GCT
Coimbatore, India
GCT
Coimbatore, India

Time filter

Source Type

News Article | May 8, 2017
Site: www.marketwired.com

DELTA, BC--(Marketwired - May 08, 2017) - On Friday, GCT Canada welcomed the largest container vessel to call the country at GCT Deltaport, located in the Port of Vancouver. The Hapag-Lloyd 13,200 TEU "Antwerpen Express" has been deployed as part of THE Alliance's Transpacific mainline West Coast PN3 service. The Hamburg class vessel is the first of a progressive ship upsizing for the service. Not only will this new fleet of vessels offer more slots for importers and exporters to grow in the market, but it will do so with an improved environmental footprint. GCT Deltaport hosts the largest ships to call the Port of Vancouver. The facility has recently completed major construction on its $280 million Intermodal Yard Reconfiguration project that increases rail capacity by over 50% within the existing footprint, enabling even better handling of big ship surge volumes. GCT Deltaport is the Antwerpen Express's first-port-of-call directly from the Far East (Hong Kong-Yantian-Ningbo-Shanghai-Pusan-Vancouver). "Our dedicated PN3 shuttle service is a competitive East West product with short transit times," stated Wolfgang Schoch, Senior Vice President of Hapag-Lloyd (Canada). "Working together with our supply chain partners, through this facility our cargo reaches more than 20 destinations across Canada and the US Midwest." Collaboration amongst CN, Canadian Pacific (CP), and GCT Canada has improved rail transit times. "CP is proud of its relationship with GCT Canada and Hapag-Lloyd, and looks forward to unlocking future international intermodal growth as a result of the improvements at GCT Deltaport," said John Brooks, CP's Senior Vice-President and Chief Marketing Officer. "CP's customers enjoy the fastest service from Vancouver to Minneapolis, Chicago and beyond and in close collaboration with our supply chain partners, we will continue to leverage our competitive advantage." "CN's vast network connects the Canadian West Coast Gateway to the largest number of destinations across Canada and the United States and is big ship and big alliance ready," said JJ Ruest, Executive Vice President and Chief Marketing Officer at CN. "We welcome THE Alliance's new import service to Vancouver. Our service level agreements with ports and partners across North America have created the fastest and most reliable supply chain from Asia to our customers' front doors. We provide truck and rail options to efficiently move freight from the port and GCT facilities to final destinations from Toronto to Detroit to Chicago to Memphis and beyond." "GCT Deltaport is purpose-built to handle rail cargo seamlessly," said Eric Waltz, President of GCT Canada. "With the terminal's process innovation, efficient equipment and design, beneficial cargo owners calling GCT Deltaport will experience the lowest rail dwells in the industry." To learn about the GCT Deltaport project, visit www.globalterminalscanada.com/#c3. About GCT Global Container Terminals Inc. Headquartered in Vancouver, BC, GCT Global Container Terminals Inc. operates four Green Marine certified terminals in two principal North American ports. Through GCT USA on the East Coast, the company operates two award-winning facilities: GCT New York on Staten Island, NY and GCT Bayonne in Bayonne, NJ. On the West Coast, GCT Canada operates two gateway terminals: GCT Vanterm and GCT Deltaport in Vancouver and Delta, BC. Visit www.globalterminals.com or follow us @BigShipReady to find out more about GCT. About Hapag-Lloyd With a fleet of 166 modern container ships and a total transport capacity of 963,000 TEU, Hapag-Lloyd is one of the world's leading liner shipping companies. The Company has around 9,400 employees at 366 sites in 121 countries. Hapag-Lloyd has a container capacity of 1.6 million TEU -- including one of the largest and most modern fleets of reefer containers. A total of 128 liner services worldwide ensure fast, reliable connections between all the continents. Hapag-Lloyd is one of the leading operators in the Transatlantic, Latin America and Intra-America trades. About CN Rail CN is a true backbone of the economy that transports more than C$250 billion worth of goods annually for a wide range of business sectors, ranging from resource products to manufactured products to consumer goods, across a rail network of approximately 20,000 route-miles spanning Canada and mid-America. CN -- Canadian National Railway Company, along with its operating railway subsidiaries -- serves the cities and ports of Vancouver, Prince Rupert, B.C., Montreal, Halifax, New Orleans, and Mobile, Ala., and the metropolitan areas of Toronto, Edmonton, Winnipeg, Calgary, Chicago, Memphis, Detroit, Duluth, Minn./Superior, Wis., and Jackson, Miss., with connections to all points in North America. For more information about CN, visit the Company's website at www.cn.ca. About Canadian Pacific Canadian Pacific (TSX: CP)( : CP) is a transcontinental railway in Canada and the United States with direct links to eight major ports, including Vancouver and Montreal, providing North American customers a competitive rail service with access to key markets in every corner of the globe. CP is growing with its customers, offering a suite of freight transportation services, logistics solutions and supply chain expertise. Visit www.cpr.ca to see the rail advantages of Canadian Pacific.


News Article | November 11, 2016
Site: www.marketwired.com

VANCOUVER, BRITISH COLUMBIA--(Marketwired - Nov. 10, 2016) - GVIC Communications Corp. ("GVIC" or the "Company")(TSX:GCT) reported cash flow, earnings and revenue for the period ended September 30, 2016. The following results are presented on an adjusted basis(1)to include the Company's share of its joint venture operations on a proportionate basis, because this is the basis on which management bases its operating decisions and performance. For a reconciliation to the results in accordance with International Financial Reporting Standards (IFRS), refer to the "Reconciliation of IFRS to Adjusted Results" as presented below and in Management's Discussion & Analysis (MD&A). GVIC Communications Corp. ("GVIC" or the "Company") generated strong profit growth in the third quarter. Adjusted consolidated EBITDA(1) increased 35.2% to $7.8 million for the three-months ended September 30, 2016 compared to $5.8 million for the same period in the prior year. EBITDA growth occurred across a wide variety of the Company's divisions. For the nine-months ended September 30, 2016, the Company's EBITDA was 4.3% higher than the same period in 2015. Adjusted consolidated revenue(1) was $58.4 million for the three-month period ended September 30, 2016 compared to $59.7 million for the same period in the prior year. The 2.2% revenue decline was primarily due to the closing of the Printwest printing plant closure and consolidation. On a same-store basis, the Company's revenues were essentially flat year over year. The improved revenue performance versus prior quarters was driven by strong revenue increases from ERIS, STP, Fundata, REW.ca and agricultural information, as well as a reduction in the rate of community media revenue declines. Both of the Company's business information and community media segments posted EBITDA increases in the quarter. Business information EBITDA growth was generated by a variety of businesses, including agricultural information, STP, REW.ca and Inceptus. The energy and mining information businesses continue to be affected by weak energy and commodities markets. Community media continues to benefit from the 2015 and year-to-date restructuring efforts. On an adjusted basis(1), including the Company's share of its joint venture interests, GVIC's consolidated debt net of cash outstanding before deferred financing charges was 2.7x trailing 12-months EBITDA as at September 30, 2016. (1) For a reconciliation of adjusted results to results in accordance with International Financial Reporting Standards ("IFRS"), refer to the "Reconciliation of IFRS to Adjusted Results" as presented in the Company's Management Discussion & Analysis. Business information's adjusted consolidated revenue(1) increased 5.4% to $24.4 million for the three-months ended September 30, 2016 compared to $23.1 million for the same period in the prior year, despite declines in energy and mining advertising revenue. Business information's adjusted consolidated EBITDA(1) increased to $4.3 million for the three-months ended September 30, 2016 compared to $4.2 million for the same period in the prior year. Conditions in the agricultural sector remain soft with low commodity prices and increasing industry consolidation. Despite this, FarmMedia ("GFM") had strong revenue and profit growth during the quarter. In July, GFM held its second annual Ag In Motion outdoor farm demonstration show held in Saskatchewan. The show experienced significant increases in both the number of exhibitors and attendance which resulted in significant increases in both revenue and profit. In September, GFM held its annual Canada's Outdoor Farm Show in Woodstock, Ontario. COFS continues to have consistent and growing results despite the soft agricultural sector. During the quarter, Weather INnovations Consulting ("WIN") commenced deployment of a UK-based weather network for the Food and Environment Research Agency, a U.K. crown corporation. The near-term outlook for the energy sector remains uncertain. Conditions at JuneWarren Nickle's Energy Group ("JWN") continue to be adversely impacted by market conditions. In order to mitigate reduced advertising revenues, JWN has pursued alternative revenue initiatives such as research contracts. In the quarter, the group announced a research partnership with the Petroleum Services Association of Canada and the Canadian Global Exploration Forum to help Canadian oil and gas companies seize opportunities to expand in export markets. The study is funded by the Government of Alberta, Export Development Canada and BDC. Electronic information subscription and database revenue have continued to hold up relatively well during the downturn, and have been aided by the increased demand for information on distressed energy assets and companies. JWN has implemented and continues to implement substantial cost reductions to help mitigate the impact of reduced revenue levels during the downturn. The mining sector continues to be impacted by weak market conditions, although some signs of improvement are beginning to emerge. The Company's mining information operations had another challenging quarter, performance was better than the first six months of 2016. Slightly improved performance is expected in the fourth quarter. Environmental Risk Information Services ("ERIS") continues to experience solid revenue growth, adding a number of new customers during the quarter. Operating investments continue to be made to allow ERIS to scale to the next revenue tier and maintain strong product quality. The tangible benefits of these investments expect to be realized over the coming quarters. STP's revenues and profit grew during the quarter as a result of continued growth in sales through Environmental Management Information Systems ("EMIS"). In October, STP was recognized as the "Emerging Content Partner of the Year" for 2016 by one of the leading EMIS providers, Enablon. The award was presented at the annual Enablon SPF conference in Chicago, attended by senior compliance and risk-management personnel from large multinational corporations. REW.ca, the Company's online real estate portal, continued to grow rapidly with increased traffic and features. During the quarter the site added "Building Pages", a comprehensive information (strata, floor plans, construction details, amenities) on over 8,000 multi-unit residential buildings throughout British Columbia. Revenues continue to scale more than doubling versus the same period in the prior year. Fundata Canada Inc. ("Fundata") continues to experience increases in revenue and invest in new products and offerings. Fundata added additional customers in the quarter for its new Point of Sales offering. Community media's adjusted consolidated revenue(1)decreased to $34.0 million for the three-months ended September 30, 2016 from $36.6 million for the same period in the prior year. A portion of this revenue decline was due to planned closures and restructurings. Revenue declines within community media were driven by a combination of the maturing nature of print advertising and the impact of continued weak commodity prices in many Western Canadian communities. Digital community media revenues grew substantially for the quarter as compared to the same period last year. The total rate of revenue decline was lower than in recent quarters. EBITDA increased in the quarter as a result of the continued realization of savings from the restructurings implemented throughout 2015 and 2016. In many cases, the changes have resulted in improved products for both readers and advertisers as fewer but more substantial editions are published. The following table is a reconciliation of the IFRS results to the adjusted results (which include the Company's proportionate share of its joint venture operations). Refer to the MD&A for further discussion and analysis of these results: The qualitative discussion of the third quarter 2016 results in this Press Release is relevant and applicable for the adjusted results and the IFRS results. Near-term uncertainty and market risk continues, especially given the ongoing impact of weak energy and commodity market conditions on the Western Canadian economy. Elements of both of the Company's segments, business information and community media, will continue to be impacted. The Company remains confident in the long-term outlook for the energy and mining information sectors. The Company continues to invest in its businesses that offer, and are demonstrating, real growth. These include ERIS, REW.ca, STP, Fundata, WIN and agricultural exhibitions and information. The Company also continues to improve the value of its database and intelligence offerings in energy and mining, which have generated positive responses given the demand for this information from investors and others seeking information in distressed markets. Within community media, cost savings initiatives from substantial restructurings, implemented throughout 2015 and 2016, will continue to benefit the bottom line. As importantly, many of these restructurings strengthened the businesses by creating more efficient operations with improved offerings for both readers and advertisers. Shares in GVIC are traded on the Toronto Stock Exchange under the symbol GCT. About the Company: GVIC Communications Corp. ("GVIC" or the "Company") is an information & marketing solutions company pursuing growth in sectors where the provision of essential information and related services provides high customer utility and value. GVIC's strategy is implemented through two operational areas: content and marketing solutions; and data, analytics and intelligence. To supplement the consolidated financial statements presented in accordance with International Financial Reporting Standards (IFRS), GVIC uses certain non-IFRS measures that may be different from the performance measures used by other companies. These non-IFRS measures include cash flow from operations (before changes in non-cash operating accounts and non- recurring items), net income attributable to common shareholders before non-recurring items, net income from continuing operation attributable to common shareholders before non-recurring items, earnings before interest, taxes, depreciation and amortization (EBITDA) and all 'adjusted' measures which are not alternatives to IFRS financial measures. Management focuses on operating cash flow per share as the primary measure of operating profitability, free cash flow and value. EBITDA per share is also an important measure as the Company has low ongoing capital expenditures and depreciation and amortization largely relates to acquisition goodwill and copyrights and does not represent a corresponding sustaining capital expense. These non-IFRS measures do not have any standardized meanings prescribed by IFRS and accordingly they are unlikely to be comparable to similar measures presented by other issuers. The adjusted consolidated financial results have been adjusted to include the Company's share of revenue, expenses, assets and liabilities from its joint venture operations on a proportionate accounting basis as this is the basis on which management bases its operating decisions and performance evaluation. IFRS does not allow for the inclusion of the joint ventures on a proportionate basis. These results include additional non-IFRS measures such as EBITDA, cash flow from operations and net income attributable to common shareholders before non-recurring items. The adjusted results are not generally accepted measures of financial performance under IFRS. The Company's method of calculating these financial performance measures may differ from other companies and accordingly, they may not be comparable to measures used by other companies. Refer to the MD&A for a reconciliation of these non-IFRS measures and adjusted results. This news release contains forward-looking statements that relate to, among other things, the Company's objectives, goals, strategies, intentions, plans, beliefs, expectations and estimates. These forward-looking statements include, among other things, statements relating to our expectations regarding revenues, expenses, cash flows, future profitability and the effect of our strategic initiatives and restructuring, including our expectations to grow our business information operations, to generate new revenues, to implement cost reduction measures, to launch new information products, to generate new business acquisitions, to improve profitability, to generate sufficient cash flow from operations to meet anticipated working capital, capital expenditures, and debt service requirements and to reduce debt levels. These forward-looking statements are based on certain assumptions, including continued economic growth and recovery and the realization of cost savings in a timely manner and in the expected amounts, which are subject to risks, uncertainties and other factors which may cause results, performance or achievements of the Company to be materially different from any future results, performance or achievements expressed or implied by such forward-looking statements, and undue reliance should not be placed on such statements. Important factors that could cause actual results to differ materially from these expectations include failure to implement or achieve the intended results from our strategic initiatives, the failure to implement or realize cost savings in a timely manner or in the expected amounts, the failure to identify, negotiate and complete the acquisition of new businesses, the failure to develop or launch new products and the other risk factors listed in our Annual Information Form under the heading "Risk Factors" and in our annual MD&A under the heading "Business Environment and Risks", many of which are out of our control. These other risk factors include, but are not limited to, the ability of the Company to sell advertising and subscriptions related to its publications, foreign exchange rate fluctuations, the seasonal and cyclical nature of the agricultural and energy industry, discontinuation of the Department of Canadian Heritage's Canada Periodical Fund's Aid to Publishers, general market conditions in both Canada and the United States, changes in the prices of purchased supplies including newsprint, the effects of competition in the Company's markets, dependence on key personnel, integration of newly acquired businesses, technological changes, tax risk, financing risk and debt service risk. The forward-looking statements made in this news release relate only to events or information as of the date on which the statements are made. Except as required by law, the Company undertakes no obligation to update or revise publicly any forward-looking statements, whether as a result of new information, future events or otherwise, after the date on which the statements are made or to reflect the occurrence of unanticipated events.


News Article | November 30, 2016
Site: www.nature.com

GCTs arise from germ cells, which can be found in the gonads (testicles and ovaries), mediastinum, pituitary and retroperitoneum, and progress from precursor lesions (germ-cell neoplasia in situ; GCNIS)1, 2, 10. Histologically, GCTs are classified as seminoma or non-seminoma. The latter may consist of one histology or be mixed non-seminoma. Clinically, most GCTs are exceptionally chemosensitive; combination cisplatin- and etoposide-based chemotherapy cures more than 80% of GCT patients with metastatic disease3. However, approximately 10% of patients with metastatic GCTs will die as a result of chemoresistant disease. Leveraging preclinical models, several mechanisms have been proposed for GCT oncogenesis and chemosensitivity, including DNA repair deficiencies, embryonic stem (ES) cell-like cell cycle properties, or high apoptotic propensity11, 12, 13. Germline genome wide association studies have identified several risk loci for GCT, most notably in KITLG14, 15. For GCTs, karyotyping demonstrated marked aneuploidy6, targeted sequencing identified rare KRAS hotspot mutations16, and whole-exome sequencing (WES) confirmed nearly universal arm-level chromosome arm 12p gain4, low mutation rates, and activating KIT mutations specific to seminomas5. However, genomic features in GCTs that contribute to the origins, chemosensitivity phenotype, and progression remain incompletely characterized. Comparison of serial treatment-responsive and refractory tumours has informed genomic progression in other cancers17, 18. We proposed that genomic evolutionary analysis of clinical GCTs from patients who respond and become resistant to chemotherapy would identify features underlying disease progression and chemotherapy response phenotype. We performed clinically integrated molecular analysis of 59 tumours samples (with matched germ line) from 47 patients with TGCTs and two patients with primary mediastinal GCTs (PMGCTs) to identify genomic features associated with disease origin and progression. The aggregate cohort features are summarized in Fig. 1a and Supplementary Tables 1, 2. The median mutational load in our cohort was 0.9 mutations Mb−1 (Supplementary Table 1). Mutational significance analysis19 identified KRAS as the most statistically significant altered gene in this cohort (Fig. 1a, b, Supplementary Table 3). The only other significantly mutated gene was RPL5, a ribosomal protein previously implicated in other cancer types19 (Fig. 1b). RPL5 may regulate the MDM2–TP53 axis20 but was mutated infrequently and is of unknown biological relevance in GCTs. KIT mutations were not observed in our cohort despite sufficient genomic power to detect mutations (KIT hotspot loci mean coverage: 316×; range: 89–800×), although meta-analysis of our cohort with a separate TGCT WES set5 confirms KIT as significantly mutated (Extended Data Fig. 1a). Expanded investigation for clinically or biologically relevant alterations identified singleton mutations in DNA repair or sex determination pathway gene sets (see Supplementary Table 4 for all somatic mutations), although these were rare and of unclear significance. Because KRAS emerged as the primary significantly mutated gene, we next sought to explore the point of KRAS mutation emergence in the context of TGCT progression. We performed phylogenetic analysis of WES from patient-matched GCNIS tumours (pre-invasive) and primary TGCT tumours (Methods). In one representative case, both samples contained chromosome arm 12p gain; however, the only somatic putative driver mutation distinguishing the two samples was a KRASG12A mutation in the TGCT (0 out of 377 reads in GCNIS, 65 out of 340 reads in TGCT) (Fig. 1c, Extended Data Fig. 2a). A similar pattern of KRAS mutation exclusive to the TGCT and not in the patient-matched GCNIS was also seen in a second patient (0 out of 210 reads in GCNIS, 35 out of 184 reads in TGCT) (Fig. 1d, Extended Data Fig. 2b). Although not required for progression, activating KRAS mutations may occur after arm level gain of chromosome 12p, thereby indicating that these are two separate processes involved in TGCT evolution. While GCTs had low point mutation rates, nearly all tumours contained arm level gain of chromosome arm 12p, as previously described5. Given previous reports of aneuploidy in GCTs6, 21, we performed allelic and absolute copy number analysis through allele deconstruction22, 23 to determine whether there were specific copy number patterns in GCTs not been previously identifiable or reported (Methods). In a representative case (DFCI_7; Fig. 2a), coverage-based copy number analysis identified 12p gain, but only allelic copy number analysis revealed frequent arm and chromosome level gains of one parental allele with simultaneous loss of the other parental allele, leading to loss of heterozygosity (LOH). These reciprocal LOH (RLOH) events often maintained the germline number of DNA copies (copy-neutral LOH), but also frequently have further amplification of the remaining parental allele. For example, in DFCI_7 chromosome 4 has undergone copy-neutral LOH, whereas chromosome 3q contains a LOH event in which the total copy number is three. Across the GCT cohort, the mean number of chromosomal arm level amplifications was 28.3 ± 7.5 (mean ± s.d.), which is significantly increased compared to 6,509 tumours representing 19 other cancer types (P < 0.0001; Mann–Whitney) (Fig. 2b, Extended Data Fig. 3 and Supplementary Tables 5, 6). Approximately 45% of arm level deletions contained a compensatory reciprocal amplification in GCTs, again sharply increased compared to other tumour types (P < 0.0001; Mann–Whitney) (Fig. 2c). To validate this RLOH pattern, we performed the same analysis on a separate primary TGCT fresh-frozen WES cohort (ICR GCT)5 and observed similar frequencies of reciprocal copy number alterations (Fig. 2b, c, Extended Data Fig. 1b–d). Given the prevalence of arm level amplifications observed in GCTs, we performed a permutation test involving deleted chromosomal arms to examine whether these deletions would be compensatory by chance23 (Methods). We observed significantly increased reciprocal events in GCTs than expected by chance (empirical P < 0.0001) (Fig. 2d). Finally, to examine whether this copy number feature was an intrinsic germ-cell property and not related to microenvironmental features, we performed absolute copy number analysis on three tumours originating in the testes with non-germ-cell histologies and did not identify such chromosomal abnormalities (Extended Data Fig. 4). Overall, GCTs have a unique pattern of highly recurrent reciprocal copy number alterations in both discovery and validation cohorts. Despite extensive copy number events in GCTs, all TGCTs were TP53 wild type, and we only observed one TP53 mutation in a PMGCT. Transcriptome profiling of a patient subset (n = 28: 21 primary TGCTs, five metastatic samples from TGCTs, and two PMGCT; Methods) demonstrated TP53 expressed across histologies (Fig. 3a, Supplementary Table 7). The overall constellation of genomic changes in clinical TGCT tumours—wild-type TP53, chromosome arm 12p gain, and additional recurrent copy number changes—is similar to adaptive mutations acquired by human ES cells during prolonged passaging in vitro24, 25. Like GCTs, ES cells are acutely sensitive to DNA damage induced by chemotherapy, and it has been shown that this sensitivity is a result of intact p53 status and high mitochondrial priming26. Also, one of the earliest identified susceptibility loci in TGCTs is in BAK1, a BCL2 antagonist and pro-apoptotic gene14, and chemosensitivity in other cancer types has been associated with increased mitochondrial priming7. We therefore proposed that the basis of chemosensitivity in TGCTs with a wild-type TP53 and RLOH abundant genomic background was a result of a fundamental apoptotic propensity caused by increased mitochondrial priming. Mitochondrial priming refers to the intrinsic potential of cellular apoptotic propensity due to the balance of pro-apoptotic and anti-apoptotic BCL2 family proteins at the mitochondria, a feature that can be assessed by BH3 profiling27. To test this hypothesis, we obtained fresh tumour samples from seven TGCTs (Fig. 3b) and performed dynamic BH3 profiling on the tumours and adjacent normal tissue7 (Methods). In one representative case, we observed an increase in BIM BH3-induced mitochondrial depolarization between the tumour and adjacent normal (Fig. 3c) (P < 0.0001; paired t-test). Across the seven samples, BIM BH3-induced mitochondrial priming remained significant (Fig. 3d) (P < 0.0001; paired t-test). Thus, intact TP53, RLOH, and high mitochondrial priming may form the foundation of chemosensitivity in TGCTs. Although most TGCTs are cured with chemotherapy, some recur and approximately 10% of patients with metastatic disease will die from chemoresistant TGCT. To track the genomic evolution of chemoresistant TGCTs, phylogenetic analysis of 13 WES tumour samples (pre- and post-chemotherapy) from 5 patients was performed (Fig. 4, Extended Data Fig. 5, Supplementary Table 8, Methods). Chromosome arm 12p was a truncal event shared in all samples. In each patient, the resistant tumour that arose after either first- or second-line chemotherapy accumulated additional copy number events, including reciprocal deletions and events involving new chromosomes (Fig. 4). In one patient with serial tumours resected over a 13-month period without intervening chemotherapy, the copy-number-derived phylogeny was proportional to the sequence and elapsed time of sample acquisition (Fig. 4a). In two cases in which the final post-chemotherapy sample had teratoma and/or poorly differentiated carcinoma components consistent with differentiation (Fig. 4b, c), complete genome doubling was observed. Notably, the pluripotency and apoptosis regulators NANOG and POU5F1 (also known as OCT3/4) expressed in GCT8, 9, 13 were not expressed in the tumours obtained from metastatic deposits resistant to chemotherapy (Fig. 4e; P < 0.001, Mann–Whitney). They were also not expressed in the two incurable PMGCTs (Fig. 4e, Supplementary Table 7). Taken together, chemotherapy-resistant germ-cell tumours are associated with continued progression of RLOH copy number events and loss of pluripotency markers in this clinical cohort, although it is uncertain whether the loss of pluripotency markers is a driver of chemoresistance11, 28, a marker of methylation changes in a further differentiated histology post-chemotherapy29, or a feature of both processes. Overall, while GCTs represent a heterogeneous set of histological subtypes, they share a distinct burden and pattern of reciprocal copy number alterations. This observation is consistent with the notion that GCTs emerge, in part, through dysregulation in the mitosis/meiosis switch from arrested gonocytes, since this process may result in abnormal chromosomal segregation30 and persist during the evolution of GCTs. Expanded molecular analysis may inform the initiators of RLOH and its role in oncogenesis. Subsets of these tumours acquire KRAS-activating mutations, although the necessity for KRAS mutation is less clearly defined, and these tumours lack recurrent nonsynonymous mutations in established cancer genes19. Instead, chemosensitivity in TGCTs may be the result of high mitochondrial priming properties, and molecular characterization paired with mitochondrial priming studies of treatment-resistant tumours may inform features exclusive to this rare patient subset with significant unmet medical need for new therapies. This strategy may also inform strategies to improve the efficacy of chemotherapy in other malignancies.


News Article | February 15, 2017
Site: www.prweb.com

Versiant, a long time implementation partner with Navis, is pleased to announce the Versiant Lynx Customer Service Portal 3.3.2 (CSP) has been validated as Navis Ready with N4 3.1. The Lynx CSP greatly enhances marine terminal customers’ interaction with their user community. Navis Ready partners provide trusted and validated software solutions that have been tested to work within a marine container terminal operating environment. Versiant has 13 Lynx CSP terminals that are either in production or being implemented across North America, with over 40,000 registered users and processing tens of millions of terminal charges annually. The Lynx CSP integration with N4 is seamless and utilizes Navis APIs to provide a real time data exchange with N4, focusing on reducing customer service inquiries and trouble tickets at the terminal gate. This solution is available to be hosted by Versiant or located on premise. “The acquisition and implementation of Versiant’s Lynx Customer Service Portal for GCT Vancouver has allowed us to improve customer service through the real-time access of data and intuitive user interface. Customers are able to submit bulk appointment requests, guarantee container charges and receive container based event notifications. The implementation of this solution was an important part of our strategy to provide faster access to data and increase efficiencies,” quoted Kwang Chen, VP of Terminal Support Services The Lynx CSP portal provides real-time access for shipping lines, trucking companies and other BCOs and includes features such as: The Lynx CSP solution adapts to any PC and mobile device with a responsive design architecture, and is virtually available with internet access. Navis N4 is the most advanced TOS solution in the industry, and is flexible enough to allow customers to configure the product with the use of code injection, making it possible for terminal operators to support an unlimited variety of processes, integrations and business rules specific to their individual business needs. Navis Ready partner solutions have been tested in a simulated environment to ensure that specific messages have integrated effectively with a specific version of Navis N4 terminal operating system (TOS). Customers choosing a Navis Ready partner will reduce the risks during project deployment as operators can verify the level of integration achieved along with the supported business process flows in advance. About Navis Navis, a part of Cargotec Corporation, is the global technology standard for managing the movement of cargo through terminals, standing the test of time. Navis combines industry best practices with innovative technology and world class services to enable our customers to maximize performance and reduce risk. Whether tracking cargo through a port, automating equipment operations, or managing multiple terminals through an integrated, centralized solution, Navis provides a holistic approach to operational optimization, providing customers with improved visibility, velocity and measurable business results. http://www.navis.com Versiant is an IT consultancy specifically focused on the unique requirements of the marine transportation industry. Our deep expertise and extensive experience in this industry sector has enabled us to develop proven software and service solutions that extend Terminal Operating Systems, increase revenue, reduce costs, and provide a competitive advantage. You can meet Versiant at the upcoming NavisWorld event in San Francisco on March 27th-29th or simply click on http://www.Versiant.com to learn more.


- Preliminary results from a phase 1 study of MDM2 inhibitor DS-3032 in relapsed/refractory acute myeloid leukemia (AML) and high-risk myelodysplastic syndrome (MDS) to be presented - Monotherapy dosing strategy of FLT3 inhibitor quizartinib identified by laboratory and clinical investigations for FLT3-ITD+ AML - Development of DS-3032 and quizartinib underscores Daiichi Sankyo commitment to AML PARSIPPANY, New Jersey and MUNICH, Nov. 30, 2016 /PRNewswire/ -- Daiichi Sankyo Company, Limited (hereafter, Daiichi Sankyo) today announced that data from two of its investigational targeted therapies, DS-3032 and quizartinib, will be presented during the 58th Annual Meeting of the American Society of Hematology (ASH) taking place on December 3-6 in San Diego. Preliminary safety and efficacy phase 1 data on DS-3032, an investigational oral selective MDM2 inhibitor, in patients with relapsed/refractory acute myeloid leukemia (AML) and high-risk myelodysplastic syndrome (MDS) will be featured as an oral presentation. Data outlining the dosing strategy for quizartinib, an oral FLT3 inhibitor, in patients with relapsed/refractory FLT3-ITD+ AML also will be presented. "Given that there has been little change in the treatment of AML for the past 30 years, we are committed to identifying novel treatments that could potentially change the standard of care for these patients," said Ken Kobayashi, MD, Executive Director, Global Oncology Research and Development, Daiichi Sankyo. "We look forward to presenting the results of the DS-3032 and quizartinib studies to the scientific community at ASH." Abstract #593: Phase 1 Dose Escalation Study of MDM2 Inhibitor DS-3032 in Patients with Hematological Malignancies – Preliminary Results Preliminary results from the dose escalation part of a phase 1 study of DS-3032 will be part of an oral presentation session on Monday, December 5, 2016 from 7:00 AM-8:30 AM at the San Diego Ballroom AB (Marriott Marquis San Diego Marina). The primary objectives are to examine the safety and tolerability of DS-3032 and determine the maximum tolerated dose or tentative recommended phase 2 dose. Secondary objectives include evaluating the pharmacokinetics and pharmacodynamics effects of DS-3032. Exploratory objectives include evaluating the efficacy of DS-3032. Data on 38 patients with relapsed/refractory AML and high-risk MDS will be presented. Abstract#4042: Laboratory and Clinical Investigations to Identify the Optimal Dosing Strategy for Quizartinib (AC220) Monotherapy in FLT3-ITD–Positive (+) Relapsed/Refractory (R/R) Acute Myeloid Leukemia (AML) An overview of pre-clinical, pharmacokinetic (PK) and clinical study results used to establish and justify monotherapy dosing strategy for quizartinib will be part of a poster session on Monday, December 5, 2016 from 6:00 PM-8:00 PM in Hall GH (San Diego Convention Center). This dosing strategy is currently being used in the phase 3 QuANTUM-R study examining the role of quizartinib monotherapy in patients with relapsed/refractory FLT3-ITD+ AML. DS-3032 and quizartinib have not been approved by any regulatory authority for uses under investigation. DS-3032 is an investigational oral selective inhibitor of the murine double minute 2 (MDM2) protein currently being investigated in three phase 1 clinical trials for solid and hematological malignancies including acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), chronic myeloid leukemia (CML) in blast phase, lymphoma, and myelodysplastic syndrome (MDS). Quizartinib is an investigational oral FLT3 inhibitor currently being evaluated in two global, pivotal phase 3 trials in patients with newly-diagnosed (QuANTUM-First) and relapsed/refractory (QuANTUM-R) FLT3-ITD+ AML. Quizartinib has been granted Orphan Drug Designation by the U.S. Food and Drug Administration (FDA) and European Medicines Agency (EMA) for the treatment of AML. Quizartinib has also been granted Fast Track Designation by the FDA for the treatment of relapsed/refractory AML. The vision of Daiichi Sankyo Cancer Enterprise is to push beyond traditional thinking to align world-class science to create innovative treatments for patients with cancer. The oncology pipeline of Daiichi Sankyo continues to grow and currently includes more than 20 small molecules, monoclonal antibodies and antibody drug conjugates with novel targets in both solid and hematological cancers. Compounds in development include: quizartinib, an oral FLT3 inhibitor, for newly-diagnosed and relapsed/refractory FLT3-ITD+ acute myeloid leukemia (AML); pexidartinib, an oral CSF-1R inhibitor, for tenosynovial giant cell tumor (TGCT), also known as pigmented villonodular synovitis (PVNS) and giant cell tumor of the tendon sheath (GCT-TS), which also is being investigated in combination with anti-PD1 immunotherapy, pembrolizumab, in a range of solid tumors; tivantinib, an oral MET inhibitor, for second-line treatment of patients with MET-high hepatocellular carcinoma in partnership with ArQule, Inc.; and DS-8201, a HER2 targeting antibody drug conjugate, for HER2-expressing breast or gastric cancer or other HER2-expressing solid tumors. Daiichi Sankyo Group is dedicated to the creation and supply of innovative pharmaceutical products to address diversified, unmet medical needs of patients in both mature and emerging markets. With over 100 years of scientific expertise and a presence in more than 20 countries, Daiichi Sankyo and its 16,000 employees around the world draw upon a rich legacy of innovation and a robust pipeline of promising new medicines to help people. In addition to a strong portfolio of medicines for hypertension and thrombotic disorders, under the Group's 2025 Vision to become a "Global Pharma Innovator with a Competitive Advantage in Oncology," Daiichi Sankyo research and development is primarily focused on bringing forth novel therapies in oncology, including immuno-oncology, with additional focus on new horizon areas, such as pain management, neurodegenerative diseases, heart and kidney diseases, and other rare diseases. For more information, please visit: www.daiichisankyo.com. Daiichi Sankyo, Inc., headquartered in Parsippany, New Jersey, is a member of the Daiichi Sankyo Group. For more information on Daiichi Sankyo, Inc., please visit: www.dsi.com. Intended for US and EU Medical Media Only


News Article | August 24, 2016
Site: www.nature.com

Mice were bred in specified-pathogen-free facilities at the University Hospital Zurich and Washington University, and housed in groups of 3–5, under a 12 h light/12 h dark cycle (from 7 a.m. to 7 p.m.) at 21 ± 1 °C, with sterilized chow food (Kliba No. 3431, Provimi Kliba) and water ad libitum. Animal care and experimental protocols were in accordance with the Swiss Animal Protection Law, and approved by the Veterinary Office of the Canton of Zurich (permits 123, 130/2008, 41/2012 and 90/2013). The following mice were used in the present study: C57BL/6J, PrnpZH1/ZH1 (ref. 3), co-isogenic C57BL/6J PrnpZH3/ZH3 and PrnpWT/WT control mice6 and Schwann cell-specifc DhhCre::Gpr126fl/fl mutants3, 4. Mice of both genders were used for experiments unless specified. Archival tissues from previous studies1, 6 were also analysed in the current study. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment except where stated. Sciatic nerves from postnatal day 2–5 were dissected using microsurgical techniques. Nerves were dissociated in serum-free DMEM supplemented with 0.05% collagenase IV (Worthington) for 1 h in the incubator. Sciatic nerves were mechanically dissociated using fire-polished Pasteur pipettes. Cells were filtered in a 40-μM cell strainer and washed in Schwann cell culture medium (DMEM, Pen-Strep, Glutamax, FBS 10%) by centrifugation at 300g for 10 min. Resuspended cells were plated on 3.5 cm Petri dishes previously coated with poly-l-lysine 0.01% (w/v) and laminin (1 mg/ml). Laminin (Cat. No: L2020; from Engelbreth-Holm-Swarm murine sarcoma basement membrane) and poly- l-lysine were obtained from Sigma-Aldrich. Full-length recombinant PrP (recPrP, residues 23–231) and globular domain (GD, residues 121–231) were purified as previously described21, 22, 23. The generation of the GST fusion FT-PrP expression vector (pGEX-KG FT-PrP) was described previously; a modified purification protocol was used24. The FT-PrP expression vector was transformed into BL21 (DE3) strain of Escherichia coli (Invitrogen). Bacteria were grown in Luria-Bertani medium to an OD of 0.6, and the expression of the fusion protein was induced with 0.5 mM isopropyl-1-thio-β-d-galactopyranoside (AppliChem). Cells were then grown for another 4 h at 37 °C and 100 rpm shaking. Cells were pelleted at 5,000g for 20 min at 4 °C (Sorvall centrifuge, DuPont). The pellet was resuspended on ice in lysis buffer (phosphate-buffered saline supplemented with complete protease inhibitors (EDTA-free, Roche), phenylmethyl sulfonyl fluoride (Sigma) and 150 μM lysozyme (Sigma)) and incubated on ice for 30 min. Triton-X 100 (1%), MgCl (10 mM) and DNase I (5 μg/ml, Roche) were added, and the lysate was incubated on ice for 30 min. The lysate was than centrifuged for 20 min at 10,000g at 4 °C. Glutathione sepharose beads were washed with PBS and incubated with the cell lysate for 1 h at 4 °C on a rotating device. Beads were packed into a column and washed with PBS until a stable baseline was reached as monitored by absorbance at A using an ÄKTAprime (GE healthcare). The fusion protein was cleaved on the beads with 5 U/ml Thrombin (GE Healthcare) for 1 h at room temperature under agitation. For thrombin removal, benzamidine sepharose beads were added and incubated for 1 h at 4 °C on a rotating wheel. Protein preparations were analysed by 12% NuPAGE gels followed by Coomassie- or silver-staining. To achieve a higher purity of the protein, we next applied the protein to a sulfopropyl (SP) sepharose column equilibrated with 50 mM Tris-HCl buffer, pH 8.5. Elution was performed with a linear NaCl gradient of 0–1,000 mM. Fractions containing the protein were collected and concentrated (AMICON; MWCO 3500). The protein was then injected in 500 μl portions into a size-exclusion chromatography system (TSK-GEL G2000SW column (Tosoh Bioscience)) and eluted with a linear gradient using PBS. Pure fractions were combined, concentrated and stored at −20 °C. The purity of FT-PrP was >95–98% as judged by a silver-stained 12% NuPAGE gel. SW10 cells and clones derived from them were all grown in DMEM medium supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin and Glutamax (all obtained from Invitrogen). HEK293T cells, its clonal variant HEK293(H) cells and clones derived therefrom overexpressing various GPCRs were grown in DMEM-F12 medium supplemented with 10% FCS, penicillin-streptomycin and Glutamax (all obtained from Invitrogen). All cell lines were regularly monitored for mycoplasma contamination. The authenticity of SW10 and its derivatives was established by monitoring the expression of Schwann-cell specific markers (Extended Data Fig. 6a). Human Gpr126 (NM_020455), Gpr124, Gpr64, Gpr56, Gpr133, Gpr56 and Gpr176 expression plasmids (pCGpr126-V5, pCGpr124-V5, pCGpr65-V5, pCGpr56-V5, pCGpr133-V5, pCGpr56-V5 and pCGpr176-V5) were generated by PCR amplification of the respective cDNA followed by TOPO cloning into the pCDNA3.1/V5-His-TOPO vector. The cDNA was in frame with the V5 tag (sequence: GKPIPNPLLGLDST) at the C terminus. HEKGPR126 and HEKGPR176 cells were generated by transfecting 1 μg of plasmid into one well of a subconfluent 6-well plate using 3 μl Fugene (Roche) according to the manufacturer’s protocol. Twenty-four hours after transfection, cells were transferred to a 10-cm dish and grown in selective medium containing 0.4 mg/ml G418 (Invitrogen) until emergence of resistant colonies. A limiting dilution was carried out to obtain clonal lines. Membrane expression of the transgene was assessed in the selected clones by confocal microscopy using 1:100 diluted anti-V5 antibody (Invitrogen) and the Cytofix/Cytoperm kit (Pharmingen Cat. Nr. 554714), according to the manufacturer’s protocol. Cerebellar granule neurons were generated from 7–8-day-old PrnpZH1/ZH1 mice as described previously25. Cultures were plated at 350,000 cells per cm2 in Basal Medium Eagle (BME) (Invitrogen) with 10% (v/v) FCS and maintained at 37 °C in 5% CO . pCDNA-PrPC was generated by cloning murine PrPC into pCDNA3.1 vector as described previously26. A site-specific mutagenesis kit (Stratagene) was used to induce alanine substitutions of QPSPG and KKRPK domains in PrPC. Primers used for generating the Ala-QPSPG plasmid were: forward, GTG GAA GCC GGT ATC CCG GGG CGG CAG CCG CTG CAG GCA ACC GTT ACC C; reverse, GGG TAA CGG TTG CCT GCA GCG GCT GCC GCC CCG GGA TAC CGG CTT CCA C. Primers for Ala-KKRPK were: forward, CTA TGT GGA CTG ATG TCG GCC TCT GCG CAG CGG CGC CAG CGC CTG GAG GGT GGA ACA CCG; reverse, CGG TGT TCC ACC CTC CAG GCG CTG GCG CCG CTG CGC AGA GGC CGA CAT CAG TCC ACA TAG. Transfections were performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. 3 μg of DNA was used per well of a 6-well plate. Cells were washed 24 h after transfection using PBS, and fresh medium was added to the cells. HEK293T and HEKGPR126 cells growing in T75 flasks at 50% density were treated with recombinant FT or GD (2 μM, 20 min). Cells were washed twice in PBS and lysed in IP buffer: 1% Triton X-100 in PBS, 1× protease inhibitors (Roche) and Phospho stop (Roche) for 20 min on ice followed by centrifugation at 5000 rpm for 5 min at 4 °C. BCA assays were performed to quantify the amount of protein, and 500 μg of protein was used for immunoprecipitations. 2 μg anti-V5 antibody was added to the cell lysate and incubated on a wheel rotator overnight at 4 °C. On the following day, Protein G dynabeads (Invitrogen) were added to the samples and incubated for a further 3 h on the wheel at 4 °C. Beads were washed three times for 5 min each using the IP buffer followed by addition of 2× sample buffer containing DTT (1 mM final). Samples were heated at 95 °C for 5 min, loaded on 4–12% Novex Bis-tris gels (Invitrogen), and migrated for 1.5 h at 150 V followed by western blotting. Immunoprecipitations were performed by adding 2 μg of POM2 antibody to 500 μl of cell medium and incubating overnight on a wheel rotator at 4 °C. Protein G beads were then added, and incubation on a wheel rotator at 4 °C was performed again. RNA extraction and quantitative PCR were performed as described previously1. The following primers were used: EGR2 forward: 5′-AATGGCTTGGGACTGACTTG-3′; EGR2 reverse: 5′-GCCAGAGAAACCTCCATT-3′; GAPDH forward: 5′-CCACCCCAGCAAGGAGAC-3′; GAPDH reverse: 5′-GAAATTGTGAGGGAGATGCT-3′. Adult zebrafish were maintained in the Washington University Zebrafish Consortium facility ( http://zebrafishfacility.wustl.edu/) and all experiments were performed in compliance with institutional protocols. Embryos were collected from harem matings or in vitro fertilization, raised at 28.5 °C, and staged according to standard protocols27. The gpr126st49 and gpr126st63 mutants were described previously7, 8. gpr126st63 or gpr126st49 mutants were collected from homozygous mutant crosses and wild-type larvae were collected from AB* strain crosses and raised to 50 hpf. FT treatment of gpr126 mutants was performed as previously described15. Briefly, egg water was replaced with either 20 μM FT in egg water or egg water containing an equivalent volume of DMSO. At 55 hpf, larvae were washed twice and raised in egg water to 5 dpf. Wild-type and gpr126 larvae were fixed in 2% paraformaldehyde plus 1% tricholoroacetic acid in phosphate buffered saline, and Mbp and acetylated tubulin immunostaining was performed as described previously8, 28. Expression scoring was performed with observers blinded to treatment according to the following rubric: strong, strong and consistent expression throughout PLLn; some, weak but consistent expression in PLLn; weak, weak and patchy expression in PLLn; none, no expression in PLLn. n = three independent replicate gpr126st63 assays and one gpr126st49 assay. n = 87 DMSO-treated gpr126st63 larvae, 81 Prp-FT-treated gpr126st63 larvae, 27 DMSO-treated gpr126st49 larvae, 25 Prp-FT-treated gpr126st49 larvae. Fluorescent nerve images were analysed using the Fiji software29. A rectangular region-of-interest (ROI) was drawn longitudinally over the fluorescent nerve. The longitudinal grey-scale histogram of the myelin basic protein (Mbp) was normalized pixel-by-pixel to the corresponding intensity of the acetylated tubulin (AcTub). The size of the measured ROIs was kept constant across different treatment modalities. SW10 cells were grown in P75 flasks at 50% density, rinsed with PBS, and detached from culture flasks with dissociation buffer containing EDTA (GIBCO). After detaching, cells were washed to remove residual EDTA and counted using a Neubauer chamber. Batches of 105 SW10 cells were transferred to FACS tubes, treated with HA-tagged recombinant peptides for 20 min, washed, and incubated with Alexa-488 conjugated anti-HA antibody for 30 min. After further washes and centrifugations, cells were resuspended in 200 μl FACS buffer (PBS +10% FBS) and analysed with a FACS Canto II cytofluorimeter (BD Biosciences). Data were analysed using FloJo software. Schwann cells were lysed in cell-lysis buffer (Tris-HCl 20 mM, NaCl 137 mM, Triton-X-100 1%) supplemented with protease inhibitor cocktail (Roche complete mini). The lysate was homogenized by passing several times through a 26G syringe, and cleared by centrifugation at 8,000g, 4 °C for 2 min. in a tabletop centrifuge (Eppendorf 5415R). Protein concentration was measured with the BCA assay (Thermo Scientific). 10 μg total protein was boiled in 4 × LDS (Invitrogen) at 95 °C for 5 min. After a short centrifugation, samples were loaded on a gradient of 4–12% Novex Bis-Tris Gel (Invitrogen) for electrophoresis at constant voltage of 200 V. Gels were transferred to PVDF membranes with the iBlot system (Life technologies). Membranes were blocked with 5% Top-Block (Sigma) in PBS-T for 1h at room temperature. Primary antibody was incubated overnight in PBS-T with 5% Top-Block. Membranes were washed three times with PBS-T for 10 min and incubated for 1 h with secondary antibodies coupled to horseradish peroxidase at room temperature. After three washes with PBS-T, the membranes were developed with a Crescendo chemiluminescence substrate system (Millipore). Signals were detected using a Stella 3200 imaging system (Raytest). Monoclonal antibodies against PrPC were obtained and used as described previously4. Fab3 and Fab71 antibodies were generated using the phage display technology and their epitopes were mapped with overlapping peptides. Anti AKT, p-AKT were obtained from Cell signaling and used at 1:2,000 dilutions for western blotting. The anti-p75NGF receptor antibody was obtained from Abcam and used at a 1:200 dilution for immunofluorescence. Anti V5 antibody was from Invitrogen and used at a dilution of 1:500 for western blot and 2 μg antibody was used for immunoprecipitation on 500 μg of cell lysate. In the direct cAMP ELISA assay, cAMP levels were assessed with a colorimetric competitive immunoassay (Enzo Life Sciences). Quantitative determination of intracellular cAMP was performed in cells or tissues lysed in 0.1 M HCl to stop endogenous phosphodiesterase activity and to stabilize the released cAMP. SW10 or HEK293T cells (100,000 cells per well) were plated in 6-well plates to ~50% density. Cells were treated with conditioned medium or recombinant peptides (2 μM, unless specified) for 20 min unless otherwise mentioned. Cells were lysed with 0.1 M HCl lysis buffer (Direct cAMP ELISA kit, Enzo). To ensure complete detachment of cells, cell scrapers were used. Lysates were homogenized with a 26G needle and syringe before clearing by centrifugation at 600g for 10 min. The subsequent steps were performed according to the manufacturer’s protocol based on competition of sample cAMP with a cAMP-alkaline phosphatase conjugate. To measure in vivo cAMP changes, BL6, PrnpZH3/ZH3 or PrnpZH1/ZH1 mice were intravenously injected with 600 μg of either FT or, as a control, uncharged FT ( ). Twenty minutes after infusion, mice were killed and all organs were collected. For cAMP assays, organs were homogenized in 0.1 M HCl. Subsequent steps were performed according to the manufacturer’s protocols as described above. Cyclic AMP levels were calculated using a cAMP standard curve in the case of ELISA based assay. Finally, cAMP concentrations were normalized to total protein content in each sample. cAMP changes are represented as fold changes to the respective controls. For each experiment, at least three independent biological replicates were used. For in vivo assays, groups of 8–16 mice were used for each experiment. For normalization purposes, the median value of the respective control sample was defined as 1. All measurements within each panel were normalized to this control value. For in vivo assays, sample sets were coded and investigators were blinded to their identities. The assignment of codes to sample identities was performed only after the cAMP values were plotted for each set. We designed two CRISPR short-guide RNA (sgRNAs) against exon 2 of Gpr126 (upper Guide CCTGTGTTCCTCTCTCAGGT and lower Guide AACAGGAACAGCAGGGCGCT). The DNA sequences corresponding to the sgRNAs were cloned into expression plasmids and transfected with EGFP-expressing Cas9-nickase plasmids. Single EGFP-expressing Schwann cells were isolated with a FACS sorter (Aria III). To determine the exact sequence of indels induced by genome editing, we amplified the sgRNA-targeted locus by PCR and subcloned the fragments into blunt-TOPO vectors. Ten colonies per cell line were sequenced and showed distinct indels on each allele. A clonal subline devoid of Gpr126 was used for further studies. This cell line possessed insertions on both the alleles; a 49-bp insertion at position 118 and a 5-bp insertion at position 84 on each allele. Both insertions led to a frameshift and to the generation of premature stop codons leading to early translation termination. Luciferase reporter constructs were generated containing a 1.3-kB sequence upstream of the transcription-starting site of Egr2. SW10 Schwann cells were transfected with Egr2 reporter construct and a renilla plasmid using lipofectamine 2000. After one day in vitro, Schwann cells were treated with recombinant full-length PrP (23–231), the globular domain of PrP (121–231) or PBS control. Luciferase activity was measured 24 h after stimulation with Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s recommendations. Results were normalized to renilla transfection controls. Glass coverslips were placed in 12-well plates (Thermo Scientific) and coated with 0.01% w/v Poly-l-lysine solution (Sigma) overnight at room temperature. Coverslips were washed three times with ddH O and dried for 2 h in a laminar-flow hood. Schwann cells were seeded and cultured at 50% density. Cells were treated with recombinant FT-PrP, full length recPrP or C1-PrP for 20 min, and washed with serum-free DMEM. Cells were further washed with PBS followed by fixation with 4% paraformaldehyde. Fixed cells were incubated in blocking buffer (PBS+10% FBS) for 1 h. Cells were treated with various primary antibodies followed by washes and incubation with Alexa 488 and Alexa 647 tagged rabbit or mouse secondary antibodies (Life Technologies). Imaging was performed by Leica SP2 confocal microscope using a 20× objective; images were processed by Image J software. Transmission electron microscopy was performed as previously described6. Briefly, mice under deep anaesthesia were subjected to transcardial perfusion with PBS heparin and sciatic nerves were fixed in situ with 2.5% glutaraldehyde plus 2% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 and embedded in Epon. Ultrathin sections were mounted on copper grids coated with Formvar membrane and contrasted with uranyl acetate/lead citrate. Micrographs were acquired using a Hitachi H-7650 electron microscope (Hitachi High-Tech, Japan) operating at 80 kV. Brightness and contrast were adjusted using Photoshop. For quantification of Remak bundles and onion bulb-like structures, images were captured at 1,500× magnification and axon numbers and abnormal onion bulb-like structures were counted manually. Quantification was performed in a blinded fashion by assigning numbers to the images and upon completion of quantification genotypes were revealed. HA-tagged and untagged synthetic peptides were produced by EZ Biosciences. A stock solution of 2 mM was prepared by dissolving the peptides in PBS and they were used at a final concentration of 2 μM unless specified. The sequences of all the peptides used in this study can be found in Extended Data Table 1.


News Article | December 9, 2015
Site: phys.org

In the two weeks leading up to the GCT prototype inauguration event on 1 December, the GCT team battled poor weather to install and begin testing the GCT camera. On the evening of Thursday, 26 November, they turned the telescope away from a nearly full moon and the bright lights of Paris towards a clear patch of sky. After 20 seconds, a single event triggered the camera, then another – in just over 300 seconds 12 events were captured. These triggers could have been caused by fluctuations in the bright night sky, but it was instantly clear that they were, in fact, what the team was looking for – images of air showers created in the atmosphere by cosmic rays. The image captured by the team shows the maximum amount of light captured in each of the camera's 2048 pixels over 100 frames. CTA astronomers will use images like this to determine the incoming direction and energy of the particle that created the air shower. "With the tough weather conditions, we only had about an hour-long window to gather as much data as we could," said GCT Camera Coordinator Dr. Richard White. "We look forward to clearer, darker skies so we can test the camera's performance in more ideal conditions." "This is a major milestone for the GCT and we hope for CTA." said GCT Spokesperson Prof. Tim Greenshaw. "Our design for the CTA telescopes that will detect the highest energy light hitting the earth's atmosphere from space has been proven to work; we are one step closer to developing a deeper understanding of where and how that light is produced." Hélène Sol, Research Director at Centre National de la Recherche Scientifique (CNRS) and GCT Deputy Spokesperson added: "I would like to congratulate all the GCT team who have made this possible, especially the group who worked day and night over the last couple of weeks to get these pictures." In order to detect the short flashes of light produced by cosmic rays and gamma rays as they hit the earth's atmosphere, the telescope's camera has to be about a million times faster than a DSLR camera. To do this, it uses high-speed digitisation and triggering technology capable of recording images at a rate of one billion frames per second and sensitive enough to resolve single photons. These first pictures are just the beginning for the GCT. The prototype telescope and camera will undergo rigorous testing over the next year, then the team intends to build 35 cameras and telescopes for the CTA Observatory based on the results of the testing process. "We're extremely pleased with the progress and performance of the GCT prototype and all of the CTA prototypes," said CTA Project Manager Christopher Townsley. "We look forward to seeing the results of further testing as we near the construction phase of the project." CTA is a global initiative to build the world's largest and most sensitive high-energy gamma-ray observatory. Over 1,000 scientists and engineers from 32 countries and over 170 research institutes participate in the CTA project. CTA will serve as an open observatory to a wide physics and astrophysics community and provide a deep insight into the non-thermal, turbulent, high-energy universe. The CTA observatory will detect high-energy radiation with unprecedented accuracy and approximately 10 times the sensitivity of current instruments, providing novel insights into some of the most extreme and violent events in the universe. Read more about CTA's expected performance. At least three telescope types are required to cover the full CTA energy range. The sensitivity in the core energy range between 100 GeV and 10 TeV will be dominated by up to 40 Medium-Size Telescopes (MSTs) distributed over both array sites in the northern and southern hemispheres. Four Large-Size Telescopes (LSTs) and around 70 SSTs will be essential to extend the energy range below 100 GeV and above a few TeV. The GCT adds to the current complement of CTA prototypes located around the world: the SST-1M (Krakow, Poland), SST-2M ASTRI (Serra la Nave, Italy), MST (Zeuthen, Germany) and the LST (La Palma, Spain). Explore further: Lung scintigraphy more reliable than CTA in excluding pulmonary embolism in pregnant patients


News Article | March 18, 2016
Site: phys.org

Different people sometimes spell the same word differently - organisation versus organization, or analogue versus analog. In such words, despite the variation in the strings of letters, the meaning conveyed by the alternatives remains the same. Similarly, DNA codes carrying instructions for creating a protein can sometimes be 'spelt' differently, although they specify the exact same sequence information to create that protein. Until recently, most biologists believed that mutations that created such 'synonymous' DNA codes, had very weak effects on the evolution of organisms. However, a new study by an international team of scientists, including those from the National Centre for Biological Sciences (NCBS), Bangalore, shows that a different set of DNA codes specifying the same product can have major effects on the survival and evolution of living beings. The code of life - composed of triplet codons of the four DNA alphabets A, T, G and C - is quite redundant. For example, the amino acid Alanine, is specified by no less than four alternative triplet codes (GCT, GCC, GCA and GCG), or codons. This redundancy is at the root of what molecular biologists term 'synonymous mutations', where a change in the DNA sequence of a gene does not change the sequence of the protein it codes for. Mutations resulting in changes to protein sequences are expected to cause disruptions in function, and are hence likely to affect an organism's abilities or fitness. Contrary to this, synonymous mutations have been generally ignored in this context. Deepa Agashe at NCBS and her team of collaborators have reinforced a growing body of evidence that synonymous variants of a gene affect an organism's fitness. Moreover, they have now shown that single highly beneficial synonymous mutations can allow organisms to rapidly evolve and adapt to their environment. Working on the bacterium Methylobacterium extorquens, the group created several variants of a gene called fae. This gene codes for a metabolic enzyme essential for survival and growth in an environment where the only source of carbon comes from methanol or methylamine. Under such restrictive conditions, bacteria undergo strong selection for retaining the fae gene function. When grown in conditions where methanol was provided as the sole carbon source, all bacterial populations with the 'synonymous' fae gene variants performed poorly when compared to bacteria carrying the normal gene. However, when bacterial populations carrying these variants of fae were grown over a long period of time with methanol being the only carbon source - described as 'strong selection conditions', an interesting phenomenon was observed. Within 100 - 200 generations, these bacterial populations began to regain their fitness through additional mutations to the gene variants. Many of these mutations were again synonymous. Furthermore, these mutations occurred at single points within the gene, were highly beneficial, and they seemed to recur in multiple experiments. "What is surprising about our results is that the beneficial mutations we see are highly repeatable in specific gene variants - you can think of this process with an analogy to climbers - different climbers who start independently from the bottom of a hill are using the exact same strategy to reach the top!", says Deepa Agashe, the lead author of the publication detailing these findings. Studies like the one described here are critical in understanding the genetic basis of adaptation. Understanding adaptation, in turn, is the key to comprehending evolution and for predicting future dynamics of populations. For example, being able to forecast the development of antibiotic resistance through genetic mutations in a bacterial population would help in developing better drugs for diseases. Until now, synonymous mutations and gene variants were considered relatively unimportant for such studies on adaptation, due to a lack of information about their effects on organism fitness. This study reinforces the view that such synonymity can no longer be ignored as irrelevant in the processes of adaptation and evolution. Explore further: Unexpectedly small effects of mutations in bacteria bring new perspectives More information: Deepa Agashe et al. Large-effect beneficial synonymous mutations mediate rapid and parallel adaptation in a bacterium, Molecular Biology and Evolution (2016). DOI: 10.1093/molbev/msw035


Three classes of telescope types are required to cover the full CTA very-high energy range (20 GeV to 300 TeV): Medium-size telescopes will cover CTA's core energy range (100 GeV to 10 TeV) while the large-size telescopes and small-size telescopes (SSTs) will extend the energy range below 100 GeV and above a few TeV, respectively. The ASTRI telescope is one of three proposed SST designs being prototyped and tested for CTA's southern hemisphere array. The ASTRI telescope uses an innovative dual-mirror Schwarzschild-Couder configuration with a 4.3 m diameter primary mirror and a 1.8 m monolithic secondary mirror. In 1905, the German physicist and astronomer Karl Schwarzschild proposed a design for a two-mirror telescope intended to eliminate much of the optical aberration across the field of view. This idea, elaborated in 1926 by André Couder, lay dormant for almost a century because it was considered too difficult and expensive to build. In 2007, a study by Vladimir Vassiliev and colleagues at the University of California Los Angeles (UCLA) demonstrated the design's usefulness for atmospheric Cherenkov telescopes. The ASTRI prototype, the first Schwarzschild-Couder telescope to be built and tested, was inaugurated in September 2014 and has been undergoing testing at the Serra La Nave observing station on Mount Etna in Sicily ever since. The technical challenges of the design were overcome by recent advances, particularly in dual-mirror technology, making it a feasible implementation for the observation of Cherenkov light. Image 2 shows Polaris as observed by ASTRI with different offsets from the optical axis of the telescope. The recorded images have approximately the same angular size, each one from a different observational direction in the field of view (from 0 to 4.5 degrees from each side with respect to the central optical axis). These images show that the optical point-spread function of the telescope is approximately constant across the full field of view. This information will allow scientists to reconstruct the direction of gamma-ray photons emitted from celestial sources. "This is also the first time that a Cherenkov telescope with two focusing mirrors has been completely characterized from the opto-mechanical point of view," said Giovanni Pareschi, astronomer at the INAF-Brera Astronomical Observatory and principal investigator of the ASTRI project. "This is an important result, because it allows us to move immediately to the next step—to mount a Cherenkov camera by December 2016 and observe the first gamma-ray light with ASTRI." The ASTRI project is led by the Italian National Institute of Astrophysics (INAF) with the collaboration of a number of Italian universities, the Italian National Institute of Nuclear Physics (INFN), Universidade de São Paulo in Brazil and North-West University in South Africa. The SSTs will outnumber all the other telescopes with 70 spread out over several square kilometres in the southern hemisphere array. Since very high-energy gamma-ray showers (between a few TeV and 300 TeV) produce a large amount of Cherenkov light, it is sufficient to build telescopes with small mirrors to catch that light. The SSTs' wide coverage and large number, spread over a large area, will improve CTA's chances of detecting the highest energy gamma rays. The Schwarzschild-Couder design is being used in two additional CTA prototypes (the SST-2M GCT and the SCT), but the ASTRI is the first to conclusively demonstrate the viability of the system.


A company specializing in NNN properties has completed a $1.7 million sale of a McDonald's property in Shorewood, Illinois. Windsor, CT, March 02, 2017 --( Dwaine L. Clarke, of GCT Net Lease represented the buyer, a private investor in the transaction. The seller, SJ-Shorewood, LLC was represented by Stan Johnson Company. The triple net property is ideally situated in the retail epicentre of Shorewood, with frontage and visibility on Brook Forest Avenue, which experiences a high daily traffic count. This McDonalds property also benefits from its central position, surrounded by a myriad of major national retail tenants including The Home Depot, Dick’s Sporting Goods and Babies “R” Us. “The market for fast food NNN properties for sale remains active as these assets are in high demand among private investors,” explained Dwaine Clarke, President of GCT Net Lease. “After speaking with my client and discussing his needs, I reached out to my network and was able to find the perfect property for their requirements. I negotiated a great price and it worked out well for my client.” The McDonald’s Corporation is the world’s largest chain of hamburger fast food restaurants and one of the most sought-after NNN properties for sale. As of December 31 2015, the McDonald’s Corporation had total revenues of over $25.4 billion, a net income of $4.5 billion and a net worth of over $7 billion and serves nearly 700 customers daily in over 100 countries across the world. Windsor, CT, March 02, 2017 --( PR.com )-- GCT Net Lease, a net leased investment property brokerage firm, completed the sale of a single tenant, 3,614 square foot McDonald’s Ground Lease property located in Shorewood, Illinois. The sale closed on January 11, 2017 for $1,737,500.Dwaine L. Clarke, of GCT Net Lease represented the buyer, a private investor in the transaction. The seller, SJ-Shorewood, LLC was represented by Stan Johnson Company.The triple net property is ideally situated in the retail epicentre of Shorewood, with frontage and visibility on Brook Forest Avenue, which experiences a high daily traffic count. This McDonalds property also benefits from its central position, surrounded by a myriad of major national retail tenants including The Home Depot, Dick’s Sporting Goods and Babies “R” Us.“The market for fast food NNN properties for sale remains active as these assets are in high demand among private investors,” explained Dwaine Clarke, President of GCT Net Lease. “After speaking with my client and discussing his needs, I reached out to my network and was able to find the perfect property for their requirements. I negotiated a great price and it worked out well for my client.”The McDonald’s Corporation is the world’s largest chain of hamburger fast food restaurants and one of the most sought-after NNN properties for sale. As of December 31 2015, the McDonald’s Corporation had total revenues of over $25.4 billion, a net income of $4.5 billion and a net worth of over $7 billion and serves nearly 700 customers daily in over 100 countries across the world. Click here to view the list of recent Press Releases from GCT Net Lease

Loading GCT collaborators
Loading GCT collaborators