Time filter

Source Type

News Article | October 28, 2015
Site: www.nature.com

Overall, this project comprised tumour samples from 217 German patients with neuroblastoma (Extended Data Table 1a). Patients were diagnosed between 1991 and 2014 and were registered and treated according to several clinical trials of the Gesellschaft für Pädiatrische Onkologie und Hämatologie. The trials were approved by the Ethics Committee of the Medical Faculty, University of Cologne. The Institutional Review Board approved collection and use of all specimens in this study. Informed consent was obtained from all patients. The MYCN gene copy number was determined as a routine diagnostic method using FISH analysis. DNA and total RNA was isolated from tumour samples with at least 60% tumour cell content as evaluated by a pathologist. TERT rearrangements were established as a novel molecular marker in a discovery cohort of 56 patients. In this set, TERT rearrangements (n = 12) occurred exclusively in high-risk patients (n = 39). We sought to validate this finding in a larger, representative neuroblastoma cohort, comprising approximately 40% high-risk patients. Allowing for a potential occurrence of TERT rearrangements in up to 10% of non-high-risk patients and ensuring a statistical power of 80%, we estimated that at least 75 non-high-risk patients were required for validation. We therefore investigated 161 additional tumours derived from 86 non-high-risk and 75 high-risk patients (including 39 and 36 tumours with and without MYCN amplification, respectively). The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. Neuroblastoma cell lines LAN-6, GI-ME-N, as well as SK-N-FI were directly purchased from the Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany) or American Type Culture Collection (ATCC/LGC Standards, Molsheim Cedex, France), respectively. Furthermore, SK-N-BE(2)C, IMR-5/75, and CLB-GA were provided by the laboratories of H. Deubzer, F. Westermann and J. H. Schulte, respectively. All cell lines not directly purchased from ATCC or DSMZ were authenticated by STR profiling at the DSMZ. IMR-5/75, SK-N-BE(2)C, GI-ME-N, and CLB-GA were grown in RPMI1640 with 10% FBS; LAN-6 and SK-N-FI were cultured in DMEM with 20% FBS. All cell lines were cultured without antibiotics and routinely tested negative for mycoplasma. DNA was extracted from fresh-frozen tumour tissue and the corresponding matched normal of 56 patients using the Puregene Core Kit A (Qiagen) and NucleoSpin Blood DNA extraction kit (Macherey-Nagel), respectively, according to the manufacturers’ instructions. DNA was eluted in 1 × TE buffer, diluted to a working concentration of 100 ng µl−1 and stored at −80 °C. Libraries were prepared with the TruSeq DNA PCR-free sample preparation kit (Illumina) followed by size selection using SPRI beads (Beckman Coulter Genomics). The final libraries were then sequenced on an Illumina HiSeq 2000 instrument with a paired-end read length of 2 × 100 nucleotides. Raw sequencing reads were aligned to the human genome (NCBI build 37/hg19) by using BWA (version 0.6.1-r104; https://github.com/lh3/bwa). Possible PCR duplicates were then masked in the resulting alignment files by searching for concordant read pairs. Next, somatic mutations were called using a further development of our in-house mutation caller. The major improvements to previous versions25 of the caller were that identified variants were filtered against a library of more than 500 normals (mixed whole-exome and whole-genome) and that the error model contained contributions of human library contamination which were estimated from the sequencing data. With these modifications we were able to gain a larger sensitivity and specificity (data not shown). Rearrangements as well as copy number changes were analysed as described previously25. Patterns of recurrent genomic rearrangements were identified by scanning the genomes for breakpoint clusters that occur within 100 kb regions in a similar approach to that described in ref. 7. To compute the telomere ratio from whole-genome sequencing data, raw sequencing reads containing the telomere repeat sequence (TTAGGG) or its reverse complement were counted5, and the ratio between the tumour and matched normal was determined. This ratio was then normalized to the absolute amount of sequenced DNA using the total amount of reads from the tumour and the normal. In the validation cohort, hybrid-capture-based target enrichment followed by massively parallel sequencing of the genomic region encompassing TERT and CLPTM1L was used to detect TERT rearrangements. Alignment and the detection of genomic rearrangements were performed analogous to whole-genome sequencing. We reported only those TERT rearrangements that had been detected both by FISH analysis and by targeted sequencing. RNA sequencing and gene expression analysis was performed as described previously26. Briefly, a Dynabeads mRNA Purification Kit (Invitrogen) was used to purify mRNA from total RNA. Library construction was performed according to the standard TruSeq protocol. Clusters were generated according to the TruSeq PE cluster Kit version 3 reagent preparation guide (for cBot-HiSeq/HiScanSQ). High-throughput shotgun sequencing was performed on the IlluminaHiSeq 2000 platform. Paired-end reads with lengths of 100 nucleotides were generated. Raw data processing, read mapping, and gene expression quantification were done using the Magic-AceView analysis pipeline as described27. The Magic analysis tool is accessible at ftp://ftp.ncbi.nlm.nih.gov/repository/acedb/Software/Magic; AceView served as primary transcriptome reference (http://www.aceview.org). RNA sequencing was also used to identify MYCN-regulated genes in IMR5/75 cells expressing MYCN shRNA under the control of the tet repressor. Briefly, for IMR5/75 shRNA inducible cells, 1 µg ml−1 tetracycline or the equivalent of volume of 70% ethanol was added to the cells, and cells were incubated for 24 h and then harvested for RNA extraction using RNeasy mini kit (Qiagen). Five micrograms of RNA from each sample was processed using the RiboGold kit (Epicentre) to remove rRNA from samples to increase reads from mRNA. The concentration of the resulting RNA was measured using the Qubit RNA assay (Life Technologies). One microgram of RNA was then used to prepare libraries for sequencing using the NEB Ultra directional RNA library prep lit for Illumina (New England Bioscience) according to the manufacturer’s instructions. Single-colour gene expression profiles were generated using customized 4×44 K oligonucleotide microarrays produced by Agilent Technologies. Labelling and hybridization was performed following the manufacturer’s protocol. Microarray expression profiles were generated using Agilent’s Feature Extraction software (version 9.5.1). Data were normalized using quantile normalization. Rearrangements of the TERT locus were validated by dideoxy sequencing in both diagnostic and relapsed tumour samples. Dideoxy sequencing was performed by Seqlab. BAC clones CTD-2191M2 (to detect the region proximal of CLPTM1L) and CTD-2511M20 (to detect the TERT/SLC6A18/SLC6A19 loci) were labelled with digoxigenin and biotin, respectively (see also Fig. 3a). Cell line cytospin preparations were pre-treated with 2 × SSC solution at 37 °C for 30 min, digested with Digest-All III (dilution 1:2, Invitrogen) at 37 °C for 6 min, fixed in 4% formaldehyde, and subsequently dehydrated in a graded ethanol series. FISH probes and human Cot-1 DNA (Life Technologies) in hybridization buffer (50% formamide, 10% dextran sulfate sodium, in 2 × SSC) were co-denatured at 85 °C for 4 min and hybridized overnight at 37 °C. Post-hybridization washing was done with 0.5 × SSC at 75 °C for 5 min, followed by washes in PBS, a blocking step with CAS-block (Life Technologies, with 10% normal goat serum in PBS) and a 1 h post-incubation with streptavidin–Alexa-555 conjugates (1:500, Life Technologies) and anti-digoxigenin-FITC (1:500, Roche), to enable fluorescence detection. After three subsequent washes in PBS, samples were mounted with VectaShield mounting media containing 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI; Vectorlabs). Images were acquired using an Olympus Fluoview FV10 scanning confocal microscope system. Telomerase activity in cell lines was determined with a PCR-based telomeric repeat amplification protocol (TRAP) enzyme-linked immunosorbent assay (ELISA) kit (TeloTAGGG Telomerase PCR ELISAPLUS, Roche) according to the manufacturer’s protocol. Formaldehyde cross-linking of cells, cell lysis, sonication, ChIP procedure, and library preparation were performed as described previously28, starting with approximately 4 × 106 cells (1 × 106 cells per individual immunoprecipitation). Direct cell lysis for each sample was achieved by incubation for 30 min in 950 µl RIPA I on ice (10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0, 140 mM NaCl, 0.2% SDS, 0.1% DOC). Tissue disruption, formaldehyde fixation, and sonication of tumour material were done according to a previously published protocol29. Approximately 30 mg of fresh-frozen tumour tissue was used per individual ChIP-seq experiment. All subsequent steps were performed analogous to cell line experiments. The Bioruptor Plus sonication device (Diagenode) was used for high intensity sonication for 30–60 min each with intervals of 30 s on and 30 s off. Library preparation was performed using the NEBNext Ultra DNA Library Prep Kit (New England Biolabs) according to the manufacturer’s protocol. Samples were mixed in equal molar ratios and sequenced on an Illumina sequencing platform. Single-end reads were aligned to the hg19 genome using Bowtie2 (version 2.1.0). Only uniquely aligned reads were kept. BAM files of aligned reads were further processed using the deepTools suite (https://github.com/fidelram/deepTools). Input files were subtracted from the treatment files using the bamCompare tool, applying the SES method for normalization of signal to noise. Resulting signals were normalized to an average 1× coverage to produce signal (bigWig) files. Peaks were called using the MACS 1.4 tool using default parameters. DNA was isolated from snap-frozen neuroblastoma tissue. Genome-wide DNA methylation was assessed using an Infinium HumanMethylation450 BeadChip (Illumina) according to the manufacturer’s instructions. Probes were removed on the basis of the following criteria: (1) proportion of non-detectable β values >0.3 (n = 379), (2) single nucleotide polymorphism at or near the targeted CpG site according to R-Forge package IMA (https://rforge.net/IMA/, n = 92,600), (3) control probes (n = 65), and (4) mapping to the X or Y chromosome (n = 10,351). Together, 382,182 probes were kept for further analysis. The k-nearest neighbours method was used to impute missing values, and a subset quantile normalization was applied. TERT-related CpGs were annotated using the assignGenomeAnnotation program of the HOMER tool suite (http://homer.salk.edu/homer). Both assays have been performed as described previously21. Briefly, genomic DNA was purified and digested with AluI and MboI. For restriction-fragment analysis, 10 μg of digested DNA was electrophoresed on a 0.8% TBE-agarose gel. Subsequently, telomeric DNA was detected by Southern blotting using a [32P]dATP end-labelled (CCCTAA) oligonucleotide probe. For the C-circle assay, DNA samples (7.5 ng, 10 µl) diluted in ultraclean water were combined with 10 μl BSA (NEB; 0.2 mg ml−1), 0.1% Tween, 0.2 mM each dATP, dGTP, dTTP, and 1 × Φ29 Buffer (NEB) in the presence or absence of 7.5 U ΦDNA polymerase (NEB), incubated at 30 °C for 8 h and then at 65 °C for 20 min. Reaction products were diluted to 100 μl with 2 × SSC and dot-blotted onto a 2 × SSC-soaked nylon membrane. DNA was ultraviolet cross-linked onto the membrane and hybridized with a 32P-end-labelled (CCCTAA) oligonucleotide probe to detect C-circle amplification products. All blots were washed, exposed to PhosphoImager screens, scanned, and quantified using a Typhoon 9400 PhosphoImager (Amersham, GE Healthcare). Genomic DNA from ALT-positive (U2OS) cells served as positive control and reference for the quantification of C-circles detected in other cell lines. ALT-associated promyelocytic leukaemia (PML) bodies were visualized by a combination of immunofluorescence with an anti-PML antibody and FISH using Alexa-488-(TTAGGG)n PNA probes as described previously21. Tumours were sliced into 4 μm sections, paraffin fixed, embedded in formalin, and mounted onto positively charged glass microscope slides. Mounted sections were incubated for 30 min at 55 °C, washed three times for 5 min in xylene, rinsed in successive 100%, 95%, and 70% ethanol baths, and washed in double-distilled H O and 1% Tween before being placed in antigen unmasking solution in a boiling kitchen steam for 30 min. Next, slides were rinsed in double-distilled H O and dehydrated in successive ethanol washes of 70%, 95%, and 100%. Slides were incubated at 72 °C for 10 min with an Alexa-488 telomeric-C PNA probe and hybridized overnight in a dark humidity chamber. Slides were washed with PNA wash buffer and PBST and incubated for 10 min in DAPI solution. After washing in double-distilled H O, slides were mounted with prolong anti-fade mounting medium. Images were taken on a Nikon 90i fluorescent light microscope at ×63 resolution. Full z-stacks were taken at 0.5 μm and projected and focused using Elements software. SPSS (package release 20.0.0, IBM Armonk), R (version 3.1.2), and GraphPad Prism (version 6.05 GraphPad Software) were applied for statistical analyses and data presentation. Overall survival was calculated as the time from diagnosis to death from disease or the last follow-up if the patient survived. Event-free survival was calculated from diagnosis to the time of tumour progression, relapse, or death from disease, or to the last follow-up if no event occurred. Survival curves were estimated according to Kaplan–Meier and compared with the log-rank test (R survival package version 2.15.0). Associations of genomic alterations with clinical risk factors were examined using Fisher’s exact test. Multivariable Cox regression models were used to analyse the simultaneous prognostic impact of TERT rearrangements and established clinical markers (stage (1–3, 4S versus 4), MYCN (non-amplified versus amplified), and age (<18 months versus >18 months)) on overall survival and event-free survival. Since TERT rearrangements were observed only in patients aged >18 months in this study, multivariable model building was restricted to this cohort (n = 125) and the variables TERT status, stage, and MYCN status. First, the proportional hazard assumption was assessed for each predictor one-at-a-time using the goodness-of-fit test of ref. 30 showing no deviation from the proportional hazard assumption. The proportional hazard assumption was considered valid whenever the P value of the goodness-of-fit test was >0.05. In addition, predicted survival curves under the Cox model were compared with the Kaplan–Meier estimates for each predictor supporting adequateness of model fit. Multivariable models were then built using a backwards selection procedure including the variables TERT status, stage, and MYCN status (inclusion criterion, P value of the score test ≤0.05; exclusion criterion, P value of the likelihood ratio test >0.1). The variables identified at this step formed the model of main effects. Finally, the factors selected in the model of main effects were fitted with all pairwise interactions in a second block by a stepwise forward selection (inclusion criterion, P value of the score test ≤ 0.05; exclusion criterion, P value of the likelihood ratio test >0.1), resulting in the final model. For the final model, the proportional hazard assumption was assessed using the goodness-of-fit test of ref. 30 as well as by fitting extended Cox models including the prognostic factors from the final model in a first block and the product terms of the prognostic factors with some function of time g(t) in a second block with stepwise forward selection in the second block (inclusion criterion, P value of the score test ≤0.05; exclusion criterion, P value of the likelihood ratio test >0.1). Choices for g(t) were g(t) = t and g(t) = log(t) with t denoting survival time. The proportional hazard assumption was considered as valid if no time-dependent factor was selected in any of the extended Cox models and if, additionally, any P value of goodness-of-fit test was >0.05. Analyses of TERT expression levels and methylation between subgroups were investigated by Mann–Whitney tests and corrected for multiple hypotheses testing using a Bonferroni correction. To test for mutual exclusivity between TERT rearrangements (TERT), MYCN amplifications (MNA), and ATRX mutations (ATRX) in the high-risk group, Fisher’s exact tests were performed between every alteration and the combination of the remaining two alterations (TERT versus MNA and ATRX; MNA versus TERT and ATRX; ATRX versus TERT and MNA). The largest P value was finally reported.


News Article | December 23, 2015
Site: www.nature.com

pCMV-FGFR4 Gly388Δ-Venus, pCMV-FGFR4 Arg388Δ-Venus, pCMV-FGFR4 Gly388Δ-Venus-6×His and pCMV-FGFR4 Arg388Δ-Venus-6×His was constructed by PCR amplification of human FGFR4 (Gly388 variant and Arg388 variant) lacking cytoplasmic domains and inserted into mVenus-N1 between NheI and AgeI sites. The 6×His Tag constructs were generated by PCR-based generation of DNA cassettes ‘FGFR4 Gly388Δ-Venus-6×His’ and ‘FGFR4 Gly388Δ-Venus-6×His’ and inserted into mVenus-N1 between NheI and NotI sites. The following primers were used: hFGFR4-DEL-F, 5′-TCTGCTAGCGCCACCATGCGGCTGCTGCTGGCCCTGTT-3′, hFGFR4-DEL-R: 5′-AGAACCGGTGCGCCGTGGAGCGCCTGCCCTC-3′; YFP–HisTag-R, 5′-TCGCGGCCGCTTTAATGGTGATGGTGATGATGCTTGTACAGCTCGTCCATGCCGAGA-3′. STAT3–turquoise fusion protein encoding plasmid was constructed by cloning PCR-amplified STAT3 complementary DNA (cDNA) in frame between BglII and SacII sites in pTurquoise2-N1 plasmid. Membrane-targeting STAT3–turquoise fusion constructs were generated by cloning PCR-amplified STAT3 cDNA into pTurquoise2 between BglII and NotI sites. The following primers were used for constructing STAT3 membrane targeting plasmids: N-Memb-STAT3-F, 5′-TCTAGATCTCGCCACCATGGGCAGCTCCAAATCTAAACCAAAGGACCCTTCACAGAGGTCCGGACTCAGGTCTATGGCTCAGTGGAACCAGCT-3′; N-MyrMut-STAT3-F, 5′-TCTAGATCTCGCCACCATGGCCAGCTCCAAATCTAAACCAAAGGACCCTTCACAGAGGTCCGGACTCAGGTCTATGGCTCAGTGGAACCAGCT-3′; C-Memb-STAT3-R, 5′-TCTGCGGCCGCTCAGGAGAGCACACACTTGCAGCTCATGCAGCCGGGGCCACTCTCATCAGGAGGGTTCAGCTTAGACCTGAGTCCGGACTTGTACAGCTCGTCCATGC-3′; C-PalmMut-STAT3-R; 5′-TCTGCGGCCGCTCAGGAGAGCACACACTTGGAGCTCATGGAGCCGGGGCCACTCTCATCAGGAGGGTTCAGCTTAGACCTGAGTCCGGACTTGTACAGCTCGTCCATGC-3′; C-FarnMut-STAT3-R; 5′-TCTGCGGCCGCTCAGGAGAGCACACCCTTGCAGCTCATGCAGCCGGGGCCACTCTCATCAGGAGGGTTCAGCTTAGACCTGAGTCCGGACTTGTACAGCTCGTCCATGC-3′ Transposon-based plasmids, namely ITR-CAG–GFP–ITR and ITR-CAG-DrRed-ITR, were constructed by gateway cloning of GFP and DsRed coding sequence under CAG promoter. Transposase-encoding construct pCMV-SB100 was provided by M.-S. Supprian. The following plasmids were obtained from Addgene: mVenus-N1, mVenus-C1 and pBabe-puro-KRASV12. The following plasmids were gifted by J. Heuckmann: pBabe-puro-EV, pBabe-puro-EGFR-WT, pBabe-puro-EGFR-L858R, pBabe-puro-EGFR-DEL1. pCdna3-STAT3–YFP was provided by T. Berg. pBabe-puro-CRAF-BxB was provided by U. R. Rapp. Small-molecule chemical inhibitors used in this study were as follows: erlotinib (5083S, Cell Signaling), Tarceva (T007500, TRC), ruxolitinib (11609, Cayman Chemical Company), InSolution MEK1/2 Inhibitor III (444968, Calbiochem), InSolution JAK Inhbitor I (420097, Calbiochem), TGI101348 (S2736, Selleckchem), Stattic (S7947, Sigma-Aldrich), wortmanin (9951, Cell Signaling) and LY 294002 (1130, Tocris). Human primary breast epithelial cells and their corresponding culture media were purchased from Zen-Bio and genotyped using primers rs351855-Forw and rs351855-Rev as described in the DNA sequencing section. Lung-cancer cell lines used in this study were as follows: NCI-HCC15, NCI-H520, NCI-H23, NCI-H1944, NCI-H1299, HCC1833, NCI-H1568, NCI-H2126, NCI-H2882, NCI-H1792 and NCI-H358. All cell lines used were obtained from American Type Culture Collection (ATCC) except HCC1833, which was obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ) and authenticated in-house using a StemElite ID system (Promega, G9530). None of the cell lines used in this study were in the International Cell Line Authentication Committee list of currently known cross-contaminated or misidentified cell lines. Cell lines maintained by our cell bank staff are routinely controlled for mycoplasma contamination. The cell lines used in this study were confirmed to be free of any mycoplasma contamination. All of the experimental protocols were performed as per the Institutional Animal Care and Use Committee at the Max Planck Institute of Biochemistry ( www.biochem.mpg.de/en/facilities/animal) and all animal experiments were approved by the Institutional Review Board. In this paper, animal experiments involving breeding and killing for organ extraction came under ‘regular animal use’ as per the guidelines of Animal Protection Law 2013 (Upper Bavarian Government). All mice used for this study were raised in C57BL/6 background. Normal, healthy Fgfr4 knock-in mice used were aged 10 weeks. A knock-in mouse model for non-small-cell lung cancer was generated by breeding Fgfr4A/A and Fgfr4G/G mice with SPC-CRAF-BxB mice. SPC-Craf-BxB induce lung tumours in alveolar type II cells of the lung that can be analysed from 4 months onwards. Six-month-old mice were genotyped and killed for analyses. The knock-in mouse model for breast cancer was generated by breeding Fgfr4A/A and Fgfr4G/G mice with WAP-Tgfα mice as previously described18. Only female mice 3 months after pregnancy were analysed. Flow cytometry analyses involving cohorts of wild-type and risk-variant groups of mice were done by killing all the mice on the same day. The differences between the means of the wild-type and mutant groups were determined using an unpaired t-test. For pSTAT3 (Y705) expression analyses of tumour cells comparing wild-type and risk variant knock-in mice groups, each group consisted of at least five mice, matched for age and gender. All lung cancer and breast cancer mouse models used for tumour analyses were male and females respectively. Tumour-bearing mice were regularly monitored and killed before tumour burden affected their well-being. In the WAP-Tgfα transgenic mouse models for breast cancer, spontaneous tumours that arise in mammary pads are visible and measurable. As per our legal institute permit, the maximum tumour volume permitted in WAP-Tgfα mouse models of breast cancers was 1,500 mm3(single tumours); in none of our experiments were these limits exceeded. In the SPC-Craf-BxB transgenic mouse models for non-small-cell lung cancer, the spontaneous tumour in vivo does not permit measurement in live animals. However, loss of body weight is proportional to tumour burden. The maximum weight loss permitted as per our animal permit was 10% of the body weight. In none of our experiments with mouse models for lung cancer were these limits exceeded. Allele frequencies for rs2456173, rs1966265, rs376618, rs351855 and rs61737768 were compiled from the 1000 Genomes Project data set release 14 October 2013. MEFs were generated from E13.5 post-coitum embryos as previously described. In short, embryos from littermates of homozygous and heterozygous genotypes derived from heterozygote parents were separated from placenta and embryo sac. Head and red organs were dissected out and the remaining tissue was finely minced and passed through a cell strainer before washing them in PBS. Two weeks after cultivation, cells were immortalized using equal amounts of transposon-based SV40-T antigen-encoding plasmids. Cells were cultivated for at least a month before preparing frozen stocks and using for downstream experiments. Biotinylation of cell-surface proteins (biotinylation of extracellular exposed domains) in serum-starved knock-in MEFs followed by precipitation of avidin-bound proteins was achieved using cell-impermeable EZ-Link Sulfo-NHS-LC-Biotin (Pierce/Thermo Scientific, 21335) by following the manufacturer’s protocol. Briefly, at indicated time points after 10% FCS addition, MEFs were washed with ice-cold PBS (pH 8.0) to remove amine-containing media and proteins from cells. Sulfo-NHS-LC-Biotin reagent (2 mM) was added and incubated for varying time points on ice. Labelled cells were washed three times in PBS containing 100 mM glycine and pellets were lysed in lysis buffer and divided into two parts. One part was used for precipitation of biotinylated proteins and the other for probing the total cellular amounts of proteins. Biotinylated proteins were pulled down using Avidin beads (Pierce, 20219) and probed by immunoblot experiments. To stably express retroviral plasmids in MEFs, Phoenix-Ecotropic retroviral packaging cell lines were used. Two days after transfection using Lipofectamine 2000 (Life Science Technologies, 11668027), cell culture supernatants were centrifuged at 1,200 r.p.m (130g) for 3 min and filtered using a 0.45 μm filter. MEFs were transduced with retroviral particles containing supernatants using ViraDuctin Retrovirus Transduction Reagent (Cell Biolabs, RV200) as per the manufacturer’s protocol. Organs were extracted from indicated mice and lysed in 1× cell lysis buffer (Cell Signaling, 9803) using a tissue homogenizer (IKA T-18, Ultra Turrax). Lysates quantified by bichinchoninic acid (BCA) reagent (Pierce, 23225) for equal protein amounts were used the assay. Levels of phosphorylated STAT3 (Y705) in organ lysate was measuring using a PathScan Phospho-STAT3 (Y705) Sandwich ELISA kit (Cell Signaling, 7149C, 7149) as per the manufacturer’s instructions. The data in Fig. 4a represent the relative chemiluminescence light units. The measurements were repeated three times with the same animal lysates using a chemiluminescence kit (Cell Signaling Technology, 7149) and twice by measuring the absorbance of organ lysate preparations from additional mice (three mice per group) using a spectrophotometric kit (Cell Signaling Technology, 7300). The figure represents the data from one chemiluminescence-based measurement assay. Truncated human FGFR4 (1-397) fused in-frame to YFP–6×His was inserted into pEYFP (Clontech) vector and expressed in HEK293E-EBNA1 (MPI core facility) cell lines. Seventy-two hours after transfection, cells were lysed in binding buffer (20 mM sodium phosphate, 500 mM sodium chloride, 40 mM imidazole, 6 M urea, pH 7.4) containing PhosSTOP tablets (Roche, 04906837001). The lysate was treated with DNase (Thermo Scientific, EN0521) 20 μg ml−1 and Benzonase followed by sonication. The cell lysate was loaded on to HisTrap FF crude 5 ml column in binding buffer. Elution was done in a one-step procedure using elution buffer (20 mM sodium phosphate, 500 mM sodium chloride, 500 mM imidazole, urea, 6 M pH 7.4). Full-length C-term GFP-tagged human FGFR4 variants were purified using a Miltenyi Epitope-tagged protein isolation kit and adapted large-scale samples with a Midi-MACS column. Cells were grown overnight in ultraviolet-sterilized glass slides in culture dishes. After plating, cells were washed in PBS and fixed in 4% paraformaldehyde–PBS at room temperature (22–24 °C) for 15 min. Permeabilization was done in 0.2% Triton X-100 in PBS for 20 min. Primary antibodies were incubated overnight at 4 °C and secondary antibodies for 45 min at room temperature. Co-localization rate was calculated as the ratio of area of the co-localized fluorescence signals to an area of the image foreground. HEK293T cells were co-transfected with either pCMV-hFGFR4 Gly388–CFP and pCMV-STAT3–YFP or pCMV-hFGFR4 Arg388–YFP and pCMV-STAT3–CFP DNA in equal amounts by the method of reverse transfection in glass-bottomed culture dishes (35 mm high) (Ibidi, 81156). For FRET localization of STAT3 phosphorylation, pCMV-STAT3–turquoise, pCMV-N1-STAT3–turquoise, pCMV-N2-STAT3–turquoise, pCMV-STAT3–turquoise-C1, pCMV-STAT3–turquoise-C2 and pCMV-STAT3–turquoise-C3 constructs were used. Two days after transfection, imaging was performed either in a spinning disc confocal microscope (PerkinElmer UltraVIEW vox) or in an sp8 Leica confocal microscope at a controlled temperature of 37 °C and 5% CO conditions. For CFP images, the light path was set to excite the sample at 2% power from a 405 nm laser and emission was collected from 454 to 568 nm. For YFP images, the light path was set to excite the sample at 2% power from 516 to 621 nm. For positive control, CFP fused to YFP was cloned. After correcting for emission cross-talk and background intensity, the FRET/CFP ratio was calculated. Analyses were performed using an sp8 Leica TCS FRET sensitized emission application. FRET efficiency was calculated using the following method: where A, B, C correspond to the intensities of the three signals (donor, FRET, acceptor) and α, β, γ and δ are the calibration factors generated by acceptor only and donor only references. The ratiometric calculation E = B/A is used in samples with a fixed stoichiometry (1:1) of donor and acceptor. Intracellular calcium levels were measured using Fluo-4 Direct calcium assay reagent (Invitrogen, F10471). MEFs were detached using 1 mM EDTA and washed in PBS. Cells were incubated in serum-free medium containing Fluo-4 direct reagent 1× for 20 min and washed afterwards in PBS. The fluorescence signal was measured in a flow cytometer (FACS Calibur) using an argon laser at FL1 green channel. The relative levels of ADP and ATP were measured using an ApoSENSOR ADP/ATP Ratio Assay kit (BioVision, Cat K255-200) in the risk variant knock-in Fgfr4A/A MEFs, Fgfr4G/A heterozygous MEFs and wild-type counterpart Fgfr4G/G MEFs. MEFs were lysed in 1× cell lysis buffer (Cell Signaling, 9803) and total protein was estimated using BCA reagent (Pierce, 23225). Lysates quantified for same protein amount by BCA assay were mixed with equal amounts of nucleotide releasing buffer and incubated at room temperature for 5 min. To the prepared sample lysate, ATP monitoring enzyme was added to a volume of 10% of total volume. Luminescence indicating ATP level was measured after about 2 min in a luminometer (EG&G Berthold Technologies, LB96v). To measure the ADP level, ADP converting enzyme was added to 1% of total volume and the luminescence measured after about 2 min. Whole-cell lysates were prepared using 1× cell lysis buffer (Cell Signaling, 9803) containing cOmplete, mini, EDTA-free tablets (Roche 11836170001) and PhosSTOP tablets (Roche 04906837001). Equal concentrations (20–30 μg) were loaded after a (BCA) assay, were run out on 4–15% Mini-PROTEAN TGX Gels (Bio-Rad 456-1083) and subsequently transferred onto a nitrocellulose membrane. The blots were blocked in 1× NET-Gelatin buffer (1.5 M NaCl, 0.05 M EDTA, 0.5 M Tris pH 7.5, 0.5% Triton X-100 and 0.25 g ml−1 gelatin) and incubated with primary antibodies overnight at 4 °C. Fractions of cell membranes were prepared using a FOCUS Membrane Protein Kit (G Biosciencs, 786-249); cytoplasm and nucleus were prepared using Nucbuster (Novagen, 71183-3). The following antibodies were used for western blotting. Rabbit anti-FGFR4 (Cell Signaling, 8562), Rabbit anti-ERK1/2 (Cell Signaling, 4695S), Rabbit anti-pERK1/2 (Cell Signaling, 4376S), Rabbit anti-FGFR4 (Santa Cruz, H121, sc9006), Mouse anti-BrdU (Cell Signaling, 5292), Rabbit anti-pSTAT3 (Y705) (Cell Signaling, 9145), Rabbit anti-pSTAT3 (S727) (Cell Signaling, 9134), Rabbit anti-STAT3 (Cell Signaling, 4904), Mouse anti-STAT3 (Cell Signaling, 9139), Mouse anti-BiP/GRP78 (BD Transduction Labs, G73320-050), Rabbit anti-BiP/GRP78 (Abcam, ab21685), Rabbit anti-ITGβ1 (Cell Signaling, 4706), anti-sulfotyrosine (Millipore, 05-1100), Rabbit anti-TPST2 (Abcam, ab157191), Mouse anti-EGFR (BD Transduction Labs, E12020), Rabbit anti-pJAK2 (Cell Signaling, 3776), Rabbit anti-JAK2 (Cell Signaling, 3230), Rabbit anti-BRAF (Santa cruz, sc-9002), Rabbit anti-MEK1 (Cell Signaling, 12671), Mouse anti-phospho Tyrosine (Cell Signaling, 9411), Mouse anti-VSV tag (Home Made), Rabbit anti-HIS tag (Cell Signaling, 2365S), Mouse anti-GFP (Home Made), Mouse anti-Tubulin (Sigma, 9026), Rabbit anti-GAPDH-HRP (Cell Signaling, 8884), horseradish-peroxidase-conjugated secondary antibodies and an ECL kit (GE Healthcare/Amersham Pharmacia Biotech, 32106) were used to detect protein signals. Multiple exposures were taken to select images within the dynamic range of the film (GE Healthcare Amersham Hyperfilm ECL, 28906838). Normalization was done using tubulin bands. Transfectants were lysed in 1× cell lysis buffer (Cell Signaling, 9803) containing cOmplete, mini, EDTA-free tablets (Roche 11836170001) and PhosSTOP tablets (Roche 04906837001). Lysates were cleared and incubated with primary antibody overnight at 4 °C. Dynabeads Protein A (10006d, Life Technologies) (50 μl) was added per sample and incubated with rocking for an additional 4 h. Magnetic-bead-bound proteins were separated using a DynaMag-2 magnet (12321, Life Technologies). After five washes, co-immunoprecipitated proteins were extracted in 3× Laemli Buffer. For samples from peptide transfectants, a Dynabeads Streptavidin Kit (65801D, Life Technologies) was used. Surface staining for FGFR4 in human cancer cell lines was performed using custom-generated monoclonal antibody raised against extracellular segments of human FGFR4 (U3-Daiichi Sankyo, Clone 4FA6). Single-cell suspensions of lung tumours were prepared for staining. Erythrolysis was performed by ACK lysis buffer (1.5 M NH Cl, 100 mM KHCO , 10 mM EDTA-Na , pH 7.4). Tumours were first sliced into small pieces and resuspended in 10 ml of digestion cocktail (0.03 g of Liberase Thermolysin Medium (Roche, 05401119001) and 1.3 mg of DNase I (Thermo Scientific, EN0521)) reconstituted in RPMI complete medium. Digestion was performed with gentle agitation at 37 °C for 30 min. Single-cell suspensions were stained with the following antibodies: Rabbit anti-pSTAT3 (Y705) (Cell Signaling, 9145) and Rabbit Isotype Control (Cell Signaling, 3900). Goat anti-Rabbit-APC (Dianova, 111-136-144) was used as secondary detection antibody. Data were analysed using Flojo software version 10.0.7. IL-10 levels in equal volumes of mouse serum samples were quantified using mouse IL-10 ELISA ready-set-go kits (ebioscience, 887104-22) by following the manufacturer’s instructions. Tissues were fixed overnight in 4% paraformaldehyde in PBS (pH 7.4) at 4 °C. Fixed tissues were embedded in paraffin and sliced. Sections were prepared for staining first by deparaffinization followed by hydration in the following solutions: three washes of xylene for 5 min each; two washes of 100% ethanol for 10 min each; two washes of 95% ethanol for 10 min each; and two washes in distilled water for 5 min each. Antigen retrieval was obtained by incubation with heated citrate buffer (sodium citrate 10 mM, pH 6) for 15 min. Immunohistochemistry was performed as per the standard procedures. Briefly, after antigen retrieval, sections were incubated 3% hydrogen peroxide for 10 min to quench endogenous peroxidase activity. Non-specific background staining was blocked by incubating in UltraVision Block (Thermo Scientific, TA-060-PBQ) for 5 min at room temperature. Ki67 staining was done by incubating in Rabbit anti-Ki67 mAb (Cell Signaling, 9027) at a dilution of 1:400 overnight at 4 °C. Detection was achieved using HRP Polymer (Thermo Scientific, TL-060-PH) followed by incubation with peroxidase-compatible DAB chromogen. For immunofluorescence, anti-Mouse CD8a-FITC, clone 53-6.7 (eBioscience, 11-0081-82) was used. Total RNA was isolated using an RNeasy Kit (Qiagen, 74104). RNA was reverse transcribed into cDNA by random hexamer with a First Strand cDNA Synthesis Kit (Thermo Scientific, K1622). A StepOne Plus Real Time PCR System (Applied Biosystem) and Fast SYBR Green Master Mix (Life Science Technologies, 4385612) were used for quantitative RT–PCR. Primers used were as follows: mouse Fgfr4 (forward: 5′-CAAGTGGTTCGTGCAGAGG-3′; reverse: 5′-CTTCATCACCTCCATCTCGG-3′) and Hprt (forward: 5′-CTTCCTCCTCAGACCGCTTT-3′; reverse: 5′-TTTTCCAAATCCTCGGCATA-3′). Transcript levels in human cell lines were quantified by the method of Taqman real-time PCR using reagents and probes from Integrated DNA Technologies. The primers and probes used were as follows: human FGFR4 (forward: 5′-TTCTCACAGCTCTCAGGGA-3′; reverse: 5′-CAGGTGAGCAGGACCCT-3′; probe: 5′-FAM-CAGGCTCGA(ZEN)GGAAGGCAGTTGG3IABkFQ3′); human HPRT1 (forward: 5′-GTATTCATTATAGTCAAGGGCATATCC-3′; reverse: 5′-AGATGGTCAAGGTCGCAAG-3′; probe: 5′-FAM-TGGTGAAAA(ZEN)GGACCCCACGAAGT3IABkFQ-3′). MEFs were cultivated in 15 cm dishes; four biological replicates that were serum-starved overnight were directly lysed on the culture dish using the guanidinium hydrochloride protein digestion method and were subjected to a total proteome analysis by mass spectrometry. The lysates were then sonicated and heated briefly before dilution followed by sequential digestion with lysC and trypsin proteases in solution. After overnight digestion, the peptides were purified with StageTips and measured on a benchtop Orbitrap mass spectrometer as described elsewhere. All raw files were processed using MacQuant software and bioinformatic analysis of quantitative results was performed using the Perseus platform. For identification of modified tyrosine in human FGFR4 Arg388–GFP, full-length recombinant proteins were purified from HEK293E-EBNA1 cell transfectants by using His-Trap crude chromatography columns in buffers containing phosphatase inhibitors. Two independent eluates were prepared for mass spectrometry analyses. Purified recombinant proteins were resolved in 10% SDS–polyacrylamide gel electrophoresis (SDS–PAGE) and in-Gel digestion procedures were adopted. Sequential digestion was performed with LysC and GluC overnight. Graphical representations of the selected peptide-spectrum matches are shown in Extended Data Figures and source data. The ion table in the bottom panel shows the calculated mass of possible fragment ions. If a fragment ion is found in the spectrum, its mass value is displayed in colour. N-terminal ions are shown in blue and C-terminal ions are shown in red. The ‘error map’ shows the mass errors of matched fragment ions. The m/z ratio is displayed on the x axis and the error on the y axis in daltons. Each matched fragment ion is represented by a dot. A fragment ion is found if the relative intensity of the matching peak is at least 2%. Samples were analysed using a Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer (Thermo Scientific). Raw files were processed and analysed using the PTM module of PEAKS 7 software (BSI). Mouse embryonic fibroblast cells (cultured at 37 °C, 7% CO in RPMI containing 4.5 g l−1 glutamine and 10% FBS) were transiently transfected for 48 h with reporter plasmids Cignal STAT3 Reporter (luc) kit (Qiagen, CCS9028L) and pTk-Renilla using Lipofectamine 2000 (Life Science Technologies, 11668027). Similarly, HEK293T cells (cultured at 37 °C, 7% CO in RPMI containing 4.5 g l−1 glutamine and 10% FBS) were transiently transfected for 48 h with reporter plasmids Cignal STAT3 Reporter (luc) kit (Qiagen, CCS9028L), pTk-Renilla and plasmids pCMV-hFGFR4-388GlyDel–YFP and pCMV-hFGFR4-388ArgDel–YFP using Lipofectamine 2000 (Life Science Technologies, 11668027). Luciferase was measured with the Dual Glo Luciferase Assay System (Promega, E1910) according to the manufacturer’s instructions. Briefly, Dual Glo Luciferase Reagent was added to the cells and, after incubation for 10 min, firefly luciferase activity was measured with a luminometer (EG&G Berthold Technologies, LB96v). Reactions were stopped by treatment for 10 min with Dual-Glo Stop and Glo Reagent and renilla luciferase activity was then measured. For some samples where increased sensitivity was required, a Nano-Glo Dual Luciferase Reporter Assay Prototype Kit (Promega, N1110) was used. DNA and peptide transfection was done using Lipofectamine 2000 (Life Science Technologies, 11668027) as per the manufacturer’s instructions. Success of peptide delivery inside the cells was evaluated by flow cytometry assessment of surface and intracellular biotinylated peptides. For surface quantification, PBS-washed cells were fixed in 2% PFA 16 h after peptide transfection. Levels of biotinylated peptide on cell surfaces were then assessed using streptavidin–APC. Untransfected cells were used as negative controls. For intracellular quantification, 4% paraformaldehyde-fixed cells were permeabilized in BD permeabilization buffer and levels were assessed using streptavidin–APC. RNA transfection used RNAi Max (Life Science Technologies, 13778-150) by following the manufacturer’s guidelines. The following siRNAs were purchased from Cell Signaling: control siRNA 6568S, Fgfr4 siRNA-1 12472S, Fgfr4 siRNA-2 12669S, Stat3 siRNA-1 6353, Stat3 siRNA-2 6353. Mouse-specific ON-TARGETpus Egfr siRNA SMART pool was purchased from Dharmacon (L-MOUSE-XX-00-0529123373). For flow-cytometry-based detection of BrdU incorporation, serum-starved MEFs were incubated in RPMI culture medium containing 1× BrdU. After indicated time points, cells were detached and fixed in 4% paraformaldehyde in PBS for 30 min at room temperature. Permeabilization was done by incubating with ice-cold 100% methanol for 20 min at 4 °C followed by washing in PBS. Mouse anti-BrdU antibody (Cell Signaling, 5292) or mouse isotype control was added and incubated overnight at 4 °C. Allophycocyanin-conjugated anti-mouse (Dianova, 115-136-146) was used as secondary antibody and measured in a flow cytometer. For measuring BrdU incorporation in multiple samples in 96-well plates, a BrdU Cell Proliferation Assay Kit (Cell Signaling, 6813) was used and the manufacturer’s instructions followed. Genomic DNA from mouse tissues and human lung-cancer cell lines was isolated using a DNeasy Blood and Tissue Kit (Qiagen, 69506). PCR was done in Q5 High Fidelity 2× Master Mix (NEB, M0492L) and amplicons obtained using primers rs351855-Forw (5′-CACATATGTTGGGAGCTGGGAG-3′) and rs351855-Rev (5′-CTGCAAAGTGGGAGACTTGG-3′) were sent for in-house sequencing. DNA samples were sequenced by the microchemistry core-facility using an ABI 3730 sequencer and BI Big Dye 3.1 sequencing chemistry. The following sequencing primers were used to genotype rs351855 (c.1162G>A): hF4-TMs-MvaI (5′-GACCGCAGCAGCGCCCGAGGC-3′) and hF4-TMas-MvaI (5′-AGAGGGAAGCGGGAGAGCTTCTG-3′). The sequence was analysed in FinchTV version 1.4.0 (Geospiza) and Seqman Pro (DNASTAR Lasergene 12 Core Suite). Raw sequencing files and contig assembly files are deposited in ‘figshare’. MEFs transfected with pCMV-hFGFR4 Gly388-Venus and pCMV-hFGFR4 Gly388-Venus were imaged using a spinning disc confocal microscope (PerkinElmer UltraVIEW vox) in controlled temperature (37 °C) and CO (5%) conditions. A time-lapse of 30 s was fixed and imaged for 1 h. Images were analysed in Volocity software (PerkinElmer). Raw image files including metafiles are deposited in ‘figshare’. A colony formation assay was performed using cells transfected with the indicated plasmid grown under plasmid-specific antibiotic selection for 3 weeks in 24-well plates. Spheroid colonies of sizes greater than 80 μm were counted under a ×10 objective. Statistical analyses were performed using Prism software (GraphPad Prism). To detect substantial effects between wild-type and mutant variants of FGFR4, sample sizes were chosen on the basis of standard deviation in the measurements under given experimental conditions. The sample size calculations were determined as per the recommendations of ref. 19. Biological and measurement replicates are indicated in the corresponding figure legends and statistical methods. For immunohistochemical analyses of tumours, a minimum of five mice in a group of age- and gender-matched littermates were used. Animals from each litter were randomly chosen for tumour extraction, and experiments were performed by a co-author unaware of the genotypes. All in vitro and immunoblots were performed by a co-author unaware of the treatment or outcome until the end. For statistical analyses, in general for two-group comparisons, we used a Mann–Whitney rank-sum test or unpaired t-test with Welch’s correction. For multiple group comparisons, two-way ANOVA with Sidak’s or Tukey’s comparison test was used. All P values are two-tailed; the criterion for statistical significance was P < 0.05. Values of P < 0.05, P < 0.001 and P < 0.0001 are denoted by *, ** and *** respectively. All data are represented as means either ± s.d. or ± s.e.m. The mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRIDE partner repository under data set identifier PXD003135 (ref. 20).


HSP90 inhibitors used in this study including PU-H71, PU-DZ13, NVP-AUY922, and SNX-2112 were synthesized as previously reported7, 19. 17-DMAG was purchased from Sigma. HSP90 bait (PU-H71 beads)21, HSP70 bait (YK beads)22, biotinylated YK (YK-biotin)22, fluorescently labelled PU-H71 (PU-FITC)23, the control derivatives PU-TEG and PU-FITC9 (ref. 24), and the radiolabelled PU-H71-derivative 124I-PU-H71 (ref. 25) were generated as previously described. The specificity of PU-H71 for HSP90 and over other proteins was extensively analysed7. Thus binding of PU-H71 in cell homogenates, live cells and organisms denotes binding to HSP90 species characteristic of each analysed tumour or tissue. Combined with the findings that PU-H71 binds more tightly to HSP90 in type 1 than in type 2 cells, an observation true for cell homogenates, live cells, and in vivo, at the organismal level, we propose that labelled versions of PU-H71 are reliable tools to perturb, identify and measure the expression of the high-molecular-weight, multimeric HSP90 complexes in tumours. The specificity of YK probes for HSP70 was previously reported22, 26, 27, 28. Cell lines were obtained from laboratories at WCMC or MSKCC, or were purchased from the American Type Culture Collection (ATCC) or Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ). Cells were cultured as per the providers’ recommended culture conditions. Cells were authenticated using short tandem repeat profiling and tested for mycoplasma. The pancreatic cancer cell lines include: ASPC-1 (CRL-1682), PL45 (CRL-2558), MiaPaCa2 (CRL-1420), SU.86.86 (CRL-1837), CFPAC (CRL-1918), Capan-2 (HTB-80), BxPc-3 (CRL-1687), HPAFII (CRL-1997), Capan-1 (HTB-79), Panc-1 (CRL-1469), Panc05.04 (CRL-2557) and Hs766t (HTB-134) (purchased from the ATCC); 931102 and 931019 are patient derived cell lines provided by Y. Janjigian, MSKCC. Breast cancer cell lines were obtained from ATCC and include MDA-MB-468 (HTB-132), HCC1806 (CRL-2335), MDA-MB-231 (CRM-HTB-26), MDA-MB-415 (HTB-128), MCF-7 (HTB-22), BT-474 (HTB-20), BT-20 (HTB-19), MDA-MB-361 (HTB-27), SK-Br-3 (HTB-30), MDA-MB-453 (HTB-131), T-47D (HTB-133), AU565 (CRL-2351), ZR-75-30 (CRL-1504), ZR-75-1 (CRL-1500). Lymphoma cell lines include: Akata1, Mutu-1 and Rae-1 (provided by W. Tam, WCMC); BCP-1 (CRL-2294), Daudi (CCL-213), EB1 (HTB-60), NAMALWA (CRL-1432), P3HR-1 (HTB-62), SU-DHL-6 (CRL-2959), Farage (CRL-2630), Toledo (CRL-2631) and Pfeiffer (CRL-2632) (obtained from ATCC); HBL-1, MD901 and U2932 (kindly provided by J. Angel Martinez-Climent, Centre for Applied Medical Research, Pamplona, Spain); Karpas422 (ACC-32), RCK8 (ACC-561) and SU-DHL-4 (ACC-495) (obtained from the DSMZ); OCI-LY1, OCI-LY3, OCI-LY4, OCI-LY7 and OCI-LY10 (obtained from the Ontario Cancer Institute); TMD8 (kindly provided by L. M. Staudt, NIH); BC-1 (derived from an AIDS-related primary effusion lymphoma); IBL-1 and IBL-4 (derived from an AIDS-related immunoblastic lymphoma) and BC3 (derived from a non-HIV primary effusion lymphoma). Leukaemia cell lines include: REH (CRL-8286), HL-60 (CCL-240), KASUMI-1 (CRL-2724), KASUMI-4 (CRL-2726), TF-1 (CRL-2003), KG-1 (CCL-246), K562 (CCL-243), TUR (CRL-2367), THP-1 (TIB-202), U937 (CRL-1593.2), MV4-11 (CRL-9591) (obtained from ATCC); KCL-22 (ACC-519), OCI-AML3 (ACC-582) and MOLM-13 (ACC-554) (obtained from DSMZ). The lung cancer cell lines include: NCI-H3122, NCI-H299 (provided by M. Moore, MSKCC); EBC1 (provided by Dr Mellinghoff, MSKCC); PC9 (kindly provided by D. Scheinberg, MSKCC), HCC15 (ACC-496) (DSMZ), HCC827 (CRL-2868), NCI-H2228 (CRL-5935), NCI-H1395 (CRL-5868), NCI-H1975 (CRL-5908), NCI-H1437 (CRL-5872), NCI-H1838 (CRL-5899), NCI-H1373 (CRL-5866), NCI-H526 (CRL-5811), SK-MES-1 (HTB-58), A549 (CCL-185), NCI-H647 (CRL-5834), Calu-6 (HTB-56), NCI-H522 (CRL-5810), NCI-H1299 (CRL-5803), NCI-H1666 (CRL-5885) and NCI-H1703 (CRL-5889) (obtained from ATCC). The gastric cancer cell lines include: MKN74 (obtained from G. Schwarz, Columbia University), SNU-1 (CRL-5971) and NCI-N87 (CRL-5822) (obtained from ATCC), OE19 (ACC-700) (DSMZ). The non-transformed cell lines MRC-5 (CCL-171), human lung fibroblast and HMEC (PCS-600-010), human mammary epithelial cells were obtained from ATCC. NIH-3T3, and NIH-3T3 cell lines stably expressing either mutant MET (Y1248H) or vSRC, were provided by L. Neckers, National Cancer Institute (NCI), USA, and were previously reported29, 30. Patient tissue was obtained with informed consent and authorized through institutional review board (IRB)-approved bio-specimen protocol number 09-121 at Memorial Sloan Kettering Cancer Centre (New York, New York). Specimens were treated for 24 h or 48 h with the indicated concentrations of PU-H71 as previously described31. Following treatment, slices were fixed in 4% formalin solution for 1 h, then stored in 70% ethanol. For tissue analysis, slices were embedded in paraffin, sectioned, slide-mounted, and stained with haematoxylin and eosin (H&E). Apoptosis and necrosis of the tumour cells (as percentage) was assessed by reviewing all the H&E slides of the case (controls and treated ones) in toto, blindly, allowing for better estimation of the overall treatment effect to the tumour. In addition, any effects to precursor lesions (if present) and any off-target effects to benign surrounding tissue, were analysed. Tissue slides were assessed blindly by a breast cancer pathologist who determined the apoptotic events in the tumour, as well as any effect on adjacent normal tissue31. Cryopreserved primary AML samples were obtained with informed consent and Weill Cornell Medical College IRB approval (IRB number 0910010677 and IRB number 0909010629). Samples were thawed and cultured for in vitro treatment as described previously32. The microdose 124I-PU-H71 PET-CT (Dunphy, M. PET imaging of cancer patients using 124I-PUH71: a pilot study available from: http://clinicaltrials.gov; NCT01269593) and phase I PU-H71 therapeutic (Gerecitano, J. The first-in-human phase I trial of PU-H71 in patients with advanced malignancies available from: http://clinicaltrials.gov; NCT01393509) studies were approved by the institutional review board (protocols 10-139 and 11-041, respectively), and conducted under an exploratory investigational new drug (IND) application approved by the US Food and Drug Administration. Patients provided signed informed consent before participation. 124I-PU-H71 tracer was synthesized in-house by the institutional cyclotron core facility at high specific activity. For PU-PET, research PET-CT was performed using an integrated PET-CT scanner (Discovery DSTE, General Electric). CT scans for attenuation correction and anatomic coregistration were performed before tracer injection. Patients received 185 megabecquerel (MBq) of 124I-PU-H71 by peripheral vein over two minutes. PET data were reconstructed using a standard ordered subset expected maximization iterative algorithm. Emission data were corrected for scatter, attenuation, and decay. 124I-PU-H71 scans (PU-PET) were performed at 24 h after tracer administration. Each picture shown in Fig. 4c and Extended Fig. 6a is a scan taken of an individual patient. PET window display intensity scales for FDG and PU-PET fusion PET-CT images are given for both PU-PET and FDG-PET. Numbers in the scale bar indicate upper and lower SUV thresholds that define pixel intensity on PET images. The phase I trial included patients with solid tumours and lymphomas who had undergone prior treatment and currently had no curative treatment options. Patient cohorts were treated with PU-H71 at escalating dose levels determined by a modified continuous reassessment model. Each patient was treated with his or her assigned dose of PU-H71 on day 1, 4, 8, and 11 of each 21-day cycle. Human embryonic stem cells (hESCs) were differentiated with a modified dual-SMAD inhibition protocol towards floor plate-based midbrain dopaminergic (mDA) neurons as described previously33. hESCs were maintained on mouse embryonic fibroblasts and passaged with Dispase (STEMCELL Technologies). For each differentiation, hESCs were harvested with Accutase (Innovative Cell Technology). At day 30 of differentiation, hESC-derived mDA neurons were replated and maintained on dishes precoated with polyornithine (PO; 15 μg ml−1), laminin (1 μg ml−1), and fibronectin (2 μg ml−1) in Neurobasal/B27/l-glutamine-containing medium (NB/B27; Life Technologies) supplemented with 10 μM Y-27632 (until day 32) and with BDNF (brain-derived neurotrophic factor, 20 ng ml−1; R&D), ascorbic acid (AA; 0.2 mM, Sigma), GDNF (glial cell line-derived neurotrophic factor, 20 ng ml−1; R&D), TGFβ3 (transforming growth factor type β3, 1 ng ml−1; R&D), dibutyryl cAMP (0.5 mM; Sigma), and DAPT (10 nM; Tocris). Two days after replating, mDA neurons were treated with 1 μg ml−1 mitomycin C (Tocris) for 1 h to kill any remaining non-post mitotic contaminants. Assays were performed at day 65 of neuron differentiation. The PU-FITC assay was performed as previously described7, 23. Briefly, cells were incubated with 1 μM PU-FITC at 37 °C for 4 h. Then cells were washed twice with FACS buffer (PBS/0.5% FBS), and resuspended in FACS buffer containing 1 μg ml−1 DAPI. HL-60 cells were used as internal control to calculate fold binding for all cell lines tested. The mean fluorescence intensity (MFI) of PU-FITC in treated viable cells (DAPI negative) was evaluated by flow cytometry. For primary AML specimens, cells were also stained with anti-CD45-APC-H7, to identify blasts and lymphocyte populations (BD biosciences). Blasts and lymphocyte populations were gated based on SSC versus CD45. The fold PU-FITC binding of leukaemic blasts (CD45dim) was calculated relative to lymphocytes (CD45hiSSClow). The FITC derivative FITC9 was used as a negative control. Cells were seeded on coverslips in 6-well plate and cultured overnight. Cells were treated with 1 μM PU-FITC or negative control (PU-FITC9, an HSP90 inert PU-H71 derivative labelled with FITC). At 4 h post-treatment, cells were fixed with 4% formaldehyde at room temperature for 30 min, and the coverslips were mounted on slides with DAPI-Fluoromount-G Mounting Media (Southern Biotech). The images were captured using EVOS FL Auto imaging system (ThermoFisher Scientific) or a confocal microscope (Zeiss LSM5). Cells were seeded on coverslips and cultured overnight. Cells were fixed with 4% formaldehyde at room temperature for 30 min, washed three times with PBS, and permeabilized with 0.2% Triton X-100 in blocking buffer (PBS/5% BSA) for 10 min. Cells were incubated in blocking buffer for 30 min, and then incubated with rabbit anti-human HSP90α antibody (1:500, Abcam 2928) and mouse anti-human HSP90β (1:500, Stressmarq H9010), or rabbit and mouse normal IgG, in blocking buffer for 1 h. Cells were washed three times with PBS, and incubated with goat anti-mouse Alexa Fluor 568 and goat anti-rabbit Alexa Fluor 488 (1:1,000, ThermoFisher Scientific) in blocking buffer in the dark for 1 h. Cells were then washed three times with PBS, and the coverslips were removed from the plate, and mounted on slides with DAPI-Fluoromount-G Mounting Media (Southern Biotech). The images were captured using EVOS FL Auto imaging system (ThermoFisher Scientific) or a confocal microscope (Zeiss LSM5). Fluorescence intensity was quantified by the integrated density algorithm as implemented in ImageJ. Assays were carried out in black 96-well microplates (Greiner Microlon Fluotrac 200). A stock of 10 μM PU-FITC (or GM-cy3B34) was prepared in DMSO and diluted with Felts buffer (20 mM Hepes (K), pH 7.3, 50 mM KCl, 2 mM DTT, 5 mM MgCl , 20 mM Na MoO , and 0.01% NP40 with 0.1 mg ml−1 BGG). To each well was added the fluorescent dye-labelled HSP90 ligand (3 nM PU-FITC or 6 nM GM-cy3B), and cell lysates (7.5 μg) in a final volume of 100 μl Felts buffer. For each assay, background wells (buffer only), and tracer controls (PU-FITC only) were included on assay plate. To determine the equilibrium binding of GM-cy3b, increasing amounts of lysate (up to 20 μg of total protein) were incubated with tracer. The assay plate was placed on a shaker at room temperature for 60 min and the FP values in mP were measured every 5 min. At time t = 60 min, dissociation of fluorescent ligand was initiated by adding 1 μM PU-H71 in Felts buffer to each well and then placing the assay plate on a shaker at room temperature and measuring the FP values in mP every 5 min. The assay window was calculated as the difference between the FP value recorded for the bound fluorescent tracer and the FP value recorded for the free fluorescent tracer (defined as mP − mPf). Measurements were performed on a Molecular Devices SpectraMax Paradigm instrument (Molecular Devices, Sunnyvale, CA), and data were imported into SoftMaxPro6 and analysed in GraphPad Prism 5. To identify and separate chaperome complexes in tumours, and to overcome the limitations of classical protein chromatography methods for resolving complexes of similar composition and size, we took advantage of a capillary-based platform that combines isoelectric focusing (IEF) with immunoblotting capabilities35. This methodology uses an immobilized pH gradient to separate native multimeric protein complexes based on their isoelectric point (pI), and allows for subsequent probing of immobilized complexes with specific antibodies. The method uses only minute amounts of sample, thus enabling the interrogation of primary specimens. Cultured cells were lysed in 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl , 0.01% NP40, 20 mM Na MoO buffer, containing protease and phosphatase inhibitors. Primary specimens were lysed in either Bicine-Chaps or RIPA buffers (ProteinSimple). Total protein assay was performed on an automated system, NanoPro 1000 Simple Western (ProteinSimple), for charge-based separation. Briefly, total cell lysates were diluted to a final protein concentration of 250 ng μl−1 using a master mix containing 1× Premix G2 pH 3-10 separation gradient (Protein simple) and 1× isoelectric point standard ladders (ProteinSimple). Samples diluted in this manner maintained their native charge state, and were loaded into capillaries (ProteinSimple) and separated based on their isoelectric points at a constant power of 21,000 μWatts for 40 min. Immobilization was performed by UV-light embedded in the Simple Western system, followed by incubations with anti-HSP90β (SMC-107A, StressMarq Biosciences), anti-HSP90α (ab2928, Abcam), anti-HSP70 (SPA-810, Enzo), AKT (4691), P-AKT (9271) or BCL2 (2872) from Cell Signaling Technology and subsequently with HRP-conjugated anti-Mouse IgG (1030-05, SouthernBiotech) or with HRP-conjugated anti-Rabbit IgG (4010-05, SouthernBiotech). Protein signals were quantitated by chemiluminescence using SuperSignal West Dura Extended Duration Substrate (Thermo Scientific), and digital imaging and associated software (Compass) in the Simple Western system, resulting in a gel-like representation of the chromatogram. This representation is shown for each figure. Protein was extracted from cultured cells in 20 mM Tris pH 7.4, 150 mM NaCl, 1% NP-40 buffer with protease and phosphatase inhibitors added (Complete tablets and PhosSTOP EASYpack, Roche). Ten to fifty μg of total protein was subjected to SDS–PAGE, transferred onto nitrocellulose membrane, and incubated with indicated antibodies. HSP90β (SMC-107) and HSP110 (SPC-195) antibodies were purchased from Stressmarq; HER2 (28-0004) from Zymed; HSP70 (SPA-810), HSC70 (SPA-815), HIP (SPA-766), HOP (SRA-1500), and HSP40 (SPA-400) from Enzo; HSP90β (ab2927), HSP90α (ab2928), p23 (ab2814), GAPDH (ab8245) and AHA1 (ab56721) from Abcam; cleaved PARP (G734A) from Promega; CDC37 (4793), CHIP (2080), EGFR (4267), S6K (2217), phospho-S6K (S235/236) (4858), P-AKT (S473) (9271), AKT (4691), P-ERK (T202/Y204) (4377), ERK (4695), MCL1 (5453), Bcl-XL (2764), BCL2 (2872), c-MYC (5605) and HER3 (4754) from Cell Signaling Technology; and β-actin (A1978) from Sigma-Aldrich. The blots were washed with TBS/0.1% Tween 20 and incubated with appropriate HRP-conjugated secondary antibodies. Chemiluminescent signal was detected with Enhanced Chemiluminescence Detection System (GE Healthcare) following the manufacturer’s instructions. We screened a panel of anti-chaperome antibodies for those that interacted with the target protein in its native form. We reasoned that these antibodies were more likely to capture stable multimeric forms of the chaperome members. These native-cognate antibodies were used in native-PAGE and IEF analyses of chaperome complexes. HSP90β (SMC-107) and HSP110 (SPC-195) antibodies were purchased from Stressmarq; HSP70 (SPA-810), HSC70 (SPA-815), HOP (SRA-1500), and HSP40 (SPA-400) from Enzo; HSP90β (ab2927), HSP90α (ab2928), and AHA1 (ab56721) from Abcam; CDC37 (4793) from Cell Signaling Technology. Cells were lysed in 20 mM Tris pH 7.4, 20 mM KCl, 5 mM MgCl , 0.01% NP40, and 10% glycerol buffer by a freeze-thaw procedure. Primary samples were lysed in either Bicine-Chaps or RIPA buffers (ProteinSimple). Twenty-five to one hundred μg of protein was loaded onto 4–10% native gradient gel and resolved at 4 °C. The gels were immunoblotted as described above following either incubation in Tris-Glycine-SDS running buffer for 15 min before transfer in regular transfer buffer for 1 h, or directly transferred in 0.1% SDS-containing transfer buffer for 1 h. Cells were plated at 1 × 106 per 6 well-plate and transfected with an siRNA against human AHA1 (AHSA1; 5′-TTCAAATTGGTCCACGGATAA-3′), HSP90α (HSP90AA1; no. 1 5′-ATGGCATGACAACTACTTTAA-3′; no. 2 5′-AACCCTGACCATTCCATTATT-3′; no.3 5′-TGCACTGTAAGACGTATGTAA-3′), HSP90β (HSP90AB1; no., 5′-CAAGAATGATAAGGCAGTTAA-3′; no. 5′-TACGTTGCTCACTATTACGTA-3′; no.3 5′-CAGAAGACAAGGAGAATTACA-3′) HSP90α/β (no.1 5′-CAGAATGAAGGAGAACCAGAA-3′, no.2 5′-CACAACGATGATGAACAGTAT-3′), HSP110 (HSPH1; 5′-AGGCCGCTTTGTAGTTCAGAA-3′) from Qiagen or HOP (STIP1) (Dharmacon; M-019802-01), or a negative control (scramble; 5′-CAGGGTATCGACGATTACAAA-3′) with Lipofectamine RNAiMAX reagent (Invitrogen), incubated for 72 h and subjected to further analysis. Total mRNA was isolated using TRIzol Reagent (Invitrogen) following the manufacturer’s recommended protocol. Reverse transcription of mRNA into cDNA was performed using QuantiTect Reverse Transcription Kit (Qiagen). qRT–PCR was performed using PerfeCTa SYBR (Quanta Bioscience), 10 nM AHSA1 (forward: 5′-GCGGCCGCTTCTAGTAGTTT-3′ and reverse: 5′-CATCTCTCTCCGTCCAGTGC-3′) and GAPDH (forward: 5′-CAAAGGCACAGTCAAGGCTGA-3′ and reverse: 5′-TGGTGAAGACGCCAGTAGATT-3′) primers, or 1× QuantiTect Primers for HSP110 (HSPH1), HSP90α (HSP90AA1), HSP90β (HSP90AB1), HSP70 (HSPA1A), HOP (STIP1) (Qiagen) following recommended PCR cycling conditions. Melting curve analysis was performed to ensure product uniformity. To investigate which of the two HSP70 paralogues is involved in epichaperome formation we performed immunodepletions with HSP70 and HSC70 antibodies. Protein lysates were immunoprecipitated consecutively three times with either an HSP70 (Enzo, SPA-810), HSC70 (Enzo, SPA-815) or HOP (kindly provided by M. B. Cox, University of Texas at El Paso), or with the same species normal antibody as a negative control (Santa Cruz). The resulting supernatant was collected and run on a native or a denaturing gel. Tumour lysates were mixed with 10 M urea (dissolved in Felts buffer) to reach the indicated final concentrations of 2 M, 4 M and 6 M. After incubation for 10 min at room temperature or frozen overnight at −80 °C, the lysates were loaded onto 4–10% native gradient gel and resolved at 4 °C or applied to the IEF capillary. The HSP90β bands were detected by using antibody purchased from Stressmarq (SMC-107). A lentiviral vector expressing the MYC shRNA, as previously described36, was requested from Addgene (Plasmid 29435, c-MYC shRNA sequence: GACGAGAACAGTTGAAACA). Viruses were prepared by co-transfecting the shRNA vector, the packaging plasmid psPAX2 and the envelop plasmid pMD2.G into HEK293 cells. OCI-LY1 cells were then infected with lentiviral supernatants in the presence of 4 μg ml−1 polybrene for 24 h. Following flow cytometry selection for positive cells, cells were expanded for further experiments. The MYC protein level was confirmed at 10 days post-infection by western blot using the anti-MYC antibody (Cell Signaling Technology, 5605). Viruses were prepared by co-transfection of the lentiviral vector expressing the MYC shRNA with pLM-mCerulean-2A-cMyc (Addgene, 23244) or pCDH-puro-cMYC (Addgene, 46970), the packaging plasmid psPAX2, and the envelope plasmid pMD2.G into HEK293 cells. ASPC1 cells were then infected with lentiviral supernatants in the presence of 4 μg ml−1 polybrene for 24 h and sorted for mCerulean positive cells or selected with puromycin treatment. Changes in cell size after infection were monitored by analysing the forward scatter (FSC) of intact cells via flow cytometry. MYC protein levels were analysed at 4 days post-infection by western blot. Whole cell extracts were prepared by homogenizing cells in RIPA buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 1% NP40, 0.25% sodium deoxycholate, 10% glycerol, protease inhibitors). MYC activity was determined using the TransAM c-Myc Kit (Active Motif, 43396), following the manufacturer’s instructions. Cell viability was assessed using CellTiter-Glo luminescent Cell Viability Assay (Promega) after a 72 h PU-H71 treatment. The method determines the number of viable cells in culture based on quantification of the ATP present, which signals the presence of metabolically active cells, and was performed as previously reported37. For the annexin V staining, cells were labelled with Annexin V-PE and 7AAD after PU-H71 treatment for 48 h, as previously reported38. The necrotic cells were defined as annexin V+/7AAD+, and the early apoptotic cells were defined as annexin V+/7AAD−. For the LDH assay the release of lactate dehydrogenase (LDH) into the culture medium only occurs upon cell death. Following indicated treatment, the culture medium was collected and centrifuged to remove living cells and cell debris. The collected medium was incubated at room temperature for 30 min with the Cytotox-96 Non-radioactive Assay kit (Promega) LDH substrate. All animal studies were conducted in compliance with MSKCC’s Institutional Animal Care and Use Committee (IACUC) guidelines. Female athymic nu/nu mice (NCRNU-M, 20–25 g, 6 weeks old) were obtained from Harlan Laboratories and were allowed to acclimatize at the MSKCC vivarium for 1 week before implanting tumours. Mice were provided with food and water ad libitum. Tumour xenografts were established on the forelimbs for PET imaging and on the flank for efficacy studies. Tumours were initiated by sub-cutaneous injection of 1 × 107 cells for MDA-MB-468 and 5 × 106 for ASPC1 in a 200 μl cell suspension of a 1:1 v/v mixture of PBS with reconstituted basement membrane (BD Matrigel, Collaborative Biomedical Products). Before administration, a solution of PU-H71 was formulated in citrate buffer. Sample size was chosen empirically based on published data39. No statistical methods were used to predetermine sample size. Animals were randomly assigned to groups. Studies were not conducted blinded. Imaging was performed with a dedicated small-animal PET scanner (Focus 120 microPET; Concorde Microsystems, Knoxville, TN). Mice were maintained under 2% isoflurane (Baxter Healthcare, Deerfield, IL) anaesthesia in oxygen at 2 litres per min during the entire scanning period. To reduce the thyroid uptake of free iodide arising from metabolism of tracer, mice received 0.01% potassium iodide solution in their drinking water starting 48 h before tracer administration. For PET imaging, each mouse was administered 9.25 MBq (250 μCi) of 124I-PU-H71 via the tail vein. List-mode data (10 to 30 min acquisitions) were obtained for each animal at various time points post-tracer administration. An energy window of 420–580 keV and a coincidence timing window of 6 ns were used. The resulting list-mode data were sorted into 2-dimensional histograms by Fourier rebinning; transverse images were reconstructed by filtered back projection (FBP). The image data were corrected for non-uniformity of scanner response, dead-time count losses, and physical decay to the time of injection. There was no correction applied for attenuation, scatter, or partial-volume averaging. The measured reconstructed spatial resolution of the Focus 120 is 1.6-mm FWHM at the centre of the field of view. Region of interest (ROI) analysis of the reconstructed images was performed using ASIPro software (Concorde Microsystems, Knoxville, TN), and the maximum pixel value was recorded for each tissue/organ ROI. A system calibration factor (that is, μCi per ml per cps per voxel) that was derived from reconstructed images of a mouse-size water-filled cylinder containing 18F was used to convert the 124I voxel count rates to activity concentrations (after adjustment for the 124I positron branching ratio). The resulting image data were then normalized to the administered activity to parameterize the microPET images in terms of per cent injected dose per gram (%ID per g) (corrected for decay of 124I to the time of injection). Post-reconstruction smoothing was applied only for visual representation of images in the figures. Upon euthanasia, radioactivity (124I) was measured in a gamma-counter (Perkin Elmer 1480 Wizard 3 Auto Gamma counter) using a 400–600 keV energy window. Count data were background- and decay-corrected to the time of injection, and the percent injected dose per gram (%ID per g) for each tumour sample was calculated using a calibration curve to convert counts to radioactivity, followed by normalization to the total activity injected. Mice (n = 5) bearing MDA-MB-468 or ASPC1 tumours reaching a volume of 100–150 mm3 were treated i.p. using PU-H71 (75mg per kg) or vehicle, on a 3 times per week schedule, as indicated. Tumour volume (in mm3) was determined by measurement with Vernier calipers, and was calculated as the product of its length × width2 × 0.5. Tumour volume was expressed on indicated days as the median tumour volume ± s.d. indicated for groups of mice. Mice were euthanized after similar PU-H71 treatment periods, and at a time before tumours reached a size that resulted in discomfort or difficulty in physiological functions of mice in the individual treatment group, in accordance with our IUCAC protocol. Frozen tissue was dried and weighed before homogenization in acetonitrile/H O (3:7). PU-H71 was extracted in methylene chloride, and the organic layer was separated and dried under vacuum. Samples were reconstituted in mobile phase. The concentrations of PU-H71 in tissue or plasma were determined by high-performance LC-MS/MS. PU-H71-d was added as the internal standard40. Compound analysis was performed on the 6410 LC-MS/MS system (Agilent Technologies) in multiple reaction monitoring mode using positive-ion electrospray ionization. For tissue samples, a Zorbax Eclipse XDB-C18 column (2.1 × 50 mm, 3.5 μm) was used for the LC separation, and the analyte was eluted under an isocratic condition (80% H O + 0.1% HCOOH: 20% CH CN) for 3 min at a flow rate of 0.4 ml min−1. For plasma samples, a Zorbax Eclipse XDB-C18 column (4.6 × 50 mm, 5 μm) was used for the LC separation, and the analyte was eluted under a gradient condition (H O + 0.1% HCOOH:CH CN, 95:5 to 70:30) at a flow rate of 0.35 ml min−1. Protein extracts were prepared either in 20 mM HEPES pH 7.5, 50 mM KCl, 5 mM MgCl , 1% NP40, and 20 mM Na MoO for PU-H71 beads pull-down, or in 20 mM Tris pH 7.4, 150 mM NaCl, and 1% NP40 for YK beads pull-down. Samples were incubated with the PU-H71 beads (HSP90 bait) for 3–4 h or with the YK beads (HSP70 bait, for chemical precipitation) overnight, at 4 °C, then washed and subjected to SDS–PAGE with subsequent immunoblotting and western blot analysis. For HSP70 proteomic analyses, cells were incubated with a biotinylated YK-derivative, YK-biotin. Briefly, MDA-MB-468 cells were treated for 4 h with 100 μM biotin-YK5 or d-biotin as a negative control. Cells were collected and lysed in 20 mM Tris pH 7.4, 150 mM NaCl, and 1% NP40 buffer. Protein extracts were incubated with streptavidin agarose beads (Thermo Scientific) for 1 h at 4 °C, washed with 20 mM Tris pH 7.4, 150 mM NaCl, and 0.1% NP40 buffer and applied onto SDS–PAGE. The gels were stained with SimplyBlue Coomassie stain (Invitrogen Life Science Technologies). Proteomic analyses were performed using the published protocol7, 18, 22. Control beads contained an inert molecule as previously described7, 18, 22. Affinity-purified protein complexes from type 1 tumours (n = 6; NCI-H1975, MDA-MB-468, OCI-LY1, Daudi, IBL1, BC3), type 2 tumours (n = 3; ASPC1, OCI-LY4, Ramos) and from non-transformed cells (n = 3; MRC5, HMEC and neurons) were resolved using SDS-polyacrylamide gel electrophoresis, followed by staining with colloidal, SimplyBlue Coomassie stain (Invitrogen Life Science Technologies) and excision of the separated protein bands. Control beads that contained an inert molecule were subjected to the same steps as PU-H71 and YK beads and served as a control experiment. To ensure that we captured a majority of the HSP90 complexes in each cell type, we performed these studies under conditions of HSP90-bait saturation. The number of gel sections per lane averaged to be 14. In situ trypsin digestion of gel bound proteins, purification of the generated peptides and LC–MS/MS analysis were performed using our published protocols7, 18, 22. After the acquisition of raw files, Proteowizard (version 3.0.3650)41 was used to create a Mascot Generic Format (mgf) file containing accurate mass for each peak and its corresponding ms2 ions. Each mgf was then subjected to search a human segment of Uniprot protein database (20,273 sequences, European Bioinformatics Institute, Swiss Institute of Bioinformatics and Protein Information Resource) using Mascot (Matrix Science; version 2.5.0; http://www.matrixscience.com). Decoy proteins were added to the search to allow for the calculation of false discovery rates (FDR). The search parameters were as follows: (i) two missed cleavage tryptic sites were allowed; (ii) precursor ion mass tolerance = 10 p.p.m.; (iii) fragment ion mass tolerance = 0.8 Da; and (iv) variable protein modifications were allowed for methionine oxidation, deamidation of asparagine and glutamines, cysteine acrylamide derivatization and protein N-terminal acetylation. MudPit scoring was typically applied using significance threshold score P < 0.01. Decoy database search was always activated and, in general, for merged LS–MS/MS analysis of a gel lane with P < 0.01, false discovery rate averaged around 1%. The Mascot search result was finally imported into Scaffold (Proteome Software, Inc.; version 4_4_1) to further analyse tandem mass spectrometry (MS/MS) based protein and peptide identifications. X! Tandem (The GPM, http://thegpm.org; version CYCLONE (2010.12.01.1) was then performed and its results are merged with those from Mascot. The two search engine results were combined and displayed at 1% FDR. Protein and peptide probability was set at 95% with a minimum peptide requirement of 1. Protein identifications were expressed as Exclusive Spectrum Counts that identified each protein listed. Primary data, such as raw mass spectrometry files, Mascot generic format files and proteomics data files created by Scaffold have been deposited onto the Massive site (https://massive.ucsd.edu/ProteoSAFe/static/massive.jsp; MassIVE Accession ID: MSV000079877). In each of the Scaffold files that validate and import Mascot searched files, peptide matches, scoring information (Mascot, as well as X! Tandem search scores) for peptide and protein identifications, MS/MS spectra, protein views with sequence coverage and more, can be easily accessed. To read the Scaffold files, free viewer software can be found at (http://www.proteomesoftware.com/products/free-viewer/). Peptide matches and scoring information that demonstrate the data processing are available in Supplementary Table 1f–q. The exclusive spectrum count values, an alternative for quantitative proteomic measurements42, were used for protein analyses. CHIP and PP5 were examined and used as internal quality controls among the samples. Statistics were performed using R (version 3.1.3) limma package43, 44. For entries with zero spectral counts, and to enable further analyses, we assigned an arbitrary small number of 0.1. The data were then transformed into logarithmic base 10 for analysis. Linear models were fit to the transformed data and moderated standard errors were calculated using empirical Bayesian methods. For Fig. 1f and Extended Data Fig. 5a, a moderated t-statistic was used to compare protein enrichment between type 1 cells and combined type 2 and non-transformed cells45. For Extended Data Fig. 5b, the t-statistic was performed to compare protein enrichment among type 1 cells, type 2 cells and non-transformed cells (see Supplementary Table 1). Heat maps were created to display the selected proteins using the package “gplots” and “lattice”46, 47. See Supplementary Table 1 in which the table tab ‘a’ corresponds to Fig. 1f and contains core chaperome networks in type 1, type 2 and non-transformed cells; the table tab ‘b’ corresponds to Extended Data Fig. 5a and contains comprehensive chaperome networks in type 1, type 2 and non-transformed cells; the table tab ‘c’ corresponds to Extended Data Fig. 5b and Extended Data Fig. 8b and contains the HSP90 interactome as isolated by the HSP90 bait in type 1, type 2 and non-transformed cells; the table tab ‘d’ corresponds to Extended Data Fig. 8a and contains upstream transcriptional regulators that explain the protein signature of type1 tumours and the table tab ‘e’ contains metastasis-related proteins characteristic of type 1 tumours. To understand the physical and functional protein-interaction properties of the HSP90-interacting chaperome proteins enriched in type 1 tumours, we used the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database48. Proteins displayed in the heat map were uploaded in STRING database to generate the PPI networks. STRING builds functional protein-association networks based on compiled available experimental evidence. The thickness of the edges represents the confidence score of a functional association. The score was calculated based on four criteria: co-expression, experimental and biochemical validation, association in curated databases, and co-mentioning in PubMed abstracts48. Proteins with no adjacent interactions were not shown. The colour scale in nodes indicates the average enrichment of the protein (measured as exclusive spectral counts) in type 1, type 2, and non-transformed cells, respectively. The network layout for type 1 tumours was generated using edge-weighted spring-electric layout in Cytoscape with slight adjustments of marginal nodes for better visualization49. The layout for type 2 and non-transformed cells retains that of type 1 for better comparison. Proteins with average relative abundance values less than 1 were deleted from analyses. The biological processes in which they participate and the functionality of proteins enriched in type 1 tumours were assigned based on gene ontology terms and based on their designated interactome from UniProtKB, STRING, and/or I2D databases48, 50, 51, 52, 53. The Upstream Regulator analytic, as implemented in Ingenuity Pathways Analysis (IPA, QIAGEN Redwood City, http://www.qiagen.com/ingenuity), was used to identify the cascade of upstream transcriptional regulators that can explain the observed protein expression changes in type 1 tumours. The analysis is based on prior knowledge of expected effects between transcriptional regulators and their target genes stored in the Ingenuity Knowledge Base. The analysis examines how many known targets of each transcription regulator are present in the data set, and calculates an overlap P value for upstream regulators based on significant overlap between dataset genes and known targets regulated by a transcription regulator. For Extended Data Fig. 8b, proteins were selected based on 3 pre-curated lists (MYC target genes based on the analysis report from INGENUITY, MYC signature genes based on the reported list provided in ref. 54 and MYC expression/function activators were manually curated from UniProt and GeneCards databases). Cell lines with information available in the cBioPortal for cancer genomics (http://www.cbioportal.org) were evaluated for mutations in pathways implicated in cancer: P53, RAS, RAF, PTEN, PIK3CA, AKT, EGFR, HER2, CDK2NA/B, RB, MYC, STAT1, STAT3, JAK2, MET, PDGFR, KDM6A, KIT. Mutations in major chaperome members (HSP90AA1, HSP90AB1, HSPH1, HSPA8, STIP1, AHSA1) were also evaluated. Data were visualized and statistical analyses performed using GraphPad Prism (version 6; GraphPad Software) or R statistical package. In each group of data, estimate variation was taken into account and is indicated in each figure as s.d. or s.e.m. If a single panel is presented, data are representative of 2 or 3 biological or technical replicates, as indicated. P values for unpaired comparisons between two groups with comparable variance were calculated by two-tailed Student’s t-test. Pearson’s tests were used to identify correlations among variables. Significance for all statistical tests was shown in figures for not significant (NS), *P < 0.05, **P < 0.01, ***P < 0.001 and ****P < 0.0001. No samples or animals were excluded from analysis, and sample size estimates were not used. Animals were randomly assigned to groups. Studies were not conducted blinded, with the exception of all patient specimen histological analyses.


Addou A.N.,Aix - Marseille University | Addou A.N.,Oran University of Science and Technology - Mohamed Boudiaf | Schumann P.,Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH | Sproer C.,Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH | And 3 more authors.
International Journal of Systematic and Evolutionary Microbiology | Year: 2012

A novel filamentous bacterium, designated NariEXT, was isolated from soil collected from Chott Melghir salt lake, which is located in the south-east of Algeria. The strain was an aerobic, halotolerant, thermotolerant, Gram-positive bacterium that was able to grow in NaCl concentrations up to 21% (w/v), at 37-60 °C and at pH 5.0-9.5. The major fatty acids were isoand anteiso-C15:0. The DNA G+C content was 47.3 mol%. The major menaquinone was MK-7, but MK-6 and MK-8 were also present. The polar lipid profile consisted of phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine and phosphatidylmonomethylethanolamine (methyl-PE). Results of molecular and phenotypic analysis led to the description of the strain as a new member of the family Thermoactinomycetaceae. The isolate was distinct from members of recognized genera of this family by morphological, biochemical and chemotaxonomic characteristics. Strain NariEXT showed 16S rRNA gene sequence similarities of 95.38 and 94.28% with the type strains of Desmospora activa and Kroppenstedtia eburnea, respectively, but differed from both type strains in its sugars, polar lipids and in the presence of methyl-PE. On the basis of physiological and phylogenetic data, strain NariEXT represents a novel species of a new genus of the family Thermoactinomycetaceae for which the name Melghirimyces algeriensis gen. nov., sp. nov. is proposed. The type strain of Melghirimyces algeriensis, the type species of the genus, is NariEXT (=DSM 45474T=CCUG 59620T). © 2012 IUMS.


Xing K.,Xuzhou Normal University | Bian G.-K.,Xuzhou Normal University | Qin S.,Xuzhou Normal University | Klenk H.-P.,Deutsche Sammlung Von Mikroorganismen und Zellkulturen GmbH | And 4 more authors.
Antonie van Leeuwenhoek, International Journal of General and Molecular Microbiology | Year: 2012

A novel actinomycete, designated strain KLBMP 1111 T, was isolated from the root of the oil-seed plant Jatropha curcas L. collected from Sichuan Province, south-west China. Strain KLBMP 1111 T formed a distinct branch in the 16S rRNA gene phylogenetic tree together with the type strains in the genus Kibdelosporangium, with the highest similarity to Kibdelosporangium aridum subsp. aridum DSM 43828 T (98.8%), K. aridum subsp. largum DSM 44150 T (98.1%) and Kibdelosporangium philippinense DSM 44226 T (98.1%). The organism produced sporangium-like structures, the typical morphological characteristic of the genus Kibdelosporangium. The chemotaxonomic properties of this strain were also consistent with those of the genus Kibdelosporangium: the peptidoglycan contained meso-diaminopimelic acid; the predominant menaquinone was MK-9(H 4); phospholipids were phosphatidylglycerol, phosphatidylethanolamine, phosphatidylmethylethanolamine, phosphatidylinositol and an unknown phospholipid; iso-C 16:0, C 16:0, anteiso-C 15:0 and iso-C 15:0 as the predominant cellular fatty acids and the G+C content was 67.2 mol%. DNA-DNA hybridization values between strain KLBMP 1111 T and the three Kibdelosporangium species were less than 50%. This strain had the ability to produce a siderophore, utilized 1-aminocyclopropane-1-carboxylic acid (ACC) as sole source of nitrogen and possessed ACC deaminase enzyme. Based on genotypic and phenotypic data, strain KLBMP 1111 T represents a novel species in the genus Kibdelosporangium. We propose the name Kibdelosporangium phytohabitans sp. nov. for this species. The type strain is the strain KLBMP 1111 T (=KCTC 19775 T = CCTCC AA 2010001 T). © 2011 Springer Science+Business Media B.V.

Loading Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH collaborators
Loading Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH collaborators