Seraing-le-chateau, Belgium
Seraing-le-chateau, Belgium

Eurogentec is an international biotechnology supplier, based in Belgium, that specializes in genomics and proteomics kits and reagents as well as cGMP biologics. The company was founded in 1985 as a spin-off from the University of Liège. Eurogentec's contract manufacturing organization facilities are licensed by the Belgian Ministry of Health to produce clinical trial and commercial biopharmaceutical material and also licensed by the US FDA to manufacture a commercial recombinant protein product for the US market. Eurogentec operates two manufacturing facilities in Belgium that provide custom biologics and oligonucleotide-based components for diagnostic and therapeutic applications. Wikipedia.


Time filter

Source Type

News Article | January 13, 2016
Site: www.nature.com

All conditional Foxo1- and Myc-mutant mice were on a C57BL/6 genetic background and generated as described16, 18, 24, 25. For constitutive Cre-mediated recombination in ECs, Foxo1fl/fl or Rosa26-Foxo1CA mice were bred with Tie2-cre transgenic mice31. To avoid recombination in the female germline, only Tie2-cre-positive male mice were used for intercrossing. Embryos were collected from cre-negative females at the indicated time points and genotyping was performed from isolated yolk sacs. For inducible Cre-mediated recombination in ECs, floxed mice were bred with transgenic mice expressing the tamoxifen-inducible, Pdgfb promoter-driven creERT2 recombinase32. The degree of Cre-mediated recombination was assessed with the double-fluorescent Cre-reporter Rosa26-mT/mG33 allele, which was crossed into the respective mutant mice. For the analysis of angiogenesis in the postnatal mouse retina, Cre-mediated recombination was induced in newborn mice by intraperitoneal (i.p.) injections of 25 μl 4-hydroxy-tamoxifen (4-OHT; 2 mg ml−1; Sigma-Adrich) from postnatal day (P)1 to P4. Eyes were harvested at P5 or P21 for further analysis. In mosaic recombination experiments, 4-OHT (20 μl g−1 body weight of 0.02 mg ml−1) was injected i.p. at P3 and eyes were collected at P5. To induce Cre-mediated recombination in mouse embryos, 100 μl of 4-OHT (10 mg ml−1) was injected i.p. into pregnant females from embryonic day (E)8.5 to E10.5. Embryos were harvested at E11.5 for the analysis of angiogenesis in the embryonic hindbrain. The Rosa26-Foxo1CA, Rosa26-Myc and Rosa26-mT/mG alleles were kept heterozygous for the respective transgene in all experimental studies. Apart from the mosaic studies, control animals were littermate animals without cre expression. Male and female mice were used for the analysis, which were maintained under specific pathogen-free conditions. Experiments involving animals were conducted in accordance with institutional guidelines and laws, following protocols approved by local animal ethics committees and authorities (Regierungspraesidium Darmstadt). To analyse blood vessel growth in the postnatal retina, whole mouse eyes were fixed in 4% paraformaldehyde (PFA) on ice for 1 h. Eyes were washed in PBS before the retinas were dissected and partially cut into four leaflets. After blocking/permeabilization in 2% goat serum (Vector Laboratories), 1% BSA and 0.5% Triton X-100 (in PBS) for 1 h at room temperature, the retinas were incubated at 4 °C overnight in incubation buffer containing 1% goat serum, 0.5% BSA and 0.25% Triton X-100 (in PBS) and the primary antibody. Primary antibodies against the following proteins were used: cleaved caspase 3 (Cell Signaling Technology, #9664, 1:100), collagen IV (AbD Serotec, #2150-1470, 1:400), ERG 1/2/3 (Abcam, #ab92513, 1:200), FOXO1 (Cell Signaling Technology, #2880, 1:100), GFP (Invitrogen, #A21311, 1:100), ICAM2 (BD Biosciences, #553326, 1:200), MYC (Millipore, 06-340, 1:100), PECAM-1 (R&D Systems, AF3628, 1:400), phospho-histone H3 (Chemicon, #06-570, 1:100), TER119 (BD Biosciences, #553670, 1:100), and VE-cadherin (BD Biosciences, #555289, 1:25). After four washes with 0.1% Triton X-100 in PBS (PBST), retinas were incubated with Alexa-Fluor 488-, Alexa-Fluor 555- or Alexa-Fluor 647-conjugated secondary antibodies (Invitrogen, 1:400) for 2 h at room temperature. For staining ECs with isolectin B4 (IB4), retinas were washed with PBLEC buffer (1 mM CaCl , 1 mM MgCl , 1 mM MnCl and 1% Triton X-100 in PBS) and incubated with biotinylated IB4 (Griffonia simplicifolia, #B1205, Vector Laboratories, 1:100) diluted in PBLEC buffer. After washing, retinas were incubated in Alexa-Fluor-coupled streptavidin (Invitrogen, #S21374, 1:200) for 2 h at room temperature. For nuclear counterstain, retinas were incubated with 4′,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich, #D9542, 1:1,000) for 15 min following washes with PBST and PBS. The labelling of proliferating cells with BrdU was performed in P5 pups. In brief, 50 mg kg−1 of BrdU (Invitrogen, #B23151) per pup was injected i.p. 3 h before they were killed. Retinas were fixed for 2 h in 4% PFA and then incubated for 1 h in 65 °C warm formamide, followed by an incubation of 30 min in 2 N HCl. Afterwards retinas were washed twice with 0.1 M Tris-HCl (pH 8) and then blocked in 1% BSA, 0.5% Tween 20 in PBS and incubated overnight at 4 °C with a mouse anti-BrdU antibody (BD Biosciences, #347580, 1:50). The detection was performed with Alexa-Fluor-488 anti-mouse secondary antibody (Invitrogen, A21202, 1:400). After the BrdU staining, retinas were processed for the IB4 staining as described earlier. The dissection of the embryonic hindbrain was performed as described34. After overnight fixation in 4% PFA, dissected hindbrains were incubated in a blocking solution containing 10% serum, 1% BSA and 0.5% Triton X-100 in PBS at 4 °C. After washes with PBS, hindbrains were incubated for 1 h in PBLEC buffer before the overnight incubation with Alexa-Fluor-conjugated IB4 (Invitrogen, #I21411, 1:100 in PBLEC) at 4 °C. Hindbrains were washed with PBS and stained with DAPI. Retinas and embryonic hindbrains were flat-mounted with Vectashield (Vector Laboratories) and examined by confocal laser microscopy (Leica TCS SP5 or SP8). Immunostainings were carried out in tissues from littermates and processed under the same conditions. HUVECs were seeded on glass-bottom culture dishes (Mattek) and cultured at 37 °C and 5% CO . To detect autophagy, cells were washed and fixed with 4% PFA for 20 min at room temperature. Permeabilization was performed in 1% BSA, 10% donkey serum and 0.5% Tween-20 in PBS. Cells were stained for anti-LC3A/B (Cell Signaling Technology, #12741, 1:400), Phalloidin-TRITC (Sigma Aldrich, #P1951, 1:500) and DAPI in incubation buffer (0.5% BSA, 5% donkey serum and 0.25% Tween-20 in PBS). After washes with PBST, samples were incubated with Alexa-Fluor-conjugated secondary antibodies (Invitrogen, 1:200). Cells were washed and mounted in VectaShield. As a positive control, HUVECs were treated with 50 μM chloroquine overnight before fixation. Stained tissue/cells were analysed at high resolution with a TCS SP8 confocal microscope (Leica). Volocity (Perkin Elmer), Fiji/ImageJ, Photoshop (Adobe) and Adobe Illustrator (Adobe) software were used for image acquisition and processing. For all of the images in which the levels of immunostaining were compared, settings for laser excitation and confocal scanner detection were kept constant between groups. All quantifications were done on high-resolution confocal images of thin z-sections of the sample using the Volocity (Perkin Elmer) software. In the retina, endothelial coverage, the number of endothelial branchpoints, and the average vessel branch diameter were quantified behind the angiogenic front in a region between an artery and a vein. In the embryonic hindbrain, randomly chosen fields were used to quantify the vascularization in the ventricular zone. All parameters were quantified in a minimum of four vascularized fields per sample. Endothelial coverage was determined by assessing the ratio of the IB4-positive area to the total area of the vascularized field (sized 200 μm × 200 μm), and expressed as a percentage of the area covered by IB4-positive ECs. Average vessel diameter was analysed by assessing the diameter of individual vessel branches in a vascularized field (sized 200 μm × 200 μm), which was used to calculate the mean diameter in each field. The diameter of individual vessel branches was averaged from three measurements taken at the proximal, middle and distal part of the vessel segment. The number of filopodial extensions was quantified at the angiogenic front. The total number of filopodia was normalized to a vessel length of 100 μm at the angiogenic front, which was defined and measured according to published protocols35. For quantifying vascular outgrowth in the mouse retina, the distance of vessel growth from the centre of the optic nerve to the periphery was measured in each leaflet of a dissected retina, which was used to calculate the mean value for each sample. The number of ERG/IB4- and BrdU/IB4-labelled cells was counted in at least four fields sized 200 μm × 200 μm per sample. Because of the lower incidence of pHH3-positive ECs, the number of pHH3/IB4- double-positive cells was quantified in larger fields (sized 580 μm × 580 μm). For the quantification of the mosaic control (Pdgfb-creERT2;Rosa26-Foxo1+/+;Rosa26-mTmGfl/+) and Foxo1iEC-CA (Pdgfb-creERT2;Rosa26-Foxo1CA/+;Rosa26-mTmGfl/+) retinas, the GFP/IB4 double-positive area per field was determined and divided by the total IB4-positive area. The percentage of the GFP/IB4 double-positive area per total IB4 area was measured in four fields (400 μm × 400 μm) per sample and used to calculate the mean value. For the quantification of nuclear FOXO1 expression in control and Foxo1iEC-CA mice, high-resolution confocal images were taken with a ×40 objective. The resulting images were analysed with the Bitplane Imaris software. Vessels were first segmented using the Surface module in Imaris. FOXO1 immunofluorescence was then used to set a threshold in the new vascular surface area, in which only CD31-positive nuclei were selected (Surface module). The sum intensity of the nuclear FOXO1 fluorescence was divided by the total vascular area to adjust for differences in vascular density on each image. An average of six images per sample was quantified in three animals per group. All of the images shown are representative of the vascular phenotype observed in samples from at least two distinct litters per group. Pooled HUVECs were purchased from Lonza and authenticated by marker expression (CD31/CD105 double-positive) and morphology. HUVECs were cultured in endothelial basal medium (EBM; Lonza) supplemented with hydrocortisone (1 μg ml−1), bovine brain extract (12 μg ml−1), gentamicin (50 μg ml−1), amphotericin B (50 ng ml−1), epidermal growth factor (10 ng ml−1) and 10% fetal bovine serum (FBS; Life Technologies). HUVECs were tested negative for mycoplasma and cultured until the fourth passage. The isolation of mouse lung ECs was performed as described36. In brief, adult mice were killed, lungs were removed and incubated with dispase. The homogenate was filtered through a cell strainer, collected by centrifugation, and washed with PBS containing 0.1% BSA (PBSB). The resulting cell suspension was incubated with rat anti-mouse VE-cadherin antibody- (BD Pharmingen, #555289) coated magnetic beads (Dynabeads, Invitrogen, #11035). Next, the beads were washed with PBSB and then resuspended in DMEM/F12 (Invitrogen) supplemented with 20% FCS, endothelial growth factor (Promocell, #C-30140), penicillin and streptomycin. The isolated cells were seeded on gelatin-coated culture dishes and re-purified with the VE-cadherin antibody during the first three passages. Sub-confluent HUVECs were infected with adenoviruses to overexpress constitutively active human FOXO1–Flag (FOXO1CA)37, human c-MYC–HA38 (Vector Biolabs) and GFP or LacZ as a control. HUVECs (70–80% confluent) were incubated in EBM containing 0.1% BSA for 4 h. Prior to infection, adenoviruses were incubated with an antennapedia-derived peptide (Eurogentec) to facilitate the infection. The mixture was then applied to the HUVECs cultured in EBM containing 0.1% BSA and incubated for 4 h. Thereafter, the cells were washed five times and cultured in EBM with 10% FCS and supplements. The adenoviral infection of murine ECs was performed with adenoviruses encoding for Cre or GFP (Vector Biolabs) as a control. To silence FOXO1, MYC or MXI1 gene expression, HUVECs were transfected with a pool of siRNA duplexes directed against human FOXO1, human c-MYC or human MXI1 (ON-TARGETplus SMARTpool, Dharmacon). A negative control pool of four siRNAs designed and microarray-tested for minimal targeting of human, mouse or rat genes was used as a control (ON-TARGETplus Non-targeting pool, Dharmacon). HUVECs were transfected with 50 nM of the indicated siRNAs using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s recommendations. Total RNA quality was verified using the Agilent Bioanalyser and the 6000 nano kit. RNA was labelled according to the Affymetrix Whole Transcript Sense Target Labelling protocol. Affymetrix GeneChip Human Gene 1.0 ST arrays were hybridized, processed and scanned using the appropriate Affymetrix protocols. Data were analysed using the Affymetrix expression console using the RMA algorithm, statistical analysis was done using DNAStar Arraystar 11. Heat maps were generated using GENE-E, publicly available from the Broad Institute (http://www.broadinstitute.org/cancer/software/GENE-E/). For gene set enrichment analysis (GSEA), gene set collections from the Molecular Signatures Database (MSigDB) 4.0 (http://www.broadinstitute.org/gsea/msigdb/) were used for the analysis of the endothelial FOXO1 and MYC transcriptomes. RNA was extracted from cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was performed on 2 μg of total RNA using the M-MLV reverse transcriptase (Invitrogen). qPCR was performed with TaqMan Gene Expression Master Mix (Applied Biosystems) and TaqMan probes (TaqMan Gene Expression Assays) available from Applied Biosystems. TaqMan Gene Expression Assays used were as follows: human ACTB Hs99999903_m1; CCNB2 Hs00270424_m1; CCND1 Hs00765553_m1; CCND2 Hs00153380_m1; CDK4 Hs00262861_m1; c-MYC Hs00153408_m1; ENO1 Hs00361415_m1; FASN Hs01005622_m1; FBXW7 Hs00217794_m1; FOXO1 Hs01054576_m1; LDHA Hs00855332_g1; LDHB Hs00929956_m1; MXI1 Hs00365651_m1; PKM2 Hs00987254_m1. Mouse probes were: Actb Mm 00607939_s1; Myc Mm00487804_m1. All qPCR reactions were run on a StepOnePlus real-time PCR instrument (Applied Biosystems) and data were calculated using the ∆∆C method. Western blot analyses were performed with precast gradient gels (Bio-Rad) using standard methods. Briefly, HUVECs were lysed in RIPA buffer (150 mM NaCl, 1.0% IGEPAL CA-630, 0.5% sodium deoxycholate, 0.1% SDS and 50 mM Tris, pH 8.0) supplemented with a protease inhibitor mix (Complete Mini Protease Inhibitor cocktail tablets, Roche) and phenylmethylsulfonyl fluoride. Proteins were separated by SDS–PAGE and blotted onto nitrocellulose membranes (Bio-Rad). Membranes were probed with specific primary antibodies and then with peroxidase-conjugated secondary antibodies. The following antibodies were used: AMPKα (Cell Signaling Technology, #2532, 1:1,000), caspase 3 (Cell Signaling Technology, #9662, 1:1,000), cleaved caspase 3 (Asp175) (Cell Signaling Technology, #9664, 1:1,000), cleaved PARP (Cell Signaling Technology, #5625, 1:1,000), c-MYC (Cell Signaling Technology, #9402, 1:1,000), FBXW7 (Abcam, #12292, 1:500), Flag M2 (Sigma, #F-3165, 1:1,000), FOXO1 (Cell Signaling Technology, #2880, 1:1,000), HA (Covance, clone 16B12, MMS-101P, 1:1,000), LC3A/B (Cell Signaling Technology, #12741, 1:1,000), MXI1 (Santa Cruz, SC-1042, 1:500), P-ACC (Cell Signaling Technology, #3661, 1:1,000), P-AMPKα (Thr 172) (Cell Signaling Technology, #2535, 1:1,000), PARP (Cell Signaling Technology, #9532, 1:1,000), Tubulin (Cell Signaling Technology, #2148, 1:1,000). The bands were visualized by chemiluminescence using an ECL detection kit (Clarity Western ECL Substrate, Bio-Rad) and a ChemiDoc MP Imaging System (Bio-Rad). The gel source data of the western blot analysis is illustrated in Supplementary Fig. 1. Quantification of band intensities by densitometry was carried out using the Image Lab software (Bio-Rad). Extracellular acidification (ECAR) and oxygen consumption (OCR) rates were measured using the Seahorse XFe96 analyser (Seahorse Bioscience) following the manufacturer’s protocols. Briefly, ECAR and OCR were measured 4 h after seeding HUVECs (40,000 cells per well) on fibronectin-coated XFe96 microplates. HUVECs were maintained in non-buffered assay medium in a non-CO incubator for 1 h before the assay. The Glycolysis stress test kit (Seahorse Bioscience) was used to monitor the extracellular acidification rate under various conditions. Three baseline recordings were made, followed by sequential injection of glucose (10 mM), the mitochondrial/ATP synthase inhibitor oligomycin (3 μM), and the glycolysis inhibitor 2-deoxy-d-glucose (2-DG; 100 mM). The Mito stress test kit was used to assay the mitochondrial respiration rate under basal conditions, in the presence of the ATP synthase inhibitor oligomycin (3 μM), the mitochondrial uncoupler carbonyl cyanide-4-(trifluoromethoxy)phenyl-hydrazone (FCCP; 1 μM), and the respiratory chain inhibitors antimycin A (1.5 μM) and rotenone (3 μM). To measure glycolysis in ECs, HUVECs were incubated for 2 h in growth medium containing 80 μCi mmol−1 [5-3H]-d-glucose (Perkin Elmer). Thereafter, supernatant was transferred into glass vials sealed with rubber stoppers. 3H O was captured in hanging wells containing a Whatman paper soaked with H O over a period of 48 h at 37 °C to reach saturation4. Radioactivity was determined by liquid scintillation counting and normalized to protein content. Lactate concentration in the HUVEC culture media was measured by using a Lactate Assay Kit (Biovision) following the instructions of the manufacturer. Glucose uptake was assessed by analysing the uptake of 2-DG with a Colorimetric Assay (BioVision). ATP was measured from lysates from HUVECs (1 × 106 per ml) with an ATP Bioluminescence Assay Kit CLS II (Roche) according to the instructions of the manufacturer. Intracellular ROS levels were determined using CM-H DCFDA dye (Life technologies). Dye was reconstituted in DMSO (10 mM) and diluted 1:1,000 in PBS containing CaCl and MagCl as working solution. Twenty-four hours after transduction, 1 × 106 cells were incubated in 1 ml working solution for 40 min at 37 °C in the dark. Subsequently the fluorescence of 10,000 living endothelial cells per sample was measured at the BD FACS LSR II flow cytometer. The assays were performed with adenoviruses, which did not co-express fluorescent reporter genes. Data were analysed using BD FACSDiva software (version 8.0.1). To detect senescence-associated β-galactosidase activity in HUVECs, a cellular senescence assay kit (#KAA002, Chemicon) was used according to the manufacturer’s instructions. Briefly, cells were fixed in 1 ml fixing solution at room temperature for 15 min. Two millilitres of freshly prepared SA-β-gal detection solution was added and cells were incubated overnight at 37 °C without CO and protected from light. Then the detection solution was removed and cells were washed and mounted in 70% glycerol in PBS. H O -treated HUVECs were used as a positive control. Statistical analysis was performed by unpaired, two-tailed Student’s t-test, or non-parametric one-way ANOVA followed by Bonferroni’s multiple comparison test unless mentioned otherwise. For all bar graphs, data are represented as mean ± s.d. P values < 0.05 were considered significant. All calculations were performed using GraphPad Prism software. No randomization or blinding was used and no animals were excluded from the analysis. Sample sizes were selected on the basis of published protocols34, 35 and previous experiments. Several independent experiments were performed to guarantee reproducibility and robustness of findings.


News Article | August 31, 2016
Site: www.nature.com

All materials were molecular biology grade. Unless noted otherwise, all were from Sigma. MCF7, MCF10A, A549, H1299, SHSY5Y, Hep G2, Hep 3B2, HT-1080, NCI-H358, LLC, Neuro-2a, 4T1 and SK-N-Be2c cell lines were obtained from the American Type Culture Collection and their identity was not further authenticated. These cell lines are not listed in the database of commonly misidentified cell lines maintained by ICLAC. LLC, Neuro-2a, 4T1, Hep G2, HT-1080, Hep 3B2, MCF7 and A549 cells were cultured at 37 °C in DMEM with 10% fetal bovine serum (FBS), 5 ml of 100 U ml−1 penicillin–streptomycin (Life Technologies) and 5 ml of l-glutamine 200 mM. NCI-H358, H1299 and SK-N-Be2c cell lines were cultured at 37 °C in RPMI 1640 Medium with 10% FBS 1% penicillin–streptomycin and 1% L-glutamine. MCF10A cells were cultured at 37 °C in DMEM/F-12 supplemented with 5% horse serum (Life Technologies), 20 ng ml−1 human epidermal growth factor (Prepotec), 0.5 μg ml−1 hydrocortisone, 100 ng ml−1 cholera toxin, 10 μg ml−1 insulin, and 100 U ml−1 penicillin-streptomycin. The SHSY5Y cell line was cultured at 37 °C in DMEM/F-12 supplemented with 10% FBS, 2% penicillin–streptomycin and 1% non-essential amino acids (MEM). Mouse J1 ES cells were cultured feeder-free in fibroblast-conditioned medium. Cell cultures were confirmed to be mycoplasma-free every month. Control cell cultures were grown at atmospheric oxygen concentrations (21%) with 5% CO . To render cultures hypoxic, they were incubated in an atmosphere of 0.5% O , 5% CO and 94.5% N . Where indicated, IOX2 (50 μM), ascorbate (0.5 mM, a dose known to support TET activity19) or dimethyl-α-ketoglutarate (0.5 mM) was added to fresh culture medium, using an equal volume of the carrier (DMSO) as a control for IOX2. Cells were plated at a density tailored to reach 80–95% confluence at the end of the treatment. Fresh medium was added to the cells just before hypoxia exposure. For glutamine-free culture experiments, dialysed FBS was added to glutamine-free DMEM, and supplemented with glutamine (4 mM) for the control. Mouse J1 ES cells and Tet1-gene-trap ES cells were cultured feeder-free in fibroblast-conditioned medium. After exposure to the aforementioned stimuli, cultured cells were washed on ice with ice-cold PBS with deferoxamin (PBS-DFO, 200 μM), detached using cell scrapers and collected by centrifugation (400g, 4 °C). Nucleic acids were subsequently extracted using the Wizard Genomic DNA Purification kit (Promega) according to instructions. All buffers were supplemented with DFO (200 μM) and DNA was dissolved in 80 μl PBS-DFO with RNase A (200 U, NEB) and incubated for 10 min at 37 °C. After proteinase K addition (200 units) and incubation for 30 min at 56 °C, DNA was purified using the QIAQuick blood and tissue kit (all buffers supplemented with DFO). It was eluted in 100 μl of a 10 mM Tris, 1 mM EDTA solution (pH 8) and stored at −8 °C until further processing. To measure the cytosine, 5mC, 5hmC and 8-oxoG content of the DNA samples, three technical replicates were run for each sample. More specifically, 0.5–2 μg DNA in 25 μl H O were digested in an aqueous solution (7.5 μl) of 480 μM ZnSO , containing 42 U nuclease S1, 5 U Antarctic phosphatase, and specific amounts of labelled internal standards were added and the mixture was incubated at 37 °C for 3 h in a Thermomixer comfort (Eppendorf). After addition of 7.5 μl of 520 μM [Na] -EDTA solution containing 0.2 U snake venom phosphodiesterase I, the sample was incubated for another 3 h at 37 °C. The total volume was 40 μl. The sample was then kept at −20 °C until the day of analysis. Samples were then filtered by using an AcroPrep Advance 96-filter plate 0.2 μm Supor (Pall Life Sciences) and then analysed by liquid chromatography electrospray ionization tandem mass spectrometry (LC-ESI-MS/MS), which are performed using an Agilent 1290 UHPLC system and an Agilent 6490 triple quadrupole mass spectrometer coupled with the stable isotope dilution technique. DNA samples were digested to give a nucleoside mixture and spiked with specific amounts of the corresponding isotopically labelled standards before LC–MS/MS analysis. The nucleosides were analysed in the positive ion selected reaction monitoring mode (SRM). In the positive ion mode, [M + H]+ species were measured. The resulting cytosine, 5mC, 5hmC and 8-oxoG peak areas were normalized using the isotopically labelled standards, and expressed relative to the total cytosine content (that is, C + 5mC + 5hmC). Concentrations were depicted as averages of independent replicates grown on different days, and compared between hypoxia and normoxia (21% O ), or between control and treated conditions, using a paired Student’s t-test. No statistical methods were used to predetermine sample size. For RNA extraction, cell culture medium was removed, TRIzol (Life Technologies) added and processed according to manufacturer’s guidelines. Reverse transcription and qPCR were performed using 2 × TaqMan Fast Universal PCR Master Mix (Life Technologies), TaqMan probes and primers (IDT, sequence in Supplementary Table 12). Thermal cycling and fluorescence detection were done using a LightCycler 480 Real-Time PCR System (Roche). Taqman assay amplification efficiencies were verified using serial cDNA dilutions, and estimated to be >95%. Cycle threshold (C ) values were determined for each sample and gene of interest in technical duplicates, and normalized according to the corresponding amplification efficiency. Per sample, TET expression was expressed relative to β-2-microglobulin (human) or hypoxanthine phosphoribosyltransferase 1 (Hprt mouse) levels by subtraction of their average C values. Concentrations were expressed as averages of at least 5 replicates extracted on different days. For Fig. 1a, copy number estimates for TET1, TET2 and TET3 were expressed for each cell line, relative to the summed copy number estimates of TET1, TET2 and TET3 under control conditions (21% O ). Concentrations were compared between hypoxia and normoxia, or between control and treatment conditions using a Student’s t-test. No statistical methods were used to predetermine sample size. To verify further induction of the hypoxia response program, hypoxia marker gene expression was verified. We analysed mRNA levels of genes encoding the E1B 19K/Bcl-2-binding protein Nip3 (BNIP3) and fructose-bisphosphate aldolase (ALDOA), 2 established hypoxia marker genes33. Reverse transcriptase–quantitative PCR (RT–qPCR) was performed as described for the TET mRNA concentration assays, and differential expression was calculated using the ΔΔ C method34. We ruled out transcriptional upregulation as the cause of the increase in HIF1α protein concentrations by assessing HIF1A mRNA expression in parallel. mRNA concentrations were expressed relative to normoxic controls (21% O ). Differences in mRNA concentration were assessed using a Student’s t-test on 5 or more independent replicates grown on different days. To assess Hif1α protein stabilization, proteins were extracted from cultured cells as follows: cells were placed on ice, and washed twice with ice-cold PBS. Proteins were extracted with extraction buffer (50 mM Tris HCl, 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate and 0.1% SDS) with 1× protease inhibitor cocktail. Protein concentrations were determined using a bicinchoninic acid protein assay (BCA, Thermo Scientific) following the manufacture’s protocol. An estimated 60 μg protein was loaded per well on a NuPAGE Novex 3–8% Tris-Acetate Protein gel (Life Technologies), separated by electrophoresis and blotted on polyvinylidene fluoride membranes. Membranes were activated with methanol, washed and incubated with antibodies targeting β-actin (4967, Cell Signaling), Tet1 (09-872, Millipore) and Tet3 (61395, Active Motif), at 1:1,000 dilution, targeting Tet2 (124297, Abcam) at 1:250 dilution, and targeting Hif1α (C-Term) (Cayman Chemical Item 10006421) at 1:3,000 dilution. Secondary antibodies and detection were according to routine laboratory practices. Western blotting was performed on 6 independent replicates grown on different days. To confirm that hypoxia-associated differential expression of TET genes is induced by the HIF pathway, we performed HIF1β ChIP–seq. Because HIF1β is the obligate binding partner of all three HIFα proteins stabilized and activated upon hypoxia35, HIF1β ChIP–seq reveals all direct HIF-target genes. Approximately 25 × 106 –30 × 106 cells were incubated in hypoxic conditions for 16 h. Cultured cells were subsequently immediately fixed by adding 1% formaldehyde (16% formaldehyde (w/v), Methanol-free, Thermo Scientific) directly to the medium and incubating for 8 min. Fixed cells were incubated with 150 μM of glycine for 5 min to revert cross-links, washed twice with ice-cold PBS 0.5% Triton X-100, scraped and collected by centrifugation (1,000g for 5 min at 4°C). The pellet was re-suspended in 1,400 μl of RIPA buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 2 mM EDTA pH 8, 1% Triton X-100, 0.5% sodium deoxycholate, 1% SDS, 1% protease inhibitors) and transferred to a new Eppendorf tube. The lysate was homogenized by passing through an insulin syringe, and incubated on ice for 10 min. The chromatin was sonicated for 3 min by using a Branson 250 Digital Sonifier with 0.7 s ‘On’ and 1.3 s ‘Off’ pulses at 40% power amplitude, yielding a size of 100 to 500 bp. The sample was kept ice cold at all times during the sonication. The samples were centrifuged (10 min at 16,000g at 4 °C) and the supernatant were transferred in a new Eppendorf tube. The protein concentration was assessed using a BCA assay. Fifty microlitres of shared chromatin was used as ‘input’ and 1.4 μg of primary ARNT/HIF-1β monoclonal antibody (NB100-124, Novus) per 1 mg of protein was added to the remainder of the chromatin, and incubated overnight at 4 °C in a rotator. Pierce Protein A/G Magnetic Beads (Life Technologies) were added to the samples in a volume four times the volume of the primary antibody and incubated at 4 °C for at least 5 h. A/G Magnetic Beads were collected and the samples were washed five times with the washing buffer (50 mM Tris-HCl, 200 mM LiCl, 2 mM EDTA, pH 8, 1% Triton, 0.5% sodium deoxycholate, 0.1% SDS, 1% protease inhibitors), and twice with a 10 mM Tris, 1 mM EDTA (TE) buffer. The A/G magnetic beads were re-suspended in 50 μl of TE buffer, and 1.5 μl of RNase A (200 units, NEB) were added to the A/G beads samples and to the input, incubated for 10 min at 37 °C. After addition of 1.5 μl of proteinase K (200 U) and overnight incubation at 65 °C, the DNA was purified using 1.8× volume of Agencourt AMPure XP (Beckman Coulter) according to the manufactory instructions, and then eluted in 15 μl of TE buffer. The input DNA was quantified on NanoDrop. In total, 5 μg of input and all of the immunoprecipitated DNA was converted into sequencing libraries using the NEBNext DNA library prep master mix set. A single end of these libraries was sequenced for 50 bases on a HiSeq 2000, mapped using Bowtie and extended for the average insert size (250 bases). ChIP peaks were called by model-based analysis for ChIP–Seq36, with standard settings and using a sequenced input sample as baseline. To assess whether tumour-associated hypoxia reduces 5hmC levels in vivo, redundant material from two endometrial tumours and a breast tumour, removed during surgery, was grafted in the interscapular region of nude mice. Informed consent was obtained from the patient, following the ethical approval of the local ethical committee. All animal experiments were approved by the local ethical committee (P098/2014). Each tumour was allowed to grow to 1 cm3, after which it was collected. 10% of this tumour was re-implanted in a nude mouse, and the tumour was propagated for three generations until it was used for this experiment. To mark hypoxic areas, mice were injected with pimonidazole (60 mg kg−1, Hypoxyprobe) i.p. 1 h before killing. Tumours were collected, fixed in formaldehyde and embedded in paraffin using standard procedures. Paraffin was removed and slides were rehydrated in two xylene baths (5 min), followed by five 3-min ethanol baths at decreasing concentrations (100%, 96%, 70%, 50% and water) and a 3-min TBS (50 mM Tris, 150 mM NaCl, pH 7.6) bath. The following antibodies were used for immunofluorescence staining: primary antibodies were FITC-conjugated mouse anti-pimonidazole (HP2-100, Hydroxyprobe), rabbit anti-5hmC (39791, Active Motif), rat anti-polyoma middle T (AB15085, Abcam), rat anti-CD31 (557355, BD Biosciences), rat anti-CD45 (553076, BD Biosciences), rabbit anti-Ki67 (AB15580, Abcam) and mouse anti-pan cytokeratin (C2562, Sigma). Secondary antibodies were Alexa Fluor 405-conjugated goat anti-rabbit (A31556, Thermo Fisher), Alexa Fluor 647 conjugated goat anti-rat (A-21247, Life Technologies), peroxidase-conjugated goat anti-FITC (PA1-26804, Pierce), biotinylated goat anti-rat (A10517, Thermo Fisher) and biotinylated goat anti-rabbit (E043201, Dako). Signal amplification was performed using the TSA Fluorescein System (NEL701A001KT, Perkin Elmer) or the TSA Cyanine 5 System (NEL705A001KT, Perkin Elmer). Different protocols were implemented depending on the epitopes of interest. Staining for the following epitopes was combined: CD45, 5hmC, pimonidazole and DNA; PyMT, 5hmC, pimonidazole and DNA; Ki67, pimonidazole and DNA; CD31 and pimonidazole; and pan-cytokeratin, 5hmC, pimonidazole and DNA. Antigen retrieval for CD31, CD45 and pan-cytokeratin was done by a 7-min trypsin digestion, for pimonidazole and Ki67 using AgR at 100 °C for 20 min, followed by cooling for 20 min. Slides were washed in TBS for 5 min, permeabilized in 0.5% Triton X-100 in PBS for 20 min. For 5hmC antigen retrieval, slides were denatured in 2 M HCl for 10 min; HCl was neutralized for 2 min in borax, 1% in PBS pH 8.5, and washed twice for 5 min in PBS. For all slides, endogenous peroxidase activity was quenched using H O (0.3% in methanol), followed by three 5-min washes in TBS. Slides were blocked using pre-immune goat serum (X0907, Dako; 20% in TNB; TSA Biotin System kit, Perkin Elmer). Binding of primary antibodies (anti-5hmC, anti-CD45, anti-CD31 and anti-pan cytokeratin or FITC-conjugated anti-pimonidazole; all 1:100 in TNB) was allowed to proceed overnight. Slides were washed 3 times in TNT (0.5% Triton-X100 in TBS) for 5 min, after which the following secondary antibodies (all 1:100 in TNB with 10% pre-immune sheep serum) were allowed to bind for 45 min: sheep-anti-FITC-PO (for pimonidazole), goat anti-rabbit-Alexa Fluor 405 (for 5hmC), goat anti-rat-Alexa Fluor 647 (for CD45), and biotinylated goat anti-mouse (for pan-cytokeratin). Slides were washed three times for 5 min in TNT, after which signal amplification was performed for 8 min using Fluorescein Tyramide (1:50 in amplification diluent). Slides stained for pimonidazole that required co-staining for Ki67 or PyMT, or slides stained for pan-cytokeratin that required co-staining for pimonidazole were subjected to a second indirect staining for the latter epitopes. After 5 min of TNT and 5 min of TBS, slides were quenched again for peroxidase activity using H O and blocked using pre-immune goat serum, prior to a second overnight round of primary antibody binding (anti-Ki67, FITC-anti-pimonidazole or anti-PyMT, all 1/100). The next day, three 5-min washes with TNT were followed by a 1-h incubation with a biotinylated goat anti-rabbit antibody (for Ki67) or goat anti-rat (for PyMT), another three 5-min washes with TNT, a 30-min incubation with peroxidase conjugated to streptavidin (for Ki67 and PyMT) or to anti-FITC (for pimonidazole), another three 5-min washes with TNT and signal amplification for 8 min using, for pimonidazole, Fluorescein Tyramide and for others Cyanine 5 Tyramide (1:50 in amplification diluent). Slides were then stained with propidium iodide with RNase (550825; BD biosciences) for 15 min, washed for 5 min in PBS and mounted with Prolong Gold (Life Technologies). Slides were imaged on a Nikon A1R Eclipse Ti confocal microscope. Three to five sections per slide were imaged, and processed using Image J. Nuclei were identified using the propidium iodide signal and nuclear signal intensities for Fluorescein and Cy3 (pimonidazole and 5hmC) measured. Analyses were exclusively performed on slide regions showing a regular density and shape of nuclei, in order to avoid inclusion of acellular or necrotic areas. The pimonidazole signal will also not stain necrotic/acellular areas37, and was used to stratify viable cell nuclei into normoxic (pimonidazole negative) and hypoxic (pimonidazole positive) regions. The 5hmC signals in each population were compared using ANOVA. PyMT-negative and CD45-positive cells were counted directly. The fraction of pimonidazole and CD31-positive areas was directly quantified using ImageJ across ten images per slide. For metabolite extractions, 12-well cell culture dishes were placed on ice and washed twice with ice-cold 0.9% NaCl, after which 500 μl of ice-cold 80% methanol was added to each well. Cells were scraped and 500 μl was transferred to a vial on ice. Wells were washed with 500 μl 80% methanol, which was combined with the initial cell extracts. The insoluble fraction was pelleted at 4 °C by a 10-min 21,000g centrifugation. The pellet (containing the proteins) was dried, dissolved in 0.2 N NaOH at 96 °C for 10 min and quantified using a bicinchoninic acid protein assay (BCA, Pierce), whereas the supernatant fraction was processed for metabolite profiling. The supernatant fraction containing the metabolites was transferred to a new vial and dried in a Speedvac. The dried supernatant fraction was dissolved in 45 μl of 2% methoxyamine hydrochloride in pyridine and held for 90 min at 37 °C in a horizontal shaker, followed by derivatization through the addition of 60 μl of N-(tert-butyldimethylsilyl)-n-methyl-trifluoroacetamide with 1% tert-butyldimethylchlorosilane and a 60-min incubation at 60 °C. Samples were subsequently centrifuged for 5 min at 21,000g and 85 μl was transferred to a new vial and analysed using a gas-chromatography based mass spectrometer (triple quadrupole, Agilent) operated in Multiple Reaction Monitoring (MRM) mode. For each sample, metabolite measurements were normalized per sample to the corresponding protein concentration estimates and expressed relative to control-treated samples. Four technical replicates were run for each sample, and the experiment was repeated 4 times using independent samples (n = 16). Differences in metabolite concentration were assessed using a two-tailed paired Student’s t-test or using analysis of variance with post-hoc Tukey HSD when repeated measures were compared. MCF7 cells were cultured in 24-well plates and exposed to 21% (control) or 0.5% O (hypoxia) for 24 h. DMEM used for staining was pre-equilibrated to the required O tension, and all steps performed at 21% (control) or 0.5% O (hypoxia) using a glove box. The cells were washed twice with 500 μl DMEM, and incubated for 30 min in 2',7'-dichlorodihydrofluorescein diacetate (DCF-DA; 10 μM) in 500 μl DMEM, keeping 2 wells unstained by DMEM without DCF-DA. Cells were treated with the indicated concentrations of H O in DMEM for 30 min at 37 °C, and fixed by adding 33.3 μl of 16% methanol-free paraformaldehyde (Thermo Fisher) for 8 min at room temperature. The fixative was quenched using glycine (150 μM), cells were washed twice in ice-cold PBS, scraped to detach them and transfer them to pre-cooled FACS tubes over cell strainers. Cells were kept on ice until they were analysed by flow cytometry using a FACSVerse (BD Biosciences). MCF7 cells were seeded on 12-well glass-bottom plates and after 24 h exposed to 21% (control) or 0.5% O (hypoxia) for 24 h. PBS used for subsequent staining was pre-equilibrated to the required O tension, and all washing, treatment and staining steps were performed at the appropriate O tension (21% or 0.5%) using a glove box. Cells were loaded with nuclear peroxy emerald 1 (NucPE1; 5 μM)38, 39 and Hoechst 33342 (10 μg ml−1) in PBS for 15 min at 37 °C. After washing three times in PBS, control cells were incubated with H O (0.5 mM in PBS) as a positive control, or with water (control and hypoxia cells) in PBS at 37 °C for 20 min. Cells were washed three times in PBS, placed on ice and immediately imaged by confocal microscopy. The nuclear NucPE1 signal was measured, and averaged across >100 nuclei per replicate using ImageJ. This experiment was repeated 5 times on different days, and signals compared using a t-test. 5,000 cells/well were seeded in three 96-well plates. After 48 h, one plate was fixed using trichloroacetic acid (3.3% w/v) for 1 h at 4 °C, one plate incubated for 24 h at 37 °C under hypoxic and one under control conditions (0.5% and 21% O , respectively). The latter 2 plates were subsequently also fixed using trichloroacetic acid (3.3% wt/vol) for 1 h at 4 °C, and all 3 plates were next analysed using the In vitro Toxicology Assay Kit, Sulforhodamine B-based (Sigma) as per the manufacturer’s instructions. Growth inhibition was calculated as described40. siRNA ON-TARGETplus SMART pools (Thermo) were diluted in Optimem I reduced serum medium using Lipofectamine RNAiMAX (Life technologies) to reverse-transfect MCF7 cells in 10-cm dishes (for DNA) or 6-well plates (for RNA). Cells were transfected 72 h before RNA and DNA extraction as described. MCF7 cells were cultured for 24 h under control or hypoxic conditions (21% or 0.5% O , respectively), chilled on ice and processed for extraction of nuclear proteins using the NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific). The activity of control and hypoxic extracts was assessed in parallel using the Colorimetric Epigenase 5mC-Hydroxylase TET Activity/Inhibition Assay Kit (Epigentek) according to manufacturer’s instructions. Reactions were allowed to proceed for one hour, after which washing and detection of 5hmC were done according to manufacturer’s instructions. Differences between hypoxia and control were analysed using ANOVA, for 5 independent experiments. The genomic DNA used in this assay was extracted from Tet triple-knockout ES cells (G. -L. Xu), and it therefore was devoid of 5hmC41. To enable efficient denaturation, it was digested using MseI before the assay and purified using solid phase reversible immobilisation paramagnetic beads (Agencourt AMPure XP, Beckman Coulter). The assays were performed in Whitley H35 Hypoxystations (don Whitley Scientific) at 37 °C, 5% CO , N , with the following oxygen tensions: 0.1%, 0.3%, 0.5%, 1%, 2.5%, 5%, 10% and 21%. Hypoxystations were calibrated less than 1 month before all experiments. Optimized assay components were as follows: 1.0 μg μl−1 bovine serum albumin (New England Biolabs), 50 mM Tris (pH 7.8), 100 μM dithiothreitol (Life Technologies), 2 ng μl−1 digested gDNA, 250 μM α-ketoglutarate, 830 μM ascorbate, 200 μM FeSO and 45 ng μl−1 Tet1 enzyme (Wisegene). The major assay components (H O, BSA and Tris) used for all samples were allowed to pre-equilibrate at 0.1% O for 1 h. These and the remaining assay buffer components (<100 μl) were then pre-equilibrated at the desired oxygen tension for 15 min, and mixed before addition of Tet1 enzyme in a total reaction volume of 25 μl. Reactions were allowed to proceed for 3 min, longer incubations showed a decrease in activity. Reactions were stopped with 80 mM EDTA and stored at −80 °C. To measure the resulting 5hmC content of the DNA, reactions were diluted to 100 μl, denatured for 10 min at 98 °C and analysed in duplicate using the Global 5-hmC Quantification Kit (Active Motif) following manufacturer’s instructions. Michaelis–Menten and Lineweaver–Burk plots and the resulting K values were estimated using R. To assess where in the genome the levels of 5mC and 5hmC were altered, we performed DNA immunoprecipitations coupled to high-throughput sequencing (DIP-seq). MCF7 cells were selected for these experiments as they were a cancer cell line with high levels of 5hmC and expression of TET genes under control conditions, and a cell growth that is unaffected by hypoxia. This enabled us to study the effects of hypoxia on TET activity in a cell line that shows high endogenous activity, but that is isolated from hypoxia-induced changes in cell proliferation. MCF7 cell culture and DNA extractions were as described for LC–MS analyses. Library preparations and DNA immunoprecipitations were performed as described42, using established antibodies targeting 5mC (clone 33D3, Eurogentec,) and 5hmC (Active Motif catalogue number 39791). For 5hmC-DIP-seq, paired barcoded libraries prepared from DNA of hypoxic and control samples were mixed before capture, to enable a direct comparison of 5hmC-DIP-seq signal to the input. A single end of these libraries was sequenced for 50 bases on a HiSeq 2000, mapped using Bowtie and extended for the average insert size (150 bases). Mapping statistics are summarized in Supplementary Information Table 11. For analysis of sequencing data, MACS peak calling, read depth quantification and annotation with genomic features as annotated in EnsEMBL build 77 was performed using SeqMonk. Differential (hydroxy-)methylation was quantified by EdgeR43, using either 3 or 5 independent pairs of control and hypoxic samples (for 5hmC-DIP-seq and 5mC-DIP-seq, respectively). These cells were cultured and exposed to hypoxia (0.5% O ) or control conditions (21% O ) on different days. Results were reported for 5hmC peak areas that exhibited a change significant at a P < 0.05 and 5% FDR. To confirm enrichment of 5mC at gene promoters using an independent method, DNA libraries were prepared using methylated adapters and the NEBNext DNA library prep master mix set following manufacturer recommendations. Libraries were bisulfite-converted using the Imprint DNA modification kit (Sigma) as recommended, and PCR amplified for 12 cycles using barcoded primers (NEB) and the KAPA HiFi HS Uracil+ ready mix (Sopachem) according to manufacturer’s instructions. Fragments were selected from these libraries using the SeqCapEpi CpGiant Enrichment Kit (Roche) following the manufacturer’s instructions, sequenced from both ends for 100 bases on a HiSeq 2000. For analysing these sequences, sequencing reads were trimmed for adapters using TrimGalore and mapped on a bisulfite-converted human genome (GRCh37) using BisMark. The number of methylated and un-methylated cytosines in captured regions was quantified using Seqmonk for each experiment. Differential methylation of regions of interest was assessed by Fisher’s exact test and for 5 independent replicates grown on different days. t-scores were averaged following Fisher’s method. Mapping statistics are summarized in Supplementary Table 11. To assess the effect of the increased 5mC occupancy at gene promoters on their expression, RNA-seq was performed. Briefly, total RNA was extracted using TRIzol (Invitrogen), and remaining DNA contaminants in 17–20 μg of RNA was removed using Turbo DNase (Ambion) according to the manufacturer’s instruction. RNA was repurified using RNeasy Mini Kit (Qiagen). Ribosomal RNA present was depleted from 5 μg of total RNA using the RiboMinus Eukaryote System (Life technologies). cDNA synthesis was performed using SuperScript III Reverse Transcriptase kit (Invitrogen). 3 μg of Random Primers (Invitrogen), 8 μl of 5× First-Strand Buffer and 10 μl of RNA mix was incubated at 94 °C for 3 min and then at 4 °C for 1 min. 2 μl of 10 mM dNTP Mix (Invitrogen), 4 μl of 0.1 M DTT, 2 μl of SUPERase In RNase Inhibitor 20U μl−1 (Ambion), 2 μl of SuperScript III RT (200 U μl−1) and 8 μl of Actinomycin D (1 μg μl−1) were then added and the mix was incubated for 5 min at 25 °C, 60 min at 50 °C and 15 min at 70 °C to heat-inactivate the reaction. The cDNA was purified by using 80 μl (2× volume) of Agencourt AMPure XP and eluted in 50 μl of the following mix: 5 μl of 10× NEBuffer 2, 1.5 μl of 10 mM dNTP mix (10 mM dATP, dCTP, dGTP, dUTP, Sigma), 0.1 μl of RNaseH (10 Uμl−1, Ambion), 2.5 μl of DNA Polymerase I Klenov (10 U μl−1, NEB) and the remaining volume of water. The eluted cDNA was incubated for 30 min at 16 °C, purified by Agencourt AMPure XP and eluted in 30 μl of dA-Tailing mix (2 μl of Klenow Fragment, 3 μl of 10× NEBNext dA-Tailing Reaction Buffer and 25 μl of water). After 30 min incubation at 37 °C, the DNA was purified by Agencourt AMPure XP, eluted in TE buffer and quantified on NanoDrop. Subsequent library preparation was performed using the DNA library prep master mix set and sequencing was performed as described for ChIP-seq. Expression levels (reads per million) of genes displaying significant increases in methylation at their gene promoter, as determined using SeqCapEpi, was compared between control and hypoxic samples using a t-test. Mapping statistics are summarized in Supplementary Table 11. From the TCGA pan-cancer analysis, we selected all solid tumour types for which >100 tumours were available with both gene expression data (RNA-seq) and DNA methylation data (Illumina Infinium HumanMethylation450 BeadChip). These were 408 bladder carcinomas, 691 breast carcinomas, 243 colorectal adenocarcinomas, 520 head and neck squamous cell carcinomas, 290 kidney renal cell carcinomas, 430 lung adenocarcinomas, 371 lung squamous cell carcinomas, and 188 uterine carcinomas, representing in total 3,141 unique patients. Corresponding RNA-seq read counts as well as DNA methylation data from Infinium HumanMethylation450 BeadChip arrays were downloaded from the TCGA server. Breast tumour subtypes were annotated for 208 tumours and, for the remaining tumours, imputed by unsupervised hierarchical clustering of genes in the PAM50 gene expression signature44. Other clinical and histological variables were available for >95% of tumours, and missing values were encoded as not available. Gene mutation data was available for 129 bladder carcinomas, 646 breast carcinomas, 200 colorectal adenocarcinomas, 306 head and neck squamous cell carcinomas, 241 kidney renal cell carcinomas, 182 lung adenocarcinomas, 74 lung squamous cell carcinomas, and 3 uterine carcinomas. To identify which of these tumour samples were hypoxic or normoxic, we performed unsupervised hierarchical clustering based a modification (Ward.D of the clusth function in R’s stats package) of the Ward error sum of squares hierarchical clustering method45, on normalized log -transformed RNA-seq read counts for 14 genes that make up the hypoxia metagene signature (ALDOA, MIF, TUBB6, P4HA1, SLC2A1, PGAM1, ENO1, LDHA, CDKN3, TPI1, NDRG1, VEGFA, ACOT7 and ADM)25. In each case the top 3 sub-clusters identified were annotated as normoxic, intermediate and hypoxic. To identify which of these tumour samples were high- or low-proliferative, we performed unsupervised hierarchical clustering based a modification (Ward.D of the clusth function in R’s stats package) of the Ward error sum of squares hierarchical clustering method45, and this for all genes annotated to an established tumour proliferation signature (MKI67, NDC80, NUF2, PTTG1, RRM2, BIRC5, CCNB1, CEP55, UBE2C, CDC20 and TYMS)46. Tumours in the top 2 sub-clusters identified were labelled as high- or low-proliferative. To identify tumour-associated hypermethylation events, we compared 450k methylation data from tumours and normal tissues. All available DNA methylation data from normal tissue (matched or unmatched to tumour samples, on average 59 per tumour type, representing 472 in total, range = 21–160) were downloaded. For each of the 8 tumour types investigated, we selected the top 1,000 CpGs that showed the highest average tumour-associated increases in DNA methylation. Per tumour type, unsupervised hierarchical clustering based on a modification of the Ward error sum of squares hierarchical clustering method (Ward.D of the clusth function in R’s stats package)45 annotated the first 3 clusters identified as having low, intermediate and high hypermethylation. Cluster co-membership for methylation and hypoxia metagene expression were analysed using the Cochran–Armitage test for trend. Analyses using the top 100, 500, 5,000 or 10,000 CpGs yielded near identical results (not shown). We next applied a method to identify those CpGs that exhibit exceptional increases in hypermethylation but that are hypermethylated only in a subset of all tumours. Such rare events are typically found in cancer, where hypermethylation inactivates a gene in only a subset of tumours. Hypermethylation of individual CpGs at gene promoters (that is, on average 3.7 CpGs per promoter are represented on the 450K array) in individual tumours was assessed as follows: To achieve a normal distribution, all β-values were transformed to M-values47 using M = log (β/(1 − β)). For each tumour type, the mean μ and standard deviation σ of the M value across all control (normoxic) tumours was next calculated, irrespective of mutational status, for each CpG, and used to assign Z-values to each CpG in each tumour using Z = (M − μ)/σ. These Z-values describe the deviation in normal methylation variation for that probe. To identify CpGs that display an extreme deviation, we selected those for which the Z-value exceeded 5.6 (that is, μ + (5.6 × σ), corresponding to a Bonferroni-adjusted P value of 0.01); they were considered as hypermethylation events in that particular tumour. This analysis was preferred over Wilcoxon-based models that assess differences in the average methylation level between subgroups, as the latter do not enable the identification or quantification of the rarer hypermethylation events in individual promoters or CpGs. To identify genes with frequently hypermethylated CpGs in their promoter, the number of hypermethylation events in that promoter was counted in all tumours, and contrasted to the expected number of hypermethylation events in that promoter (that is, the general hypermethylation frequency multiplied by the number of CpGs assessed in that promoter multiplied by the number of tumours) using Fisher’s exact test. Genes with an associated Bonferroni-adjusted P value below 0.01 were retained and considered as frequently hypermethylated in that tumour type. To assess what fraction of these hypermethylation events are hypoxia-related, we assumed that the fraction of events detected under normoxia was hypoxia-unrelated, and that all excess events detected in intermediate and hypoxic tumours were hypoxia-related. For example, in 691 breast carcinomas, 0.25% of CpGs were hypermethylated in 251 normoxic tumours, 0.81% in 350 intermediate and 1.40% in 90 hypoxic tumours. So, 0.56% and 1.15% of hypermethylation events in respectively intermediate and hypoxic tumours were hypoxia-related. Taking into account the number of tumours, 0.25% of hypermethylation events (that is, (0.25% × 251 + 0.25% × 350 + 0.25% × 90)/691) are not hypoxia-related, and 0.43% are hypoxia related (that is, (0% × 251 + 0.56% × 350 + 1.15% × 90)/691). So, 63% of all hypermethylation events combined (that is, 0.43/(0.43 + 0.25)) are hypoxia related. To assess the contribution of hypoxia to hypermethylation relative to other covariates, partial R2 values were calculated for the contribution of each covariate in a linear model, and compared to the total R2 achieved by the model. To identify genes with CpGs in their promoter that are more frequently hypermethylated in hypoxic than normoxic tumours, the number of hypermethylation events in that promoter was counted in all hypoxic tumours, and contrasted to the number found in normoxic tumours. Differences in frequencies were assessed using Fisher’s exact test, and genes with a Bonferroni-adjusted P < 0.01 were retained and considered hypermethylated upon hypoxia. Enrichment of ontologies associated with these genes was assessed using Fisher’s exact test as implemented in R’s topGO package. To enable a direct comparison between the expression of different genes, we transformed gene expression values (reads per million) to their respective z-scores. To assess the impact of hypermethylation events on the expression of associated genes, we compared the expression z-scores of all frequently hypermethylation genes that contain one or more hypermethylation events in their promoter (on average each promoter contains 3.7 CpGs; if one of these is hypermethylated the associated gene is considered hypermethylated in that particular tumour), to the expression of all frequently hypermethylated genes that do not contain a hypermethylation event. The effect of hypermethylation on gene expression was plotted for the 8 main tumour types stratified into normoxic, intermediately hypoxic and hypoxic tumours, and for glioblastomas was stratified into normoxic, intermediately hypoxic, hypoxic and IDH-mutant tumours (n = 4). The difference in expression z-scores between genes not carrying and carrying a hypermethylation event in their promoter was assessed using a t-test. To assess the impact of somatic mutations on hypoxia-associated hypermethylation frequencies, we analysed the top 20 genes described to be most frequently mutated in the pan-cancer analysis24, and supplemented this list with genes known to cause hypermethylation upon mutation (that is, IDH1, IDH2, SDHA, FH, TET1, TET2 and TET3). Mutations in IDH1 and IDH2 were retained if they respectively affected amino acid R132, and amino acids R140 or R172. Mutations in other genes were scored using Polyphen, and only mutations classified as probably damaging were retained. 7 mutations were found in lung tumours, 3 mutations in colorectal tumours, 8 mutations in breast tumours and 6 mutations (all IDH1R132) in glioblastomas. None of these mutations were enriched in hypoxic subsets. In multivariate analyses of variance, in each of the tumour types analysed, mutations in these genes were significantly associated with increased hypermethylation frequencies. Hypoxia was independently and significantly associated with the hypermethylation frequency. Gene expression values (reads per million) of DNMT and TET enzymes were determined for each tumour using available RNA-seq data. The number of hypermethylation events at significantly hypermethylated genes in each tumour was determined as described above. Hypermethylation in each tumour was subsequently correlated to TET or DNMT gene expression in that tumour, correcting for hypoxia and proliferation status using ANOVA. Newly diagnosed and untreated non-small-cell lung cancer patients scheduled for curative-intent surgery were prospectively recruited. Included subjects had a smoking history of at least 15 pack-years. The study protocol was approved by the Ethics Committee of the University Hospital Gasthuisberg (Leuven, Belgium). All participants provided written informed consent. In the framework of a different project48, RNA-seq was performed on 39 tumours from these patients. Gene expression for these samples was clustered for their hypoxia metagene signature25. This yielded 2 clear clusters, containing 24 and 15 normoxic and hypoxic tumours, respectively. Twelve samples were randomly selected from each cluster, in order to perform 5hmC and 5mC profiling. For TAB–ChIP, DNA was glycosylated and oxidized as described49, using the 5hmC TAB-Seq Kit (WiseGene). Subsequently, bisulfite conversion, DNA amplification and array hybridization were done following manufacturer’s instructions. Data processing was largely as described50. In brief, intensity data files were read directly into R. Each sample was normalized using Subset-quantile within array normalization (SWAN) for Illumina Infinium HumanMethylation450 BeadChips49. Batch effects between chips and experiments were corrected using the runComBat function from the ChAMP bioconductor package51. For obtaining 5mC-specific beta values, TAB-ChIP generated normalized beta values were substracted from the standard 450K generated normalized beta values, exactly as described50. All the experimental procedures were approved by the Institutional Animal Care and Research Advisory Committee of the KU Leuven. For sFlk1-overexpression studies, male Tg(MMTV-PyMT) FVB mice were intercrossed with wild-type FVB female mice. Female pups of the Tg(MMTV-PyMT) genotype were retained, and tumours allowed to develop for 9 weeks. Subsequently, 2.5 μg of plasmid (sFlk1-overexpressing or empty vector; randomly assigned within litter mates) per gram of mouse body weight was introduced in the bloodstream using hydrodynamic tail vein injections52. sFlk1 overexpression was monitored at 4 days after injection and at the day of killing (18 days after the injection), by eye bleeds followed by an ELISA assay for sFlk1 (R&D Systems) in blood plasma. At 12 weeks of age, mice were killed and mammary tumours collected were blinded for treatment. For the Phd2+/− experiments, male Tg(MMTV-PyMT) FVB mice were intercrossed with female Phd2−/+ mice, yielding litters of which half have either a Tg(MMTV-PyMT) genotype or a Tg(MMTV-PyMT);Phd2−/+ genotype. For the Phd2WT/fl experiments, male Tg(MMTV-PyMT) FVB mice were intercrossed with female Tie2-Cre;Phd2WT/fl mice as described27, yielding litters of which half have either a Tie2-cre;Tg(MMTV-PyMT);Phd2WT/WT genotype or a Tie2-cre;Tg(MMTV-PyMT);Phd2−/+ genotype. At 16 weeks of age, female mice were killed and mammary tumours collected. RNA was extracted from fresh-frozen tumours (stored at −8 °C) using TRIzol (Life Technologies), and converted to cDNA and quantified as described for the cell lines. TaqMan probes and primers (IDT or Life Technologies) are described under Supplementary Table 12. TAB-seq libraries were prepared as described, using the 5hmC TAB-Seq Kit (WiseGene). DNA was bisulfite-converted using the EZ DNA Methylation-Lightning Kit (Zymo Research) and sequenced as described for SeqCapEpi experiments. Reads were mapped to the mouse genome (build Mm9) and further data processing was as for SeqCapEpi experiments. DNA from 3 independent tumours was selected per condition. TET oxidation efficiency was required to exceed 99.5% as estimated using a fully CG-methylated plasmid spike-in, 5hmC protection by glycosylation was 65% as estimated using a fully hydroxymethylated plasmid spike-in, bisulfite conversion efficiencies were estimated to exceed 99.8% based on nonCG methylation (equal to percentage hypermethylated CpG). Mapping statistics are summarized in Supplementary Table 11. As no mouse capture kit was available for targeted BS-seq, a specific ampliconBS was developed for a set of 15 tumour suppressor gene promoters and 5 oncogene promoters. More specifically, DNA was bisulfite-converted using the Imprint DNA modification kit and amplified using the MegaMix Gold 2× mastermix and validated primer pairs. Per sample, PCR products were mixed to equimolar concentrations, converted into sequencing libraries using the NEBNext DNA library prep master mix set and sequenced to a depth of ~500×. Mapping and quantification were done as described for SeqCapEpi. The average and variance of methylation level M values in normal mammary glands were used as baseline, and amplicons displaying over 3 standard deviations more methylation (FDR-adjusted P < 0.05) than this baseline were called as hypermethylated. At least 9 different tumours, each from different animals, were profiled per genotype or treatment, and differences in hypermethylation frequencies between sets of tumours were assessed using Mann–Whitney’s U-test. Data entry and analysis were performed in a blinded fashion. Statistical significance was calculated by two-tailed unpaired t-test (Excel) or analysis of variance (R) when repeated measures were compared. Data were tested for normality using the D’Agostino–Pearson omnibus test (for n > 8) or the Kolmogorov–Smirnov test (for n ≤ 8) and variation within each experimental group was assessed. Data are presented as mean ± s.e.m. DNA methylation and RNA-seq gene expression data distributions were transformed to a normal distribution by conversion to M values and log transformation respectively. Sample sizes were chosen based on prior experience for in vitro and mouse experiments, or on sample and data availability for human tumour analyses. Other statistical methods (mostly related to specific sequencing experiments) are described together with the experimental details in other sections of the methods.


All animal experiments were performed in accordance with the European Community and local ethics committee guidelines. Xenopus laevis were purchased (Nasco) and maintained in our animal facility. Ambystoma mexicanum (axolotls) were bred and maintained in our facility, where they were kept at 18 °C in Dresden tap water and fed daily with artemia or fish pellets. Five-to-six centimetre (snout to tail tip) axolotls were used for all the experiments. Animals were anaesthetized for all the surgical process as previously described20. Labelling of connective tissue was achieved by transplanting lateral plate mesoderm from GFP transgenic embryos to normal host embryos as previously described20. Total RNA was isolated from day-1, day-3 and day-5 limb and tail blastemas with TRIzol reagent (Invitrogen) according to the manufacturer’s manual. Total RNA from mature (not regenerating) limb tissues was isolated using the same procedure as blastema samples. Blastema RNAs from the different time points were equivalently pooled as limb–blastema total RNA or tail–blastema total RNA, respectively. mRNA was purified from limb–blastema or tail–blastema total RNA with the Poly (A) Quick mRNA isolation kit (Stratagene). Xenopus oocyte preparation and microinjection were performed essentially as previously described6, 7, 21. Briefly, mature oocytes were defolliculated with collagenase (Sigma). Purified mRNA (5.0 ng) was injected into the selected healthy oocytes after the defolliculation. Eight injected oocytes were cultured together in one well of a 96-well plate (Nunc) for 48 h and the supernatants were harvested for myotube assay (see later). Clones (110,592) from a 6-day tail blastema library were arrayed into 288 × 384-well plates22. To prepare the ‘pools’, all the saturated bacterial cultures on one 384-well plate were pooled in one conical tube, and 288 pools were prepared from the library in total. To prepare the ‘superpools’, 24 pools were combined together in one conical tube, and 12 superpools were prepared from the pools in total (Extended Data Fig. 1a–c). To obtain superpool plasmid, 500 μl of superpool bacteria were cultured in 50 ml LB medium (Extended Data Fig. 1d). To avoid losing low frequency clones in the superpools, the optical density (OD) of each culture was controlled and the cultures were harvested around OD 0.6. Superpool plasmids were purified with QIAGEN Plasmid Midi Kit (QIAGEN) according to the manufacturer’s manual. To reconstitute the whole library, 5 μg of each superpool’s plasmids were pooled in one tube before transfection. HEK293FT cells (Invitrogen) were maintained with the standard protocol from Invitrogen. To obtain the superpool supernatants, 8.0 × 105 of HEK293 cells were plated on one well of a 6-well plate (Nunc) and 1 μg of each individual superpool plasmids were transfected into HEK293 cells with Fugene 6 (Roche; Extended Data Fig. 1e) according to the manufacturer’s manual. For the first 24 h, the transfected HEK293 cells were kept in the 10% fetal calf serum (FCS) medium. Then the cells were rinsed with FreeStyle 293 expression medum (Gibco) that is a serum-free medium and cultured in the medium at 72 h after transfection. Individually harvested supernatants were concentrated approximately tenfold with a Vivaspin 10,000 MWCO (Sartorius). These concentrated supernatants were tested on A1 myotubes (Extended Data Fig. 1f). It should be noted that given the injury-specific extracellular activity of AxMLP, we infer that the Xenopus oocyte and HEK293 cell systems are likely to be in ‘wound-epithelium-like’ signalling states that permit at least some extracellular release of AxMLP, and that the 6-day regenerating tail blastema cDNA had a sufficient number of AxMLP clones for detection in the expression cloning system. We only detected 1 AxMLP clone among 100,000 clones, and this may reflect the levels of mRNA present at later regeneration time points. Maintenance of A1 myoblasts, myotube differentiation from A1 myoblasts, myotube purification and subsequent myotube assays were performed essentially as described previously8, 23, 24. Briefly, concentrated supernatants were individually added into myotube culture medium in a 96-well plate and incubated for 5 days, and BrdU (Sigma; final 10 μg ml−1) was added to the culture media for 18 h before the fixation with 1.5% PFA (Sigma)/PBS. Fixed myotubes were stained with anti-MHC and anti-BrdU antibodies (mouse monoclonal, 4a1025 and Bu20a) conjugated to FITC or rhodamine with DyLight Antibody Labelling Kit (Thermo Scientific) according to the manufacturer’s manual. For the quantification of BrdU incorporation activity, the total number of myotubes and BrdU+ myotubes were counted by hand under the microscope (Zeiss Axioplan 2). This biological evaluation of the BrdU-incorporation activity on myotubes is called the myotube assay. The high-serum (15% FCS) condition was used as a positive control for myotube assays and the low-serum (0.5% FCS) or serum-free condition was used as a negative control. For the second screen from superpool number 9, the clones from the 24 384-well plates contained in superpool 9 were divided into smaller sub-pools according to a two-dimensional matrix (Extended Data Fig. 2a). For example, sub-pool A contained pools from plates 193–198 and sub-pool 1 contained pools from plates 193, 199, 205, 211. These sub-pools were cultured to OD 0.6 before plasmid preparation. For the third screen from pool number 212, 384 single clones were arrayed by 96-pin plastic replicators (Genetix) on 96-well plates (SARSTEDT) filling 150 μl LB medium per well (Extended Data Fig. 2b; groups A–D). Individual clones on the 96-well plates were statically cultured until they were saturated and 24 clones were pooled together (Extended Data Fig. 2b; sub-pools A1–D4). Plasmids from each pool were purified with QIAprep spin miniprep kit (QIAGEN). For the fourth screen from A1, 24 clones were individually cultured in LB medium and the plasmids were purified with QIAprep spin miniprep kit (QIAGEN). To construct sub-pools, 1 μg of the plasmid from each single clone was pooled according to the diagram in Extended Data Fig. 2c. The process from the transfection into HEK293 cells to myotube assay in the second to the fourth screen was the same as the first screen. To validate transfection efficiency during whole expression cloning, 50 pg of secreted alkaline phosphatase (SEAP)-pCMV-SPORT6 plasmid was co-transfected with the samples as a spike and a portion of the supernatants was assayed by Great EscAPe SEAP Chemiluminescence Kit 2.0 (Clontech). The luminescence of the supernatants was measured by GENiosPro Microplate Reader (TECAN). We confirmed that there was no significant difference of transfection efficiency during the expression cloning (data not shown). There were no cell line misidentification and cross-contamination in the experiments. We used a single mammalian cell line (HEK293FT cells) provided by Invitrogen and single amphibian cell line (newt A1 cells) in the experiments. These two cell lines have totally different morphologies and are cultured under mutually incompatible culture conditions. The growth of both cells were carefully monitored during the experiments and cells samples were constantly stained with Hoechst 33342 (Sigma, final 0.5 μg ml−1) to test mycoplasma contamination. Human and mouse MLP cDNA clones were purchased from OriGene Technologies (clone ID: human, SC112373; mouse, MC208965). Zebrafish and Xenopus mlp cDNA clones were purchased from Source BioScience (clone ID: zebrafish, 6795591; Xenopus, 8330180). All oligonucleotide sequences and the restriction enzyme sites using for cloning are shown in Supplementary Table 2. Since the backbone vector of the cDNA library is pCMV-SPORT6, we subcloned following genes into pCMV-SPORT6 vector (Invitrogen) or pCMV-SPORT6-3C-His vector. PCR-amplified fragments with the oligonucleotides numbers 1 and 2 from pSEAP2-Basic (Clontech) were subcloned into pCMV-SPORT6. The oligonucleotides numbers 3 and 4 were attached to pCMV-SPORT6 to generate a backbone vector, pCMV-SPORT6-3C-His (Extended Data Fig. 3c, bottom left). The AxMlp open reading frame (ORF) was amplified by PCR with the oligonucleotides numbers 5 and 6 from the original AxMlp clone (BL212a101) and subcloned in the pCMV-SPORT6-3C-His vector (Extended Data Fig. 3c, top left). N-terminal deletion AxMlp was amplified by PCR with the oligonucleotides numbers 7 and 8 from the original AxMlp clone (BL212a101) and subcloned in the pCMV-SPORT6-3C-His vector (Extended Data Fig. 6a, bottom). Human, mouse, zebrafish and Xenopus MLP ORFs were amplified from purchased cDNA clones with specific primers (for human, oligonucleotides numbers 9, 10; mouse, oligonucleotides numbers 9, 11; zebrafish, oligonucleotides numbers 12, 13; Xenopus, oligonucleotides numbers 14, 15, respectively), and were subcloned in the pCMV-SPORT6-3C-His vector. The oligonucleotides numbers 16 and 17 were inserted into to the pEGFP-N1 plasmid (Clontech) to generate a backbone vector, pEGFP-N1-3C (Extended Data Fig. 3c, bottom right). The AxMlp ORF was amplified by PCR with the oligonucleotides numbers 18 and 19 from the original AxMlp clone (BL212a101) and subcloned into pEGFP-N1-3C (Extended Data Fig. 3c, top right). Newt Mlp ORF was amplified by PCR from newt limb blastema cDNA with the oligonucleotides numbers 28 and 29 and the PCR fragments were subcloned in the pCMV-SPORT6-3C-His vector. These constructs were confirmed by sequencing. For measuring the GFP intensity of supernatants, 8.0 × 105 of HEK293 cells were plated on 6-well plates and 1 μg of AxMLP-3C-pEGFP-N1 plasmid or 1 μg of empty-pEGFP-N1 plasmid were transfected into HEK293 cells. The supernatants were harvested at 24 h post-transfection (hpt), 48 hpt and 72 hpt and concentrated with Vivaspin 10,000 MWCO (Sartorius) individually. The fluorescence intensity was measured using a GENiosPro Microplate Reader (TECAN). To determine the percentage of GFP+ cells in the culture, the transfected cells were detached with Trypsin-EDTA (Gibco, final 0.05%)/PBS from the well, then spread on improved Neubauer chamber. The number of GFP+ cells and total cells in the grids were counted by hand and the percentage was calculated. Time-lapse imaging was performed under Axiovert 200M (Zeiss) with humidity, temperature and CO control chamber. Images were taken every 30 min from 5 to 72 hpt. For the antibody-based blocking assay in vitro, 1 μg of AxMlp-3C-His-pCMV-SPORT6 plasmid or empty-pCMV-SPORT6-3C-His plasmid was transfected into HEK293 cells with Fugene 6 (Roche). The supernatants were harvested at 72 hpt and concentrated. Ten micrograms of AxMLP-3C-His protein (22.7 kDa) were treated with 70 μg or 350 μg of anti-AxMLP polyclonal antibody (see later) or anti-GFP polyclonal antibody (MPI-CBG antibody facility) as a negative control, respectively, at room temperature for 2 h. These antibody-treated supernatants were used for the myotube assay. For the in vivo antibody blocking assay, anti-full-length AxMLP polyclonal antibody (see later), anti-GFP polyclonal antibody (MPI-CBG antibody facility) or PBS as a negative control were injected into mature (not regenerating) tail as the first injection (3 h before amputation) and injected into the blastema as the second injection (12 h post-amputation) and as the third injection (1 day post-amputation) (Extended Data Fig. 9a). These samples were co-injected with tetramethylrhodamine dextran MW 70,000 (Molecular Probes; final 2.5 mg ml−1) as a tracer. The injection efficiency was confirmed based on the intensity of the rhodamine under the fluorescence dissecting microscope (SZX 16, OLYMPUS). No animals were excluded from the analysis. In each injection 500 ng, then, in total 1.5 μg antibody or equivalent volume of PBS were injected. Injected animals were kept in clean tap water for 3 days at room temperature. The animals were injected intraperitoneally with 30 μl of 2.5 mg ml−1 BrdU (Sigma) 4 h before collecting the tails. The injected blastemas were fixed, embedded, cryosectioned and immunostained as described later. For the imaging, the tiled images of the entire cross-section of the tails taken on a Zeiss Observer.Z1 (Zeiss) were then stitched by Axiovision software or Zen 2 (Zeiss). For the quantification at least a total of 1,000 cells per one animal were counted from four different animals in each condition (PBS, anti-GFP antibody or anti-AxMLP injection, respectively), and the marker-positive nuclei (BrdU+, PAX7+, MEF2+ or Hoechst+) on the sections were counted by hand. The cells in spinal cord, epidermis and cartilage/notochord were separately counted based on morphology. The label “Other tissues” in Fig. 2d, contained mainly mesenchymal cells and endothelial cells and was calculated by the subtraction from the total number to the number of all the other specific cell types. For His-tagged AxMLP purification, AxMLP-3C-His-pCMV-SPORT6 plasmid was transfected into HEK293 cells and the supernatant was harvested at 72 hpt. His-tagged protein in the supernatant was purified in native conditions on a 1 ml HisTrap HP column (GE Healthcare) using FreeStyle 293 expression medium including 500 mM imidazole step elution. The eluate (purified AxMLP) and depleted media (flow-through) were concentrated with Vivaspin 10,000 MWCO (sartorius) 40 fold and the final concentration of purified AxMLP was 1.31 μg μl−1. Both concentrated eluate (purified AxMLP) and flow-through fractions were dialysed with Spectra/Por Dialysis Membrane MWCO 6-8000 (Spectrum Laboratories) in AMEM (MEM medium (Gibco) diluted 25% with distilled water) for biological assays. The fractions from the purification were tested by silver staining and western blotting (Extended Data Fig. 3g, h). The washing fraction was concentrated about tenfold to load the same volume as other fractions on 4–20% gradient SDS–PAGE gels (anamed Elektrophorese). Western blotting and silver staining were performed with a standard protocol. Briefly, the fractions were treated with 2× Sample Buffer including dithiothreitol (DTT; Sigma, final 0.2 M) and boiled at 95 °C for 10 min. The proteins were blotted on PROTRAN nitrocellulose transfer membrane (Whatman) by TE 77 Semi-Dry Transfer Unit (Amersham). The membrane was blocked with 5% skim milk. Primary antibodies used: mouse anti-His (QIAGEN, 1/5,000), mouse anti-α-tubulin (MPI-CBG antibody facility, DM1A 1/5,000), rabbit anti-AxMLP-full length (1/2,500), rabbit anti-AxMLP-C terminus (1/2,500). Secondary antibodies used: goat anti mouse-HRP (Jackson ImmunoResearch Laboratories, 1/5,000), goat anti rabbit-HRP (Jackson ImmunoResearch Laboratories, 1/5,000). Cell lysates for western blotting were obtained by directly adding 2× Sample Buffer on top of the cultured cells and were boiled at 95 °C for 10 min. For the preparation of anti-full-length AxMLP polyclonal antibody, a glutathione S-transferase (GST) fusion protein with full-length amino acids of AxMLP was expressed in bacteria and purified by standard methods on GS-trap, glutathione sepharose (GE Healthcare). Purified GST fusion protein as an antigen was used to immunize rabbits (Charles River). Anti-serum was affinity purified using maltose-binding protein fused with full-length AxMLP conjugated to NHS-Sepharose resin (GE Healthcare). To raise C-terminal AxMLP polyclonal antibody, keyhole limpet haemocyanin (KLH)-tagged peptides, PPVEPQVEEVAAPAP, was used to immunize rabbits and the affinity-purified polyclonal antibody was provided (Eurogentec). Both anti-full-length and anti-C-terminal AxMLP polyclonal antibodies were tested on the cell lysate from AxMLP-transfected HEK293 cells (Extended Data Fig. 3f). Limb blastema and tail blastema preparations for sectioning were produced essentially as previously described25. Briefly, limb blastemas amputated at the wrist level were collected from the level of the shoulder, and tail blastemas amputated at the 12th myotome from the cloaca were collected at the 10th myotome of the regenerating tail. These limb and tail blastemas were immunostained as previously described15, 25, 26. Briefly, the samples were fixed with MEMFA fixative at 4 °C overnight, and were rinsed with PBS several times. The buffer was replaced from PBS to 10%, 20% and 30% sucrose (Sigma)/PBS, then the samples were embedded in Tissue-Tek O.C.T. Compound (Sakura) for cryosection and the tissues were sectioned at 10-μm thickness with Microm HM 560 cryostat (Thermo). Primary antibodies used: mouse anti-BrdU (MPI-CBG antibody facility, Bu20a 1/400), rabbit anti-BrdU (antibodies-online, 1/600), mouse anti-PAX7 (MPI-CBG antibody facility, PAX7 1/450), rabbit anti-MEF2 (Santa Cruz, 1/200), rabbit anti-AxMLP-C terminus (1/200), rabbit anti-GFP (Rockland, 1/400), rabbit anti-FITC (Invitrogen, 1/400), mouse anti-FITC (Jackson ImmunoResearch Laboratories, 1/400), rat anti-MBP (GeneTex, 1/200). The following appropriate fluorophore-conjugated secondary antibodies were used (all in 1/200 dilution): donkey anti-mouse Alexa Fluor (AF) 647 (Molecular Probes), goat anti-mouse AF 647 (Jackson ImmunoResearch Laboratories), donkey anti-mouse AF 488 (Molecular Probes), goat anti-rabbit AF 647 (Jackson ImmunoResearch Laboratories), donkey anti-rabbit AF 488 (Molecular Probes), donkey anti-rat AF 488 (Molecular Probes). The cell nuclei were stained with Hoechst 33342 (Sigma, final 0.5 μg ml−1). Imaging for the stained sections was performed with Zeiss Observer.Z1 (Zeiss) controlled by Axiovision software or Zen2 (Zeiss). Total RNA preparation, reverse transcription and qRT–PCR were essentially described in the previous work2. Briefly, three biological replicas were prepared for each time point and they were technically independent in all the processes (tissue collection, RNA preparation, cDNA synthesis and qRT–PCR). Eight to approximately ten limb or tail blastemas from one time point were collected in one tube and homogenized by POLYTRON PT1600E (KINEMATICA). Total RNA was purified with RNeasy Mini or Midi Kit (QIAGEN) according to the manufacturer’s manual. cDNA was synthesized from 300 ng of total RNA using SuperScript III First-Strand Synthesis System (Invitrogen) and qRT–PCR was performed with Power SYBR Green Master Mix (Invitrogen) in total volume of 12 μl with the final primer concentration of 300 nM on the LightCycler 480 (Roche). To obtain the values of fold change for each time point, the relative concentration of the PCR products was calculated by the standard curve method. To obtain the standard curves of the limb time course or the tail time course respectively, the dilution series (1/4, 1/16, 1/64, 1/256 and 1/1,024) were made from the mixture of cDNAs that were equivalently collected from the cDNA samples in all the different time points. These dilution series were used as the template for the PCR and the relative concentrations were calculated by LightCycler 480 Software (Roche) based on the standard curves. The concentration of AxMlp was normalized with that of Rpl4 (large ribosomal protein 4). Primers used for PCR were showed in Supplementary Table 2 (for AxMlp, oligonucleotides numbers 20, 21; for Rpl4, oligonucleotides numbers 22, 23). The raw values of qPCR data are shown in Supplementary Table 1. The dialysed protein samples: purified AxMLP, depleted media (flow-through) (see earlier) or PBS as a negative control were injected into mature (not regenerating) tails with a pressure injector, PV830 Pneumatic Picopump (World Precision Instruments). These protein samples were co-injected with tetramethylrhodamine dextran MW 70,000 (Molecular Probes, final 2.5 mg ml−1) as a tracer. A glass capillary (Harvard Apparatus) for the injection was pulled with P-97 Micropipette Puller (Sutter Instrument) and sharpened manually (external tip diameter: 30 μm). The injection efficiency was confirmed based on the intensity of the rhodamine under the fluorescence dissecting microscope (SZX 16, OLYMPUS). No animals were excluded from the analysis. In total, 270 ng of purified AxMLP or equivalent volume of controls were injected into one side of the tail. Injected animals were kept in clean tap water for 3 days at room temperature. The animals were injected intraperitoneally with 30 μl of 2.5 mg ml−1 BrdU (Sigma) 4 h before collecting the tails (Fig. 2a). The injected part of the tails was identified by rhodamine-positive myotomes and these tails were fixed, embedded, cryosectioned and immunostained as described earlier. For the quantification, the tile images of whole cross-sections of the tails from Zeiss Observer.Z1 (Zeiss) were stitched by Axiovision software (Zeiss). Three sections from five different animals in each condition (PBS, flow-through or purified AxMLP injection, respectively) were taken, and the marker-positive nuclei (BrdU+, PAX7+, MEF2+ or Hoechst+) on the sections were counted by hand. The cells in spinal cord, epidermis and notochord were separately counted based on morphology. The label “Other tissues”, contained mainly mesenchymal cells and endothelial cells, and was calculated by the subtraction from the total number to the number of all the other specific cell types. For the protein injection into the limb, the procedure was essentially as described earlier. Purified AxMLP protein was injected into the mature (not regenerating) right lower limbs at the centre between the elbow and the wrist. The control samples (flow-through fraction or PBS) were injected into the left limbs of the same animal that were injected with purified AxMLP on their right limbs. In total 2.0 μg purified AxMLP or equivalent volume of controls were injected into the limbs. The animals were injected intraperitoneally with 30 μl of 2.5 mg ml−1 BrdU (Sigma) 12 h before collecting the limbs (Extended Data Fig. 4e). For the quantification, at least a total of 1,000 cells per one animal were counted from four different animals in each condition (PBS, flow-through or purified AxMLP injection, respectively), and the marker-positive nuclei (BrdU+, PAX7+, MEF2+, MBP + or Hoechst+) on the sections were counted by hand. The cells in epidermis and bone/perichondrium were separately counted with their morphology. The label “Other tissues”, contained mainly mesenchymal cells and endothelial cells, and was calculated by the subtraction from the total number to the number of all the other specific cell types. For the acceleration experiment, purified AxMLP, flow-through or PBS as a negative control were injected into mature (not regenerating) tail as the first (3 days before amputation) injection and as the second (1 day before amputation) injection and injected into the blastema as the third (2 days post-amputation) injection (Extended Data Fig. 10a). These samples were co-injected with tetramethylrhodamine dextran MW 70,000 (Molecular Probes, final 2.5 mg ml−1) as a tracer. The injection efficiency was confirmed based on the intensity of the rhodamine under the fluorescence dissecting microscope (SZX 16, OLYMPUS). No animals were excluded from the analysis. The samples were injected into both side of the tail and in each injection, 600 ng, then, in total 1.8 μg protein or equivalent volume of controls were injected. Injected animals were kept in clean tap water for 4 days at room temperature. The length of the blastema was measured from the amputation plane to the tip at the spinal cord level at 4 dpa based on the stereoscope images (SZX 16, OLYMPUS). A1 myoblasts were transfected with original clone BL212a101, AxMLP-3C-His, ΔN-AxMLP-3C-His or empty pCMV-SPORT6-3C-His plasmids and co-transfected with AxMLP-specific morpholinos (Gene Tools; Supplementary Table 2: oligonucleotides numbers 24, 26) or control morpholinos (Gene Tools; Supplementary Table 2: oligonucleotides numbers 25, 27) using Microporator (Digital Bio) according to the manufacturer’s manual with some modifications. All morpholinos were modified with FITC at the 3′ end. A1 myoblasts were re-suspended in 1× Steinberg solution at a density of 5.0 × 106 cells per ml followed by incubation of 10 μl cell suspension with 0.5 μg of plasmid and 1 μl of the morpholino (final 100 μM in the incubation). Electroporation was performed at 1,000 V, 35 mS pulse length and 3 pulses and the electroporated cells were spread in 10% FCS AMEM media24 on a 24-well plate (Nunc), immediately after the electroporation. The culture medium was replaced by new media at 24 h post-electroporation and the cells were kept in culture at 72 h post-electroporation. The electroporated cells were fixed with 1.5% PFA/PBS, and the cell lysates were prepared for western blotting. Primary antibodies used for immunostaining: mouse anti-His (QIAGEN, 1/200), mouse anti-FITC (Jackson ImmunoResearch Laboratories, 1/400), rabbit anti-FITC (Invitrogen, 1/400), rabbit anti-AxMLP-full length (1/1,000). Secondary antibodies used for immunostaining (all in 1/250 dilution): goat anti-mouse Cy3 (Jackson ImmunoResearch Laboratories), goat anti-mouse AF488 (Jackson ImmunoResearch Laboratories), donkey anti-rabbit AF 488 (Molecular Probes), goat anti-rabbit Cy3 (Jackson ImmunoResearch Laboratories). Images of the stained cells were taken with Zeiss Observer.Z1 (Zeiss) controlled by Axiovision software (Zeiss). Electroporation to the spinal cord was performed as previously described with some modifications27. To deliver morpholino into the spinal cord and both sides of the tail epidermis, the tail required electroporation twice with NEPA 21 electroporator (Nepa Gene). The first electroporation was for the spinal cord and one side (left) of the epidermis, and the second electroporation was for the other side (right) of the epidermis. 1.5 μl of morpholino (1.0 mM) was loaded onto a small piece of tissue paper on the left side of the epidermis. Approximately 3 μl of morpholino (1.0 mM) was injected into the spinal cord and immediately electroporated (first electroporation). Sequentially, 1.5 μl of morpholino (1.0 mM) was loaded onto a small piece of tissue paper on the right side of the epidermis and electroporated (second electroporation). The first electroporation conditions: poring pulse, 70 V, 5.0 mS pulse length and 1 pulse; transfer pulse, 55 V, 55 mS pulse length, 5 pulses and 15% decay. The second electroporation conditions: poring pulse, 70 V, 10 mS pulse length and 1 pulse; transfer pulse, 30 V, 30 mS pulse length, 7 pulses and 5% decay. FITC dextran MW 70,000 (Molecular Probes, final 5 mg ml−1) was used as a negative control, since morpholinos were labelled with FITC. The electroporation efficiency in the spinal cord and epidermis was examined based on the intensity of the FITC under the fluorescence dissecting microscope (SZX 16, OLYMPUS). The animals with low FITC intensity were excluded from the next step of the experiments. Three days post-electroporation, the tails were amputated at the level of the maximal morpholino electroporated part. One day post-amputation, a total of 360 ng (180 ng for the spinal cord and 180 ng for blastema) of purified AxMLP or equivalent volume of control flow-through fraction was injected into the spinal cord and the blastema to rescue the morpholino effect. The length of the blastema was measured from the amputation plane to the tip at the spinal cord level on 1, 3, 6, 10 and 14 dpa based on the stereoscope images (SZX 16, OLYMPUS). To detect BrdU incorporation, the animals were injected intraperitoneally with 30 μl of 2.5 mg ml−1 BrdU (Sigma) 4 h before collecting the tails at 3 dpa. Fixation, embedding, cryosection, staining and imaging were described earlier. For the quantification, 3 cross-sections of the blastema (200–300 μm posterior to the amputation plane) from four different animals in each condition (FITC/flow-through, FITC/purified AxMLP, control morpholino/flow-through, control morpholino/purified AxMLP, AxMLP-specific morpholino/flow-through, AxMLP-specific morpholino/purified AxMLP, respectively) were taken, and the marker-positive nuclei (BrdU+, PAX7+, MEF2+ or Hoechst+) on the sections were counted by hand. Red-spotted newts, Notophthalmus viridescens, were supplied by Charles D. Sullivan Co. Animals were anaesthetized in 0.1% ethyl 3-aminobenzoate methanesulfonate (Sigma) for 15 min. Forelimbs were amputated above the elbow, and the bone and soft tissue were trimmed to produce a flat amputation surface. Animals were left to recover overnight in an aqueous solution of 0.5% sulfamerazine (Sigma). At specified time points, the uninjured or regenerating limbs were collected. All surgical procedures were performed according to the European Community and local ethics committee guidelines. The general condition in the newt experiments: 2 μl of 5 mg ml−1 purified AxMLP protein or equivalent volume of flow-through (AxMLP depleted fraction) was injected into the newt limbs. For EdU labelling, animals were injected intraperitoneally with 50–100 μl of 1 mg ml−1 EdU. To investigate the effect of AxMLP on intact newt limbs, purified AxMLP or flow-through was injected into the uninjured limb twice at day 1 and day 3. EdU was administered daily from day 1 to day 5 (Fig. 3a, top). To investigate the effect of AxMLP on regenerating limbs, purified AxMLP or flow-through was injected into the regenerating limbs at 7 and 10 dpa (Fig. 3b, top). EdU was administered daily from 8 to 13 dpa. For labelling myofibre progeny, a H2B-YFP reporter construct was introduced into myofibres before amputation as previously described15 (Fig. 3c, top). Cell cycle re-entry was quantified by EdU incorporation in the YFP+ myofibre progeny at 13 dpa. Frozen sections (5–10 μm) were thawed at room temperature and fixed in 4% formaldehyde for 5 min. Sections were blocked with 5% donkey serum and 0.1% Triton-X for 30 min at room temperature. Sections were incubated with anti-GFP (Abcam 6673), anti-PAX7 (DSHB) or anti-MHC (DSHB) overnight at 4 °C and with secondary antibodies for 1 h at room temperature. Antibodies were diluted in blocking buffer and sections were mounted in mounting medium (DakoCytomation) containing 5 μg ml−1 DAPI (Sigma). EdU detection was performed as previously described15. An LSM 700 Meta laser microscope with LSM 6.0 Image Browser software (Carl Zeiss) was used for confocal analyses. One in every eight sections was selected and labelled. For PAX7+ satellite cell counting, three sections were randomly selected and counted. For blastema YFP+ cell counting, all the sections in the region from regenerate tip to the bone were counted. Statistical analyses were performed using GraphPad Prism 6.0 (GraphPad Software). Student’s t-test, parametric, two-tail testing was applied to populations to determine the P values indicated in the figures. Significance was considered to have been reached at P values from <0.05. No statistical methods were used to predetermine sample size. In vivo axolotl experiments were not randomized and no blind tests were applied.


News Article | December 7, 2016
Site: www.nature.com

Drosophila melanogaster w1118, Canton-S and Oregon-R were used as wild-type controls. Other fly stocks used were tub-GAL4, elavC155-GAL4, how24B-GAL4, Df(3R)Exel6197, Df(2L)BSC200/Cyo, Df(3L)Exel6094 (Bloomington Drosophila Stock Center). UAS-Ime4-HA/Cyo flies were generated by injection of UAS Ime4–HA vector at Bestgene. Mutant alleles for Ime4, dMettl14, fl(2)d and YT521-B were generated using the CRISPR–Cas9 system following the previously described procedure41. Two independent guide RNAs (gRNAs) per gene were designed using the gRNA design tool: http://www.crisprflydesign.org/ (Supplementary Table 9). Oligonucleotides were annealed and cloned into pBFv-U6.2 vector (National Institute of Genetics, Japan). Vectors were injected into embryos of y2 cho2 v1; attP40(U6.2-w-ex3-2) flies. Positive recombinant males were further crossed with y2 cho2 v1; attP40(nos-Cas9)/CyO females. Males carrying nos-Cas9 and U6-gRNA transgenes were screened for the expected deletion and further crossed with the balancer strain AptXa/CyoGFP-TM6c. Ime4∆cat allele was obtained using gRNA sequences (GGACTCTTTCCGCGCTACAG and GGCTCACACGGACGAATCTC). A deletion of 569 bp (607–1,175 bp in the genome region chr3R:24032157..24034257, genome assembly BDGP release 6) was produced. Ime4null allele was obtained using gRNA sequences (GGCCCTTTTAACGTTCTTGA and GGCTCACACGGACGAATCTC) and produced a deletion of 1,291 bp (1,876–3,166 bp in the genome region chr3R:24030157..24034257). dMettl14fs allele was obtained using gRNA sequences (GGTTCCCTTCAGGAAGGTCG and GGACCAACATTAACAAGCCC) and produced a 2-nucleotide frame shift at position 227 of the coding sequence, leading to a premature stop codon at amino acid position 89. YT521-BΔN allele was obtained using gRNA sequences (GGCATTAATTGTGTGGACAC and GGCTGTCGATCCTCGGTATC) and produced a deletion of 602 bp (133–734 bp in the genome region chr3L:3370451..3374170 (reverse complemented)). The phylogenetic trees were constructed with ClustalX42 from multiple sequence alignments generated with MUSCLE43 of the Drosophila sequences with homologues from representative species. Drosophila S2R+ are embryonic-derived cells obtained from Drosophila Genomics Resource Center (DGRC; FlyBase accession FBtc0000150). The presence of Mycoplasma contamination was not tested. The plasmids used for immunohistochemistry and co-immunoprecipitation assays in Drosophila S2R+ cells were constructed by cloning the corresponding cDNA in the pPAC vector44 with N-terminal Myc tag and the Gateway-based vectors with N-terminal Flag–Myc tag (pPFMW) as well as C-terminal HA tag (pPWH) (obtained from Drosophila Genomics Resource Center at Indiana University). Two-to-three-day-old flies were gender-separated and placed into measuring cylinders to assess their locomotion using the climbing assay reported previously45. Flies were tapped to the bottom and the number of flies that climb over the 10 cm threshold in 10 s interval were counted. Ten female flies were used per experiment and six independent measurements were performed. Staging experiment was performed using Drosophila melanogaster w1118 flies that were kept in a small fly cage at 25 °C. Flies laid embryos on big apple juice plates that were exchanged every 2 h. Before each start of collection, 1 h pre-laid embryos were discarded to remove all retained eggs and embryos from the collection. All the resultant plates with embryos of 1 h or 2 h lay were further incubated at 25 °C between 0 h and 20 h, with 2 h increments, to get all embryonic stages. For the collection of larval stages, L1 larvae (~30 larvae/stage) were transferred onto a new apple juice plate and were further incubated at 25 °C till they reached a defined age (24 to 110 h, 2 h intervals). Similarly, pupal stages were obtained by the transfer of L3 larvae (~30/stage) in a fresh vial, that were kept at 25 °C and left to develop into defined stage between 144 and 192 h in 2 h increments. One-to-three-day-old adults were collected and gender separated. Heads and ovaries from 50 females were also collected. A total of three independent samples were collected for each Drosophila stage as well as for heads and ovaries. Samples from the staging experiment were used for RNA extraction to analyse m6A abundance in mRNA and expression levels of different transcripts during Drosophila development. Total RNA from S2R+ cells was isolated using Trizol reagent (Invitrogen) and DNA was removed with DNase-I treatment (NEB). mRNA was purified with Oligotex mRNA Kit (Qiagen) or by using two rounds of purification with Dynabeads Oligo (dT)25 (Invitrogen). cDNA for RT–qPCR was prepared using M-MLV Reverse Transcriptase (Promega) and transcript levels were quantified using Power SYBR Green PCR Master Mix (Invitrogen) and the oligonucleotides indicated in Supplementary Table 9. For RNA isolation from fly heads, 20 female flies were collected in 1.5 ml Eppendorf tubes and flash frozen in liquid nitrogen. Heads were first removed from the body by spinning the flies on vortex and then collected via the 0.63 mm sieve at 4 °C. Fly heads were homogenized using a pestle and total RNA was isolated with Trizol reagent. DNA was removed by DNase-I treatment and RNA was further purified using RNeasy Kit (Qiagen). RNA from adult flies and dissected ovaries was prepared as described earlier by skipping the head separation step. Two-to-three-day-old flies were collected and their RNA isolated as described earlier. Following cDNA synthesis PCR was performed using the oligonucleotides described in Supplementary Table 9 to analyse Sxl, tra and msl-2 splicing. For in situ hybridization Drosophila melanogaster w1118 flies were kept at 25 °C in conical flasks with apple juice agar plates and embryos were collected every 24 h. Embryos were transferred in a sieve and dechorionated for 2 min in 50% sodium hypochloride. After 5 min wash in water, embryos were permeabilized with PBST (0.1% Tween X-100 in PBS) for 5 min. Embryos were transferred in 1:1 mixture of heptane (Sigma) and 8% formaldehyde (Sigma) and fixed for 20 min with constant shaking at room temperature. After fixation the lower organic phase was removed and 1 volume of MeOH was added to the aqueous phase containing fixed embryos. Following 5 min of extensive shaking all liquid was removed and embryos were washed 3 times with 100% MeOH. At this point embryos were stored at −20 °C or used for further analysis. For in situ hybridization MeOH was gradually replaced with PBST with 10 min washes and with three final washes in PBST. Embryos were further washed for 10 min at room temperature with 50% HB4 solution (50% formamide, 5× SSC, 50 μg/ml heparin, 0,1% Tween, 5 mg/ml torula yeast extract) diluted in PBST. Blocking was performed with HB4 solution, first for 1 h at room temperature and next for 1 h at 65 °C. In situ probes were prepared with DIG RNA labelling Kit (Roche) following the manufacturer’s protocol. Two microlitres of the probe were diluted in 200 μl of HB4 solution, heated up to 65 °C to denature the RNA secondary structure and added to blocked embryos for further overnight incubation at 65 °C. The next day, embryos were washed 2 times for 30 min at 65 °C with formamide solution (50% formamide, 1× SSC in PBST) and further 3 times for 20 min at room temperature with PBST. Embryos were then incubated with anti-DIG primary antibody (Roche) diluted in PBST (1:2,000) for 2 h at room temperature and later washed 5 times for 30 min with PBST. In order to develop the staining, embryos were rinsed with AP buffer (100 mM Tris pH 9.5, 50 mM MgCl , 100 mM NaCl, 0.1% Tween) and incubated with NBT/BCIP solution in AP buffer (1:100 dilution) until the intense staining was observed. Reaction was stopped with several 15 min PBST washes. Prior to mounting, embryos were incubated in 20% glycerol and later visualized on Leica M205-FA stereomicroscope. S2R+ cells were depleted for the indicated proteins with two treatments of double-stranded RNA (dsRNA). Four days after treatment Myc-tagged YT521-B was transfected along with the control Myc construct. Seventy-two hours after transfection, cells were fixed with 1% formaldehyde at room temperature for 10 min and harvested as described previously46. Extracted nuclei were subjected to 13 cycles of sonication on a bioruptor (Diagnode), with 30 s “ON”/“OFF” at high settings. Nuclear extracts were incubated overnight with 4 μg of anti-Myc 9E10 antibody (Enzo Life Sciences). Immunoprecipitation was performed as described previously46 except that samples were DNase-treated (NEB) instead of RNase-treated and subjected to proteinase K treatment for reversal of crosslinks, 1 h at 65 °C. RNase inhibitors (Murine RNase Inhibitor, NEB) were used in all steps of the protocol at a concentration of 40 U/ml. Antibodies against Ime4 and dMettl14 were generated at Eurogentec. For anti-Ime4 sera guinea pig was immunized with a 14 amino-acid-long peptide (163–177 amino acids (AA)); for anti-dMettl14 sera rabbit was immunized with a 14 amino acid-long peptide (240–254 AA). Both serums were affinity-purified using peptide antigens crosslinked to sepharose columns. For ovary immunostaining, ovaries from 3–5-day-old females were dissected in ice-cold PBS and fixed in 5% formaldehyde for 20 min at room temperature. After a 10 min wash in PBT1% (1% Triton X-100 in PBS), ovaries were further incubated in PBT1% for 1 h at room temperature. Ovaries were then blocked with PBTB (0.2% Triton, 1% BSA in PBS) for 1 h at room temperature and later incubated with the primary antibodies in PBTB overnight at 4 °C: rabbit anti-Vasa, 1:250 (gift from Lehmann laboratory), mouse anti-ORB 1:30 (#6H4 DSHB). The following day, ovaries were washed 2 times for 30 min in PBTB and blocked with PBTB containing 5% donkey serum (Abcam) for 1 h at room temperature. Secondary antibody was added later in PBTB with donkey serum and ovaries were incubated for 2 h at room temperature. Five washing steps of 30 min were performed with 0.2% Triton in PBT and ovaries were mounted onto slides in Vectashield (Vector Labs). For NMJ staining, third instar larvae were dissected in calcium free HL-3 saline and fixed in 4% paraformaldehyde in PBT (PBS + 0.05% Triton X-100). Larvae were then washed briefly in 0.05% PBT for 30 min and incubated overnight at 4 °C with the following primary antibodies: rabbit anti-synaptotagmin, 1:2,000 (ref. 47); mouse anti-DLG, 1:100 (#4F3, DSHB); TRITC-conjugated anti-HRP, 1:200 (Jackson ImmunoResearch). Secondary antibodies conjugated to Alexa-488 (goat anti-rabbit, Jackson ImmunoResearch) and Alexa-647 (goat anti-mouse, Jackson ImmunoResearch) were used at a concentration of 1:200 and incubated at room temperature for 2 h. Larvae were finally mounted in Vectashield. For staining of Drosophila S2R+ cells, cells were transferred to the poly-lysine pre-treated 8-well chambers (Ibidi) at the density of 2 × 105 cells/well. After 30 min, cells were washed with 1× DPBS (Gibco), fixed with 4% formaldehyde for 10 min and permeabilized with PBST (0.2% Triton X-100 in PBS) for 15 min. Cells were incubated with mouse anti-Myc (1:2000; #9E10, Enzo) in PBST supplemented with 10% of donkey serum at 4 °C, overnight. Cells were washed 3× for 15 min in PBST and then incubated with secondary antibody and 1× DAPI solution in PBST supplemented with 10% of donkey serum for 2 h at 4 °C. After three 15 min washes in PBST, cells were imaged with Leica SP5 confocal microscope using ×63 oil immersion objective. Images from muscles 6–7 (segment A3) were acquired with a Leica Confocal Microscope SP5. Serial optical sections at 512 × 512 or 1,024 × 1,024 pixels were obtained at 0.38 μm with the ×63 objective. Different genotypes were processed simultaneously and imaged using identical confocal acquisition parameters for comparison. Bouton number was quantified in larval abdominal segment A3, muscles 6 and 7, of wandering third instar larvae. ImageJ software (version 1.49) was used to measure the area of the synaptotagmin-positive area. Drosophila S2R+ cells were grown in Schneider`s medium (Gibco) supplemented with 10% FBS (Sigma) and 1% penicillin–streptomycin (Sigma). For RNA interference (RNAi) experiments, PCR templates for the dsRNA were prepared using T7 megascript Kit (NEB). dsRNA against bacterial β-galactosidase gene (lacZ) was used as a control for all RNA interference (RNAi) experiments. S2R+ cells were seeded at the density of 106 cells/ml in serum-free medium and 7.5 μg of dsRNA was added to 106 cells. After 6 h of cell starvation, serum supplemented medium was added to the cells. dsRNA treatment was repeated after 48 and 96 h and cells were collected 24 h after the last treatment. Effectene (Qiagen) was used to transfect vector constructs in all overexpression experiments following the manufacturer`s protocol. For the co-immunoprecipitation assay, different combinations of vectors with indicated tags were co-transfected in S2R+ cells seeded in a 10 cm cell culture dish as described earlier. Forty-eight hours after transfection cells were collected, washed with DPBS and pelleted by 10 min centrifugation at 400g. The cell pellet was lysed in 1 ml of lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% NP-40) supplemented with protease inhibitors (1 μg/ml leupeptin, 1 μg/ml pepstatin, 1 μg/ml aprotinin and 1 mM PMSF) and rotated head-over-tail for 30 min at 4 °C. Nuclei were collected by 10 min centrifugation at 1,000g at 4 °C re-suspended in 300 μl of lysis buffer and sonicated with 5 cycles of 30 s ON, 30 s OFF low power setting. Cytoplasmic and nuclear fractions were joined and centrifuged at 18,000g for 10 min at 4 °C to remove the remaining cell debris. Protein concentrations were determined using Bradford reagent (BioRad). For immunoprecipitation, 2 mg of proteins were incubated with 7 μl of anti-Myc antibody coupled to magnetic beads (Cell Signaling) in lysis buffer and rotated head-over-tail overnight at 4 °C. The beads were washed 3 times for 15 min with lysis buffer and immunoprecipitated proteins were eluted by incubation in 1× NuPAGE LDS buffer (ThermoFischer) at 70 °C for 10 min. Eluted immunoprecipitated proteins were removed from the beads and DTT was added to 10% final volume. Immunoprecipitated proteins and input samples were analysed by western blot after incubation at 70 °C for additional 10 min. For western blot analysis, proteins were separated on 7% SDS–PAGE gel and transferred on Nitrocellulose membrane (BioRad). After blocking with 5% milk in PBST (0.05% Tween in PBS) for 1 h at room temperature, the membrane was incubated with primary antibody in blocking solution overnight at 4 °C. Primary antibodies used were: mouse anti-Myc 1:2,000 (#9E10, Enzo); mouse anti-HA 1:1,000 (#16B12, COVANCE); mouse anti-Tubulin 1:2,000 (#903401, Biolegend); guinea pig anti-Ime4 1:500 and rabbit anti-dMettl14 1:250. The membrane was washed 3 times in PBST for 15 min and incubated 1 h at room temperature with secondary antibody in blocking solution. Protein bands were detected using SuperSignal West Pico Chemiluminescent Substrate (Thermo Scientific). S2R+ cells were transfected with either Myc–YT521-B of Myc–GFP constructs. Forty-eight hours after transfection cells were collected, washed with PBS and pelleted by centrifugation at 400g for 10 min. The cell pellet was lysed and processed in 1 ml of pull-down lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 2 mM EDTA, 0.5% Triton-X100, 0.5 mM DTT). For individual pull-down, 1.5 mg of protein were incubated with either 3 μg of biotinylated RNA probe of bPRL containing m6A or not, or without probe, as a control in 0.5 ml of pull-down buffer supplemented with protease inhibitor mix and 10 U of Murine RNase Inhibitor (NEB) and incubated for 2 h at 4 °C. Five microlitres of Streptavidin beads (M-280, Invitrogen) were added and pull-down samples were incubated for an additional 1 h at 4 °C. After 3 washes of 15 min with pull-down buffer, beads were re-suspended in 400 μl of pull-down buffer. One-hundred microlitres was were used for RNA isolation and dot blot analysis of recovered RNA probes with anti Strep-HRP. The remaining 300 μl of the beads was collected on the magnetic rack and immunoprecipitated proteins were eluted by incubation in 1× SDS buffer (ThermoFischer) at 95 °C for 10 min. Immunoprecipitated proteins as well as input samples were analysed by western blot. Serial dilutions of biotinylated RNA probe of bPRL containing m6A or A were spotted and crosslinked on nitrocellulose membrane (Biorad) with ultraviolet 245 light (3 × 150 mJ/cm2). RNA loading was validated with methylene blue staining. Membranes were blocked with 5% milk in PBST for 1 h at room temperature and washed in PBST before incubation with the proteins of interest. S2R+ cells were transfected with either Myc–YT521-B or Myc–GFP constructs. Forty-eight hours after transfection cells were collected, washed with PBS and pelleted by centrifugation at 400g for 10 min. The cell pellet was lysed in 1 ml of lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.5% NP-40). Three milligrams of the protein lysate were mixed with 2% BSA in lysis buffer and incubated with the membrane overnight at 4 °C. For control dot-blot rabbit anti-m6A antibody (Synaptic Systems) was used. The next day membranes were washed 3 times in lysis buffer. Membranes with bound proteins were further crosslinked with ultraviolet 245 light (3 × 150 mJ/cm2) and analysed using anti-Myc antibody. For SILAC experiments, S2R+ cells were grown in Schneider medium (Dundee Cell) supplemented with either heavy (Arg8, Lys8) or light amino acids (Arg0, Lys0) (Sigma). For the forward experiment, Myc–YT521-B was transfected in heavy-labelled cells and Myc-alone in light-labelled cells. The reverse experiment was performed vice versa. The co-immunoprecipitation experiment was done as described earlier. Before elution, beads of the heavy and light lysates were combined in 1:1 ratio and eluted with 1× NuPAGE LDS buffer that was subject to MS analysis as described previously48. Raw files were processed with MaxQuant (version 1.5.2.8) and searched against the Uniprot database of annotated Drosophila proteins (Drosophila melanogaster: 41,850 entries, downloaded 8 January 2015). mRNA samples from S2R+ cells depleted for the indicated proteins or from Drosophila staging experiments were prepared following the aforementioned procedure. Three-hundred nanograms of purified mRNA was further digested using 0.3 U Nuclease P1 from Penicillum citrinum (Sigma-Aldrich, Steinheim, Germany) and 0.1 U Snake venom phosphodiesterase from Crotalus adamanteus (Worthington, Lakewood, USA). RNA and enzymes were incubated in 25 mM ammonium acetate, pH 5, supplemented with 20 μM zinc chloride for 2 h at 37 °C. Remaining phosphates were removed by 1 U FastAP (Thermo Scientific, St Leon-Roth, Germany) in a 1 h incubation at 37 °C in the manufacturer supplied buffer. The resulting nucleoside mix was then spiked with 13C stable isotope labelled nucleoside mix from Escherichia coli RNA as an internal standard (SIL-IS) to a final concentration of 6 ng/μl for the sample RNA and 10 ng/μl for the SIL-IS. For analysis, 10 μl of the before mentioned mixture were injected into the LC–MS/MS machine. Generation of technical triplicates was obligatory. All mRNA samples were analysed in biological triplicates, except for the ctr, nito, vir, hrb27C and qkr58E-1 knockdown samples, which were measured as biological duplicates. LC separation was performed on an Agilent 1200 series instrument, using 5 mM ammonium acetate buffer as solvent A and acetonitrile as buffer B. Each run started with 100% buffer A, which was decreased to 92% within 10 min. Solvent A was further reduced to 60% within another 10 min. Until minute 23 of the run, solvent A was increased to 100% again and kept at 100% for 7 min to re-equilibrate the column (Synergi Fusion, 4 μM particle size, 80 Å pore size, 250 × 2.0 mm, Phenomenex, Aschaffenburg, Germany). The ultraviolet signal at 254 nm was recorded via a DAD detector to monitor the main nucleosides. MS/MS was then conducted on the coupled Agilent 6460 Triple Quadrupole (QQQ) mass spectrometer equipped with an Agilent JetStream ESI source which was set to the following parameters: gas temperature, 350 °C; gas flow, 8 l/min; nebulizer pressure, 50 psi; sheath gas temperature, 350 °C; sheath gas flow, 12 l/min; and capillary voltage, 3,000 V. To analyse the mass transitions of the unlabelled m6A and all 13C m6A simultaneously, we used the dynamic multiple reaction monitoring mode. Mass transitions, retention times and QQQ parameters are listed in Supplementary Table 10. The quantification was conducted as described previously49. Briefly, the amount of adenosine was evaluated by the external linear calibration of the area under the curve (AUC) of the ultraviolet signal. The amount of modification was calculated by linear calibration of the SIL-IS in relation to m6A nucleoside. The R2 of both calibrations was at least 0.998 (see Extended Data Fig. 1a, b). Knowing both amounts, the percentage of m6A/A could be determined. MeRIP was performed using the previously described protocol50 with the following modifications. Eight micrograms of purified mRNA from Drosophila S2R+ cells was incubated with 5 μg of anti-m6A antibody (Synaptic Systems) in MeRIP buffer (150 mM NaCl, 10 mM Tris-HCl pH 7.4, 0.1% NP-40) supplemented with 5 U/ml of Murine RNase inhibitor (NEB) for 2 h at 4 °C. In control MeRIP experiment, no antibody was used in the reaction mixture. Five microlitres of A+G magnetic beads were added to all MeRIP samples for 1 h at 4 °C. On bead digestion with RNase T1 (Thermo Fisher) at final concentration 0.1 U/ml was performed for 15 min at room temperature. Beads with captured RNA fragments were then immediately washed 3 times with 500 μl of ice-cold MeRIP buffer and further eluted with 100 μl of elution buffer (0.02 M DTT, 150 mM NaCl, 50 mM Tris-HCl pH 7.4, 1 mM EDTA, 0.1% SDS, 5 U/ml Proteinase K) at 42 °C for 5 min. Elution step was repeated 4 times and 500 μl of acidic phenol/chloroform pH 4.5 (Ambion) was added to 400 μl of the combined eluate per sample to extract captured RNA fragments. Samples were mixed and transferred to Phase Lock Gel Heavy tubes (5Prime) and centrifuged for 5 min at 12,000g. Aqueous phase was precipitated overnight, −80 °C. On the following day, samples were centrifuged, washed twice with 80% EtOH and re-suspended in 10 μl of RNase-free H O (Ambion). Recovered RNA was analysed on RNA Pico Chip (Agilent) and concentrations were determined with RNA HS Qubit reagents. Since no RNA was recovered in the MeRIP control samples, libraries were prepared with 30 ng of duplicate MeRIPs and duplicate input mRNA samples. MeRIP-qPCR was performed on the fraction of eluted immunoprecipitated RNA and an equal amount of input mRNA. cDNA for RT–qPCR was prepared using M-MLV Reverse Transcriptase (Promega) and transcript levels were quantified using Power SYBR Green PCR Master Mix (Invitrogen) using oligonucleotides indicated in Supplementary Table 9. For lifespan assay, 2–3-day-old flies were gender-separated and kept at 25 °C in flasks with apple juice medium (<20 flies/tube). Number of flies tested: females (37, Ime4Δcat/Ime4Δcat; 57, Tubulin-GAL4/UAS-Ime4); males (33, Ime4Δcat/Ime4Δcat; 41, Tubulin-GAL4/UAS-Ime4). To monitor their survival rate over time, flies were counted and transferred into a new tube every 2 days. Behavioural tests were performed on 2–5-day-old females with Canton-S as wild-type control. Wings were cut under cold anaesthesia to one-third of their length on the evening before the experiment. Walking and orientation behaviour was analysed using Buridan’s paradigm as described36. Dark vertical stripes of 12° horizontal viewing angle were shown on opposite sides of an 85-mm diameter platform surrounded by water. The following parameters were extracted by a video-tracking system (5 Hz sampling rate): total fraction of time spent walking (activity), mean walking speed taken from all transitions of a fly between the visual objects, and number of transitions between the two stripes. The visual orientation capacity (mean angular deviation) of the flies was assessed by comparing all 0.2-s path increments per fly (4,500 values in 15 min) to the respective direct path towards the angular-wise closer of the two dark stripes. All statistical groups were tested for normal distribution with the Shapiro–Wilk test. Multiple comparisons were performed using the Kruskal–Wallis ANOVA or one-way ANOVA with a post-hoc Bonferroni correction. n = 15 for all genotypes. The sample size was chosen based on a previous study51 and its power was validated with result analysis. Blinding was applied during the experiment. For samples from S2R+ cells and for full fly RNA samples, Ilumina TruSeq Sequencing Kit (Illumina) was used. For Drosophila head samples, NEBNext Ultra Directional RNA Kit (NEB) was used. Libraries were prepared following the manufacturer`s protocol and sequenced on Illumina HiSeq 2500. The read-length was 71 bp paired end. For MeRIP, NEBNext Ultra Directional Kit was used omitting the RNA fragmentation step for recovered MeRIP samples and following the manufacturer’s protocol for input samples. Libraries were sequenced on an Illumina MiSeq as 68 bp single read in one pool on two flow cells. The RNA-seq data was mapped against the Drosophila genome assembly BDGP6 (Ensembl release 79) using STAR52 (version 2.4.0). After mapping, the bam files were filtered for secondary alignments using samtools (version 1.2). Reads on genes were counted using htseq-count (version 0.6.1p1). After read counting, differential expression analysis was done between conditions using DESeq2 (version 1.6.3) and filtered for a false discovery rate (FDR) < 5%. Differential splicing analysis was performed using rMATS (3.0.9) and filtered for FDR < 10%. The data from fly heads were treated as above but cleaned for mitochondrial and rRNA reads after mapping before further processing. The sample Ime4hom_3 was excluded as an outlier from differential expression analysis. The MeRIP-seq data were processed following the same protocol as the RNA samples for mapping and filtering of the mapped reads. After mapping, peaks were called using MACS (version 1.4.1)53. The genome size used for the MACS was adjusted to reflect the mappable transcriptome size based on Ensembl-annotated genes (Ensembl release 79). After peak calling, peaks were split into subpeaks using PeakSplitter (version 1.0, http://www.ebi.ac.uk/research/bertone/software). Consensus peaks were obtained by intersecting subpeaks of both replicates (using BEDTools, version 2.25.0). For each consensus peak, the coverage was calculated as counts per million (CPM) for each of the samples and averaged for input and MeRIP samples. Fold changes for MeRIP over input were calculated based on these. Peaks were filtered for a minimal fold change of 1.3 and a minimal coverage of 3 CPM in at least one of the samples. Peaks were annotated using the ChIPseeker and the GenomicFeatures package (based on R/Bioconductor)54. In the Buridan paradigm, normality was tested for every dataset; different tests were used depending on the outcome. For not normally distributed data, Kruskal–Wallis test and Wilcoxon test were used. For normally distributed data, Bartlett test was applied to check for homogeneity of variances. ANOVA and t-test were used. Bonferroni corrections were applied. For climbing assays, normality was tested for every dataset. Homogeneity of variances were analysed with Levene’s test. One-way ANOVA test with Tukey’s post-hoc test was performed for multiple comparisons and Student’s t-test when two data sets were compared. For m6A level measurement, normality was tested for every dataset. Homogeneity of variances were analysed with Levene’s test. One-way ANOVA test with Tukey’s post-hoc test was performed for multiple comparisons. Randomization was used for selection of female flies of chosen genotype for climbing tests, Buridan paradigm and RNA sequencing experiments. Randomized complete block design was applied to ensure the equal number of flies per test group. Complete randomization was applied for selection of larvae or flies of the chosen genotype for lifespan assay and NMJ staining experiment. The data that support the findings of this study have been deposited in the NCBI Gene Expression Omnibus (GEO) under accession number GSE79297. All other relevant data are available from the corresponding author.


News Article | November 21, 2016
Site: www.newsmaker.com.au

Notes: Sales, means the sales volume of Alkaline Phosphatase Kit Revenue, means the sales value of Alkaline Phosphatase Kit This report studies sales (consumption) of Alkaline Phosphatase Kit in Global market, especially in United States, China, Europe, Japan, focuses on top players in these regions/countries, with sales, price, revenue and market share for each player in these regions, covering Interlab Srl GeneTex Stemgent EMD Millipore Corporation Formosa Biomedical Technology BioVision Abcam Eurogentec AnaSpec Arrayit Corporation ScienCell Research Laboratories Beyotime BioAssay Systems Market Segment by Regions, this report splits Global into several key Regions, with sales (consumption), revenue, market share and growth rate of Alkaline Phosphatase Kit in these regions, from 2011 to 2021 (forecast), like United States China Europe Japan Split by product Types, with sales, revenue, price and gross margin, market share and growth rate of each type, can be divided into Type I Type II Type III Split by applications, this report focuses on sales, market share and growth rate of Alkaline Phosphatase Kit in each application, can be divided into Application 1 Application 2 Application 3 Global Alkaline Phosphatase Kit Sales Market Report 2016 1 Alkaline Phosphatase Kit Overview 1.1 Product Overview and Scope of Alkaline Phosphatase Kit 1.2 Classification of Alkaline Phosphatase Kit 1.2.1 Type I 1.2.2 Type II 1.2.3 Type III 1.3 Application of Alkaline Phosphatase Kit 1.3.1 Application 1 1.3.2 Application 2 1.3.3 Application 3 1.4 Alkaline Phosphatase Kit Market by Regions 1.4.1 United States Status and Prospect (2011-2021) 1.4.2 China Status and Prospect (2011-2021) 1.4.3 Europe Status and Prospect (2011-2021) 1.4.4 Japan Status and Prospect (2011-2021) 1.5 Global Market Size (Value and Volume) of Alkaline Phosphatase Kit (2011-2021) 1.5.1 Global Alkaline Phosphatase Kit Sales and Growth Rate (2011-2021) 1.5.2 Global Alkaline Phosphatase Kit Revenue and Growth Rate (2011-2021) 2 Global Alkaline Phosphatase Kit Competition by Manufacturers, Type and Application 2.1 Global Alkaline Phosphatase Kit Market Competition by Manufacturers 2.1.1 Global Alkaline Phosphatase Kit Sales and Market Share of Key Manufacturers (2011-2016) 2.1.2 Global Alkaline Phosphatase Kit Revenue and Share by Manufacturers (2011-2016) 2.2 Global Alkaline Phosphatase Kit (Volume and Value) by Type 2.2.1 Global Alkaline Phosphatase Kit Sales and Market Share by Type (2011-2016) 2.2.2 Global Alkaline Phosphatase Kit Revenue and Market Share by Type (2011-2016) 2.3 Global Alkaline Phosphatase Kit (Volume and Value) by Regions 2.3.1 Global Alkaline Phosphatase Kit Sales and Market Share by Regions (2011-2016) 2.3.2 Global Alkaline Phosphatase Kit Revenue and Market Share by Regions (2011-2016) 2.4 Global Alkaline Phosphatase Kit (Volume) by Application Figure Picture of Alkaline Phosphatase Kit Table Classification of Alkaline Phosphatase Kit Figure Global Sales Market Share of Alkaline Phosphatase Kit by Type in 2015 Figure Type I Picture Figure Type II Picture Table Applications of Alkaline Phosphatase Kit Figure Global Sales Market Share of Alkaline Phosphatase Kit by Application in 2015 Figure Application 1 Examples Figure Application 2 Examples Figure United States Alkaline Phosphatase Kit Revenue and Growth Rate (2011-2021) Figure China Alkaline Phosphatase Kit Revenue and Growth Rate (2011-2021) Figure Europe Alkaline Phosphatase Kit Revenue and Growth Rate (2011-2021) Figure Japan Alkaline Phosphatase Kit Revenue and Growth Rate (2011-2021) Figure Global Alkaline Phosphatase Kit Sales and Growth Rate (2011-2021) Figure Global Alkaline Phosphatase Kit Revenue and Growth Rate (2011-2021) Table Global Alkaline Phosphatase Kit Sales of Key Manufacturers (2011-2016) Table Global Alkaline Phosphatase Kit Sales Share by Manufacturers (2011-2016) Figure 2015 Alkaline Phosphatase Kit Sales Share by Manufacturers Figure 2016 Alkaline Phosphatase Kit Sales Share by Manufacturers Table Global Alkaline Phosphatase Kit Revenue by Manufacturers (2011-2016) Table Global Alkaline Phosphatase Kit Revenue Share by Manufacturers (2011-2016) Table 2015 Global Alkaline Phosphatase Kit Revenue Share by Manufacturers Table 2016 Global Alkaline Phosphatase Kit Revenue Share by Manufacturers Table Global Alkaline Phosphatase Kit Sales and Market Share by Type (2011-2016) Table Global Alkaline Phosphatase Kit Sales Share by Type (2011-2016) Figure Sales Market Share of Alkaline Phosphatase Kit by Type (2011-2016) Figure Global Alkaline Phosphatase Kit Sales Growth Rate by Type (2011-2016) Table Global Alkaline Phosphatase Kit Revenue and Market Share by Type (2011-2016) Table Global Alkaline Phosphatase Kit Revenue Share by Type (2011-2016) Figure Revenue Market Share of Alkaline Phosphatase Kit by Type (2011-2016) Figure Global Alkaline Phosphatase Kit Revenue Growth Rate by Type (2011-2016) Table Global Alkaline Phosphatase Kit Sales and Market Share by Regions (2011-2016) Table Global Alkaline Phosphatase Kit Sales Share by Regions (2011-2016) Figure Sales Market Share of Alkaline Phosphatase Kit by Regions (2011-2016) Figure Global Alkaline Phosphatase Kit Sales Growth Rate by Regions (2011-2016) Table Global Alkaline Phosphatase Kit Revenue and Market Share by Regions (2011-2016) …. CONTINUED FOR ANY QUERY, REACH US @     Alkaline Phosphatase Kit Sales Global Market Research Report 2016


Patent
French National Center for Scientific Research, Lille University of Science, Technology and Eurogentec | Date: 2011-05-25

The invention concerns a conjugate of formula A-X-B, wherein:- A is a peptide tag molecule of known molecular weight,- X is a linker that is cleaved during sample desorption/ionization, and- B is an antibody that binds specifically to said target molecule,and wherein said conjugate is of formula: The invention also relates to a method for determining at least one target peptide, protein, antigen or hapten map in a tissue section, comprising the use of the conjugate.


Patent
French National Center for Scientific Research, Lille University of Science, Technology and Eurogentec | Date: 2011-05-18

The invention relates to a method for determining at least one target molecule map in a tissue section, comprising : a) hybridizing said tissue section with at least one (A-X)_(n)-B conjugate, wherein A is a tag molecule of known molecular weight, X is a linker that is cleaved by fragmentation during sample desorption/ionization, n is an integer of at least 1, B is a binding molecule that binds specifically to said target molecule, and each distinct B molecule is linked to a distinct A tag molecule; b) scanning the tissue section surface and analyzing each adjacent spot with a mass spectrometer, wherein said linker X is cleaved by fragmentation during sample desorption/ionization, and wherein the resulting data of each spot is saved; and c) analyzing the obtained data in the molecular mass window(s) of each distinct tag molecule to create as many maps of the tissue section as the number of distinct studied target molecules.


Patent
French National Center for Scientific Research, Lille University of Science, Technology and Eurogentec | Date: 2011-05-18

The invention concerns a modified base of formula:_(n)-B, wherein A is a peptide tag molecule of known molecular weight, X is a linker that is cleaved during sample desorption/ionization, n is an integer superior to 1 and B is a nucleic acid probe with a sequence complementary to a target mRNA molecule, wherein the nucleic acid probe comprises at least one modified base according ot the invention. The invention further relates to a method for determining at least one target mRNA molecule map in a tissue section, comprising the use of the conjugate.

Loading Eurogentec collaborators
Loading Eurogentec collaborators