Denmark
Denmark

Time filter

Source Type

News Article | May 8, 2017
Site: www.prnewswire.com

An Industrial Advisor with Nordic Capital LTD, he has gained significant experience from the life science industries over the last 30 years especially in international business. Previously he was at Agilent Technologies Inc. Life Sciences Group where, as President, he realized a number of acquisitions, including that of Dako. He oversaw the restructuring of the company and was responsible for delivering organic company growth well above the market average. "Bluebee is at a special point in its development both as a business and as an organization," said Nicolas Roelofs. "I look forward to contributing to the future direction and growth of Bluebee, using my knowledge and past experiences. I am particularly excited that Hans and the team share my passion for building a successful and positive culture." Involved with several life science companies where Lars has strong skills and a proven track record in drafting strategies, based on customer, market and technology inputs, and improving profitability. He has gained significant experience, including as Chairman of the Board of Directors of Virogates A/S and as CEO and President of Exiqon A/S. He has been responsible for efficient international commercialization and company growth, a successful IPO and many out-licensing deals. "There is a strong need in the market for a secure platform for genetic analysis and easy retrieval of raw and analyzed genetic data. This is not served well today and I strongly believe that Bluebee can make a difference in this market," said Lars Kongsbak. "Also, the strategy of serving the end-users through third parties is brilliant, secure cloud solutions, as mentioned above, are not trivial and outsourcing to specialists like Bluebee allows the focus to stay on understanding the samples." These appointments complement Bluebee's Board of Directors with past accomplishments clearly demonstrating the considerable creative negotiation skills and innovative approach. "We conducted an exhaustive search for people who would further strengthen our board's breadth of talent and background, and we are delighted to have identified such outstanding individuals," said Hans Cobben CEO of Bluebee. "Both Nick Roelofs and Lars Kongsbak will bring a unique perspective and tremendous depth of experience and knowledge, especially in building a global business across both developed and emerging markets." Bluebee (http://www.bluebee.com) provides high performance genomics solutions, enabling genomic labs to substantially reduce cost and time-to-diagnosis. Bluebee's unique cloud-based accelerated genomics platform enables fast, efficient and affordable processing of large volumes of genomics data. With Bluebee's private-cloud based solutions, labs can run their pipelines orders of magnitude faster without compromising the algorithms and methods used, nor the flexibility required to provide quality, sensitivity and reliability. The combination of domain experts in the development and deployment of large scale, mission-critical infrastructure, seasoned bioinformaticians and renowned academic researchers in high-performance computing, led to the use of three disruptive technologies - high performance computing, cloud computing and genomics - which together deliver a unique genome analytics service for research and clinical labs.


News Article | May 8, 2017
Site: www.prnewswire.co.uk

An Industrial Advisor with Nordic Capital LTD, he has gained significant experience from the life science industries over the last 30 years especially in international business. Previously he was at Agilent Technologies Inc. Life Sciences Group where, as President, he realized a number of acquisitions, including that of Dako. He oversaw the restructuring of the company and was responsible for delivering organic company growth well above the market average. "Bluebee is at a special point in its development both as a business and as an organization," said Nicolas Roelofs. "I look forward to contributing to the future direction and growth of Bluebee, using my knowledge and past experiences. I am particularly excited that Hans and the team share my passion for building a successful and positive culture." Involved with several life science companies where Lars has strong skills and a proven track record in drafting strategies, based on customer, market and technology inputs, and improving profitability. He has gained significant experience, including as Chairman of the Board of Directors of Virogates A/S and as CEO and President of Exiqon A/S. He has been responsible for efficient international commercialization and company growth, a successful IPO and many out-licensing deals. "There is a strong need in the market for a secure platform for genetic analysis and easy retrieval of raw and analyzed genetic data. This is not served well today and I strongly believe that Bluebee can make a difference in this market," said Lars Kongsbak. "Also, the strategy of serving the end-users through third parties is brilliant, secure cloud solutions, as mentioned above, are not trivial and outsourcing to specialists like Bluebee allows the focus to stay on understanding the samples." These appointments complement Bluebee's Board of Directors with past accomplishments clearly demonstrating the considerable creative negotiation skills and innovative approach. "We conducted an exhaustive search for people who would further strengthen our board's breadth of talent and background, and we are delighted to have identified such outstanding individuals," said Hans Cobben CEO of Bluebee. "Both Nick Roelofs and Lars Kongsbak will bring a unique perspective and tremendous depth of experience and knowledge, especially in building a global business across both developed and emerging markets." Bluebee (http://www.bluebee.com) provides high performance genomics solutions, enabling genomic labs to substantially reduce cost and time-to-diagnosis. Bluebee's unique cloud-based accelerated genomics platform enables fast, efficient and affordable processing of large volumes of genomics data. With Bluebee's private-cloud based solutions, labs can run their pipelines orders of magnitude faster without compromising the algorithms and methods used, nor the flexibility required to provide quality, sensitivity and reliability. The combination of domain experts in the development and deployment of large scale, mission-critical infrastructure, seasoned bioinformaticians and renowned academic researchers in high-performance computing, led to the use of three disruptive technologies - high performance computing, cloud computing and genomics - which together deliver a unique genome analytics service for research and clinical labs.


The generation and characterization of Ercc1∆/+ and Ercc1+/−mice have been previously described16. Ercc1∆/− mice were obtained by crossing Ercc1∆/+ (in a pure C57BL6J or FVB background) with Ercc1+/− mice (in a pure FVB or C57BL6J background respectively) to yield Ercc1∆/− offspring with a genetically uniform F1 C57BL6J/FVB hybrid background (see ref. 6 for motivation). Wild-type F1 littermates were used as controls. Xpg−/− mice have been characterized previously6 and were generated by crossing Xpg+/− (in a pure C57BL6J background) with Xpg+/− mice (in a pure FVB background). Hence, all animals used in the studies described here were of the same F1 C57BL6J/FVB hybrid background. Typical unfavourable characteristics, such as blindness in an FVB background or deafness in a C57BL6J background, do not occur in this hybrid background. Mice were weighed, visually inspected weekly, and scored in a blinded fashion for gross morphological and motor abnormalities. Since the Ercc1∆/− and Xpg−/− mice were smaller, food was administered within the cages and water bottles with long nozzles were used from around two weeks of age. Animals were maintained in a controlled environment (20–22 °C, 12 h light:12 h dark cycle) and were housed in individual ventilated cages under specific pathogen free conditions. Animals were individually housed at the EMC location and group housed at the RIVM location. Experiments were performed in accordance with the Principles of Laboratory Animal Care and with the guidelines approved by the Dutch Ethical Committee in full accordance with European legislation. For the lifespan studies the indicated number of mice per group for ad libitum and 30% dietary restriction were generated. Additionally, several cross-sectional cohorts were generated. For Ercc1∆/− mice we generated groups which were killed at 7, 11, 16 or 30 weeks of age. The 7-week group consisted only of ad libitum-fed animals while the 30-week group consisted only of dietary restriction-treated mice. For wild-type mice, ad libitum-fed and dietary restriction-treated groups were sacrificed at 11, 16 or 20 weeks. Sample size of the lifespan cohorts were based on power analysis. No statistical methods were used to predetermine sample size of cross-sectional cohorts. Animals were divided randomly over all groups to prevent selection bias. All mice were clinically diagnosed daily in a blinded manner and, when moribund, killed, after which necropsy was performed. Animals from cross-sectional cohorts were killed when necropsy age was reached. Organs were stored at −80°C for molecular analysis or (perfusion) fixated in (para)formaldehyde for pathological examinations. Statistics was performed with survival curve analysis using the product-limit method of Kaplan and Meier in GraphPad Prism. All animals were bred and maintained on AIN93G synthetic pellets (Research Diet Services B.V.; gross energy content 4.9 kcal/g dry mass, digestible energy 3.97 kcal/g). The initial lifespan cohort, shown in Fig. 1a, were fed standard AIN93G pellets containing 2.5 g/kg choline bitartrate. To avoid potential formation of bladder and kidney stones, we replaced choline bitartrate with choline chloride in all subsequent experiments. The amount of dietary restriction was determined in a prior pilot study and food intake of the ad libitum-fed mice was continuously monitored. On average, Ercc1∆/− and Xpg−/− mice ate 2.3 g food per day. Dietary restriction was initiated at 7 weeks of age with 10% food reduction (2.1 g/day), when animals reached almost-maximum bodyweight and development was completed. Dietary restriction was increased weekly by 10%, until it reached 30% dietary restriction (1.6 g/day) from 9 weeks of age onward. Temporary dietary restriction was initiated directly with 30% food reduction at 6 weeks of age. These mice received ad libitum food again from 12 weeks onward. Wild-type mice ate on average 3.0 g food per day, resulting in 2.1 g/day for 30% dietary restriction. Food was given to the animals just before the start of the dark (active) period to avoid alteration of the biological clock. Representative sections from the liver, kidneys, sciatic nerve, testes and femur were processed, stained with haematoxylin and eosin, and microscopically examined in a blinded manner by two board-certified pathologists (SAY, AdB) for the presence of histopathologic lesions. The severity score of lesions was semi-quantitatively assessed. Scores were given as absent (0), subtle (1), mild (2), moderate (3), severe (4), and massive (5). Digital images from the kidneys and femur cortical bone at mid-shaft area were taken for morphometric analysis using Labsense image analysis software (Olympus). Ageing characteristics were assessed in >5 animals per group per sex. Groups were compared with nonparametric Mann–Whitney U and Kruskal–Wallis tests. Polyploidy levels were assessed based on propidium iodide (PI) fluorescence using FACS analysis31, 32. A small part of the left lobe (approximately 5 mm3) was dissected from ad libitum- and dietary restriction-treated Ercc1∆/− mice (7, 11, 16 and 30 weeks, n = 5) and wild-type mice (11 weeks, n = 5), cut into small fragments and suspended in 800 μl PBS using a syringe (21G). 300 μl homogenate was added to 300 μl 100% ethanol for fixation. Samples were stored for at least 24 h before further processing. After fixation the liver homogenate was washed with ice-cold PBS and subsequently incubated with a pepsin solution for 20 min. After washing in PBS/Tween-20, cells were collected in 500 μl PBS supplemented with 5 μg/ml PI and 250 μg/ml RNase and samples were measured using the FACS (FACSCalibur, Becton Dickinson). Differences between groups were assessed with a two-way ANOVA, with age and diet as fixed factors. Ad libitum- and diet-restricted mice were killed by cervical dislocation at scheduled ages, femora were excised and non-osseous tissue was removed. Two days after fixation in 4% formalin, the right femora were scanned using Skyscan 1076 in vivo X-Ray computed tomography (Bruker microCT) with a voxel size of 8.88 μm. Osseous tissue was distinguished from non-osseous tissue by segmenting the reconstructed grayscale images with an automated algorithm using local thresholds33. The region of interest (ROI) (the distal metaphysis of the femora) was selected using 3D data analysis software. To compensate for bone length differences, the length of each ROI was determined relative to the largest specimen femur of the cohort. The cortex and trabeculae of the metaphysis were separated using automated software developed in-house. The thickness of the trabeculae and cortices were assessed using 3D analysis software as described34 using the CT analyser software package (Bruker microCT). A bone specimen with known bone morphometrics was included within each scan as a quantitative control. Statistical significance was calculated using one-way Anova with Bonferroni’s multiple comparison test. The responses of isolated aortic tissue were ex vivo measured in small-wire myograph organ baths containing oxygenated Krebs-Henseleit buffer at 37 °C. After preconstriction with 30 nmol/l U46619, relaxation concentration–response curves to acetylcholine were constructed35. Single-cell suspensions were prepared from spleen by passing the cells through a cell strainer with HEPES-buffered saline solution (HBSS) supplemented with 2% FBS and washed. Erythrocytes were eliminated with ACK buffer. For CD4+CD25+Foxp3+ staining, cells were first stained for the expression of cell surface markers and then fixed, permeabilised, and stained using the Foxp3 kit (eBiosciences) according to the manufacturer’s instructions. FACS analysis was performed using FACS (Becton Dickinson) and analysed with FlowJo Software (TreeStar). Mice were killed by CO asphyxiation and blood was immediately collected from the heart. Glucose levels were measured using a Freestyle mini blood glucose metre. Insulin and albumin levels were measured in blood plasma using an ultrasensitive mouse insulin Elisa (Mercodia AB) or mouse albumin ELISA kit (Immunology Consultants Laboratory, Inc.), respectively. Insulin levels were determined after overnight fasting. Glucose levels were determined after feeding, at the beginning of the dark period. Euthanasia of moribund or cross-sectional animals was performed by intramuscular injection of a ketamine–rompun mixture, followed by exsanguination3. IgA immunoglobulin was measured in blood serum using the commercially available bead-based multiplexed panel Mouse Immunoglobulin Isotyping (Millipore Corporation). Standard analysis protocols were followed and all samples were analysed at least in duplo. The mice were weighed and visually inspected weekly, and were scored in a blinded manner by two experienced research technicians (R.M.C.B. and S.B.) for the onset of various phenotypical parameters. Clasping was measured by suspending mice by their tails for 20 s. A clasping event was scored when retraction of both hind limbs towards the body was observed for at least 5 s. Whole-body tremor was scored if mice were trembling for a combined total of at least 10 s when put on a flat surface for 20 s. Impaired balance was determined by observing the mice walking on a flat surface for 20 s. Mice that had difficulties in maintaining an upright orientation during this period were scored as having imbalance. If mice showed a partial loss of function of the hind limbs, they were scored as having paresis. Statistics were performed with survival-curve analysis using the product-limit method of Kaplan and Meier in GraphPad Prism. Rotarod performance was assessed by measuring the average time spent on an accelerating rotarod (Ugo Basile). All animals were given four consecutive trials of a maximum of 5 min with inter-trial intervals of 1 h. For weekly monitoring, the motor coordination performance was measured with two consecutive trials of a maximum of 5 min. Grip strength was determined by placing mice with forelimbs or all limbs on a grid attached to a force gauge, and steadily pulling the mice by their tail. Grip strength is defined as the maximum strength produced by the mouse before releasing the grid. For each value the test was performed in triplicate. To quantify apoptotic cells in the retina, eyes were fixed overnight in 10% phosphate-buffered formalin (JT Baker), paraffin-embedded, sectioned at 5 mm, and mounted on Superfrost Plus slides. Paraffin sections were employed for TdT-mediated dUTP nick-end labelling (TUNEL) assay using an Apoptag Plus Peroxidase in situ apoptosis detection kit (Millipore). Sections were deparaffinised and incubated as described by the manufacturer. Statistical differences were calculated with a t-test. Primary antibodies (supplier; catalogue number; dilutions) used in this study were as follows: rabbit anti-ATF3 (Santa Cruz; sc-188; 1:2,000), goat anti-ChAT (Millipore; AB144P; 1:500); rabbit anti-GFAP (DAKO; Z0334; 1:8,000); mouse anti-GM130 (BD Transduction; 610823; 1:100); rabbit anti-Iba-1 (Wako; 019-19741; 1:5,000); rat anti-Mac2 (Cedarlane; CL8942AP; 1:2,000); mouse anti-NeuN (Millipore; MAB377; 1:1,000); rabbit anti-p53 (Leica; NCL-p53-CM5p; 1:1,000); mouse anti-γH2AX (Millipore; 05-636; 1:4,000). For avidin-biotin-peroxidase immunocytochemistry biotinylated secondary antibodies from Vector Laboratories, diluted 1:200 were used. Alexa488-, Cy3-, and Cy5-conjugated secondary antibodies raised in donkey (Jackson ImmunoResearch) diluted at 1:200 were used for confocal immunofluorescence. Mice were anaesthetized with pentobarbital and perfused transcardially with 4% paraformaldehyde. The brain and spinal cord were carefully dissected out, post-fixed for 1 h in 4% paraformaldehyde, cryoprotected, embedded in 12% gelatin, rapidly frozen, and sectioned at 40 μm using a freezing microtome or stored at −80 °C until use. Frozen sections were processed free floating using the ABC method (ABC, Vector Laboratories) or single-, double-, and triple-labelling immunofluorescence. Immunoperoxidase-stained sections were analysed and photographed using an Olympus BX40 microscope. Immunofluorescence sections were analysed using a Zeiss LSM700 confocal microscope. Mean intensities were quantified using Fiji. Statistical differences were calculated with a t-test. Total RNA was extracted using QIAzol lysis Reagent from mouse tissue specimens. For increased purity, miRNAeasy Mini Kits (QIAGEN) were used. Addition of wash buffers RPE and RWT (QIAGEN) was done mechanically by using the QIAcube (QIAGEN) via the miRNeasy program and tissue was stored at −80 °C. The concentration of RNA was measured by Nanodrop (Thermo Fisher Scientific). Gene expression analyses were performed with gene-specific real-time PCR primers (see below) using SYBR Green (Sigma-Aldrich) and Platinum Taq polymerase (Life Technologies) on a Bio-Rad CFX96 thermocycler or with pre-designed TaqMan Gene Expression Assays (given below) with a 7500 Fast Real-Time PCR System (Applied Biosystems). Relative gene expressions were calculated as previously described6. For SYBR Green method the following primers were used (forward primer 5′ to 3′; reverse primer 5′ to 3′): Gsta1 (CTTCTGACCCCTTTCCCTCT; ATCCATGGGAGGCTTTCTCT), Nqo1 (GGTAGCGGCTCCATGTACTC; GAGTGTGGCCAATGCTGTAA), Nfe2l2 (AGGACATGGAGCAAGTTTGG; TCTGTCAGTGTGGCTTCTGG), Gstt2 (CGAGCAATTCTCCCAGGTGA; TATTCGTGGACTTGGGCACG), Fkbp5 (TGTTCAAGAAGTTCGCAGAGC; CCTTCTTGCTCCCAGCTTT), Srxn1 (TGAGCAGCTCCTCTGATGTG; GCTGAGGTGACAATTGACTATGG), Gsta4 (TCGATGGGATGATGCTGAC; CATCTGCATACATGTCAATCCTG), Gclm (TGGAGCAGCTGTATCAGTGG; CAAAGGCAGTCAAATCTGGTG), Hmox1 (CAGGTGATGCTGACAGAGGA; ATGGCATAAATTCCCACTGC), Gclc (AGATGATAGAACACGGGAGGAG; TGATCCTAAAGCGATTGTTCTTC), Ephx1 (GAGTGGAGGAACTGCACACC; AGCACAGAAGCCAGGATGA), Mgst1 (CTCGGCAGGACAACTTGC; CCATGCTTCCAATCTTGGTC), TubG2 (CAGACCAACCACTGCTACAT; AGGGAATGAAGTTGGCCAGT), Hprt (TGATAGATCCATTCCTATGACTGTAGA; AAGACATTCTTTCCAGTTAAAGTTGAG), Rps9 (ATCCGCCAACGTCACATTA; TCTTCACTCGGCCTGGAC). As pre-designed TaqMan assays we used (order number; sequence 5′ to 3′): Ghr (Mm00439093_m1; GACAAGCTGCAAGAATTGCTCATGA), Igf1r (Mm00802831_m1; GGCCAGAAGTGGAGCAGAATAATCT), HPRT-E2_3 (HPRT-E2_3_F; GCCGAGGATTTGGAAAAAGTGTTTA, HPRT-E2_3_R; TTCATGACATCTCGAGCAAGTCTTT, HPRT-E2_3_M; CAGTCCTGTCCATAATCA), POLR2A-E2_3 (POLR2A-E2_3F; GCAGTTCGGAGTCCTGAGT, POLR2A-E2_3R; CCCTCTGTTGTTTCTGGGTATTTGA, POLR2A-E2_3M2; CATCCGCTTCAATTCAT). RNA quality was assessed using the 2100 Bio-Analyzer (Agilent Technologies) following the manufacturer’s instructions. The quality of the RNA is expressed as the RNA integrity number (RIN, range 0–10). Samples with a RIN below 8 were excluded from analysis. Hybridization to Affymetrix HT MG-430 p.m. Array Plates was performed at the Microarray Department of the University of Amsterdam according to Affymetrix protocols. Quality control and normalization were performed using the pipeline at the www.arrayanalysis.org website (Maastricht University). The same total RNA extracts were used as extracted for mRNA analysis (above). miRNA expression levels were assessed using a miRNA micro-array (miRCURY LNA microRNA Array (7th Gen.), Exiqon). All probes with more than three calls were selected for assessing differential expression between groups. Differences in mean expression were compared using a one-way ANOVA. Probes with a FDR of 5% were considered as significantly differentially expressed. RNA expression analysis was also performed with the next-generation sequencing approach on one animal per treatment as described in ref. 36. Raw data (CEL files) were normalized by robust multichip average (RMA) in the oligo BioConductor package, which summarizes perfect matches through median polish and collapses probes into core transcripts based on.CDF annotation file provided by Affymetrix using the R open statistical package (http://www.r-project.org/). All data files have been submitted to the NCBI gene expression omnibus under accession number GSE77495. Principal component analysis (PCA) was performed using all the probe sets in the array. A graphical representation was generated to show the relationship among the different samples. PCA is a linear projection method that defines a new dimensional space to capture the maximum information present in the initial data set. It is an unsupervised exploratory technique used to remove noise, reduce dimensionality and identify common/dominant signals oriented to try to find biological meaning37. The two principal components with the highest amount of variance were plotted. PCA was performed using the prcomp package and the plot was drawn with gplots, both from the Bioconductor project (https://www.bioconductor.org/). The linear model from Limma38 implemented in R was used to identify the DEGs. Pairwise comparisons for each genotype between ad libitum and dietary restriction samples were applied to calculate the fold change (FC), P value and false discovery rate (FDR) for each probe in the microarray. Cut-off values for a DEG were put at FDR < 5% with FC ≥ |1.5|. For all mouse analyses, differentially expressed probes were considered as DEGs. Overlap between lists of DEGs was identified looking by the intersection between pair of lists. To determine if the overlap was higher than expected by chance the hypergeometric distribution was used as is implemented in phyper function in R. Additionally the factor of enrichment was calculated with the formula: EF = nAB/((nA × nB)/nC). Where: nA = Number of DEG in experimental group A; nB = Number of DEG in experimental group B; nC = Number of total genes in the microarray; nAB = Number of common DEG between A and B. Pathway enrichment analysis was conducted via overrepresentation analysis (ORA). ORA was performed in the Interactive pathway analysis (IPA) of complex genomics data software (Ingenuity Systems, Qiagen) by employing a pre-filtered list of differentially expressed genes. Genes were selected as differentially expressed if they had a fold change ≥ 1.5 and an FDR lower than 0.05. The over-represented canonical pathways were generated based on information in the Ingenuity Pathways Knowledge Base. A pathway was selected as deregulated when the P value in the Fisher test was lower than 0.01. Additionally, IPA transcription factor (TF) analysis was performed to identify the cascade of upstream transcriptional regulators that can explain the observed gene expression changes in the different lists of DEGs. To do this, data stored in the Ingenuity Knowledge Base, with prior information on the expected effects between TF and their target genes, were used. The analysis examines how many known targets of each TF are present in the list of DEGs, and also compares their direction of change to what is expected from the literature, in order to predict likely relevant transcriptional regulators. If the observed direction of change is mostly consistent with a particular activation state of the transcriptional regulator (‘activated’ or ‘inhibited’), then a prediction is made about that activation state. For each TF two statistical measures are computed (overlap P value and activation z-score). The overlap P value labels upstream regulators based on significant overlap between data set genes and known targets regulated by a TF. The activation z-score is used to infer the likely activation states of upstream regulators based on comparison with a model that assigns random regulation directions. Overlap P value lower than 0.05 and z-score higher than |2| were selected as thresholds to identify a TF as relevant. Limma was used to identify the DEGs among ALWT samples compared with the other experimental conditions (DRWT, ALErcc1 and DRErcc1). Next, probe-sets in the Affymetrix array with multiple gene annotation were filtered out. BiomaRt39 was used to retrieve the gene length for the remaining probe sets (32,930 probe-sets from 45,142 probe-sets in the original microarray). Differentially expressed genes were selected using an FDR of <0.05 and a linear fold change of ±1.5. The Shapiro–Wilk test was applied to contrast the normality of the distribution of gene length in the different lists of DEGs. Because most of the distributions were not normal, a Mann–Whitney test for non-paired samples test was used to evaluate whether the distributions of DEGs were different between the different comparisons. Finally, a relative frequency (kernel density) plot of gene length and probability density for DEG in each comparison was drawn using the density function implemented in R. Kernel density estimates are related to histograms, but with the possibility to smooth and continuity by using a kernel function. The y axis represents the density probability for a specific range of values in the x axis. Liver extracts from ad libitum- and dietary restriction-treated Ercc1∆/− and wild type mice (n = 6, 11 weeks) were prepared by mechanical disruption in lysis buffer (150 mM NaCl, 1% Triton X-100, 50 mM Tris), which was supplemented with mini complete protease inhibitor (Roche Diagnostics) and phosphate inhibitors (5 mM NaF, 1 mM Na-orthovanadate). After mechanical disruption, lysates were incubated on ice for 1 h and subsequently centrifuged at 4 °C for 20 min. Lysate (25–50 μg) was loaded on a 10% SDS–PAGE gel (Life Technologies LTD) and transferred to a PVDF transfer membrane (GE-Healthcare Life Sciences). Levels of S6 (#2217S Lot5; 1:2,000), S6(Ser240/244; #2215 Lot14; 1:500), Akt (#9272 Lot25; 1:500), Akt(Ser473; #9271S Lot13; 1:250) and Akt(Thr308; #9275S Lot19; 1:500) were detected (Cell Signaling Technology), semi-quantified using the ImageJ software package (http://rsb.info.nih.gov/ij/index.html) and phosphorylated:total ratios relative to ad libitum samples were calculated. Differences between groups were assessed with a t-test. β-Actin was used as loading control (Sigma; A5441 Lot064M4789V; 1:25,000).


News Article | November 2, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. U2OS, HeLa 1.3, HeLa S3, DLD-1, and 293T cell lines were grown in DMEM (Thermo Fisher) with 10% calf serum and 1% penicillin/streptomycin. VA13, GM847, LM216T, and LM216J cell lines were grown in DMEM (Thermo Fisher) with 10% FBS and 1% penicillin/streptomycin. SKNFI cell line was grown in RPMI (Thermo Fisher) with 10% FBS and 1% penicillin/streptomycin. VA13 cell line refers to WI-38 VA-13 subline 2RA. LM216T/J are matched lines. Cell lines were obtained from ATCC and tested negative for Mycoplasma using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza). The U2OS TRF1–FokI inducible cell line was authenticated by STR analysis (ATCC). Other lines were validated by ALT characteristics. None of the cell lines used is listed as commonly misidentified by the International Cell Line Authentication Committee (ICLAC). Cells were pulsed with 100 μM BrdU (Sigma) for 2 h before fixation. After permeabilization, cells were denatured with 500 U ml−1 DNaseI (Roche) in 1× reaction buffer (20 mM Tris-HCl (pH 8.4), 2 mM MgCl , 50 mM KCl in PBST) for 10–25 min at 37 °C in a humidified chamber. Coverslips were then washed and incubated with anti-BrdU antibody (BD) for 20 min at 37 °C followed by secondary antibody and telomere FISH. For metaphases, cells pulsed with BrdU were treated with 100 ng ml−1 colcemid for 90 min followed by 75 mM KCl for 30 min. Cells were fixed in 3:1 methanol:acetic acid, dropped onto slides, and allowed to dry overnight. Denaturation was performed with 2 N HCl for 30 min at room temperature followed by antibody incubations as described above. BrdU pulldown was adapted from a published protocol34. Cells were pulsed with 100 μM BrdU (Sigma) for 2 h before collection. Genomic DNA (gDNA) was isolated using phenol–chloroform extraction followed by resuspension in TE buffer. gDNA was then sheared into 100–300 bp fragments using a Covaris S220 sonicator. 1–4 μg sheared gDNA was denatured for 10 min at 95 °C and cooled in an ice-water bath. Denatured gDNA was incubated with 2 μg anti-IgG (Sigma) or anti-BrdU antibody (BD) diluted in immunoprecipitation buffer (0.0625% (v/v) Triton X-100 in PBS) rotating overnight at 4 °C. The next day, samples were incubated with 30 μl Protein G magnetic beads (Pierce) that had been pre-bound to a bridging antibody (Active Motif) for 1 h rotating at 4 °C. Beads were subsequently washed three times with immunoprecipitation buffer and once with TE buffer. Beads were then incubated twice in elution buffer (1% (w/v) SDS in TE) for 15 min at 65 °C. Pooled eluate was cleaned with ChIP DNA Clean & Concentrator kit (Zymo). Samples, along with 10% inputs, were diluted into 2× SSC buffer, treated at 95 °C for 5 min, and dot-blotted onto an Amersham Hybond-N+ nylon membrane (GE). The membrane was then denatured in a 0.5 N NaOH 1.5 M NaCl solution, neutralized, and ultraviolet crosslinked. The membrane was hybridized with 32P-labelled (TTAGGG) oligonucleotides, unless otherwise noted, in PerfectHyb Plus Hybridization Buffer (Sigma) overnight at 37 °C. The next day, the membrane was washed twice in 2× SSC buffer, exposed onto a storage phosphor screen (GE Healthcare) and scanned using STORM 860 with ImageQuant (Molecular Dynamics). All quantifications were performed in Fiji and normalized to 10% input. The SMARD assay was performed as previously described4, 5. U2OS cells were induced with TRF1–FokI for 20 min or 2 h and were subsequently labelled by incubating with 30 μM IdU for 2 h, followed by 30 μM CIdU for the next 2 h. After pulsing, 106 labelled cells per condition were embedded in 1% agarose and lysed using detergents (100 mM EDTA, 0.2% sodium deoxycholate, 1% sodium lauryl sarcosine and 0.2 mg ml−1 Proteinase K). The plugs were then washed several times with TE, treated with 100 μM PMSF, and then washed again with TE buffer followed by incubation with 1× Cut-Smart buffer (NEB) for 30 min. The DNA in the plugs was then digested overnight at 37 °C using 50 U of both MboI and AluI (NEB) per plug. The digested plugs were then cast into a 0.7% low-melting point agarose gel and a distinct fragment running above 10 kb (containing telomeric DNA defined by Southern blotting) was excised, melted and stretched on slides coated with 3-aminopropoyltriethoxysilane (Sigma-Aldrich). After denaturation of the DNA strands using alkali buffer (0.1 M NaOH in 70% ethanol and 0.1% β-mercaptoethanol), the DNA was fixed using 0.5% glutaraldehyde and incubated overnight with biotin-OO-(CCCTAA) locked nucleic acid (LNA) probe (Exiqon) at 37 °C. Telomere FISH probes were then detected using the Alexa Fluor 405-conjugated streptavidin (Thermo-Fisher) followed by sequential incubation with the biotinylated anti-avidin antibody (Vector Laboratories) and additional Alexa 405-conjugated streptavidin. IdU and CldU were visualized using mouse anti-IdU (BD) and rat anti-CIdU (Serotec) monoclonal antibodies followed by Alexa Fluor 568-goat anti-mouse and Alexa Fluor 488-goat anti-rat secondary antibodies (Life Technologies). Images were acquired using the NIS-element software (Nikon) and a Nikon eclipse 80i microscope equipped with a 63× objective and a Cool Snap camera (MYO). For calculating the length of the telomeres and replication tracts, the line-scan function from Image J was used. For conversion of microns to kilobases, as 10 bp (equals one turn of the helix) has a linear length of 3.4 nm, 0.26 microns corresponded to 1 kb of DNA. Death domain (DD)–Oestrogen receptor (ER)–mCherry–TRF1–FokI and Flag–TRF1–FokI constructs were cloned as previously described7. Doxycycline-inducible TRF1–FokI lines were generated using the Tet-On 3G system. Briefly, Flag–DD–ER–mCherry–TRF1–FokI was cloned into the pLenti CMV TRE3G Puro Dest vector, which was introduced into cells engineered to co-express the reverse tetracycline transactivator 3G (rtTA3G). N-terminal GFP-tagged proteins were generated by PCR amplification and ligation of cDNAs from the ProQuest HeLa cDNA Library (Invitrogen) into the pDEST53 (Invitrogen) mammalian expression vector. CRISPR lines were generated using a two-vector system (pLentiCas9-Blast and pLentiGuide-Puro). POLD3 reconstitution vector was generated by cloning POLD3 cDNA (RefSeq NM_006591.2) into the pOZ–N–Flag–HA retroviral vector followed by site-directed mutagenesis of siRNA binding sites. Sanger sequencing of POLD3 CRISPR clones was performed on gDNA fragments cloned into a TOPO TA vector (Thermo Fisher). Transient plasmid transfections were carried out with LipoD293 (Signagen), and siRNA transfections with Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s instructions. Analyses were performed 16 h after transfection of plasmids, and 72 h after siRNA transfection. All siRNAs were used at a final concentration of 20 nM. The following primers were used for qRT–PCR: The following siRNA sequences were used: The following CRISPR sgRNA sequences were used: The following antibodies were used: anti-BrdU (mouse B44, BD 347580; rat BU1/75, AbD Serotec OBT0030G), anti-ATRX (rabbit H-300, Santa Cruz sc-15408), anti-53BP1 (rabbit, Novus NB100-904), anti-γH2AX (mouse JBW301, Millipore 05-636), anti-Flag (mouse M2, Sigma F1804), anti-PML (mouse PG-M3, Santa Cruz sc-966), anti-Rad51 (rabbit H-92, Santa Cruz sc-8349; mouse 14B4, Abcam ab-213), anti-Hop2/PSMC3IP (rabbit, Novus NBP1-92301), anti-POLD3 (mouse 3E2, Abnova H00010714-M01), anti-POLD1 (mouse 607, Abcam ab10362; rabbit, Bethyl A304-005A), anti-POLD2 (rabbit, Bethyl A304-322A), anti-POLD4 (mouse 2B11, Abnova H00057804-M01A), anti-POLE (mouse 93H3A, Pierce MA5-13616; rabbit, Novus NBP1-68470), anti-POLE3 (rabbit, Bethyl A301-245A), anti-POLA1 (rabbit, Bethyl A302-851A), anti-MCM7 (rabbit, Bethyl A302-584A), anti-MCM4 (rabbit, Bethyl A300-193A), anti-MCM5 (rabbit, Abcam ab75975), anti-RFC1 (rabbit, Bethyl A300-320A), anti-PCNA (mouse PC10, CST #2586) anti-ATR (goat N-17, Santa Cruz sc-1887), anti-PRIM1 (rabbit H300, Santa Cruz sc-366482), anti-Rad17 (goat, Bethyl A300-151A), anti-REV3L (rabbit, GeneTex GTX100153), anti-POLH (rabbit, Bethyl A301-231A), anti-REV1 (rabbit H300, Santa Cruz sc-48806) anti-GAPDH (rabbit 14c10, CST #2118), anti-αTubulin (mouse TU-02, Santa Cruz sc-8035). Doxycycline was used at a concentration of 40 ng ml−1 for 16–24 h to induce expression of TRF1–FokI. Shield-1 (Cheminpharma LLC) and 4-hydroxytamoxifen (4-OHT) (Sigma-Aldrich) were both used at a concentration of 1 μM for 2 h, unless otherwise stated, in to allow for TRF1–FokI stabilization and translocation into the nucleus. RO-3306 (Selleck Chemicals) was used at a concentration of 10 μM for 20–24 h. G2 enrichment was confirmed by propidium iodide staining and flow cytometry. Colcemid (Roche) was used at a concentration of 100 ng ml−1. The ATR inhibitor VE-821 (Selleck Chemicals) and Chk1 inhibitor LY2603618 (Selleck Chemicals) were used at a concentration of 5 μM and 1 μM respectively for 24 h. Cells were lysed in RIPA buffer supplemented with cOmplete protein inhibitor cocktail (Roche) and Halt phosphatase inhibitor cocktail (Thermo) on ice and subsequently spun down at max speed at 4 °C. The supernatant was removed and protein concentration determined using the Protein Assay Dye Reagent (Bio-Rad). 20–40 μg of protein was run on a 4–12% Bis–Tris gel (Invitrogen). Proteins were transferred onto an Amersham Protran 0.2 μm nitrocellulose membrane (GE) and blocked with 5% milk. Membranes were incubated with primary antibodies overnight at 4 °C. The next day membranes were incubated with secondary antibodies for 1 h at room temperature and subsequently developed using Western Lightning Plus-ECL (Perkins Elmer) or SuperSignal West Femto (Thermo). Cells grown on coverslips were fixed in 4% paraformaldehyde for 10 min at room temperature. Coverslips were then permeabilized in 0.5% Triton X-100 for 5 min at 4 °C (for most antibodies) or 100% cold methanol for 10 min at −20 °C (for anti-PCNA). Primary antibody incubation was performed at 4 °C in a humidified chamber overnight unless otherwise indicated. Coverslips were washed and incubated with appropriate secondary antibody for 20 min at 37 °C, then mounted onto glass slides using Vectashield mounting medium with DAPI (Vector Labs). For immunofluorescence–FISH, coverslips were re-fixed in 4% paraformaldehyde for 10 min at room temperature after secondary antibody binding. Coverslips were then dehydrated in an ethanol series (70%, 90%, 100%) and allowed to air dry. Dehydrated coverslips were denatured and incubated with TelC–Cy3 peptide nucleic acid (PNA) probe (Panagene) in hybridization buffer (70% deionized formamide, 10 mM Tris (pH 7.4), 0.5% Roche blocking solution) overnight at room temperature in a humidified chamber. The next day, coverslips were washed and mounted as described above. Images were acquired with a QImaging RETIGA-SRV camera connected to a Nikon Eclipse 80i microscope. For TIF assay, cells were scored for co-localized 53BP1 and telomere foci by immunofluorescence–FISH. For APB assay, cells were scored for the number of PML–telomere colocalizations by immunofluorescence–FISH. Hop2 immunofluorescence and CO–FISH experiments were performed as previously described7. Telomere gels were performed using telomere restriction fragment (TRF) analysis. Genomic DNA was digested using AluI and MboI (NEB). 4–10 μg of DNA was run on a 1% PFGE agarose gel (Bio-Rad) in 0.5× TBE buffer using the CHEF-DRII system (Bio-Rad) at 6 V cm−1; initial switch time 5 s, final switch time 5 s, for 16 h at 14 °C. The gel was then dried for 4 h at 50 °C, denatured in a 0.5 N NaOH 1.5 M NaCl solution, and neutralized. Gel was hybridized with 32P-labelled (CCCTAA) oligonucleotides in Church buffer overnight at 42 °C. The next day, the membrane was washed four times in 4× SSC buffer, exposed onto a storage phosphor screen (GE Healthcare) and scanned using STORM 860 with ImageQuant (Molecular Dynamics). Telomere length was determined using TeloTool software35. C-circle assay was performed as previously described28. Genomic DNA was digested using AluI and MboI (NEB). 30 ng of digested DNA was combined with 0.2 mg ml−1 BSA, 0.1% Tween, 1 mM each dNTP without dCTP, 1× ϕ29 Buffer (NEB) and 7.5 U ϕ29 DNA polymerase (NEB). Samples were incubated for 8 h at 30 °C followed by 20 min at 65 °C. Samples were then diluted in 2× SSC buffer and dot-blotted onto an Amersham Hybond-N+ nylon membrane (GE). Membrane was ultraviolet crosslinked and then hybridized with 32P-labelled (CCCTAA) oligonucleotides in PerfectHyb Plus Hybridization Buffer (Sigma) overnight at 37 °C. The next day, the membrane was washed twice in 2× SSC buffer, exposed onto a storage phosphor screen (GE Healthcare) and scanned using STORM 860 with ImageQuant (Molecular Dynamics). Cells were lysed in HEPES immunoprecipitation buffer (10 mM HEPES (pH 8), 2 mM EDTA, 0.1% NP-40) supplemented with 5 mM DTT, 1 mM PMSF, and 1× cOmplete protein inhibitor cocktail (Roche) on ice and subsequently spun down at max speed at 4 °C. The supernatant was removed and protein concentration determined using the Protein Assay Dye Reagent (Bio-Rad). 25 μg protein was removed for input. 500 μg protein was diluted to 1 mg ml−1 in HEPES immunoprecipitation buffer and pre-cleared with 10 μl Protein G magnetic beads (Pierce) for 1 h rotating at 4 °C. Protein lysate was then incubated with 10 μg anti-IgG (Sigma) or anti-POLD1 antibody (Abcam) rotating overnight at 4 °C. The next day, samples were incubated with 30 μl Protein G magnetic beads (Pierce) that had been pre-bound to a bridging antibody (Active Motif) for 1 h rotating at 4 °C. Beads were subsequently washed five times with HEPES immunoprecipiation buffer. Proteins were eluted by incubating beads with 2× sample buffer with BME for 5 min at 95 °C. Samples were analysed by western blot. ChIP was performed as previously described and analysed by western blot and dot blot36. 400 ng of genomic DNA was diluted into 2× SSC buffer, treated at 95 °C for 5 min, and dot-blotted onto an Amersham Hybond-N+ nylon membrane (GE). Membrane was then denatured in a 0.5 N NaOH 1.5 M NaCl solution, neutralized, and UV crosslinked. Membrane was hybridized with 32P-labelled (CCCTAA) , or Alu repeat oligonucleotides in PerfectHyb Plus Hybridization Buffer (Sigma) overnight at 37 °C. The next day, the membrane was washed twice in 2× SSC, exposed onto a storage phosphor screen (GE Healthcare) and scanned using STORM 860 with ImageQuant (Molecular Dynamics). Live cell imaging was performed and analysed as previously described7. Fixed cell and live cell images were captured at 60× and 100× magnification, respectively. Microscope images and dot blots were prepared and analysed using Fiji. Southern blot telomere gel images were prepared using Fiji and were not cropped to exclude any part of the presented lanes. Western blot gel images were prepared using Adobe Photoshop and cropped to present relevant bands. Uncropped western blot images are shown in Supplementary Fig. 1. All statistical analysis was done using GraphPad Prism 5 software. Unpaired t-tests were used to generate two-tailed P values.


News Article | February 22, 2017
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Animal experiments were neither randomized nor blinded. All animals used in this study (ADicerKO, Dicerlox/lox, or C57BL/6) were males and 6 months of age unless specifically indicated otherwise. All animal experiments were conducted in accordance with IRB protocols with respect to live vertebrate experimentation. Human serum was obtained from human subjects after obtaining IRB approval and patients were given informed consent. Mouse and human sera were centrifuged at 1,000g for 5 min and then at 10,000g for 10 min to remove whole cells, cell debris and aggregates. The serum was subjected to 0.1-μm filtration and ultracentrifuged at 100,000g for 1 h. Pelleted vesicles were suspended in 1× PBS, ultracentrifuged again at 100,000g for washing, resuspended in 1× PBS and prepared for electron microscopy and immune-electron microscopy or miRNA extraction. All in vitro experiments were carried out using exosome-free FBS. AML-12 cells were acquired from ATCC (cat no. CRL-2254) and were tested for mycoplasma contamination. Dicerfl/fl brown preadipocytes were generated as previously described16. For exosome loading, exosome preparations were isolated and diluted with PBS to final volume of 100 μl. Exosome electroporation was carried out by using a variation of a previously described technique45. Exosome preparations were mixed with 200 μl phosphate-buffered sucrose (272 mM sucrose 7 mM, K HPO ) with 10 nΜ of a miRNA mimic, and the mixture was pulsed at 500 mV with 250 μF capacitance using a Bio-Rad Gene Pulser (Bio-Rad). Electroporated exosomes were resuspended in a total volume of 500 μl PBS and added to the target cells. Isolated exosomes were subjected to immune-electron microscopy using standard techniques7. In brief, exosome suspensions were fixed with 2% glutaraldehyde supplemented with 0.15 M sodium cacodylate and post-fixed with 1% OsO . They were then dehydrated with ethanol and embedded in Epon 812. Samples were sectioned, post-stained with uranyl acetate and lead citrate, and examined with an electron microscope. For immune-electron microscopy, cells were fixed with a solution of 4% paraformaldehyde, 2% glutaraldehyde and 0.15 M sodium cacodylate and processed as above. Sections were probed with anti-CD63 (Santa Cruz Biotechnology, sc15363) or anti-CD9 (Abcam, ab92726) antibodies (or rabbit IgG as a control) and visualized with immunogold-labelled secondary antibodies. Immuno-electron microscopy analysis revealed that the isolated exosomes were 50–200 nM in diameter and stained positively for the tetraspanin exosome markers CD63 and CD9 (ref. 46). Exosomal concentration was assessed using the EXOCET ELISA assay (System Biosciences), which measured the esterase activity of cholesteryl ester transfer protein (CETP) activity. CETP is known to be enriched in exosomal membranes. The assay was calibrated using a known isolated exosome preparation (System Biosciences). Additionally, exosome preparations were subjected to the qNano system employing tunable resistive pulse sensing technology (IZON technologies) to measure the number and size distribution of exosomes. For total serum miRNA isolation, 100 μl of serum was obtained from ADicerKO mice or Lox littermates and miRNAs were isolated using an Exiqon miRCURY Biofluid RNA isolation kit following the manufacturer’s protocol. RNA was isolated from exosomal preparations using TRIzol, following the manufacturer’s protocol (Life Sciences). Subsequently, 50 ng of exosomal RNA was subjected to reverse transcription into cDNA by using a mouse miRNome profiler kit (System Biosciences). qPCR was then performed in 6-μl reaction volumes containing cDNA along with universal primers for each miRNA and SYBR Green PCR master mix (Bio-Rad). In line with previous research, for all serum and exosomal miRNA quantitative PCR reactions the C values were normalized using U6 snRNA as an internal control. To estimate miRNA abundance in fat tissue, data were normalized using the global average of expressed C values per sample47, as the snRNA U6 was differentially expressed between depots. For all quantitative PCR reactions involving gene expression calculations for FGF21, normalization was carried out by using the TATA-binding protein as an internal control. Differential expression analysis of the high-throughput −ΔC values was done using the Bioconductor limma package48 in R (www.r-project.org). Fold differences in comparisons were expressed as 2−ΔΔC . Ct Principal component analysis plots were created using R with the ggplot2 package. A detection threshold was set to C  = 34 for all mouse miRNA PCR reactions; no threshold was used for human miRNA PCR, according to the manufacturer’s recommendation (System Biosciences). An miRNA was plotted only if its raw C value was ≤34 in at least three samples, except for the brown pre-adipocyte and 4-week-old mouse experiments, in which the raw C only had to be ≤34 twice. miRNA −ΔC values were Z scored and heatmaps were created by Cluster 3.0 and TreeView programs as previously described49. Fat tissue transplantation was carried out as previously described50. In brief, 10-week-old male Lox donor mice (C57BL/6 males) were killed, and their inguinal, epididymal, and BAT fat depots were isolated, cut into several 20-mg pieces and transplanted into 10-week-old male ADicerKO mice (n = 5 male mice per group). Each recipient ADicerKO mice received the equivalent transplanted fat mass of two donor Lox control mice. Transplanted mice received post-surgical analgesic intraperitoneal injections (buprenorphine, 50 mg/kg) for 7 days. At day 12, a glucose tolerance test was performed after a 16-h fast by intraperitoneal injection of 2 g/kg glucose. All mice were killed after 14 days. All procedures were conducted in accordance with Institutional Animal Care and Use Committee regulations. An adenoviral Fgf21 3′ UTR reporter was created by cloning the 3′ UTR of Fgf21 into the pMir-Report vector. Subsequently, the luciferase-tagged 3′ UTR fragment was cloned into the adenoviral vector pacAd5-CMV-IRES-GFP, creating an adenovirus bearing the Fgf21 3′UTR reporter. Hsa-miR-302f-3′-UTR was created by cloning the synthesized Luc-miR-302f-3′-UTR fragment (Genescript) into the Viral Power Adenoviral Expression System (Invitrogen). In vitro bioluminescence was measured using a dual luciferase kit (Promega). Eight-week-old male ADicerKO or wild-type mice were injected intravenously with adenovirus bearing the 3′-UTR of Fgf21 fused to the luciferase gene to create two groups of liver-reporter mice—one with a ADicerKO background and one with a wild-type background. One day later, a third group of ADicerKO mice, which had also been injected intravenously with an adenovirus bearing the 3′-UTR of Fgf21 fused to the luciferase gene, were injected intravenously with exosomes isolated from the serum of wild-type mice. After 24 h, in vivo luminescence of the Fgf21 3′ UTR was measured using the IVIS imaging system (Perkin Elmer) by administering d-luciferin (20 mg/kg) according to the manufacturer’s protocol (Perkin Elmer). For the second group, 8-week-old male ADicerKO or wild-type mice were also transfected with adenovirus bearing the 3′ UTR of Fgf21 fused to the luciferase gene by intravenous injection. After 1 day, mice received an intravenous injection of exosomes isolated from the serum of either ADicerKO mice or ADicerKO mice reconstituted in vitro with 10 nM miR-99b by electroporation. Twenty-four hours later, in vivo luminescence was measured using the IVIS imaging system by administering d-luciferin (20 mg/kg) according to the manufacturer’s protocol (Perkin Elmer). Protocol 1. On day 0, adenovirus bearing either pre-hsa_miR-302f or lacZ mRNA (as a control) was injected directly into the BAT of 8-week-old male C57BL/6 mice. Hsa_miR-302f is human-specific and does not have a mouse homologue. This procedure was conducted under ketamine-induced anaesthesia. Four days later, the same mice were injected intravenously with an adenovirus bearing the 3′ UTR of miR-302f in-frame with the luciferase gene, thereby transducing the liver tissue of the mouse with this human 3′ UTR miRNA reporter. Suppression of the 3′ UTR miR-302f reporter would occur only if there was communication between the BAT-produced miRNA and the liver. In vivo luminescence was measured on day 6 using the IVIS imaging system as described above. Protocol 2. To assess specifically the role of exosomal miR-302f in the regulation of its target reporter in the liver, two separate cohorts of 8-week-old male C57BL/6 mice were generated. One cohort was injected with adenovirus bearing pre-miR-302f or lacZ directly into the BAT (the donor cohort); the second cohort was transfected with an adenovirus bearing the 3′ UTR reporter of this miR-302f in the liver, as described for Protocol 1 (the acceptor cohort). Serum was obtained on days 3 and 6 from the donor cohorts; the exosomes were isolated and then injected intravenously into the acceptor mice the next day (days 4 and 7). On day 8, in vivo luminescence was measured in the acceptor mice using the IVIS imaging system as described above. To test for the presence of adenovirus in the liver and BAT of C57BL/6 mice, 100 mg tissue was homogenized in 1 ml sterile 1× PBS. The homogenate was spun down and 150 μl cleared supernatant was used to isolate adenoviral DNA using the Nucleospin RNA and DNA Virus kit, following the manufacturer’s protocol (Takara). PCR was performed on 2 μl isolated adenoviral DNA using SYBR green to detect lacZ or miR-302f amplicons. For all PCR data obtained in the fat-tissue-transplantation experiment, an miRNA was considered to be present only if its mean C in the wild-type group was <34. We then identified those miRNAs that were significantly decreased in ADicerKO serum. For an miRNA to be considered restored after transplantation by a particular depot it had to be significantly increased from ADicerKO serum with a mean C  < 34 and its C had to be more than 50% of the way from ADicerKO to the wild type on the C scale. ANOVA tests were followed by two-tailed Dunn’s post-hoc analysis or Tukey’s multiple comparisons test to identify statistically significant comparisons. All t-tests and Mann–Whitney U-tests were two-tailed. P values less than 0.05 were considered significant. All ANOVA, t-tests, and area-under-the-curve calculations were carried out in GraphPad Prism 5.0. For miRDB analysis (http://www.mirdb.org), a search by target gene was performed against the mouse database. A target score of 85 was set to exclude potential false-positive interacting miRNAs. All high-throughput qRT–PCR data (raw C values), the code used to analyse them (in the free statistical software R), and its output (including supplementary tables, tables used to generate heatmaps, and statements in the text) can be freely downloaded and reproduced from https://github.com/jdreyf/fat-exosome-microrna. All other data are available from the corresponding author upon reasonable request.


Hematological Malignancies Market analysis is provided for global market including development trends by regions, competitive analysis of the Hematological Malignancies market. Hematological Malignancies Industry report focuses on the major drivers and restraints for the key players. “Hematological Malignancies: Multiple Myeloma (Mm) – Early and Robust Diagnosis Along With New Treatment Options Can Have Considerable Impact on Management of the Disease” report speaks about the manufacturing process. The process is analysed thoroughly with respect four points Manufacturers, regional analysis, Segment by Type and Segment by Applications and the actual process of whole Hematological Malignancies industry. Over the past decade, Proteasome inhibitor and the immunomodulatory drugs have become the cornerstone of treatment for pts with Multiple Myeloma (MM) resulting in improved survival. However, eventually all pts relapse and use of modern diagnosis will enable risk stratification to help distinguish pts along the spectrum of the condition. This can aid in the selection of new treatment options for Relapsed/ Refractory Multiple Myeloma (RRMM) to further improve survival and quality of life of each patient. Two new drugs have successfully fulfilled this need – POMALYST/ IMNOVID (pomalidomide – POM, Celgene, approved) and Kyprolis (carfilzomib-CFZ, Amgen/ Ono Pharma – JP, approved). While novel targets address unmet need, the pertinent Question remains – is there a need for further improvement? What should be the diagnosis criteria and/or novel imaging / diagnostic tools that can further stratify a pts’ risk profile? Ask Sample PDF @ http://www.absolutereports.com/enquiry/request-sample/10437984 In this report, we highlight the emerging new treatments in RRMM /NDMM, which includes combination of small molecules and biologics, and novel approach of molecular analysis of MM. This report also provides M&A deals in the diagnostic, cancer area along with growing market opportunities. Furthermore, the competitive landscape of NDMM and RRMM is also highlighted. The rivalry prevalent in the global onco-diagnostic and therapeutic MM market is quite fierce with numerous local and global players contenting for the market share. On the global diagnostic front, the key players are Roche, Abbott Diagnostics, and Illumina; and in Tx area, the key players are Celgene, Takeda pharma, Amgen, Novartis, and JNJ While targeting unmet needs in the treatment of hematological malignancies/ cancer through innovative drug development strategies have witnessed favorable outcomes, the specific choice of the therapies is dependent on the identification of important genomic alterations in cancerous cells that allow for the tumor’s sub classification. Precision medicine approaches in myeloma require fast, robust, and practicable molecular diagnostic tools, and the current diagnostic standard iFISH (interphase fluorescence in situ hybridization) is unable to fulfill any of these criteria. Integration of Diagnostics into therapeutic products/ industry has potential to improve trial design, enhance safety profile, enhance therapeutic efficacy, accelerate trial outcome, and increase commercial success. However, there are few hurdles which are also associated with new model, such as understanding the diagnostic industry, complex trial execution, seeking a ‘right’ diagnostic partner, managing the co-development process, regulatory uncertainty around companion diagnostics and intellectual property issues.  Two new drugs have successfully fulfilled this need – POMALYST/ IMNOVID (pomalidomide – POM, Celgene, approved) and Kyprolis (carfilzomib-CFZ, Amgen/ Ono Pharma – JP, approved). While novel targets address unmet need, the pertinent Question remains – is there a need for further improvement? What should be the diagnosis criteria and/or novel imaging / diagnostic tools that can further stratify a pts’ risk profile? 1. Executive Summary 2. Disease Overview, Diagnosis, and Current Treatment 2.1 Overview of Diagnostic tools for Multiple Myeloma 2.2 Diagnostic Criteria of Myeloma and Recent Amendment  2.3 Diagnostic Approaches for Multiple Myeloma 2.3.1 Molecular pathogenesis of Myeloma  2.3.2 Unmet Need  2.3.3 New Diagnostics Perspective and Technologies a ‘Companion’ Diagnostics (CDx) b Genome-wide array c RAN based technologies d Next-Generation Sequencing (NGS) technology 3. Diagnostic Tools for Multiple Myeloma 3.1 Affymetrix GeneChip 3.2 SkylineDx MMprofiler 3.3 AgenaBio iPLEX Genotyping 3.4 Signal Genetics MyPRS 3.5 Cancer Genetics Genomic Products 3.6 Illumina NGS 3.7 NeoGenomics CLIA-certified Cancer Test 3.8 Exiqon microRNA PCR  3.9 Regulus Therapeutics microRNA Marker 3.10 Rosetta Genomics Cancer Origin Test 3.11 Sequenta LymphoSIGHT Platform 4. M&A Deals and Market Opportunity in Diagnostic Space 5. Current Therapies 5.1 Newly Diagnosed Multiple Myeloma (NDMM) 5.1.1 Competitive Landscape for NDMM 5.2 Relapsed and/or Refractory Multiple Myeloma (RRMM) 5.2.1 Competitive Landscape for RRMM 5.3 Approved Therapies 5.3.1 Revlimid 5.3.2 Velcade 5.3.1 Kyprolis 5.3.2 POMALYST 5.1 Data Comparison 5.4.1 Newly Diagnosed Multiple Myeloma (NDMM) 5.4.2 Relapsed and/or Refractory Multiple Myeloma (RRMM) 6. Novel Targets 6.1 Monoclonal Antibodies 6.1.1 Elotuzumab 6.1.2 Situximab 6.1.3 Daratumumab 6.1.4 MOR202 6.1.5 SAR650984 6.1.6 BI-505 6.1.7 BHQ880 6.1.8 CT-011 6.1.9 IPH2101/ Lirilumab 6.1.10 BMS-936564 (ulocuplumab) 6.2 Small Molecules 6.2.1 Panobinostat 6.2.2 Ixazomib (MLN9708) 6.2.3 Aplidin (plitidepsin) 6.2.4 ARRY-520 (filanesib) 6.2.5 Oprozomib 6.2.6 KPT-330 (selinexor) 6.2.7 SNS01-T 6.2.8 Ibrutinib 6.2.9 Ricolinostat 6.2.10 Afuresertib 6.2.11 KW-2478 6.2.12 BT-062 7. Clinical Milestones 9. Launch Timeline and Commercial Opportunity of Late-Stage Pipeline 10. M&A/ Licensing Deals and Unpartnered Product Opportunities Absolute Reports is an upscale platform to help key personnel in the business world in strategizing and taking visionary decisions based on facts and figures derived from in depth market research. We are one of the top report resellers in the market, dedicated towards bringing you an ingenious concoction of data parameters.


News Article | November 29, 2016
Site: www.newsmaker.com.au

With a CAGR of 10.1%, global market value for PCR Products/Tools market is anticipated to be worth US$12 billion by 2020. On a global scale, Europe accounts for more than 25% of the market. While USA accounts for the largest share of the global market value on a country basis, Asia-Pacific is the fastest growing region in terms of growth rate anticipated in the near future and leads the world. PCR Machines account for the largest share of the entire market, driving a CAGR of 9.5% during the analysis period 2014-2020. PCR Reagents and PCR Detection Kits/Assays accounts for more than 40% of the market share and fastest growing segment with a CAGR approximately 10.8% and 10.5% by 2020 respectively. The report “Polymerase Chain Reaction (PCR) - Products/Tools - Global Trends, Estimates and Forecasts, 2014-2020” reviews the latest PCR market trends with a perceptive attempt to disclose the near-future growth prospects. An in-depth analysis on a geographic basis provides strategic business intelligence for life science sector investments. The study reveals profitable investment strategies for pharmaceutical manufacturers, biotechnology companies, laboratories, Contract Research  Organizations (CROs) and many more in preferred locations. The report primarily focuses on: Estimates are based on online surveys using customized questionnaires by our research team. Besides information from government databases, company websites, press releases & published research reports are also used for estimates. The analysis primarily deals with major PCR product/tools market. Further, the subdivided categories include: The period considered for the PCR Products/Tools market analysis is 2014-2020. The region wise distribution of the market consists of North America (USA and Canada), Europe (Germany, France, United Kingdom, Italy, Spain and Rest of Europe), Asia- Pacific (Japan, China, India, South Korea and Rest of Asia-Pacific), Latin America (Brazil, Columbia, Argentina and Rest of Latin America) and Rest of the World. The market growth rate in the major economies such as the U.S., Japan, China etc. are estimated individually for the upcoming years. More than 435 leading market players are identified and 45 key companies that project improved market activities in the near future are profiled. The report consists of 91 data charts describing the market shares, sales forecasts and growth prospects. Moreover, key strategic activities in the market including mergers/acquisitions, collaborations/partnerships, product launches/developments are discussed. Abbott Laboratories, Affymetrix, Inc., Agilent Technologies, Inc., BD Biosciences, Bio-Rad Laboratories, Inc., Complete Genomics, Inc., Epicentre® Biotechnologies, GE Healthcare (Life Sciences), Illumina, Qiagen, Inc., Dna Landmarks, Inc., Roche Diagnostics, Eppendorf AG, Cytocell Ltd, Shimadzu Biotech, Dnavision SA, Exiqon, Hokkaido System Science Co., Ltd., Ocimum Biosolutions, Ltd., HY Laboratories LTD., PerkinElmer Life Sciences & many more… History Of Polymerase Chain Reaction  All About PCR Specimen Preparation 1. Isolating The Target DNA - Denaturation 2. Binding PrimerstoThe DNA Chain - Annealing 3. Making A Replica – Extension PCR Variations Of Polymerase Chain Reaction Basic PCR Technique’s Fluctuations Allele-Precise PCR Pca (Polymerase Cycling Assembly)orAssembly PCR Asymmetric PCR Helicase-Reliant Amplification Hot–Start PCR Intersequence-Specific PCR Reverse PCR Ligation Mediated PCR Methylation Specific PCR Miniprimer PCR Multiplex Ligation-Reliant Probe Amplification Multiplex PCR Nested PCR Overlap-Extension PCR Quantitative PCR Rt-PCR Solid-Phase PCR Tail-PCR Touchdown PCR Pan-Ac Universal Fast Walking Parameters For Successful PCR I) Metal Ion Cofactors And PCR Ii) Substrates And Substrate Analogs For PCR Iii) Buffers And Salts For PCR Iv) Cosolvents Theory And Methodology Of Polymerase Chain Reaction Methodology Of Use PCR – Improvised Technique For Testing Nucleic Acids Formatting Step Denaturation Step Annealing Step Extension/Elongation Step PCR Reagents Role Of PCR Reagents Gotaq® PCR Mix Primers PCR Reagents Next Generation PCR Reagents For Clinical Diagnostics PCR Reagent Market Trends Other PCR Software PCR Robotics The Automation And Usage Of Robotics In Amplification Assays Pre-PCR Robotic System The Post-PCR Robotic System Integrated Robotic System For High Sample Throughput Within A DNA Databasing Unit PCR Arrays Need Of PCR Arrays Doctrine Of Assay Corroboration For Nucleic Acid Diagnostic Tests Assay Corroboration – An Introduction 1. Selecting An Assay Fitting Its Intended Purpose Considerations Towards Primitive Assay Developments A) Care And Restraints B) Protections For Avoiding False-Positive Results C) Safeguards For Avoiding Negative Outcomes. D) Standards’ Preparation


News Article | December 21, 2016
Site: www.nature.com

Endogenous 14-subunit Pol I was prepared from Saccharomyces cerevisiae as described previously5, with some modifications. Yeast strain CB010 expressing a C-terminal Flag/10× histidine-tagged A190 subunit was fermented and collected during the exponential phase. For Pol I purification, 350 g of cells were used. Proteins were precipitated overnight at 4 °C with ammonium sulphate (2 M). Re-solubilized Pol I was enriched by large-scale affinity purification with Ni-NTA beads (Qiagen). Further enrichment with anion and cation exchange chromatography yielded to pure Pol I enzyme. The sample was applied to a Superose 6 10/300 size-exclusion column (GE Healthcare) in 5 mM HEPES (pH 7.8), 150 mM potassium acetate, 1 mM MgCl , 10 μM ZnCl and 10 μM β-mercaptoethanol. DNA and RNA were purchased from IDT and Exiqon (Vedbaek), respectively. The nucleic acid scaffold sequences were as follows. Template DNA, 5′-AAGCTCAAGTACTTAAGCCTGGTCATTACTAGTACTGCC-3′; nontemplate DNA, 5′GGCAGTACTAGTAAACTAGTATTGAAAGTACTTGAGCTT-3′; RNA, 5′-UAUCUGCAUGUAGACC C-3′ (in underlined nucleosides, a methylene bridge connects the 2′-O and the 4′-C atoms of the ribose ring, thereby forming locked nucleic acids). Nucleic acids were annealed by continuously decreasing temperature from 95 °C to room temperature over a period of 60 min. EC assembly was achieved by incubating Pol I (300 μg, 3.5 mg ml−1) with a twofold molar excess of scaffold for 10 min at room temperature (Extended Data Fig. 1). For single-particle cryo-EM, Pol I EC complexes at a concentration of 200 μg ml−1 were cross-linked with 0.9 mM BS3 (Sigma Aldrich) for 30 min at 30 °C after optimization (Extended Data Fig. 1). The reaction was stopped by adding 50 mM ammonium bicarbonate, and the sample was purified by size-exclusion chromatography on a Superose 6 3.2/300 column (GE Healthcare) equilibrated in 5 mM HEPES (pH 7.8), 150 mM potassium acetate, 1 mM MgCl , 10 μM ZnCl and 10 μM β-mercaptoethanol. A 4 μl aliquot of 100 μg ml−1 purified sample was applied to a glow-discharged (10 s) R1.2/1.3 UltrAuFoil grid (Quantifoil), and plunge-frozen in liquid ethane (Vitrobot Mark IV (FEI) at 95% humidity, 4 °C, 8.5 s blotting time, blot force 14). Dose-fractionated movies (30 frames, 0.25 s each) were collected at a nominal magnification of 130,000× (1.05 Å per pixel) in nanoprobe energy-filtered transmission electron microscopy (EFTEM) mode at 300 kV with a Titan Krios (FEI) electron microscope using a GIF Quantum s.e. post-column energy filter in zero loss peak mode and a K2 Summit detector (Gatan). The camera was operated in dose-fractionation counting mode with a dose rate of ~7.5 electrons per pixel per second (0.25 s single frame exposure) and a total dose of ~56 electrons per Å2. Defocus values ranged from −0.6 to −3 μm with marginal (<0.1 μm) astigmatism. Global motion correction was performed as described28, but single-particle cryo-EM images were not partitioned. Parameters of the contrast transfer function (CTF) on each micrograph were estimated with CTFFIND4 (ref. 29). In a first step, ~1,500 particles were picked with the semi-automated swarm method of EMAN2 e2boxer.py30. Relion was used for the whole-image processing workflow31 unless stated otherwise. Reference-free 2D classes were generated, seven of which were used for template-based auto-picking after filtering to 20 Å. We extracted 401,000 particles from 2,300 micrographs with a 230 × 230 pixel box and used them for further processing. Pixels with 5 standard deviations from the mean value were replaced with random values from a Gaussian noise distribution. All images were normalized to make the average density of the background equal to zero during pre-processing. False-positive particles showing very bright dots, which were presumably gold contamination, were removed by manual inspection or unsupervised 2D classification. The remaining 282,000 particles were aligned on a reference generated from the PDB entry 4C2M5 filtered to 40 Å. To correct for local motion and for radiation damage, we used the movie processing function of Relion including ‘particle polishing’, in which the resolution-dependent decay caused by radiation damage is taken into account31. Local resolution was estimated as described32, 33. During classification of single-particle cryo-EM images (Extended Data Fig. 2), we first separated out particles lacking nucleic acids. To this end, the Pol I cleft of the average resulting after the first round of alignment was masked. The subsequent classification led to four classes: (1) nucleic acid-free Pol I (115,000 particles); (2) Pol I elongation complex (94,000 particles; hereafter referred to as ‘EC’); (3) Pol I elongation complex with an alternative DNA conformation (37,000 particles); and (4) other particles (35,000 particles). Among the nucleic acid-free polymerase particles, 80,000 particles displayed a defined position of the C-terminal domain of A12.2. We refer to the SP average of these particles as the ‘monomer’. In a second step, a mask around the dimerization domain was applied to remove particles from which the A49–34.5 subcomplex dissociated. This led to 32,000 and 40,000 particles in case of the Pol I monomer and Pol I EC, respectively. To visualize the mobile stalk, we then applied a mask around A14/43 during refinement allowing only local searches. Gold-standard Fourier shell correlations (FSCs) were calculated during the 3D refinement in Relion between two independently refined halves of the data. According to the FSC 0.143 criterion, global resolutions of 4.0 Å and 3.8 Å were estimated for Pol I monomer and EC structures, respectively, which were sharpened with temperature factors of −146 Å2 and −149 Å2, respectively. Two separate models were built for the monomer and the Pol I EC. PDB entry 4C2M5 was used as the starting model in both cases. Models were constructed lacking the expander, connector and, in case of the EC, the C-terminal domain of A12.2. The models were further truncated by removing the peripheral subcomplexes A49–34.5 and A14–43. The starting models were placed in densities for the monomer and the EC by fitting in UCSF Chimera34, followed by rigid body fitting with a Phenix real space refinement35. Rigid body groups were defined based on module definitions originally proposed for Pol II14. A starting model for DNA and RNA was derived from bovine Pol II11 and further refined. Structurally altered regions were adjusted to the density in COOT36 followed by real space refinement in Phenix. To generate complete models, structure of subcomplexes A49–34.5 and A14–43 were fit into the classified map in Chimera. No changes were made within the domains during model building, except for A34.5 C-terminal tail. The models were validated using the FSC between the model and the map, EMRinger37 and Molprobity38. Miller chromatin spreads25 were prepared with some modifications as described39, using the NOY1071 yeast strain with 25 copies of ribosomal DNA (rDNA) repeats40. Yeast cells were grown to mid-log phase (absorbance (A ) = 0.4) in YPG medium supplemented with 1 M sorbitol at 30 °C. YPG medium contains 1% (w/v) yeast extract, 2% (w/v) bacto-peptone and 2% glucose. 1 ml yeast cell culture in mid-log phase was added for 4.5 min to the preheated 20T zymolyase (Amsbio, Biotechnology) solution (5 mg/200 μl zymolyase in YPG medium at 30 °C) for a slight digestion of the yeast cell wall. Subsequently, the yeast cell culture was centrifuged at 13.000 rpm for 15 s and the pellet was resuspended in 1 ml of 0.0025% Trition-X-100 (Sigma-Aldrich) ddH O at pH 9.2 adjusted with pH 10 buffer (Thermo Fischer Scientific). The yeast suspension was transferred to a flask containing 5 ml of 11 mM KCl solution. The lysate was pipetted and incubated in a hydrophobic plastic Petri dish (Carl Roth GmbH + Co. Kg) placed on a shaker for 45 min. Sucrose was excluded from the sucrose-formalin solution as used in ref. 39. To fix chromatin, 400 μl of 37% formaldehyde (Sigma-Aldrich) solution was applied for 5 min. The yeast lysate was deposited on electron microscopy grids with a ~30 nm thick carbon support layer evaporated by a carbon coater 208Carbon (Cressington) and glow discharged for ~1 min using a home-made device. Subsequently they were placed within home-built grid chamber insets and centrifuged within an Eppendorf 5810R centrifuge (Eppendorf) for 5 min at ~2,200g at 20 °C. Before plunge-freezing the grids were transferred to an 11 mM KCl solution for which ddH O at pH 9.2 was used. The grids were immediately plunge-frozen in liquid ethane by a Vitrobot Mark IV (FEI) with 25 blotting force, 3 s blotting and 10–15 s draining time and the blotting chamber set to 100% humidity at 10 °C. Cryo-grids were mounted into autoloader grids with C-clippings (FEI) in an EM FC6 cryo-microtome (Leica) that was cooled with liquid nitrogen under gaseous flow to −150 °C. During mounting, grids were visually inspected to determine whether they contained an intact carbon film. Tilt-series were recorded using DigitalMicrograph (Gatan Inc.) at a nominal magnification of 33,000× (4.0 Å per pixel) in EFTEM mode at 300 keV using a Titan Krios with a GATAN GIF Quantum s.e. post-column energy filter in zero loss peak mode and a K2 Summit detector. The camera was operated in counting mode with a dose rate of ~15 electrons per pixel per second and a total dose of ~100 electrons per Å2. The tilt-series ranged from –63° to +63° with an angular increment of 2° and defocus set at −5 μm. Tilted images were fiducial-less aligned41 and reconstructed by super-sampling SART42. The CTF was measured and corrected in slices in 3D43. 3D reconstructions were visualized with the EMpackage in Amira (FEI & Zuse Institute)44 and analysed in TOM package45. Segmentation of the Miller trees was performed manually in Amira by drawing contours encompassing individual features on mildly Gaussian low-pass filtered tomograms using the high-contrast option of super-sampling SART42. Sub-tomograms containing transcribing Pol I enzymes on rDNA were manually selected. The enzymes were re-centred using a Gaussian blob of the size of Pol I. The positions of all enzymes were subsequently indexed such that they were placed sequentially on the DNA. As the DNA was visible in the reconstructions, the indexing was unambiguous (Extended Data Fig. 8d). For sub-tomogram averaging (that is, the cryo-electron tomography structure) we selected five Miller trees according to the following criteria: (1) They visually showed a transcriptional directionality (several Miller trees were not completely visualized in the field of view). (2) All Pol I enzymes aligned according to the Miller tree directionality. (3) The RNA exit site matched previous observations11 (Extended Data Fig. 8c, e). This resulted in a total of 225 Pol I enzymes contributing to the final sub-tomogram average. Sub-tomogram averaging was then performed on each Miller tree individually. This was to guarantee that the directionalities of the enzymes were not mixed owing to the globular shape of the enzyme, the pseudo-symmetry axis, and the varying ice thickness of the recording area leading to different signal-to-noise ratio among the enzymes. The Euler angles were determined a priori for each of the three consecutive Pol I enzymes per Miller tree by calculating the vector from centre-to-centre position. Constrained sub-tomogram averaging was performed on sub-tomograms with 64 × 64 × 64 voxels using a spherical mask (~20 nm diameter). To ensure the robustness of the sub-tomogram averaging, two different starting references were used (1) the average of all rotationally pre-aligned Pol I enzymes per strand, and (2) a Gaussian blob of the size of Pol I. Both converged to approximately the same density. During sub-tomogram averaging of each individual Miller tree, polymerases were low-pass filtered and the alignment was run with a translational freedom of 10 voxels around the Gaussian blob refined position, a full rotational freedom for phi and psi, and a constrained rotational freedom of ±30 degrees for θ with 5 degrees sampling increment, until the average reached convergence. The missing wedge was taken into account during the entire alignment. The sub-tomogram averages of each Miller tree were individually inspected and the orientation of the Pol I enzymes on each Miller tree was analysed. The 3′ to 5′ directionality of the enzymes on each Miller tree was analysed. If all enzymes had the same directionality (that is, the signal-to-noise ratio was sufficient to align them properly), their sub-tomogram average was used for further processing. If the enzymes had conflicting directionalities (including complete random directionality), their sub-tomogram average was rejected. Five Miller trees qualified for this criterion. Their enzyme directionality was visualized compared to the Miller-tree directionality, and they all conformed. Finally, 225 enzymes (from the 993 total enzymes in the tomograms) of the five selected Miller trees were subjected to a refined sub-tomogram averaging and the resulting cryo-electron tomography structure reached a resolution of ~29 Å with the FSC 0.5 threshold criterion (~31 Å when compared to the single-particle cryo-EM structure). In the tomograms both the DNA and the RNA could be seen emanating from the enzymes (Extended Data Fig. 8c, d). They were manually localized as close as possible to the enzyme and subsequently sub-tomogram averaging was performed around this position. To obtain evidence for the RNA exit channel visualized in the single-particle cryo-EM structure, we made three independent attempts to manually select the position of exiting RNA on Pol I in the tomogram without prior knowledge of the structure (Extended Data Fig. 8e). The resulting point distribution of exiting RNA on the cryo-electron tomography structure agreed with the location of the RNA exit channel in the single-particle cryo-EM map and further confirmed the correct superposition of the two independent structures. The distances of consecutive Pol I enzymes were calculated as the Euclidian distance between their centre-to-centre positions. For plotting the probability density function, one enzyme was centred, the downstream enzyme was placed on the x axis, and the upstream enzyme was placed on the plane. Between three consecutive neighbouring enzymes, the in-plane angle was estimated. For fitting of structures to the cryo-electron tomography reconstruction, rigid body fitting of the cryo-electron tomography and the single-particle cryo-EM structures of the Pol I EC was performed automatically, using MATLAB scripts (MATLAB and Statistics Toolbox Release 2012b, The MathWorks, Inc., Natick), implemented in the TOM package45 (all scripts are freely available upon request) as well as Chimera34. This resulted in a global cross-correlation value of ~0.8 and a FSC shown in Extended Data Fig. 9a. The contour level for the cryo-electron tomography structure for volume rendering of our average was calculated from the theoretical molecular mass with an average protein density of 0.8 kDa nm−3. Cryo-electron microscopy densities were deposited in the Electron Microscopy Data Base under the accession codes EMD-4147 and EMD-4148 for the EC and the free monomer, respectively. Sub-tomogram average densities were deposited in the Electron Microscopy Data Base under the accession codes EMD-4149. Model coordinates were deposited in the Protein Data Bank under the accession codes 5M3F and 5M3M for the EC and the free monomer, respectively.


News Article | September 21, 2016
Site: www.nature.com

Fh1-proficient (Fh1fl/fl) cells and the two Fh1-deficient clones (Fh1−/−CL1 and Fh1−/−CL19) were obtained as previously described7. Fh1−/−+pFh1 cells were single clones generated from Fh1−/−CL19 after stable expression of a plasmid carrying mouse wild-type Fh1 (Origene, MC200586). Mouse cells were cultured using DMEM (Gibco-41966-029) supplemented with 10% heat-inactivated serum (Gibco-10270-106) and 50 μg ml−1 uridine. Genotyping of cells was assessed as previously described7. Human FH-deficient (UOK262) and FH-restored (UOK262pFH) cells were obtained as previously described7 and cultured in DMEM (Gibco-41966-029) supplemented with 10% heat-inactivated serum (Gibco-10270-106). HK2 cells were a gift from the laboratory of E.R.M. These cells were authenticated by short tandem repeat and cultured in DMEM (Gibco-41966-029) supplemented with heat-inactivated 10% serum. All cell lines were tested for mycoplasma contamination using MycoProbe Mycoplasma Detection Kit (R&D Systems CUL001B) and were confirmed mycoplasma-free. The Fh1–GFP vector was generated by amplifying wild-type Fh1 sequence using cDNA generated from Fh1fl/fl cells by PCR. Restriction overhangs (KpnI, EcoRI) were included in the primer sequence to allow restriction enzyme cloning of Fh1 into the backbone vector pEF1α-V5/His (Life Technology). We then used a two-step PCR ‘restriction-free’ method to swap the V5-His sequence within pEF1α with the AcGFP sequence to yield a fusion protein, Fh1–GFP. 105 Fh1−/− CL1 cells were plated onto 6-well plates and the day after transfected with the Fh1–GFP vector using Lipofectamine 2000 following the manufacturer’s instructions. After 2 weeks, cells were sorted for GFP expression and the medium-expressing population was maintained in culture and amplified. A pEF1α–GFP empty vector was used as control. Primers for cloning are listed in Supplementary Table 1. Lentiviral particles for shRNA delivery were obtained as previously described7 from the filtered growth medium of 2 × 106 HEK293T cells transfected with 3 μg psPAX, 1 μg pVSVG and 4 μg of the plasmid of interest using Lipofectamine 2000/3000 (Life Technology). 105 cells of the indicated genotype were then plated onto 6-well plates and infected with the viral supernatant in the presence of 4 μg ml−1 polybrene. After two days, the medium was replaced with selection medium containing 1 μg ml−1 puromycin. pGIPZ vectors for shRNA against mouse Hif1b (also known as Arnt; RMM4532-EG11863), Tet2 (RMM4532-EG214133) and Tet3 (RMM4532-EG194388) were purchased from GE Healthcare UK. pLenti 4.1 Ex for expression of miRNAs was purchased from Addgene (Plasmid #35533 and #35534). pLenti 4.1 Ex scrambled vector was generated by cloning a scrambled DNA sequence taken from a commercially available vector (pCAG-RFP-miR-Scrint Addgene no. 198252) into the empty backbone. Cells were plated the day before the experiments onto 6-well plates (3 × 105) or 12-well plates (105). Total RNA was isolated using RNeasy Kit (Qiagen). miRCURY RNA Isolation Kit (Exiqon) was used for miRNA extraction. RNA isolation was carried out following the manufacturer’s protocols. RNA was quantified using the fluorimeter Qubit 2.0 (Life Technologies) following the manufacturer’s instructions or Nanodrop (Thermo). Reverse transcription of RNA was performed using Quantitect-Reverse transcription kit (Qiagen) or miScript PCR kit (Qiagen) using 300–500 ng total RNA. Real-time qPCR was performed using Quantitect Syber Green master mix (Qiagen) or Taqman universal mix (Life Technology) on a Step One Plus real-time PCR system (Life Technology). Experiments were analysed using the software Expression Suite (Life Technology) and StepOne software 2.3 and relative quantification (RQ) with max and min values (RQ max and RQ min) were calculated using the s.d. algorithm. Statistical analysis was performed using Expression Suite software on at least three independent cultures. Housekeeping genes used for internal normalization were Actb for mRNA and Snord95, Snord61 and RNU6-6P for miRNAs. The primers were designed using ProbeFinder (Roche) or purchased from Qiagen and are listed in Supplementary Table 1. 5 × 105 cells were plated onto 6-cm dishes. Their genomic DNA was extracted using DNeasy kit (Qiagen), and purified using DNA Cleaning and Concentrator kit (Zymo Research) following the manufacturer’s instructions. Genomic DNA (20 ng per well), quantified using Qubit, was digested using OneStep qMethyl kit (Zymo Research) following the manufacturer’s protocol. Primers used are listed in Supplementary Table 1. For the methyl-specific PCR (MSP) assay, 500 ng of purified DNA was bisulfate converted using the EZ-DNA Methylation-direct kit (Zymo Research) following the manufacturer’s datasheet. 50 ng bisulfate-converted DNA, quantified using a Nanodrop spectrofluorimeter, were used for PCR reaction with AmpliTaq Gold (Life Technology) following the manufacturer’s protocol. Thirty amplification cycles were used. Methylation-specific primers were designed using MethPrimer31 (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi) and are listed in Supplementary Table 1. Migration experiments were performed using xCELLigence instrument (ACEA Biosciences). In brief, 5 × 104 cells were plated onto cell invasion/migration (CIM) plates in medium supplemented with 1% FBS. Complete medium with 20% FBS was used as a chemoattractant. Migration was registered in real time for at least 24 h and the cell index was calculated using the appropriate function of the xCELLigence software. The day before the experiment, 5 × 104 mouse cells of the indicated genotype were plated onto 6-cm dishes. The next day, the medium was replaced with fresh medium containing Hoechst (Sigma-Aldrich) and cells were incubated for 15 min at 37 °C with 5% CO before starting recording. Images were collected every minute for 3 h using a Zeiss Axiovert 200M microscope with a 10× objective. Analysis of cell movement was performed using cell tracker (http://www.celltracker.website) implemented in MATLAB (MATLAB R2013b, MathWorks) as previously described32. Three replicates were analysed for each cell type. All tracks were examined and those belonging to non-isolated cells deleted. The average speed for each cell was calculated as the sum length of the cell’s trajectory divided by the total time over which the trajectory was measured. As the data were not normally distributed (Shapiro-Wilk test), a Mann–Whitney test was used to compare the average speeds of the cells. Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using the real-time flux analyser XF-24e (Seahorse Bioscience) as previously described7. In brief, 4 × 104 cells were left untreated and then treated with 1 μM oligomycin, 2 μM carbonyl cyanide-p-trifluoromethoxyphenylhydrazone (FCCP), rotenone and antimycin A (both 1 μM) (all Sigma-Aldrich). At the end of the run, cells were lysed using RIPA buffer (25 mM Tris/HCl pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, 0.1% SDS). The protein content of each well was measured using a BCA kit (Pierce) following the manufacturer’s instruction. OCR and ECAR were normalized to total protein content as indicated. 5 × 104 cells were plated onto chamber slides (Laboratory Tech), cultured in standard conditions overnight and then fixed using 100% methanol for 2 min at –20 °C. After two washes in PBS, cells were permeabilized and incubated with blocking solution (BSA 2%, 0.1% Triton X-100, 0.1% Tween 20 in PBS) for 30 min at room temperature. Cells were then incubated with the primary antibody (overnight at 4 °C). For 5hmC staining, cells were grown on coverslips onto a 12-well plate. Cells were then fixed with 4% PFA in PBS for 15 min at room temperature, washed three times in PBS and then incubated for 15 min with 0.4% Triton X-100 in PBS. After three washes in PBS, cells were denatured using a solution of 2 M HCl for 15 min at room temperature and neutralized using 100 mM Tris pH 8 for 5 min After three washes in PBS, cells were incubated with blocking solution (5% FBS, 0.1% Triton X-100, 0.1% Tween 20 in PBS) for 1 h and then primary antibody was added at 4 °C overnight. After three washes in PBS, cells were incubated with secondary antibody for 2 h at room temperature and then slides or coverslips were mounted (Vectashield with DAPI) and images taken using a Leica confocal microscope TCS SP5 with 20× or 40× objectives. Laser intensity, magnification, and microscope settings per each channel were maintained equal throughout the different experimental conditions. Antibodies used are listed in Supplementary Table 1. Cell lysates were prepared in RIPA buffer. Protein content was measured using a BCA kit (Pierce) following the manufacturer’s instructions. 50–100 μg protein was heated at 70 °C for 10 min in the presence of Bolt loading buffer 1× supplemented with 4% β-mercaptoethanol (Sigma). Samples were then loaded onto Bolt gel 4–12% Bis-Tris (Life Technology) and run using MOPS 1× or MES 1× buffer at 165 V constant for 40 min. Dry transfer of the gels was carried out using IBLOT2 system (Life Technology). Membranes were then incubated in blocking buffer (5% BSA or 5% milk in TBS 1× + 0.01% Tween 20) for 1 h at room temperature. Primary antibodies in blocking buffer were incubated overnight at 4 °C. Secondary antibodies (conjugated with 680 or 800 nm fluorophores from Li-Cor) were diluted 1:2,000 in blocking buffer and incubated for 1 h at room temperature. Images were acquired using Odyssey software (Li-Cor). Primary antibodies are listed in Supplementary Table 1. Fh1fl/fl cells were cultured either with 200 μM monomethyl-fumarate (MMF, Sigma-Aldrich) for 2 weeks and then with 400 μM MMF for the following 6 weeks, or with 4 mM monomethyl-succinate (MMS, Sigma-Aldrich) for 8 weeks. HK2 cells were cultured with MMF 400 μM for 8 weeks. Fh1−/− cells were treated with the indicated doses of dimethyl aKG (DM-aKG, Sigma-Aldrich) for 24 h. Fh1fl/fl cells were treated with histone demethylase inhibitor GSKJ4 (Tocris) 1 μM for 8 weeks. MMF, MMS and GSK-J4 were added twice a week after passaging the cells. ChIP was performed as previously described33. Enrichment was determined by real-time PCR and the ChIP signal was normalized to input, IgG-only ChIP and negative control (genomic region devoid of histone markers). For Tet ChIP–PCR, the signal was normalized over input and IgG ChIP, as Tet-specific genomic negative controls are not as readily identifiable. Antibodies and primers for ChIP-PCR are indicated in Supplementary Table 1. 3C assay coupled with quantitative PCR (qPCR) was performed as previously described18. In brief, 107 cells were crosslinked with 1% formaldehyde for 10 min at room temperature and were quenched with glycine. Cells were then lysed by dounce homogenization in ice-cold lysis buffer (10 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.2% Igepal CA-630, all Sigma) supplemented with protease inhibitor (Roche). Cells were then washed in 1.2× NEB buffer 2 (New England Biolabs). Non-crosslinked proteins were removed with SDS (Sigma-Aldrich) and then quenched with Triton X-100. Chromatin was digested overnight with EcoRI restriction enzyme (New England Biolabs). Afterwards EcoRI was inactivated by heating at 65 °C for 20 min In-nuclear DNA ligation was performed at 16 °C for 4 h in the mixture containing 1× T4 DNA ligase buffer (New England Biolabs), 10 mg ml−1 BSA (New England Biolabs), and 1 U μl−1 T4 DNA ligase (Invitrogen). The ligation mixture was then incubated with Proteinase K (Roche) at 65 °C overnight to reverse the crosslinking and was incubated with RNase A (Roche) at 37 °C for 1 h. DNA was purified with phenol (pH 8.0, Sigma) once and then with phenol:chloroform:isoamyl alcohol (25:24:1, pH 8.0, Sigma), followed by ethanol precipitation by adding 2.5 volume of ice-cold 100% ethanol and 1/10 volume of 3 M sodium acetate (pH 5.2, Lonza). The DNA pellet was washed with 70% ethanol twice and was eventually dissolved in 100 μl distilled water. The concentration of 3C DNA was determined by Qubit dsDNA HS assays (Invitrogen). 100 ng DNA was taken to run qPCR in duplicate wells for each 3C sample, using Taqman Universal PCR Master Mix (Applied Biosystems) and specific Taqman primers and probes on ABI 7900 (Applied Biosystems) following the manufacturer’s instruction. Data were analysed as recommended18 and were normalized to the internal loading control of the Gapdh locus. Calculation of primer locations was based on the transcription start site (TSS) of the Ttll10 transcript (ENSMUST00000097731). Oligonucletide sequences are listed in Supplementary Table 1. 3 × 105 cells were plated onto a 6-well plate and cultured in standard conditions for 24 h. Medium was replenished with fresh medium and, after 24 h, intracellular metabolites were extracted as previously described21. Liquid chromatography–mass spectrometry (LC–MS) analysis was performed on a QExactive Orbitrap mass spectrometer coupled to a Dionex UltiMate 3000 Rapid Separation LC system (Thermo). The LC system was fitted with either a SeQuant Zic-HILIC column (column A, 150 mm × 4.6 mm, 5 μm), or a SeQuant Zic-pHILIC (column B, 150 mm × 2.1 mm, 5 μm) with the corresponding guard columns (20 mm × 2.1 mm, 5 μm) both from Merck. With column A, the mobile phase was composed of 0.1% aqueous formic acid (solvent A) and 0.1% formic acid in acetonitrile (solvent B). The flow rate was set at 300 μl min−1 and the gradient was as follows: 0–5 min 80% B, 5–15 min 15 min 30% B, 15–20 min 10% B, 20–21 min 80% B, hold at 80% B for 9 min For column B, the mobile phase was composed of 20 mM ammonium carbonate and 0.1% ammonium hydroxide in water (solvent C), and acetonitrile (solvent D). The flow rate was set at 180 μl min−1 with the following gradient: 0 min 70% D, 1 min 70% D, 16 min 38% D, 16.5 min 70% D, hold at 70% D for 8.5 min The mass spectrometer was operated in full MS and polarity switching mode. Samples were randomized, in order to avoid machine drift, and were blinded to the operator. The acquired spectra were analysed using XCalibur Qual Browser and XCalibur Quan Browser softwares (Thermo Scientific) by referencing to an internal library of compounds. Calibration curves were generated using synthetic standards of the indicated metabolites. Proteomics experiments were performed using mass spectrometry as reported34, 35. In brief, cells were lysed in urea lysis buffer (8 M urea, 10 mM Na VO , 100 mM β-glycerol phosphate and 25 mM Na H P O and supplemented with phosphatase inhibitors (Sigma)) and proteins reduced and alkylated by sequential addition of 1 mM DTT and 5 mM iodoacetamide. Immobilized trypsin was then added to digest proteins into peptides. After overnight incubation with trypsin, peptides were desalted by solid phase extraction (SPE) using OASIS HLB columns (Waters) in a vacuum manifold following the manufacturer’s guidelines with the exception that the elution buffer contained 1 M glycolic acid. Dried peptide extracts were dissolved in 0.1% TFA and analysed by nanoflow LC–MS/MS in an LTQ-orbitrap as described34, 35. Gradient elution was from 2% to 35% buffer B in 90 min with buffer A being used to balance the mobile phase (buffer A was 0.1% formic acid in water and B was 0.1% formic acid in acetonitrile). MS/MS was acquired in multistage acquisition mode. MS raw files were converted into Mascot Generic Format using Mascot Distiller (version 1.2) and searched against the SwissProt database (version 2013.03) restricted to human entries using the Mascot search engine (version 2.38). Allowed mass windows were 10 ppm and 600 mmu for parent and fragment mass to charge values, respectively. Variable modifications included in searches were oxidation of methionine, pyro-glu (N-term) and phosphorylation of serine, threonine and tyrosine. Results were filtered to include those with a potential for false discovery rate less than 1% by comparing with searches against decoy databases. Quantification was performed by obtaining peak areas of extracted ion chromatographs (XICs) for the first three isotopes of each peptide ion using Pescal36, 37. To account for potential shifts in retention times, these were re-calculated for each peptide in each LC–MS/MS run individually using linear regression based on common ions across runs (a script written in python 2.7 was used for this retention time alignment step). The mass and retention time windows of XICs were 7 ppm and 1.5 min, respectively. Initial sample quality control was performed using a Bioanalyzer 2200 system in conjunction with the Total RNA Nano chip (Agilent). 250 ng total RNA was labelled using the miRCURY LNA microRNA Hy5 Power labelling kit (Exiqon) according to the Toray array protocol. Samples were hybridized to the Human/Mouse/Rat miRNA 4-plex miRBase v17 array (Toray) and subsequently scanned using the 3D-Gene Scanner 3000 (Toray) according to the manufacturer’s instructions. Data were normalized according to instructions provided by Toray. Briefly, the presence or absence of signals was determined using a cut off defined as the mean of the middle 90% of the blank control intensities (background average intensity) + 2σ. Positive control signals were removed and the background average intensity subtracted from the signal intensities to give the background subtracted signal intensities (y). Normalized signal intensities (NSI) were then calculated as follows: NSI = 25y/(y). Raw data are presented in Supplementary Table 4. DNA from healthy and tumour tissue was extracted using DNeasyKit (Qiagen) following the manufacturer’s instructions. 0.5–1 μg DNA resuspended in 25 μl water was first denatured at 100 °C for 30 s, cooled on ice, and 2 μl ZnSO (20 mM) was added. DNA was digested at 50 °C for 16 h using 1 μl Nuclease P1 (200 U ml−1, Sigma Aldrich) and dephosphorylated at 65 °C for 2 h by adding 1 μl bacterial alkaline phosphatase (BAP) (150 U μl−1, Life Technology). The pH was then adjusted using 30 μl 0.5 M Tris-HCl pH 7.9 for 1 h at 37 °C. Analysis of global levels of C, 5hmC and 5mC was performed on a QExactive Orbitrap mass spectrometer coupled to a Dionex UltiMate 3000 Rapid Separation LC fitted with an Acquity UHPLC HSS T3 column (100 × 2.1 mm, 1.8). The mobile phase consisted of 0.1% aqueous formic acid (solvent A) and 0.1% formic acid in acetonitrile (solvent B) at a flow rate of 300 μl min−1. Calibration curves were generated using synthetic standards for 2′-deoxycytidine and 5-methyl- and 5-hydroxymethyl-2′-deoxycytidine (Berry&Associates). The mass spectrometer was set in a positive ion mode and operated in parallel reaction monitoring. Ions of masses 228.10, 242.11, and 258.11 were fragmented and full scans were acquired for the base fragments 112.0505, 126.0661, and 146.0611 ± 5 ppm (corresponding to C, 5mC and 5hmC, respectively). The extracted ion chromatogram (EIC) of the corresponding base-fragment was extracted using the XCalibur Qual Browser and XCalibur Quan Browser software (Thermo Scientific), and used for quantification. Quantification was performed by comparison with the standard curve obtained from the pure nucleoside standards running with the same batch of samples. The level of 5hmC present in the sample was expressed as a percentage of total cytosine content. Specimens were formalin fixed and embedded in paraffin wax; 3-μm serial sections mounted on Snowcoat X-tra slides (Surgipath, Richmond, Illinois) were dewaxed in xylene and rehydrated using graded ethanol washes. For antigen retrieval, sections were immersed in preheated DAKO target retrieval solution (DAKO) and treated for 90 s in a pressure cooker. Sections analysed contained both tumour and adjacent normal renal parenchyma acting as an internal control; in addition, substitution of the primary antibody with antibody diluent was used as a negative control. Antigen–antibody complexes were detected using the Envision system (DAKO) according to the manufacturer’s instructions. Sections were counterstained with haematoxylin for 30 s, dehydrated in graded ethanol washes, and mounted in DPX (Lamb). Antibodies used were: E-cadherin (HECD1, CRUK) and vimentin (clone V9, Dako). TET1 (SAB 2501479) and TET2 (HPA 019032) antibodies were purchased from Sigma Aldrich. Total RNA was extracted from tumour and healthy tissue using miRCURY kit (Exiqon, Denmark) following the manufacture’s protocols. RNA reverse-transcription and real-time qPCR were carried out as described above. Data were normalized to healthy tissue using SNORD61 and RNU6-6P as endogenous controls. The patients consented to use of tissues for studies approved by the National Research Ethics Committee London (REF number 2002/6486 and 03/018). The FH mutation in HLRCC Patient A is c.1300 T>C and in Patient B is c.1189 G>A. Volcano plots were generated using the log fold-change on the x-axis and −log of the multi-hypothesis corrected P value (false-discovery rate) on the y-axis generated by Limma38 differential analysis. The EMT gene signature was extracted from Taube and colleagues39. Signature enrichment was performed with the commonly used GSEA test8. Signature significance was calculated by randomizing the gene signatures 10,000 times. The TCGA RNA-seq and miRNA-seq data sets for clear cell (KIRC) and papillary (KIRP) renal carcinoma were downloaded from the Broad Firehose webpage (http://gdac.broadinstitute.org/). Differential analysis was performed with R package Limma38 using voom40 to transform the RNA-seq counts. Cancer patients were ranked according to FH expression and survival analysis was performed by comparing the overall survival time of upper versus lower quartile of the FH-ranked list of patients. Kaplan–Meier curves were built using in-house R scripts and significance was calculated using the R package Survival by applying a χ2 test. Hive plots were generated using the R package HiveR. Graphpad Prism 6 was used to generate graphs and perform statistical analysis (one-way ANOVA test with Tukey’s post hoc test for multiple comparisons was used unless otherwise indicated). ChIP statistical analysis was generated using Excel (Microsoft). Except for metabolomic experiments, no randomization or blinding was performed. No statistical method or power analysis was used to predetermine sample size. The R and Python scripts for the analyses above can be found at https://github.com/saezlab/Sciacovelli_et_al. Specific queries related to the computational analysis can be addressed to J.S.-R.


According to Stratistics MRC, the Global Polymerase Chain Reaction market is accounted for $6.95 billion in 2015 and is expected to reach $12.56 billion by 2022 growing at a CAGR of 8.8% during the forecast period. Increasing investments in gene therapy and government support in R&D are some of the factors fueling the market growth. However, rising non-validated home brew test and reimbursement issues are hampering the market. Real time polymerase chain reaction instrument is one of the major challenges for the polymerase chain reaction technologies market. Academics and research organizations hold the largest share in end users segment. Clinical diagnostic labs and hospitals market is anticipated to grow at a faster pace during the forecast period. North America is the leading PCR market followed by Europe, owing to rising demand for low-cost diagnosis in healthcare. Some of the key players in Polymerase Chain Reaction market are Sigma-Aldrich Co. LLC., Thermo Fisher Scientific Inc., GE Healthcare, F. Hoffmann-La Roche Ltd., Becton, Dickinson & Company, QIAGEN, Agilent Technologies Inc., Bio-Rad Laboratories Inc., Beckman Coulter Inc., Affymetrix Inc., Abbott Laboratories, Cytocell Ltd, Shimadzu Biotech, HY LABORATORIES, Eppendorf AG, Exiqon, Dna Landmarks, Roche Diagnostics, Ocimum Biosolutions, BD Biosciences, Illumina, Complete Genomics, Dnavision SA, Epicentre® Biotechnologies and Hokkaido System Science Co. Products Covered: • Reagents and Consumables o Buffers o Consumable o Nuclease Free Water o Enzymes o Template o Primers And Probes o DNA o Master Mixes o dNTP's o Others Reagents and Consumables • Instruments  o Digital PCR Systems o Standard PCR Systems Real time PCR's • Life Sciences • Industrial Application o Animal husbandry o Environment o Biomedical research o Agricultural o Applied testing o Other PCR industry applications • Clinical Diagnostics o Infectious o Non Infectious • Others Applications o Dentistry o Pathogen Detection End Users Covered: • Academic and Research Organizations • Pharmaceutical and Biotechnology Industries • Clinical Diagnostics Labs and Hospitals • Other End Users o Blood Banks Regions Covered: • North America o US o Canada o Mexico • Europe o Germany o France o Italy o UK  o Spain   o Rest of Europe     • Asia Pacific o Japan        o China        o India        o Australia        o New Zealand       o Rest of Asia Pacific     • Rest of the World o Middle East o Brazil o Argentina o South Africa o Egypt What our report offers: - Market share assessments for the regional and country level segments - Market share analysis of the top industry players - Strategic recommendations for the new entrants - Market forecasts for a minimum of 7 years of all the mentioned segments, sub segments and the regional markets - Market Trends (Drivers, Constraints, Opportunities, Threats, Challenges, Investment Opportunities, and recommendations) - Strategic recommendations in key business segments based on the market estimations - Competitive landscaping mapping the key common trends - Company profiling with detailed strategies, financials, and recent developments - Supply chain trends mapping the latest technological advancements

Loading Exiqon collaborators
Loading Exiqon collaborators