Harlan, IN, United States
Harlan, IN, United States

Time filter

Source Type

Da Costa Martins P.A.,Hubrecht Institute and Interuniversity Cardiology | Da Costa Martins P.A.,Maastricht University | Salic K.,Hubrecht Institute and Interuniversity Cardiology | Salic K.,Maastricht University | And 15 more authors.
Nature Cell Biology | Year: 2010

MicroRNAs (miRs) are a class of single-stranded, non-coding RNAs of about 22 nucleotides in length. Increasing evidence implicates miRs in myocardial disease processes. Here we show that miR-199b is a direct calcineurin/NFAT target gene that increases in expression in mouse and human heart failure, and targets the nuclear NFAT kinase dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1a (Dyrk1a), constituting a pathogenic feed forward mechanism that affects calcineurin-responsive gene expression. Mutant mice overexpressing miR-199b, or haploinsufficient for Dyrk1a, are sensitized to calcineurin/NFAT signalling or pressure overload and show stress-induced cardiomegaly through reduced Dyrk1a expression. In vivo inhibition of miR-199b by a specific antagomir normalized Dyrk1a expression, reduced nuclear NFAT activity and caused marked inhibition and even reversal of hypertrophy and fibrosis in mouse models of heart failure. Our results reveal that microRNAs affect cardiac cellular signalling and gene expression, and implicate miR-199b as a therapeutic target in heart failure. © 2010 Macmillan Publishers Limited. All rights reserved.


News Article | September 14, 2016
Site: www.nature.com

PLX4032, PD98059, AZD6244 and PF-573228 were purchased from Selleck Chemicals. The siRNAs against TCF4 (sc-61657), c-Myc (sc-29226), TCF3 (sc-36618) or TCF12 (sc-35552) were purchased from Santa Cruz Biotechnology. Antibodies against ITGA4, ITGA5, ITGB1, ITGB3, ITGB4, ITGB5, FAK, c-Myc, TCF12, ERK1/2, pERK1/2 and Porin were purchased from Cell Signaling Technology; p-FAK (Y397) antibodies were from Cell Signaling and Thermo Fisher Scientific, ID2 antibodies were from Cell Signaling, Santa Cruz Biotechnology and Thermo Fisher; tubulin, V5, HMB45, COX5 A, NDUFS4 and NDUFA9 antibodies were from Abcam; TCF4 antibodies were from Abnova and Santa Cruz; and PGC1α antibodies were from Santa Cruz and Millipore. The GSEA software v2.0 (http://www.broadinstitute.org/gsea)30 was used to perform the GSEA analysis. In all the analysis, the KEGG gene sets were used. The values of the 219195_at probe (corresponding to PPARGC1A) were used as phenotype. For the analysis of the CCLE data set, the gene expression data was downloaded from the CCLE portal (http://www.broadinstitute.org/ccle) and the data from 61 melanoma cell lines were used in the analysis. The GSEA default parameters were used with the exception that Pearson correlation was computed to rank the genes for the analysis of the CCLE data and permutation was changed to gene set for the analysis of the GSE36879 data set. Published data sets GSE318931 and GSE1239132 with associated pathological stages for each sample as Invasive/Vertical or Superficial/Radial were analysed for relative deviation from median-normalized PGC1α intensities (linear) within each data set (significance based on 2-sample, 2-sided t-test statistics). To examine the enrichment of the PGC1α-regulated metastasis/invasion signature genes (ITGA3, ITGA4, ITGA10, ITGB3, ITGB5, CAV1, CAV2, ACTN2, LAMA4A, COL4A1, INHBA, TGFBI, TGFBR3, TGFBR2, SMAD3, SMAD7, IL8, IL11, LEF1, TCF7L2, DKK3, PPP3CA and SFRP1), we performed ssGSEA projections33 to yield a percentile-based normalized enrichment score within each of GSE3189 and GSE12391, which were used to combine the data sets (2-sample, 2-sided t-test statistics). The association between primary melanoma survival and PGC1α-regulated metastasis/invasion signature was based on ssGSEA for signature closeness within GSE57715 and calculation of log-rank survival. For the analysis of PGC1α and TCF4 gene expression, data obtained from the TCGA skin cutaneous melanoma data set34 consisting of 471 samples with RNA-seq data was downloaded from the cBioPortal35, 36 (www.cbioportal.org). Data were represented as Z-scores of RNA-seq V2 RSM. The dotted lines denote Z-scores of 0. Samples were classified as expressing if Z-score > 0 and a mutually exclusivity report from the cBioPortal was generated. The pDONR223–LacZ entry control vector was purchased from Addgene (25893) and the pLX304–LacZ control vector was generated using LR clonase II (Invitrogen). The V5-tagged pLX304–ID2 and –TCF4 vectors were provided by the Marc Vidal Laboratory at Dana-Farber Cancer Institute. Luciferase-expressing FUW–Luc was provided by A. Kung and the pMSCV–Luciferase–hygro plasmid was purchased from Addgene. Full-length PGC1α was amplified by KOD polymerase (F: GCTTGGGACATGTGCAGCGAA and R: TTACCTGCGCAAGCTTCTCTGAGC), and then the PCR product was ligated into pDONR223 by BP reaction. PGC1α expressing destination vectors (pLX304 for constitutive expression and pInducer2037 for doxycycline-inducible expression) were generated by LR reaction with entry vector (pDONR223–PGC1α). Melanoma cells were obtained from ATCC and their authentication was confirmed by either DNA fingerprinting with small tandem repeat (STR) profiling or in-house PCR testing of melanoma marker genes and BRAF mutation status. Mycoplasma contamination was tested negative in-house with the PCR Mycoplasma Detection Kit (Lonza). Melanoma cells were cultured in high-glucose DMEM containing 10% FBS. For detachment culture conditions, cells were plated on plates coated with poly-2-hydroxy methacrylate (poly-HEMA). Lentiviruses encoding shRNAs or cDNAs were produced in HEK293T cells with packaging vectors (pMD2G and psPAX2) using Polyfect (Qiagen). pLKO.1 vector expressing a scramble sequence, as listed in the Supplementary Information, was used as control (shScr). Lentiviruses particles were collected 48 h post-transfection and used to infect melanoma cells in the presence of 8 μg/ml polybrene. Infected cells were selected with 2 μg/ml of puromycin or 7 μg/ml blasticidin for 4 days before experiments. siRNA transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Guide-RNAs were cloned into pLX–sgRNA (Addgene #50662 for PGC1α) or lentiCRISPR (Addgene #52961 for ID2). The respective empty vector lacking the sgRNA sequence was used as control (sgCtrl). Cells were subsequently infected with lentiviruses encoding Cas9 (pCW-Cas9, Addgene #50661) and sgRNAs followed by selection with respective antibiotics as described above, and 1 μg/ml of doxycycline for 7 days. Cells were lysed in a buffer containing 1% IGEPAL, 150 mM NaCl, 20 mM HEPES (pH7.9), 10 mM NaF, 0.1 mM EDTA, 1 mM sodium orthovanadate and 1× protease inhibitor cocktail. Protein concentration was quantified using the BCA protein concentration assay kit (Pierce). Cell lysates were electrophoresed on SDS-polyacrylamide gels and transferred to Immobilon-P membranes (Millipore). Membranes were incubated with primary antibodies in 5% bovine serum albumin containing 0.05% Tween-20 overnight at 4 °C. The membrane was then incubated with HRP-conjugated secondary antibody for 1 h at room temperature, and visualized using an ECL Prime (GE Healthcare). Total RNA was isolated with Trizol (Invitrogen) by Direct-zol RNA MiniPrep kit (Zymo Research), and 2 μg of total RNA was used for cDNA synthesis using a high capacity cDNA reverse transcription kit (Applied Biosystems). qPCR was carried out using SYBR Green PCR Master Mix (Applied Biosystems). Experimental Ct values were normalized to 36B4 where not otherwise indicated and relative mRNA expression was calculated. Sequences for all the primers are provided in the Supplementary Information. For PGC1α overexpression by adenovirus, A375P–shPGC1α and A375 cells were infected with adenoviruses expressing GFP or Flag–PGC1α for 36 h, followed by qPCR. PGC1α targets such as GSTM4 and COX5 A were used as positive controls. For inhibitor treatment, cells were incubated with indicated concentrations of inhibitors for 6 h and mRNAs were analysed by qPCR. For the RNA from migratory and non-migratory cells, migration of the A375P and G361 cells was initiated as described below. The non-migratory cells in suspension in the upper chambers were collected by centrifugation and resuspension in lysis buffer from the Cells-to-cDNA II kit (Invitrogen). The migratory cells were collected by directly applying the lysis buffer to the membrane, following the wash and clearing of the non-migratory cells in the upper chambers. 18S rRNA was used as internal control. For cells from paraffin-embedded tissue sections, Pinpoint Slide RNA Isolation System II (Zymo Research) was used to extract RNAs. Cells with different mitochondrial contents were sorted based on the labelling of MitoTracker Green (Invitrogen). Briefly, MitoTracker Green was spiked in the medium of 100% confluent melanoma cells at the final concentration of 75 nM, and incubated with the cells for 20 min, followed by FACS sorting at DFCI Flow Cytometry Core. The top 10% cell population with the highest mitochondrial contents (mito/PGC1α–high) and the bottom 10% cell population with the lowest mitochondrial contents (mito/PGC1α–low) were collected for qPCR, western blot, migration assay (1 × 105 per well overnight) and metastasis assay. For the circulating tumour cells, whole blood of the tumour-bearing mice was collected by cardiac perfusion with PBS containing 0.5 mM EDTA. After red blood cell lysis, the pelleted cells were stained with anti-mouse CD31 and CD45, along with anti-human HLA (eBioscience, as depicted in Extended Data Fig. 4c). The CD31−CD45−hHLA+ cells were directly sorted into RNAprotect Cell Reagent (Qiagen), and then converted into cDNA using the Cells-to-cDNA II kit. The primary tumours were subjected to enzymatic digestion for single cell suspension and FACS sorting to make them equivalent controls. qPCR was performed with SYBR Green, following the unbiased, target-specific preamplification of cDNA using SsoAdvanced PreAmp Supermix (BioRad). Experimental Ct values were normalized to 18S rRNA, and relative mRNA expression was calculated. Lactate and glucose assay kits (BioVision Research Products) were used to measure extracellular lactate and glucose, following manufacturer’s instructions. Briefly, equal number of cells were seeded in 6-well plates and cultured in Phenol-Red-free DMEM for 24 h or 36 h. Cultured medium was then mixed with the reaction solution. Lactate and glucose levels were measured at 450 nm and 570 nm, respectively, using a FLUO star Omega plate reader. Values were normalized to cell number. Melanoma cell lines were lifted by 0.5 mM EDTA in PBS and washed with 1 × PBS. For the intravenous injection, a total of 3 × 105 (A375) or 1 × 106 (G361 and MeWo) or 2 × 106 (A375P and FACS-sorted MeWo) cells in 0.2 ml of DMEM were injected into the tail veins of 6-week-old male nude mice. No randomization or blinding techniques were applied in this study. To assess the degree of tumour formation in the lung, bioluminescence imaging of living mice was performed on a Xenogen IVIS-50TM imaging system equipped with an isoflurane (1–3%) anaesthesia system and a temperature-controlled platform19, three weeks (G361 and MeWo) or four weeks (A375 and A375P) post-injection. For the doxycycline-induction experiment, upon detection of lung metastasis following tail-vein implantation, PGC1α expression was induced by feeding mice with a chow or doxycycline-containing diet (200 mg/kg, Harlan Laboratories) for one week. For the orthotopic metastasis model, 1 × 106 cells were injected subcutaneously into one side of 6-week-old male NOD/SCID mice, with two injections per animal, followed by surgical tumour removal when the subcutaneous tumours reached 2 mm in diameter. Metastasis was monitored by in vivo imaging at 8–10 weeks post-surgery. After the measurement of bioluminescence, animals were killed and the lungs were removed. Collected lung tissues were fixed in 10% buffered formalin solution (Sigma-Aldrich) overnight. Fixed tissues were stained with haematoxylin and eosin (H&E) or antibodies against p-FAK-Y397 (Invitrogen) or HMB45 (Abcam), and one image per sample was shown as representative of one or three pictures captured, as indicated specifically in corresponding figure legend. Scale bar represents 200 μm unless otherwise indicated. All procedures were conducted in accordance with the guidelines of the Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committee, and none of the tumours exceeded the size limit dictated by the IACUC guidelines. For cell migration assays, transwell chambers were purchased from Corning Life Science. Generally, A375P (5 × 103) or G361 (4 × 103) cells in 0.1 ml of FBS-free medium were seeded into the upper chamber and incubated for 6 h if not otherwise indicated. For invasion assays, A375P (5 × 103), A375 (3 × 103), G361 (4 × 103), A2058 (3 × 103), RPMI7951 (5 × 103) or WM115 (4 × 103) cells in 0.1 ml of FBS-free medium were seeded into the upper chamber of an 8 μM matrigel coated chamber (BD Bioscience) and incubated for 16 h if not otherwise indicated. Specifically, for the migration and invasion assays on sorted cells (Fig. 2c) or A375P cells with ID2 knockdown (Fig. 3b), 1 × 105 cells were seeded and incubated for 24 h. Cells that had migrated and invaded through the matrigel were then fixed and stained with H&E if not otherwise indicated. The membrane attached with migrated and invaded cells was placed on a glass slide and total cell numbers from three or four random fields under 20–40× magnifications were quantified with an Olympus IX51 or a Nikon 80i Upright microscope, by counting cells on 20–50% of one field area and extrapolated to 100% of the field17. Specifically for the experiments with FAK inhibitor, shScr or shPGC1α stably expressing cells (A375P 1 × 105 per well, G361 2.5 × 104 per well) were cultured in transwell chambers with either DMSO or indicated concentration of PF-573228, followed by staining with Crystal Violet and quantification after migration for 24 h. For the experiments with PLX4032, cells were incubated with DMSO or 1 μM PLX4032 for 10 h in matrigel-coated transwell chambers, followed by quantification. Nuclear lysates were incubated with specific antibodies overnight at 4 °C, followed by precipitation with protein G Dynabeads (Invitrogen) at 4 °C for 2 h. For Fig. 3h, nuclear lysates from V5−ID2 stably-expressing A375P cells were subjected to co-IP with 1 μg ID2 antibody (C-20, Santa Cruz Biotechnology), followed by western blot with TCF4 (M03, Abnova) and ID2 (4E12G5, Thermo Scientific); for Fig. 4d, 10 mg of nuclear lysates from A375P cells treated with DMSO or 1 μM PLX4032 for 16 h were subjected to co-IP with 4 μg ID2 antibody (C-20). ChIP was performed with the MilliPore ChIP Kit with slight modification. Following sonication, nuclear lysates were precleared with protein A/G-Dynabeads (Invitrogen) for 1 h. Equal amounts of precleared lysates were incubated with IgG or gene-specific antibodies (PGC1α 4C1.3 from Millipore, or PGC1α H-300, and TCF4 K-15 from Santa Cruz Biotechnology) overnight, followed by precipitation with protein A/G-Dynabeads for 2 h. qPCR with SYBR Green was performed to quantify the promoter occupancy. For Fig. 4e, A375P cells stably expressing V5–TCF4 were cultured with PLX4032 at 5 μM for 16 h and followed by ChIP and qPCR. A ToxiLight Non-destructive Cytotoxicity BioAssay Kit (Lonza) was used to quantify the cytotoxic effects of the indicated compounds according to the manufacturer’s instruction. The measurement of dead cells in the DMSO group was set as 1, and was used to normalize other treatment groups (Extended Data Fig. 2j). For the cell growth assay with PLX4032 (Extended Data Fig. 9d), cells were cultured with DMSO or PLX4032 for the indicated time under either attachment or detachment conditions, followed by cell counting with a haemocytometer. For detachment culture conditions, cells were plated on tissue culture plates coated with poly-HEMA. No statistical methods were used to predetermine sample size. All statistics are described in figure legends. In general, for two experimental comparisons, a two-tailed unpaired Student’s t-test was used unless otherwise indicated. For multiple comparisons, one-way ANOVAs were applied. When cells were used for experiments, three replicates per treatment were chosen as an initial sample size. All n values defined in the legends refer to biological replicates. If technical failures such as tail-vein injection failure or inadequate intraperitoneal injection occurred before collection, those samples were excluded from the final analysis. Statistical significance is represented by asterisks corresponding to *P < 0.05, **P < 0.01 and ***P < 0.005.


News Article | November 22, 2016
Site: www.newsmaker.com.au

The extremely consolidated global market for mice models is primarily dominated by the players Charles River, The Jackson Laboratory, and Harlan Laboratories – three companies that collectively occupied 75% of the market in 2014 in terms of value. At the time, the market was predominantly controlled by a small number of players, mostly owing to the disparity in demand between developed and developing economies. However, as the rate of development of emerging economies and their biomedical industries ramps up, so does their demand for mice models. The resultant effect on the competitive landscape for the global mice models market is a significant growth in the number of regional players in the emerging economies. They pose a direct threat to the globally prominent players that are trying to invest in the opportunities that these regions hold. According to a new publication by Transparency Market Research, the trend of outsourcing mice models to CROs and pharma companies is also driving the global demand for mice models. There is, however, considerable strain on the market’s growth rate due to the stringent regulations applied by global healthcare and pharmaceutical bodies. Advancements in Mice Model Types and Services Add to Research Scope and Capabilities “The ALS Association had recently shown the use of mutated mice models for the study of the disease,” states a TMR analyst. “This is only one of the many examples that can show that the recent advancements in mice model types and services have not only added to the strength of existing research processes, but have also expanded the scope of mice model use within other medical research fields.” New mice models are found to be acceptable in the studies of advanced diseases, a fact which is greatly driving the demand for mice models. They can now be used in advanced research such as lung disease repair. The integral nature of the mice models market with the pharmaceutical and biomedical fields has allowed companies from these industries to form alliances that can even revolve around further advancing the mice models types and services in the future. Growing Scope of Alternative Technologies Restrains Use of Mice Models A lot of companies are currently seeking non-animal test methods for their research processes in order to either eliminate animal use completely or to restrict it as much as possible. Alternatives include solutions such as the Irritation Assay System which is a simplified procedure in a test tube used for skin irritation, or even human skin culture. A lot of these alternatives are not only cheaper but also provide a faster and more accurate conclusion formation process. This complements the reduction in use of animal models due to the growing protests by people against their use. In another alternative, professionals are adopting computer-generated simulations to test their processes, further reducing the need for animal models. The global market for mice models is expected to be evaluated at US$1.79 bn by the end of 2023. North America has consistently been a key region in terms of demand for mice models. By the end of 2023, this region is expected to generate a revenue of US$785.4 mn. Meanwhile, the demand for mice models is expected to expand at a CAGR of 11.1% in Asia Pacific, from 2015 to 2023. Request For Discount On This Report: http://www.transparencymarketresearch.com/sample/sample.php?flag=D&rep_id=2085 An immense demand for genetically engineered mice models is expected to put this service type in the leading position by 2023, with an expected revenue of US$155.2 mn. Mouse breeding and re-derivation have so far been the more popular mice model service types but are likely to be replaced by genetically engineered models soon. Inbred mice models have consistently been the more popular mice model types. By the end of 2023, the revenue earned by the inbred mice model segment is expected to reach US$340.6 mn. Transparency Market Research (TMR) is a market intelligence company, providing global business information reports and services. Our exclusive blend of quantitative forecasting and trends analysis provides forward-looking insight for thousands of decision makers. TMR’s experienced team of analysts, researchers, and consultants, use proprietary data sources and various tools and techniques to gather, and analyze information. Our business offerings represent the latest and the most reliable information indispensable for businesses to sustain a competitive edge. Each TMR syndicated research report covers a different sector - such as pharmaceuticals, chemicals, energy, food & beverages, semiconductors, med-devices, consumer goods and technology. These reports provide in-depth analysis and deep segmentation to possible micro levels. With wider scope and stratified research methodology, TMR’s syndicated reports strive to provide clients to serve their overall research requirement.


News Article | November 22, 2016
Site: www.newsmaker.com.au

According to Stratistics MRC, the Global Genotyping market is estimated at $6.43 billion in 2015 and is expected to reach $24.36 billion by 2022 growing at a CAGR of 21% from 2015 to 2022. Growing awareness regarding personalised medicine and genetic diseases among the people, increase in target diseases occurrence and technological improvements in genotyping are the key factors driving the market growth. On the other hand,  poor reimbursement policies is hampering the market growth. Demand for low cost genotyping service and huge flow of investments are the opportunities for the market to grow. Access the complete report at: http://www.strategymrc.com/report/genotyping-market The reagents and kits in product segment leads the market globally with the biggest market share and reagents is expected to grow with a high CAGR during the forecast period. Polymerase Chain Reaction (PCR) holds the largest share whereas sequencing in application segment is expected to overtake it during forecast period. North America is projected to be the leading markets in terms of market size, the growth is attributed to R&D investments and technological advancements. Asia Pacific is expected to witness high growth rate during the forecast period. Some of the key players in the market are Sequenom Inc., Bio-Rad Laboratories, Illumina, Inc., Roche Diagnostics., Life Technologies Corporation (Thermofisher Scientific), Harlan Laboratories, Agilent Technologies, Affymetrix, Inc, Beckman Coulter, Genewiz, Inc., Qiagen NV, GE Healthcare and Fluidigm Corp. Request for a sample at: http://www.strategymrc.com/report/genotyping-market Technologies Covered: • Sequencing o Sanger Sequencing o Next Generation Sequencing (NGS) o Pyrosequencing • Maldi-Tof • Capillary Electrophoresis o Single Strand Conformation Polymorphism (SSCP) o Restriction Fragment Length Polymorphism (RFLP) o Amplified Fragment Length Polymorphisms (AFLP) • Polymerase Chain Reaction (PCR) o Digital PCR o Real Time PCR • Microarray • Other Technologies End Users Covered: • Academic Institutions • Pharmaceutical & Biopharmaceutical Companies • Diagnostic & Research Laboratories Products Covered: • Genotyping Services • Reagents & Kits • Instruments o Analyzers o Sequencers & Amplifiers • Bioinformatics Software Applications Covered: • Agricultural Biotechnology • Pharmacogenomics • Animal Genetics • Diagnostic Research • Other Applications Regions Covered: • North America o US o Canada o Mexico • Europe o Germany o France o Italy o UK  o Spain   o Rest of Europe     • Asia Pacific o Japan        o China        o India        o Australia        o New Zealand       o Rest of Asia Pacific     • Rest of the World o Middle East o Brazil o Argentina o South Africa o Egypt What our report offers: - Market share assessments for the regional and country level segments - Market share analysis of the top industry players - Strategic recommendations for the new entrants - Market forecasts for a minimum of 7 years of all the mentioned segments, sub segments and the regional markets - Market Trends (Drivers, Constraints, Opportunities, Threats, Challenges, Investment Opportunities, and recommendations) - Strategic recommendations in key business segments based on the market estimations - Competitive landscaping mapping the key common trends - Company profiling with detailed strategies, financials, and recent developments - Supply chain trends mapping the latest technological advancements


News Article | November 7, 2016
Site: marketersmedia.com

— Growing awareness regarding personalised medicine and genetic diseases among the people, increase in target diseases occurrence and technological improvements in genotyping are the key factors driving the market growth. On the other hand, poor reimbursement policies is hampering the market growth. Demand for low cost genotyping service and huge flow of investments are the opportunities for the market to grow. The reagents and kits in product segment leads the market globally with the biggest market share and reagents is expected to grow with a high CAGR during the forecast period. Polymerase Chain Reaction (PCR) holds the largest share whereas sequencing in application segment is expected to overtake it during forecast period. North America is projected to be the leading markets in terms of market size, the growth is attributed to R&D investments and technological advancements. Asia Pacific is expected to witness high growth rate during the forecast period. Some of the key players in the market are Sequenom Inc., Bio-Rad Laboratories, Illumina, Inc., Roche Diagnostics., Life Technologies Corporation (Thermofisher Scientific), Harlan Laboratories, Agilent Technologies, Affymetrix, Inc, Beckman Coulter, Genewiz, Inc., Qiagen NV, GE Healthcare and Fluidigm Corp. Regions Covered: • North America o US o Canada o Mexico • Europe o Germany o France o Italy o UK o Spain o Rest of Europe • Asia Pacific o Japan o China o India o Australia o New Zealand o Rest of Asia Pacific • Rest of the World o Middle East o Brazil o Argentina o South Africa o Egypt What our report offers: - Market share assessments for the regional and country level segments - Market share analysis of the top industry players - Strategic recommendations for the new entrants - Market forecasts for a minimum of 7 years of all the mentioned segments, sub segments and the regional markets - Market Trends (Drivers, Constraints, Opportunities, Threats, Challenges, Investment Opportunities, and recommendations) - Strategic recommendations in key business segments based on the market estimations - Competitive landscaping mapping the key common trends - Company profiling with detailed strategies, financials, and recent developments - Supply chain trends mapping the latest technological advancements About Stratistics MRC We offer wide spectrum of research and consulting services with in-depth knowledge of different industries. We are known for customized research services, consulting services and Full Time Equivalent (FTE) services in the research world. We explore the market trends and draw our insights with valid assessments and analytical views. We use advanced techniques and tools among the quantitative and qualitative methodologies to identify the market trends. Our research reports and publications are routed to help our clients to design their business models and enhance their business growth in the competitive market scenario. We have a strong team with hand-picked consultants including project managers, implementers, industry experts, researchers, research evaluators and analysts with years of experience in delivering the complex projects. For more information, please visit http://www.strategymrc.com/


HSP90 inhibitors used in this study including PU-H71, PU-DZ13, NVP-AUY922, and SNX-2112 were synthesized as previously reported7, 19. 17-DMAG was purchased from Sigma. HSP90 bait (PU-H71 beads)21, HSP70 bait (YK beads)22, biotinylated YK (YK-biotin)22, fluorescently labelled PU-H71 (PU-FITC)23, the control derivatives PU-TEG and PU-FITC9 (ref. 24), and the radiolabelled PU-H71-derivative 124I-PU-H71 (ref. 25) were generated as previously described. The specificity of PU-H71 for HSP90 and over other proteins was extensively analysed7. Thus binding of PU-H71 in cell homogenates, live cells and organisms denotes binding to HSP90 species characteristic of each analysed tumour or tissue. Combined with the findings that PU-H71 binds more tightly to HSP90 in type 1 than in type 2 cells, an observation true for cell homogenates, live cells, and in vivo, at the organismal level, we propose that labelled versions of PU-H71 are reliable tools to perturb, identify and measure the expression of the high-molecular-weight, multimeric HSP90 complexes in tumours. The specificity of YK probes for HSP70 was previously reported22, 26, 27, 28. Cell lines were obtained from laboratories at WCMC or MSKCC, or were purchased from the American Type Culture Collection (ATCC) or Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ). Cells were cultured as per the providers’ recommended culture conditions. Cells were authenticated using short tandem repeat profiling and tested for mycoplasma. The pancreatic cancer cell lines include: ASPC-1 (CRL-1682), PL45 (CRL-2558), MiaPaCa2 (CRL-1420), SU.86.86 (CRL-1837), CFPAC (CRL-1918), Capan-2 (HTB-80), BxPc-3 (CRL-1687), HPAFII (CRL-1997), Capan-1 (HTB-79), Panc-1 (CRL-1469), Panc05.04 (CRL-2557) and Hs766t (HTB-134) (purchased from the ATCC); 931102 and 931019 are patient derived cell lines provided by Y. Janjigian, MSKCC. Breast cancer cell lines were obtained from ATCC and include MDA-MB-468 (HTB-132), HCC1806 (CRL-2335), MDA-MB-231 (CRM-HTB-26), MDA-MB-415 (HTB-128), MCF-7 (HTB-22), BT-474 (HTB-20), BT-20 (HTB-19), MDA-MB-361 (HTB-27), SK-Br-3 (HTB-30), MDA-MB-453 (HTB-131), T-47D (HTB-133), AU565 (CRL-2351), ZR-75-30 (CRL-1504), ZR-75-1 (CRL-1500). Lymphoma cell lines include: Akata1, Mutu-1 and Rae-1 (provided by W. Tam, WCMC); BCP-1 (CRL-2294), Daudi (CCL-213), EB1 (HTB-60), NAMALWA (CRL-1432), P3HR-1 (HTB-62), SU-DHL-6 (CRL-2959), Farage (CRL-2630), Toledo (CRL-2631) and Pfeiffer (CRL-2632) (obtained from ATCC); HBL-1, MD901 and U2932 (kindly provided by J. Angel Martinez-Climent, Centre for Applied Medical Research, Pamplona, Spain); Karpas422 (ACC-32), RCK8 (ACC-561) and SU-DHL-4 (ACC-495) (obtained from the DSMZ); OCI-LY1, OCI-LY3, OCI-LY4, OCI-LY7 and OCI-LY10 (obtained from the Ontario Cancer Institute); TMD8 (kindly provided by L. M. Staudt, NIH); BC-1 (derived from an AIDS-related primary effusion lymphoma); IBL-1 and IBL-4 (derived from an AIDS-related immunoblastic lymphoma) and BC3 (derived from a non-HIV primary effusion lymphoma). Leukaemia cell lines include: REH (CRL-8286), HL-60 (CCL-240), KASUMI-1 (CRL-2724), KASUMI-4 (CRL-2726), TF-1 (CRL-2003), KG-1 (CCL-246), K562 (CCL-243), TUR (CRL-2367), THP-1 (TIB-202), U937 (CRL-1593.2), MV4-11 (CRL-9591) (obtained from ATCC); KCL-22 (ACC-519), OCI-AML3 (ACC-582) and MOLM-13 (ACC-554) (obtained from DSMZ). The lung cancer cell lines include: NCI-H3122, NCI-H299 (provided by M. Moore, MSKCC); EBC1 (provided by Dr Mellinghoff, MSKCC); PC9 (kindly provided by D. Scheinberg, MSKCC), HCC15 (ACC-496) (DSMZ), HCC827 (CRL-2868), NCI-H2228 (CRL-5935), NCI-H1395 (CRL-5868), NCI-H1975 (CRL-5908), NCI-H1437 (CRL-5872), NCI-H1838 (CRL-5899), NCI-H1373 (CRL-5866), NCI-H526 (CRL-5811), SK-MES-1 (HTB-58), A549 (CCL-185), NCI-H647 (CRL-5834), Calu-6 (HTB-56), NCI-H522 (CRL-5810), NCI-H1299 (CRL-5803), NCI-H1666 (CRL-5885) and NCI-H1703 (CRL-5889) (obtained from ATCC). The gastric cancer cell lines include: MKN74 (obtained from G. Schwarz, Columbia University), SNU-1 (CRL-5971) and NCI-N87 (CRL-5822) (obtained from ATCC), OE19 (ACC-700) (DSMZ). The non-transformed cell lines MRC-5 (CCL-171), human lung fibroblast and HMEC (PCS-600-010), human mammary epithelial cells were obtained from ATCC. NIH-3T3, and NIH-3T3 cell lines stably expressing either mutant MET (Y1248H) or vSRC, were provided by L. Neckers, National Cancer Institute (NCI), USA, and were previously reported29, 30. Patient tissue was obtained with informed consent and authorized through institutional review board (IRB)-approved bio-specimen protocol number 09-121 at Memorial Sloan Kettering Cancer Centre (New York, New York). Specimens were treated for 24 h or 48 h with the indicated concentrations of PU-H71 as previously described31. Following treatment, slices were fixed in 4% formalin solution for 1 h, then stored in 70% ethanol. For tissue analysis, slices were embedded in paraffin, sectioned, slide-mounted, and stained with haematoxylin and eosin (H&E). Apoptosis and necrosis of the tumour cells (as percentage) was assessed by reviewing all the H&E slides of the case (controls and treated ones) in toto, blindly, allowing for better estimation of the overall treatment effect to the tumour. In addition, any effects to precursor lesions (if present) and any off-target effects to benign surrounding tissue, were analysed. Tissue slides were assessed blindly by a breast cancer pathologist who determined the apoptotic events in the tumour, as well as any effect on adjacent normal tissue31. Cryopreserved primary AML samples were obtained with informed consent and Weill Cornell Medical College IRB approval (IRB number 0910010677 and IRB number 0909010629). Samples were thawed and cultured for in vitro treatment as described previously32. The microdose 124I-PU-H71 PET-CT (Dunphy, M. PET imaging of cancer patients using 124I-PUH71: a pilot study available from: http://clinicaltrials.gov; NCT01269593) and phase I PU-H71 therapeutic (Gerecitano, J. The first-in-human phase I trial of PU-H71 in patients with advanced malignancies available from: http://clinicaltrials.gov; NCT01393509) studies were approved by the institutional review board (protocols 10-139 and 11-041, respectively), and conducted under an exploratory investigational new drug (IND) application approved by the US Food and Drug Administration. Patients provided signed informed consent before participation. 124I-PU-H71 tracer was synthesized in-house by the institutional cyclotron core facility at high specific activity. For PU-PET, research PET-CT was performed using an integrated PET-CT scanner (Discovery DSTE, General Electric). CT scans for attenuation correction and anatomic coregistration were performed before tracer injection. Patients received 185 megabecquerel (MBq) of 124I-PU-H71 by peripheral vein over two minutes. PET data were reconstructed using a standard ordered subset expected maximization iterative algorithm. Emission data were corrected for scatter, attenuation, and decay. 124I-PU-H71 scans (PU-PET) were performed at 24 h after tracer administration. Each picture shown in Fig. 4c and Extended Fig. 6a is a scan taken of an individual patient. PET window display intensity scales for FDG and PU-PET fusion PET-CT images are given for both PU-PET and FDG-PET. Numbers in the scale bar indicate upper and lower SUV thresholds that define pixel intensity on PET images. The phase I trial included patients with solid tumours and lymphomas who had undergone prior treatment and currently had no curative treatment options. Patient cohorts were treated with PU-H71 at escalating dose levels determined by a modified continuous reassessment model. Each patient was treated with his or her assigned dose of PU-H71 on day 1, 4, 8, and 11 of each 21-day cycle. Human embryonic stem cells (hESCs) were differentiated with a modified dual-SMAD inhibition protocol towards floor plate-based midbrain dopaminergic (mDA) neurons as described previously33. hESCs were maintained on mouse embryonic fibroblasts and passaged with Dispase (STEMCELL Technologies). For each differentiation, hESCs were harvested with Accutase (Innovative Cell Technology). At day 30 of differentiation, hESC-derived mDA neurons were replated and maintained on dishes precoated with polyornithine (PO; 15 μg ml−1), laminin (1 μg ml−1), and fibronectin (2 μg ml−1) in Neurobasal/B27/l-glutamine-containing medium (NB/B27; Life Technologies) supplemented with 10 μM Y-27632 (until day 32) and with BDNF (brain-derived neurotrophic factor, 20 ng ml−1; R&D), ascorbic acid (AA; 0.2 mM, Sigma), GDNF (glial cell line-derived neurotrophic factor, 20 ng ml−1; R&D), TGFβ3 (transforming growth factor type β3, 1 ng ml−1; R&D), dibutyryl cAMP (0.5 mM; Sigma), and DAPT (10 nM; Tocris). Two days after replating, mDA neurons were treated with 1 μg ml−1 mitomycin C (Tocris) for 1 h to kill any remaining non-post mitotic contaminants. Assays were performed at day 65 of neuron differentiation. The PU-FITC assay was performed as previously described7, 23. Briefly, cells were incubated with 1 μM PU-FITC at 37 °C for 4 h. Then cells were washed twice with FACS buffer (PBS/0.5% FBS), and resuspended in FACS buffer containing 1 μg ml−1 DAPI. HL-60 cells were used as internal control to calculate fold binding for all cell lines tested. The mean fluorescence intensity (MFI) of PU-FITC in treated viable cells (DAPI negative) was evaluated by flow cytometry. For primary AML specimens, cells were also stained with anti-CD45-APC-H7, to identify blasts and lymphocyte populations (BD biosciences). Blasts and lymphocyte populations were gated based on SSC versus CD45. The fold PU-FITC binding of leukaemic blasts (CD45dim) was calculated relative to lymphocytes (CD45hiSSClow). The FITC derivative FITC9 was used as a negative control. Cells were seeded on coverslips in 6-well plate and cultured overnight. Cells were treated with 1 μM PU-FITC or negative control (PU-FITC9, an HSP90 inert PU-H71 derivative labelled with FITC). At 4 h post-treatment, cells were fixed with 4% formaldehyde at room temperature for 30 min, and the coverslips were mounted on slides with DAPI-Fluoromount-G Mounting Media (Southern Biotech). The images were captured using EVOS FL Auto imaging system (ThermoFisher Scientific) or a confocal microscope (Zeiss LSM5). Cells were seeded on coverslips and cultured overnight. Cells were fixed with 4% formaldehyde at room temperature for 30 min, washed three times with PBS, and permeabilized with 0.2% Triton X-100 in blocking buffer (PBS/5% BSA) for 10 min. Cells were incubated in blocking buffer for 30 min, and then incubated with rabbit anti-human HSP90α antibody (1:500, Abcam 2928) and mouse anti-human HSP90β (1:500, Stressmarq H9010), or rabbit and mouse normal IgG, in blocking buffer for 1 h. Cells were washed three times with PBS, and incubated with goat anti-mouse Alexa Fluor 568 and goat anti-rabbit Alexa Fluor 488 (1:1,000, ThermoFisher Scientific) in blocking buffer in the dark for 1 h. Cells were then washed three times with PBS, and the coverslips were removed from the plate, and mounted on slides with DAPI-Fluoromount-G Mounting Media (Southern Biotech). The images were captured using EVOS FL Auto imaging system (ThermoFisher Scientific) or a confocal microscope (Zeiss LSM5). Fluorescence intensity was quantified by the integrated density algorithm as implemented in ImageJ. Assays were carried out in black 96-well microplates (Greiner Microlon Fluotrac 200). A stock of 10 μM PU-FITC (or GM-cy3B34) was prepared in DMSO and diluted with Felts buffer (20 mM Hepes (K), pH 7.3, 50 mM KCl, 2 mM DTT, 5 mM MgCl , 20 mM Na MoO , and 0.01% NP40 with 0.1 mg ml−1 BGG). To each well was added the fluorescent dye-labelled HSP90 ligand (3 nM PU-FITC or 6 nM GM-cy3B), and cell lysates (7.5 μg) in a final volume of 100 μl Felts buffer. For each assay, background wells (buffer only), and tracer controls (PU-FITC only) were included on assay plate. To determine the equilibrium binding of GM-cy3b, increasing amounts of lysate (up to 20 μg of total protein) were incubated with tracer. The assay plate was placed on a shaker at room temperature for 60 min and the FP values in mP were measured every 5 min. At time t = 60 min, dissociation of fluorescent ligand was initiated by adding 1 μM PU-H71 in Felts buffer to each well and then placing the assay plate on a shaker at room temperature and measuring the FP values in mP every 5 min. The assay window was calculated as the difference between the FP value recorded for the bound fluorescent tracer and the FP value recorded for the free fluorescent tracer (defined as mP − mPf). Measurements were performed on a Molecular Devices SpectraMax Paradigm instrument (Molecular Devices, Sunnyvale, CA), and data were imported into SoftMaxPro6 and analysed in GraphPad Prism 5. To identify and separate chaperome complexes in tumours, and to overcome the limitations of classical protein chromatography methods for resolving complexes of similar composition and size, we took advantage of a capillary-based platform that combines isoelectric focusing (IEF) with immunoblotting capabilities35. This methodology uses an immobilized pH gradient to separate native multimeric protein complexes based on their isoelectric point (pI), and allows for subsequent probing of immobilized complexes with specific antibodies. The method uses only minute amounts of sample, thus enabling the interrogation of primary specimens. Cultured cells were lysed in 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl , 0.01% NP40, 20 mM Na MoO buffer, containing protease and phosphatase inhibitors. Primary specimens were lysed in either Bicine-Chaps or RIPA buffers (ProteinSimple). Total protein assay was performed on an automated system, NanoPro 1000 Simple Western (ProteinSimple), for charge-based separation. Briefly, total cell lysates were diluted to a final protein concentration of 250 ng μl−1 using a master mix containing 1× Premix G2 pH 3-10 separation gradient (Protein simple) and 1× isoelectric point standard ladders (ProteinSimple). Samples diluted in this manner maintained their native charge state, and were loaded into capillaries (ProteinSimple) and separated based on their isoelectric points at a constant power of 21,000 μWatts for 40 min. Immobilization was performed by UV-light embedded in the Simple Western system, followed by incubations with anti-HSP90β (SMC-107A, StressMarq Biosciences), anti-HSP90α (ab2928, Abcam), anti-HSP70 (SPA-810, Enzo), AKT (4691), P-AKT (9271) or BCL2 (2872) from Cell Signaling Technology and subsequently with HRP-conjugated anti-Mouse IgG (1030-05, SouthernBiotech) or with HRP-conjugated anti-Rabbit IgG (4010-05, SouthernBiotech). Protein signals were quantitated by chemiluminescence using SuperSignal West Dura Extended Duration Substrate (Thermo Scientific), and digital imaging and associated software (Compass) in the Simple Western system, resulting in a gel-like representation of the chromatogram. This representation is shown for each figure. Protein was extracted from cultured cells in 20 mM Tris pH 7.4, 150 mM NaCl, 1% NP-40 buffer with protease and phosphatase inhibitors added (Complete tablets and PhosSTOP EASYpack, Roche). Ten to fifty μg of total protein was subjected to SDS–PAGE, transferred onto nitrocellulose membrane, and incubated with indicated antibodies. HSP90β (SMC-107) and HSP110 (SPC-195) antibodies were purchased from Stressmarq; HER2 (28-0004) from Zymed; HSP70 (SPA-810), HSC70 (SPA-815), HIP (SPA-766), HOP (SRA-1500), and HSP40 (SPA-400) from Enzo; HSP90β (ab2927), HSP90α (ab2928), p23 (ab2814), GAPDH (ab8245) and AHA1 (ab56721) from Abcam; cleaved PARP (G734A) from Promega; CDC37 (4793), CHIP (2080), EGFR (4267), S6K (2217), phospho-S6K (S235/236) (4858), P-AKT (S473) (9271), AKT (4691), P-ERK (T202/Y204) (4377), ERK (4695), MCL1 (5453), Bcl-XL (2764), BCL2 (2872), c-MYC (5605) and HER3 (4754) from Cell Signaling Technology; and β-actin (A1978) from Sigma-Aldrich. The blots were washed with TBS/0.1% Tween 20 and incubated with appropriate HRP-conjugated secondary antibodies. Chemiluminescent signal was detected with Enhanced Chemiluminescence Detection System (GE Healthcare) following the manufacturer’s instructions. We screened a panel of anti-chaperome antibodies for those that interacted with the target protein in its native form. We reasoned that these antibodies were more likely to capture stable multimeric forms of the chaperome members. These native-cognate antibodies were used in native-PAGE and IEF analyses of chaperome complexes. HSP90β (SMC-107) and HSP110 (SPC-195) antibodies were purchased from Stressmarq; HSP70 (SPA-810), HSC70 (SPA-815), HOP (SRA-1500), and HSP40 (SPA-400) from Enzo; HSP90β (ab2927), HSP90α (ab2928), and AHA1 (ab56721) from Abcam; CDC37 (4793) from Cell Signaling Technology. Cells were lysed in 20 mM Tris pH 7.4, 20 mM KCl, 5 mM MgCl , 0.01% NP40, and 10% glycerol buffer by a freeze-thaw procedure. Primary samples were lysed in either Bicine-Chaps or RIPA buffers (ProteinSimple). Twenty-five to one hundred μg of protein was loaded onto 4–10% native gradient gel and resolved at 4 °C. The gels were immunoblotted as described above following either incubation in Tris-Glycine-SDS running buffer for 15 min before transfer in regular transfer buffer for 1 h, or directly transferred in 0.1% SDS-containing transfer buffer for 1 h. Cells were plated at 1 × 106 per 6 well-plate and transfected with an siRNA against human AHA1 (AHSA1; 5′-TTCAAATTGGTCCACGGATAA-3′), HSP90α (HSP90AA1; no. 1 5′-ATGGCATGACAACTACTTTAA-3′; no. 2 5′-AACCCTGACCATTCCATTATT-3′; no.3 5′-TGCACTGTAAGACGTATGTAA-3′), HSP90β (HSP90AB1; no., 5′-CAAGAATGATAAGGCAGTTAA-3′; no. 5′-TACGTTGCTCACTATTACGTA-3′; no.3 5′-CAGAAGACAAGGAGAATTACA-3′) HSP90α/β (no.1 5′-CAGAATGAAGGAGAACCAGAA-3′, no.2 5′-CACAACGATGATGAACAGTAT-3′), HSP110 (HSPH1; 5′-AGGCCGCTTTGTAGTTCAGAA-3′) from Qiagen or HOP (STIP1) (Dharmacon; M-019802-01), or a negative control (scramble; 5′-CAGGGTATCGACGATTACAAA-3′) with Lipofectamine RNAiMAX reagent (Invitrogen), incubated for 72 h and subjected to further analysis. Total mRNA was isolated using TRIzol Reagent (Invitrogen) following the manufacturer’s recommended protocol. Reverse transcription of mRNA into cDNA was performed using QuantiTect Reverse Transcription Kit (Qiagen). qRT–PCR was performed using PerfeCTa SYBR (Quanta Bioscience), 10 nM AHSA1 (forward: 5′-GCGGCCGCTTCTAGTAGTTT-3′ and reverse: 5′-CATCTCTCTCCGTCCAGTGC-3′) and GAPDH (forward: 5′-CAAAGGCACAGTCAAGGCTGA-3′ and reverse: 5′-TGGTGAAGACGCCAGTAGATT-3′) primers, or 1× QuantiTect Primers for HSP110 (HSPH1), HSP90α (HSP90AA1), HSP90β (HSP90AB1), HSP70 (HSPA1A), HOP (STIP1) (Qiagen) following recommended PCR cycling conditions. Melting curve analysis was performed to ensure product uniformity. To investigate which of the two HSP70 paralogues is involved in epichaperome formation we performed immunodepletions with HSP70 and HSC70 antibodies. Protein lysates were immunoprecipitated consecutively three times with either an HSP70 (Enzo, SPA-810), HSC70 (Enzo, SPA-815) or HOP (kindly provided by M. B. Cox, University of Texas at El Paso), or with the same species normal antibody as a negative control (Santa Cruz). The resulting supernatant was collected and run on a native or a denaturing gel. Tumour lysates were mixed with 10 M urea (dissolved in Felts buffer) to reach the indicated final concentrations of 2 M, 4 M and 6 M. After incubation for 10 min at room temperature or frozen overnight at −80 °C, the lysates were loaded onto 4–10% native gradient gel and resolved at 4 °C or applied to the IEF capillary. The HSP90β bands were detected by using antibody purchased from Stressmarq (SMC-107). A lentiviral vector expressing the MYC shRNA, as previously described36, was requested from Addgene (Plasmid 29435, c-MYC shRNA sequence: GACGAGAACAGTTGAAACA). Viruses were prepared by co-transfecting the shRNA vector, the packaging plasmid psPAX2 and the envelop plasmid pMD2.G into HEK293 cells. OCI-LY1 cells were then infected with lentiviral supernatants in the presence of 4 μg ml−1 polybrene for 24 h. Following flow cytometry selection for positive cells, cells were expanded for further experiments. The MYC protein level was confirmed at 10 days post-infection by western blot using the anti-MYC antibody (Cell Signaling Technology, 5605). Viruses were prepared by co-transfection of the lentiviral vector expressing the MYC shRNA with pLM-mCerulean-2A-cMyc (Addgene, 23244) or pCDH-puro-cMYC (Addgene, 46970), the packaging plasmid psPAX2, and the envelope plasmid pMD2.G into HEK293 cells. ASPC1 cells were then infected with lentiviral supernatants in the presence of 4 μg ml−1 polybrene for 24 h and sorted for mCerulean positive cells or selected with puromycin treatment. Changes in cell size after infection were monitored by analysing the forward scatter (FSC) of intact cells via flow cytometry. MYC protein levels were analysed at 4 days post-infection by western blot. Whole cell extracts were prepared by homogenizing cells in RIPA buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1% NP40, 0.25% sodium deoxycholate, 10% glycerol, protease inhibitors). MYC activity was determined using the TransAM c-Myc Kit (Active Motif, 43396), following the manufacturer’s instructions. Cell viability was assessed using CellTiter-Glo luminescent Cell Viability Assay (Promega) after a 72 h PU-H71 treatment. The method determines the number of viable cells in culture based on quantification of the ATP present, which signals the presence of metabolically active cells, and was performed as previously reported37. For the annexin V staining, cells were labelled with Annexin V-PE and 7AAD after PU-H71 treatment for 48 h, as previously reported38. The necrotic cells were defined as annexin V+/7AAD+, and the early apoptotic cells were defined as annexin V+/7AAD−. For the LDH assay the release of lactate dehydrogenase (LDH) into the culture medium only occurs upon cell death. Following indicated treatment, the culture medium was collected and centrifuged to remove living cells and cell debris. The collected medium was incubated at room temperature for 30 min with the Cytotox-96 Non-radioactive Assay kit (Promega) LDH substrate. All animal studies were conducted in compliance with MSKCC’s Institutional Animal Care and Use Committee (IACUC) guidelines. Female athymic nu/nu mice (NCRNU-M, 20–25 g, 6 weeks old) were obtained from Harlan Laboratories and were allowed to acclimatize at the MSKCC vivarium for 1 week before implanting tumours. Mice were provided with food and water ad libitum. Tumour xenografts were established on the forelimbs for PET imaging and on the flank for efficacy studies. Tumours were initiated by sub-cutaneous injection of 1 × 107 cells for MDA-MB-468 and 5 × 106 for ASPC1 in a 200 μl cell suspension of a 1:1 v/v mixture of PBS with reconstituted basement membrane (BD Matrigel, Collaborative Biomedical Products). Before administration, a solution of PU-H71 was formulated in citrate buffer. Sample size was chosen empirically based on published data39. No statistical methods were used to predetermine sample size. Animals were randomly assigned to groups. Studies were not conducted blinded. Imaging was performed with a dedicated small-animal PET scanner (Focus 120 microPET; Concorde Microsystems, Knoxville, TN). Mice were maintained under 2% isoflurane (Baxter Healthcare, Deerfield, IL) anaesthesia in oxygen at 2 litres per min during the entire scanning period. To reduce the thyroid uptake of free iodide arising from metabolism of tracer, mice received 0.01% potassium iodide solution in their drinking water starting 48 h before tracer administration. For PET imaging, each mouse was administered 9.25 MBq (250 μCi) of 124I-PU-H71 via the tail vein. List-mode data (10 to 30 min acquisitions) were obtained for each animal at various time points post-tracer administration. An energy window of 420–580 keV and a coincidence timing window of 6 ns were used. The resulting list-mode data were sorted into 2-dimensional histograms by Fourier rebinning; transverse images were reconstructed by filtered back projection (FBP). The image data were corrected for non-uniformity of scanner response, dead-time count losses, and physical decay to the time of injection. There was no correction applied for attenuation, scatter, or partial-volume averaging. The measured reconstructed spatial resolution of the Focus 120 is 1.6-mm FWHM at the centre of the field of view. Region of interest (ROI) analysis of the reconstructed images was performed using ASIPro software (Concorde Microsystems, Knoxville, TN), and the maximum pixel value was recorded for each tissue/organ ROI. A system calibration factor (that is, μCi per ml per cps per voxel) that was derived from reconstructed images of a mouse-size water-filled cylinder containing 18F was used to convert the 124I voxel count rates to activity concentrations (after adjustment for the 124I positron branching ratio). The resulting image data were then normalized to the administered activity to parameterize the microPET images in terms of per cent injected dose per gram (%ID per g) (corrected for decay of 124I to the time of injection). Post-reconstruction smoothing was applied only for visual representation of images in the figures. Upon euthanasia, radioactivity (124I) was measured in a gamma-counter (Perkin Elmer 1480 Wizard 3 Auto Gamma counter) using a 400–600 keV energy window. Count data were background- and decay-corrected to the time of injection, and the percent injected dose per gram (%ID per g) for each tumour sample was calculated using a calibration curve to convert counts to radioactivity, followed by normalization to the total activity injected. Mice (n = 5) bearing MDA-MB-468 or ASPC1 tumours reaching a volume of 100–150 mm3 were treated i.p. using PU-H71 (75mg per kg) or vehicle, on a 3 times per week schedule, as indicated. Tumour volume (in mm3) was determined by measurement with Vernier calipers, and was calculated as the product of its length × width2 × 0.5. Tumour volume was expressed on indicated days as the median tumour volume ± s.d. indicated for groups of mice. Mice were euthanized after similar PU-H71 treatment periods, and at a time before tumours reached a size that resulted in discomfort or difficulty in physiological functions of mice in the individual treatment group, in accordance with our IUCAC protocol. Frozen tissue was dried and weighed before homogenization in acetonitrile/H O (3:7). PU-H71 was extracted in methylene chloride, and the organic layer was separated and dried under vacuum. Samples were reconstituted in mobile phase. The concentrations of PU-H71 in tissue or plasma were determined by high-performance LC-MS/MS. PU-H71-d was added as the internal standard40. Compound analysis was performed on the 6410 LC-MS/MS system (Agilent Technologies) in multiple reaction monitoring mode using positive-ion electrospray ionization. For tissue samples, a Zorbax Eclipse XDB-C18 column (2.1 × 50 mm, 3.5 μm) was used for the LC separation, and the analyte was eluted under an isocratic condition (80% H O + 0.1% HCOOH: 20% CH CN) for 3 min at a flow rate of 0.4 ml min−1. For plasma samples, a Zorbax Eclipse XDB-C18 column (4.6 × 50 mm, 5 μm) was used for the LC separation, and the analyte was eluted under a gradient condition (H O + 0.1% HCOOH:CH CN, 95:5 to 70:30) at a flow rate of 0.35 ml min−1. Protein extracts were prepared either in 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl , 1% NP40, and 20 mM Na MoO for PU-H71 beads pull-down, or in 20 mM Tris pH 7.4, 150 mM NaCl, and 1% NP40 for YK beads pull-down. Samples were incubated with the PU-H71 beads (HSP90 bait) for 3–4 h or with the YK beads (HSP70 bait, for chemical precipitation) overnight, at 4 °C, then washed and subjected to SDS–PAGE with subsequent immunoblotting and western blot analysis. For HSP70 proteomic analyses, cells were incubated with a biotinylated YK-derivative, YK-biotin. Briefly, MDA-MB-468 cells were treated for 4 h with 100 μM biotin-YK5 or d-biotin as a negative control. Cells were collected and lysed in 20 mM Tris pH 7.4, 150 mM NaCl, and 1% NP40 buffer. Protein extracts were incubated with streptavidin agarose beads (Thermo Scientific) for 1 h at 4 °C, washed with 20 mM Tris pH 7.4, 150 mM NaCl, and 0.1% NP40 buffer and applied onto SDS–PAGE. The gels were stained with SimplyBlue Coomassie stain (Invitrogen Life Science Technologies). Proteomic analyses were performed using the published protocol7, 18, 22. Control beads contained an inert molecule as previously described7, 18, 22. Affinity-purified protein complexes from type 1 tumours (n = 6; NCI-H1975, MDA-MB-468, OCI-LY1, Daudi, IBL1, BC3), type 2 tumours (n = 3; ASPC1, OCI-LY4, Ramos) and from non-transformed cells (n = 3; MRC5, HMEC and neurons) were resolved using SDS-polyacrylamide gel electrophoresis, followed by staining with colloidal, SimplyBlue Coomassie stain (Invitrogen Life Science Technologies) and excision of the separated protein bands. Control beads that contained an inert molecule were subjected to the same steps as PU-H71 and YK beads and served as a control experiment. To ensure that we captured a majority of the HSP90 complexes in each cell type, we performed these studies under conditions of HSP90-bait saturation. The number of gel sections per lane averaged to be 14. In situ trypsin digestion of gel bound proteins, purification of the generated peptides and LC–MS/MS analysis were performed using our published protocols7, 18, 22. After the acquisition of raw files, Proteowizard (version 3.0.3650)41 was used to create a Mascot Generic Format (mgf) file containing accurate mass for each peak and its corresponding ms2 ions. Each mgf was then subjected to search a human segment of Uniprot protein database (20,273 sequences, European Bioinformatics Institute, Swiss Institute of Bioinformatics and Protein Information Resource) using Mascot (Matrix Science; version 2.5.0; http://www.matrixscience.com). Decoy proteins were added to the search to allow for the calculation of false discovery rates (FDR). The search parameters were as follows: (i) two missed cleavage tryptic sites were allowed; (ii) precursor ion mass tolerance = 10 p.p.m.; (iii) fragment ion mass tolerance = 0.8 Da; and (iv) variable protein modifications were allowed for methionine oxidation, deamidation of asparagine and glutamines, cysteine acrylamide derivatization and protein N-terminal acetylation. MudPit scoring was typically applied using significance threshold score P < 0.01. Decoy database search was always activated and, in general, for merged LS–MS/MS analysis of a gel lane with P < 0.01, false discovery rate averaged around 1%. The Mascot search result was finally imported into Scaffold (Proteome Software, Inc.; version 4_4_1) to further analyse tandem mass spectrometry (MS/MS) based protein and peptide identifications. X! Tandem (The GPM, http://thegpm.org; version CYCLONE (2010.12.01.1) was then performed and its results are merged with those from Mascot. The two search engine results were combined and displayed at 1% FDR. Protein and peptide probability was set at 95% with a minimum peptide requirement of 1. Protein identifications were expressed as Exclusive Spectrum Counts that identified each protein listed. Primary data, such as raw mass spectrometry files, Mascot generic format files and proteomics data files created by Scaffold have been deposited onto the Massive site (https://massive.ucsd.edu/ProteoSAFe/static/massive.jsp; MassIVE Accession ID: MSV000079877). In each of the Scaffold files that validate and import Mascot searched files, peptide matches, scoring information (Mascot, as well as X! Tandem search scores) for peptide and protein identifications, MS/MS spectra, protein views with sequence coverage and more, can be easily accessed. To read the Scaffold files, free viewer software can be found at (http://www.proteomesoftware.com/products/free-viewer/). Peptide matches and scoring information that demonstrate the data processing are available in Supplementary Table 1f–q. The exclusive spectrum count values, an alternative for quantitative proteomic measurements42, were used for protein analyses. CHIP and PP5 were examined and used as internal quality controls among the samples. Statistics were performed using R (version 3.1.3) limma package43, 44. For entries with zero spectral counts, and to enable further analyses, we assigned an arbitrary small number of 0.1. The data were then transformed into logarithmic base 10 for analysis. Linear models were fit to the transformed data and moderated standard errors were calculated using empirical Bayesian methods. For Fig. 1f and Extended Data Fig. 5a, a moderated t-statistic was used to compare protein enrichment between type 1 cells and combined type 2 and non-transformed cells45. For Extended Data Fig. 5b, the t-statistic was performed to compare protein enrichment among type 1 cells, type 2 cells and non-transformed cells (see Supplementary Table 1). Heat maps were created to display the selected proteins using the package “gplots” and “lattice”46, 47. See Supplementary Table 1 in which the table tab ‘a’ corresponds to Fig. 1f and contains core chaperome networks in type 1, type 2 and non-transformed cells; the table tab ‘b’ corresponds to Extended Data Fig. 5a and contains comprehensive chaperome networks in type 1, type 2 and non-transformed cells; the table tab ‘c’ corresponds to Extended Data Fig. 5b and Extended Data Fig. 8b and contains the HSP90 interactome as isolated by the HSP90 bait in type 1, type 2 and non-transformed cells; the table tab ‘d’ corresponds to Extended Data Fig. 8a and contains upstream transcriptional regulators that explain the protein signature of type1 tumours and the table tab ‘e’ contains metastasis-related proteins characteristic of type 1 tumours. To understand the physical and functional protein-interaction properties of the HSP90-interacting chaperome proteins enriched in type 1 tumours, we used the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database48. Proteins displayed in the heat map were uploaded in STRING database to generate the PPI networks. STRING builds functional protein-association networks based on compiled available experimental evidence. The thickness of the edges represents the confidence score of a functional association. The score was calculated based on four criteria: co-expression, experimental and biochemical validation, association in curated databases, and co-mentioning in PubMed abstracts48. Proteins with no adjacent interactions were not shown. The colour scale in nodes indicates the average enrichment of the protein (measured as exclusive spectral counts) in type 1, type 2, and non-transformed cells, respectively. The network layout for type 1 tumours was generated using edge-weighted spring-electric layout in Cytoscape with slight adjustments of marginal nodes for better visualization49. The layout for type 2 and non-transformed cells retains that of type 1 for better comparison. Proteins with average relative abundance values less than 1 were deleted from analyses. The biological processes in which they participate and the functionality of proteins enriched in type 1 tumours were assigned based on gene ontology terms and based on their designated interactome from UniProtKB, STRING, and/or I2D databases48, 50, 51, 52, 53. The Upstream Regulator analytic, as implemented in Ingenuity Pathways Analysis (IPA, QIAGEN Redwood City, http://www.qiagen.com/ingenuity), was used to identify the cascade of upstream transcriptional regulators that can explain the observed protein expression changes in type 1 tumours. The analysis is based on prior knowledge of expected effects between transcriptional regulators and their target genes stored in the Ingenuity Knowledge Base. The analysis examines how many known targets of each transcription regulator are present in the data set, and calculates an overlap P value for upstream regulators based on significant overlap between dataset genes and known targets regulated by a transcription regulator. For Extended Data Fig. 8b, proteins were selected based on 3 pre-curated lists (MYC target genes based on the analysis report from INGENUITY, MYC signature genes based on the reported list provided in ref. 54 and MYC expression/function activators were manually curated from UniProt and GeneCards databases). Cell lines with information available in the cBioPortal for cancer genomics (http://www.cbioportal.org) were evaluated for mutations in pathways implicated in cancer: P53, RAS, RAF, PTEN, PIK3CA, AKT, EGFR, HER2, CDK2NA/B, RB, MYC, STAT1, STAT3, JAK2, MET, PDGFR, KDM6A, KIT. Mutations in major chaperome members (HSP90AA1, HSP90AB1, HSPH1, HSPA8, STIP1, AHSA1) were also evaluated. Data were visualized and statistical analyses performed using GraphPad Prism (version 6; GraphPad Software) or R statistical package. In each group of data, estimate variation was taken into account and is indicated in each figure as s.d. or s.e.m. If a single panel is presented, data are representative of 2 or 3 biological or technical replicates, as indicated. P values for unpaired comparisons between two groups with comparable variance were calculated by two-tailed Student’s t-test. Pearson’s tests were used to identify correlations among variables. Significance for all statistical tests was shown in figures for not significant (NS), *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001. No samples or animals were excluded from analysis, and sample size estimates were not used. Animals were randomly assigned to groups. Studies were not conducted blinded, with the exception of all patient specimen histological analyses.


Strickland F.M.,University of Michigan | Hewagama A.,University of Michigan | Wu A.,University of Michigan | Sawalha A.H.,University of Michigan | And 9 more authors.
Arthritis and Rheumatism | Year: 2013

Objective Lupus flares occur when genetically predisposed individuals encounter appropriate environmental agents. Current evidence indicates that the environment contributes by inhibiting T cell DNA methylation, causing overexpression of normally silenced genes. DNA methylation depends on both dietary transmethylation micronutrients and ERK-regulated DNA methyltransferase 1 (DNMT-1) levels. We used transgenic mice to study the effect of interactions between diet, DNMT-1 levels, and genetic predisposition on the development and severity of lupus. Methods A doxycycline-inducible ERK defect was bred into lupus-resistant (C57BL/6) and lupus-susceptible (C57BL/6 × SJL) mouse strains. Doxycycline-treated mice were fed a standard commercial diet for 18 weeks and then switched to a transmethylation micronutrient-supplemented (MS) or -restricted (MR) diet. Disease severity was assessed by examining anti-double-stranded DNA (anti-dsDNA) antibody levels, the presence of proteinuria and hematuria, and by histopathologic analysis of kidney tissues. Pyrosequencing was used to determine micronutrient effects on DNA methylation. Results Doxycycline induced modest levels of anti-dsDNA antibodies in C57BL/6 mice and higher levels in C57BL/6 × SJL mice. Doxycycline-treated C57BL/6 × SJL mice developed hematuria and glomerulonephritis on the MR and standard diets but not the MS diet. In contrast, C57BL/6 mice developed kidney disease only on the MR diet. Decreasing ERK signaling and methyl donors also caused demethylation and overexpression of the CD40lg gene in female mice, consistent with demethylation of the second X chromosome. Both the dietary methyl donor content and the duration of treatment influenced methylation and expression of the CD40lg gene. Conclusion Dietary micronutrients that affect DNA methylation can exacerbate or ameliorate disease in this transgenic murine lupus model, and contribute to lupus susceptibility and severity through genetic-epigenetic interactions. Copyright © 2013 by the American College of Rheumatology.


News Article | April 20, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment C57BL/6 (CD45.2) mice were purchased from Harlan Laboratories (Rehovot, Israel). B6.SJL (CD45.1) mice were bred in-house. Transgenic Ly6a(Sca-1)-EGFP mice and transgenic ROSA26-eYFP (EndoYFP) reporter mice were purchased from Jackson Laboratories. Transgenic nestin-GFP mice were kindly provided by G. N. Enikolopov (Cold Spring Harbour Laboratory, USA). Transgenic c-Kit-EGFP mice were kindly provided by S. Ottolenghi (University of Milano-Bicocca, Italy). Transgenic VE-cadherin (Cdh5, PAC)-CreERT2 mice were kindly provided by R. H. Adams (Max Planck Institute for Molecular Biomedicine, Germany). Conditional mutants carrying loxP-flanked Cxcr4 were provided by D. Scadden (Harvard University, Cambridge, USA). Conditional mutants carrying loxP-flanked Fgfr1 and Fgfr2 (Fgfr1/Fgfr2lox/lox) mice were provided by S. Werner (Institute of Cell Biology, Switzerland) and by D. Ornitz (Washington University School of Medicine, USA). To induce endothelial-specific Cre activity and gene inactivation/expression, adult VE-cadherin(Cdh5, PAC)-CreERT2 mice interbred with Cxcr4lox/lox (EndoΔCxcr4) or Fgfr1/2lox/lox (EndoΔFgfr1/2) or with ROSA26-eYFP mice (EndoYFP) were injected intraperitoneally (i.p.) with Tamoxifen (Sigma, T5648) at 1 mg per mouse per day for 5 days. Mice were allowed to recover for 4 weeks after tamoxifen injections, before euthanasia and experimental analysis. Mice carrying only VE-cadherin (Cdh5, PAC)-CreERT2 transgene or the Cxcr4lox/lox/Fgfr1/2lox/lox mutations were used as wild-typecontrols to exclude non-specific effects of Cre activation or of floxed alleles mutation. The endothelial Fgfr1/2 deletion was confirmed by qRT–PCR measurements of Cxcr4 and Fgfr1/2 mRNA from isolated BMECs. Male and female mice at 8–12 weeks of age were used for all experiments. All mouse offspring from all strains were routinely genotyped using standard PCR protocols. Sample size was limited by ethical considerations and background experience in stem cell transplantation (bone marrow transplantation) which exists in the laboratory for many years and other published manuscripts in the stem cell field, confirming a significant difference between means. No randomization or blinding was used to allocate experimental groups and no animals were excluded from analysis. All mutated or transgenic mouse strains had a C57BL/6 background. All experiments were done with approval from the Weizmann Institute Animal Care and Use Committee. Mice that were maintained at the Weizmann Institute of Science were bred under defined flora conditions. Two-photon in vivo microscopy procedures that were performed in Harvard Medical School were approved by the Institutional Animal Care and Use Committee at Massachusetts General Hospital. AMD3100 (Sigma-Aldrich) 5 mg per kg was used to treat mice by subcutaneous (s.c.) injection. Mice were euthanized 30 min later. Recombinant murine FGF-2 (ProSpec) 200 μg per kg was used to treat mice by i.p. injections for seven consecutive days. Neutralizing rat anti-VE-cadherin antibodies or rat IgG (eBioscience) at 50 μg per mouse per day were used to treat mice by intravenous (i.v.) injections for 2 or 5 days. Neutralizing mouse anti-CXCR4 antibodies (12G5 clone) or mouse IgG (eBioscience) at 50 μg per mouse were administered twice, with a 30 min interval, by intravenous (i.v.) injections. To inhibit ROS production, the antioxidant N-acetyl-l-cysteine (NAC; Sigma-Aldrich) was administered by i.p. injection of 130 mg per kg for 2, 5 or 7 days. Mice were euthanized 2–4 h following the final injection. For standard and confocal fluorescent microscopy, femurs were fixed for 2 h in 4% paraformaldehyde, which was replaced and then the samples were washed with 30% sucrose, embedded in optimum cutting temperature compound, and then snap-frozen in N-methylbutane chilled in liquid nitrogen. Sections (5–10 μm) were generated with a CM1850 Cryostat (Leica) at −25 °C with a tungsten carbide blade (Leica) and a CryoJane tape transfer system (Instrumedics), and were mounted on adhesive-coated slides (Leica), fixed in acetone and air-dried. Sections were stained by incubation overnight at 4 °C with primary antibodies, followed by 1 h incubation of secondary antibody at room temperature and in some cases also nuclei labelling by Hoechst 33342 (Molecular Probes) for 5 min at room temperature. Standard analysis (5–6 μm sections) was performed with Olympus BX51 microscope and Olympus DP71 camera. Confocal analysis (10 μm sections) was performed using a Zeiss LSM-710 microscope. In some cases, for BMBV morphological and phenotypical confocal analysis, femurs and tibias were fixed for 2 h in 4% paraformaldehyde, decalcified with 0.5 M EDTA at 4 °C with constant shaking, immersed into 20% sucrose and 2% polyvinylpyrrolidone (PVP) solution for 24 hours, then embedded and frozen in 8% gelatin (porcine) in presence of 20% sucrose and 2% PVP. Sections (80–300 μm) were generated using low-profile blades on a CM3050 cryostat (Leica). Bone sections were air-dried, permeabilized for 10 min in 0.3% Triton X-100, blocked in 5% donkey serum at room temperature for 30 min, and incubated overnight at 4 °C with primary antibodies. Confocal analysis was performed using a Zeiss LSM-780 microscope. Z-stacks of images were processed and 3D-reconstructed with Imaris software (version 7.00, Bitplane). As previously described4, tile scan images were produced by combining the signal of multiple planes along the Z-stalk of bone sections to allow visualization of the distinct types of bone marrow blood vessels and the cells in their surroundings. For the quantifications of blood vessel diameters, a region of 600–700 μm from the growth plate towards the caudal region was selected and diameters for arterial and sinusoidal blood vessels were calculated using ImageJ software on the high-resolution confocal images. Primary and secondary antibodies and relevant information about them are indicated in Supplementary Table 1. For in vivo ROS detection in bone marrow sections, mice were injected i.p. with hydroethidine (Life Technologies) 10 mg per kg, 30 min before euthanasia. For in vivo LDL-uptake detection in bone marrow sections, mice were i.v. injected with Dil-Ac-LDL (BTI) 20 μg per mouse, 4 h before euthanasia. Femurs were immediately collected and processed as mentioned earlier. Bone marrow section analysis for scoring ROShigh cells was performed using ImageJ software (Extended Data Fig. 1). Multiple sections (>16 per mouse) were generated and analysed from at least 4 mice per group of experimental procedure, in order to confirm biological repeats of the observed data. In some cases, images were processed to enhance the contrast in order to allow better evaluation of co-localization of cellular borders and markers. Imaris, Volocity (Perkin Elmer), Photoshop and Illustrator (Adobe) software were used for image processing. For blood vessel imaging in the calvarium of Sca-1-EGFP and nestin-GFP mice, we used a microscope (Ultima Multiphoton; Prairie Technologies) incorporating a pulsed laser (Mai Tai Ti-sapphire; Newport Corp.). A water-immersed 20× (NA 0.95) or 40× (NA 0.8) objective (Olympus) was used. The excitation wavelength was set at 850–910 nm. For intravital imaging, mice were anaesthetized with 100 mg ketamine, 15 mg xylazine and 2.5 mg acepromazine per kg. During imaging, mice were supplied with oxygen and their core temperature was maintained at 37 °C with a warmed plate. The hair on the skullcap was trimmed and further removed using urea-containing lotion and the scalp was incised at the midline. The skull was then exposed and a small steel plate with a cut-through hole was centred on the frontoparietal suture, glued to the skull using cyanoacrylate-based glue and bolted to the warmed plate. To visualize blood vessels, mice were injected i.v. with 2 μl of a 2 μM non-targeted nanoparticles solution (Qtracker 655, Molecular Probes). In some cases, mice were i.v. injected with Dil-Ac-LDL (BTI) 40 μg per mouse, 2 h before their imaging. We typically scanned a 50 μm-thick volume of tissue at 4 μm Z-steps. Movies and figures based on two-photon microscopy were produced using Volocity software (Perkin Elmer). For live imaging of blood vessels permeability and leukocyte bone marrow trafficking, a previously described experimental procedures and a home built laser-scanning multiphoton imaging system29, were used with some modifications. Anaesthesia was slowly induced in mice via inhalation of a mixture of 1.5–2% isoflurane and O . Once induced, the mixture was reduced to 1.35% isoflurane. By making a U-shaped incision on the scalp, calvarial bone was exposed for imaging and 2% methocellulose gel placed on it for refractive index matching. For bone marrow blood vessel permeability studies, mice were positioned in heated skull stabilization mount which allowed access to the eye for on-stage retro-orbital injection of 40–60 μl of 10 mg ml−1 70 kDa rhodamine-dextran (Life Technologies). Nestin-GFP (excited at 840 nm) and confocal reflectance (at 840 nm) signals were used to determine a region of interest within the mouse calvarial bone marrow for measurement of permeability. Rhodamine-dextran was injected and was continuously recorded (30 frames per second) for the first 10 min after injection. After video acquisition, mice were removed from the microscope and euthanasized with CO . In some cases, following dextran clearance, the same mice were used for homing experiments to monitor leukocyte cell trafficking in regions and blood vessels that were defined as less or more permeable. For cell homing studies, mice were injected with 2 × 106 DiD-labelled (Life Technologies) lineage depleted immature haematopoietic progenitor cells (Miltenyi depletion) and with 2 × 106 DiI-labelled (Life Technologies) bone marrow MNC isolated from age matched C57BL/6 mice along with 150 μl of 2 nmol per 100 μl Angiosense 750EX (Perkin Elmer) fluorescent blood pool imaging agent, immediately before mounting the mice on a heated stage of a separate confocal/multiphoton microscope. Intravital images of the mouse bone marrow were collected for up to the first 3 h after injection of the cells. After imaging, the mice were removed from the microscope and euthanized with CO . Permeability, blood flow/shear rates and homing experiments were repeated, n = 3 mice each, measuring multiple blood vessels and events, each mouse regarded as an independent experiment, in order to confirm biological repeats of the observed data. The contrast and brightness settings of the images in the figures were adjusted for display purposes only. For permeability studies, the RGB movies were separated into red (Rhodamine-Dextran), green (nestin-GFP), and blue (reflectance) grayscale image stacks. An image registration algorithm (Normalized Correlation Coefficient, Template Matching) was performed on the red stack using ImageJ (v. 1.47p) to minimize movement artefacts within the image stack. Manual selection of regions of interest (ROI) was performed immediately next to individual vessels within the focus. Permeability of the vessels was calculated using the following equation: P is the permeability of the vessel, V is the volume of the ROI next to the vessel, A is the fractional surface area of the vessel corresponding to the ROI, dI/dt is the intensity of the dye in the ROI as a function of time, I is the intensity of the dye inside the corresponding vessel at the beginning of measurement, and I is the intensity of the dye in the ROI at the beginning of measurement. To calculate dI/dt for a given vessel, the change in intensity was measured within the ROI over time and linearly fit the first ~5–40 s of the data. The slope of this linear fit is dI/dt. The ROI intensity curve is only linear for the first 30–40 s, after which it begins to plateau. For cell homing, the number of stationary cells from the calvarial bone marrow images was counted and categorized into two groups: adherent and extravasated. We categorized both cells within the lumen of the vessel and cells in the process of transmigration in the adherent category. Maximum intensity projections of multiple z-stacks of images were used to count the number of cells in the two categories. When there was a gap between cells and vessels in the two-dimensional projection image, those cells were categorized as extravasated. If any part of a cell overlapped a vessel in the projection image, the corresponding three dimensional z-stack was viewed to determine if the cell had undergone extravasation. When it was unclear if a cell had extravasated, it was always categorized as adherent. For the flow speed measurement, red blood cells (RBCs) were labelled with 15 μM CFSE for 12 min at 37 °C in PBS supplemented with 1 g per litre of glucose and 0.1% BSA. About 0.6 billion RBCs were injected (i.v). 40 μl of rhodamineB-dextran 70 kDa (10 mg ml−1) was retro-orbitally injected immediately before imaging for visualizing bone marrow vasculature. Videos of confocal images of blood vessel (RhodamineB, excitation: 561 nm, emission: 573–613 nm) and labelled RBCs (CFDA-SE, excitation: 491 nm, emission: 509–547 nm) were taken with the speed of 120 frames per second. Individual RBCs were traced over a couple of frames. Total displacement of the RBCs was measured by ImageJ and the speed of blood flow was calculated by: To calculate the shear rate, we assumed that the vessels were straight (straight cylinder) and the blood is an ideal Newtonian fluid with constant viscosity. Under these conditions, the shear rate (du/dr) can be calculated by du/dr = 8×u/d (u is the average blood flow speed which was measured by tracing labelled RBCs and d is the diameter of the blood vessel as measured using ImageJ). Immunostaining signal intensity was analysed with MacsQuant (Miltenyi, Germany) or with a FACS LSRII (BD Biosciences) with FACSDiva software, data were analysed with FlowJo (Tree Star). Data of the expression of molecules by cells was analysed and presented as MFI (mean fluorescent intensity). To acquire single bone marrow cell suspensions, freshly isolated bones were cleaned, flushed and crushed using liver digestion medium (LDM, Invitrogen) supplemented with 0.1% DNaseI (Roche) and further digested for 30 min at 37 °C, under shaking conditions. Following the incubation time, cells were filtered and washed extensively. To isolate and acquire mononuclear cells (MNC) from the peripheral blood PB, blood was collected from the heart using heparinized syringes and MNC were separated using Lymphoprep (Axis-Shield) according to the manufacturer’s instructions. Isolated bone marrow and peripheral blood MNC cells underwent red blood cell lysis (Sigma) before staining. Cells were stained for 30 min at 4 °C in standard flow cytometry buffer with primary antibodies and, where indicated, with secondary antibodies. Information about the primary and secondary antibodies can be found in the antibody information (Supplementary Table 1). For antigens that required intracellular staining, cell surface staining was followed by cell fixation and permeabilization with the Cytofix/Cytoperm kit following the manufacturer’s instructions (BD Biosciences). In case of internal GFP labelled cells, cells were fixed for 20 min with 4% PFA at room temperature, washed and incubated at room temperature for 1 h in 30% sucrose. Cells were washed with flow cytometry buffer and further permeabilized. For intracellular ROS detection, cells were incubated for 10 min at 37 °C with 2 μM hydroethidine (Life Technologies). For glucose uptake detection, cells were incubated for 30 min at 37 °C with the glucose analogue 2-NBDG (Life Technologies). For detection of apoptotic cells, cells were resuspended in annexinV binding buffer (BioLegend) and stained with Pacific Blue AnnexinV (BioLegend). Bone marrow cells were enriched for the lineage negative population, prepared as indicated for flow cytometry and analysed using an ImageStreamX (Amnis) machine. Samples were visualized and analysed for the expression of markers and antigens with IDEAS 4.0 software (Amnis). Single-stained control cells were used to compensate fluorescence between channel images. Cells were gated for single cells with the area and aspect ratio features or, for focused cells, with the Gradient RMS feature. Cells were then gated for the selection of positively stained cells only with their pixel intensity, as set by the cutoff with IgG and secondary antibody control staining. At least 5 samples from 5 mice were analysed to confirm biological repeats of observed data. Detection of mouse calcitonin (Cusabio) and mouse PTH (Cloud-Clone Corp.) levels in bone marrow supernatants was performed according to the manufacturer’s instructions. CFU-GM and CFU-F assays were previously described34. For CFU-Ob assay (also known as mineralized nodule formation assay), CFU-F medium was supplemented with 50 μg ml−1 ascorbic acid and with 10 mM β-glycerophosphate. After 3 weeks, cultures were washed, fixed and stained using Alizarin red for mineralized matrix. The area of mineralized nodules per cultured well was quantified based on image analysis using ImageJ. Bone marrow cells were isolated after sterile bone flushing, crushing and digestion (as previously described). After washing, total bone marrow cells were incubated in medium supplemented with or without 25% blood plasma or supplemented with 20 ng ml−1 TGF-β1 (ProSpec) for 2 h. Plasma was isolated and collected from the upper fraction acquired from the peripheral blood after 5 min centrifugation at 1,500 r.p.m. Bone marrow vascular endothelial barrier function was assessed using the Evans Blue Dye (EBD) assay. Evans Blue (Sigma-Aldrich) 20 mg per kg was injected i.v. 4 h before mice were euthanized. In each experiment, a non-injected mouse was used for control blank measurements. Subsequently, mice were perfused with PBS via the left ventricle to remove intravascular dye. Femurs were removed and formamide was used for bone flushing, crushing and chopping. EBD was extracted in formamide by incubation and shaking of flushed and crushed fractions, overnight at 60 °C. After 30 min centrifugation at 2,000g, EBD in bone marrow supernatants was quantitated by dual-wavelength spectrophotometric analysis at 620 nm and 740 nm. This method corrects the specimen’s absorbance at 620 nm for the absorbance of contaminating haem pigments, using the following formula: corrected absorbance at 620 nm = actual absorbance at 620 nm – (1.426(absorbance at 740) + 0.03). Samples were normalized by subtracting control measurements. Levels of EBD bone marrow penetration per femur were expressed as OD /femur and the fold change in EBD bone marrow penetration was calculated by dividing the controls OD /femur from the treated OD /femur in each experiment. Finally, values were normalized per total protein extract as determined by Bradford assay per sample. For competitive LTR assay, B6.SJL (CD45.1) recipient mice were lethally irradiated (1,000 cGy from a caesium source) and injected 5 h later with 2 × 105 donor-derived (C57BL/6 background, CD45.2) bone marrow cells or with 500 μl of donor-derived whole blood together with 4 × 105 recipient derived (CD45.1) bone marrow cells. Recipient mice were euthanized 24 weeks after transplantation to determine chimaerism levels using flow cytometry analysis. For calculation of competitive repopulating units (CRU), recipient mice were transplanted with limiting dilutions of donor derived bone marrow cells (2.5 × 104 to 2 × 105) together with 2 × 105 recipient derived bone marrow cells. Mice were euthanized after 24 weeks and multi-lineage myelo-lymphoid donor derived contribution in the peripheral blood was assessed using flow cytometry analysis. HSC-CRU frequency and statistical significance was determined using ELDA software (http://bioinf.wehi.edu.au/software/elda/). Lineage negative cells were enriched from total bone marrow cells, taken from c-Kit-EGFP mice, using mouse lineage depletion kit (BD) according to the manufacturer’s instructions. Non-irradiated recipient mice were transplanted by i.v. injection with 2 × 106 c-Kit-EGFP-labelled Lin− cells. Recipient mice were euthanized 4 h after transplantation. Bone marrow cells were isolated from femurs and stained for flow cytometry as described above. Femur cellularity was determined in order to calculate the number of homed CD34−/LSK HSPC per femur. For magnetic isolation of BMECs, freshly recovered bones were processed under sterile conditions as described for BMECs flow cytometry analysis, and post-digestion incubated with biotin rat anti-mouse CD31 antibodies (BD pharmigen) for 30 min at 4 °C. Next, cells were washed and incubated with streptavidin particles plus (BD IMag) for 30 min at 4 °C. Positive selection was performed using BD IMagnet (BD) according to the manufacturer’s instructions (BD Biosciences). BD IMag buffer (BD) was used for washing and for antibodies dilution. Isolated cells were seeded on fibronectin (Sigma-Aldrich) coated wells and cultured overnight in EBM-2 medium (Lonza) supplemented with EGM-2 SingleQuots (Lonza) at 37 °C 5% CO . Non-adhesive cells were removed and adherent cells were collected using accutase (eBioscience). Flow cytometry was applied to confirm endothelial identity and >90% purity of recovered cells. BMEC were further processed to isolate RNA. Total RNA was isolated using TRI-Reagent (Sigma-Aldrich) according to the manufacturer’s protocol. An aliquot of 2 μg of total RNA was reverse-transcribed using Moloney murine leukaemia virus reverse transcriptase (Promega, Madison, WI) and oligo-dT primers (Promega). Quantitative reverse transcribed–polymerase chain reaction (qRT–PCR) was done using the ABI 7000 machine (Applied Biosystems, Foster City, CA) with SYBR Green PCR Master Mix (Applied Biosystems). Comparative quantization of transcripts was assessed relative to hypoxanthine phosphoribosyl transferase (Hprt) levels and amplified with appropriate primers. Primer sequences used were as follows (mouse genes): Cxcr4 forward 5′- ACGGCTGTAGAGCGAGTGTT-3′; reverse 5′- AGGGTTCCTTGTTGGAGTCA-3′; Fgfr1 forward 5′-CAACCGTGTGACCAAAGTGG-3′; reverse 5′-TCCGACAGGTCCTTCTCCG-3′; Fgfr2 forward 5′-ATCCCCCTGCGGAGACA-3′; reverse 5′-GAGGACAGACGCGTTGTTATCC-3′; Hprt forward 5′-GCAGTACAGCCCCAAAATGG-3′; reverse 5′-GGTCCTTTTCACCAGCAAGCT-3′. All statistical analyses were conducted with Prism 4.0c version or Excel (*P < 0.05, **P < 0.01, ***P < 0.005; NS, not significant). All data are expressed as mean ± standard error (s.e.m) and all n numbers represent biological repeats. Unless indicated otherwise in figure legends, a Student’s two-tailed unpaired t-test was used to determine the significance of the difference between means of two groups. One-way ANOVA or two-way ANOVA was used to compare means among three or more independent groups. Bonferroni post-hoc tests were used to compare all pairs of treatment groups when the overall P value was <0.05. A normal distribution of the data was tested using the Kolmogorov–Smirnov test if the sample size allowed. If normal-distribution or equal-variance assumptions were not valid, statistical significance was evaluated using the Mann–Whitney test and the Wilcoxon signed rank test. Animals were randomly assigned to treatment groups. Tested samples were assayed in a blinded fashion.

Loading Harlan Laboratories collaborators
Loading Harlan Laboratories collaborators