FST
Tunis, Tunisia
FST
Tunis, Tunisia

Time filter

Source Type

MINNEAPOLIS & REHOVOT, Israel--(BUSINESS WIRE)--Stratasys Ltd. (Nasdaq:SSYS), the 3D printing and additive manufacturing solutions company, today announced that the Mobility Division of global engineering and technology solutions leader, Siemens, is pioneering the use of Stratasys FDM 3D printing technology by producing customized final production parts for German transport services provider, Stadtwerke Ulm/Neu Ulm (SWU) Verkehr GmbH. Using a Stratasys Fortus 900mc Production 3D Printer, Siemens Mobility is able to overcome the barriers of traditional low-volume production by 3D printing final tram parts in a matter of days compared to weeks with traditional methods, while also eradicating the need for costly tooling. Located in Erlangen, Krefeld, Berlin and Munich, Germany, Siemens Mobility develops technology for vehicles and infrastructure for transport machines. Prior to its 3D printing production capability, Siemens Mobility faced a challenge in being able to meet increasing customer demands for one-off customized parts. For the rail industry, if a replacement part is not in stock, Siemens would need to purchase the machinery or tools to manufacture it. This is not only a lengthy process, but from a cost-perspective, Siemens was limited to only taking orders above 10 parts, with lower volumes unable to justify the production cost. “Our production services for end-use parts have become much more flexible and tailored to our customers’ needs since we introduced the Stratasys Fortus 900mc Production 3D Printer into our manufacturing process,” explains Tina Eufinger, Business Development, Siemens Mobility Division. “Before we integrated 3D printing into production, we were forced to produce higher quantities of parts in order to make the project cost-effective. For small volume part demands from customers, we would store excess parts until they were used, discarded or became too outdated to use. With the Fortus 900mc, we can now create a design that is 100 percent customized to specific requirements and optimized several times before it is 3D printed. This takes our production time down from weeks to a matter of days, and makes it now cost-effective enough to extend our customer service offering to one-off part production.” This cost-effective low volume manufacturing is being exemplified by Siemens’ work for SWU Verkehr GmbH, which offers transport services across 10 rail networks in the inner city of Ulm. 3D printed parts include customized armrests for the driver seat and housing covers for the ‘coupler’ (the cover of the link between two tram carriages). In order to meet the German rail industry’s criteria for production parts, Siemens is using a flame, smoke and toxicity (FST) compliant synthetic thermoplastic 3D printing material from Stratasys to align with necessary fire protection requirements. This enables Siemens to employ the 3D printed parts – which serve as lightweight and durable transport parts – directly into the trams in Ulm. Andreas Düvel, Siemens Mobility Sales Representative Customer Service, explains: “Customers such as SWU Verkehr GmbH see ‘availability’ as the most important asset to their business – trams and services need to be available and run constantly throughout the day in order for the transport company to be profitable. We at Siemens are regularly faced with this challenge, however the ability to quickly and cost-effectively 3D print customized parts specific to customer requirements enables clients such as SWU Verkehr GmbH to be closely involved in the design and production of its own parts. “Through customized additive manufacturing we are achieving maximum customer satisfaction, as the client is actively participating in the creation and optimization of its parts. This would simply not be possible with mass production,” he adds. Beyond offering 3D printed production parts for customers in the transport industry, Siemens Mobility division has expanded its business branch online, with customers able to order customized 3D printed parts. Customers who require replacement parts or who need to make changes to existing ones can go online and request the desired part, which is subsequently 3D printed and delivered to them. This has given birth to an on-demand production business model, whereby customers can have part requirements met how and when they need them. “Siemens is a prime example of how 3D printing can make customized low volume production profitable for businesses – not just for the manufacturer in this case, but also for the end-use customer, the rail industry,” explains Andy Middleton, President, Stratasys EMEA. “With the ability to localize manufacturing and 3D print on-demand, entire supply chains can be redefined with large stocks of obsolete parts no longer required. For the rail industry, the likes of SWU Verkehr GmbH can now work closely with manufacturers to design and optimize 3D printed parts when they need them, ensuring trams are operational and that there is minimal disruption to public services.” Video: Learn how Siemens Mobility is overcoming time and cost barriers of traditional low volume production with Stratasys 3D printing For more than 25 years, Stratasys Ltd. (NASDAQ:SSYS) has been a defining force and dominant player in 3D printing and additive manufacturing – shaping the way things are made. Headquartered in Minneapolis, Minnesota and Rehovot, Israel, the company empowers customers across a broad range of vertical markets by enabling new paradigms for design and manufacturing. The company’s solutions provide customers with unmatched design freedom and manufacturing flexibility – reducing time-to-market and lowering development costs, while improving designs and communications. Stratasys subsidiaries include MakerBot and Solidscape, and the Stratasys ecosystem includes 3D printers for prototyping and production; a wide range of 3D printing materials; parts on-demand via Stratasys Direct Manufacturing; strategic consulting and professional services; and the Thingiverse and GrabCAD communities with over 2 million 3D printable files for free designs. With more than 2,700 employees and 1,200 granted or pending additive manufacturing patents, Stratasys has received more than 30 technology and leadership awards. Visit us online at: www.stratasys.com or http://blog.stratasys.com/, and follow us on LinkedIn. Stratasys, Stratasys signet logo, Connex and PolyJet are trademarks or registered trademarks of Stratasys Ltd. and/or its subsidiaries or affiliates. Autodesk and Fusion 360 are trademarks of Autodesk Inc. and/or its subsidiaries and/or affiliates. Attention Editors, if you publish reader-contact information, please use:


News Article | April 21, 2017
Site: www.materialstoday.com

Diab has signed a long term contract with Diehl Aircabin to supply its Divinycell F foam core for cabin applications. The company says that Divinycell F can minimize the need for labor intensive and putty, sanding, and sweeping steps. Featuring closed cells and minimal water absorption, Divinycell F also eliminates the need for edge fill. Many honeycomb panel designs now incorporate Divinycell F as an edge close-out. Divinycell F can also withstand high temperatures and exceeds requirements for aircraft interiors with regards to fire, smoke, toxicity (FST), and OSU heat release. Divinycell is used in aircrft seats, as lavatory interiors, galleys, luggage bins, cabin air distribution and window frames for the Airbus 350 XWB and other aircrafts. ‘It has been a pleasure to work with Diehl, and we are very proud of being a supplier and partner with Diehl Aircabin,’ said Lennart Thalin, Diab Executive Group vice president sales & segments. This story uses material from DIAB, with editorial changes made by Materials Today. The views expressed in this article do not necessarily represent those of Elsevier.


WiseGuyReports.Com Publish a New Market Research Report On – “Global Perishable Goods Transportation Market 2017 Share,Trend,Segmentation and Forecast to 2022”.Pune, India - April 25, 2017 /MarketersMedia/ — This report studies the Perishable Goods Transportation market status and outlook of global and United States, from angles of players, regions, product types and end industries; this report analyzes the top players in global and United States market, and splits the Perishable Goods Transportation market by product type and applications/end industries. The global Perishable Goods Transportation market is valued at XX million USD in 2016 and is expected to reach XX million USD by the end of 2022, growing at a CAGR of XX% between 2016 and 2022. Get a Sample Report @ https://www.wiseguyreports.com/sample-request/1220245-2017-2022-perishable-goods-transportation-report-on-global-and-united-states For more information or any query mail at sales@wiseguyreports.com The Asia-Pacific will occupy for more market share in following years, especially in China, also fast growing India and Southeast Asia regions. North America, especially The United States, will still play an important role which cannot be ignored. Any changes from United States might affect the development trend of Perishable Goods Transportation. United States plays an important role in global market, with market size of xx million USD in 2016 and will be xx million USD in 2022, with a CAGR of XX. Geographically, this report is segmented into several key regions, with sales, revenue, market share (%) and growth Rate (%) of Perishable Goods Transportation in these regions, from 2012 to 2022 (forecast), covering United States North America Europe Asia-Pacific South America Middle East and Africa The major players in global and United States Perishable Goods Transportation market, including C.H. Robinson, Ingersoll-Rand, Maersk Line, Swift Transportation, Africa Express Line, APL, Bay & Bay, China Shipping Container Lines, Compa?ía Sud Americana de Vapores, CRST International, Frost Sales, FST Logistics, Geest Line, Green Reefers Group, Hamburg Süd, Hanson Logistics, Hapag-Lloyd, Klinge, Kyowa Shipping, Maestro Reefers, MCT Transportation, Mitsui O.S.K. Lines, STAR Reefers, UNITED ARAB SHIPPING COMPANY, Weber Logistics, Witte Bros.Exchange, Inc., YANG MING The On the basis of product, the Perishable Goods Transportation market is primarily split into Rail Transportation Air Transportation Marine Transportation Road Transportation On the basis on the end users/applications, this report covers Food Medical Fresh Others Complete Report Details @ https://www.wiseguyreports.com/reports/1220245-2017-2022-perishable-goods-transportation-report-on-global-and-united-states Table Of Contents – Major Key Points 1 Methodology and Data Source 1.1 Methodology/Research Approach 1.1.1 Research Programs/Design 1.1.2 Market Size Estimation 1.1.3 Market Breakdown and Data Triangulation 1.2 Data Source 2.1.1 Secondary Sources 2.1.2 Primary Sources 1.3 Disclaimer 2 Perishable Goods Transportation Market Overview 2.1 Perishable Goods Transportation Product Overview 2.2 Perishable Goods Transportation Market Segment by Type 2.2.1 Rail Transportation 2.2.2 Air Transportation 2.2.3 Marine Transportation 2.2.4 Road Transportation 2.3 Global Perishable Goods Transportation Product Segment by Type 2.3.1 Global Perishable Goods Transportation Sales (K Ton) and Growth (%) by Types (2012, 2016 and 2022) 2.3.2 Global Perishable Goods Transportation Sales (K Ton) and Market Share (%) by Types (2012-2017) 2.3.3 Global Perishable Goods Transportation Revenue (Million USD) and Market Share (%) by Types (2012-2017) 2.3.4 Global Perishable Goods Transportation Price (USD/Ton) by Type (2012-2017) 2.4 United States Perishable Goods Transportation Product Segment by Type 2.4.1 United States Perishable Goods Transportation Sales (K Ton) and Growth by Types (2012, 2016 and 2022) 2.4.2 United States Perishable Goods Transportation Sales (K Ton) and Market Share by Types (2012-2017) 2.4.3 United States Perishable Goods Transportation Revenue (Million USD) and Market Share by Types (2012-2017) 2.4.4 United States Perishable Goods Transportation Price (USD/Ton) by Type (2012-2017) 3 Perishable Goods Transportation Application/End Users 3.1 Perishable Goods Transportation Segment by Application/End Users 3.1.1 Food 3.1.2 Medical 3.1.3 Fresh 3.1.4 Others 3.2 Global Perishable Goods Transportation Product Segment by Application 3.2.1 Global Perishable Goods Transportation Sales (K Ton) and CGAR (%) by Applications (2012, 2016 and 2022) 3.2.2 Global Perishable Goods Transportation Sales (K Ton) and Market Share (%) by Applications (2012-2017) 3.3 United States Perishable Goods Transportation Product Segment by Application 3.3.1 United States Perishable Goods Transportation Sales (K Ton) and CGAR (%) by Applications (2012, 2016 and 2022) 3.3.2 United States Perishable Goods Transportation Sales (K Ton) and Market Share (%) by Applications (2012-2017) 4 Perishable Goods Transportation Market Status and Outlook by Regions 4.1 Global Market Status and Outlook by Regions 4.1.1 Global Perishable Goods Transportation Market Size and CAGR by Regions (2012, 2016 and 2022) 4.1.2 North America 4.1.3 Asia-Pacific 4.1.4 Europe 4.1.5 South America 4.1.6 Middle East and Africa 4.1.7 United States 4.2 Global Perishable Goods Transportation Sales and Revenue by Regions 4.2.1 Global Perishable Goods Transportation Sales (K Ton) and Market Share (%) by Regions (2012-2017) 4.2.2 Global Perishable Goods Transportation Revenue (Million USD) and Market Share (%) by Regions (2012-2017) 4.2.3 Global Perishable Goods Transportation Sales (K Ton), Revenue (Million USD), Price (USD/Ton) and Gross Margin (%) (2012-2017) 4.2.4 North America Perishable Goods Transportation Sales (K Ton), Revenue (Million USD), Price (USD/Ton) and Gross Margin (%) (2012-2017) 4.2.5 Europe Perishable Goods Transportation Sales (K Ton), Revenue (Million USD), Price (USD/Ton) and Gross Margin (%) (2012-2017) 4.2.6 Asia-Pacific Perishable Goods Transportation Sales (K Ton), Revenue (Million USD), Price (USD/Ton) and Gross Margin (%) (2012-2017) 4.2.7 South America Perishable Goods Transportation Sales (K Ton), Revenue (Million USD), Price (USD/Ton) and Gross Margin (2012-2017) 4.2.8 Middle East and Africa Perishable Goods Transportation Sales (K Ton), Revenue (Million USD), Price (USD/Ton) and Gross Margin (%) (2012-2017) 4.2.9 United States Perishable Goods Transportation Sales (K Ton), Revenue (Million USD), Price (USD/Ton) and Gross Margin (2012-2017) 5 Global Perishable Goods Transportation Market Competition by Players/Manufacturers 5.1 Global Perishable Goods Transportation Sales (K Ton) and Market Share by Players (2012-2017) 5.2 Global Perishable Goods Transportation Revenue (Million USD) and Share by Players (2012-2017) 5.3 Global Perishable Goods Transportation Average Price (USD/Ton) by Players (2012-2017) 5.4 Players Perishable Goods Transportation Manufacturing Base Distribution, Sales Area, Product Types 5.5 Perishable Goods Transportation Market Competitive Situation and Trends 5.5.1 Perishable Goods Transportation Market Concentration Rate 5.5.2 Global Perishable Goods Transportation Market Share (%) of Top 3 and Top 5 Players 5.5.3 Mergers & Acquisitions, Expansion Continued……. For more information or any query mail at sales@wiseguyreports.com Buy 1-User PDF @ https://www.wiseguyreports.com/checkout?currency=one_user-USD&report_id=1220245 ABOUT US: Wise Guy Reports is part of the Wise Guy Consultants Pvt. Ltd. and offers premium progressive statistical surveying, market research reports, analysis & forecast data for industries and governments around the globe. Wise Guy Reports features an exhaustive list of market research reports from hundreds of publishers worldwide. We boast a database spanning virtually every market category and an even more comprehensive collection of rmaket research reports under these categories and sub-categories. Contact Info:Name: Norah TrentEmail: sales@wiseguyreports.comOrganization: WiseGuy Research Consultants Pvt Ltd.Address: Office No. 528, Amanora Chambers Magarpatta Road, Hadapsar Pune - 411028Phone: +1-646-845-9349 Source URL: http://marketersmedia.com/global-perishable-goods-transportation-market-2017-share-trend-segmentation-and-forecast-to-2022/190221For more information, please visit https://www.wiseguyreports.comSource: MarketersMediaRelease ID: 190221


News Article | March 30, 2016
Site: www.nature.com

The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. The ScaI/HindIII linearized hArl13b–mCherry–GECO1.2 pCAG vector (chicken actin promoter) was gel-purified and injected into the pronucleus of C57BL6/6J oocytes at the transgenic animal core facility at Boston Children’s Hospital (Boston, Massachusetts). The integration site for the Arl13b–mCherry–GECO1.2 transgene was determined by genomic walking (Bio S&T). The genotype of transgenic animals was determined by PCR: primers 372-up, ACATGGCCTTTCCTGCTCTC; 372-down, TTCAACATTTCCGTGTCGCC; and 944-down, GACATCTGTGGGAGGAGTGG. PCR product for the wild-type genomic sequence: ~600 bp; transgene PCR product ~400 bp. All animal procedures of this study were approved by the IACUCs of Boston Children’s Hospital and Harvard Medical School (Boston, MA). Animals were maintained according to ARCH standards at Boston Children’s Hospital and euthanized using CO . Arl13b–mCherry–GECO1.2tg: mIMCD cells were isolated as described31. Briefly, ten kidneys isolated from P14–P21 Arl13b–mCherry–GECO1.2tg mice were cut longitudinally with fine scissors and the outer and inner medulla removed. The tissue was cut into small pieces with a razor blade and digested in collagenase (2 mg ml−1) and hyaluronidase (1 mg ml−1) for 1 h at 37 °C in L-15 medium (Life Technologies). After trituration of the homogenate, cells were washed twice in phosphate-buffered saline (PBS) and plated on laminin-coated dishes (Life Technologies). Cells were grown in DMEM (adjusted to 600 mOsm with urea and NaCl), containing 200 μM dibutyryl-cAMP (db-cAMP), unless stated otherwise. After 2 days, cells were split on laminin-coated coverslips (NeuVitro) and imaged after culturing for an additional 1–2 days to allow confluent cell growth. For side-view imaging, cells were grown on 24 mm Transwell inserts (Corning) until they reached confluency. The membrane was excised with a scalpel and folded before imaging. Where indicated, mIMCD cells were serum starved in DMEM containing 0.2% BSA for 24 h or 48 h. Imaging solutions: L-15 medium (1.3 mM Ca2+) or HEPES-containing solution buffered to 50 nM [Ca2+] (see ‘Calibration of the ratiometric Arl13b–mCherry–GECO1.2 sensor’ for buffer composition). Microdissection was performed as described previously32 with modifications. In brief, 1-mm thick transverse slices of P14–P21 kidneys were incubated with collagenase (1 mg ml−1) and hyaluronidase (1 mg ml−1) for 30 min at 37 °C in L-15 medium (Life Technologies), or gently dissected without prior treatment. The cortex was removed with fine forceps and bundles of tubules were isolated at the transition of inner (white) and outer (red) medulla (Extended Data Fig. 5c). Thick-walled individual tubules with luminal fluorescent cilia were microdissected and mounted on glass or plastic coverslips coated with Cell-Tak (Corning). Under ×4 magnification (upright Nikon NiE), a micromanipulator-mounted 20° micro-knife (Minitool) was used to cut individual tubules from the bundles. A second micromanipulator held a long-tapered micropipette (bent ~20° to ensure the tip of the pipette was parallel to the surface of the coverslip, Extended Data Fig. 5). Under higher magnification (×100/1.1 numerical aperture or ×60/1.0 numerical aperture water dipping lenses), the micropipette was gently inserted into the tubule lumen and the pressure stimulus applied. Regions of the tubule with no direct micropipette contact were used for Ca2+ imaging. In some experiments a third micromanipulator was used to deliver digitonin (20 μM) to the tubules (direct injection into the tubule lumen or external application). Cilia from kidney tubule perfusion experiments were collected from three independent microdissections. GCaMP6f (B6;129S-Gt(ROSA)26Sortm95.1(CAG-GCaMP6f)Hze/J) and E2a-Cre (Tg(EIIa-cre)C5379Lmgd) transgenic animals were obtained from Jackson Laboratories. Embryo isolation was performed as described previously33. Timed pregnancies resulting from mating wild-type C57BL6/6J, Arl13b–mCherry–GECO1.2tg/- or Arl13b–mCherry–GECO1.2tg/tg females with Arl13b–mCherry–GECO1.2tg/tg or GCaMP6ftg/tg:E2a-Cretg/tg males yielded embryos that were then selected for the appropriate developmental stages34. Embryos expressing motile cilia in the embryonic node at stages critical for asymmetric gene expression35 (starting at developmental stages ‘early allantoic bud’ up to two-somite stage) were used for experiments. Embryos were mounted with the embryonic node facing up in a custom-designed embryo mounting plate (Extended Data Fig. 10b–d). Laser cut holes (diameters 0.5–1.2 mm) in 0.8 mm Delrin ensured a good fit of the embryo into the holding well (Extended Fig. 10b, c). All embryonic node imaging was performed in DMEM/F12 with 10% fetal calf serum (Invitrogen). A similar mating strategy was used to obtain Arl13b–mCherry–GECO1.2tg:GCaMP6ftg:E2a-Cretg E14 embryos. Mouse embryonic fibroblasts were isolated from E14 embryos as described previously17. Where indicated, MEF cells were serum starved in DMEM containing 0.2% BSA for up to 48 h. To visualize cytoplasmic Ca2+ oscillations, Arl13b–mCherry–GECO1.2tg: GCaMP6ftg:E2a-Cretg embryos from late allantoic bud to late headfold stage were used. In brief, embryos were mounted in the upright position as described above and imaged for 4–6 min at a frame rate of 0.5 Hz on an upright FV1000 confocal system (Olympus, ×60/1.1 numerical aperture water dipping lens) at either 36 °C or 22 °C (room temperature). Cytoplasmic Ca2+ oscillations were quantified using ImageJ as described previously33 with slight modifications: in brief, fluorescence of all frames was averaged and individual frames were divided by average intensity to generate ΔF/F. Images were thresholded to exclude cells with ΔF/F less than 30%. Furthermore, only regions with area greater than 90 square pixels and circularities greater than 0.6 were used to define cells with cytoplasmic Ca2+ oscillations. All Ca2+ oscillations within 50 µm surrounding the embryonic node were analysed for occurrence on the left versus the right side of the node. The following reagents were used: mouse anti-acetylated tubulin (Sigma-Aldrich; T7451); CF 405M phalloidin to stain filamentous actin (Biotium; 00034); goat anti-PC2 (Santa Cruz; G-20 sc-10376), rat anti-mCherry (Life Technologies; M11240), chicken anti-EGFP (Aves Labs; GFP-1020). Cells or embryos were fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked by 10% donkey serum in PBS. Cells were labelled with the indicated antibody followed by secondary donkey anti-rabbit, anti-goat, or anti-mouse fluorescently labelled immunoglobulin-G (IgG) (Life Technologies) and Hoechst 33342 (Life Technologies). Confocal images were obtained using an inverted Olympus FV1000 (×60 1.2 numerical aperture water immersion objective lens) and images processed using ImageJ (NIH). Fixed (4% paraformaldehyde) 15 μm frozen tissue sections were permeabilized with 0.5% TX100/PBS (pH 7.4) for 15 min and blocked with PBS containing 5% goat serum, 1% BSA, 0.1% fish gelatin, 0.1% TX-100, and 0.05% Tween20. For primary antibodies raised in mice, endogenous mouse IgGs were blocked by incubating sections with the unconjugated Fab fragment goat anti-mouse IgG for 1 h at room temperature. For goat primary antibodies, donkey serum and donkey secondary antibodies were used. Sections were washed twice in PBS-T, and incubated with primary antibodies in blocking solution overnight at 4 °C. Slides were washed twice in PBS-T and goat anti-rabbit/anti-mouse fluorescent-labelled secondary antibodies applied at room temperature for 1 h with Hoechst 33342 (nuclear) dye. Sections were washed twice in PBS-T, mounted in Prolong Gold Antifade (Life Technologies), and imaged (inverted Olympus FV1000; ×60, 1.2 numerical aperture water immersion objective). Images were further processed with ImageJ (NIH). Arl13b–mCherry–GECO1.2-expressing cilia were observed under an upright Nikon NiE microscope (×100, 1.1 numerical aperture, 2.5 working distance) equipped with an Opterra swept-field confocal imaging system (Bruker Nano Technologies) and a Photometrics Evolve 128 liquid-cooled EMCCD camera (128 pixels × 128 pixels, 120 nm effective pixel size). This system enables fast imaging of up to 500–1,000 frames per second (f.p.s.) in low-light conditions. In most cases, tissue was illuminated sequentially by 488 nm (GECO1.2) and 561 nm (mCherry) laser light, and imaged using the full CCD chip (15 ms exposure per channel; 33 f.p.s.). To increase light delivery to the camera and avoid excessive photobleaching, swept-field confocal imaging was performed in slit mode (35 μm). mIMCD and MEF cells isolated from Arl13b–mCherry–GECO1.2tg mice were seeded in an IBIDI μ-Slide VI 0.4 flow chamber coated with laminin (see IBIDI Application Note 11; for this chamber, apical membrane shear stress is τ = η ×131.6 × Φ, where η is dynamic viscosity (0.01 dyn s−1 cm−2) and Φ is flow rate in millilitres per minute. A syringe pump (Harvard Apparatus) delivered steady flow via 10 ml syringes containing L-15 medium. Z-stacks of primary cilia were recorded on an inverted Olympus FV1000 (×60, 1.2 numerical aperture water immersion objective). The bend angle was measured between ciliary base and tip18. Fluid velocities were measured by imaging the flow of the solution supplemented with 300 nm green fluorescent beads (Sicastar greenF, Micromod) at the focal plane corresponding to ciliary tips at rest. Images were acquired as line scans (2 ms per line) or in continuous scanning mode (64 or 128 ms per frame) and particles tracked using an ImageJ plugin. Calibration was performed using an inverted Olympus FV1000 (×60, 1.2 numerical aperture water immersion objective) as described previously17. In brief, standard solutions of [Ca2+] (ranging from 50 nM to 50 μM) were prepared by adjusting the ratio of EGTA and CaCl (MaxChelator) in 137 mM NaCl, 5.4 mM KCl, 10 mM HEPES. After isolation, mIMCD cells were plated onto 12 mm laminin-coated glass coverslips (Neuvitro) and cultured for 3–4 days to allow cilia formation. For controls, digitonin membrane permeabilization (3 min) was followed by image acquisition in multiple fields of view. Ratios were obtained by dividing the average F (per ROI, corresponding to a single cilium) by the average F . The average ratios were plotted as a function of free [Ca2+] fitted to a sigmoid curve: y = A  + (A  − A )/{1 + exp[(x − x )/dx]}, where A  = 0.15 ± 0.03, A  = 1.58 ± 0.06, x  = 442 ± 25, dx = 114 ± 20, with x  = K (the dissociation constant). The K of bacterially expressed/purified GECO1.2 was 1.1 μM (ref. 36), about twice the K measured for our GECO1.2 fusion construct in mammalian cells in situ. [Ca2+] in embryonic node primary cilia was estimated from an R - and R -adjusted calibration curve, where both values were calculated from images collected on swept-field confocal imaging system. Late bud to late headfold embryos were permeabilized with 20 μM digitonin (5 min) in either 50 nM or 5 μM [Ca2+]. Resting values for nodal primary cilia were measured in DMEM/F12 + 10% FCS using the same imaging settings used to calculate and R . Ratios were converted to [Ca2+] using the adjusted Ca2+ calibration curve. Primary cilia and stereocilia bundle deflections were performed using a custom-made fluid-jet system. Briefly, the micropipette pressure at the back of the pipette could be rapidly changed to a desired value by supplying vacuum and/or pressurized air via feedback-controlled solenoid valves (5–10 ms rise time for the pressure step stimulus). The micropipette was filled with bath solution and the pressure at the mouth of the pipette carefully adjusted before approaching to the cilium, ensuring that there was no flow applied to the cilium before the onset of the stimulus. Depending on the experimental design, digitonin was applied to the cells either using the fluid-jet pipette, or via an additional pipette positioned near the cilium and connected to an IM-9C microinjector (Narishige). For kinocilium deflection experiments, organ of Corti explants were acutely dissected and mounted on a coverslip coated with CellTak, or immobilized with tungsten minutien pins (FST). All hair cell imaging experiments were performed at room temperature in L-15 cell culture medium (Invitrogen), containing in mM: NaCl (138), KCl (5.3), CaCl (1.3), MgCl (1.0), Na HPO (1.0), KH PO (0.44), MgSO (0.81). For stereocilia bundle Ca2+ imaging experiments, organ of Corti explants were dissected at P5 in L-15 medium and placed in culture in DMEM/F12 supplemented with 5% FBS and 10 mg l−1 ampicillin at 37 °C (10% CO ). Explants were cultured for 3 days to increase the number of cells with sufficient sensor in stereocilia bundles. All images were analysed using a custom-made MATLAB tracking algorithm (described below), ImageJ (NIH), and Origin 8 (OriginLab). Osteocyte-like cell lines MLO-Y4 and Ocy454 (ref. 37) were tested for authenticity in the laboratories that supplied them (see Acknowledgements) and for mycoplasma contamination by our laboratory. Both cell types were transfected with a plasmid encoding Arl13b–mCherry–GECO1.2 using electroporation (LONZA, solution V, program T-20), as described previously38. Cells were seeded on coverslips after transfection and cultured at 37 °C. Cells were used after a primary cilium was visible. Embryonic node cilia were deflected with either a fast fluid-jet stimulus (described above) or with a ramp of slow, physiological level flow, delivering up to ~10 μm s−1 velocities: fluid flowed from a gravity-fed open-ended syringe to the micropipette. Flow rates were calibrated using 100 nm fluorescent beads (Sicastar-greenF, Micromod) and adjusted by gently lifting the syringe up 5–10 mm using a coarse micromanipulator. Perfusion fluid contained 100 nm fluorescent beads at 10 μg ml−1 and was applied directly to the node via micropipette (pipette opening 4–6 μm in diameter) that was 4–6 μm away from the imaging area. Flow rates were adjusted manually as described above such that there was no net flow at the beginning of the experiment and ~10–12 μm s−1 velocity at the end of the 15 s imaging experiment. Bead velocities and tracks were quantified and visualized using the ‘manual tracking’ plugin in ImageJ. Pipette flow was calibrated using 300 nm fluorescent beads (Sicastar-greenF, Micromod) re-suspended at 0.5 mg ml−1 in DMEM/F12 10% FCS and loaded into micropipettes following sonication. A pressure stimulus was applied to the back of the pipette and steady flow imaged at 1,000 f.p.s. to ensure accurate frame-by-frame reading for each bead position while exiting the pipette and during its travel across the imaging area (~15 μm). The 1-ms time resolution of the calibration experiment was sufficient to resolve and calibrate the range of velocities used. Cultured mIMCD cells were fixed for 1 h at room temperature with 2.5% glutaraldehyde (Electron Microscopy Sciences) in 0.1 M sodium cacodylate buffer (pH 7.4), supplemented with 2 mM CaCl , and stored in distilled water. Organ of Corti explants were fixed following Ca2+ imaging experiments, or the entire cochlea was fixed, microdissected in distilled water and prepared for scanning electron microscopy as previously described39. Briefly, specimens were dehydrated in ethanol, critical point dried from liquid CO , mounted on a carbon tape, sputter-coated with 5 nm platinum, and imaged on a Hitachi S-4800 field emission scanning electron microscope. All images were analysed using a custom-made MATLAB tracking algorithm (described below), ImageJ (NIH), and Origin 8 (OriginLab). In stereocilia we observed a 2.9 ± 1.05 (mean ± s.d.) -fold change (effect size d = 2.76) in F /F after activation of a Ca2+-conducting mechanosensor. Assuming a one-sided, paired t-test conducted at the 0.05 level of significance, a minimum of 12 cells would be required to detect an effect size of d = 1 in mechanosensitive [Ca2+] increase post-stimulation with 95% power. Customized image analyses were developed using MATLAB to automatically process the large volume of ratiometric time-lapse data to improve quantitation and objectivity. The analysis was divided into three steps: channel alignment, object detection, and object tracking over time, with subsequent ratio calculations. Channel alignment. Two factors contribute to misalignment of two channels during image acquisition: chromatic aberration from the optics and time delay due to sequential acquisition. For chromatic aberration, the two channels from each frame of a given time-lapse image were aligned using a translational transformation. A global translational transformation, derived from the individual frame transformations, was applied to all frames. Object detection. Frame-by-frame superimposed images of both channels were created. When cilia motion was faster than acquisition time, channels were significantly misaligned. To create a combination image, two channels were added and smoothed using a Gaussian filter. Local image background was subtracted from the combination image, and Otsu thresholding used to detect objects. Small objects (less than three pixels) were filtered as noise. Object tracking with ratio calculations. Different cilia in the same image vary with relative orientation. During flow application, many cilia undergo large deflections and even cross one another, further complicating the tracking of individual cilia. A tracking algorithm based on object overlap was implemented. It included features such as splitting of crossed cilia, linking cilia with no spatial overlap, and closing gaps over a given number of time frames. Once an individual cilium was tracked, the analysis code measured the signal of the cilium from both channels, calculated the ratio, and plotted it against time or spatial displacement. The algorithms were developed in MATLAB in open-source, and are available upon request.


Experiments were performed in accordance with the regulations of the Institutional Animal Care and Use Committee of the University of California, San Diego. We used the following mouse lines: VGAT–ChR2–EYFP31 (Jackson Labs #014548), PV–Cre32 (Jackson Labs #008069), Gad2–Cre33 (Jackson Labs #010802) and Hoxd10–GFP34 (MMRRC #032065-UCD). Mice were bred by crossing homozygous VGAT–ChR2–EYFP, PV–Cre or Gad2–Cre males (all lines with a C57BL/6 background) with wild-type ICR females or homozygous Hoxd10–GFP females (ICR background) to C57BL/6 males. Mice were housed in a vivarium with a reversed light cycle (12 h day–12 h night). Mice of both genders were used for experiments at postnatal ages of 2–6 months. We used the following adeno-associated viruses (AAV) and canine adenovirus (CAV2): For the Cre recombinase (Cre)-dependent expression of Channelrhodopsin2 (ChR2)35, 36: AAV2/9.CAGGS.Flex.ChR2.tdTomato.SV40 (Addgene 18917; UPenn Vector Core). For the Cre-dependent expression of tdTomato: AAV2/1.CAG.Flex.tdTomato.WPRE.bGH (Allen Institute 864; UPenn Vector Core). For the expression of Cre: AAV2/9.hSyn.HI.eGFP-Cre.WPRE.SV40 (UPenn Vector Core). For Cre-dependent expression of the diphtheria toxin receptor (DTR)37: AAV2/1.Flex.DTR.GFP (Jessell laboratory; produced at UNC Vector Core). AAV2/9.CAGGS.Flex.ChR2.tdTomato.SV40 was bilaterally injected into the visual cortex of newborn PV–Cre or Gad2–Cre pups (postnatal day (P) 0–2). The virus was loaded into a bevelled glass micropipette (tip diameter 20–40 μm) mounted on a Nanoject II (Drummond) attached to a micromanipulator. Pups were anaesthetized by hypothermia and secured in a molded platform. In each hemisphere the virus was injected at two sites along the medial–lateral axis of the visual cortex. At each site we made three bolus injections of 28 nl. Each were at three different depths between 300 and 600 μm. Protein expression was verified by epi-fluorescent illumination through a dissection microscope (Leica MZ10F). Experiments were performed on animals with expression over the entire extent of visual cortex. AAV2/9.hSyn.HI.EGFP-Cre.WPRE.SV40 and AAV2/9.CAGGS.Flex.ChR2.tdTomato were mixed in 1:20 ratio. The mixture was injected into the visual cortex of newborn C57BL/6 pups (as described above). Protein expression was verified by epi-fluorescent illumination. Adult Hoxd10–GFP mice were anaesthetized with ~2% isoflurane (vol/vol) in O . The depth of anaesthesia was monitored with the toe-pinch response. The eyes were protected from drying by artificial tears. We cut open the scalp and thinned the skull to create a window of ~300–500 μm diameter. The remaining layer of bone in the window was thin enough to allow the penetration of the beveled glass pipette. A bolus of retrograde fluorescent microspheres (RetroBeads, Lumafluor Inc.) or CAV2.Cre virus (40 nl RetroBeads or 20 nl CAV2 virus) was injected into the NOT-DTN (coordinates (anteroposterior axis (AP) relative to bregma; mediolateral axis (ML) relative to the midline): AP: −1,260 μm; ML: 3,080 μm; depth: 1,960 μm; coordinates were adjusted based on the distance between bregma and lambda on mouse skull) using an UltraMicroPump (UMP3, WPI). The wound was sutured with a few stitches of 6-0 suture silk (Fisher Scientific NC9134710). Mice were perfused 3 days after the retrobead injection or 2 weeks after the CAV2 injection. AAV2/1.Flex.DTR.GFP was bilaterally injected into the visual cortex of VGAT–ChR2–EYFP pups between P0 and P2. CAV2.Cre virus was subsequently stereotactically injected into the NOT-DTN (same coordinates as above) bilaterally in mice of 2–6 months of age. Three to four weeks later we injected diphtheria toxin (DT 40 ng/g) intraperitoneally three times on alternate days. The OKR was assessed 11 or 12 days after the first diphtheria toxin injection. In control experiments, diphtheria toxin was replaced with PBS or diphtheria toxin was injected into mice that had not been infected with AAV2/1.Flex.DTR.GFP. Mice were implanted with a T-shaped head bar for head fixation. Mice were anaesthetized using ~2% isoflurane. The scalp and fascia were removed and a metal head bar was mounted over the midline using dental cement (Ortho-Jet powder; Lang Dental) mixed with black paint (iron oxide). We created a cranial window of ~3 × 3 mm (1.5–4.5 mm lateral to midline and 2.3–5.2 mm posterior to bregma) over the visual cortex on each hemisphere by gently thinning the skull until it appeared transparent when wetted by saline solution. The window was then covered with a thin layer of crazy glue. Following the surgery animals were injected subcutaneously with 0.1 mg/kg buprenorphine and allowed to recover in their home cage for at least 1 week. Several days before the test, mice were familiarized with head fixation in the recording setup. No visual stimulation was given. The horizontal OKR was elicited by a ‘virtual drum’ system39. Three computer LED monitors (Viewsonic VX2450wm-LED, 60-Hz refresh rate, gamma-corrected) were mounted orthogonally to each other to form a square enclosure that covered ~270° of visual field along the azimuth. The mouse head was immobilized at the centre of the enclosure with the nasal and temporal corners of the eye leveled. Visual stimuli were generated with Psychophysics Toolbox 3 running in Matlab (Mathworks). To ensure synchronized updating across multiple monitors we used AMD Eyefinity Technology (ATI FirePro V4800). The monitors displayed a vertical sinusoidal grating whose period (spacing between stripes) was adjusted throughout the azimuthal plane such that the projection of the grating on the eye had constant spatial frequency. In other words, the spatial frequency of the grating was perceived as constant throughout the visual field, as if the grating was drifting along the surface of a virtual drum. The dependence of pixel brightness on monitor coordinates was obtained by using this equation: B = L + L × C × sin(2π × x  × SF), where B is the brightness of pixels, L is the luminance in cd/m2, C is the contrast, SF is the spatial frequency and x is the azimuth of pixels in degrees, which is transformed from the Cartesian coordinates of the monitor into the cylindrical coordinates of the virtual drum by the following formula: x  = tan−1(x /D), where x is the horizontal pixel position in Cartesian coordinates and D is the distance from the centre of the monitors to the eye (Extended Data Fig. 1a). The grating drifted clockwise or counterclockwise in an oscillatory manner7, 11 (oscillation amplitude ± 5°; grating spatial frequency: 0.04–0.45 cpd; oscillation frequency 0.2–1 Hz, corresponding to a peak velocity of the stimulus of 6.28–31.4° s−1; contrast: 80%; mean luminance: 40 cd/m2). We chose the duration of the visual stimulus to allow the presentation of an integral number of oscillatory cycles (10 or 15 s for OKR test only; 7.5 s for simultaneous NOT-DTN electrophysiology and OKR test). Trials were spaced by an inter-stimulation interval of at least 8 s. The inter-stimulation interval following trials of cortical silencing was increased to 20 s. To measure the oscillation frequency tuning, spatial frequency was kept constant at 0.08 cpd; to measure the spatial frequency tuning oscillation, the frequency was kept at 0.4 Hz. To obtain the transfer function, we varied the spatial frequency of the visual stimulus rather than the oscillation frequency because OKR peak velocity is strongly modulated by spatial frequency and much less so by the oscillation frequency (consistent with previous observations7, 40; Extended Data Fig. 9a). The spatial frequency was varied from 0.04 to 0.45 cpd, and the oscillation frequency was kept constant at 0.4 Hz. To evaluate the directional preference of NOT-DTN neurons, one monitor was positioned 20 cm from the eye contralateral to the side of recording. Full-field sinusoidal drifting gratings (oscillation frequency: 1 Hz; spatial frequency: 0.08 cpd; mean luminance: 50 cd/m2; contrast: 100%) were used. Gratings were randomly presented at 12 equally spaced positions. The duration of the visual stimulus was 2 s and the inter-trial interval was 2.2 s. To visualize NOT-DTN with c-Fos immunostaining (c-Fos is an immediate early gene expressed in response to neuronal activity), OKR was elicited by drum stimulation of various spatial frequencies (0.04–0.45 cpd) with oscillation frequency 0.4 Hz, contrast 100% and luminance 50 cd/m2. Trials of oscillatory motion lasted for 15 s and were followed by an inter-trial interval of 8 s. The whole stimulation procedure took 60 min. The movement of the right eye was monitored through a high speed infrared (IR) camera (Imperx IPX-VGA 210; 100 Hz). The camera captured the reflection of the eye on an IR mirror (transparent to visible light, Edmund Optics #64-471) under the control of custom labview software and a frame grabber (National Instrument PCIe-1427). The pupil was identified online by thresholding pixel values or post hoc by combining thresholding and morphology operation and its profile was fitted with an ellipse to determine the centre. The eye position was measured by computing the distance between the pupil centre and the corneal reflection of a reference IR LED placed along the optical axis of the camera. To calibrate the measurement of the eye position, the camera and the reference IR LED were moved along a circumference centred on the image of the eye by ± 10° (Extended Data Fig. 1b). Three mouse lines (VGAT–ChR2–EYFP, PV–Cre and Gad2–Cre) were used in experiments involving optogenetic silencing of the visual cortex. They are equally efficient in silencing activity of visual cortex and interchangeable. VGAT–ChR2–EYFP mice were used in most of the silencing experiments, except in experiments illustrated in Extended Data Fig. 2a (PV–Cre line) and Extended Data Fig. 3b (all 3 lines). To photostimulate ChR2-expressing cortical inhibitory neurons in vivo, a 470-nm blue fibre-coupled LED (1 mm diameter, Doric Lenses) was placed ~5–10 mm above the cranial windows of each hemisphere. We restricted the illumination to the tissue under the cranial window by covering neighbouring areas with dental cement. An opaque shield of black clay prevented LED light from directly reaching the eyes. The total light power out of the LED fibre was 15–20 mW. Trials were alternated between visual stimulus alone and visual stimulus plus LED. The LED was turned on during the whole period of visual stimulation and turned off by ramping down the power over 0.5 s to limit rebound activation of the visual cortex. To photostimulate cortical input to the NOT-DTN in vivo, blue light illuminated only the visual cortex ipsilateral to the NOT-DTN where the probe was inserted. We dissected out the tissue overlying the horizontal semicircular canal in mice under ~2% isoflurane anaesthesia. A small hole was drilled in the canal with a miniature Busch Bur (0.25 mm, Gesswein) and the endolymph was partially drained. The horizontal semicircular canal was plugged with bone wax (FST 19009-00) to seal the opening and reduce the flow of the endolymph within the canal. The wound was sutured with a few stitches of 6/0 suture. Mice recovered for two days in their home cages before being tested for OKR. Sham lesions were done in the same way except that no hole was drilled and no wax was introduced in the semicircular canal. OKR gain (spatial frequency: 0.1 cpd; oscillation frequency: 0.4 Hz; contrast: 100%; mean luminance: 35 cd/m2) was assessed 1 day before and 1 h before OKR training. Two sessions (12 min) were used to minimize the effect of visual stimulation during OKR evaluation on OKR gain. During continuous OKR stimulation, a drum of the same visual parameters ran continuously for 38 min. OKR gain was then assessed again 12 min after OKR stimulation was finished. Mice were implanted with a T-shaped head bar for head fixation in the same way as described above for the OKR assessment, except that the procedure was done stereotactically with the help of an inclinometer (Digi-Key electronics 551-1002-1-ND). The inclinometer allowed us to calibrate the inclination of the two axis of the T bar relative to the anteroposterior (AP) and mediolateral (ML) axes of the skull before fixing it to the skull with dental cement. Three reference points with known coordinates were marked on the mouse skull because both bregma and lambda were inevitably masked by the dental cement holding the head bar. The head post on the recording rig was also calibrated with the same inclinometer to ensure that the recording probes were in register with the skull. Recordings from awake animals were performed using a method similar to that described previously43. One to two weeks before recording, mice were familiarized with head fixation within the recording setup over the course of two to four 50-min sessions. One day before recording, mice were anaesthetized with ~2% isoflurane. Whiskers and eyelashes contralateral to the recording side were trimmed to prevent interference with infrared video-oculography. To access the NOT-DTN we made an elongated, anteroposteriorly oriented craniotomy (~0.4 × 0.8 mm) around the coordinates of −3 mm (anteroposterior) and 1.3 mm (mediolateral). The coordinates were adjusted based on the distance between bregma and lambda on mouse skull. The craniotomy was then covered by Kwik-Cast Sealant (WPI). On the day of recording, after peeling off the Kwik-Cast cover, a drop of artificial cerebrospinal fluid (ACSF; in mM, 140 NaCl, 2.5 KCl, 2.5 CaCl , 1.3 MgSO , 1.0 NaH PO , 20 HEPES and 11 glucose, pH 7.4) was placed in the well of the craniotomy to keep the exposed brain moist. A 16-channel linear silicon probe (NeuroNexus a1x16-5mm-25-177) mounted on a manipulator (Luigs &Neumann) was slowly advanced into the brain to a depth of 2,000–2,200 μm. The occurrence of direction modulated activity upon visual stimulation was used to identify the NOT-DTN (see data analysis below). The probe was stained by lipophilic DiI to label the recording track for post hoc verification of successful targeting of the NOT-DTN. Recordings were not started until 20 min after insertion of the probe into the NOT-DTN. Signals were amplified 400-fold, band-pass filtered (0.3–5,000 Hz, with the presence of a notch filter) with an extracellular amplifier (A-M Systems 3600) and digitized at 32 kHz (National Instrument PCIe-6259) with custom-written software in Matlab. Raw data were stored on a computer hard drive for offline analysis. At the end of the recording session, brains were fixed by transcardial perfusion of 4% paraformaldehyde for histological analysis. Recordings from the superior colliculus or vLGN were done in the same way except that the coordinates of the craniotomy were 3.5 mm (anteroposterior) and 1 mm (mediolateral) for the superior colliculus and 2.5 mm (anteroposterior) and 2.3 mm (mediolateral) for the vLGN. For recordings from anaesthetized mice we used the same procedures as described above except that (1) the familiarization step was omitted and the craniotomy was performed immediately before recording; (2) animals were anaesthetized with urethane (1.2 g/kg, intraperitoneal) and given the sedative chlorprothixene (0.05 ml of 4 mg/ml, intramuscular), as previously described44; (3) body temperature was maintained at 37 °C using a feedback-controlled heating pad (FHC 40-90-8D); (4) a uniform layer of silicone oil was applied to the eyes to prevent drying; and (5) lactated Ringer’s solution was administrated at 3 ml/kg/h to prevent dehydration. Mice at postnatal days 15–30 were anaesthetized by intraperitoneal injection of ketamine and xylazine (100 mg/kg and 10 mg/kg, respectively), perfused transcardially with cold (0–4 °C) slice cutting solution ((in mM) 80 NaCl, 2.5 KCl, 1.3 NaH PO , 26 NaHCO , 20 d-glucose, 75 sucrose, 0.5 sodium ascorbate, 4 MgCl and 0.5 CaCl , 315 mOsm, pH 7.4, saturated with 95% O2/5% CO ) and decapitated. Brains were sectioned into coronal slices of 300–400 μm in cold cutting solution with a Super Microslicer Zero1 (D.S.K.). Slices containing the NOT-DTN were incubated in a submerged chamber at 34 °C for 30 min and then at room temperature (~21 °C) until used for recordings. During the whole procedure, the cutting solution was bubbled with 95% O /5% CO . Whole-cell recordings were done in ACSF (in mM: 119 NaCl, 2.5 KCl, 1.3 NaH PO , 26 NaHCO , 20 d-glucose, 0.5 sodium ascorbate, 4 MgCl , 2.5 CaCl , 300 mOsm, pH 7.4, saturated with 95% O /5% CO ). The ACSF was warmed to ~30 °C and perfused at 3 ml/min. NOT-DTN neurons were visualized with DIC infrared video-microscopy under a water immersion objective (40×, 0.8 NA) on an upright microscope (Olympus BX51WI) with an IR CCD camera (Till Photonics VX44). Whole-cell voltage-clamp recordings were performed with patch pipettes (borosilicate glass; Sutter Instruments) using a caesium-based internal solution ((in mM) 115 CsMeSO , 1.5 MgCl , 10 HEPES, 0.3 Na GTP, 4 MgATP, 10 Na -phosphocreatine, 1 EGTA, 2 QX-314-Cl, 10 BAPTA-tetracesium, 0.5% biocytin, 295 mOsm, pH 7.35). AMPA receptor-mediated EPSCs were recorded at the reversal potential for IPSCs (~−65 mV) and NMDA receptor-mediated EPSCs were recorded at +40 mV in the presence of the GABA receptor antagonist gabazine (5 μM, Tocris 1262) and the AMPA receptor antagonist NBQX (10 μM, Tocris 1044). To verify monosynaptic connectivity, we isolated NMDA receptor-mediated EPSCs in the presence of NBQX and high Mg2+ concentration (4 mM) or monosynaptic AMPA receptor-mediated EPSCs by a modified sCRACM approach45 in the presence of tetrodotoxin (TTX; 1 μM, Tocris 1069), 4-aminopyridine (4-AP; 1.5 mM, Abcam ab120122) and tetraethylammonium (TEA; 1.5 mM, ab120275). EPSCs were acquired and filtered at 4 kHz with a Multiclamp 700B amplifier, and digitized with a Digidata 1440A at 10 kHz under the control of Clampex 10.2 (Molecular Devices). Data were analysed offline with Clampfit 10.2 (Molecular Device). To photostimulate ChR2-expressing cortico-fugal axons, we delivered blue light using a collimated LED (470 nm) and a T-Cube LED Driver (Thorlabs) through the fluorescence illuminator port and the 40× objective. Light pulses of 10 ms and 5.5 mW/mm2 were given with a 20 s inter-stimulus interval. After recordings, slices were fixed by 4% paraformaldehyde for histology. After implanting the head bar, under anaesthesia (2% isoflurane), we dissected out part of the skull and removed, by aspiration, the area of the cortex and hippocampus overlaying the NOT-DTN. The identity of the NOT-DTN was assessed visually by its anatomy and stereotactic coordinates and verified electrophysiologically (see data analysis below). After the surgery, the mice were head-fixed and isoflurane was withdrawn. For at least the next 45 min, OKR performance and NOT-DTN activity were recorded. The GABA receptor agonist muscimol (0.2–1 mM in ACSF) was applied on top of the NOT-DTN. It took ~30 min for muscimol to silence the NOT-DTN, as assessed electrophysiologically. Pupillary dilation, as a side effect of silencing the olivary pretectal nucleus, was counteracted by topical application of 2% pilocarpine hydrochloride (agonist of muscarinic receptor, Tocris 0694) in saline to both eyes. Mice were perfused transcardially first with phosphate buffered saline (PBS, pH 7.4) and then with 4% paraformaldehyde in PBS (pH 7.4) under anaesthesia (ketamine 100 mg/kg and xylazine10 mg/kg; intraperitoneal injection). Brains were removed from the skull, post-fixed overnight in 4% paraformaldehyde and then immersed in 30% sucrose in PBS until they sank. Brains were subsequently coronally sectioned (40–60 μm sections) with a sliding microtome (Thermo Scientific HM450). Slices were incubated in blocking buffer (PBS, 5% goat serum (Life Technologies 16210-072), 1% Triton X-100) at room temperature for 2 h and then incubated with primary antibodies in blocking buffer at 4 °C overnight. The following primary antibodies were used: rabbit anti-GFP (1:1,000, Life Technologies A6455) and rabbit anti-c-Fos (1:1,000, Santa Cruz Biotechnology sc-52). The slices were washed three times with blocking buffer for 30 min each and then incubated with secondary antibodies conjugated with Alexa Fluor 488, 594 or 633 (1:800, Life Technologies A11008, A11012 or A21070, respectively) in blocking buffer for 2 h at room temperature. After being washed three times with blocking buffer for 10 min each, slices were mounted in Vectashield mounting medium containing DAPI (Vector Laboratories H1500). For c-Fos immunostaining, 90 min after the beginning of OKR stimulation (30 min after 60-min OKR simulation was finished), animals were perfused transcardially first with PBS and then with 4% paraformaldehyde in PBS. Brains were coronally sectioned into slices of 40 μm. To reveal the morphology of NOT-DTN neurons filled with biocytin, following fixation and blocking (see above), we incubated the slices with streptavidin conjugated with Alexa Fluor 647 (1:500, Life Technologies s32357) in blocking buffer overnight and then washed the slices three times. Images were acquired on a Leica SP5 confocal microscope, a Zeiss Axio Imager A1 epifluorescence microscope or an Olympus MVX10 stereoscope, and processed using ImageJ (National Institutes of Health). Analysis of eye tracking and in vivo electrophysiology was performed using custom-written codes in Matlab. Analysis of in vitro electrophysiology was done with Clampfit 10.2 (Molecular Devices). Saccade-like fast eye movements were removed from the recorded eye trajectory before computing OKR amplitude (Extended Data Fig. 1c). Saccades were detected as ‘spikes’ in the temporal derivative of the eye position (velocity) and replaced by linear interpolation. To derive the amplitude of the OKR we used the Fourier transform of the eye position as a function of time. The eye trajectories illustrated in this study are the averages of several cycles. The gain of the OKR was expressed as OKR gain = Amp /Amp , where Amp is the amplitude of eye movement and Amp the amplitude of drum movement. The OKR gain derived in the space domain is similar to that derived in the velocity domain (Extended Data Fig. 1f). In this study, we computed the gain in the space domain because deriving eye velocity from eye position introduces noise. Therefore, the OKR gain is 1 if the eye perfectly tracks the trajectory of the virtual drum and 0 if it does not track. The cortical contribution to the OKR gain is expressed as the percentage reduction in OKR gain caused by cortical silencing and calculated as ΔV (%) = (V − V )/V , where V and V are the values of the OKR gain measured under control conditions or during optogenetic cortical silencing, respectively. OKR potentiation is calculated as V / V , where V and V are the values of the OKR gain measured before and after vestibular lesion, respectively. The cortical contribution to OKR potentiation is expressed as PI = (ΔV − ΔV )/(ΔV − ΔV ), where ΔV and ΔV are the cortical contribution to the OKR gain before and after vestibular lesioning, respectively, and ΔV is the maximum possible cortical contribution to the OKR gain assuming that the entire amount of OKR potentiation depends on visual cortex. ΔV  = (V − V )/V . Hence PI is 1 if the entire amount of OKR potentiation depends on visual cortex and is 0 if the cortical contribution to OKR gain before vestibular lesion is the same as the cortical contribution to OKR gain after vestibular lesion (ΔV  = ΔV ) (Extended Data Fig. 3c, d). The cortical contribution to NOT-DTN activity is expressed as the cortical contribution to OKR gain but V and V are the firing rates of NOT-DTN neurons under control conditions or during optogenetic cortical silencing, respectively. Single units were isolated using spike-sorting Matlab codes, as described previously43. The raw extracellular signal was band-pass filtered between 0.5 and 10 kHz. Spiking events were detected with a threshold at 3.5 or 4 times the standard deviation of the filtered signal. Spike waveforms of four adjacent electrode sites were clustered using a k-means algorithm. After initial automated clustering, clusters were manually merged or split with a graphical user interface in Matlab. Unit isolation quality was assessed by considering refractory period violations and Fisher linear discriminant analysis. All units were assigned a depth according to the electrode sites at which their amplitudes were largest. Multi-unit spiking activity was defined as all spiking events exceeding the detection threshold after the removal of electrical noise or movement artefacts by the sorting algorithm. Individual spiking events were also assigned to one of the 16 recording sites according to where they showed the largest amplitude. For both single-unit activity and multi-unit activity, the visual response was computed as the mean firing rate during visual stimulation without baseline subtraction. Units recorded from visual cortex were assigned as regular-spiking neurons or fast-spiking putative inhibitory neurons based on the trough-to-peak times of spike waveforms43. A threshold of 0.4 ms was used to distinguish fast-spiking from regular-spiking units. The boundary of the NOT-DTN was determined by the appearance of a temporonasal directional bias in the multi-unit response to the visual stimulus. The preferred direction of an isolated NOT-DTN unit was determined by summing response vectors of 12 evenly spaced directions. The direction selectivity index (DSI) was calculated along the sampled orientation axis closest to the preferred direction according to the formula DSI = (R − R )/(R + R ), where R is the response at the preferred direction and R is the response at the opposite direction. The DSI of the response evoked by oscillatory drum movement was calculated as DSI = (R − R )/(R + R ), where R is the response during the temporonasal phase of drum movement and R is the response during the nasotemporal phase. The onset latency of optogenetically evoked activity of NOT-DTN neurons was determined as the time lag between the beginning of the LED illumination and the time point at which the firing rate reached three times the standard deviation of spontaneous activity. Similarly, the onset latency of optogenetically evoked EPSCs in NOT-DTN neurons was determined as the time lag between the beginning of the LED illumination and the time point at which the EPSC amplitude reached three times the standard deviation of baseline noise. Trial-by-trial jitter of optogenetically evoked EPSCs was calculated as the standard deviation of the onset latency. Analysis of c-Fos immunohistochemistry was performed with ImageJ (National Institutes of Health). c-Fos-positive cells were identified as continuous pixels after thresholding and counted automatically. To quantify the extent of overlap between arborization of GFP-expressing RGC axons and c-Fos expression in the NOT-DTN, their boundaries were manually drawn and the overlap coefficient r was calculated as where S1 is 1 if pixel i is within the domain of RGC axons, otherwise 0; and S2 is 1 if pixel i is within the domain of c-Fos immunohistochemistry, otherwise 0 (Extended Data Fig. 5c). For each animal, NOT-DTN multiunit activity was normalized to the average firing rate evoked by optimal spatial frequency. Data points of transfer functions from all animals were pooled, binned and averaged. The vectors (arrows in Extended Data Fig. 9g–i) start at the centre of mass of data points obtained at a given spatial frequency under control conditions (grey) and end at the centre of mass of data points obtained at the same spatial frequency during cortical silencing trials (blue). The x-axis value of the centre of mass is the NOT-DTN multiunit firing rate averaged over trials obtained at a given spatial frequency, normalized by the average firing rate evoked by the best spatial frequency. The y-axis value of the centre of mass is the average OKR gain obtained during the same trials. All samples or animals were included in the analysis except for the following exclusions: (1) in the analysis of OKR gain, trials in which video-oculography failed as a result of eye blinking or tears were excluded from analysis; (2) in Fig. 1g, h, one mouse was excluded from the analysis because its value of OKR potentiation was less than the threshold of 0.1; (3) in Fig. 3, two mice were excluded from the analysis because they were sick and lost a lot in body weight during experiments; (4) in Figs. 4, 5, one mouse was excluded because the identification of NOT-DTN failed; and (5) in statistics of the activities of superior colliculus and vLGN, recordings which were identified post hoc as missing the target structures were excluded from the analysis. These criteria were pre-established. Statistical analyses were done using statistics toolbox in Matlab. All data are presented as mean ± s.e.m. unless otherwise noted. Statistical significance was assessed using paired or unpaired t-tests and further confirmed with nonparametric Wilcoxon signed rank test or Wilcoxon rank sum test unless otherwise noted. Estimated sample sizes were retrospectively determined to achieve 80% power to detect expected effect sizes using Matlab. We did not intentionally select particular mice for treatment group or control group. No blinding was used. Owing to the limited sample size, the assumption of normal distribution was not tested. Nonparametric tests were used to confirm statistical significances reported by paired or unpaired t-tests. Thus, the conclusions of statistical tests were validated regardless of whether the data were normally distributed. The variance was not compared between groups. In t-tests, we assumed that samples were from distributions of unknown and unequal variances. The experiments were not randomized.


SANTA CLARA, Calif., Nov. 14, 2016 /PRNewswire/ -- Based on its recent analysis of the biometric identification market, Frost & Sullivan recognizes FST Biometrics with the 2016 Global Frost & Sullivan Award for Visionary Innovation Leadership. FST Biometrics emerged as a leading player in the biometric identification market by pioneering In Motion Identification (IMID) access, a multi-modal verification solution for instant, seamless, and non-invasive verification. This patented solution employs a fusion function algorithm that leverages both physiological and behavioral patterns to identify the subject – even when in motion – and to evaluate access eligibility. FST Biometrics employs biometric behavior technology to create a solution that mimics the way a human brain identifies individuals. It leverages functions such as face and voice recognition, video analytics, and, for higher security areas, can incorporate other identifiers including radio frequency identification (RFID) to enhance the fluidity of movement between secure areas. This allows it to eliminate shortcomings that are inherent in traditional biometric solutions, such as malfunctions and consequent downtimes. "The IMID access solution is software-centric, so it easily interoperates with existing access control systems and standard hardware, facilitating smooth and cost-effective installation," said Frost & Sullivan Best Practices Analyst, Taruna Hariparsad. "It can also analyze and identify multiple individuals simultaneously, addressing the need for scalability in areas with heavy traffic." FST Biometrics constantly enhances the behavioral and physiological profile of an individual through repetitive analysis, memorization, and adjustment, enabling FST Biometrics to achieve remarkably low false rejection rates (FRRs) of 3 out of 1,000 cases, and false acceptance rates (FARs) of 3 out of 10,000 cases. "FST Biometrics offers a range of solutions for different security options," noted Hariparsad. "For instance, it has the IMID Digital Doorman for a single access point, while the IMID Rapid is a short-term, event-oriented security system that fits into a suitcase and easily deploys. Lastly, the IMID Mobile service is an application that downloads onto an Android device and utilizes the camera to provide more information on authorized individuals." "This has been a critical year for FST as we ready ourselves for a major growth phase. We have gained significant traction across industries, have formed strategic partnerships with major security companies in Europe and the United States, and have expanded our management team with highly experienced leaders with proven track records," explained Maj. Gen. (res.) Aharon Zeevi Farkash, President of FST Biometrics. "We are honored that Frost & Sullivan has recognized the excellence and vision of our product, as this recognition strengthens our resolve to make IMID the standard of biometric identification globally." FST Biometrics' futuristic solutions deliver differentiated benefits that improve not only business performance, but also customers' work and personal lives. For its singular focus on innovating for the future, Frost & Sullivan is pleased to present it with the 2016 Global Frost & Sullivan Award for Visionary Innovation Leadership. Each year, Frost & Sullivan presents this award to the company that demonstrates the understanding to leverage global Mega Trends, integrating a vision into processes to achieve strategic excellence. The award recognizes the efficacy of the recipient's innovative process and the impact it has on business and society at large. Frost & Sullivan Best Practices awards recognize companies in a variety of regional and global markets for demonstrating outstanding achievement and superior performance in areas such as leadership, technological innovation, customer service, and strategic product development. Industry analysts compare market participants and measure performance through in-depth interviews, analysis, and extensive secondary research to identify best practices in the industry. FST Biometrics is a leading identity management solutions provider. The company's IMID™ product line offers access control through its proprietary In Motion Identification technology. This provides the ultimate security and convenience for users, who are accurately identified without having to stop or slow down. IMID™ solutions integrate a fusion of biometric and analytic technologies that include face recognition, body behavior analytics and voice verification. For more information, please visit www.fstbm.com. Frost & Sullivan, the Growth Partnership Company, works in collaboration with clients to leverage visionary innovation that addresses the global challenges and related growth opportunities that will make or break today's market participants. For more than 50 years, we have been developing growth strategies for the global 1000, emerging businesses, the public sector, and the investment community. Contact us: Start the discussion.


The superior accuracy and reliability of the game-changing IMID solution ensure secure and seamless access for the user SANTA CLARA, California, Nov. 14, 2016 /PRNewswire/ -- Based on its recent analysis of the biometric identification market, Frost & Sullivan recognizes FST Biometrics with the 2016 Global Frost & Sullivan Award for Visionary Innovation Leadership. FST Biometrics emerged as a leading player in the biometric identification market by pioneering In Motion Identification (IMID) access, a multi-modal verification solution for instant, seamless, and non-invasive verification. This patented solution employs a fusion function algorithm that leverages both physiological and behavioral patterns to identify the subject – even when in motion – and to evaluate access eligibility. FST Biometrics employs biometric behavior technology to create a solution that mimics the way a human brain identifies individuals. It leverages functions such as face and voice recognition, video analytics, and, for higher security areas, can incorporate other identifiers including radio frequency identification (RFID) to enhance the fluidity of movement between secure areas. This allows it to eliminate shortcomings that are inherent in traditional biometric solutions, such as malfunctions and consequent downtimes. "The IMID access solution is software-centric, so it easily interoperates with existing access control systems and standard hardware, facilitating smooth and cost-effective installation," said Frost & Sullivan Best Practices Analyst, Taruna Hariparsad. "It can also analyze and identify multiple individuals simultaneously, addressing the need for scalability in areas with heavy traffic." FST Biometrics constantly enhances the behavioral and physiological profile of an individual through repetitive analysis, memorization, and adjustment, enabling FST Biometrics to achieve remarkably low false rejection rates (FRRs) of 3 out of 1,000 cases, and false acceptance rates (FARs) of 3 out of 10,000 cases. "FST Biometrics offers a range of solutions for different security options," noted Hariparsad. "For instance, it has the IMID Digital Doorman for a single access point, while the IMID Rapid is a short-term, event-oriented security system that fits into a suitcase and easily deploys. Lastly, the IMID Mobile service is an application that downloads onto an Android device and utilizes the camera to provide more information on authorized individuals." "This has been a critical year for FST as we ready ourselves for a major growth phase. We have gained significant traction across industries, have formed strategic partnerships with major security companies in Europe and the United States, and have expanded our management team with highly experienced leaders with proven track records," explained Maj. Gen. (res.) Aharon Zeevi Farkash, President of FST Biometrics. "We are honored that Frost & Sullivan has recognized the excellence and vision of our product, as this recognition strengthens our resolve to make IMID the standard of biometric identification globally." FST Biometrics' futuristic solutions deliver differentiated benefits that improve not only business performance, but also customers' work and personal lives. For its singular focus on innovating for the future, Frost & Sullivan is pleased to present it with the 2016 Global Frost & Sullivan Award for Visionary Innovation Leadership. Each year, Frost & Sullivan presents this award to the company that demonstrates the understanding to leverage global Mega Trends, integrating a vision into processes to achieve strategic excellence. The award recognizes the efficacy of the recipient's innovative process and the impact it has on business and society at large. Frost & Sullivan Best Practices awards recognize companies in a variety of regional and global markets for demonstrating outstanding achievement and superior performance in areas such as leadership, technological innovation, customer service, and strategic product development. Industry analysts compare market participants and measure performance through in-depth interviews, analysis, and extensive secondary research to identify best practices in the industry. FST Biometrics is a leading identity management solutions provider. The company's IMID™ product line offers access control through its proprietary In Motion Identification technology. This provides the ultimate security and convenience for users, who are accurately identified without having to stop or slow down. IMID™ solutions integrate a fusion of biometric and analytic technologies that include face recognition, body behavior analytics and voice verification. For more information, please visit www.fstbm.com. Frost & Sullivan, the Growth Partnership Company, works in collaboration with clients to leverage visionary innovation that addresses the global challenges and related growth opportunities that will make or break today's market participants. For more than 50 years, we have been developing growth strategies for the global 1000, emerging businesses, the public sector, and the investment community. Contact us: Start the discussion.


VREDEN, GERMANY--(Marketwired - October 24, 2016) - Quadrant Engineering Plastic Products (EPP), the world's leading manufacturer of semi-finished engineering plastic materials, showcases its portfolio of products and solutions for the Aerospace industry at this year's Airtec show. Quadrant's polymer solutions in Aerospace industry are dedicated to metal-to-plastics conversion. As a further development to the broad existing portfolio, and to address the market trend for mechanically higher loaded plastic solutions, Quadrant is now launching a special range of polymers being suitable for use in structural aircraft construction: Quadrant's HLS-Series: Composite Materials for High Load Solutions. These are special carbon fibre reinforced composite materials [Ketron® CC PEEK, Duratron® CC PEI, Techtron® CC PPS and KyronMAX™], available in various thicknesses and geometries, offering endless design opportunities to engineers. Frank Johänning, Global Market Manager for Aerospace at Quadrant EPP comments: "These materials achieve metal like mechanical characteristics by offering all advantages of thermoplastic polymers like corrosion resistance and recyclability. The market has been waiting for this development. It offers a higher level of functional integration of advanced engineering polymers in aircraft." Quadrant's materials are accredited to the most important globally stringent certifications and approvals, such as AS9100C, ISO 9001, ISO 14001, OEM approvals and JAR/FAR 25.853. Fire, smoke and toxicity (FST) resistant materials complete the portfolio. In addition, Quadrant combines extensive engineering expertise and in-depth application knowledge across a wide range of components in bearing, wear and gear functions for key aircraft sub-assemblies, including interiors, propulsion, systems and structures. Johänning emphasizes: "By focusing on constant innovation we keep pace with the developments and requirements of the evolving and dynamic global Aerospace market. The Airtec show offers a great opportunity to demonstrate how our innovative advanced polymers help to increase safety and reliability and improve productivity." To find out more about Quadrant Engineering Plastic Products, visit www.quadrantplastics.com. Quadrant Engineering Plastic Products (Quadrant EPP) is the world's leading manufacturer of semi-finished products. Quadrant EPP's materials range from UHMW polyethylene, nylon and acetal to ultra-high performance polymers that resist temperatures to over 425°C. The company's rods, sheets, tubes and custom shapes are among others used to machine components for the semiconductor manufacturing, aerospace, electronics, chemical processing and various other industries. Quadrant EPP also manufactures finished products for these industries. Products and services are available through a worldwide network of branch offices, technical support centres and authorized dealers. Learn more about Quadrant EPP at www.quadrantplastics.com. Quadrant is a leading global manufacturer of high-performance thermoplastic materials in the form of semifinished products and finished parts. The company has locations in 20 countries and more than 2 000 employees. Its specialty engineering thermoplastics and composites are superior in performance to metals and other materials and are used in a wide range of applications, primarily in the capital goods industry. Together with leaders in a broad variety of customer markets, Quadrant is continuously developing new areas of application. With its new owner Mitsubishi Plastics, Inc., Quadrant is well prepared to expand its market leadership position in the future. Nylatron®, is a registered trademark of the Quadrant Group.


News Article | February 27, 2017
Site: www.prweb.com

General Plastics Manufacturing Company, leading provider of high performance rigid and flexible polyurethane foam and build-to-print parts, will participate in this year’s JEC World International Composites Event in Paris, France on March 14 – 16, booth R39a in Hall 6. The company will showcase various product lines which address the industry challenge of producing lighter, stronger and cost-effective composite parts, with an emphasis on safety. “General Plastics has consistently worked towards providing sophisticated, high-value solutions to its customers over the past 75 years,” said Dr. Mitchell Johnson, President of General Plastics. “This year’s event gives us another opportunity to participate in several conversations, have a better understanding of the challenges faced by our customers, and provide solutions to help address those challenges.” Rigid Foam Sheets, Blocks and Molded Parts Conference attendees can expect to see application samples of General Plastics’ signature LAST-A-FOAM® rigid foam series. Due to unique chemical formulas, products are exceptionally uniform and consistent in all physical properties, strong, durable and versatile. Customers have a wide range of products to select from based on application specifications, including tooling and core requirements. Included is FST/OSU-compliant FR-3800 FST rigid foam which can be thermoformed under specific conditions, is easy to machine and bonds securely with composite skins. This foam series, as well as two LAST-A-FOAM® rigid foam product lines - FR-4700 for applications with peak temperature up to 400°F and FR-6700 which complies with aerospace specifications – are also supplied as complex molded or cast parts. This rigid, self-skinning foam can be shaped based on customers’ requirements, and texture and color specified. Some aircraft interior applications include various panel configurations, decorative flyaway parts, and as replacement for aluminum parts. Non-aerospace customers may also benefit where applications require raw material cost reduction, light-weighting and cost savings for high throughput parts. Flexible Foam Molded Parts In addition to rigid foam sheets, blocks and molded parts, General Plastics produces custom molded parts that are manufactured from flame-retardant, self-extinguishing and self-skinning flexible polyurethane foam materials. Examples of typical molded parts include various flight deck components, bin-to-bin closeout seals, header seals, and armrest pads. Services offered include part and tool design, mold tooling manufacture, and production of parts through all phases to completion. General Plastics proven build-to-print capabilities and high-capacity production facilities enable it to scale production from small runs of specialty parts to ongoing, high-volume OEM and Tier 1 and Tier 2 parts programs. FAA-Certified Flammability Testing Services Information on General Plastics’ testing services will also be available at the event. The company offers a wide range of flammability and mechanical testing services in General Plastics' on-site testing laboratory. General Plastics’ FAA-approved operations span the following flammability tests: About General Plastics Manufacturing Company     Tacoma, Washington-based General Plastics Manufacturing Company has been a leading innovator in the plastics industry for 75 years. The company develops and manufactures rigid and flexible polyurethane foam products, which include its signature LAST-A-FOAM® brand series and build-to-print composite parts. Directly or through its network of distributors, General Plastics serves the aerospace and defense, nuclear packaging, composite core, prototype and modeling, construction, dimensional signage, testing and marine industries. General Plastics is certified to ISO 9001:2008/AS9100C and meets the rigorous demands of numerous leading quality systems, which include NQA-1, Mil-I-45208A and Boeing Company D6-82479. Please visit http://www.generalplastics.com.


News Article | November 16, 2016
Site: www.prnewswire.co.uk

SHENZHEN, Chine, 16 novembre 2016 /PRNewswire/ -- ZTE Corporation (0763.HK / 000063.SZ), un important fournisseur mondial de solutions technologiques pour les télécommunications, les entreprises et le grand public pour l'Internet mobile, a annoncé aujourd'hui que sa solution intelligente de connexion de diagnostic embarqué (OBD) a été choisie par TeliaSonera, le plus grand fournisseur de services de télécommunications (FST) en Europe du Nord, pour alimenter son service de télématique, TELIA SENSE. Disponible depuis le 1er novembre en Suède, le service TELIA SENSE allie le dispositif innovant de l'Internet des objets (Ido) de ZTE, développé par ZTEWelink, une filiale de ZTE axée sur le M2M/IdO, à une plateforme nuagique et une application de SpringWorks, un fournisseur de plateforme télématique sous l'égide de Telia. TELIA SENSE fournit aux utilisateurs une expérience enrichissante de l'application. S'appuyant sur le dispositif intelligent OBD 4G, TELIA SENSE offre aux utilisateurs une connexion Wi-Fi 4G stable et fiable qui peut relier jusqu'à 10 dispositifs à la fois. Les utilisateurs peuvent aussi voir l'emplacement du véhicule, installer des barrières virtuelles ou recevoir des alertes de perturbations ou nuisances autour du véhicule par le biais d'une application, pour mieux comprendre le comportement au volant ou économiser sur la consommation de carburant. Grâce à une collaboration entre Telia et un fournisseur de services tiers, les utilisateurs peuvent aussi obtenir du carburant moins cher et trouver le garage le plus proche en cas de panne ou de besoin d'entretien du véhicule. TELIA SENSE devrait lancer des services supplémentaires à l'avenir. « En termes d'IdO automobile, la voiture connectée remplace rapidement les smartphones car de plus en plus d'opérateurs et de FST choisissent de se développer sur le marché de l'IdO avec une solution de connexion OBD, ce qui va leur apporter les données nécessaires pour développer davantage de services à valeur ajoutée », a déclaré Zhang Shumin, vice-président de ZTE Corporation. « Nous sommes très heureux de faire équipe avec Telia de façon à les aider à donner de meilleurs services aux automobilistes par le biais de données télématiques. » En tant que fournisseur de solutions de communications sans fil, ZTEWelink explore continuellement le domaine de la télématique en vertu de la stratégie mobile ICT (M-ICT) de ZTE. À présent, l'entreprise peut fournir une solution de dispositif, une solution totale de dispositif et de plateforme, une solution d'interopérabilité standard entre les FST et un serveur d'application, ainsi de nombreux cas de figure de démonstration pour servir de références aux constructions des différentes plateformes dont les clients pourraient avoir besoin dans différents types de situation, et dans des emplacements géographiques variés. ZTE fournit des systèmes sophistiqués de télécommunications, des dispositifs mobiles et des solutions technologiques d'entreprise au grand public, aux opérateurs, aux entreprises et aux pouvoirs publics. Dans le cadre de la stratégie M-ICT de ZTE, la société entend offrir à ses clients des innovations de bout en bout intégrées pour assurer excellence et bon rapport qualité-prix, à l'heure où convergent les secteurs des télécommunications et de l'informatique. Cotés sur les bourses de Hong Kong et de Shenzhen (cote pour les actions H : 0763.HK / cote pour les actions A : 000063.SZ), les produits et services ZTE sont vendus à plus de 500 opérateurs dans plus de 160 pays. ZTE consacre 10 pour cent de son chiffre d'affaires annuel à la recherche et au développement, et elle occupe un rôle éminent dans des organisations internationales de normalisation. ZTE est attachée à la responsabilité sociétale des entreprises, et elle participe au Pacte mondial de l'ONU. Pour en savoir plus, rendez-vous sur www.zte.com.cn.

Loading FST collaborators
Loading FST collaborators