Entity

Time filter

Source Type

GCT
Coimbatore, India

Jayanthi J.,SCT | Rathi S.,GCT
Journal of Theoretical and Applied Information Technology | Year: 2014

Internet's foremost information retrieval service is the World Wide Web. It serves as a platform for retrieving variety of information that are associated with research, education, marketing, sports, games, politics, Finance, etc. The utter volume of information growth leads to the information overload on the Internet. Search engines are the collection of programs that facilitates information retrieval from the Internet. Even though the search engines do a good job of retrieving content from the Internet, users often feel disoriented about the result retrieved. Hence, no matter who the user of the search engine is, if the same query is provided as input to the search engine, the results returned will be exactly the same. The need to provide users with information tailored to their needs led to the development of various information personalization techniques. Personalization aims to provide users with what they need either by asking explicitly or implicitly. Web Personalization is conventionally defined as the process of tailoring web pages to satisfy the individual user needs by adapting different approaches. Several personalized web search models were developed based on web link structure, web contents, user queries, user profiles, browsing history etc. A Personalized Web Search has various levels of effectiveness for different users, queries, contexts etc. Personalized search has been a most important research area and many techniques have been developed and tested, still many issues and challenges are yet to be explored. This paper concentrates on the analysis, comparison and application of many personalized web search approaches that are being widely used today.Hence the motivation of this survey is directed towards to understand the web personalization processes, benefits, limitations and future trends. © 2005 - 2014 JATIT & LLS. All rights reserved. Source


News Article
Site: http://phys.org/biology-news/

Different people sometimes spell the same word differently - organisation versus organization, or analogue versus analog. In such words, despite the variation in the strings of letters, the meaning conveyed by the alternatives remains the same. Similarly, DNA codes carrying instructions for creating a protein can sometimes be 'spelt' differently, although they specify the exact same sequence information to create that protein. Until recently, most biologists believed that mutations that created such 'synonymous' DNA codes, had very weak effects on the evolution of organisms. However, a new study by an international team of scientists, including those from the National Centre for Biological Sciences (NCBS), Bangalore, shows that a different set of DNA codes specifying the same product can have major effects on the survival and evolution of living beings. The code of life - composed of triplet codons of the four DNA alphabets A, T, G and C - is quite redundant. For example, the amino acid Alanine, is specified by no less than four alternative triplet codes (GCT, GCC, GCA and GCG), or codons. This redundancy is at the root of what molecular biologists term 'synonymous mutations', where a change in the DNA sequence of a gene does not change the sequence of the protein it codes for. Mutations resulting in changes to protein sequences are expected to cause disruptions in function, and are hence likely to affect an organism's abilities or fitness. Contrary to this, synonymous mutations have been generally ignored in this context. Deepa Agashe at NCBS and her team of collaborators have reinforced a growing body of evidence that synonymous variants of a gene affect an organism's fitness. Moreover, they have now shown that single highly beneficial synonymous mutations can allow organisms to rapidly evolve and adapt to their environment. Working on the bacterium Methylobacterium extorquens, the group created several variants of a gene called fae. This gene codes for a metabolic enzyme essential for survival and growth in an environment where the only source of carbon comes from methanol or methylamine. Under such restrictive conditions, bacteria undergo strong selection for retaining the fae gene function. When grown in conditions where methanol was provided as the sole carbon source, all bacterial populations with the 'synonymous' fae gene variants performed poorly when compared to bacteria carrying the normal gene. However, when bacterial populations carrying these variants of fae were grown over a long period of time with methanol being the only carbon source - described as 'strong selection conditions', an interesting phenomenon was observed. Within 100 - 200 generations, these bacterial populations began to regain their fitness through additional mutations to the gene variants. Many of these mutations were again synonymous. Furthermore, these mutations occurred at single points within the gene, were highly beneficial, and they seemed to recur in multiple experiments. "What is surprising about our results is that the beneficial mutations we see are highly repeatable in specific gene variants - you can think of this process with an analogy to climbers - different climbers who start independently from the bottom of a hill are using the exact same strategy to reach the top!", says Deepa Agashe, the lead author of the publication detailing these findings. Studies like the one described here are critical in understanding the genetic basis of adaptation. Understanding adaptation, in turn, is the key to comprehending evolution and for predicting future dynamics of populations. For example, being able to forecast the development of antibiotic resistance through genetic mutations in a bacterial population would help in developing better drugs for diseases. Until now, synonymous mutations and gene variants were considered relatively unimportant for such studies on adaptation, due to a lack of information about their effects on organism fitness. This study reinforces the view that such synonymity can no longer be ignored as irrelevant in the processes of adaptation and evolution. Explore further: Unexpectedly small effects of mutations in bacteria bring new perspectives More information: Deepa Agashe et al. Large-effect beneficial synonymous mutations mediate rapid and parallel adaptation in a bacterium, Molecular Biology and Evolution (2016). DOI: 10.1093/molbev/msw035


News Article
Site: http://www.nature.com/nature/current_issue/

Mice were bred in specified-pathogen-free facilities at the University Hospital Zurich and Washington University, and housed in groups of 3–5, under a 12 h light/12 h dark cycle (from 7 a.m. to 7 p.m.) at 21 ± 1 °C, with sterilized chow food (Kliba No. 3431, Provimi Kliba) and water ad libitum. Animal care and experimental protocols were in accordance with the Swiss Animal Protection Law, and approved by the Veterinary Office of the Canton of Zurich (permits 123, 130/2008, 41/2012 and 90/2013). The following mice were used in the present study: C57BL/6J, PrnpZH1/ZH1 (ref. 3), co-isogenic C57BL/6J PrnpZH3/ZH3 and PrnpWT/WT control mice6 and Schwann cell-specifc DhhCre::Gpr126fl/fl mutants3, 4. Mice of both genders were used for experiments unless specified. Archival tissues from previous studies1, 6 were also analysed in the current study. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment except where stated. Sciatic nerves from postnatal day 2–5 were dissected using microsurgical techniques. Nerves were dissociated in serum-free DMEM supplemented with 0.05% collagenase IV (Worthington) for 1 h in the incubator. Sciatic nerves were mechanically dissociated using fire-polished Pasteur pipettes. Cells were filtered in a 40-μM cell strainer and washed in Schwann cell culture medium (DMEM, Pen-Strep, Glutamax, FBS 10%) by centrifugation at 300g for 10 min. Resuspended cells were plated on 3.5 cm Petri dishes previously coated with poly-l-lysine 0.01% (w/v) and laminin (1 mg/ml). Laminin (Cat. No: L2020; from Engelbreth-Holm-Swarm murine sarcoma basement membrane) and poly- l-lysine were obtained from Sigma-Aldrich. Full-length recombinant PrP (recPrP, residues 23–231) and globular domain (GD, residues 121–231) were purified as previously described21, 22, 23. The generation of the GST fusion FT-PrP expression vector (pGEX-KG FT-PrP) was described previously; a modified purification protocol was used24. The FT-PrP expression vector was transformed into BL21 (DE3) strain of Escherichia coli (Invitrogen). Bacteria were grown in Luria-Bertani medium to an OD of 0.6, and the expression of the fusion protein was induced with 0.5 mM isopropyl-1-thio-β-d-galactopyranoside (AppliChem). Cells were then grown for another 4 h at 37 °C and 100 rpm shaking. Cells were pelleted at 5,000g for 20 min at 4 °C (Sorvall centrifuge, DuPont). The pellet was resuspended on ice in lysis buffer (phosphate-buffered saline supplemented with complete protease inhibitors (EDTA-free, Roche), phenylmethyl sulfonyl fluoride (Sigma) and 150 μM lysozyme (Sigma)) and incubated on ice for 30 min. Triton-X 100 (1%), MgCl (10 mM) and DNase I (5 μg/ml, Roche) were added, and the lysate was incubated on ice for 30 min. The lysate was than centrifuged for 20 min at 10,000g at 4 °C. Glutathione sepharose beads were washed with PBS and incubated with the cell lysate for 1 h at 4 °C on a rotating device. Beads were packed into a column and washed with PBS until a stable baseline was reached as monitored by absorbance at A using an ÄKTAprime (GE healthcare). The fusion protein was cleaved on the beads with 5 U/ml Thrombin (GE Healthcare) for 1 h at room temperature under agitation. For thrombin removal, benzamidine sepharose beads were added and incubated for 1 h at 4 °C on a rotating wheel. Protein preparations were analysed by 12% NuPAGE gels followed by Coomassie- or silver-staining. To achieve a higher purity of the protein, we next applied the protein to a sulfopropyl (SP) sepharose column equilibrated with 50 mM Tris-HCl buffer, pH 8.5. Elution was performed with a linear NaCl gradient of 0–1,000 mM. Fractions containing the protein were collected and concentrated (AMICON; MWCO 3500). The protein was then injected in 500 μl portions into a size-exclusion chromatography system (TSK-GEL G2000SW column (Tosoh Bioscience)) and eluted with a linear gradient using PBS. Pure fractions were combined, concentrated and stored at −20 °C. The purity of FT-PrP was >95–98% as judged by a silver-stained 12% NuPAGE gel. SW10 cells and clones derived from them were all grown in DMEM medium supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin and Glutamax (all obtained from Invitrogen). HEK293T cells, its clonal variant HEK293(H) cells and clones derived therefrom overexpressing various GPCRs were grown in DMEM-F12 medium supplemented with 10% FCS, penicillin-streptomycin and Glutamax (all obtained from Invitrogen). All cell lines were regularly monitored for mycoplasma contamination. The authenticity of SW10 and its derivatives was established by monitoring the expression of Schwann-cell specific markers (Extended Data Fig. 6a). Human Gpr126 (NM_020455), Gpr124, Gpr64, Gpr56, Gpr133, Gpr56 and Gpr176 expression plasmids (pCGpr126-V5, pCGpr124-V5, pCGpr65-V5, pCGpr56-V5, pCGpr133-V5, pCGpr56-V5 and pCGpr176-V5) were generated by PCR amplification of the respective cDNA followed by TOPO cloning into the pCDNA3.1/V5-His-TOPO vector. The cDNA was in frame with the V5 tag (sequence: GKPIPNPLLGLDST) at the C terminus. HEKGPR126 and HEKGPR176 cells were generated by transfecting 1 μg of plasmid into one well of a subconfluent 6-well plate using 3 μl Fugene (Roche) according to the manufacturer’s protocol. Twenty-four hours after transfection, cells were transferred to a 10-cm dish and grown in selective medium containing 0.4 mg/ml G418 (Invitrogen) until emergence of resistant colonies. A limiting dilution was carried out to obtain clonal lines. Membrane expression of the transgene was assessed in the selected clones by confocal microscopy using 1:100 diluted anti-V5 antibody (Invitrogen) and the Cytofix/Cytoperm kit (Pharmingen Cat. Nr. 554714), according to the manufacturer’s protocol. Cerebellar granule neurons were generated from 7–8-day-old PrnpZH1/ZH1 mice as described previously25. Cultures were plated at 350,000 cells per cm2 in Basal Medium Eagle (BME) (Invitrogen) with 10% (v/v) FCS and maintained at 37 °C in 5% CO . pCDNA-PrPC was generated by cloning murine PrPC into pCDNA3.1 vector as described previously26. A site-specific mutagenesis kit (Stratagene) was used to induce alanine substitutions of QPSPG and KKRPK domains in PrPC. Primers used for generating the Ala-QPSPG plasmid were: forward, GTG GAA GCC GGT ATC CCG GGG CGG CAG CCG CTG CAG GCA ACC GTT ACC C; reverse, GGG TAA CGG TTG CCT GCA GCG GCT GCC GCC CCG GGA TAC CGG CTT CCA C. Primers for Ala-KKRPK were: forward, CTA TGT GGA CTG ATG TCG GCC TCT GCG CAG CGG CGC CAG CGC CTG GAG GGT GGA ACA CCG; reverse, CGG TGT TCC ACC CTC CAG GCG CTG GCG CCG CTG CGC AGA GGC CGA CAT CAG TCC ACA TAG. Transfections were performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. 3 μg of DNA was used per well of a 6-well plate. Cells were washed 24 h after transfection using PBS, and fresh medium was added to the cells. HEK293T and HEKGPR126 cells growing in T75 flasks at 50% density were treated with recombinant FT or GD (2 μM, 20 min). Cells were washed twice in PBS and lysed in IP buffer: 1% Triton X-100 in PBS, 1× protease inhibitors (Roche) and Phospho stop (Roche) for 20 min on ice followed by centrifugation at 5000 rpm for 5 min at 4 °C. BCA assays were performed to quantify the amount of protein, and 500 μg of protein was used for immunoprecipitations. 2 μg anti-V5 antibody was added to the cell lysate and incubated on a wheel rotator overnight at 4 °C. On the following day, Protein G dynabeads (Invitrogen) were added to the samples and incubated for a further 3 h on the wheel at 4 °C. Beads were washed three times for 5 min each using the IP buffer followed by addition of 2× sample buffer containing DTT (1 mM final). Samples were heated at 95 °C for 5 min, loaded on 4–12% Novex Bis-tris gels (Invitrogen), and migrated for 1.5 h at 150 V followed by western blotting. Immunoprecipitations were performed by adding 2 μg of POM2 antibody to 500 μl of cell medium and incubating overnight on a wheel rotator at 4 °C. Protein G beads were then added, and incubation on a wheel rotator at 4 °C was performed again. RNA extraction and quantitative PCR were performed as described previously1. The following primers were used: EGR2 forward: 5′-AATGGCTTGGGACTGACTTG-3′; EGR2 reverse: 5′-GCCAGAGAAACCTCCATT-3′; GAPDH forward: 5′-CCACCCCAGCAAGGAGAC-3′; GAPDH reverse: 5′-GAAATTGTGAGGGAGATGCT-3′. Adult zebrafish were maintained in the Washington University Zebrafish Consortium facility ( http://zebrafishfacility.wustl.edu/) and all experiments were performed in compliance with institutional protocols. Embryos were collected from harem matings or in vitro fertilization, raised at 28.5 °C, and staged according to standard protocols27. The gpr126st49 and gpr126st63 mutants were described previously7, 8. gpr126st63 or gpr126st49 mutants were collected from homozygous mutant crosses and wild-type larvae were collected from AB* strain crosses and raised to 50 hpf. FT treatment of gpr126 mutants was performed as previously described15. Briefly, egg water was replaced with either 20 μM FT in egg water or egg water containing an equivalent volume of DMSO. At 55 hpf, larvae were washed twice and raised in egg water to 5 dpf. Wild-type and gpr126 larvae were fixed in 2% paraformaldehyde plus 1% tricholoroacetic acid in phosphate buffered saline, and Mbp and acetylated tubulin immunostaining was performed as described previously8, 28. Expression scoring was performed with observers blinded to treatment according to the following rubric: strong, strong and consistent expression throughout PLLn; some, weak but consistent expression in PLLn; weak, weak and patchy expression in PLLn; none, no expression in PLLn. n = three independent replicate gpr126st63 assays and one gpr126st49 assay. n = 87 DMSO-treated gpr126st63 larvae, 81 Prp-FT-treated gpr126st63 larvae, 27 DMSO-treated gpr126st49 larvae, 25 Prp-FT-treated gpr126st49 larvae. Fluorescent nerve images were analysed using the Fiji software29. A rectangular region-of-interest (ROI) was drawn longitudinally over the fluorescent nerve. The longitudinal grey-scale histogram of the myelin basic protein (Mbp) was normalized pixel-by-pixel to the corresponding intensity of the acetylated tubulin (AcTub). The size of the measured ROIs was kept constant across different treatment modalities. SW10 cells were grown in P75 flasks at 50% density, rinsed with PBS, and detached from culture flasks with dissociation buffer containing EDTA (GIBCO). After detaching, cells were washed to remove residual EDTA and counted using a Neubauer chamber. Batches of 105 SW10 cells were transferred to FACS tubes, treated with HA-tagged recombinant peptides for 20 min, washed, and incubated with Alexa-488 conjugated anti-HA antibody for 30 min. After further washes and centrifugations, cells were resuspended in 200 μl FACS buffer (PBS +10% FBS) and analysed with a FACS Canto II cytofluorimeter (BD Biosciences). Data were analysed using FloJo software. Schwann cells were lysed in cell-lysis buffer (Tris-HCl 20 mM, NaCl 137 mM, Triton-X-100 1%) supplemented with protease inhibitor cocktail (Roche complete mini). The lysate was homogenized by passing several times through a 26G syringe, and cleared by centrifugation at 8,000g, 4 °C for 2 min. in a tabletop centrifuge (Eppendorf 5415R). Protein concentration was measured with the BCA assay (Thermo Scientific). 10 μg total protein was boiled in 4 × LDS (Invitrogen) at 95 °C for 5 min. After a short centrifugation, samples were loaded on a gradient of 4–12% Novex Bis-Tris Gel (Invitrogen) for electrophoresis at constant voltage of 200 V. Gels were transferred to PVDF membranes with the iBlot system (Life technologies). Membranes were blocked with 5% Top-Block (Sigma) in PBS-T for 1h at room temperature. Primary antibody was incubated overnight in PBS-T with 5% Top-Block. Membranes were washed three times with PBS-T for 10 min and incubated for 1 h with secondary antibodies coupled to horseradish peroxidase at room temperature. After three washes with PBS-T, the membranes were developed with a Crescendo chemiluminescence substrate system (Millipore). Signals were detected using a Stella 3200 imaging system (Raytest). Monoclonal antibodies against PrPC were obtained and used as described previously4. Fab3 and Fab71 antibodies were generated using the phage display technology and their epitopes were mapped with overlapping peptides. Anti AKT, p-AKT were obtained from Cell signaling and used at 1:2,000 dilutions for western blotting. The anti-p75NGF receptor antibody was obtained from Abcam and used at a 1:200 dilution for immunofluorescence. Anti V5 antibody was from Invitrogen and used at a dilution of 1:500 for western blot and 2 μg antibody was used for immunoprecipitation on 500 μg of cell lysate. In the direct cAMP ELISA assay, cAMP levels were assessed with a colorimetric competitive immunoassay (Enzo Life Sciences). Quantitative determination of intracellular cAMP was performed in cells or tissues lysed in 0.1 M HCl to stop endogenous phosphodiesterase activity and to stabilize the released cAMP. SW10 or HEK293T cells (100,000 cells per well) were plated in 6-well plates to ~50% density. Cells were treated with conditioned medium or recombinant peptides (2 μM, unless specified) for 20 min unless otherwise mentioned. Cells were lysed with 0.1 M HCl lysis buffer (Direct cAMP ELISA kit, Enzo). To ensure complete detachment of cells, cell scrapers were used. Lysates were homogenized with a 26G needle and syringe before clearing by centrifugation at 600g for 10 min. The subsequent steps were performed according to the manufacturer’s protocol based on competition of sample cAMP with a cAMP-alkaline phosphatase conjugate. To measure in vivo cAMP changes, BL6, PrnpZH3/ZH3 or PrnpZH1/ZH1 mice were intravenously injected with 600 μg of either FT or, as a control, uncharged FT ( ). Twenty minutes after infusion, mice were killed and all organs were collected. For cAMP assays, organs were homogenized in 0.1 M HCl. Subsequent steps were performed according to the manufacturer’s protocols as described above. Cyclic AMP levels were calculated using a cAMP standard curve in the case of ELISA based assay. Finally, cAMP concentrations were normalized to total protein content in each sample. cAMP changes are represented as fold changes to the respective controls. For each experiment, at least three independent biological replicates were used. For in vivo assays, groups of 8–16 mice were used for each experiment. For normalization purposes, the median value of the respective control sample was defined as 1. All measurements within each panel were normalized to this control value. For in vivo assays, sample sets were coded and investigators were blinded to their identities. The assignment of codes to sample identities was performed only after the cAMP values were plotted for each set. We designed two CRISPR short-guide RNA (sgRNAs) against exon 2 of Gpr126 (upper Guide CCTGTGTTCCTCTCTCAGGT and lower Guide AACAGGAACAGCAGGGCGCT). The DNA sequences corresponding to the sgRNAs were cloned into expression plasmids and transfected with EGFP-expressing Cas9-nickase plasmids. Single EGFP-expressing Schwann cells were isolated with a FACS sorter (Aria III). To determine the exact sequence of indels induced by genome editing, we amplified the sgRNA-targeted locus by PCR and subcloned the fragments into blunt-TOPO vectors. Ten colonies per cell line were sequenced and showed distinct indels on each allele. A clonal subline devoid of Gpr126 was used for further studies. This cell line possessed insertions on both the alleles; a 49-bp insertion at position 118 and a 5-bp insertion at position 84 on each allele. Both insertions led to a frameshift and to the generation of premature stop codons leading to early translation termination. Luciferase reporter constructs were generated containing a 1.3-kB sequence upstream of the transcription-starting site of Egr2. SW10 Schwann cells were transfected with Egr2 reporter construct and a renilla plasmid using lipofectamine 2000. After one day in vitro, Schwann cells were treated with recombinant full-length PrP (23–231), the globular domain of PrP (121–231) or PBS control. Luciferase activity was measured 24 h after stimulation with Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s recommendations. Results were normalized to renilla transfection controls. Glass coverslips were placed in 12-well plates (Thermo Scientific) and coated with 0.01% w/v Poly-l-lysine solution (Sigma) overnight at room temperature. Coverslips were washed three times with ddH O and dried for 2 h in a laminar-flow hood. Schwann cells were seeded and cultured at 50% density. Cells were treated with recombinant FT-PrP, full length recPrP or C1-PrP for 20 min, and washed with serum-free DMEM. Cells were further washed with PBS followed by fixation with 4% paraformaldehyde. Fixed cells were incubated in blocking buffer (PBS+10% FBS) for 1 h. Cells were treated with various primary antibodies followed by washes and incubation with Alexa 488 and Alexa 647 tagged rabbit or mouse secondary antibodies (Life Technologies). Imaging was performed by Leica SP2 confocal microscope using a 20× objective; images were processed by Image J software. Transmission electron microscopy was performed as previously described6. Briefly, mice under deep anaesthesia were subjected to transcardial perfusion with PBS heparin and sciatic nerves were fixed in situ with 2.5% glutaraldehyde plus 2% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 and embedded in Epon. Ultrathin sections were mounted on copper grids coated with Formvar membrane and contrasted with uranyl acetate/lead citrate. Micrographs were acquired using a Hitachi H-7650 electron microscope (Hitachi High-Tech, Japan) operating at 80 kV. Brightness and contrast were adjusted using Photoshop. For quantification of Remak bundles and onion bulb-like structures, images were captured at 1,500× magnification and axon numbers and abnormal onion bulb-like structures were counted manually. Quantification was performed in a blinded fashion by assigning numbers to the images and upon completion of quantification genotypes were revealed. HA-tagged and untagged synthetic peptides were produced by EZ Biosciences. A stock solution of 2 mM was prepared by dissolving the peptides in PBS and they were used at a final concentration of 2 μM unless specified. The sequences of all the peptides used in this study can be found in Extended Data Table 1.


News Article
Site: http://phys.org/space-news/

In the two weeks leading up to the GCT prototype inauguration event on 1 December, the GCT team battled poor weather to install and begin testing the GCT camera. On the evening of Thursday, 26 November, they turned the telescope away from a nearly full moon and the bright lights of Paris towards a clear patch of sky. After 20 seconds, a single event triggered the camera, then another – in just over 300 seconds 12 events were captured. These triggers could have been caused by fluctuations in the bright night sky, but it was instantly clear that they were, in fact, what the team was looking for – images of air showers created in the atmosphere by cosmic rays. The image captured by the team shows the maximum amount of light captured in each of the camera's 2048 pixels over 100 frames. CTA astronomers will use images like this to determine the incoming direction and energy of the particle that created the air shower. "With the tough weather conditions, we only had about an hour-long window to gather as much data as we could," said GCT Camera Coordinator Dr. Richard White. "We look forward to clearer, darker skies so we can test the camera's performance in more ideal conditions." "This is a major milestone for the GCT and we hope for CTA." said GCT Spokesperson Prof. Tim Greenshaw. "Our design for the CTA telescopes that will detect the highest energy light hitting the earth's atmosphere from space has been proven to work; we are one step closer to developing a deeper understanding of where and how that light is produced." Hélène Sol, Research Director at Centre National de la Recherche Scientifique (CNRS) and GCT Deputy Spokesperson added: "I would like to congratulate all the GCT team who have made this possible, especially the group who worked day and night over the last couple of weeks to get these pictures." In order to detect the short flashes of light produced by cosmic rays and gamma rays as they hit the earth's atmosphere, the telescope's camera has to be about a million times faster than a DSLR camera. To do this, it uses high-speed digitisation and triggering technology capable of recording images at a rate of one billion frames per second and sensitive enough to resolve single photons. These first pictures are just the beginning for the GCT. The prototype telescope and camera will undergo rigorous testing over the next year, then the team intends to build 35 cameras and telescopes for the CTA Observatory based on the results of the testing process. "We're extremely pleased with the progress and performance of the GCT prototype and all of the CTA prototypes," said CTA Project Manager Christopher Townsley. "We look forward to seeing the results of further testing as we near the construction phase of the project." CTA is a global initiative to build the world's largest and most sensitive high-energy gamma-ray observatory. Over 1,000 scientists and engineers from 32 countries and over 170 research institutes participate in the CTA project. CTA will serve as an open observatory to a wide physics and astrophysics community and provide a deep insight into the non-thermal, turbulent, high-energy universe. The CTA observatory will detect high-energy radiation with unprecedented accuracy and approximately 10 times the sensitivity of current instruments, providing novel insights into some of the most extreme and violent events in the universe. Read more about CTA's expected performance. At least three telescope types are required to cover the full CTA energy range. The sensitivity in the core energy range between 100 GeV and 10 TeV will be dominated by up to 40 Medium-Size Telescopes (MSTs) distributed over both array sites in the northern and southern hemispheres. Four Large-Size Telescopes (LSTs) and around 70 SSTs will be essential to extend the energy range below 100 GeV and above a few TeV. The GCT adds to the current complement of CTA prototypes located around the world: the SST-1M (Krakow, Poland), SST-2M ASTRI (Serra la Nave, Italy), MST (Zeuthen, Germany) and the LST (La Palma, Spain). Explore further: Lung scintigraphy more reliable than CTA in excluding pulmonary embolism in pregnant patients


Devi K.I.,Coimbatore Institute of Technology | Shanmugalakshmi R.,GCT
European Journal of Scientific Research | Year: 2011

The increase in image transmission increased throughout the world. Therefore, the size of image plays an important role in order to transmit the image in lesser time and with the allotted bandwidth. This leads to the requirement of better technique for reducing the image size. This can be achieved by using the image compression technique which focuses to remove the redundancy occurs in the image in a way that it should not affect the image reconstruction. There are various researches suggests their own image compression technique to satisfy the needs. All technique has its own advantages and disadvantages. This paper focuses on using the Principal Component Analysis (PCA) technique which is well known for its better ability for dimensionality reduction. To deal with the problem of large covariance matrix in PCA, 2-Dimensional (2DPCA) is used in this paper. 2DPCA directly calculates the eigenvectors of the covariance matrix without matrix-to-vector conversion. This image compression technique is built using VLSI architecture. The simulation result shows that the proposed technique results. © EuroJournals Publishing, Inc. 2011. Source

Discover hidden collaborations