Genève, Switzerland
Genève, Switzerland

Time filter

Source Type

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. The deletion allele Ime4∆22-3 was obtained from imprecise excision of the transposon P{SUPor-P}KrT95D and mapped by primers 5933 F1 (CTCGCTCTATTTCTCTTCAGCACTCG) and 5933 R9 (CCTCCGCAACGATCACATCGCAATCGAG). To obtain a viable line of Ime4null, the genetic background was cleaned by out-crossing to Df(3R)Exel6197. Flight ability was scored as the number of flies capable of flying out of a Petri dish within 30 s for groups of 15–20 flies for indicated genotypes. Viability was calculated from the numbers of females compared to males of the correct genotype and statistical significance was determined by a χ2 test (GraphPad Prism). Unfertilized eggs were generated by expressing sex-peptide in virgin females as described30. The genomic rescue construct was retrieved by recombineering (Genebridges) from BAC clone CH321-79E18 by first cloning homology arms with SpeI and Acc65I into pUC3GLA separated by an EcoRV site for linearization (CTCCGCCGCCGGAACCGCCGCCTCCTCCGCCACTTTGCAGGTTGAGCGGACCGCCTCCA GGGCCGCTGCCGCCGGTGCCGCTGATATCCCAGCATGGTAGCTGCGGCCACTCCTAGTC CCGCCTTTAACCACAGCTTGGGGTCCTCCGTCATCAGGCCGAATTGCCTCGAG). An HA-tag was then fused to the end of the ORF using two PCR amplicons and SacI and XhoI restriction sites. This construct was the inserted into PBac{y+-attB-3B}VK00002 at 76A as described31. The Ime4 UAS construct was generated by cloning the ORF from fly cDNA into a modified pUAST with primers Adh dMT-A70 F1 EI (GCAGAATTCGAGATCtAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCATGGCAGATGC GTGGGACATAAAATCAC) and dMT-A70 HA R1 Spe (GGTAACTAGTCTTTTGTATTCCATTGATCGACGCCGCATTGG) by adding a translation initiation site from the Adh gene and two copies of an HA tag to the end of the ORF. This construct was then also inserted into PBac{y+-attB-3B}VK00002 at 76A. For transient transfection in S2 cells, YT52B-1 and CG6422 ORFs were amplified from fly cDNA by a combination of nested and fusion PCR incorporating a translation initiation site from the Adh gene using primers CG6422 Adh F1 (GCCTGCTAAAGCAAAAAAGAAGTCACCACATGTCAGGCGTGGATCAGATGAAAATACCAG), pACT Adh CG6422 F1 (CCAGAGACCCCGGATCCAGATATCAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCAC), CG6422 Adh R1, (GATTCCTGCGAACAGGTCCCGTGGGCGAAAC) and CG6422 3′ F1 (CCCACGGGACCTGTTCGCAGGAATCTAG), CG6422 3′ R1 (CATTGCTTCGCATTTTATCCTTGTCCGTGTCCTTAAAGCGCACGCCGATTTTAATTTG), pACT CG6422 3×HA R1 (GTGGAGATCCATGGTGGCGGAGCTCGAGGAATATTCATTGCTTCGCATTTTATCCTTGTC) for CG6422 and primers YT521 Adh F1, (AAGCAAAAAAGAAGTCACATGCCAAGAGCAGCCCGTAAACAAACGCTGCCGATGCGCGAG), pACT Adh YT521 F1 (CCAGAGACCCCGGATCCAGATATCAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACATGCC), YT521 Adh R1 (TGCCATCCGGGCGAATCCTGCAAATTTACCACTCTCGTTGACCGAGAAAATGAGCAGGAC) and YT521 3′ F1(GCAGGATTCGCCCGGATGGCAGCCCCCTCAC), pact YT521 R1 (GGTGGAGATCCATGGTGGCGGAGCTCGAGCGCCTGTTGTCCCGATAGCTTCGCTG) for YT521-B, and cloned into a modified pACT using Gibson Assembly (NEB) also incorporating HA epitope tags at the C terminus. Constructs were verified by Sanger sequencing. The Sxl-HA expression vector was a gift from N. Perrimon32. The YT521-B UAS construct was generated by sub-cloning the ORF from the pACT vector into a modified pUAST with primers YT521 Adh F1 (AAGCAAAAAAGAAGTCACATGCCAAGAGCAGCCCGTAAACAAACGCTGCCGATGCGCGAG), YT521 Adh F2 (TAGGGAATTGGGAATTCGAGATCTAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACATGCC) and YT521 3′ R1 (GGGCACGTCGTAGGGGTACAGACTAGTCTCGAGGCGCCTGTTGTCCCGATAGCTTCGCTG) by adding a translation initiation site from the Adh gene and two copies of an HA tag to the end of the ORF. This construct was then also inserted into PBac{y+-attB-3B}VK00002 at 76A. Essential parts of all DNA constructs were sequence-verified. S2 cells (ATCC) were cultured in Insect Express medium (Lonza) with 10% heat-inactivated FBS and 1% penicillin/streptomycin. The Drosophila S2 cell line was verified to be male by analysing Sxl alternative splicing using species-specific primers Sxl F2 (ATGTACGGCAACAATAATCCGGGTAG) and Sxl R2 (CATTGTAACCACGACGCGACGATG) to confirm species and gender (Extended Data Fig. 8). Transient transfections were done with Mirus Reagent (Bioline) according to the manufacturer’s instruction and cells were assayed 48 h after transfection for protein expression or RNA binding of expressed proteins. To adhere S2 cells to a solid support, Concanavalin A (Sigma) coated glass slides (in 0.5 mg ml−1) were added 1 day before transfection, and cells were stained 48 h after transfection with antibodies as described. Transfections and follow up experiments were repeated at least once. Total RNA was extracted using Tri-reagent (SIGMA) and reverse transcription was done with Superscript II (Invitrogen) according to the manufacturer’s instructions using an oligodT17V primer. PCR for Sxl, tra, msl2 and ewg was done for 30 cycles with 1 μl of cDNA with primers Sxl F2, Sxl R2 or Sxl NP R3 (GAGAATGGGACATCCCAAATCCACG), Sxl M F1 (GCCCAGAAAGAAGCAGCCACCATTATCAC), Sxl M R1 (GCGTTTCGTTGGCGAGGAGACCATGGG), Tra FOR (GGATGCCGACAGCAGTGGAAC), Tra REV (GATCTGGAGCGAGTGCGTCTG), Msl-2 F1 (CACTGCGGTCACACTGGCTTCGCTCAG), Msl-2 R1 (CTCCTGGGCTAGTTACCTGCAATTCCTC), Ewg 4F and Ewg 5R and quantified with ImageQuant (BioRad)22. Experiments included at least three biological replicates. For qPCR, reverse transcription was carried out on input and pull-down samples spiked with yeast RNA using ProtoScript II reverse transcriptase and random nanomers (NEB). Quantitative PCR was carried out using 2× SensiMix Plus SYBR Low ROX master mix (Quantace) using normalizer primers ACT1 F1 (TTACGTCGCCTTGGACTTCG) and ACT1 R1 (TACCGGCAGATTCCAAACCC) and for Sxl, Sxl ZB F1 (CACCACAATGGCAGCAGTAG) and Sxl ZB R1 (GGGGTTGCTGTTTGTTGAGT). Samples were run in triplicate for technical repeats and duplicate for biological repeats. Relative enrichment levels were determined by comparison with yeast ACT1, using the method33. For immunoprecipitations of Sxl RNA bound to Sxl or YTH proteins, S2 cells were fixed in PBS containing 1% formaldehyde for 15 min, quenched in 100 mM glycine and disrupted in IP-Buffer (150 mM NaCl, 50 mM Tris–HCL, pH 7.5, 1% NP-40, 5% glycerol). After IP with anti-HA beads (Sigma) for 2 h in the presence of Complete Protein Inhibitor (Roche) and 40 U RNase inhibitors (Roche), IP precipitates were processed for Sxl RT–PCR using gene-specifc RT primer SP NP2 (CATTCCGGATGGCAGAGAATGGGAC) and PCR primers Sxl NP intF (GAGGGTCAGTCTAAGTTATATTCG) and Sxl NP R3 as described31. Western blots were done as described using rat anti-HA (1:50, clone 3F10, Roche) and HRP-coupled secondary goat anti-rat antibodies (Molecular Probes)34. All experiments were repeated at least once from biological samples. Poly(A) mRNA from at least two rounds of oligo dT selection was prepared according to the manufacturer (Promega). For each sample, 10–50 ng of mRNA was digested with 1 μl of Ribonuclease T1 (1,000 U μl−1; Fermentas) in a final volume of 10 μl in polynucleotide kinase buffer (PNK, NEB) for 1 h at 37 °C. The 5′ end of the T1-digested mRNA fragments were then labelled using 10 U T4 PNK (NEB) and 1 μl [γ-32P]-ATP (6,000 Ci mmol−1; Perkin-Elmer). The labelled RNA was precipitated, resuspended in 10 μl of 50 mM sodium acetate buffer (pH 5.5), and digested with P1 nuclease (Sigma-Aldrich) for 1 h at 37 °C. Two microlitres of each sample was loaded on cellulose TLC plates (20 × 20 cm; Fluka) and run in a solvent system of isobutyric acid: 0.5 M NH OH (5:3, v/v), as the first dimension, and isopropanol:HCl:water (70:15:15, v/v/v), as the second dimension. TLCs were repeated from biological replicates. The identification of the nucleotide spots was carried out using m6A-containing synthetic RNA. Quantification of 32P was done by scintillation counting (Packard Tri-Carb 2300TR). For the quantification of spot intensities on TLCs or gels, a storage phosphor screen (K-Screen; Kodak) and Molecular Imager FX in combination with QuantityOne software (BioRad) were used. For immunoprecipitation of m6A mRNA, poly(A) mRNA was digested with RNase T1 and 5′ labelled. The volume was then increased to 500 μl with IP buffer (150 mM NaCl, 50 mM Tris–HCL, pH 7.5, 0.05% NP-40). IPs were then done with 2 μl of affinity-purified polyclonal rabbit m6A antibody (Synaptic Systems) and protein A/G beads (SantaCruz). Whole-fly extracts were prepared from 20–30 adult Drosophila previously frozen in liquid N and ground into fine powder in liquid N . Cells were then lysed in 0.5 ml lysis buffer (0.3 M NaCl, 15 mM MgCl , 15 mM Tris-HCl pH 7.5, cycloheximide 100 μg ml−1, heparin (sodium salt) 1 mg ml−1, 1% Triton X-100). Lysates were loaded on 12 ml sucrose gradients and spun for 2 h at 38,000 r.p.m. at 4 °C. After the gradient centrifugation 1-ml fractions were collected and precipitated in equal volume of isopropanol. After several washes with 80% ethanol the samples were resuspended in water and processed. Experiments were done in duplicate. Drosophila nuclear extracts were prepared from Kc cells as described35. Templates for in vitro transcripts were amplified from genomic DNA using the primers listed below and in vitro transcribed with T7 polymerase in the presence of [α-32P]-ATP. DNA templates and free nucleotides were removed by DNase I digestion and Probequant G-50 spin columns (GE Healthcare), respectively. Markers were generated by using in vitro transcripts with or without m6ATP (Jena Bioscience), which were then digested with RNase T1, kinased with PNK in the presence of [γ-32P]-ATP. After phenol extraction and ethanol precipitation, transcripts were digested to single nucleotides with P1 nuclease as above. For in vitro methylation, transcripts (0.5–1 × 106 c.p.m.) were incubated for 45 min at 27 °C in 10 μl containing 20 mM potassium glutamate, 2 mM MgCl , 1 mM DTT, 1 mM ATP, 0.5 mM S-adenosylmethionine disulfate tosylate (Abcam), 7.5% PEG 8000, 20 U RNase protector (Roche) and 40% nuclear extract. After phenol extraction and ethanol precipitation, transcripts were digested to single nucleotides with P1 nuclease as above, and then separated on cellulose F TLC plates (Merck) in 70% ethanol, previously soaked in 0.4 M MgSO and dried36. In vitro methylation assays were done from biological replicates at least in duplicates. Primers to amplify parts of the Sxl alternatively spliced intron from genomic DNA for in vitro transcription with T7 polymerase were Sxl A T7 F (GGAGCTAATACGACTCACTATAGGGAGAGGATATGTACGGCAACAATAATCCGGGTAG) and Sxl A R (CGCAGACGACGATCAGCTGATTCAAAGTGAAAG), Sxl B T7 F (GGAGCTAATACGACTCACTATAGGGAGAGCGCTCGCATTTATCCCACAGTCGCAC) and Sxl B R (GGGTGCCCTCTGTGGCTGCTCTGTTTAC), Sxl C T7 F (GGAGCTAATACGACTCACTATAGGGGTCGTATAATTTATGGCACATTATTCAG) and Sxl C R (GGGAGTTTTGGTTCTTGTTTATGAGTTGGGTG), Sxl D T7 F (GGAGCTAATACGACTCACTATAGGGAGAAAACTTCCAGCCCACACAACACACAC) and Sxl D R (GCATATCATATTCGGTTCATACATTTAGGTCTAAG), Sxl E T7 F (GGAGCTAATACGACTCACTATAGGGAGAGGGGAAGCAGCTCGTTGTAAAATAC) and Sxl E R (GATGTGACGATTTTGCAGTTTCTCGACG), Sxl F T7 F (GGAGCTAATACGACTCACTATAGGGAGAGGGGGATCGTTTTGAGGGTCAGTCTAAG) and Sxl NP2, Sxl C T7 F and Sxl C1 R (GTAGTTTTGCTCGGCATTTTATGACCTTGAGC), Sxl C2 F (GGAGCTAATACGACTCACTATAGGGAGACTCTCATTCTCTATATCCCTGTGCTGACC) and Sxl C2 R (CTAATTTCGTGAGCTTGATTTCATTTTGCACAG), Sxl C3 F (GGAGCTAATACGACTCACTATAGGGAGACTGTGCAAAATGAAATCAAGCTCACGAAATTAG) and Sxl C R, Sxl E T7 F and Sxl E1 R (AAAAAAATCAAAAAAATAATCACTTTTGGCACTTTTTCATCAC), Sxl E2 F (GGAGCTAATACGACTCACTATAGGGAGATGAAAAAGTGCCAAAAGTGATTATTTTTTTG), Sxl E2 R (AAAAGCATGATGTATTTTTTTTTTTTTGTACTTTCGAATCACCG), Sxl E3 F (GGAGCTAATACGACTCACTATAGGGAGACGGTGATTCGAAAGTACAAAAAAAAAAAAATAC) and Sxl E R, Sxl C4 F (GAGCTAATACGACTCACTATAGGGAGAAATACTAAAACATCAAACCGCAAGCAGAGCAGC) and Sxl C4 R (GAGTGCCACTTCAAAATCTCAGATATGC), Sxl C5 F (CTAATACGACTCACTATAGGGAGACTCTTTTTTTTTTTCTTTTTTTTACTGTGCAAAATG) and Sxl C5 R (AAAAAAATATGCAAAAAAAAAAAGGTAGGGCACAAAGTTCTCAATTAC), Sxl C6 F (GAGCTAATACGACTCACTATAGGGAGACTGTGCAAAATGAAATCAAGCTCACGAAATTAG) and Sxl C6 R (CAATTTCACTATATGTACGAAAACAAAAGTGAG), Sxl E4 F (GGAGCTAATACGACTCACTATAGGGAGAACCAAAATTCGACGTGGGAAGAAAC) and Sxl E4 R (TAATCACTTTTGGCACTTTTTCATCACATTAAC), Sxl E5 F (GGCTAATACGACTCACTATAGGGAGATTTTTTTGATTTTTTTAAAGTGAAAATGTGCTCC) and Sxl E5 R (CACCGAAAAAAAATAAAAAAAAATAATCATGGGACTATACTAG), Sxl E6 F (GGCTAATACGACTCACTATAGGGAGACTTAAGTGCCAATATTTAAAGTGAAACCAATTG) and Sxl E6 R (CCCCCAGTTATATTCAACCGTGAAATTCTGC). Total RNA was extracted from 15 pulverized head/thoraces previously flash-frozen in liquid nitrogen, using TRIzol reagent from white (w) control and w;Ime4∆22-3 females that have been outcrossed for several generations to w;Df(3R)Exel6197 to equilibrate genetic background. Total RNA was treated with DNase I (Ambion) and stranded libraries for Illumina sequencing were prepared after poly(A) selection from total RNA (1 μg) with the TruSeq stranded mRNA kit (Illumina) using random primers for reverse transcription according to the manufacturer’s instructions. Pooled indexed libraries were sequenced on an Illumina HiSeq2500 to yield 40–46 million paired-end 100 bp reads, and in a second experiment 14–19 million single-end 125-bp reads for three controls and mutants each. After demultiplexing, sequence reads were aligned to the Drosophila genome (dmel-r6.02) using Tophat2.0.6 (ref. 37). Differential gene expression was determined by Cufflinks-Cuffdiff and the FDR-correction for multiple tests to raw P values with q < 0.05 considered significant38. alternative splicing was analysed by SPANKI39 and validated for selected genes based on length differences detectable on agarose gels. Illumina sequencing, differential gene expression and alternative splicing analysis was done by Fasteris (Switzerland). For dosage compensation analysis, differential expression analysis of X-linked genes versus autosomal genes in Ime4null mutant was done by filtering Cuffdiff data by a P value expression difference significance of P < 0.05, which corresponds to a false discovery rate of 0.167 to detect subtle differences in expression consistent with dosage compensation. Visualization of sequence reads on gene models and splice junctions reads in Sashimi plots was done using Integrated Genome Viewer40. For validation of alternative splicing by RT–PCR as described above, the following primers were used: Gprk2 F1 (CCAACCAGCCGAAACTCACAGTGAAGC) and Gprk2 R1 (CAGGGTCTCGGTTTCAGACACAGGCGTC), fl(2)d F1 (GCAGCAAACGAGAAATCAGCTCGCAGCGCAG) and fl(2)d R1 (CACATAGTCCTGGAATTCTTGCTCCTTG), A2bp1 F3 (CTGTGGGGCTCAGGGGCATTTTTCCTTCCTC) and A2bp1 R1 (CTCCTCTCCCGTGTGTCTTGCCACTCAAC), cv.-c F1 (GGGTTTCCACCTCGACCGGGAAAAGTCG) and cv.-c R1 (GCGTTTGCGGTTGCTGCTCGCGAAGAGAG), CG8312 F1 (GCGCGTGGCCTCCTTCTTATCGGCAGTC) and CG8312 R1 (GCGTGGCCACTATAAAGTCCACCTCATC), Chas F2 (CCGATTCGATTCGATTCGATCCTCTCTTC) and Chas R1 (GTCGGTGTCCTCGGTGGTGTTGGTGGAG). GO enrichment analysis was done with FlyMine. For the analysis of uATGs, an R script was used to count the uATGs in 5′ UTRs in all ENSEMBL isoforms of those genes which are differentially spliced in Ime4 mutants, that were then compared to the mean number of ATGs in all Drosophila ENSEMBL 5′ UTRs using a t-test. Gene expression data were obtained from flybase. >pattern <-”atg” # the pattern to look for >dict <-PDict(pattern, max.mismatch = 0)#make a dictionary of the pattern to look for >seq <- DNAStringSet(unlist(fasta_file)[1:638])#make the DNAstringset from the DNAsequences that is, all 638 UTRs related to the 156 genes identified in spanki >result <-vcountPDict(dict,seq)#count the pattern in each of the sequences >pattern <-”atg” # the pattern to look for >dict <-PDict(pattern, max.mismatch = 0)#make a dictionary of the pattern to look for >seq <- DNAStringSet(unlist(fasta_file)[1:29822])#make the DNAstringset from the DNAsequences that is, all UTRs >result <-vcountPDict(dict,seq)#count the pattern in each of the sequences Ime4 or YT521-B were expressed in salivary glands with C155-GAL4 from a UAS transgene. Larvae were grown at 18 °C under non-crowded conditions. Salivary glands were dissected in PBS containing 4% formaldehyde and 1% Triton X-100, and fixed for 5 min, and then for another 2 min in 50% acetic acid containing 4% formaldehyde, before placing them in lactoacetic acid (lactic acid:water:acetic acid, 1:2:3). Chromosomes were then spread under a siliconized cover slip and the cover slip removed after freezing. Chromosome were blocked in PBT containing 0.2% BSA and 5% goat serum and sequentially incubated with primary antibodies (mouse anti-PolII H5, 1:1000, Abcam, or rabbit anti-histone H4, 1:200, Santa-Cruz, and rat anti-HA monoclonal antibody 3F10, 1:50, Roche) followed by incubation with Alexa488- and/or Alexa647-coupled secondary antibodies (Molecular Probes) including DAPI (1 μg ml−1, Sigma). RNase A treatment (4 and 200 μg ml−1) was done before fixation for 5 min. Ovaries were analysed as previously described41. The YTH domain (amino acids 207–423) was PCR-amplified with oligos YTHdom F1 (CAGGGGCCCCTGTCGACTAGTCCCGGGAATGGTGGCGGCAACGGCCG) and R1 (CACGATGAATTGCGGCCGCTCTAGATTACTTGTAGATCACGTGTATACCTTTTTCTCGC) and cloned with Gibson assembly (NEB) into a modified pGEX expression vector to express a GST-tagged fusion protein. The YTH domain was cleaved while GST was bound to beads using Precession protease. Electrophoretic mobility shift assays and UV cross-linking assays were performed as described35, 42. Quantification was done using ImageQuant (BioRad) by measuring free RNA substrate to calculate bound RNA from input. All binding assays were done at least in triplicates. RNA-seq data that support the findings of this study have been deposited at GEO under the accession number GSE79000, combining the single-end (GSE78999) and paired-end (GSE78992) experiments. All other data generated or analysed during this study are included in this published article and its Supplementary Information.


Guex N.,Swiss Institute of Bioinformatics | Iseli C.,Swiss Institute of Bioinformatics | Syngelaki A.,King's College London | Deluen C.,Fasteris | And 4 more authors.
Prenatal Diagnosis | Year: 2013

What's already known about this topic?Non-invasive genome-wide screening of fetal aneuploidy by shotgun sequencing cell-free DNA in maternal blood has been shown to effectively identify fetal trisomy 21, but the performance of screening for other aneuploidies is variable. What does this study add?Optimizing all individual steps in the procedure and performing rigorous quality control provides a test capable of replacing invasive testing for the major aneuploidies. © 2013 John Wiley & Sons, Ltd.


Toedling J.,University Pierre and Marie Curie | Toedling J.,French Institute of Health and Medical Research | Toedling J.,MINES ParisTech | Toedling J.,French National Center for Scientific Research | And 16 more authors.
PLoS ONE | Year: 2012

Second-generation sequencing is a powerful method for identifying and quantifying small-RNA components of cells. However, little attention has been paid to the effects of the choice of sequencing platform and library preparation protocol on the results obtained. We present a thorough comparison of small-RNA sequencing libraries generated from the same embryonic stem cell lines, using different sequencing platforms, which represent the three major second-generation sequencing technologies, and protocols. We have analysed and compared the expression of microRNAs, as well as populations of small RNAs derived from repetitive elements. Despite the fact that different libraries display a good correlation between sequencing platforms, qualitative and quantitative variations in the results were found, depending on the protocol used. Thus, when comparing libraries from different biological samples, it is strongly recommended to use the same sequencing platform and protocol in order to ensure the biological relevance of the comparisons. © 2012 Toedling et al.


Yalcin B.,University of Oxford | Nicod J.,University of Oxford | Bhomra A.,University of Oxford | Davidson S.,University of Oxford | And 14 more authors.
PLoS Genetics | Year: 2010

Genome-wide association studies using commercially available outbred mice can detect genes involved in phenotypes of biomedical interest. Useful populations need high-frequency alleles to ensure high power to detect quantitative trait loci (QTLs), low linkage disequilibrium between markers to obtain accurate mapping resolution, and an absence of population structure to prevent false positive associations. We surveyed 66 colonies for inbreeding, genetic diversity, and linkage disequilibrium, and we demonstrate that some have haplotype blocks of less than 100 Kb, enabling gene-level mapping resolution. The same alleles contribute to variation in different colonies, so that when mapping progress stalls in one, another can be used in its stead. Colonies are genetically diverse: 45% of the total genetic variation is attributable to differences between colonies. However, quantitative differences in allele frequencies, rather than the existence of private alleles, are responsible for these population differences. The colonies derive from a limited pool of ancestral haplotypes resembling those found in inbred strains: over 95% of sequence variants segregating in outbred populations are found in inbred strains. Consequently it is possible to impute the sequence of any mouse from a dense SNP map combined with inbred strain sequence data, which opens up the possibility of cataloguing and testing all variants for association, a situation that has so far eluded studies in completely outbred populations. We demonstrate the colonies' potential by identifying a deletion in the promoter of H2-Ea as the molecular change that strongly contributes to setting the ratio of CD4+ and CD8+ lymphocytes. © 2010 Yalcin et al.


Tiacci E.,University of Perugia | Trifonov V.,Center for Computational Biology and Bioinformatics | Schiavoni G.,University of Perugia | Holmes A.,Center for Computational Biology and Bioinformatics | And 33 more authors.
New England Journal of Medicine | Year: 2011

Background: Hairy-cell leukemia (HCL) is a well-defined clinicopathological entity whose underlying genetic lesion is still obscure. Methods: We searched for HCL-associated mutations by performing massively parallel sequencing of the whole exome of leukemic and matched normal cells purified from the peripheral blood of an index patient with HCL. Findings were validated by Sanger sequencing in 47 additional patients with HCL. Results: Whole-exome sequencing identified five missense somatic clonal mutations that were confirmed on Sanger sequencing, including a heterozygous mutation in BRAF that results in the BRAF V600E variant protein. Since BRAF V600E is oncogenic in other tumors, further analyses were focused on this genetic lesion. The same BRAF mutation was noted in all the other 47 patients with HCL who were evaluated by means of Sanger sequencing. None of the 195 patients with other peripheral B-cell lymphomas or leukemias who were evaluated carried the BRAF V600E variant, including 38 patients with splenic marginal-zone lymphomas or unclassifiable splenic lymphomas or leukemias. In immunohistologic and Western blot studies, HCL cells expressed phosphorylated MEK and ERK (the downstream targets of the BRAF kinase), indicating a constitutive activation of the RAF-MEK-ERK mitogen-activated protein kinase pathway in HCL. In vitro incubation of BRAF-mutated primary leukemic hairy cells from 5 patients with PLX-4720, a specific inhibitor of active BRAF, led to a marked decrease in phosphorylated ERK and MEK. Conclusions: The BRAF V600E mutation was present in all patients with HCL who were evaluated. This finding may have implications for the pathogenesis, diagnosis, and targeted therapy of HCL. (Funded by Associazione Italiana per la Ricerca sul Cancro and others.) Copyright © 2011 Massachusetts Medical Society.


Lazarevic V.,University of Geneva | Whiteson K.,University of Geneva | Gaia N.,University of Geneva | Gizard Y.,University of Geneva | And 5 more authors.
Journal of Clinical Bioinformatics | Year: 2012

Background: The salivary microbiota is a potential diagnostic indicator of several diseases. Culture-independent techniques are required to study the salivary microbial community since many of its members have not been cultivated.Methods: We explored the bacterial community composition in the saliva sample using metagenomic whole genome shotgun (WGS) sequencing, the extraction of 16S rRNA gene fragments from metagenomic sequences (16S-WGS) and high-throughput sequencing of PCR-amplified bacterial 16S rDNA gene (16S-HTS) regions V1 and V3.Results: The hierarchical clustering of data based on the relative abundance of bacterial genera revealed that distances between 16S-HTS datasets for V1 and V3 regions were greater than those obtained for the same V region with different numbers of PCR cycles. Datasets generated by 16S-HTS and 16S-WGS were even more distant. Finally, comparison of WGS and 16S-based datasets revealed the highest dissimilarity.The analysis of the 16S-HTS, WGS and 16S-WGS datasets revealed 206, 56 and 39 bacterial genera, respectively, 124 of which have not been previously identified in salivary microbiomes. A large fraction of DNA extracted from saliva corresponded to human DNA. Based on sequence similarity search against completely sequenced genomes, bacterial and viral sequences represented 0.73% and 0.0036% of the salivary metagenome, respectively. Several sequence reads were identified as parts of the human herpesvirus 7.Conclusions: Analysis of the salivary metagenome may have implications in diagnostics e.g. in detection of microorganisms and viruses without designing specific tests for each pathogen. © 2012 Lazarevic et al; licensee BioMed Central Ltd.


Leclerc M.,University of Orléans | Otten P.,Fasteris | Osteras M.,Fasteris
American Journal of Immunology | Year: 2013

The axial organ of the sea-star Asterias rubens is a primitive immune organ. The B-like cells, when stimulated by various antigens, produce antibody substances correlated with Ig Kappa gene. A candidate Ig kappa gene (IgK chain V-IV region S107B precursor) more convincing in term of genome was shown. © 2013 Science Publication.


Vincent N.,Fasteris | Osteras M.,Fasteris | Otten P.,Fasteris | Leclerc M.,556 rue Isabelle Romee
Meta Gene | Year: 2014

The sea star Asterias rubens reacts specifically to the antigen:HRP (horseradish peroxydase) and produces an antibody anti-HRP. We previously identified a candidate Ig kappa gene corresponding to this manuscript. We show now the gene referred to as: "sea star Ig kappa gene in its specificity". © 2014 The Authors.

Loading Fasteris collaborators
Loading Fasteris collaborators