of gene-expression data based on a large-scale causal network derived from the Ingenuity Knowledge Base. We extend the method to predict downstream effects on biological functions and diseases and demonstrate the validity of our approach by applying it to example datasets.Availability: The causal analytics tools 'Upstream Regulator Analysis', 'Mechanistic Networks', 'Causal Network Analysis' and 'Downstream Effects Analysis' are implemented and available within Ingenuity Pathway Analysis (IPA, http://www.ingenuity.com).Supplementary information: Supplementary material is available at Bioinformatics online. © 2013 The Author.


Patent
Ingenuity Systems | Date: 2014-07-28

Methods for identifying disease-related pathways that can be used to identify drug discovery targets, to identify new uses for known drugs, to identify markers for drug response, and related purposes.


Patent
Ingenuity Systems | Date: 2012-08-02

The invention provides computer systems and methods for visualization and analysis of relationships between biological data.


The present invention (fig. 3) relates to the field of information extraction and storage and more specifically to techniques for extracting information from a plurality of articles in a distributed manner and for storing the extracted information in an information store. An embodiment of the present invention identifies a plurality of articles from which information is to be extracted and a plurality of information extractors for extracting the information from the articles (56). A database is provided for storing information related to the plurality of articles and the plurality of information extractors (58). The plurality of articles are assigned to the plurality of information extractors for information extraction. Information extracted by information extractors from the articles is stored in the information store (64).


Methods for constructing and maintaining knowledge representation systems are disclosed herein. The knowledge representation system is initially organized and populated using knowledge engineers. After the initial organization, scientific domain experts digest and structure source texts for direct entry into the knowledge representation system using templates created by the knowledge engineers. These templates constrain both the form and content of the digested information, allowing it to be entered directly into the knowledge representation system. Although knowledge engineers are available to evaluate and dispose of those instances when the digested information cannot be entered in the form required by the templates, their role is much reduced from conventional knowledge representation system construction methods. The methods disclosed herein permit the construction and maintenance of a much larger knowledge representation system than could be constructed and maintained using known methods.


Patent
Ingenuity Systems | Date: 2013-06-10

Methods for identifying disease-related pathways that can used to identify drug discovery targets, to identify new uses for known drugs, to identify markers for drug response, and related purposes.


Patent
Ingenuity Systems | Date: 2012-11-06

Methods and systems for filtering variants in data sets comprising genomic information are provided herein.

Loading Ingenuity Systems collaborators
Loading Ingenuity Systems collaborators