Boston, MA, United States
Boston, MA, United States

Dana–Farber Cancer Institute is a center for cancer treatment and research in Boston, Massachusetts. It is a major affiliate of Harvard Medical School, and a founding member of Dana–Farber/Harvard Cancer Center, a Comprehensive Cancer Center designated by the National Cancer Institute. Wikipedia.


Time filter

Source Type

Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2015-04-30

The present invention comprises compositions, methods, and devices for enhancing an endogenous immune response against a cancer. Devices and methods provide therapeutic immunity to subjects against cancer.


Patent
Dana-Farber Cancer Institute and Childrens Medical Center Corporation | Date: 2016-06-01

Described herein is a method of mitigating, in a subject (individual), tissue injury resulting from exposure to radiation (accidental/unintentional or intentional, such as therapeutic), chemoradiotherapy, disease, toxin, or drug or biologic mediated therapy.


Patent
Dana-Farber Cancer Institute and Childrens Medical Center Corporation | Date: 2016-06-01

Described herein is a method of mitigating, in a subject (individual), tissue injury resulting from exposure to radiation (accidental/unintentional or intentional, such as therapeutic), chemoradiotherapy, disease, toxin, or drug or biologic mediated therapy.


Patent
Dana-Farber Cancer Institute | Date: 2015-03-09

The present invention provides compositions and methods for regulating pancreatic beta cell function through modulation of adipsin activity and/or expression. Also provided are methods for preventing, treating, diagnosing, and prognosing metabolic disorders, such as diabetes, in a subject through modulation or detection of adipsin activity and/or expression.


Patent
Dana-Farber Cancer Institute, Brigham and Women's Hospital | Date: 2016-08-12

The present invention comprises a humanized monoclonal antibody that binds to the chemokine receptor CCR4. This antibody is derived from Mab 1567 and recognizes the same epitope. Binding of the invented antibody to CCR4 inhibits ligand-mediated activities and is used to treat symptoms of cancer. Moreover, the antibody is used in combination with vaccines to suppress the activity of regulatory T cells.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2016-11-16

Cross-linked peptides related to human p53 and bind to HMD2 or a family member of HDM2 useful for promoting apoptosis, e.g., in the treatment of and identifying therapeutic agents that binding to HMD2 or a family member of HDM2.


Patent
Dana-Farber Cancer Institute | Date: 2015-04-23

The present invention provides kinase inhibitors, such as compounds of Formula (I) and Formula (II). The compounds may covalently or non-covalently bind a kinase (e.g., Janus kinase 3 (JAK3)). Also provided are pharmaceutical compositions, kits, methods, and uses that involve the compounds for reducing the activity of a kinase and/or treating and/or preventing a condition associated with aberrant activity of a kinase (e.g., a proliferative disease, inflammatory disorder, autoimmune disorder, painful condition, and/or viral infection). (I) (II)


Patent
Dana-Farber Cancer Institute | Date: 2015-04-23

The present invention provides Janus kinase inhibitors, such as compounds of Formula (I) and Formula (II) wherein R^(Y1 )and R^(Y2 )comprise a tagged hydrophobic moiety R^(H). The compounds may covalently or non-covalently bind a kinase (e.g., Janus kinase 3 (JAK3)). The hydrophobic moiety R^(H )may signal to the intracellular protein homeostasis machinery to induce degradation of the targeted kinase. Also provided are pharmaceutical compositions, kits, methods, and uses that involve the compounds for reducing the activity of a kinase and/or treating and/or preventing a condition associated with aberrant activity of a kinase (e.g., a proliferative disease, inflammatory disorder, autoimmune disorder, painful condition, and/or viral infection).


Patent
Dana-Farber Cancer Institute | Date: 2016-11-11

The present invention comprises a humanized monoclonal antibody that binds to the human immunoglobulin heavy chain variable region germline gene VH1-69. This antibody is derived from Mab G6 and recognizes the same epitope. Moreover, the antibody is used in combination with vaccines to augment an immune response to the antigen.


The invention features compositions and methods for treating or preventing a neoplasia. More specifically, the invention provides compositions and methods for disrupting the interaction of a BET family polypeptide comprising a bromodomain with chromatin (e.g., disrupting a bromodomain interaction with an acetyl-lysine modification present on a histone N-terminal tail).


The present invention is based, in part, on the identification, of novel mitochondrial iron-sulfur (FeS) cluster biosynthesis pathway biomarkers and modulators, and methods of use thereof, for identifying, assessing, preventing, and treating cancer.


Patent
Dana-Farber Cancer Institute and Sloan Kettering Cancer Center | Date: 2015-03-17

A method of increasing the efficacy of treatment for a patient suffering from urothelial carcinoma. The method comprises the steps of determining the presence or absence in a biological sample from the patient of somatic ERCC2 mutation followed by performing appropriate treatment. The absence of somatic ERCC2 mutation indicates that the urothelial carcinoma is likely to be unresponsive to cisplatin chemotherapy, and the patient then undergoes surgery to remove the carcinoma without accompanying cisplatin chemotherapy. The presence of somatic ERCC2 mutation indicates that the uroethelial carcinoma is likely to be responsive to cisplatin chemotherapy and the patient then undergoes surgery to remove the carcinoma accompanied by cisplatin chemotherapy.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2015-04-30

Aspects of the disclosure provide fusion proteins that bind cells expressing one or more target molecules including, for example, one or more cell surface multisubunit signaling receptors (e.g., EGFRvIII-expressing cells that also express interferon receptors) and that induce anti-proliferative effects, and related compositions and methods for the treatment of cancer.


Patent
Childrens Medical Center Corporation and Dana-Farber Cancer Institute | Date: 2015-04-23

Provided herein are compositions and methods for determining the structure of individual targets using nucleic acid caliper by determining long-range distances within such targets.


Patent
Dana-Farber Cancer Institute, Beth Israel Deaconess Medical Center and Massachusetts General Hospital | Date: 2015-12-11

Provided herein are methods for treating cancer that is resistant to treatment with an anti-ErbB therapeutic agent and which is associated with an activating MET gene mutation or a MET gene amplification. The methods involve administering to a subject a combination of an anti-ErbB therapeutic and an anti-MET therapeutic. Also provided are methods for reducing ErbB mediated signaling or PI3 kinase mediated signaling in a cancer cell.


Patent
The Broad Institute Inc. and Dana-Farber Cancer Institute | Date: 2016-10-14

Methods for treating patients with squamous cell lung cancer, including detecting the presence of mutations in the discoidin domain receptor 2 (DDR2) gene.


Patent
Dana-Farber Cancer Institute, Brigham, Women's Hospital, Childrens Medical Center Corporation and Technical University of Denmark | Date: 2016-10-20

The present invention is based, in part, on the identification of novel methods for defining predictive biomarkers of response to anti-cancer drugs.


Patent
Dana-Farber Cancer Institute and Scripps Research Institute | Date: 2017-04-05

The present invention provides novel heteroaryl compounds that are linked to an aryl group via an amine linker. Such compounds are useful for the treatment of cancers.


Patent
Abbvie Inc. and Dana-Farber Cancer Institute | Date: 2017-01-11

Composition suitable for treating multiple myeloma in subject, comprising a therapeutically effective amount of HuLuc63, a therapeutically effective amount of lenalidomide and/or bortezomib, and a pharmaceutically acceptable carrier, wherein said composition is capable of being administered in a single or multiple dose regimen.


Patent
Dana-Farber Cancer Institute and Emory University | Date: 2017-02-22

The present invention is based, in part, on the identification of novel human anti-PD-1, PD-L1, and PD-L2 antibodies. Accordingly, the invention relates to compositions and methods for diagnosing, prognosing, and treating conditions that would benefit from modulating PD-1, PD-L1, and/or PD-L2 activity (e.g., persistent infectious diseases, autoimmune diseases, asthma, transplant rejection, inflammatory disorders and tumors) using the novel human anti-PD-1, PD-L1, and PD-L2 antibodies described herein.


Patent
Dana-Farber Cancer Institute, Brigham, Women's Hospital, Emory University and The President And Fellows Of Harvard College | Date: 2017-02-15

The present invention provides methods and compositions for the treatment, prevention, or reduction of persistent infections, such as chronic infections, latent infections, and slow infections and cancer. The methods and compositions of the invention are also useful for the alleviation of one or more symptoms associated with such infections and cancer.


Patent
Dana-Farber Cancer Institute | Date: 2017-02-01

A series of stapled BCL-2 family peptide helices were identified as able to target the survival protein MCL-1 with high affinity and a subset with unprecedented selectivity. Agents and methods for selective pharmacologic neutralization of MCL-1 are provided for drug discovery and therapeutic uses, including use in overcoming the apoptotic resistance of cancer and other diseases associated with impaired cell death.


This invention relates to compounds which selectively bind to the survival protein MCL-1 with high affinity and selectivity, pharmaceutical compositions containing such compounds and the use of those compounds or compositions for modulating MCL-1 activity and for treating hyperproliferative disorders, angiogenesis disorders, cell cycle regulation disorders, autophagy regulation disorders, inflammatory disorders, and/or infectious disorders and/or for enhancing cellular engraftment and/or wound repair, as a sole agent or in combination with other active ingredients.


Boland C.R.,University of California at San Diego | Yurgelun M.B.,Dana-Farber Cancer Institute
CMGH Cellular and Molecular Gastroenterology and Hepatology | Year: 2017

Gastric cancer is a common disease worldwide, typically associated with acquired chronic inflammation in the stomach, related in most instances to infection by Helicobacter pylori. A small percentage of cases occurs in familial clusters, and some of these can be linked to specific germline mutations. This article reviews the historical background to the current understanding of familial gastric cancer, focuses on the entity of hereditary diffuse gastric cancer, and also reviews the risks for gastric cancer related to a number of other familial genetic diseases. © 2017 The Authors


Mukerji S.S.,Dana-Farber Cancer Institute
Journal of Acquired Immune Deficiency Syndromes | Year: 2017

BACKGROUND:: Cerebrospinal fluid (CSF) viral escape is an increasingly recognized clinical event among HIV-1-infected adults. We analyzed longitudinal data and drug-resistance mutations to characterize profiles of HIV-1-infected patients on antiretroviral therapy with discordant CSF and plasma HIV-1 RNA levels. METHODS:: Forty-one cases of CSF escape defined as detectable CSF HIV-1 RNA when plasma levels were undetectable, or HIV-1 RNA >0.5-log higher in CSF than plasma, were identified from Boston Hospitals and National NeuroAIDS Tissue Consortium (NNTC) from 2005-2016. RESULTS:: Estimated prevalence of CSF escape in Boston and NNTC cohorts was 6.0 and 6.8%, respectively; median age was 50, duration of HIV-1 infection 17 years, CD4 count 329 cells/mm and CD4 nadir 21 cells/mm. Neurological symptoms were present in 30 cases; 4 had repeat episodes of CSF escape. Cases were classified into subtypes based plasma HIV-1 RNA levels in the preceding 24 months: high-level viremia (HLV: ≥ 1000 copies/ml), low-level viremia (LLV: 51-999 copies/ml), and plasma suppression with CSF blip or escape (CSF RNA < 200 or ≥200 copies/ml). HLV cases reported more substance abuse, while LLV or plasma suppression cases were more neurosymptomatic (81% vs. 53%); 75% of repeat CSF escape cases were classified LLV. M184V/I mutations were identified in 74% of CSF samples when plasma levels were ≤ 50 copies/ml. CONCLUSION:: Characteristics frequently observed in CSF escape include HIV-1 infection >15 years, prior LLV, and M184V/I mutations in CSF. Classification based on preceding plasma HIV RNA levels provides a useful conceptual framework to identify causal factors and test therapeutics. Copyright © 2017 Wolters Kluwer Health, Inc. All rights reserved.


Ibrahim M.,Dana-Farber Cancer Institute
Journal of Acquired Immune Deficiency Syndromes | Year: 2017

BACKGROUND:: HIV point-of-care (POC) testing allows for early infant HIV diagnosis and treatment, but POC accuracy at birth and in the setting of antiretroviral prophylaxis for the prevention of mother-to-child HIV transmission (MTCT) is unknown. METHODS:: We evaluated the Cepheid Xpert® HIV-1 Qual POC test against the Roche Taqman HIV-1 PCR platform using dried blood spots from 15 HIV-infected and 75 HIV-exposed uninfected newborns. These infants were screened for HIV at <96 hours of life at 5 hospital maternity wards in Botswana; all infants received post-exposure antiretroviral prophylaxis (PEP) and most mothers received 3-drug antiretroviral therapy in pregnancy and at delivery. RESULTS:: Fourteen of 15 PCR positive samples tested positive by Cepheid POC, yielding a sensitivity of 93.3% (95%CI: 68.1-99.8%). Baseline viral load among positive infants ranged from <40 to >10,000,000 copies/ml, with a median of 2,403 copies/mL. The HIV RNA for the infant with false negative POC testing was 1,661 copies/mL. Of note, two infants with low HIV RNA (< 40 copies/mL and 272 copies/ml) were correctly identified as HIV positive by Cepheid POC. All of the 75 PCR-negative samples tested negative by Cepheid POC, yielding a specificity of 100% (95% CI: 96.1 –100%). DISCUSSION:: Our study demonstrates high sensitivity and specificity for the Cepheid POC assay in the first week of life despite early infection and antiretroviral prophylaxis. This platform may be a useful approach for adding early infant HIV diagnosis to current testing programs. Copyright © 2017 Wolters Kluwer Health, Inc. All rights reserved.


The nucleolar factor, digestive organ expansion factor (DEF), has a key role in ribosome biogenesis, functioning in pre-ribosomal RNA (pre-rRNA) processing as a component of the small ribosomal subunit (SSU) processome. Here we show that the peripheral sympathetic nervous system (PSNS) is very underdeveloped in def-deficient zebrafish, and that def haploinsufficiency significantly decreases disease penetrance and tumor growth rate in a MYCN-driven transgenic zebrafish model of neuroblastoma that arises in the PSNS. Consistent with these findings, DEF is highly expressed in human neuroblastoma, and its depletion in human neuroblastoma cell lines induces apoptosis. Interestingly, overexpression of MYCN in zebrafish and in human neuroblastoma cells results in the appearance of intermediate pre-rRNAs species that reflect the processing of pre-rRNAs through Pathway 2, a pathway that processes pre-rRNAs in a different temporal order than the more often used Pathway 1. Our results indicate that DEF and possibly other components of the SSU processome provide a novel site of vulnerability in neuroblastoma cells that could be exploited for targeted therapy.Oncogene advance online publication, 6 March 2017; doi:10.1038/onc.2016.527. © 2017 The Author(s)


Cutler C.S.,Dana-Farber Cancer Institute | Koreth J.,Dana-Farber Cancer Institute | Ritz J.,Dana-Farber Cancer Institute
Blood | Year: 2017

Clinical outcomes for patients undergoing allogeneic hematopoietic stem cell transplantation continue to improve, but chronicgraft-versus-host disease (GVHD) remains a common toxicity and major cause of nonrelapse morbidity and mortality. Treatment of chronic GVHD has previously relied primarily on corticoste-roids and other broadly immune sup-pressive agents. However, conventional immune suppressive agents have limited clinical efficacy in chronic GVHD, and prolonged immune suppressive treatments result in additional toxicities that further limit clinical recovery from transplant and return to normal daily function. Recent advances in our understanding of the immune pathology of chronic GVHD offer the possibility that new therapeutic approaches can be directed in more precise ways to target specific immunologic mechanisms and pathways. In this review, we briefly summarize current standard treatment options and present new therapeutic approaches that are supported by preclinical studies and early-phase clinical trials suggesting that these approaches may have clinical utility for treatment or prevention of chronic GVHD. Further evaluation of these new therapeutic options in well-designed prospective multicenter trials are needed to identify the most effective new agents and improve outcomes for patients with chronic GVHD. © 2017 by The American Society of Hematology.


The original version of this article unfortunately contained a mistake. The middle initial of Patrick A. Ott was not captured. The correct name is now presented above. © 2017, Springer Science+Business Media New York.


Steensma D.P.,Dana-Farber Cancer Institute
Leukemia Research | Year: 2017

In biology, the term “clone” is most widely used to designate genetically identical cells or organisms that are asexually descended from a common progenitor. The concept of clonality in hematology-oncology has received much attention in recent years, as the advent of next-generation sequencing platforms has provided new tools for detection of clonal populations in patients, and experiments on primary cells have provided fascinating new insights into the clonal architecture of human malignancies. The term “clone” is used more loosely by the general public to mean any close or identical copy. Cloning of humans has been a staple of science fiction films and dystopian novels since Aldous Huxley's Brave New World was published in 1932. Here I trace the origin and evolution of the word clone, from its first use as an agricultural and botanical term in 1903, to its widespread adoption in biology, adaptation by artists, and contemporary use in hematology-oncology. © 2017 Elsevier Ltd


Rajabi H.,Dana-Farber Cancer Institute | Kufe D.,Dana-Farber Cancer Institute
Biochimica et Biophysica Acta - Reviews on Cancer | Year: 2017

The MUC1 gene evolved in mammalian species to provide protection of epithelia. The transmembrane MUC1 C-terminal subunit (MUC1-C) signals stress to the interior of the epithelial cell and, when overexpressed as in most carcinomas, functions as an oncoprotein. MUC1-C induces the epithelial-mesenchymal transition (EMT) by activating the inflammatory NF-κB p65 pathway and, in turn, the EMT-transcriptional repressor ZEB1. Emerging evidence has indicated that MUC1-C drives a program integrating the induction of EMT with activation of stem cell traits, epigenetic reprogramming and immune evasion. This mini-review focuses on the potential importance of this MUC1-C program in cancer progression. © 2017 Elsevier B.V.


Mouw K.W.,Dana-Farber Cancer Institute
Cancers | Year: 2017

Most bladder tumors have complex genomes characterized by a high mutation burden as well as frequent copy number alterations and chromosomal rearrangements. Alterations in DNA repair pathways—including the double-strand break (DSB) and nucleotide excision repair (NER) pathways—are present in bladder tumors and may contribute to genomic instability and drive the tumor phenotype. DNA damaging such as cisplatin, mitomycin C, and radiation are commonly used in the treatment of muscle-invasive or metastatic bladder cancer, and several recent studies have linked specific DNA repair pathway defects with sensitivity to DNA damaging-based therapy. In addition, tumor DNA repair defects have important implications for use of immunotherapy and other targeted agents in bladder cancer. Therefore, efforts to further understand the landscape of DNA repair alterations in bladder cancer will be critical in advancing treatment for bladder cancer. This review summarizes the current understanding of the role of DNA repair pathway alterations in bladder tumor biology and response to therapy. © 2017 by the authors; licensee MDPI, Basel, Switzerland.


Clement J.M.,University of Connecticut | Sweeney C.J.,Dana-Farber Cancer Institute
Journal of Oncology Practice | Year: 2017

Oligometastatic disease was postulated byHellman andWeichselbaum in 1995 to be a disease state that may reflect a time point in themalignant process thatmay be amenable to local therapies to allow for patients to achieve a durable response or possible cure despite having advanced disease. Aggressive metastasis-directed therapy has been used inmalignancies such as renal cell carcinoma, non-small-cell lung cancer, and colorectal cancer with some evidence of long-term benefit in selected patients. Recently, it has been proposed that some men with oligometastatic hormone-sensitive prostate cancermay also benefit frommetastasis-directed therapy. As with most malignancies, optimal therapy for prostate cancer relies on multimodal therapy, best highlighted by the survival benefit seen in high-volume metastatic prostate cancer with the addition of docetaxel to androgen-deprivation therapy. This is becoming increasingly evident for oligometastatic prostate cancer, with emerging data sets suggesting a possible benefit of local ablative therapies for metastatic lesions combined with androgendeprivation therapy. However, the bulk of the data is retrospective and thus subject to bias. Ongoing clinical trials are evaluating combination therapy to help elucidate the role of each therapy separately and together to determine optimal interventions for this population. This clinical review discusses the retrospective data evaluating local therapies such as radiation and surgeryinmenwithlymphnode-positive disease,aswellaslimitedbonemetastases,andoutlines ongoing, prospective clinical trials designed to further investigate the role of multimodality therapy in the outcomes of men with oligometastatic hormone-sensitive prostate cancer. Copyright © 2017 by American Society of Clinical Oncology.


Reardon D.A.,Dana-Farber Cancer Institute | Mitchell D.A.,University of Florida
Seminars in Immunopathology | Year: 2017

In this review, we focus on the biologic advantages of dendritic cell-based vaccinations as a therapeutic strategy for cancer as well as preclinical and emerging clinical data associated with such approaches for glioblastoma patients. © 2017, Springer-Verlag Berlin Heidelberg.


Hermel D.J.,University of Southern California | Ott P.,Dana-Farber Cancer Institute
Cancer and Metastasis Reviews | Year: 2017

Both immune checkpoint inhibitors and molecularly targeted agents have dramatically improved clinical outcomes for patients with metastatic melanoma. These two therapeutic approaches harness distinct mechanistic pathways—on the one hand, monoclonal antibodies against the immune checkpoints CTLA-4 and PD-1/PD-L1 stimulate the T cell mediated host immune response, while targeted inhibitors of the proto-oncogenes BRAF and MEK disrupt constitutive kinase activity responsible for tumor growth. The prospect of combining these two treatment modalities has been proposed as a potential way to increase overall response rate, extend durability of the anti-tumor response, and circumvent the immune-mediated resistance to targeted therapy. This review explores the preclinical rationale—building upon a wealth of in vitro and in vivo studies—for improved anti-tumor efficacy from combined immune checkpoint inhibition and targeted therapy. In the process, we detail the early clinical trials that have assessed the compatibility of combining these two therapies and the unexpected challenges faced from studies showing increased toxicity from these regimens. Ultimately, with more clinical data expected to mature and accrue in the near future, we elucidate a potentially novel and promising strategy for patients with advanced melanoma. © 2017 Springer Science+Business Media New York


Otto T.,Dana-Farber Cancer Institute | Otto T.,RWTH Aachen | Sicinski P.,Dana-Farber Cancer Institute
Nature Reviews Cancer | Year: 2017

Cancer is characterized by uncontrolled tumour cell proliferation resulting from aberrant activity of various cell cycle proteins. Therefore, cell cycle regulators are considered attractive targets in cancer therapy. Intriguingly, animal models demonstrate that some of these proteins are not essential for proliferation of non-transformed cells and development of most tissues. By contrast, many cancers are uniquely dependent on these proteins and hence are selectively sensitive to their inhibition. After decades of research on the physiological functions of cell cycle proteins and their relevance for cancer, this knowledge recently translated into the first approved cancer therapeutic targeting of a direct regulator of the cell cycle. In this Review, we focus on proteins that directly regulate cell cycle progression (such as cyclin-dependent kinases (CDKs)), as well as checkpoint kinases, Aurora kinases and Polo-like kinases (PLKs). We discuss the role of cell cycle proteins in cancer, the rationale for targeting them in cancer treatment and results of clinical trials, as well as the future therapeutic potential of various cell cycle inhibitors. © 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.


OBJECTIVES:: Nitrite inhalants (poppers) are commonly used recreational drugs among men who have sex with men (MSM) and were previously associated with elevated rates of high-risk sexual behavior, HIV and HHV-8 seroconversion, and transient immunosuppressive effects in experimental models. Whether long-term popper use is associated with cancer risk among MSM in the HAART era is unclear. DESIGN:: Prospective cohort study of cancer risk in 3223 HIV-infected and -uninfected MSM in the Multicenter AIDS Cohort Study from 1996–2010. METHODS:: Poisson regression models were used to examine the association between heavy popper use (defined as daily or weekly use for at least one year) and risk of individual cancers or composite category of virus-associated cancers. RESULTS:: Among all participants, heavy popper use was not associated with increased risk of any individual cancers. Among HIV-uninfected men ages 50–70, heavy popper use was associated with increased risk of virus-associated cancer with etiologies linked to HPV, HHV-8, and EBV in models adjusted for demographics, number of sexual partners, immunological parameters (CD4 counts or CD4/CD8 ratios), and HBV/HCV (IRR, 3.24; 95% CI, 1.05–9.96) or sexually transmitted infections (IRR 3.03, 95% CI, 1.01–9.09), as was cumulative use over a 5-year period (IRR 1.012, 95% CI 1.003–1.021; p?=?0.007). There was no significant association between heavy popper use and virus-associated cancer in HIV-infected men. CONCLUSIONS:: Long-term heavy popper use is associated with elevated risk of some virus-associated cancers with etiologies related to HPV, HHV-8, and EBV infections in older HIV-uninfected MSM independent of sexual behavior and immunological parameters. Copyright © 2017 Wolters Kluwer Health, Inc.


Liu X.S.,Dana-Farber Cancer Institute | Mardis E.R.,Ohio State University
Cell | Year: 2017

Cancer immunogenomics originally was framed by research supporting the hypothesis that cancer mutations generated novel peptides seen as “non-self” by the immune system. The search for these “neoantigens” has been facilitated by the combination of new sequencing technologies, specialized computational analyses, and HLA binding predictions that evaluate somatic alterations in a cancer genome and interpret their ability to produce an immune-stimulatory peptide. The resulting information can characterize a tumor's neoantigen load, its cadre of infiltrating immune cell types, the T or B cell receptor repertoire, and direct the design of a personalized therapeutic. © 2017 Elsevier Inc.


Vander Heiden M.G.,Massachusetts Institute of Technology | Vander Heiden M.G.,Dana-Farber Cancer Institute | DeBerardinis R.J.,University of Texas Southwestern Medical Center
Cell | Year: 2017

Transformed cells adapt metabolism to support tumor initiation and progression. Specific metabolic activities can participate directly in the process of transformation or support the biological processes that enable tumor growth. Exploiting cancer metabolism for clinical benefit requires defining the pathways that are limiting for cancer progression and understanding the context specificity of metabolic preferences and liabilities in malignant cells. Progress toward answering these questions is providing new insight into cancer biology and can guide the more effective targeting of metabolism to help patients. © 2017 Elsevier Inc.


Oncogenic driver mutations are those that provide a proliferative or survival advantage to neoplastic cells, resulting in clonal selection. Although most cancer-causing mutations have been detected in the protein-coding regions of the cancer genome; driver mutations have recently also been discovered within noncoding genomic sequences. Thus, a current challenge is to gain precise understanding of how these unique genomic elements function in cancer pathogenesis, while clarifying mechanisms of gene regulation and identifying new targets for therapeutic intervention. Here we report a C-to-T single nucleotide transition that occurs as a somatic mutation in noncoding sequences 4 kb upstream of the transcriptional start site of the LMO1 oncogene in primary samples from patients with T-cell acute lymphoblastic leukaemia. This single nucleotide alteration conforms to an APOBEC-like cytidine deaminase mutational signature, and generates a new binding site for the MYB transcription factor, leading to the formation of an aberrant transcriptional enhancer complex that drives high levels of expression of the LMO1 oncogene. Since APOBEC-signature mutations are common in a broad spectrum of human cancers, we suggest that noncoding nucleotide transitions such as the one described here may activate potent oncogenic enhancers not only in T-lymphoid cells but in other cell lineages as well.Leukemia advance online publication, 28 March 2017; doi:10.1038/leu.2017.75. © 2017 The Author(s)


News Article | April 26, 2017
Site: www.eurekalert.org

The Howard Hughes Medical Institute's (HHMI) Medical Research Fellows Program has selected 79 talented medical and veterinary students to conduct in-depth, mentored biomedical research. Fifty-three percent of the awardees are female, the greatest representation of women in the program to date. Starting this summer, each fellow will spend a year pursuing basic, translational, or applied biomedical research at one of 32 academic or nonprofit research institutions across the United States. "The Med Fellows Program allows exceptional MD, DVM, and DDS students to effectively shift course and conduct rigorous research at top institutions throughout the country," says David Asai, senior director in science education at HHMI. "It's an extraordinary opportunity for future physicians, veterinarians, and dentists to explore the intersection of medicine and scientific discovery, and we hope that each student comes away further empowered to pursue a career as a physician-scientist." Now, 28 years after the Med Fellows Program was first launched, it has helped more than 1,700 medical, veterinary, and dental students establish a foothold in the research world. In this year's group, 18% of the fellows are from minority groups typically underrepresented in the biomedical sciences, and seven fellows will continue their research for another year. Tolu Rosanwo, a second-year fellow and medical student at Case Western Reserve University School of Medicine, says the program is a gift, but for Rosanwo, it was a gift that left her wanting more. "I couldn't leave just as my research was starting to show promise," she says. "I'm still intrigued by my initial question, and I want to see it through." That initial question dates back to Rosanwo's childhood, growing up with two siblings with sickle cell anemia. Her curiosity about what caused them to be sick turned into a committed desire to understand and contribute to a treatment for the disorder. Now, in the laboratory of George Daley, Dean of Harvard Medical School and an alumnus of the HHMI Investigator Program, she's trying to tackle that question. "An important and profound place to be is in between science and patients," she says. "I want to be a physician whose patient care is informed by research, and vice versa." Anna Cheng, a first-year fellow and current medical student at University of South Florida Morsani College of Medicine, started dabbling in the scientific method as a high school student. Science had always interested her, but when her best friend and her godmother found themselves in a fight against cancer, Cheng decided to narrow her scientific focus. "My best friend was diagnosed with leukemia and my godmother with ovarian cancer. I wanted to understand why - to figure it out," she says. "Yes, I was interested in cancer research, but I had personal factors that really drove me." During her undergraduate studies at Duke University, Cheng continued to make time for lab research, fitting it in over summers and in between coursework. And though she valued the experiences, the fleeting glimpses of bench time only whet her appetite for more. The Med Fellows Program, she says, provided her the opportunity for more sustained exposure to research. "I feel so fortunate, because now I get to pursue a project for an entire year," she says. After a thoughtful pause, she amends her statement. "But the program's experience isn't really just a year. It's something that will serve me well for the rest of my career." The Med Fellows Program takes a multilevel mentoring approach to help incoming fellows get off to a strong start, make new connections, and access a network of support throughout their fellowship year. Various meetings bring the fellows together to connect with newly minted Med Fellow alumni, early-career faculty, and senior investigators to participate in seminars and learn from physician-scientists at various career stages. The most direct form of support comes from each fellow's mentor. Cathy Wu, an alumna from the early days of the Med Fellows Program and associate professor at the Dana-Farber Cancer Institute, will be mentoring her third med fellow this fall. "The fellows are such a terrific bunch - they're brimming with enthusiasm, super smart, and eager to learn," Wu says. As someone who took great inspiration from her own mentors as a student in the program, Wu emphasizes that the mentor-mentee relationship is a crucial part in learning how to approach investigation. "Part of the Med Fellows Program is getting a sense of the opportunities and resources available - having the latitude to explore and learn about the investigative process. When I was a fellow, the program helped me cement research as part of my medical career," she says. "I'm eager for these students to have their year, too." In collaboration with HHMI, five partners - the American Society of Human Genetics, Burroughs Wellcome Fund, Citizens United for Research in Epilepsy, Foundation Fighting Blindness, and Parkinson's Foundation - will fund 8 of the 79 aspiring physician- and veterinarian- scientists, bringing the program's total investment to $3.4 million. The Howard Hughes Medical Institute plays an important role in advancing scientific research and education in the United States. Its scientists, located across the country and around the world, have made important discoveries that advance both human health and our fundamental understanding of biology. The Institute also aims to transform science education into a creative, interdisciplinary endeavor that reflects the excitement of real research. HHMI's headquarters are located in Chevy Chase, Maryland, just outside Washington, D.C.


The Department of Biomedical Informatics at Harvard Medical School has named Bill Geary to its advisory council. Geary joins a group of distinguished individuals and thought leaders charged with advising department chair Isaac Kohane as he scales up the research and education activities at Harvard Medical School’s newest academic department. The Department of Biomedical Informatics was established in 2015 to propel a radical transformation in scientific discovery, clinical medicine and population health by harnessing the power of computation to generate new insights. The department seeks to develop the methods, tools and infrastructure required for a new generation of research investigators and health care providers to move biomedicine forward by taking full advantage of existing and emerging data resources. Geary is a general partner and cofounder of Flare Capital Partners, a healthcare technology and digital health venture capital firm. Prior to that, Geary was with North Bridge Venture Partners since inception,  a partner at Hambro International Equity Partners, and the chief financial officer of MathSoft, a science and engineering applications software start-up. Geary holds an undergraduate degree from the Carroll School of Management at Boston College and served as chair of the university’s Board of Trustees. Geary is a member of the Massachusetts General Hospital Institute of Health Professions Board of Trustees. He was previously appointed by the Massachusetts governor to the oversight council of the Center for Health Information and Analysis. Additionally, Geary represents Flare Capital Partners on the Boards of Directors as an investor in numerous healthcare technology and digital health companies. Harvard Medical School  Harvard Medical School (http://hms.harvard.edu) has more than 11,000 faculty working in 10 academic departments located at the School’s Boston campus or in hospital-based clinical departments at 15 Harvard-affiliated teaching hospitals and research institutes: Beth Israel Deaconess Medical Center, Boston Children’s Hospital, Brigham and Women’s Hospital, Cambridge Health Alliance, Dana-Farber Cancer Institute, Harvard Pilgrim Health Care Institute, Hebrew SeniorLife, Joslin Diabetes Center, Judge Baker Children’s Center, Massachusetts Eye and Ear/Schepens Eye Research Institute, Massachusetts General Hospital, McLean Hospital, Mount Auburn Hospital, Spaulding Rehabilitation Network and VA Boston Healthcare System.


News Article | April 17, 2017
Site: www.eurekalert.org

Multiple myeloma is a cancer of the plasma cells, which are white blood cells produced in bone marrow that churn out antibodies to help fight infection. When plasma cells become cancerous, they produce abnormal proteins, and the cells can build up in bone marrow, ultimately seeping into the bloodstream. The disease is typically diagnosed through a bone marrow biopsy, in which a needle is inserted near a patient's hip bone to suck out a sample of bone marrow -- a painful process for many patients. Clinicians can then isolate and analyze the plasma cells in the bone marrow sample to determine if they are cancerous. There is currently no way to easily detect plasma cells that have escaped into the bloodstream. Circulating plasma cells are not normally found in healthy people, and the ability to detect these cells in blood could enable doctors to diagnose and track the progression of multiple myeloma. Now engineers at MIT have devised a microfluidic technique to capture and count circulating plasma cells from small samples of blood. The technique, which relies on conventional blood draws, may provide patients with a less painful test for multiple myeloma. "Procedures of the traditional tissue biopsy are painful, associated with complications such as potential infections, and often available only in central hospitals which require patients to travel long distances," says former MIT postdoc Mohammad Qasaimeh. "Capturing plasma cells from blood samples can serve as a liquid biopsy, which can be performed in clinics as often as required, and serve as a diagnostic and prognostic test during and after chemotherapy treatment. Moreover, captured cells can be used for drug testing and thus serve as a tool for personalized medicine." Qasaimeh and his colleagues have published their results today in the journal Scientific Reports. His co-authors include Rohit Karnik, an associate professor in MIT's Department of Mechanical Engineering; Yichao Wu and Suman Bose, both former students; Jeffrey Karp, an associate professor in the Harvard-MIT Division of Health Sciences and Technology; and Rao Prabhala, an instructor in medicine at Dana-Farber Cancer Institute and Harvard Medical School. The group's technique builds on a microfluidic design that was previously developed by George Whitesides, a professor of chemistry at Harvard University. Whitesides and his colleagues fabricated a small microchip, the channel of which they etched with repeating, V-shaped grooves, similar to a herringbone pattern. The grooves cause any fluid flowing through the microchip to swirl about in eddies, rather passing straight through. The cells within the fluid therefore have a higher chance of making contact with the floor of the device, as first shown by Memhmet Toner at Massachusetts General Hospital. Researchers including Karnik have since reproduced this microfluidic design, coating the microchip's floor with certain molecules to attract cells of interest. In its latest work, Karnik's team used the microfluidic herringbone design to capture circulating plasma cells. They coated the channels of a microchip, about the size of a glass slide, with CD138, an antibody that is also expressed on the membranes of plasma cells. The team then flowed small, 1-milliliter samples of blood through the device. The herringbone grooves circulated the blood in the microfluidic channels, where the antibodies, acting as tiny Velcro pads, grabbed onto any passing plasma cells while letting the rest of the blood flow out of the device. Once the cells were isolated in the microchip, the researchers could count the cells, as well determine the kinds of antibodies that each cell secretes. "With the ease of a blood draw" The researchers tested the device using blood samples from healthy donors as well as patients with the disease. After counting the number of cells captured in each sample, they observed very low numbers of circulating plasma cells in healthy samples -- about two to five cells per milliliter of blood -- versus substantially higher counts in patients diagnosed with multiple myeloma, of about 45 to 184 cells per milliliter. The team also analyzed the captured plasma cells to determine the type of antibodies they produced. Plasma cells can generate one of two kinds of antibodies, known as kappa- and lambda-type. In addition to conducting bone marrow biopsies, clinicians can analyze blood samples for the ratio of these two antibodies, which can be an indicator of how the disease is progressing. Karnik and his colleagues determined the ratio of plasma cells producing kappa- and lambda-type antibodies, and compared them to conventional blood tests for the same antibodies, for both healthy subjects and patients with multiple myeloma. Encouragingly, they found both sets of results matched, validating the microfluidic device's accuracy. Surprisingly, the team noted that patients who were in remission exhibited higher counts of circulating plasma cells than healthy donors. These same patients had shown normal ratios of antibodies in conventional blood tests. Karnik says that the group's new device may reveal more subtle information about a patient's state, even in remission. "When patients go into remission, their antibody levels can look normal," Karnik says. "But we detect a level of circulating plasma cells that is above the baseline. It's hard to tell whether these cells are cancerous, but at least this technique is giving us more information. With the ease of a blood draw, this may enable us to track cancer in a much better way." Karnik adds that in the future, researchers may use the group's design to perform genetic tests on the captured cells, or to look for mutations in the cells that may further characterize the disease. "We can capture and stain these cells in the device, which opens the possibility of studying whether there are new mutations in the cells," Karnik says. "With cancers like multiple myeloma, even for patients in remission, cancer can recur. Detecting the level or mutation of plasma cells in blood might provide an early detection method for these patients." This research was supported, in part, by the National Institutes of Health and the Al Jalila Foundation.


News Article | May 3, 2017
Site: www.futurity.org

A new study shows that gene editing using CRISPR/Cas9 technology can work in rhesus monkey embryos. The results, published in the current issue of Human Molecular Genetics, open the door for pursuing gene editing in nonhuman primates as models for new therapies, including pharmacological, gene-, and stem cell-based therapies, says Keith Latham, animal science professor at Michigan State University and lead author of the study. “Our paper is the first in the US to publish on the use of this technology in nonhuman primate embryos,” he says. “Using nonhuman primate embryos is important because the closer we can approximate the human condition in the animal model, the better the chances of developing successful treatments as well as limiting risks that may be encountered in clinical trials.” While mice are mammals, they bear litters rather than individual offspring. Their anatomy and physiology differ in many respects from humans. While many advances in understanding diseases have been made first using mouse models, making the leap from a successful mouse study to clinical trials can be difficult or impossible for some areas of research. “If scientists want to test drugs for dementia, Alzheimer’s, or autism, ideal models would react similarly to humans in regards to the reduction of symptoms, outbreak of side effects, such as enduring the same lesions as humans do, or exhibiting similar behavioral characteristics,” says Latham. “Nonhuman primates are much better models for such diseases. And in terms of some surgical procedures, implants, developing prosthetics, or other therapies, nonhuman primates can prove better suited than rodents.” CRISPR has opened the door to do gene editing in many species other than mice. Developing this technology in nonhuman primates in the US would allow more scientists in this country to incorporate these models into their research, he adds. The advances will allow scientists to move forward and tackle some of the technical barriers related to the research. Other issues that may be later resolved are the commitment to increased costs and longer waiting times when using nonhuman primates. Fruit flies, often used in genetic studies, reproduce in two weeks. Rodents, with pre-disposed genetic characteristics, can be easily ordered and shipped to laboratories within days. Committing to raising nonhuman primates can cost around $15,000 and can take as long as four-to-six years to have a mature monkey with the desired genetic characteristics. The high-efficiency of gene editing that scientists are now able to achieve makes it worth the cost and the wait, Latham says. To conduct the research, Latham worked with the California National Primate Research Center, where the monkey embryos were produced, in collaboration with his co-investigator Catherine VandeVoort, an expert in nonhuman primate reproduction. Daniel Bauer, at Harvard Medical School, Boston Children’s Hospital, and Dana-Farber Cancer Institute also collaborated on the study. “Extreme amounts of care go into maintaining the well-being of the monkeys,” says Latham. “They follow strict protocols to ensure this is a priority. Funding came from the National Institutes of Health, Michigan State’s AgBioResearch, Michigan State, the National Institute of Diabetes and Digestive and Kidney Disease, the Burroughs Wellcome Fund, American Society of Hematology, Charles H. Hood Foundation, and Cooley’s Anemia Foundation.


News Article | May 1, 2017
Site: www.chromatographytechniques.com

Mice have been and will continue to be good base models for human medicinal advances. However, their size and some of their physiological differences leave them lacking in important areas of human medicine, including neurological and reproductive research. In a study led by Michigan State University, scientists have shown that gene editing using CRISPR/Cas9 technology can be quite effective in rhesus monkey embryos ­– the first time this has been demonstrated in the U.S. The results, published in the current issue of Human Molecular Genetics, open the door for pursuing gene editing in nonhuman primates as models for new therapies, including pharmacological, gene- and stem cell-based therapies, said Keith Latham, MSU animal science professor and lead author of the study. “Our paper is the first in the U.S. to publish on the use of this technology in nonhuman primate embryos,” he said. “Using nonhuman primate embryos is important because the closer we can approximate the human condition in the animal model, the better the chances of developing successful treatments as well as limiting risks that may be encountered in clinical trials.” While mice are mammals, they bear litters rather than individual offspring. Their anatomy and physiology differ in many respects from humans. While many advances in understanding diseases have been made first using mouse models, making the leap from a successful mouse study to clinical trials can be difficult or impossible for some areas of research. “If scientists want to test drugs for dementia, Alzheimer’s or autism, ideal models would react similarly to humans in regards to the reduction of symptoms, outbreak of side effects, such as enduring the same lesions as humans do, or exhibiting similar behavioral characteristics,” said Latham, who’s with the College of Agriculture and Natural Resources and an MSU AgBioResearch scientist. “Nonhuman primates are much better models for such diseases. And in terms of some surgical procedures, implants, developing prosthetics, or other therapies, nonhuman primates can prove better suited than rodents.” CRISPR has opened the door to do gene editing in many species other than mice. Developing this technology in nonhuman primates in the U.S. would allow more scientists in this country to incorporate these models into their research, he added. The advances will allow scientists to move forward and tackle some of the technical barriers related to the research. Other issues that may be later resolved are the commitment to increased costs and longer waiting times when using nonhuman primates. Fruit flies, often used in genetic studies, reproduce in two weeks. Rodents, with pre-disposed genetic characteristics, can be easily ordered and shipped to laboratories within days. Committing to raising nonhuman primates can cost around $15,000 and can take as long as four to six years to have a mature monkey with the desired genetic characteristics. The high-efficiency of gene editing that scientists are now able to achieve makes it worth the cost and the wait, Latham said. To conduct the research, Latham partnered with the California National Primate Research Center, where the monkey embryos were produced, in collaboration with his co-investigator Catherine VandeVoort, an expert in nonhuman primate reproduction. Daniel Bauer, at Harvard Medical School, Boston Children’s Hospital and Dana-Farber Cancer Institute also collaborated on the study. The resources offered by the CNPRC were crucial for this work, Latham said. “Extreme amounts of care go into maintaining the well-being of the monkeys,” he said. “They follow strict protocols to ensure this is a priority. So being able to conduct the science here at Michigan State while partnering with the center is the best combination of science and animal welfare.”


News Article | May 1, 2017
Site: www.PR.com

Santa Barbara, CA, May 01, 2017 --( “Dr. Miller has a very real and genuine empathy for those who have been given a diagnosis they cannot control and has dedicated his life to helping people prepare for death,” said Dream Foundation’s Chief Executive Officer Kisa Heyer. “Dream Foundation joins Dr. Miller in the belief that dying is not about the disease but rather making the most out of the remaining days that life offers.” As Honorary Medical Chair, Dr. Miller will provide guidance and support to the Dream Foundation team about the palliative care of Dreamers, and allow Dream Foundation to continue focusing on improving the quality of life for the patients and families Dream Foundation is honored to serve. “Death presents us all with the creative challenge of living the best life we can while we can, not just for ourselves but for each other,” says Dr. Miller. “Dream Foundation proves this point and I’m thrilled and proud to be part of it.” Dr. BJ Miller sees patients in the Symptom Management Service of the UCSF Helen Diller Family Comprehensive Cancer Center, one of the very first outpatient palliative care clinics in the US. BJ Miller, a native of Chicago, studied art history as an undergraduate at Princeton University. He worked for several years for art and disability-rights nonprofit organizations before earning a medical degree at UCSF. He completed an internal medicine residency at Cottage Hospital in Santa Barbara, where he was chief resident, and a fellowship in Hospice and Palliative Medicine at Harvard Medical School, working at the Massachusetts General Hospital and Dana-Farber Cancer Institute. In his work, he connects art, spirituality and medicine in end-of-life care. Miller is an assistant clinical professor of medicine in the Division of General Internal Medicine. Miller’s TED Talk, “What Really Matters at the End of Life,” has garnered over 5.5 million views to date and ranked among the Top 15 Most Viewed Talks of 2015. About Dream Foundation: Dream Foundation, the only national dream-granting organization for terminally-ill adults, fulfills final Dreams that provide inspiration, comfort and closure at the end of life. With the support of a nationwide network of volunteers, hospices, health care organizations and committed donors, Dream Foundation has given life to more than 25,000 final Dreams over the past two decades and has never turned down a qualified applicant. Dream Foundation does not receive any federal or state funding and relies solely on individual donations and corporate partnerships to fund its programs. The Foundation is proud to maintain Charity Navigator’s four-star rating—its highest—for sound fiscal management ensuring its donors and partners that their investment will be used wisely. For more information, please visit DreamFoundation.org. Click here to view the list of recent Press Releases from Dream Foundation


News Article | May 4, 2017
Site: www.eurekalert.org

Already extolled for their health benefits as a food compound, omega-3 fatty acids now appear to also play a critical role in preserving the integrity of the blood-brain barrier, which protects the central nervous system from blood-borne bacteria, toxins and other pathogens, according to new research from Harvard Medical School. Reporting in the May 3 issue of Neuron, a team led by Chenghua Gu, associate professor of neurobiology at Harvard Medical School, describes the first molecular explanation for how the barrier remains closed by suppressing transcytosis--a process for transporting molecules across cells in vesicles, or small bubbles. They found that the formation of these vesicles is inhibited by the lipid composition of blood vessel cells in the central nervous system, which involves a balance between omega-3 fatty acids and other lipids maintained by the lipid transport protein Mfsd2a. While the blood-brain barrier is a critical evolutionary mechanism that protects the central nervous system from harm, it also represents a major hurdle for delivering therapeutic compounds into the brain. Blocking the activity of Mfsd2a may be a strategy for getting drugs across the barrier and into the brain to treat a range of disorders such as brain cancer, stroke and Alzheimer's. "This study presents the first clear molecular mechanism for how low rates of transcytosis are achieved in central nervous system blood vessels to ensure the impermeable nature of the blood-brain barrier," Gu said. "There is still a lot we do not know about how the barrier is regulated. A better understanding of the mechanisms will allow us to begin to manipulate it, with the goal of getting therapeutics into the brain safely and effectively." The blood-brain barrier is composed of a network of endothelial cells that line blood vessels in the central nervous system. These cells are connected by tight junctions that prevent most molecules from passing between them, including many drugs that target brain diseases. In a 2014 study published in Nature, Gu and colleagues discovered that a gene and the protein it encodes, Mfsd2a, inhibits transcytosis and is critical for maintaining the blood-brain barrier. Mice that lacked Mfsd2a, which is found only in endothelial cells in the central nervous system, had higher rates of vesicle formation and leaky barriers, despite having normal tight junctions. In the current study, Gu, Benjamin Andreone, a neurology student at Harvard Medical School, and their colleagues examined how Mfsd2a maintains the blood-brain barrier. Mfsd2a is a transporter protein that moves lipids containing DHA, an omega-3 fatty acid found in fish oil and nuts, into the cell membrane. To test the importance of this function to the barrier, the team created mice with a mutated form of Mfsd2a, in which a single amino acid substitution shut down its ability to transport DHA. They injected these mice with a fluorescent dye and observed leaky blood-brain barriers and higher rates of vesicle formation and transcytosis--mirroring mice that completely lacked Mfsd2a. A comparison of the lipid composition of endothelial cells in brain capillaries against those in lung capillaries--which do not have barrier properties and do not express Mfsd2a--revealed that brain endothelial cells had around two- to five-fold higher levels of DHA-containing lipids. Additional experiments revealed that Mfsd2a suppresses transcytosis by inhibiting the formation of caveolae--a type of vesicle that forms when a small segment of the cell membrane pinches in on itself. As expected, mice with normal Cav-1, a protein required for caveolae formation, and that lacked Mfsd2a exhibited higher transcytosis and leaky barriers. Mice that lacked both Mfsd2a and Cav-1, however, had low transcytosis and impermeable blood-brain barriers. "We think that by incorporating DHA into the membrane, Mfsd2a is fundamentally changing the composition of the membrane and making it unfavorable for the formation of these specific type of caveolae," Andreone said. "Even though we observed low rates of vesicle formation and transcytosis in blood-brain barrier cells decades ago, this is the first time that a cellular mechanism can explain this phenomenon." By revealing the role of Mfsd2a and how it controls transcytosis in the central nervous system, Gu and her colleagues hope to shed light on new strategies to open the barrier and allow drugs to enter and remain in the brain. They are currently testing the efficacy of an antibody that potentially can temporarily block the function of Msfd2a, and whether caveolae-mediated transcytosis can be leveraged to shuttle therapeutics across the barrier. "Many of the drugs that could be effective against diseases of the brain have a hard time crossing the blood-brain barrier," Gu said. "Suppressing Mfsd2a may be an additional strategy that allows us to increase transcytosis, and deliver cargo such as antibodies against beta-amyloid or compounds that selectively attack tumor cells. If we can find a way across the barrier, the impact would be enormous." This work was supported by The National Institutes of Health (grants F31NS090669, NS092473), the Mahoney postdoctoral fellowship, the Howard Hughes Medical Institute, the Kaneb Fellowship, Fidelity Biosciences Research Initiative and the Harvard Blavatnik Biomedical Accelerator. Harvard Medical School has more than 11,000 faculty working in 10 academic departments located at the School's Boston campus or in hospital-based clinical departments at 15 Harvard-affiliated teaching hospitals and research institutes: Beth Israel Deaconess Medical Center, Boston Children's Hospital, Brigham and Women's Hospital, Cambridge Health Alliance, Dana-Farber Cancer Institute, Harvard Pilgrim Health Care Institute, Hebrew SeniorLife, Joslin Diabetes Center, Judge Baker Children's Center, Massachusetts Eye and Ear/Schepens Eye Research Institute, Massachusetts General Hospital, McLean Hospital, Mount Auburn Hospital, Spaulding Rehabilitation Network and VA Boston Healthcare System.


News Article | May 1, 2017
Site: www.businesswire.com

BOSTON--(BUSINESS WIRE)--The Publicity Club of New England is thrilled to announce the finalists of the 2017 Bell Ringer Awards. Following a submission period that included an impressive number of data-driven, head-turning entries, and a rigorous judging panel comprised of industry leaders, the Publicity Club looks forward to celebrating the winners at the 49th annual awards ceremony on June 1. “Our finalists reflect the top talent and innovation that characterizes Boston’s PR and marketing industry,” said Cheryl Gale, Publicity Club president and managing director of March Communications. “This year’s finalists are standouts in digital, experiential, and more – and they share the common thread of driving business results and brand equity for their clients, teams, or partners.” This year, the Bell Ringers event will be returning to the Revere Hotel’s Liberty Hall in Boston. An evening of merriment and reflection on New England’s best PR and marketing campaigns and initiatives of the year, the celebration is a long-standing tradition that is open to all industry professionals. This year’s event will feature a delicious family-style dinner and complimentary wine with the meal. The always-popular cocktail hour and awards presentation will feature new and exciting additions as well. This year’s host will be Josh Brogadir, anchor and reporter for WCVB, Boston’s ABC affiliate. Brogadir is a bilingual news reporter, sports anchor, and play-by-play broadcaster with more than a decade of experience on-screen. The Publicity Club’s board of directors is thrilled to have him and his many talents lined up for the ceremony. Tickets and full tables of different sizes and variations are available to purchase here. Single seats for Publicity Club members are available at $125. Non-members may purchase single seats for $150. Full tables of six, eight, and 16 are available for purchase, and special packages are available for purchasing more than one table. The 2017 Bell Ringer Award Finalists Include: 360PR+ Adams & Knight Adam Ritchie Brand Direction Agency 451 Boston University PRLab Boston Children's Hospital Brodeur Partners C + C East Cone Communications CTP Cronin & Company Dana-Farber Cancer Institute Duffy & Shanley Food Truck Festivals of America Harvard Medical School Harvard Pilgrim Health Care Hollywood Public Relations InkHouse JaiCG John Guilfoil Public Relations LEWIS Lois Paul & Partners March Communications Massachusetts Dental Society Matter Communications McLean Hospital MSLGROUP MassHousing May Institute PAN Communications Porter Novelli Racepoint Global Rainier Communications Raytheon Integrated Defense Systems RF | Binder Rinck Advertising SHIFT Communications TEXT100 Thomson Communications Version 2.0 Communications W2O Group Wayfair WE Worldwide About the Publicity Club of New England Founded in 1949, The Publicity Club of New England is the region’s oldest not-for-profit public relations trade organization. The Publicity Club strives to promote and encourage involvement in the communications industry and specifically the professions of public relations, promotions, and marketing. Additional information about monthly Publicity Club programs, social and networking events, the “Bell Ringer” blog, and the Bell Ringer Awards ceremony, can be found at www.pubclub.org. Follow us on Twitter @PubClubofNE (#pcne).


The present invention is based on the identification of novel biomarkers predictive of responsiveness to anti-immune checkpoint inhibitor therapies.


Patent
Dana-Farber Cancer Institute | Date: 2017-03-22

In one aspect, a method for forming particles is provided. The method may allow biocompatible particles comprising an agent (e.g., pharmaceutically active agent) to be produced absent one or more purification step (e.g., removal of excess reagent). In certain embodiments, particles, produced as described herein, can be utilized in a pharmaceutical composition and/or administered to a subject without further purification. The lack of one or more purification step may simplify manufacturing and/or minimize or eliminate the loss of agent from the particle after formation. In some embodiments, the method comprises associating albumin with an agent and crosslinking to form particles, such that little or no cytotoxic molecules are produced and/or remain after particle formation. Cross-linked albumin particles formed via the methods described herein may serve as biocompatible carriers for a variety of agents.


The present invention is based on the identification of novel biomarkers predictive of responsiveness to anti-immune checkpoint inhibitor therapies.


News Article | May 1, 2017
Site: www.eurekalert.org

EAST LANSING, Mich. - Mice have been and will continue to be good base models for human medicinal advances. However, their size and some of their physiological differences leave them lacking in important areas of human medicine, including neurological and reproductive research. In a study led by Michigan State University, scientists have shown that gene editing using CRISPR/Cas9 technology can be quite effective in rhesus monkey embryos ¬- the first time this has been demonstrated in the U.S. The results, published in the current issue of Human Molecular Genetics, open the door for pursuing gene editing in nonhuman primates as models for new therapies, including pharmacological, gene- and stem cell-based therapies, said Keith Latham, MSU animal science professor and lead author of the study. "Our paper is the first in the U.S. to publish on the use of this technology in nonhuman primate embryos," he said. "Using nonhuman primate embryos is important because the closer we can approximate the human condition in the animal model, the better the chances of developing successful treatments as well as limiting risks that may be encountered in clinical trials." While mice are mammals, they bear litters rather than individual offspring. Their anatomy and physiology differ in many respects from humans. While many advances in understanding diseases have been made first using mouse models, making the leap from a successful mouse study to clinical trials can be difficult or impossible for some areas of research. "If scientists want to test drugs for dementia, Alzheimer's or autism, ideal models would react similarly to humans in regards to the reduction of symptoms, outbreak of side effects, such as enduring the same lesions as humans do, or exhibiting similar behavioral characteristics," said Latham, who's with the College of Agriculture and Natural Resources and an MSU AgBioResearch scientist. "Nonhuman primates are much better models for such diseases. And in terms of some surgical procedures, implants, developing prosthetics, or other therapies, nonhuman primates can prove better suited than rodents." CRISPR has opened the door to do gene editing in many species other than mice. Developing this technology in nonhuman primates in the U.S. would allow more scientists in this country to incorporate these models into their research, he added. The advances will allow scientists to move forward and tackle some of the technical barriers related to the research. Other issues that may be later resolved are the commitment to increased costs and longer waiting times when using nonhuman primates. Fruit flies, often used in genetic studies, reproduce in two weeks. Rodents, with pre-disposed genetic characteristics, can be easily ordered and shipped to laboratories within days. Committing to raising nonhuman primates can cost around $15,000 and can take as long as 4-6 years to have a mature monkey with the desired genetic characteristics. The high-efficiency of gene editing that scientists are now able to achieve makes it worth the cost and the wait, Latham said. To conduct the research, Latham partnered with the California National Primate Research Center, where the monkey embryos were produced, in collaboration with his co-investigator Dr. Catherine VandeVoort, an expert in nonhuman primate reproduction. Dr. Daniel Bauer, at Harvard Medical School, Boston Children's Hospital and Dana-Farber Cancer Institute also collaborated on the study. The resources offered by the CNPRC were crucial for this work, Latham said. "Extreme amounts of care go into maintaining the well-being of the monkeys," he said. "They follow strict protocols to ensure this is a priority. So being able to conduct the science here at Michigan State while partnering with the center is the best combination of science and animal welfare." Additional MSU scientists contributing to the study include Uros Midic, Kailey Vincent and Benjamin Goheen. This research was funded by the National Institutes of Health, MSU AgBioResearch, MSU, the National Institute of Diabetes and Digestive and Kidney Disease, the Burroughs Wellcome Fund, American Society of Hematology, Charles H. Hood Foundation and Cooley's Anemia Foundation. Michigan State University has been working to advance the common good in uncommon ways for more than 150 years. One of the top research universities in the world, MSU focuses its vast resources on creating solutions to some of the world's most pressing challenges, while providing life-changing opportunities to a diverse and inclusive academic community through more than 200 programs of study in 17 degree-granting colleges. For MSU news on the Web, go to MSUToday. Follow MSU News on Twitter at twitter.com/MSUnews.


PLYMOUTH MEETING, Pa. and TARRYTOWN, N.Y., May 08, 2017 (GLOBE NEWSWIRE) -- Inovio Pharmaceuticals, Inc. (NASDAQ:INO) and Regeneron Pharmaceuticals, Inc. (NASDAQ:REGN) today announced a clinical study agreement for a phase 1b/2a immuno-oncology trial. The study will be conducted by Inovio in patients with newly diagnosed glioblastoma multiforme (GBM) and will evaluate Regeneron’s PD-1 inhibitor, REGN2810, in combination with Inovio’s INO-5401 T cell activating immunotherapy encoding multiple antigens and INO-9012, an immune activator encoding IL-12. The open-label trial, which is expected to begin later this year, is designed to evaluate the safety and efficacy of the combination therapy in approximately 50 patients. The study will be conducted at 30 U.S. sites and the primary endpoints are safety and tolerability. The study will also evaluate immunological impact, progression-free survival and overall survival. GBM is a devastating disease for both patients and caregivers. It is the most aggressive brain cancer and its prognosis is extremely poor, despite a limited number of new therapies approved over the last ten years. The median overall survival for patients receiving standard of care therapy is approximately 15 months and the average five-year survival rate is less than three percent. “Regeneron’s approach to oncology includes evaluating the combination of innovative therapies that act on diverse pathways and targets,” said Israel Lowy, MD, PhD, Vice President of Translation Sciences and Oncology, Regeneron. “Using our PD-1 inhibitor as a therapeutic backbone alongside Inovio’s T cell-generating therapies offers a new path for exploration and heightens the potential to develop new, desperately-needed treatment options for patients.” “The unmet need for effective therapies in GBM remains extremely high. Certain immune checkpoint inhibitors have shown efficacy in certain cancers, but evidence increasingly suggests that the benefit of checkpoint inhibitors can be enhanced when used in combination with therapies that generate T cells,” said David Reardon, MD, Clinical Director of the Center for Neuro-Oncology at Dana-Farber Cancer Institute and Professor of Medicine at Harvard Medical School. “Inovio has an innovative immunotherapy platform which has shown the ability to generate antigen-specific T cells in disease areas including cancer. We look forward to exploring the potential of combining a T cell generating immunotherapy encoding multiple antigens with REGN2810, a PD-1 checkpoint inhibitor.” Dr. J. Joseph Kim, Inovio's President and Chief Executive Officer, said, “I am a strong believer in this combination regimen approach  in immuno-oncology: use Inovio immunotherapies to generate killer T cells to turn ‘cold’ tumors into ‘hot’ tumors, then block T cell suppression via checkpoint inhibition. This step with INO-5401 is very important for us in 2017, as we believe INO-5401 has the potential to be a powerful cancer immunotherapeutic in combination with promising checkpoint inhibitors such as Regeneron’s REGN2810, and we look forward to investigating its potential for GBM and multiple other challenging cancers.” Under the terms of the agreement, the trial will be solely conducted and funded by Inovio, based upon a mutually agreed upon study design, and Regeneron will supply REGN2810. Inovio and Regeneron will jointly conduct immunological analyses in support of the study. Regeneron, in collaboration with Sanofi, is developing REGN2810 both alone and in combination with other therapies for the treatment of various cancers. Glioblastoma, also known as glioblastoma multiforme (GBM), is the most common and aggressive type of brain cancer. GBM is usually found in the area of the brain which controls some of the most advanced processes, such as speech and emotions. GBM treatment is often limited by the tumor location and ability of a patient to tolerate surgery. Consequently, it is a particularly difficult cancer to treat. Worldwide there are an estimated 240,000 cases of brain and nervous system tumors per year; GBM is the most common and most lethal of these tumors. INO-5401 includes Inovio’s SynCon® antigens for WT1, hTERT and PSMA and has the potential to be a powerful cancer immunotherapy in combination with checkpoint inhibitors. The National Cancer Institute previously highlighted WT1, hTERT and PSMA among a list of attractive cancer antigens, designating them as high priorities for cancer immunotherapy development. WT1 was at the top of the list. The hTERT antigen relates to 85 percent of cancers, and WT1 and PSMA antigens are also widely prevalent in many cancers. Regeneron (NASDAQ:REGN) is a leading science-based biopharmaceutical company that discovers, invents, develops, manufactures and commercializes medicines for the treatment of serious medical conditions. Regeneron commercializes medicines for eye diseases, high LDL-cholesterol, atopic dermatitis and a rare inflammatory condition and has product candidates in development in other areas of high unmet medical need, including rheumatoid arthritis, asthma, pain, cancer and infectious diseases. For additional information about the company, please visit www.regeneron.com or follow @Regeneron on Twitter. Inovio is taking immunotherapy to the next level in the fight against cancer and infectious diseases. We are the only immunotherapy company that has reported generating T cells in vivo in high quantity that are fully functional and whose killing capacity correlates with relevant clinical outcomes with a favorable safety profile. With an expanding portfolio of immune therapies, the company is advancing a growing preclinical and clinical stage product pipeline. Partners and collaborators include MedImmune, The Wistar Institute, University of Pennsylvania, DARPA, GeneOne Life Science, Plumbline Life Sciences, ApolloBio Corporation, Drexel University, NIH, HIV Vaccines Trial Network, National Cancer Institute, U.S. Military HIV Research Program, and Laval University. For more information, visit www.inovio.com. Inovio statement This press release contains certain forward-looking statements relating to our business, including our plans to develop electroporation-based drug and gene delivery technologies and DNA vaccines, our expectations regarding our research and development programs and our capital resources. Actual events or results may differ from the expectations set forth herein as a result of a number of factors, including uncertainties inherent in pre-clinical studies, clinical trials and product development programs, including the cancer immunotherapy INO-5401, the availability of funding to support continuing research and studies in an effort to prove safety and efficacy of electroporation technology as a delivery mechanism or develop viable DNA vaccines, our ability to support our broad pipeline of SynCon® active immunotherapy and vaccine products, the ability of our collaborators to attain development and commercial milestones for products we license and product sales that will enable us to receive future payments and royalties, the adequacy of our capital resources, the availability or potential availability of alternative therapies or treatments for the conditions targeted by the company or its collaborators, including alternatives that may be more efficacious or cost effective than any therapy or treatment that the company and its collaborators hope to develop, issues involving product liability, issues involving patents and whether they or licenses to them will provide the company with meaningful protection from others using the covered technologies, whether such proprietary rights are enforceable or defensible or infringe or allegedly infringe on rights of others or can withstand claims of invalidity and whether the company can finance or devote other significant resources that may be necessary to prosecute, protect or defend them, the level of corporate expenditures, assessments of the company's technology by potential corporate or other partners or collaborators, capital market conditions, the impact of government healthcare proposals and other factors set forth in our Annual Report on Form 10-K for the year ended December 31, 2016, and other regulatory filings from time to time. There can be no assurance that any product in Inovio's pipeline will be successfully developed or manufactured, that final results of clinical studies will be supportive of regulatory approvals required to market licensed products, or that any of the forward-looking information provided herein will be proven accurate. Regeneron Forward-Looking Statements and Use of Digital Media This news release includes forward-looking statements that involve risks and uncertainties relating to future events and the future performance of Regeneron Pharmaceuticals, Inc. (“Regeneron” or the "Company"), and actual events or results may differ materially from these forward-looking statements. Words such as "anticipate," "expect," "intend," "plan," "believe," "seek," "estimate," variations of such words, and similar expressions are intended to identify such forward-looking statements, although not all forward-looking statements contain these identifying words. These statements concern, and these risks and uncertainties include, among others, the nature, timing, and possible success and therapeutic applications of Regeneron's products, product candidates, and research and clinical programs now underway or planned, including without limitation Regeneron’s immuno-oncology program, REGN2810 (Regeneron’s PD-1 inhibitor), and the Phase 1b/2a clinical trial evaluating the combination therapy consisting of REGN2810 and Inovio Pharmaceuticals, Inc.’s T cell activator INO-5401 and immune activator INO-9012 in patients with newly-diagnosed glioblastoma multiforme (the “GBM Combination Therapy”); unforeseen safety issues resulting from the administration of products and product candidates in patients, including serious complications or side effects in connection with the use of Regeneron's and its collaborators’ product candidates in clinical trials, such as the GBM Combination Therapy; determinations by regulatory and administrative governmental authorities which may delay or restrict Regeneron's ability to continue to develop or commercialize Regeneron's products and product candidates; the likelihood, timing, and scope of possible regulatory approval and commercial launch of Regeneron's late-stage product candidates and new indications for marketed products; ongoing regulatory obligations and oversight impacting Regeneron’s marketed products, research and clinical programs (such as the trial evaluating the GBM Combination Therapy), and business, including those relating to patient privacy; competing drugs and product candidates that may be superior to Regeneron's products and product candidates; uncertainty of market acceptance and commercial success of Regeneron's products and product candidates and the impact of studies (whether conducted by Regeneron or others and whether mandated or voluntary) on the commercial success of Regeneron's products and product candidates; the ability of Regeneron’s collaborators, suppliers, or other third parties to perform filling, finishing, packaging, labelling, distribution, and other steps related to Regeneron’s products and product candidates; coverage and reimbursement determinations by third-party payers, including Medicare and Medicaid; the ability of Regeneron to manufacture and manage supply chains for multiple products and product candidates; unanticipated expenses; the costs of developing, producing, and selling products; the ability of Regeneron to meet any of its sales or other financial projections or guidance and changes to the assumptions underlying those projections or guidance; the potential for any license or collaboration agreement, including Regeneron's agreements with Sanofi, Bayer HealthCare LLC, and Teva Pharmaceutical Industries Ltd. (or their respective affiliated companies, as applicable), as well as Regeneron’s clinical study agreement with Inovio Pharmaceuticals, Inc. discussed in this news release, to be cancelled or terminated without any further product success; and risks associated with intellectual property of other parties and pending or future litigation relating thereto, including without limitation the patent litigation relating to Praluent® (alirocumab) Injection, the permanent injunction granted by the United States District Court for the District of Delaware that, if upheld on appeal, would prohibit Regeneron and Sanofi from marketing, selling, or commercially manufacturing Praluent in the United States, the outcome of any appeals regarding such injunction, the ultimate outcome of such litigation, and the impact any of the foregoing may have on Regeneron’s business, prospects, operating results, and financial condition. A more complete description of these and other material risks can be found in Regeneron's filings with the United States Securities and Exchange Commission, including its Form 10-K for the year ended December 31, 2016 and its Form 10-Q for the quarterly period ended March 31, 2017. Any forward-looking statements are made based on management's current beliefs and judgment, and the reader is cautioned not to rely on any forward-looking statements made by Regeneron. Regeneron does not undertake any obligation to update publicly any forward-looking statement, including without limitation any financial projection or guidance, whether as a result of new information, future events, or otherwise. Regeneron uses its media and investor relations website and social media outlets to publish important information about the Company, including information that may be deemed material to investors. Financial and other information about Regeneron is routinely posted and is accessible on Regeneron’s media and investor relations website (http://newsroom.regeneron.com) and its Twitter feed (http://twitter.com/regeneron).


GBM is a devastating disease for both patients and caregivers. It is the most aggressive brain cancer and its prognosis is extremely poor, despite a limited number of new therapies approved over the last ten years. The median overall survival for patients receiving standard of care therapy is approximately 15 months and the average five-year survival rate is less than three percent. "The unmet need for effective therapies in GBM remains extremely high. Certain immune checkpoint inhibitors have shown efficacy in certain cancers, but evidence increasingly suggests that the benefit of checkpoint inhibitors can be enhanced when used in combination with therapies that generate T cells," said David Reardon, MD, Clinical Director of the Center for Neuro-Oncology at Dana-Farber Cancer Institute and Professor of Medicine at Harvard Medical School. "Inovio has an innovative immunotherapy platform which has shown the ability to generate antigen-specific T cells in disease areas including cancer. We look forward to exploring the potential of combining a T cell generating immunotherapy encoding multiple antigens with REGN2810, a PD-1 checkpoint inhibitor." Under the terms of the agreement, the trial will be solely conducted and funded by Inovio, based upon a mutually agreed upon study design, and Regeneron will supply REGN2810. Inovio and Regeneron will jointly conduct immunological analyses in support of the study. Regeneron, in collaboration with Sanofi, is developing REGN2810 both alone and in combination with other therapies for the treatment of various cancers. "Regeneron's approach to oncology includes evaluating the combination of innovative therapies that act on diverse pathways and targets," said Israel Lowy, MD, PhD, Vice President of Translation Sciences and Oncology, Regeneron. "Using our PD-1 inhibitor as a therapeutic backbone alongside Inovio's T cell-generating therapies offers a new path for exploration and heightens the potential to develop new, desperately-needed treatment options for patients." "I am a strong believer in this combination regimen approach in immuno-oncology: use Inovio immunotherapies to generate killer T-cells to turn 'cold' tumors into 'hot' tumors, then block T cell suppression via checkpoint inhibition," said J. Joseph Kim, PhD, Inovio's President and Chief Executive Officer. "This step with INO-5401 is very important for us in 2017, as we believe INO-5401 has the potential to be a powerful cancer immunotherapeutic in combination with promising checkpoint inhibitors such as Regeneron's REGN2810, and we look forward to investigating its potential for GBM and multiple other challenging cancers." About Glioblastoma Glioblastoma, also known as glioblastoma multiforme (GBM), is the most common and aggressive type of brain cancer. GBM is usually found in the area of the brain which controls some of the most advanced processes such as speech and emotions. GBM treatment is often limited by the tumor location and ability of a patient to tolerate surgery. Consequently, it is a particularly difficult cancer to treat. Worldwide there are an estimated 240,000 cases of brain and nervous system tumors per year; GBM is the most common and most lethal of these tumors. About INO-5401 INO-5401 includes Inovio's SynCon® antigens for WT1, hTERT and PSMA and has the potential to be a powerful cancer immunotherapy in combination with checkpoint inhibitors. The National Cancer Institute previously highlighted WT1, hTERT and PSMA among a list of attractive cancer antigens, designating them as high priorities for cancer immunotherapy development. WT1 was at the top of the list. The hTERT antigen relates to 85 percent of cancers, and WT1 and PSMA antigens are also widely prevalent in many cancers. About Regeneron Pharmaceuticals, Inc. Regeneron (NASDAQ: REGN) is a leading science-based biopharmaceutical company that discovers, invents, develops, manufactures and commercializes medicines for the treatment of serious medical conditions. Regeneron commercializes medicines for eye diseases, high LDL-cholesterol, atopic dermatitis and a rare inflammatory condition and has product candidates in development in other areas of high unmet medical need, including rheumatoid arthritis, asthma, pain, cancer and infectious diseases. For additional information about the company, please visit www.regeneron.com or follow @Regeneron on Twitter. About Inovio Pharmaceuticals, Inc. Inovio is taking immunotherapy to the next level in the fight against cancer and infectious diseases. We are the only immunotherapy company that has reported generating T cells in vivo in high quantity that are fully functional and whose killing capacity correlates with relevant clinical outcomes with a favorable safety profile. With an expanding portfolio of immune therapies, the company is advancing a growing preclinical and clinical stage product pipeline. Partners and collaborators include Regeneron, MedImmune, The Wistar Institute, University of Pennsylvania, DARPA, GeneOne Life Science, Plumbline Life Sciences, ApolloBio Corporation, Drexel University, NIH, HIV Vaccines Trial Network, National Cancer Institute, U.S. Military HIV Research Program, and Laval University. For more information, visit www.inovio.com. Regeneron Forward-Looking Statements and Use of Digital Media This news release includes forward-looking statements that involve risks and uncertainties relating to future events and the future performance of Regeneron Pharmaceuticals, Inc. ("Regeneron" or the "Company"), and actual events or results may differ materially from these forward-looking statements. Words such as "anticipate," "expect," "intend," "plan," "believe," "seek," "estimate," variations of such words, and similar expressions are intended to identify such forward-looking statements, although not all forward-looking statements contain these identifying words. These statements concern, and these risks and uncertainties include, among others, the nature, timing, and possible success and therapeutic applications of Regeneron's products, product candidates, and research and clinical programs now underway or planned, including without limitation Regeneron's immuno-oncology program, REGN2810 (Regeneron's PD-1 inhibitor), and the Phase 1b/2a clinical trial evaluating the combination therapy consisting of REGN2810 and Inovio Pharmaceuticals, Inc.'s T cell activator INO-5401 and immune activator INO-9012 in patients with newly-diagnosed glioblastoma multiforme (the "GBM Combination Therapy"); unforeseen safety issues resulting from the administration of products and product candidates in patients, including serious complications or side effects in connection with the use of Regeneron's and its collaborators' product candidates in clinical trials, such as the GBM Combination Therapy; determinations by regulatory and administrative governmental authorities which may delay or restrict Regeneron's ability to continue to develop or commercialize Regeneron's products and product candidates; the likelihood, timing, and scope of possible regulatory approval and commercial launch of Regeneron's late-stage product candidates and new indications for marketed products; ongoing regulatory obligations and oversight impacting Regeneron's marketed products, research and clinical programs (such as the trial evaluating the GBM Combination Therapy), and business, including those relating to patient privacy; competing drugs and product candidates that may be superior to Regeneron's products and product candidates; uncertainty of market acceptance and commercial success of Regeneron's products and product candidates and the impact of studies (whether conducted by Regeneron or others and whether mandated or voluntary) on the commercial success of Regeneron's products and product candidates; the ability of Regeneron's collaborators, suppliers, or other third parties to perform filling, finishing, packaging, labelling, distribution, and other steps related to Regeneron's products and product candidates; coverage and reimbursement determinations by third-party payers, including Medicare and Medicaid; the ability of Regeneron to manufacture and manage supply chains for multiple products and product candidates; unanticipated expenses; the costs of developing, producing, and selling products; the ability of Regeneron to meet any of its sales or other financial projections or guidance and changes to the assumptions underlying those projections or guidance; the potential for any license or collaboration agreement, including Regeneron's agreements with Sanofi, Bayer HealthCare LLC, and Teva Pharmaceutical Industries Ltd. (or their respective affiliated companies, as applicable), as well as Regeneron's clinical study agreement with Inovio Pharmaceuticals, Inc. discussed in this news release, to be cancelled or terminated without any further product success; and risks associated with intellectual property of other parties and pending or future litigation relating thereto, including without limitation the patent litigation relating to Praluent® (alirocumab) Injection, the permanent injunction granted by the United States District Court for the District of Delaware that, if upheld on appeal, would prohibit Regeneron and Sanofi from marketing, selling, or commercially manufacturing Praluent in the United States, the outcome of any appeals regarding such injunction, the ultimate outcome of such litigation, and the impact any of the foregoing may have on Regeneron's business, prospects, operating results, and financial condition. A more complete description of these and other material risks can be found in Regeneron's filings with the United States Securities and Exchange Commission, including its Form 10-K for the year ended December 31, 2016 and its Form 10-Q for the quarterly period ended March 31, 2017. Any forward-looking statements are made based on management's current beliefs and judgment, and the reader is cautioned not to rely on any forward-looking statements made by Regeneron. Regeneron does not undertake any obligation to update publicly any forward-looking statement, including without limitation any financial projection or guidance, whether as a result of new information, future events, or otherwise. Regeneron uses its media and investor relations website and social media outlets to publish important information about the Company, including information that may be deemed material to investors. Financial and other information about Regeneron is routinely posted and is accessible on Regeneron's media and investor relations website (http://newsroom.regeneron.com) and its Twitter feed (http://twitter.com/regeneron). Inovio Forward-Looking Statements This press release contains certain forward-looking statements relating to our business, including our plans to develop electroporation-based drug and gene delivery technologies and DNA vaccines, our expectations regarding our research and development programs and our capital resources. Actual events or results may differ from the expectations set forth herein as a result of a number of factors, including uncertainties inherent in pre-clinical studies, clinical trials and product development programs, including the cancer immunotherapy INO-5401, the availability of funding to support continuing research and studies in an effort to prove safety and efficacy of electroporation technology as a delivery mechanism or develop viable DNA vaccines, our ability to support our broad pipeline of SynCon® active immunotherapy and vaccine products, the ability of our collaborators to attain development and commercial milestones for products we license and product sales that will enable us to receive future payments and royalties, the adequacy of our capital resources, the availability or potential availability of alternative therapies or treatments for the conditions targeted by the company or its collaborators, including alternatives that may be more efficacious or cost effective than any therapy or treatment that the company and its collaborators hope to develop, issues involving product liability, issues involving patents and whether they or licenses to them will provide the company with meaningful protection from others using the covered technologies, whether such proprietary rights are enforceable or defensible or infringe or allegedly infringe on rights of others or can withstand claims of invalidity and whether the company can finance or devote other significant resources that may be necessary to prosecute, protect or defend them, the level of corporate expenditures, assessments of the company's technology by potential corporate or other partners or collaborators, capital market conditions, the impact of government healthcare proposals and other factors set forth in our Annual Report on Form 10-K for the year ended December 31, 2016, and other regulatory filings from time to time. There can be no assurance that any product in Inovio's pipeline will be successfully developed or manufactured, that final results of clinical studies will be supportive of regulatory approvals required to market licensed products, or that any of the forward-looking information provided herein will be proven accurate. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/regeneron-and-inovio-enter-immuno-oncology-clinical-study-agreement-for-glioblastoma-combination-therapy-300452464.html


Since 1980, tens of thousands of cyclists have ridden in the Pan-Mass Challenge to raise a total of $547 million for the Jimmy Fund of the Dana-Farber Cancer Institute. The race proceeds are the Institute's greatest contribution and comprise more than 50 percent of the Jimmy Fund’s annual revenue. This year, TheStreet biotech writer Adam Feuerstein is riding for his fourth time and aims to raise $41,600 to achieve a four-year sum of $100,000. “I’m riding the PMC so more Jimmys can ring a bell and dance a jig,” Feuerstein wrote on his fundraising site. The Dana Farber Institute facilitates more than 380,000 patient visits per year and has a hand in 760 clinical trials. It runs in affiliation with Harvard Medical School and the college’s various research centers. Sponsored by the Boston Red Sox Foundation and New Balance, the fundraiser will take place Aug. 5 and 6, and 100 percent of donations will support research and treatment at the Institute. Feuerstein On Neurotrope: The Study Failed And There Was Never ‘A Lot Of Hope Here’ ___________ Image Credit: "Sailors assigned to amphibious assault ship USS Wasp (LHD 1) spend time with young patients during a Caps for Kids visit to the Jimmy Fund Clinic at the Dana-Farber Cancer Institute in Boston.jpg" By U.S. Navy photo by Chief Mass Communication Specialist Dave Kaylor [Public domain], via Wikimedia Commons See more from Benzinga © 2017 Benzinga.com. Benzinga does not provide investment advice. All rights reserved.


News Article | April 27, 2017
Site: globenewswire.com

NEW YORK, April 27, 2017 (GLOBE NEWSWIRE) -- Checkpoint Therapeutics, Inc. (“Checkpoint”) (OTCQX:CKPT), a Fortress Biotech (NASDAQ:FBIO) company, today announced that James F. Oliviero, President and CEO of Checkpoint, will present a company update at PIONEERS 2017, presented by Joseph Gunnar & Co., on Tuesday, May 2, 2017 at 4:30 p.m. ET. The conference will be held at the Mandarin Oriental Hotel in New York City. A live audio webcast of the presentation will be available on the Events page of the Investors & Media section of Checkpoint’s website: www.checkpointtx.com. About Checkpoint Therapeutics Checkpoint Therapeutics, Inc. (“Checkpoint”), a Fortress Biotech company, is a clinical-stage, immuno-oncology biopharmaceutical company focused on the acquisition, development and commercialization of novel, non-chemotherapy, immune-enhanced combination treatments for patients with solid tumor cancers. Checkpoint’s broad pipeline consists of fully-human, immuno-oncology and checkpoint inhibitor antibodies licensed from the Dana-Farber Cancer Institute that target programmed death-ligand 1 (“PD-L1”); glucocorticoid-induced TNFR-related protein (“GITR”); and carbonic anhydrase IX (“CAIX”). In addition, Checkpoint is developing three oral, small-molecule, targeted anti-cancer agents that inhibit epidermal growth-factor receptor (“EGFR”) mutations, the bromodomain and extra-terminal (“BET”) protein BRD4, and poly (ADP-ribose) polymerase (“PARP”). Checkpoint will also seek to expand its pipeline to create additional proprietary combination therapies that leverage the immune system and complimentary mechanisms. Checkpoint is headquartered in New York City. For more information, visit www.checkpointtx.com. Fortress Biotech, Inc. (“Fortress”) is a biopharmaceutical company dedicated to acquiring, developing and commercializing novel pharmaceutical and biotechnology products. Fortress develops and commercializes products both within Fortress and through certain of its subsidiary companies, also known as Fortress Companies. Additionally, Fortress recently acquired a controlling interest in National Holdings Corporation (NASDAQ:NHLD), a diversified independent brokerage company (together with its subsidiaries, “NHLD”). In addition to its internal development programs, Fortress leverages its biopharmaceutical business expertise and drug development capabilities and provides funding and management services to help the Fortress Companies achieve their goals. Fortress and the Fortress Companies may seek licensings, acquisitions, partnerships, joint ventures and/or public and private financings to accelerate and provide additional funding to support their research and development programs. For more information, visit www.fortressbiotech.com. Forward-Looking Statements This press release may contain “forward-looking statements” within the meaning of Section 27A of the Securities Act of 1933 and Section 21E of the Securities Exchange Act of 1934. Such statements include, but are not limited to, any statements relating to our growth strategy and product development programs and any other statements that are not historical facts. Forward-looking statements are based on management’s current expectations and are subject to risks and uncertainties that could negatively affect our business, operating results, financial condition and stock price. Factors that could cause actual results to differ materially from those currently anticipated are: the risk that Checkpoint will not be able to advance its research programs; risks related to the timing of starting and completing of clinical trials; risks inherent in research and development activities; risks related to its growth strategy; its ability to obtain, perform under and maintain financing and strategic agreements and relationships; uncertainties relating to preclinical and clinical testing; its dependence on third-party suppliers; its ability to attract, integrate, and retain key personnel; the early stage of products under development; its need for substantial additional funds; government regulation; patent and intellectual property matters; competition; as well as other risks described in Checkpoint’s public filings and reports. Checkpoint expressly disclaims any obligation or undertaking to release publicly any updates or revisions to any forward-looking statements contained herein to reflect any change in our expectations or any changes in events, conditions or circumstances on which any such statement is based, except as required by law.


Leder K.,University of Minnesota | Pitter K.,Sloan Kettering Cancer Center | Laplant Q.,Sloan Kettering Cancer Center | Ross B.D.,University of Michigan | And 4 more authors.
Cell | Year: 2014

Glioblastomas (GBMs) are the most common and malignant primary brain tumors and are aggressively treated with surgery, chemotherapy, and radiotherapy. Despite this treatment, recurrence is inevitable and survival has improved minimally over the last 50 years. Recent studies have suggested that GBMs exhibit both heterogeneity and instability of differentiation states and varying sensitivities of these states to radiation. Here, we employed an iterative combined theoretical and experimental strategy that takes into account tumor cellular heterogeneity and dynamically acquired radioresistance to predict the effectiveness of different radiation schedules. Using this model, we identified two delivery schedules predicted to significantly improve efficacy by taking advantage of the dynamic instability of radioresistance. These schedules led to superior survival in mice. Our interdisciplinary approach may also be applicable to other human cancer types treated with radiotherapy and, hence, may lay the foundation for significantly increasing the effectiveness of a mainstay of oncologic therapy. PaperClip © 2014 Elsevier Inc.


Punglia R.S.,Dana-Farber Cancer Institute | Schnitt S.J.,Dana-Farber Cancer Institute | Weeks J.C.,Beth Israel Deaconess Medical Center
Journal of the National Cancer Institute | Year: 2013

Corresponding to the increased use of mammography, the incidence of ductal carcinoma in situ (DCIS) has risen dramatically in the past 30 years. Despite its growing incidence, the treatment of DCIS remains highly variable and controversial. Although DCIS itself does not metastasize and is never lethal, it may be a precursor of invasive breast cancer and is a marker of increased breast cancer risk. Confusing a precursor lesion with cancer, many clinicians apply an invasive breast cancer treatment paradigm to DCIS patients, offering adjuvant radiation therapy and tamoxifen after diagnosis. In this commentary, we outline the issues associated with DCIS management - is DCIS a cancer, a precursor of cancer, or a marker of invasive carcinoma risk? Specifically, we argue that consideration be given to removing the term "carcinoma" from DCIS, using cancer "occurrence" to mean the diagnosis of invasive cancer after DCIS instead of "recurrence," and make the argument that a prophylactic paradigm of treatment after excision may be more appropriate. © The Author 2013. Published by Oxford University Press.


Haining W.N.,Dana-Farber Cancer Institute | Haining W.N.,The Broad Institute of MIT and Harvard | Pulendran B.,Emory Vaccine Center
Current Opinion in Immunology | Year: 2012

Molecular predictors of the response to vaccination could transform vaccine development. They would allow larger numbers of vaccine candidates to be rapidly screened, shortening the development time for new vaccines. Gene-expression based predictors of vaccine response have shown early promise. However, a limitation of gene-expression based predictors is that they often fail to reveal the mechanistic basis of their ability to classify response. Linking predictive signatures to the function of their component genes would advance basic understanding of vaccine immunity and also improve the robustness of vaccine prediction. New analytic tools now allow more biological meaning to be extracted from predictive signatures. Functional genomic approaches to perturb gene expression in mammalian cells permit the function of predictive genes to be surveyed in highly parallel experiments. The challenge for vaccinologists is therefore to use these tools to embed mechanistic insights into predictors of vaccine response. © 2012 Elsevier Ltd.


Robert C.,CNRS Gustave Roussy Institute | Schadendorf D.,University of Duisburg - Essen | Messina M.,Bristol Myers Squibb | Hodi F.S.,Dana-Farber Cancer Institute | O'Day S.,Beverly Hills Cancer Center
Clinical Cancer Research | Year: 2013

Purpose: Ipilimumab is a fully human monoclonal antibody against cytotoxic T-lymphocyte-associated antigen-4 (CTLA-4) that has been shown to improve survival in patients with pretreated, advanced melanoma in a phase III trial. Some patients in this study who initially responded to ipilimumab treatment but later progressed were eligible for retreatment with their original randomized regimen. Here, outcomes for these patients concerning baseline characteristics, best overall response, and disease control rate are assessed and considered with respect to the overall study population. Experimental Design: In the phase III study, 676 pretreated patients were randomly allocated to treatment with ipilimumab 3 mg/kg plus gp100 vaccine, ipilimumab 3 mg/kg plus placebo, or gp100 vaccine alone. Of these patients, 32 had a partial or complete objective response or stable disease after treatment and met the eligibility criteria for retreatment, although a total of 40 patients were retreated. Results: Best overall response rates (complete responses plus partial responses) for 31 retreatmenteligible patients in the ipilimumab plus gp100 and ipilimumab plus placebo groups were 3 of 23 (13.0%) and 3 of 8 (37.5%), respectively, and disease control rates were 65.2% and 75.0%. No new types of toxicities occurred during retreatment and most events were mild-to-moderate. Conclusion: Ipilimumab provided durable objective responses and/or stable disease in qualifying patients who received retreatment upon disease progression with a similar toxicity profile to that seen during their original treatment regimen. ©2013 AACR.


Wang J.-H.,Peking University | Wang J.-H.,Dana-Farber Cancer Institute
Cell Research | Year: 2012

The inside-out signaling of integrins regulates the ligand-binding affinity of the cell surface receptors in response to changes in the environment for cell survival. The specific binding to the cytoplasmic tail of integrin's β subunit by the intracellular protein talin is the key step of inside-out signaling. A pull-push mechanism has been proposed to explain how the PIP2-enriched membrane disrupts the dual auto-inhibition of the N-terminal talin-FERM domain by the C-terminal talin-rod domain such that activated talin-FERM can reach the β-tail for integrin activation. © 2012 IBCB, SIBS, CAS All rights reserved.


Sollid L.M.,University of Oslo | Pos W.,Dana-Farber Cancer Institute | Wucherpfennig K.W.,Dana-Farber Cancer Institute | Wucherpfennig K.W.,Harvard University
Current Opinion in Immunology | Year: 2014

It will soon be 50 years since the first MHC associations with human disease were described. These seminal studies opened a flourishing area of research, yet much remains to be discovered. Genome-wide association studies of autoimmune diseases have demonstrated that the MHC region has effect sizes that supersede those for any non-MHC locus for most diseases. Thus, an understanding of how particular MHC alleles confer susceptibility will be essential for a comprehensive understanding of autoimmune disease pathogenesis. Here we review recent exciting findings in this important field. © 2014 Elsevier Ltd. All rights reserved.


Tomasetti C.,Johns Hopkins University | Marchionni L.,Johns Hopkins University | Nowak M.A.,Harvard University | Parmigiani G.,Dana-Farber Cancer Institute | And 2 more authors.
Proceedings of the National Academy of Sciences of the United States of America | Year: 2015

Cancer arises through the sequential accumulation of mutations in oncogenes and tumor suppressor genes. However, how many such mutations are required for a normal human cell to progress to an advanced cancer? The best estimates for this number have been provided by mathematical models based on the relation between age and incidence. For example, the classic studies of Nordling [Nordling CO (1953) Br J Cancer 7(1):68-72] and Armitage and Doll [Armitage P, Doll R (1954) Br J Cancer 8(1):1-12] suggest that six or seven sequential mutations are required. Here, we describe a different approach to derive this estimate that combines conventional epidemiologic studies with genome-wide sequencing data: incidence data for different groups of patients with the same cancer type were compared with respect to their somatic mutation rates. In two well-documented cancer types (lung and colon adenocarcinomas), we find that only three sequential mutations are required to develop cancer. This conclusion deepens our understanding of the process of carcinogenesis and has important implications for the design of future cancer genome-sequencing efforts. © 2015, National Academy of Sciences. All rights reserved.


Patent
Dana-Farber Cancer Institute, University of Pennsylvania, Bryn Mawr College, Johns Hopkins University and Columbia University | Date: 2012-12-14

Described herein are small-molecule mimics of CD4, which both enter the Phe43 cavity and target Asp368 of gp120, the HIV-1 envelope protein. Also described herein are methods of using these compounds to inhibit the transmission or progression of HIV infection. These compounds exhibit antiviral potency greater than that of a known antiviral, NBD-556, with 100% breadth against clade B and C viruses. Importantly, the compounds do not activate HIV infection of CD4-negative, CCR5-positive cells, in contrast to NBD-556.


Grant
Agency: European Commission | Branch: FP7 | Program: CP-IP | Phase: HEALTH-2009-2.1.1-2 | Award Amount: 13.88M | Year: 2010

All cancers arise due to somatically acquired mutations in their genomes which alter the function of key cancer genes. Understanding these critical mutational events underlying cancer development is paramount for advancing prevention, early detection, monitoring and treatment of the disease. Breast cancer is the most common class of cancer diagnosed in women worldwide with more than one million cases diagnosed annually. It is responsible for >400,000 deaths per year making it the leading cause of cancer deaths in women and is the most common cause of all deaths in women aged >40yrs. Breast cancer is a heterogeneous disease with a number of subtypes. We propose here to generate complete catalogues of somatic mutations in 500 breast cancers, of the ER\ve HER2- subclass, under the International Cancer Genome Consortium model by high coverage, shotgun genome sequencing of both tumour and normal DNA. All classes of mutations are expected to be detected including base substitutions, insertions, deletions, copy number changes and rearrangements. These catalogues of mutations will afford us statistical power to identify cancer genes that are mutated at a frequency of greater than 3% in this class of breast cancer. Complementary catalogues of epigenomic changes (genome-wide DNA methylation) will be generated for the same cancer samples together with transcript expression profiles. Integrated analyses of these data will be carried out and compared to parallel datasets from other classes of breast cancer and other types of cancer. The potential clinical utility of these findings for detection and monitoring of minimal residual disease will be investigated. Finally, data will be made rapidly available to all scientific researchers with minimal restrictions. The results of this exhaustive and comprehensive set of studies will have an enormous impact on our understanding of the causes and biology of breast cancer and will lead to major advances in detection, prevention and treatment of breast cancer


News Article | November 1, 2016
Site: www.eurekalert.org

(Boston)--Implanted medical devices such as left ventricular-assist devices for patients with heart failure or other support systems for patients with respiratory, liver or other end organ disease save lives every day. However, bacteria that form infectious biofilms on those devices, called device-associated infections, not only often sabotage their success but also contribute to the rampant increase in antibiotic resistance currently seen in hospitals. As reported in Biomaterials, a team led by Joanna Aizenberg, Ph.D., and Elliot Chaikof, M.D., Ph.D., at the Wyss Institute for Biologically Inspired Engineering and the Harvard John A. Paulson School of Engineering and Applied Sciences at Harvard University (SEAS), as well as the Beth Israel Deaconess Medical Center (BIDMC), has created self-healing slippery surface coatings with medical-grade teflon materials and liquids that prevent biofilm formation on medical implants while preserving normal innate immune responses against pathogenic bacteria. The technology is based on the concept of 'slippery liquid-infused porous surfaces' (SLIPS) developed by Aizenberg, who is a Wyss Institute Core Faculty member, Professor of Chemistry and Chemical Biology and the Amy Smith Berylson Professor of Materials Science at SEAS. Inspired by the carnivorous Nepenthes pitcher plant, which uses the porous surface of its leaves to immobilize a layer of liquid water, creating a slippery surface for capturing insects, Aizenberg previously engineered industrial and medical surface coatings that are able to repel unwanted substances as diverse as ice, crude oil and biological materials. "We are developing SLIPS recipes for a variety of medical applications by working with different medical-grade materials, tuning the chemical and physical features of these solids and the infused lubricants to ensure the stability of the coating, and carefully pairing the non-fouling properties of the integrated SLIPS materials to specific disturbing factors, contaminating environments and performance requirements," said Aizenberg. "Here we have extended our repertoire of materials classes and applied the SLIPS concept very convincingly to medical-grade teflon, demonstrating its enormous potential in implanted devices prone to bacterial fouling and infection." First, the team searched ex vivo for the teflon material that would work best with a selection of compatible lubricants to provide a long-lived repellent surface against a common device-associated bacterial strain. The most advantageous teflon-lubricant combinations had to preserve the anti-bacterial activity of innate immune cells that provide the natural first-line response against invading bacteria. The winning material was 'expanded polytetrafluoroethylene' (ePTFE). Used in prosthetic grafts for cardiovascular reconstruction, mesh for hernia repair, as well as implants in a wide variety of reconstructive surgery, ePTFE tested well with lubricants with proven acceptable safety profiles. Moving to a rodent model, the team compared bacterial and tissue responses to implanted hernia meshes with or without a SLIPS surface after infecting the animals with Staphylococcus aureus. "SLIPS coatings yielded extremely favorable responses in vivo: they resisted infection by bacteria and were associated with considerably less infiltrating immune cells and inflammatory abscesses than non-coated ePTFE," said Chaikof, who is a Wyss Institute Associate Faculty member, Chairman of the Roberta and Stephen R. Weiner Department of Surgery and Surgeon-in-Chief at BIDMC. "At present, patients who receive implants for the repair, reconstruction or replacement of diseased or damaged organs or tissues or otherwise depend upon temporary life sustaining support systems, often require antibiotics at the time of implantation to keep the risk of bacterial infection at bay. SLIPS coatings one day could obviate the widespread use of antibiotics, minimize the development of antibiotic resistant microorganisms, and enhance the capacity of temporary or permanent artificial devices to resist infection," said Chaikof. "This new study by Joanna and Elliot exemplifies the Wyss Institute model in which collaborations between basic scientists focused on industrial applications and clinicians working in the medical area are fostered in a way that can lead to unexpected developments -- in this case, one that has the potential to have a major positive impact in the clinical setting," said Don Ingber, M.D., Ph.D., Founding Director of the Wyss Institute, Judah Folkman Professor of Vascular Biology at Harvard Medical School and Boston Children's Hospital, and Professor of Bioengineering at SEAS. Previous medical SLIPS applications include coatings that can repel bacteria and blood from small medical implants, tools and surgical instruments that are made of steel or, more recently, coatings that help keep the glass surfaces of endoscopy and bronchoscopy lenses free from highly contaminating body fluids and thus transparent during procedures. The Wyss Institute for Biologically Inspired Engineering at Harvard University uses Nature's design principles to develop bioinspired materials and devices that will transform medicine and create a more sustainable world. Wyss researchers are developing innovative new engineering solutions for healthcare, energy, architecture, robotics, and manufacturing that are translated into commercial products and therapies through collaborations with clinical investigators, corporate alliances, and formation of new startups. The Wyss Institute creates transformative technological breakthroughs by engaging in high risk research, and crosses disciplinary and institutional barriers, working as an alliance that includes Harvard's Schools of Medicine, Engineering, Arts & Sciences and Design, and in partnership with Beth Israel Deaconess Medical Center, Brigham and Women's Hospital, Boston Children's Hospital, Dana-Farber Cancer Institute, Massachusetts General Hospital, the University of Massachusetts Medical School, Spaulding Rehabilitation Hospital, Boston University, Tufts University, Charité - Universitätsmedizin Berlin, University of Zurich and Massachusetts Institute of Technology. The Beth Israel Deaconess Medical Center is a patient care, teaching and research affiliate of Harvard Medical School and consistently ranks as a national leader among independent hospitals in National Institutes of Health funding. BIDMC is in the community with Beth Israel Deaconess Hospital-Milton, Beth Israel Deaconess Hospital-Needham, Beth Israel Deaconess Hospital-Plymouth, Anna Jaques Hospital, Cambridge Health Alliance, Lawrence General Hospital, Signature Healthcare, Beth Israel Deaconess HealthCare, Community Care Alliance and Atrius Health. BIDMC is also clinically affiliated with the Joslin Diabetes Center and Hebrew Rehabilitation Center and is a research partner of Dana-Farber/Harvard Cancer Center and The Jackson Laboratory. BIDMC is the official hospital of the Boston Red Sox. The Harvard John A. Paulson School of Engineering and Applied Sciences serves as the connector and integrator of Harvard's teaching and research efforts in engineering, applied sciences, and technology. Through collaboration with researchers from all parts of Harvard, other universities, and corporate and foundational partners, we bring discovery and innovation directly to bear on improving human life and society.


News Article | November 10, 2016
Site: www.chromatographytechniques.com

*Editor's Note: This article is part of "Startup Series," a series of articles that profile multiple startup companies in the life science sector over the course of a few weeks. Click on the link below to access earlier articles in the series. Experienced Scientists Try to Cure Alzheimer's Using Cancer Playbook Personalized Nutrition Company Relies on DNA, Biomarkers for Menu Semma Therapeutics is fueled by one of the most powerful forces in the world—a father’s desire to cure his children. Once Doug Melton’s young children were diagnosed with type I diabetes, he turned his research efforts at Harvard toward turning stem cells into transplantable tissue. Eighteen years later, a breakthrough in Melton’s lab became the basis for Semma (named for Melton’s children Sam and Emma). Melton’s breakthrough was the ability to generate sufficient and well-functioning human pancreatic beta cells from undifferentiated pluripotent stem cells. He was able to demonstrate that he could control blood glucose levels of mice for six months using transplants of human beta cells. Melton believes he can achieve the same effect in humans, and for an even longer time period. But first, he needs a device that can hold, protect and disperse the beta cells in the body—which is where Semma comes into play. Semma is an organization of two parts. In Cambridge, Mass., Semma North comprises a team of cell biologists committed to refining and advancing Melton’s breakthrough (a paper with first author Felicia Pagliuca was published in Cell) so it can be scaled up and commercialized. Semma has already moved the beta cells from a research line to a clinically relevant cell line, making it eligible to enter the clinic and for license. Semma South is based in Providence, Rhode Island, where Semma purchased a company named CytoSolv that specialized in designing devices to hold cells for delivery to patients. They are now focused on developing macro-protection and immune-protection devices. “[We want] to be in a position where we have the best cells and hopefully the best device, or the best ability to use a third-party device, to get the two together into patients in an expedited fashion,” Semma CEO Robert Millman told Laboratory Equipment. Partnerships are incredibly important to Semma. The company already has an agreement with pharma giant Novartis, and it accepted a $5 million grant from the California Institute of Regenerative Medicine (CIRM), as well as forming a collaboration with the Harvard Stem Cell Institute, Brigham and Women’s Hospital, the Joslin Diabetes Center and the Dana-Farber Cancer Institute. The CIRM award provides funding to develop personalized cell therapy for the treatment of diabetes. Diabetic patients’ own cells will be collected, transformed first into stem cells and then differentiated into stem-cell derived pancreatic islets to use as an investigational cell therapy for diabetes. Meanwhile, the collaboration with Boston-area institutions is intended to leverage stem cell and beta cell capabilities toward a novel therapy for diabetic patients. “We were able to devise a plan for the local program, taking advantage of a broad array of unique resources in the Boston environment, that would be complementary to what is happening in California,” Millman explained. “I would like to think that both programs will move in parallel because the two will inform each other and be able to use certain information from one site to help inform the other. They are focused on two different types of patients who are insulin-dependent so it’s very complementary for everyone.” As a company, Millman said he hopes—before 2021—Semma is able to present proof-of-concept in clinical settings that diabetes can be cured with allergenic cells and protection devices. In March 2015, Semma secured $44 million in Series A funding, which is also when it signed an agreement with Novartis. While Series A pushed the project further toward clinical and enabled the purchase of CytoSolv, it can only go so far. Millman said Semms will be actively engaged in Series B discussion in the next 6 months. “In general, the successes of the regenerative medicine field will continue to push and point people to the stem cell field as not a field that has failed over the past forever, but one that is starting to show successes. We should be poised [for success], like the immunocology field four years ago and the gene therapy field 2 years ago. We hope the regenerative medicine field will now start to open up to investors as well as investigators as positive successes,” Milliman said.


SAN DIEGO, CA ¬- An immunotherapy drug able to induce lasting remissions in classical Hodgkin lymphoma may be equally effective in patients with either of two rare, aggressive forms of non-Hodgkin lymphoma, results from a small case series indicate. Dana-Farber Cancer Institute investigators who treated the patients will report their findings at the 58th annual meeting of the American Society of Hematology (ASH) on Monday, December 5, 2016. The research involved five patients with recurrent or refractory primary central nervous system lymphoma (PCNSL) or primary testicular lymphoma (PTL) who were treated with nivolumab, a drug that blocks a key protein, PD-1, on immune system T cells. The blocking allows the T cells to ignore signals that would dampen their attack on the lymphoma cells. Four of the patients had a complete response to the drug - showing no evidence of tumor on brain imaging - and one had a partial response. Both PCNSL and PTL are aggressive non-Hodgkin's lymphomas that occur outside the lymph nodes and respond poorly to conventional therapy. Nearly half of patients with PCNSL relapse within two years of diagnosis, and almost half of patients with PTL have their disease worsen after initial chemotherapy. For patients whose disease recurs or resists frontline therapy, there are few treatment options. Nivolumab has had striking success in clinical trials involving patients with classical Hodgkin lymphoma. Results from phase 1 and 2 trials show that approximately 70 percent of patients, all with drug-resistant forms of the disease, had full or partial remissions after treatment with the drug. Researchers in the lab of senior author Margaret Shipp, MD, of Dana-Farber discovered that PCNSL and PTL share a key molecular abnormality with classic Hodgkin lymphoma, leading them to hypothesize that nivolumab could be effective against these diseases as well. "There have been major advances in treatment of PCNSL, including high-dose chemotherapy and autologous stem cell transplant, particularly for young and healthy patients," said study lead author Lakshmi Nayak, MD, of Dana-Farber. "But because the median age at which patients are diagnosed is 65, transplant is often not an option. Our findings are very encouraging, particularly as the responses to nivolumab in our patients have been durable for more than 10 months." Based on their laboratory findings and clinical results, investigators have now opened a phase 2 trial of nivolumab in patients with relapsed or treatment-resistant PCNSL and PTL. Co-authors are Ann LaCasce, MD, Margaretha Roemer, Bjoern Chapuy, MD, PhD, Philippe Armand, MD, PhD, and Scott Rodig, of Dana-Farber; Fabio Iwamoto, MD, of Columbia University; and Srinivasan Mukundan Jr., of Brigham and Women's Hospital. From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world.


News Article | December 13, 2016
Site: www.eurekalert.org

Rhabdoid tumors are among the most recalcitrant childhood cancers, and scientists have long sought ways to understand what drives their resilience and makes them impervious to treatment. Now researchers from Harvard Medical School, St. Jude Children's Research Hospital and elsewhere have uncovered a molecular chain of events that interferes with a key mechanism that regulates cell behavior and controls tumor formation. Rhabdoid tumors typically start out in the kidneys, but they can also arise or migrate into the brain and other soft tissues. While rare -- they account for less than 2 percent of pediatric kidney cancers -- rhabdoid tumors are highly lethal with a survival rate of less than 25 percent. The report of the multi-institutional team's findings, published Dec. 12 in Nature Genetics, describes how the loss of a protein, SMARCB1, can disrupt the work of a regulatory mechanism, thereby fueling uncontrolled malignant cell proliferation and the continued survival of rhabdoid tumors. The absence of SMARCB1 in rhabdoid tumor cells has been known for some time, so scientists suspected it played a role in cancer development. Yet, just how it did so remained somewhat of a puzzle. The new findings provide the missing piece in that puzzle and reveal just how the absence of SMARCB1 unlocks a chain of events that culminates in the loss of cellular identity and profound aberrations in cell behavior. SMARCB1 is a key component of a protein complex known as SWI/SNF, which largely acts as a tumor suppressor. SWI/SNF works by altering the packaging of genetic material inside a cell's nucleus. Such alterations are important because they make DNA accessible to proteins that turn on gene expression, a fundamental way to regulate cell behavior and determine cell identity. "Our results shed light into the long-standing mystery of rhabdoid tumor behavior," said study co-senior author Peter Park, associate professor of biomedical Informatics at HMS. "They reveal just how SMARCB1 becomes the central character that unleashes mischief in a twisted plot of epigenetic changes that alter cell identity and fuel cancer formation." The findings, the research team said, identify possible treatment targets and provide a conceptual framework for designing therapies. In addition, the team said, the results may have relevance for other forms of cancer. "Mutations in the SWI/SNF complex occur in a broad range of human cancers so our findings may provide insight well beyond rhabdoid tumors," said Charles Roberts, co-senior author and director of the Comprehensive Cancer Center at St. Jude. The curious case of the mutation-free tumor Throughout the past decade, advances in cancer genome sequencing have revealed cancer cells have very high rates of genetic mutations. This mutability turns tumors into shape-shifters capable of evading drug therapies. But, curiously, rhabdoid tumors are among the most genomically stable and least mutable of cancers, harboring only a few genetic mutations, compared with the hundreds or thousands of mutations in other cancers. So what exactly makes these immutable tumors so pernicious, the researchers wondered? Based on the study's findings, the answer appears to lie--literally--outside of the tumor cell's DNA and in its epigenome--the separate layer of proteins and chemical modifiers that sits atop DNA and can profoundly alter its behavior. The insights illuminate a critical survival mechanism that allows rhabdoid tumors to escape the body's checks and controls. In a series of experiments with patient-derived rhabdoid tumor tissue, the investigators showed that the absence of SMARCB1 interferes with SWI/SNF's function. Researchers observed the lack of SMARCB1 dramatically reduced the levels of several other proteins that make up the SWI/SNF complex, severely weakening its regulatory ability. Specifically, SMARCB1 deletion interfered with the SWI/SNF's ability to bind to genetic switches called enhancers -- snippets of DNA that act as genome regulators to determine which genes get turned on and which ones remain dormant. Some 10,000 to 20,000 enhancers are turned on in any given cell at any given time. Because all cells in an organism share the same DNA, the activity of these genetic switches is critical to determining which genes in a cell get activated to produce what proteins. In other words, enhancers play a vital role in determining the identity and behavior of a given cell. Loss of SMARCB1, the experiments showed, led to the deactivation of many of the regular enhancers that modulate gene expression and cell behavior, while at the same time keeping another set of enhancers switched on. The researchers think it is precisely those "on" enhancers that may be critical to tumor growth and survival. "If something goes wrong in deciding which enhancers should be on, the cell loses its identity," said co-investigator Burak Han Alver, a research associate in biomedical informatics at HMS who focuses on epigenetic regulation and transcription. "When that happens, in most cases, the cells will realize there is a problem and trigger self-death. But, in rare cases, errors in the enhancer landscape can lead to cancer. This is what we observed is happening in the case of rhabdoid tumor formation." Finding a way to shut off the remaining active enhancers, the researchers said, could turn out to be a chink in the armor of rhabdoid tumors and provide a target for treatment. In a final, proof-of-concept step, the scientists restored SMARCB1 inside cell lines derived from patient tumors. The tumor cell lines stopped growing, a finding that underscores the protein's role in curbing tumor formation, the team said. In addition to Harvard Medical School and St. Jude Children's Research Hospital, the following institutions were involved in the research: Dana-Farber Cancer Institute, Boston Children's Hospital, Massachusetts General Hospital, Brigham and Women's Hospital, the Broad Institute of Harvard and MIT, the University of Southern California and the Howard Hughes Medical Institute. The work was supported by the National Institutes of Health (grants R01CA172152, R01CA113794 and U54HG006991), the Avalanna Fund, Cure ATRT Now and the Garrett B. Smith Foundation. Harvard Medical School has more than 9,500 full-time faculty working in 10 academic departments located at the School's Boston campus or in hospital-based clinical departments at 15 Harvard-affiliated teaching hospitals and research institutes: Beth Israel Deaconess Medical Center, Boston Children's Hospital, Brigham and Women's Hospital, Cambridge Health Alliance, Dana-Farber Cancer Institute, Harvard Pilgrim Health Care Institute, Hebrew SeniorLife, Joslin Diabetes Center, Judge Baker Children's Center, Massachusetts Eye and Ear/Schepens Eye Research Institute, Massachusetts General Hospital, McLean Hospital, Mount Auburn Hospital, Spaulding Rehabilitation Network and VA Boston Healthcare System.


News Article | February 19, 2017
Site: www.eurekalert.org

WASHINGTON, D.C., Feb. 19, 2017 - One year after the Global Biological Standards Institute (GBSI) issued its Reproducibility2020 challenge and action plan for the biomedical research community, the organization reports encouraging progress toward the goal to significantly improve the quality of preclinical biological research by year 2020. "Reproducibility2020 Report: Progress and Priorities," posted today on bioRxiv, identifies action and impact that has been achieved by the life science research community and outlines priorities going forward. The report is the first comprehensive review of the steps being taken to improve reproducibility since the issue became more widely known in 2012. "By far the greatest progress over these few years has been in stakeholders recognizing the severity of the problem and the importance of taking active steps for improvement," said Leonard P. Freedman, PhD, president of GBSI. "Every stakeholder group is now addressing the issues, including journals, NIH, private funders, academicians and industry. That's crucial because there is not one simple fix--it is a community-wide problem and a community-wide effort to achieve solutions." The report addresses progress in four major components of the research process: study design and data analysis, reagents and reference materials, laboratory protocols, and reporting and review. Moreover, it identifies the following broad strategies as integral to the continued improvement of reproducibility in biomedical research: 1) drive quality and ensure greater accountability through strengthened journal and funder policies; 2) create high quality online training and proficiency testing and make them widely accessible; 3) engage the research community in establishing community-accepted standards and guidelines in specific scientific areas; and 4) enhance open access to data and methodologies. Research community stakeholders have responded with innovation and policy. The community is taking more steps to work together and to tackle the complexities of the reproducibility problem. The report highlights tangible examples of community-led actions from implementing new funding guidelines and accountability to tackling industry-wide research standards and incentives for compliance. The lessons learned from these early efforts will assist all stakeholders seeking to scale up or replicate successful initiatives. "We are confident that continued transparent, global, multi-stakeholder engagement is the way forward to better, more impactful science," says Freedman. "We are calling on all stakeholders - individuals and organizations alike - to take action to improve reproducibility in the preclinical life sciences by joining an existing effort, replicating successful policies and practices, providing resources to replication efforts and taking on new opportunities." The report contains specific actions that each stakeholder group can take to enhance reproducibility. In its leadership role, GBSI will: Freedman introduced the new report at the AAAS 2017 Annual Meeting today during the session, "Rigor and Reproducibility One Year Later: How Has the Biomedical Community Responded?," hosted by GBSI. Freedman was joined by panelists Michael S. Lauer, M.D. of NIH; William G. Kaelin Jr., M.D. of the Dana-Farber Cancer Institute; and Judith Kimble University of Wisconsin-Madison. "The research culture, particularly at academic institutions, must also seek greater balance between the pressures of career advancement and advancing rigorous research through standards and best practices," said Freedman, noting a major challenge still facing the community. "Additional leadership and community-wide support will be needed and we believe that the many initiatives described in this report add needed momentum to this emerging culture shift in science. "The preclinical research community is full of talented, motivated people who care deeply about producing high-quality science. We are optimistic about the potential to improve reproducibility, and look forward to continuing to contribute to the effort." GBSI is an independent non-profit organization dedicated to enhancing the quality of biomedical research by advocating best practices and standards to accelerate the translation of research breakthroughs into life-saving therapies. GBSI was founded by ATCC. For more information, visit GBSI.org and Twitter @GBSIorg.


News Article | December 12, 2016
Site: www.marketwired.com

BROOKLINE, MA--(Marketwired - December 12, 2016) - Join us to kick off the Bubbles For Brain Cancer Digital Challenge to support the world renowned non-profit Dana-Farber Cancer Institute and The Jimmy Fund to raise $1 million for brain cancer research, in hopes of finding a cure that will ultimately change the lives of millions. Much like what the Ice Bucket challenge did for ALS, the Bubbles For Brain Cancer Digital Challenge takes place worldwide over all social media channels such as Facebook, Instagram, YouTube, and Twitter. We would love for you to blow some bubbles, any and all types of bubbles. Challenge your friends and family to spread the message, post your videos and pictures on your and our social media channels to get this digital challenge kicked off and help us raise money through generous donations to find a cure. Start your own personalized fundraising page at www.bubblesforbraincancer.org or go to the following social media channels to help spread the word: Your participation during the Holiday Season is greatly appreciated. Please help us make the difference and support our fight to cure brain cancer. All donations go directly to the world renowned non-profit 501 (c)(3) Dana-Farber Cancer Institute and The Jimmy Fund. Thanks for your support. Media enquiries please contact info@bubblesforbraincancer.org. Dana-Farber Cancer Institute The mission of Dana-Farber Cancer Institute is to provide expert, compassionate care to children and adults with cancer while advancing the understanding, diagnosis, treatment, cure, and prevention of cancer and related diseases. As an affiliate of Harvard Medical School and a Comprehensive Cancer Center designated by the National Cancer Institute, the Institute also provides training for new generations of physicians and scientists, designs programs that promote public health particularly among high-risk and underserved populations, and disseminates innovative patient therapies and scientific discoveries to our target community across the United States and throughout the world. Jimmy Fund The Jimmy Fund solely supports Boston's Dana-Farber Cancer Institute, raising funds for adult and pediatric cancer care and research to improve the chances of survival for cancer patients around the world. Since its founding in 1948, the Jimmy Fund has raised millions of dollars through thousands of community fundraising events.


News Article | September 14, 2016
Site: www.nature.com

Attendees at the 2015 Genitourinary Cancers Symposium in Orlando, Florida, were presented with a head scratcher. At a poster session on renal cancer, a team at the Dana-Farber Cancer Institute in Boston, Massachusetts, led by Laurence Albiges, now at Gustave Roussy near Paris, presented its findings from a study of 4,657 individuals with metastatic kidney cancer. Almost two-thirds were classified as overweight or obese on the basis of their body mass index (BMI)1. That breakdown made sense — it is well established that obesity puts people at greater risk of developing kidney cancer. But the researchers found something striking: the higher the patient's BMI, the longer their survival time. That counter-intuitive finding added to a growing body of evidence for an obesity paradox in kidney cancer. Similar results are found in obese people with other disorders, including heart disease, diabetes and even hip fractures. Kidney specialist Kamyar Kalantar-Zadeh at the University of California, Irvine, was one of the first to report these confounding results. He compares the situation to having the wrong sort of friend. It's like “that guy who led you to prison, becomes your friend in prison”, he says. This idea is controversial, however. Indeed, attendees at same session at the Orlando symposium could also find a poster purporting to discredit the obesity paradox. Researchers led by Kathryn Wilson from Brigham and Women's Hospital and the Harvard T. H. Chan School of Public Health, both in Boston, had combed through data from two longitudinal studies to identify 575 individuals who had gone on to develop kidney cancer. The people had been followed for three decades or more as part of two long-term epidemiological studies. When the researchers zoomed in on these patients' medical histories and looked at their BMI trajectories they found that obese participants were more likely not only to develop kidney cancer, but also to die from it. “The real question is whether the obesity paradox is a true biological phenomenon,” says Martin Lajous, an epidemiologist at Harvard T. H. Chan School of Public Health, who was not involved in the study. It is more likely, he contends, that the perplexing results are merely “the result of a poor analytic strategy”. Determining whether the obesity paradox is valid in kidney cancer matters for clinicians who treat and manage the disease. Do fat and thin people develop different types of kidney cancer, for instance? Should treatments take body weight into consideration? And should clinicians be advising overweight people who develop kidney cancer to refrain from dieting? “Since obesity is reaching these epidemic proportions,” says Helena Furberg, an epidemiologist at the Memorial Sloan Kettering Cancer Center in New York City, “we've got to figure out what's going on with this paradox. In the early 1980s, a team in France found that dialysis patients with advanced kidney disease had fewer cardiovascular complications and longer survival times if they were overweight. Research over the next few decades confirmed that finding. In 2012, researchers in South Korea found evidence that the paradox also applied to kidney cancer. The most common type of kidney cancer is renal-cell carcinoma. And the biggest risk factor for this disease is obesity, which accounts for 40% of all cases in the United States and 30% in Europe. Moreover, the rate of kidney cancer worldwide has been growing — there was a 2.6% annual increase between 1997 and 2007 in the United States. In South Korea, it grew by 6% a year between 1999 and 2007. To further investigate the role of obesity in kidney cancer, South Korean researchers identified 1,543 patients who had undergone surgery to remove a kidney tumour between 1994 and 2008. The team found that obese people with kidney cancer had a 53% lower risk of dying from renal-cell carcinoma than patients who were normal weight2. To see if their findings matched those of other labs around the world, the team scoured the literature and turned up 15 studies of cancer-specific survival from Europe, Asia and the United States. The researchers found that the 5-year survival rate of patients in the lowest BMI category was around 76% compared with almost 93% for those in the highest BMI category. But the study was purely observational. “We do not know the exact mechanism,” says co-author Jung Eun Lee, an epidemiologist at Sookmyung Women's University in Seoul. On the other side of the world, Furberg and kidney specialist Ari Hakimi, also at the Memorial Sloan Kettering Cancer Center, came across the obesity paradox in their research. But their team realized that it could take the analysis up a notch. In the mid-2000s, the US National Cancer Institute and the National Human Genome Research Institute began profiling the genomes of different cancers for the Cancer Genome Atlas. Cancer institutes around the United States and Canada began collecting genomic information on tumours — Memorial Sloan Kettering was one of them. When The Cancer Genome Atlas Research Network reported its genomic profiling of clear-cell kidney tumours, about one-quarter of participants (126 patients) had been operated on at Memorial Sloan Kettering3. Furberg, Hakimi and their colleagues pulled up the medical data from these 126 people and calculated each patient's BMI just before surgery4. They wanted to see if a person's BMI had any bearing on the tumours' gene expression. It did. They found lower expression of the gene FASN in people who were obese. FASN encodes the enzyme fatty acid synthase, which is responsible for making fatty acids — an essential source of energy. The altered gene expression may have led to slower-growing kidney tumours. Albiges's team followed up on Furberg and Hakimi's work by comparing survival rates of normal weight and obese individuals with kidney cancer that had metastasized. Not only did obese patients have better survival outcomes, but they also had lower expression of fatty acid synthase. By explaining a potential genetic mechanism, says Kalantar-Zadeh, the Memorial Sloan Kettering team has “brought this paradox to a higher level of understanding”. Obesity-paradox sceptics such as Lajous criticize the use of BMI as a proxy for fatness. Because muscle weighs more than fat, a bodybuilder could have the same BMI as someone who is obese. Smokers, who are typically thinner, are often included in analyses. And BMI does not account for conditions that cause muscle wasting, potentially giving an obese sick person a normal BMI measurement. People with cancer and sarcopenia are known to have poor outcomes. To understand the obesity paradox in kidney cancer, some researchers are now homing in on the fat that surrounds the kidneys. Besides providing protection, the fat around the body's organs may also serve a metabolic purpose. “If you stripped away all of that fat, more than likely the kidney wouldn't function optimally,” says Steven Heymsfield, a metabolism researcher at Pennington Biomedical Research Center in Baton Rouge, Louisiana. Molecular oncologist Ricardo Ribeiro at the University of Lisbon has been studying the fat around various organs by looking at its molecular characteristics and measuring its thickness using tools such as CT scanners. “We are looking at the relevance of specific fat depots,” says Ribeiro. Although Ribeiro's research into kidney fat is too new to have borne results, his earlier work on prostate cancer could hold some clues about the kidney-cancer obesity paradox. Fat in the body, including around the organs, is known to come in different colours, from brown to white. Babies are born with predominantly brown fat; as humans get older, more and more of the brown fat is replaced by white fat. Exercise, however, seems to transform white fat into beige fat — a middle ground between white and brown. Ribeiro has shown that the colour of fat around the prostate influences prostate-cancer aggressiveness5. Molecular analysis and microscopic observations revealed that the fat around the cancerous prostrate is mostly white. When Ribeiro studied the interaction between different-hued fat cells and prostate-tumour cells in the lab, he found that the tumours were more aggressive in the presence of white fat. This would suggest that fat offers no survival advantage — and that the obesity paradox does not exist in prostate cancer. The fat around kidneys seems to remain more brown-like regardless of weight. Ribeiro's team is now investigating the molecular composition of the fat around the kidneys, particularly tissue in close contact with tumours. It is also using CT scans from more than 200 patients with kidney cancer to see if the thickness and density of those renal fat deposits are a better measure of obesity than BMI. It's still too early to know exactly what's going on, Ribeiro says. But he thinks that both the colour of the fat around the kidneys and its thickness might provide some insight into why obesity seems to suppress kidney tumours. But even if researchers such as Ribeiro find more precise ways to measure fatness, critics of the obesity paradox contend that there is a more pervasive bias in how patients are selected for such studies. Take the Memorial Sloan Kettering study. When Hakimi, Furberg and colleagues started researching the obesity paradox in kidney cancer, they looked into all the ways that their approach might skew the results. “Our first question was: 'Is this a phenomenon that could be explained away by other potential confounding factors?'” Hakimi says. To find out, the researchers ran through several variables. They measured tumour size and found that people with normal weight and excess weight presented with similar-sized masses. They also measured albumin, a proxy for nutritional status, and found no differences between groups. (Low albumin can indicate that a person has begun to waste away from disease.) Whenever possible, they asked patients if they had lost weight before surgery. But that too did not change the results. “The findings persisted regardless of different adjustments,” Furberg says. The one piece of information that the study lacked was patients' weight trajectory over many years — the study included only a single weight measurement taken just a few weeks before surgery. But critics of the obesity paradox see that single BMI measurement as problematic, especially when it comes to cancer. Unlike other diseases that have an obesity paradox, such as diabetes and cardiovascular disease, cancer can trigger unexpected weight loss well before the disease's clinical symptoms appear, says Hailey Banack, an epidemiologist who recently completed her doctorate at McGill University in Montreal, Canada. So measuring a person's BMI just before surgery, and even asking about recent weight loss, might lump formerly obese people in with people who have had a normal BMI for many years. What's more, protracted weight loss can be a harbinger of more aggressive forms of cancer. This could explain the poor outcomes for normal weight individuals with kidney cancer. This line of reasoning is what made the findings presented by Wilson's group so striking. In that study, researchers had access to the medical histories of participants enrolled in the Nurses' Health Study, which began in 1976 to assess the health of US women, and the corresponding men-only Health Professionals Follow-up Study, which began in 1986. Participants had their BMI measured every two years. When viewed across many years, the benefits of obesity for people with kidney cancer disappeared. As researchers try to make sense of what is going on, doctors must work out how to advise people with a kidney-cancer diagnosis. “It comes right down to the bedside,” Heymsfield says. “Should you be telling someone, 'No, this isn't the right time to go on a diet?' Most people studying the obesity paradox in kidney cancer think that changing medical guidelines to endorse obesity or weight gain rather than weight reduction is misguided. Being fat does not suddenly become beneficial after diagnosis. Instead, Banack and Furberg both think that a plausible explanation for the difference between fat and thin people is that they develop different subtypes of kidney cancer. Although excess weight probably contributed to kidney cancer in an obese (or formerly obese) person, something else, such as environmental factors or genetic predisposition, is likely to have been the culprit for the cancer in a normal-weight person. Somehow, that 'thin-person' cancer is more aggressive. “Obesity appears to be protective,” Banack says, but that's an illusion. More likely, she says, is that the disease variants that come from other causes are so much worse. Furberg hopes that it will one day be possible to use an individual's BMI — or some other, more suitable, proxy for obesity — to develop treatments that are specific to a person's cancer subtype, as well as to provide better prognoses. “My colleagues and I are doing research to see whether we can better understand the types of kidney cancer that different body sizes impart,” Furberg says. Rather than ratchet up the competition, the various players investigating the obesity paradox in kidney cancer did something unusual in the cutthroat world of scientific research: they decided to collaborate. “It just makes more sense for us to work together on this,” says Mark Preston, a urologist at Brigham and Women's Hospital. The plan is for the Memorial Sloan Kettering team to evaluate the genetic profiles of tumours excised from patients in the two longitudinal cohorts used by Wilson, Preston and their colleagues. The various groups will also address shortcomings in the weight measurements by assessing both BMI and waist circumference, a better proxy for obesity (bodybuilders rarely sport a bulging belly). “Right now we seem to be getting these two diametrically opposed answers,” says Preston. “I think there's probably truth in both.”


News Article | April 27, 2016
Site: www.nature.com

It is precision medicine taken to the extreme: cancer-fighting vaccines that are custom designed for each patient according to the mutations in their individual tumours. With early clinical trials showing promise, that extreme could one day become commonplace — but only if drug developers can scale up and speed up the production of their tailored medicines. The topic was front and centre at the American Association for Cancer Research (AACR) annual meeting in New Orleans, Louisiana, on 16–20 April. Researchers there described early data from clinical trials suggesting that personalized vaccines can trigger immune responses against cancer cells. Investors seem optimistic that those results will translate into benefits for patients; over the past year, venture capitalists have pumped cash into biotechnology start-ups that are pursuing the approach. But some researchers worry that the excitement is too much, too soon for an approach that still faces many technical challenges. “What I do really puzzle at is the level of what I would call irrational exuberance,” says Drew Pardoll, a cancer immunologist at Johns Hopkins University in Baltimore, Maryland. The concept of a vaccine to treat cancer has intrinsic appeal. Some tumour proteins are either mutated or expressed at different levels than in normal tissue. This raises the possibility that the immune system could recognize these unusual proteins as foreign — especially if it were alerted to their presence by a vaccine containing fragments of the mutated protein. The immune system’s army of T cells could then seek out and destroy cancer cells bearing the protein. Decades of research into cancer-treatment vaccines have thus far yielded disappointing clinical trial results, but recent advances — including a suite of drugs that may amplify the effects of cancer vaccines — have rekindled hope for the field. And DNA sequencing of tumour genomes has revealed a staggering diversity of mutations, producing proteins that could serve as ‘antigens’ by alerting the immune system. Last year, researchers reported that they had triggered an immune response in three patients with melanoma by administering a vaccine tailored to their potential tumour antigens1. The vaccines' effects on tumour growth are not yet clear, but by the end of 2015, several companies had announced their intention to enter the field. Gritstone Oncology, a start-up firm in Emeryville, California, raised US$102 million to pursue the approach, and Neon Therapeutics of Cambridge, Massachusetts, raised $55 million. A third company, Caperna, spun out of a prominent biotechnology company called Moderna Therapeutics, also in Cambridge. Academic groups are also moving quickly. At the AACR meeting, Robert Schreiber of Washington University in St. Louis described six ongoing studies at his institution in cancers ranging from melanoma to pancreatic. Cancer researcher Catherine Wu of the Dana-Farber Cancer Institute in Boston, Massachusetts, also presented data from a trial in melanoma, showing signs of T-cell responses to the vaccine. But it takes Wu’s team about 12 weeks to generate a vaccine, and the Washington University team needs about 8 weeks. That could limit the treatment to slow-growing cancers, says Wu. There is also a reason that so many researchers choose melanoma for proof-of-principle trials. Melanoma tumours tend to harbour many mutations — sometimes thousands — which provide scientists with ample opportunity to select those that may serve as antigens. Some researchers worry that tumours with fewer mutations may not be as suitable for personalized vaccines. But Schrieber notes that researchers have been able to design a vaccine for a woman with the brain tumour glioblastoma — which often has relatively few mutations. In that case, however, the tumour had many mutations, some of which may have been caused by her previous cancer treatment. The number of potential antigens could be crucial. At the AACR meeting, Ton Schumacher, an immunologist at the Netherlands Cancer Institute in Amsterdam, noted that many of the mutant proteins that his group has found are not required for tumour survival. As a result, a tumour could maintain its cancerous lifestyle but become resistant to the vaccine if the proteins used to design the vaccine mutate again. “We will need to attack tumours from many different sides,” he says. Pardoll, meanwhile, is concerned that the field is shifting too quickly to the personalized-vaccine approach and leaving behind decades of research on antigens that might be shared across tumours — an approach that has not borne out in clinical trials thus far, but would be much simpler to manufacture and deploy on a large scale. “I will be the happiest person in the world to be proven wrong on these,” he says of personalized vaccines. “But I think one has to nonetheless be cognizant of where the challenges are.”


News Article | November 10, 2016
Site: www.prweb.com

OncLive® is proud to announce the 2016 Giants of Cancer Care®, an esteemed group of 10 innovators in oncology research and clinical practice who have made landmark contributions to the field of oncology and set the stage for future advances. The winners were announced today at 11:35 a.m. and will be honored at tonight’s awards celebration from 5 to 7 p.m. at the New York Marriott Marquis, which is being held during the 34th Annual CFS Chemotherapy Foundation Symposium: Innovative Cancer Therapy for Tomorrow®. Now in its fourth year, the Giants of Cancer Care® campaign celebrates the achievements of leading physicians and researchers who have devoted their time, talent and resources to improving care for patients and their families affected by cancer. Recipients of the award demonstrate the qualities that distinguish them from others: unlimited selflessness, compassion for their patients and a desire to understand and develop life-changing treatments against a disease that affects so many. “Giants of Cancer Care® award winners are helping to move the field of oncology forward through their commitment to innovative and groundbreaking contributions in cancer treatment and research. Our winners' achievements not only give cancer patients and their families hope, but they also inspire future generations of researchers and practitioners to continue advancing toward a cure for this disease,” says Michael Hennessy, Jr., president of Mike J. Hennessy Associates Inc., which produces OncLive®. Nominated by the oncology community, all finalists are vetted by an elite five-member advisory board of world-renowned oncologists. The finalists in each category are then voted on by an 80+ member selection committee comprising the nation's leading physicians in the oncology space. The winners represent 10 categories: breast cancer, community outreach and education, gastrointestinal cancer, genitourinary cancer, hematologic malignancies, lung cancer, melanoma, radiation oncology, scientific advances and surgical oncology. Hematologic Malignancies – James F. Holland, M.D., Icahn School of Medicine at Mount Sinai, New York, N.Y. According to the National Cancer Institute, almost 1.7 million new cases of cancer will be diagnosed in 2016, and nearly 600,000 people will die from the disease. However, the number of people living beyond a cancer diagnosis is rising and is expected to reach almost 19 million by 2024. Giants of Cancer Care® honorees are at the forefront of the battle against this disease. The Giants of Cancer Care® program is overseen by an advisory board that includes its chairman Dr. Maurie Markman, from Cancer Treatment Centers of America, and members Dr. Patrick Borgen, Maimonides Hospital; Dr. George D. Demetri, Dana-Farber Cancer Institute/Harvard Cancer Center; Dr. Hope S. Rugo, University of California, San Francisco/Helen Diller Family Comprehensive Cancer Center; and Dr. Heather Wakelee, Stanford University Medical Center. Every year for the past 33 years, the annual CFS Chemotherapy Foundation Symposium: Innovative Cancer Therapy for Tomorrow® has brought together more than 2,000 oncologists, hematologists, radiation oncologists, immunologists, pharmacists, oncology nurses, nurse practitioners, physician assistants and case managers to learn about state-of-the-art treatments across solid and hematologic malignancies and diverse clinical scenarios. At the 34th Annual CFS Chemotherapy Foundation Symposium: Innovative Cancer Therapy for Tomorrow®, leading clinical innovators in virtually every tumor subspecialty will continue to provide expert insights on new developments in cancer therapeutics. Domestic and international nominations for the 2017 Giants of Cancer Care® are open now through March 20, 2017, and may be submitted online at http://www.giantsofcancercare.com/nominate. Self-nominations are permitted and encouraged. The Giants of Cancer Care® Advisory Board will determine finalists in each category, and a selection committee of more than 90 oncologists will vote to select the 2017 winners. The Class of 2017 Giants of Cancer Care® inductees will be announced in Chicago on June 1, 2017. The 2016 Giants of Cancer Care® program was sponsored by Bayer Health Care, Merck, Puma Biotechnology, Incyte and Otsuka America Pharmaceutical Inc. About OncLive® OncLive® is a digital platform for practicing oncologists that offers oncology professionals information to help them provide the best patient care. OncLive.com is the official website for Michael J. Hennessy Associates Inc.'s Oncology Specialty Group, which publishes OncologyLive®, Oncology Nursing News®, Oncology Business Management™ and more. Michael J. Hennessy Associates Inc. is a full-service health care communications company offering education, research, medical media, curetoday.com and CURE® magazine, the largest consumer publication focused entirely on cancer. CURE® combines science and humanity to make cancer understandable and reaches patients, cancer centers and advocacy groups.


News Article | November 18, 2016
Site: www.biosciencetechnology.com

Researchers leading the largest genomic tumor profiling effort of its kind say such studies are technically feasible in a broad population of adult and pediatric patients with many different types of cancer, and that some patients can benefit by receiving precision drugs targeted to their tumors' mutations or being enrolled in clinical trials. Published online by JCI Insight, it is the first report of "clinical implementation of tumor profiling in an enterprise-wide, unselected cancer patient population," according to the authors. The report contains data on 3,727 patients whose samples were analyzed during the first year of the Profile program at Dana-Farber/Brigham and Women's Cancer Center and Boston Children's Hospital. Unlike most other genomic testing programs, Profile tumor analysis is offered to all patients regardless of age, cancer type, or stage of the cancer. While determining the genetic makeup of a patient's tumor is a critical tool for precision cancer medicine, the report's authors noted several challenges and unanswered questions about large-scale clinical application of the methods. Just over half of patients in the study who gave consent and had tumor profiling ordered by a physician actually received results, due to a variety of technical and logistical factors. For example, a patient's cancer sample might not have had sufficient material for study or for DNA sequencing. And in only a minority of cases - about 10 percent across the cohort, the researchers estimated - was the test information used in caring for the patient, although in some cancer types genomic results were used in a much higher percent of cases. Reasons for the attrition rate included absence of effective drugs, timing of genomic testing in the course of a patient's disease, less-than-optimal access to targeted drugs or clinical trials, and patient and provider preferences. Identifying these barriers allows researchers to develop and implement new solutions, with the goal of improving the rate of use of the genomic results, the authors said. Overall, the turnaround time from receiving the sample to issuing a report of the findings was 5.3 weeks - a timespan the researchers said they have since shortened to less than three weeks. Profile tumor genotyping, which started in 2011, uses a platform called OncoPanel that comprehensively sequences hundreds of known cancer-related genes in a patient sample to look for mutations or other genetic alterations that drive tumors and which might be "actionable" - that is, potentially helpful in guiding the choice of a precision treatment or in enrolling the patient in appropriate clinical drug trials. Although 3,727 cases were reported in this paper, more than 15,000 individual tumors have been analyzed to date. "A widespread genomic profiling initiative is expensive, and this cost has been borne by our institutions," said Laura MacConaill, PhD, of Dana-Farber Cancer Institute and Brigham and Women's Hospital (BWH), the scientific director of the Profile program and corresponding author of the publication. First author of the report is Lynette M. Sholl, MD, of BWH. MacConaill noted that the results of Profile genomic testing are being used to further research within the institutions and are being shared more widely with initiatives like Project GENIE of the American Association for Cancer Research (AACR), which will help advance the field of precision medicine. The study wasn't designed to measure whether tumor profiling made a difference in how patients fared, but "it nonetheless lays the groundwork for more systematic study of the impact of genomics on clinical practice and patient outcomes," the report said. According to the report, at least one actionable mutation was discovered in about two-thirds of patient samples. In 20 percent of cases, such mutations could inform treatment decisions, such as matching a patient's tumor profile to a targeted drug or improving the original diagnosis. In the remaining cases, the information could lead to referring the patient to clinical trials of approved or investigational drugs. Tumor profiling can also reveal rare mutations and other changes that make some cancers unusually responsive to targeted drugs - knowledge that can be applied to patients with a variety of cancer types. The report gave some examples of how genomic testing clarified or changed a patient's diagnosis, which in turn altered treatment and prognosis. The authors concluded that "Genomic results may alter management in diverse scenarios; however, additional barriers must be overcome to enable precision cancer medicine on a large scale."


News Article | September 14, 2016
Site: www.nature.com

PLX4032, PD98059, AZD6244 and PF-573228 were purchased from Selleck Chemicals. The siRNAs against TCF4 (sc-61657), c-Myc (sc-29226), TCF3 (sc-36618) or TCF12 (sc-35552) were purchased from Santa Cruz Biotechnology. Antibodies against ITGA4, ITGA5, ITGB1, ITGB3, ITGB4, ITGB5, FAK, c-Myc, TCF12, ERK1/2, pERK1/2 and Porin were purchased from Cell Signaling Technology; p-FAK (Y397) antibodies were from Cell Signaling and Thermo Fisher Scientific, ID2 antibodies were from Cell Signaling, Santa Cruz Biotechnology and Thermo Fisher; tubulin, V5, HMB45, COX5 A, NDUFS4 and NDUFA9 antibodies were from Abcam; TCF4 antibodies were from Abnova and Santa Cruz; and PGC1α antibodies were from Santa Cruz and Millipore. The GSEA software v2.0 (http://www.broadinstitute.org/gsea)30 was used to perform the GSEA analysis. In all the analysis, the KEGG gene sets were used. The values of the 219195_at probe (corresponding to PPARGC1A) were used as phenotype. For the analysis of the CCLE data set, the gene expression data was downloaded from the CCLE portal (http://www.broadinstitute.org/ccle) and the data from 61 melanoma cell lines were used in the analysis. The GSEA default parameters were used with the exception that Pearson correlation was computed to rank the genes for the analysis of the CCLE data and permutation was changed to gene set for the analysis of the GSE36879 data set. Published data sets GSE318931 and GSE1239132 with associated pathological stages for each sample as Invasive/Vertical or Superficial/Radial were analysed for relative deviation from median-normalized PGC1α intensities (linear) within each data set (significance based on 2-sample, 2-sided t-test statistics). To examine the enrichment of the PGC1α-regulated metastasis/invasion signature genes (ITGA3, ITGA4, ITGA10, ITGB3, ITGB5, CAV1, CAV2, ACTN2, LAMA4A, COL4A1, INHBA, TGFBI, TGFBR3, TGFBR2, SMAD3, SMAD7, IL8, IL11, LEF1, TCF7L2, DKK3, PPP3CA and SFRP1), we performed ssGSEA projections33 to yield a percentile-based normalized enrichment score within each of GSE3189 and GSE12391, which were used to combine the data sets (2-sample, 2-sided t-test statistics). The association between primary melanoma survival and PGC1α-regulated metastasis/invasion signature was based on ssGSEA for signature closeness within GSE57715 and calculation of log-rank survival. For the analysis of PGC1α and TCF4 gene expression, data obtained from the TCGA skin cutaneous melanoma data set34 consisting of 471 samples with RNA-seq data was downloaded from the cBioPortal35, 36 (www.cbioportal.org). Data were represented as Z-scores of RNA-seq V2 RSM. The dotted lines denote Z-scores of 0. Samples were classified as expressing if Z-score > 0 and a mutually exclusivity report from the cBioPortal was generated. The pDONR223–LacZ entry control vector was purchased from Addgene (25893) and the pLX304–LacZ control vector was generated using LR clonase II (Invitrogen). The V5-tagged pLX304–ID2 and –TCF4 vectors were provided by the Marc Vidal Laboratory at Dana-Farber Cancer Institute. Luciferase-expressing FUW–Luc was provided by A. Kung and the pMSCV–Luciferase–hygro plasmid was purchased from Addgene. Full-length PGC1α was amplified by KOD polymerase (F: GCTTGGGACATGTGCAGCGAA and R: TTACCTGCGCAAGCTTCTCTGAGC), and then the PCR product was ligated into pDONR223 by BP reaction. PGC1α expressing destination vectors (pLX304 for constitutive expression and pInducer2037 for doxycycline-inducible expression) were generated by LR reaction with entry vector (pDONR223–PGC1α). Melanoma cells were obtained from ATCC and their authentication was confirmed by either DNA fingerprinting with small tandem repeat (STR) profiling or in-house PCR testing of melanoma marker genes and BRAF mutation status. Mycoplasma contamination was tested negative in-house with the PCR Mycoplasma Detection Kit (Lonza). Melanoma cells were cultured in high-glucose DMEM containing 10% FBS. For detachment culture conditions, cells were plated on plates coated with poly-2-hydroxy methacrylate (poly-HEMA). Lentiviruses encoding shRNAs or cDNAs were produced in HEK293T cells with packaging vectors (pMD2G and psPAX2) using Polyfect (Qiagen). pLKO.1 vector expressing a scramble sequence, as listed in the Supplementary Information, was used as control (shScr). Lentiviruses particles were collected 48 h post-transfection and used to infect melanoma cells in the presence of 8 μg/ml polybrene. Infected cells were selected with 2 μg/ml of puromycin or 7 μg/ml blasticidin for 4 days before experiments. siRNA transfection was performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. Guide-RNAs were cloned into pLX–sgRNA (Addgene #50662 for PGC1α) or lentiCRISPR (Addgene #52961 for ID2). The respective empty vector lacking the sgRNA sequence was used as control (sgCtrl). Cells were subsequently infected with lentiviruses encoding Cas9 (pCW-Cas9, Addgene #50661) and sgRNAs followed by selection with respective antibiotics as described above, and 1 μg/ml of doxycycline for 7 days. Cells were lysed in a buffer containing 1% IGEPAL, 150 mM NaCl, 20 mM HEPES (pH7.9), 10 mM NaF, 0.1 mM EDTA, 1 mM sodium orthovanadate and 1× protease inhibitor cocktail. Protein concentration was quantified using the BCA protein concentration assay kit (Pierce). Cell lysates were electrophoresed on SDS-polyacrylamide gels and transferred to Immobilon-P membranes (Millipore). Membranes were incubated with primary antibodies in 5% bovine serum albumin containing 0.05% Tween-20 overnight at 4 °C. The membrane was then incubated with HRP-conjugated secondary antibody for 1 h at room temperature, and visualized using an ECL Prime (GE Healthcare). Total RNA was isolated with Trizol (Invitrogen) by Direct-zol RNA MiniPrep kit (Zymo Research), and 2 μg of total RNA was used for cDNA synthesis using a high capacity cDNA reverse transcription kit (Applied Biosystems). qPCR was carried out using SYBR Green PCR Master Mix (Applied Biosystems). Experimental Ct values were normalized to 36B4 where not otherwise indicated and relative mRNA expression was calculated. Sequences for all the primers are provided in the Supplementary Information. For PGC1α overexpression by adenovirus, A375P–shPGC1α and A375 cells were infected with adenoviruses expressing GFP or Flag–PGC1α for 36 h, followed by qPCR. PGC1α targets such as GSTM4 and COX5 A were used as positive controls. For inhibitor treatment, cells were incubated with indicated concentrations of inhibitors for 6 h and mRNAs were analysed by qPCR. For the RNA from migratory and non-migratory cells, migration of the A375P and G361 cells was initiated as described below. The non-migratory cells in suspension in the upper chambers were collected by centrifugation and resuspension in lysis buffer from the Cells-to-cDNA II kit (Invitrogen). The migratory cells were collected by directly applying the lysis buffer to the membrane, following the wash and clearing of the non-migratory cells in the upper chambers. 18S rRNA was used as internal control. For cells from paraffin-embedded tissue sections, Pinpoint Slide RNA Isolation System II (Zymo Research) was used to extract RNAs. Cells with different mitochondrial contents were sorted based on the labelling of MitoTracker Green (Invitrogen). Briefly, MitoTracker Green was spiked in the medium of 100% confluent melanoma cells at the final concentration of 75 nM, and incubated with the cells for 20 min, followed by FACS sorting at DFCI Flow Cytometry Core. The top 10% cell population with the highest mitochondrial contents (mito/PGC1α–high) and the bottom 10% cell population with the lowest mitochondrial contents (mito/PGC1α–low) were collected for qPCR, western blot, migration assay (1 × 105 per well overnight) and metastasis assay. For the circulating tumour cells, whole blood of the tumour-bearing mice was collected by cardiac perfusion with PBS containing 0.5 mM EDTA. After red blood cell lysis, the pelleted cells were stained with anti-mouse CD31 and CD45, along with anti-human HLA (eBioscience, as depicted in Extended Data Fig. 4c). The CD31−CD45−hHLA+ cells were directly sorted into RNAprotect Cell Reagent (Qiagen), and then converted into cDNA using the Cells-to-cDNA II kit. The primary tumours were subjected to enzymatic digestion for single cell suspension and FACS sorting to make them equivalent controls. qPCR was performed with SYBR Green, following the unbiased, target-specific preamplification of cDNA using SsoAdvanced PreAmp Supermix (BioRad). Experimental Ct values were normalized to 18S rRNA, and relative mRNA expression was calculated. Lactate and glucose assay kits (BioVision Research Products) were used to measure extracellular lactate and glucose, following manufacturer’s instructions. Briefly, equal number of cells were seeded in 6-well plates and cultured in Phenol-Red-free DMEM for 24 h or 36 h. Cultured medium was then mixed with the reaction solution. Lactate and glucose levels were measured at 450 nm and 570 nm, respectively, using a FLUO star Omega plate reader. Values were normalized to cell number. Melanoma cell lines were lifted by 0.5 mM EDTA in PBS and washed with 1 × PBS. For the intravenous injection, a total of 3 × 105 (A375) or 1 × 106 (G361 and MeWo) or 2 × 106 (A375P and FACS-sorted MeWo) cells in 0.2 ml of DMEM were injected into the tail veins of 6-week-old male nude mice. No randomization or blinding techniques were applied in this study. To assess the degree of tumour formation in the lung, bioluminescence imaging of living mice was performed on a Xenogen IVIS-50TM imaging system equipped with an isoflurane (1–3%) anaesthesia system and a temperature-controlled platform19, three weeks (G361 and MeWo) or four weeks (A375 and A375P) post-injection. For the doxycycline-induction experiment, upon detection of lung metastasis following tail-vein implantation, PGC1α expression was induced by feeding mice with a chow or doxycycline-containing diet (200 mg/kg, Harlan Laboratories) for one week. For the orthotopic metastasis model, 1 × 106 cells were injected subcutaneously into one side of 6-week-old male NOD/SCID mice, with two injections per animal, followed by surgical tumour removal when the subcutaneous tumours reached 2 mm in diameter. Metastasis was monitored by in vivo imaging at 8–10 weeks post-surgery. After the measurement of bioluminescence, animals were killed and the lungs were removed. Collected lung tissues were fixed in 10% buffered formalin solution (Sigma-Aldrich) overnight. Fixed tissues were stained with haematoxylin and eosin (H&E) or antibodies against p-FAK-Y397 (Invitrogen) or HMB45 (Abcam), and one image per sample was shown as representative of one or three pictures captured, as indicated specifically in corresponding figure legend. Scale bar represents 200 μm unless otherwise indicated. All procedures were conducted in accordance with the guidelines of the Beth Israel Deaconess Medical Center Institutional Animal Care and Use Committee, and none of the tumours exceeded the size limit dictated by the IACUC guidelines. For cell migration assays, transwell chambers were purchased from Corning Life Science. Generally, A375P (5 × 103) or G361 (4 × 103) cells in 0.1 ml of FBS-free medium were seeded into the upper chamber and incubated for 6 h if not otherwise indicated. For invasion assays, A375P (5 × 103), A375 (3 × 103), G361 (4 × 103), A2058 (3 × 103), RPMI7951 (5 × 103) or WM115 (4 × 103) cells in 0.1 ml of FBS-free medium were seeded into the upper chamber of an 8 μM matrigel coated chamber (BD Bioscience) and incubated for 16 h if not otherwise indicated. Specifically, for the migration and invasion assays on sorted cells (Fig. 2c) or A375P cells with ID2 knockdown (Fig. 3b), 1 × 105 cells were seeded and incubated for 24 h. Cells that had migrated and invaded through the matrigel were then fixed and stained with H&E if not otherwise indicated. The membrane attached with migrated and invaded cells was placed on a glass slide and total cell numbers from three or four random fields under 20–40× magnifications were quantified with an Olympus IX51 or a Nikon 80i Upright microscope, by counting cells on 20–50% of one field area and extrapolated to 100% of the field17. Specifically for the experiments with FAK inhibitor, shScr or shPGC1α stably expressing cells (A375P 1 × 105 per well, G361 2.5 × 104 per well) were cultured in transwell chambers with either DMSO or indicated concentration of PF-573228, followed by staining with Crystal Violet and quantification after migration for 24 h. For the experiments with PLX4032, cells were incubated with DMSO or 1 μM PLX4032 for 10 h in matrigel-coated transwell chambers, followed by quantification. Nuclear lysates were incubated with specific antibodies overnight at 4 °C, followed by precipitation with protein G Dynabeads (Invitrogen) at 4 °C for 2 h. For Fig. 3h, nuclear lysates from V5−ID2 stably-expressing A375P cells were subjected to co-IP with 1 μg ID2 antibody (C-20, Santa Cruz Biotechnology), followed by western blot with TCF4 (M03, Abnova) and ID2 (4E12G5, Thermo Scientific); for Fig. 4d, 10 mg of nuclear lysates from A375P cells treated with DMSO or 1 μM PLX4032 for 16 h were subjected to co-IP with 4 μg ID2 antibody (C-20). ChIP was performed with the MilliPore ChIP Kit with slight modification. Following sonication, nuclear lysates were precleared with protein A/G-Dynabeads (Invitrogen) for 1 h. Equal amounts of precleared lysates were incubated with IgG or gene-specific antibodies (PGC1α 4C1.3 from Millipore, or PGC1α H-300, and TCF4 K-15 from Santa Cruz Biotechnology) overnight, followed by precipitation with protein A/G-Dynabeads for 2 h. qPCR with SYBR Green was performed to quantify the promoter occupancy. For Fig. 4e, A375P cells stably expressing V5–TCF4 were cultured with PLX4032 at 5 μM for 16 h and followed by ChIP and qPCR. A ToxiLight Non-destructive Cytotoxicity BioAssay Kit (Lonza) was used to quantify the cytotoxic effects of the indicated compounds according to the manufacturer’s instruction. The measurement of dead cells in the DMSO group was set as 1, and was used to normalize other treatment groups (Extended Data Fig. 2j). For the cell growth assay with PLX4032 (Extended Data Fig. 9d), cells were cultured with DMSO or PLX4032 for the indicated time under either attachment or detachment conditions, followed by cell counting with a haemocytometer. For detachment culture conditions, cells were plated on tissue culture plates coated with poly-HEMA. No statistical methods were used to predetermine sample size. All statistics are described in figure legends. In general, for two experimental comparisons, a two-tailed unpaired Student’s t-test was used unless otherwise indicated. For multiple comparisons, one-way ANOVAs were applied. When cells were used for experiments, three replicates per treatment were chosen as an initial sample size. All n values defined in the legends refer to biological replicates. If technical failures such as tail-vein injection failure or inadequate intraperitoneal injection occurred before collection, those samples were excluded from the final analysis. Statistical significance is represented by asterisks corresponding to *P < 0.05, **P < 0.01 and ***P < 0.005.


News Article | February 21, 2017
Site: www.businesswire.com

CAMBRIDGE, Mass.--(BUSINESS WIRE)--H3 Biomedicine Inc., a biopharmaceutical company specializing in the discovery and development of precision medicines for oncology and a member of Eisai’s global Oncology Business Group, announced today that Peter G. Smith, Ph.D., will become the company’s chief scientific officer, effective March 1, 2017. Dr. Smith transitions to his new position from vice president, Drug Discovery Biology. “Since joining H3 shortly after the company’s inception, Pete has been essential to the rapid success of the company and a driving force behind our pre-clinical and clinical advancements,” said Dr. Markus Warmuth, president and CEO of H3 Biomedicine. “Under Pete’s scientific leadership, H3 brought forward its first two oncology drug candidates and established a robust pre-clinical program that shows enormous promise.” In his role as chief scientific officer, Dr. Smith will be responsible for setting the scientific strategy and priorities for H3 Biomedicine, as well as overseeing day-to-day research operations. “I am grateful for this recognition of my contributions to H3, and am honored to be part of such a transformative company,” said Dr. Smith. “It has been a privilege to help H3 advance from a young, discovery-stage company to one with a strong clinical footprint and the potential to grow that even further over the next few years.” Dr. Smith joined H3 Biomedicine in 2011 as the director of Target Biology, and soon advanced to the position of vice president, Drug Discovery Biology. Within this capacity, he led a multidisciplinary team of scientists towards the identification and early development of novel small molecule oncology therapeutics. Under Dr. Smith’s leadership, H3’s scientific team has delivered two clinical stage compounds (H3B-8800 and H3B-6527), and a third pre-clinical compound which is scheduled for clinical introduction in Q2 2017. Dr. Smith came to H3 Biomedicine from Millennium Pharmaceuticals/Takeda Oncology in Cambridge, Mass., where he held positions of increasing scientific and management responsibility in the oncology discovery group. Prior to Millennium, Dr. Smith served as a post-doctoral researcher at the Dana-Farber Cancer Institute, Harvard Medical School; at the Molecular Medicine Unit, St James’s University Hospital, University of Leeds, U.K.; and at the Cancer Research Unit, University of Newcastle upon Tyne, U.K. Dr. Smith earned a Ph.D. from the Cancer Research Unit at the University of Newcastle upon Tyne, U.K. and a B.Sc. in pharmacology from the University of Sheffield, U.K. About H3 Biomedicine Inc. H3 Biomedicine is a Cambridge, Massachusetts-based biopharmaceutical company specializing in the discovery and development of precision oncology treatments, which was established as a subsidiary of Eisai’s U.S. pharmaceutical operation, Eisai Inc. Using modern synthetic chemistry, chemical biology, and human genetics, H3 Biomedicine seeks to bring the next generation of cancer treatments to market with the goal of improving the lives of patients. For more information, please visit www.h3biomedicine.com.


News Article | December 5, 2016
Site: www.eurekalert.org

SAN DIEGO, CA - A combination of two targeted agents - one approved by the Food and Drug Administration and one undergoing testing - has demonstrated safety as well as encouraging signs of effectiveness in a phase 1 clinical trial in patients with relapsed or hard-to-treat chronic lymphocytic leukemia (CLL) or mantle cell lymphoma (MCL). Dana-Farber Cancer Institute researchers will report the findings at the 58th annual meeting of the American Society of Hematology (ASH). The combination of the approved drug ibrutinib and the novel agent TGR-1202 is being tested in patients to determine if the two agents can be safely given at the same time and whether they lead to more durable remissions in CLL and MCL compared to ibrutinib alone. While ibrutinib, which targets the cell protein BTK, often reduces the amount of cancer in patients with relapsed or drug-resistant CLL or MCL, it rarely eliminates the cancer or generates long-lasting results in MCL or high-risk forms of CLL. By pairing it with TGR-1202, which blocks the P13K-delta protein, researchers hope to disable two key parts of cancer cells' growth circuitry. As of late July, investigators had treated 28 patients - 17 with CLL, 11 with MCL - with the tandem therapy. The regimen was shown to be safe, with an 800 mg dose of TGR-1202 found to be suitable for further study. "The efficacy of the combination looks promising as well," said Dana-Farber's Matthew Davids, MD, principal investigator of the investigator-initiated trial. Davids will present the findings Monday, December 5, at 8 a.m. in Room 5AB of the San Diego Convention Center. "We have already seen a complete response - no evidence of cancer - in one patient with CLL, and several other patients are approaching complete response," Davids added. Another potential benefit of the two-drug combination is that it could offer greater flexibility in treatment, Davids remarked. Patients who need to discontinue one of the drugs because of temporary complications could continue with the other and resume the two-drug regimen when the complications subside. While enrollment of patients with CLL in the trial is complete, openings remain for patients with MCL, and the study is open at several sites across the country through the Blood Cancer Research Partnership, a Dana-Farber-led hematologic malignancies research consortium funded through the Leukemia & Lymphoma Society. The senior author of the study is Jennifer Brown, MD, PhD, of Dana-Farber. Co-authors are Haesook Kim, PhD, Alyssa Nicotra, Alexandra Savell, Karen Francoeur, RN, Jeffrey Hellman, PA-C, Caron Jacobson, MD, and David C. Fisher, MD, of Dana-Farber; Hari Miskin, MS, and Peter Sportelli of TG Therapeutics, New York, N.Y.; Asad Bashey, MD, PhD, of Northside Hospital, Atlanta, Ga.; Laura Stampleman, MD, of Pacific Cancer Care, Monterey, Cal.; Jens Rueter, MD, of Eastern Maine Medical Center; Adam Boruchov, MD, of Saint Francis Hospital and Medical Center, Hartford, Conn.; and Jon Arnason, MD, of Beth Israel Deaconess Medical Center. Research funding for the study was provided by TG Therapeutics (New York, NY). From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world.


News Article | November 17, 2016
Site: www.sciencedaily.com

Researchers leading the largest genomic tumor profiling effort of its kind say such studies are technically feasible in a broad population of adult and pediatric patients with many different types of cancer, and that some patients can benefit by receiving precision drugs targeted to their tumors' mutations or being enrolled in clinical trials. Published online by JCI Insight, it is the first report of "clinical implementation of tumor profiling in an enterprise-wide, unselected cancer patient population," according to the authors. The report contains data on 3,727 patients whose samples were analyzed during the first year of the Profile program at Dana-Farber/Brigham and Women's Cancer Center and Boston Children's Hospital. Unlike most other genomic testing programs, Profile tumor analysis is offered to all patients regardless of age, cancer type, or stage of the cancer. While determining the genetic makeup of a patient's tumor is a critical tool for precision cancer medicine, the report's authors noted several challenges and unanswered questions about large-scale clinical application of the methods. Just over half of patients in the study who gave consent and had tumor profiling ordered by a physician actually received results, due to a variety of technical and logistical factors. For example, a patient's cancer sample might not have had sufficient material for study or for DNA sequencing. And in only a minority of cases -- about 10 percent across the cohort, the researchers estimated -- was the test information used in caring for the patient, although in some cancer types genomic results were used in a much higher percent of cases. Reasons for the attrition rate included absence of effective drugs, timing of genomic testing in the course of a patient's disease, less-than-optimal access to targeted drugs or clinical trials, and patient and provider preferences. Identifying these barriers allows researchers to develop and implement new solutions, with the goal of improving the rate of use of the genomic results, the authors said. Overall, the turnaround time from receiving the sample to issuing a report of the findings was 5.3 weeks -- a timespan the researchers said they have since shortened to less than three weeks. Profile tumor genotyping, which started in 2011, uses a platform called OncoPanel that comprehensively sequences hundreds of known cancer-related genes in a patient sample to look for mutations or other genetic alterations that drive tumors and which might be "actionable" -- that is, potentially helpful in guiding the choice of a precision treatment or in enrolling the patient in appropriate clinical drug trials. Although 3,727 cases were reported in this paper, more than 15,000 individual tumors have been analyzed to date. "A widespread genomic profiling initiative is expensive, and this cost has been borne by our institutions," said Laura MacConaill, PhD, of Dana-Farber Cancer Institute and Brigham and Women's Hospital (BWH), the scientific director of the Profile program and corresponding author of the publication. First author of the report is Lynette M. Sholl, MD, of BWH. MacConaill noted that the results of Profile genomic testing are being used to further research within the institutions and are being shared more widely with initiatives like Project GENIE of the American Association for Cancer Research (AACR), which will help advance the field of precision medicine. The study wasn't designed to measure whether tumor profiling made a difference in how patients fared, but "it nonetheless lays the groundwork for more systematic study of the impact of genomics on clinical practice and patient outcomes," the report said. According to the report, at least one actionable mutation was discovered in about two-thirds of patient samples. In 20 percent of cases, such mutations could inform treatment decisions, such as matching a patient's tumor profile to a targeted drug or improving the original diagnosis. In the remaining cases, the information could lead to referring the patient to clinical trials of approved or investigational drugs. Tumor profiling can also reveal rare mutations and other changes that make some cancers unusually responsive to targeted drugs -- knowledge that can be applied to patients with a variety of cancer types. The report gave some examples of how genomic testing clarified or changed a patient's diagnosis, which in turn altered treatment and prognosis. • A patient with blood cancer who had received several diagnoses was found, through testing, to have an unusual form of acute myeloid leukemia (AML), which predicted responsiveness to imatinib. He was treated with that drug and experienced a "dramatic and sustained clinical response." • Testing revealed an ALK gene rearrangement when a sample of a patient's uterine leiomyosarcoma was profiled. Although she needed no further treatment, doctors would be prepared to give her an ALK inhibitor drug if needed later on. • A patient's undifferentiated small bowel sarcoma was found to contain a KIT gene deletion, resulting in a revised diagnosis of GIST (gastrointestinal stromal tumor) that was successfully treated with imatinib. The authors concluded that "Genomic results may alter management in diverse scenarios; however, additional barriers must be overcome to enable precision cancer medicine on a large scale."


News Article | November 17, 2016
Site: www.chromatographytechniques.com

Researchers leading the largest genomic tumor profiling effort of its kind say such studies are technically feasible in a broad population of adult and pediatric patients with many different types of cancer, and that some patients can benefit by receiving precision drugs targeted to their tumors’ mutations or being enrolled in clinical trials. Published online by JCI Insight, it is the first report of “clinical implementation of tumor profiling in an enterprise-wide, unselected cancer patient population,” according to the authors. The report contains data on 3,727 patients whose samples were analyzed during the first year of the Profile program at Dana-Farber/Brigham and Women’s Cancer Center and Boston Children’s Hospital. Unlike most other genomic testing programs, Profile tumor analysis is offered to all patients regardless of age, cancer type, or stage of the cancer. While determining the genetic makeup of a patient’s tumor is a critical tool for precision cancer medicine, the report’s authors noted several challenges and unanswered questions about large-scale clinical application of the methods. Just over half of patients in the study who gave consent and had tumor profiling ordered by a physician actually received results, due to a variety of technical and logistical factors. For example, a patient’s cancer sample might not have had sufficient material for study or for DNA sequencing. And in only a minority of cases – about 10 percent across the cohort, the researchers estimated – was the test information used in caring for the patient, although in some cancer types genomic results were used in a much higher percent of cases. Reasons for the attrition rate included absence of effective drugs, timing of genomic testing in the course of a patient’s disease, less-than-optimal access to targeted drugs or clinical trials, and patient and provider preferences. Identifying these barriers allows researchers to develop and implement new solutions, with the goal of improving the rate of use of the genomic results, the authors said. Overall, the turnaround time from receiving the sample to issuing a report of the findings was 5.3 weeks – a timespan the researchers said they have since shortened to less than three weeks. Profile tumor genotyping, which started in 2011, uses a platform called OncoPanel that comprehensively sequences hundreds of known cancer-related genes in a patient sample to look for mutations or other genetic alterations that drive tumors and which might be “actionable” – that is, potentially helpful in guiding the choice of a precision treatment or in enrolling the patient in appropriate clinical drug trials. Although 3,727 cases were reported in this paper, more than 15,000 individual tumors have been analyzed to date. “A widespread genomic profiling initiative is expensive, and this cost has been borne by our institutions,” said Laura MacConaill, of Dana-Farber Cancer Institute and Brigham and Women’s Hospital (BWH), the scientific director of the Profile program and corresponding author of the publication. First author of the report is Lynette M. Sholl, MD, of BWH. MacConaill noted that the results of Profile genomic testing are being used to further research within the institutions and are being shared more widely with initiatives like Project GENIE of the American Association for Cancer Research (AACR), which will help advance the field of precision medicine. The study wasn’t designed to measure whether tumor profiling made a difference in how patients fared, but “it nonetheless lays the groundwork for more systematic study of the impact of genomics on clinical practice and patient outcomes,” the report said. According to the report, at least one actionable mutation was discovered in about two-thirds of patient samples. In 20 percent of cases, such mutations could inform treatment decisions, such as matching a patient’s tumor profile to a targeted drug or improving the original diagnosis. In the remaining cases, the information could lead to referring the patient to clinical trials of approved or investigational drugs. Tumor profiling can also reveal rare mutations and other changes that make some cancers unusually responsive to targeted drugs – knowledge that can be applied to patients with a variety of cancer types. The report gave some examples of how genomic testing clarified or changed a patient’s diagnosis, which in turn altered treatment and prognosis. • A patient with blood cancer who had received several diagnoses was found, through testing, to have an unusual form of acute myeloid leukemia (AML), which predicted responsiveness to imatinib. He was treated with that drug and experienced a “dramatic and sustained clinical response.” • Testing revealed an ALK gene rearrangement when a sample of a patient’s uterine leiomyosarcoma was profiled. Although she needed no further treatment, doctors would be prepared to give her an ALK inhibitor drug if needed later on. • A patient’s undifferentiated small bowel sarcoma was found to contain a KIT gene deletion, resulting in a revised diagnosis of GIST (gastrointestinal stromal tumor) that was successfully treated with imatinib. The authors concluded that “Genomic results may alter management in diverse scenarios; however, additional barriers must be overcome to enable precision cancer medicine on a large scale.”


News Article | November 17, 2016
Site: www.eurekalert.org

Glioblastoma multiforme remains the most common and highly lethal brain cancer and is known for its ability to relapse. Researchers at The University of Texas MD Anderson Cancer Center have identified a pathway by which cancer cells aggressively spread and grow in the brain, opening up new possibilities for treatment. Study findings were published in the Nov. 17 online version of Cell. Co-authors included Baoli Hu, Ph.D., senior research scientist, Y. Alan Wang, Ph.D., associate professor, and Ronald A. DePinho, M.D., professor, all of Cancer Biology, and Qianghu Wang Ph.D., Bioinformatics and Computational Biology. "The poor prognosis of glioblastoma relates to the near universal recurrence of tumors despite robust treatment including surgery, radiotherapy and chemotherapy," said Hu. "Our study shows the potential for a new therapeutic strategy based on targeting the mechanisms allowing glioma to re-grow aggressively in the brain." Hu and his colleagues developed a glioblastoma model to locate glioma stem cells, which, like all stem calls, have the ability to become other cell types. The researchers further found that the gene, WNT5A, when activated, allowed glioma stem cells to transition, leading to invasive tumor growth. "We uncovered a process by which glioma stem cells mediated by the WNT5A gene become endothelial-like cells," said Hu. "These new cells known as GdECs, recruit existing endothelial cells to form a niche supporting the growth of invasive glioma cells away from the primary tumor, and often leading to satellite "lesions" and disease recurrence." Clinical data revealed higher WNT5A and GdECs expression in these satellite lesions and recurrent tumors than was observed in the primary tumors, affirming the tie between WNT5A-mediated stem cell differentiation and glioma cell spread throughout the brain, and contributing to the cancer's lethalness. The study established WNT5A as a key factor in glioma stem cells transitioning to GdECs. The team believes this opens up the possibility for a new therapeutic strategy for patients with glioblastoma. Recent clinical data show the FDA-approved drug, bevacizumab, did not benefit patients as a first line treatment of recurrent glioblastoma by targeting vascular endothelial growth factors (VEGF). With this new information, the study team proposes an additional therapeutic approach targeting WNT5A and VEGF signaling pathways for recurrent glioblastoma. "Our preliminary data show that bevacizumab may increase WNT5A-mediated GdECs differentiation and recruitment of existing endothelial cells resulting in no proven benefit to patients with glioblastoma" said Hu. "This new strategy should improve the outcome of brain cancer patients undergoing VEGF therapy, by limiting new tumor growth and invasion, and disease recurrence," said Hu. MD Anderson study team members included Y. Alan Wang, Ph.D., Sujun Hua, Ph.D., Charles-Etienne Sauvé, Derrick Ong, Ph.D., Zheng Lan, Ph.D., Yan Wing Ho, Ph.D., Marta Monasterio, Ph.D., Xin Lu, Ph.D., Pingna Deng, Guocan Wang, Ph.D., Wen-Ting Liao, Ph.D., Denise Spring, Ph.D., Jian Hu, Ph.D., and Ronald DePinho, M.D., all of Cancer Biology; Roeland Verhaak, Ph.D., Bioinformatics and Computational Biology; Jianhua Zhang, Ph.D., and Lynda Chin, M.D., Genomic Medicine; Yi Zong, Ph.D., Epigenetics and Molecular Carcinogenesis; Zhi Tan, Experimental Therapeutics; Lynda Corley and Gregory Fuller, M.D., Ph.D., Pathology; and Erik Sulman, M.D., Ph.D., Radiation Oncology. Other participating institutions included Dana-Farber Cancer Institute, Boston; Nanjing Medical University, Nanjing, China; Guangdong 999 Brain Hospital, Guangzhou, China; the Fondazione IRCCS Istituto Neurologico C. Besta, Milan; and the University of California, San Francisco. The study was funded by National Institutes of Health (P50 CA097257, 2P50CA127001, 5P01CA095616, and P30CA16672).


News Article | November 21, 2016
Site: www.eurekalert.org

BOSTON -- In a new study, a group of Boston scientists, including researchers at Dana-Farber Cancer Institute, offer a genetic explanation for the age-old conundrum of why cancer is more common in males than females. Females, it turns out, carry an extra copy of certain protective genes in their cells - an additional line of defense against the cells growing out of control - the investigators report in a paper published online today by Nature Genetics. Though not solely responsible for cancer's "bias" toward males, the duplicate copies likely account for some of the imbalance, including up to 80 percent of the excess male cases in some tumor types, report the study authors, based at Dana-Farber, the Broad Institute of Harvard and MIT, and Massachusetts General Hospital. "Across virtually every type of cancer, occurrence rates are higher in males than in females. In some cases, the difference might be very small - just a few percent - but in certain cancers, incidence is two or three times higher in males," said Andrew Lane, MD, PhD, of Dana-Farber, the co-senior author of the study with Gad Getz, PhD, of the Broad Institute and Massachusetts General Hospital. "Data from the National Cancer Institute show that males carry about a 20 percent higher risk than females of developing cancer. That translates into 150,000 additional new cases of cancer in men every year." Despite the size of the gap, the reasons for this divergence have been difficult to discern. The historic explanation - that men were more likely to smoke cigarettes and be exposed to hazardous chemicals in the work environment - has proven inadequate, because even as smoking rates have dropped and occupational patterns changed, men still outpace women in developing many cancers, including some associated with tobacco use such as kidney, renal, bladder, and oral cancers, Lane said. The disparity is present among boys and girls, as well as men and women. Previous research found that in one form of leukemia, the cancer cells often carried a mutation in a gene called KDM6A, located on the X chromosome - one of the sex chromosomes that determine whether an individual is male or female. (Females cells carry two X chromosomes; males carry an X chromosome and a shorter, smaller Y chromosome.) If KDM6A is a tumor-suppressor gene - responsible for preventing cell division from spinning out of control - the mutation could lead to cancer by crippling that restraint system. One might expect female cells to be just as vulnerable to the mutation. During embryo formation, one of the X chromosomes in female cells shuts down and remains off-line for life. A mutation in KDM6A on the active X chromosome, therefore, should lead to the same cell-division havoc as it does in males. Unexpectedly, KDM6A mutations were detected more often in male cancers. It turns out that some genes on the inactivated X chromosome in female cells "escape" that dormant state and function normally. One of those awakened genes happens to be a working copy of KDM6A. The "good" copy of the gene is sufficient to prevent the cell from turning cancerous. The new study explored whether this phenomenon - fully functional tumor-suppressor genes on an otherwise idle X chromosome - underlies the broader phenomenon of cancer's partiality toward male cells. The researchers dubbed such genes "EXITS," for Escape from X-Inactivation Tumor Suppressors. "Under this theory, one of the reasons cancer is more common in males is that male cells would need a harmful mutation in only one copy of an EXITS gene to turn cancerous," Lane said. "Female cells, by contrast, would need mutations in both copies." To test this hypothesis, researchers at the Broad Institute scanned the genomes of more than 4,000 tumor samples, representing 21 different types of cancer, looking for various types of abnormalities, including mutations. They then examined whether any of the irregularities they found were more common in male cells or female cells. The results were striking. Of nearly 800 genes found solely on the X chromosome, six were more frequently mutated - and incapacitated - in males than females. Of more than 18,000 other genes, none showed a gender imbalance in mutation rates. Of the six genes more likely to be mutated in males, five were known to escape X chromosome inactivation, making them strong candidates to be EXITS genes. "The fact that the very genes which are more often mutated in males are found exclusively on the X chromosome - and that several of them are known to be tumor-suppressors and escape X-inactivation - is compelling evidence of our theory," Lane remarked. "The protection afforded by the working copies of these genes in female cells may help explain the lower incidence of many cancers in women and girls." One of the implications of the finding is that many cancers may arise through different molecular pathways in men and women. To circumvent the added genetic safeguards against cancer in female cells, tumors in women may employ alternate genetic circuits than in men. To explore this possibility, the study authors recommend that future clinical studies of cancer treatments be "statistically powered" ¬- that is, involve enough patients and tumor tissue samples - to understand whether men and women respond differently to treatment because of genetic differences in their tumors. The lead authors of the study are Andrew Dunford, of the Broad Institute and David M. Weinstock, MD, of Dana-Farber and the Broad Institute. Co-authors are Virginia Savova, PhD, John P. Cleary, Akinori Yoda, PhD, and Alexander A. Gimelbrant, PhD, of Dana-Farber; Steven E. Schumacher, MS, and Rameen Beroukhim, MD, PhD, of Dana-Farber and the Broad Institute; Timothy J. Sullivan, Julian M. Hess of the Broad Institute; and Michael S. Lawrence, PhD, of Massachusetts General. Financial support for the research was provided by the National Cancer Institute (grant K08CA181340); an American Society of Hematology Scholar Award; a V Foundation Scholar Award and a Stand Up to Cancer Innovative Research Grant. From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world.


News Article | December 5, 2016
Site: www.eurekalert.org

PORTLAND, OR - New research shows that quickly identifying patients with high-risk acute myeloid leukemia (AML), and speeding the process to find them a stem cell donor and performing the transplant earlier, can significantly improve their chances of surviving for at least two years after diagnosis without a relapse. The research was conducted by SWOG, the cancer clinical trials group that is part of the National Cancer Institute's (NCI) National Clinical Trials Network, the oldest and largest cancer research network in the nation. Results will be presented Monday, Dec. 5 at the 58th American Society of Hematology Annual Meeting by Dr. John Pagel, chief of the Hematologic Malignancies program at the Swedish Cancer Institute in Seattle, WA and co-principal investigator for the SWOG research study, called S1203. Pagel's presentation is one of 18 made by SWOG investigators at the 2016 ASH annual meeting, held in San Diego, CA. "We are very excited to share these results," Pagel said. "This study showed we can get significantly more high-risk AML patients to a stem cell transplant before their cancer recurs by simply working hard to identify an appropriate donor and proceeding to transplantation as soon as possible. When we do, more high-risk patients live longer and are likely cured. This process may establish a new standard of care." AML is a fast-growing type of cancer, common in the elderly, in which the bone marrow makes too many white blood cells. According to NCI statistics, there will be an estimated 19,950 new cases of AML in 2016, with an estimated 10,430 deaths, in the United States. Only 27 percent of AML patients survive five years after their diagnosis, NCI data shows. Some are at even greater risk. High-risk AML marked by certain genetic mutations is more resistant to chemotherapy, and even if it responds to chemotherapy, can more quickly cause relapse and death. These high-risk patients are the population that Pagel and his team wanted to help when they designed and launched S1203. Previous research had shown that high-risk AML patients can live longer if they use a donor's stem cells to get an allogeneic hematopoietic cell transplant, or allogeneic HCT, after chemotherapy and before a relapse. But only about 40 percent of these high-risk patients do so. An allogeneic HCT is a complicated process of transplanting a type of stem cell from healthy donors, or in select cases, from cord blood, to patients with certain cancers of the bone marrow and blood. Could Pagel and his team more quickly identify high-risk AML patients, and more quickly get them a transplant? If they did, how much of a difference would it make to their survival? These are the questions the SWOG team set out to answer. To more rapidly identify high-risk patients, the SWOG team created a protocol that involved running a DNA test on patients immediately upon their AML diagnosis. The test checks for genetic mutations that signal high-risk - and likely extremely difficult to cure - variants of the disease, with results returning in about a week. Working with the National Marrow Donor Program (NMDP), they also created a process to rapidly identify stem cell donors for these high-risk patients. All patients in the trial got a cheek swab upon diagnosis, and DNA on the swab was used to find a donor in the worldwide registry, or investigators worked with relatives, such as siblings, to find a match even while the patient was undergoing chemotherapy. This coordinated, proactive approach is different. Often, doctors and patients wait until after chemotherapy, when the cancer returns, to begin to seek an allogeneic HCT. Pagel and his team enrolled 738 eligible patients to the trial, and 159 of them - or about 22 percent - were identified as high-risk. Out of 159 high-risk patients, 107 had the stem cell transplant. The results were clear. Pagel and his team increased the transplant rate for high-risk patients from the 40 percent standard to a whopping 64 percent. And two-year survival for high-risk patients also increased significantly. Typically, only about 22 percent of high-risk patients survive two years after their cancer diagnosis. Pagel and his team saw that two-year survival rate increase to 45 percent for high-risk patients who got the transplant. "The big message here is 'Don't delay identifying a donor,'" Pagel said. "Find these high-risk patients fast - and get them a transplant fast - and you can save lives. This only requires a simple, coordinated approach to testing and transplant searches. It's not complicated, but it makes an impact." The co-principal investigator of the S1203 study team is Dr. Guillermo Garcia-Manero of University of Texas MD Anderson Cancer Center. The study team also includes: Megan Othus, Ph.D., of Fred Hutchinson Cancer Research Center; Dr. Min Fang of the University of Washington and the Seattle Cancer Care Alliance; Dr. Jerald Radich of the University of Washington and the Seattle Cancer Care Alliance; Dr. David A. Rizzieri of Duke University and the Duke Cancer Institute; Dr. Guido Marcucci of City of Hope; Dr. Stephen A. Strickland, Jr. of Vanderbilt University and Vanderbilt-Ingram Cancer Center; Dr. Mark. R. Litzow of Mayo Clinic; Dr. M. Lynn Savoie of University of Calgary and Arnie Charbonneau Cancer Institute; Dr. Stephen R. Spellman of the Center for International Blood & Marrow Transplant Research; Dr. Dennis L. Confer of the National Marrow Donor Program; Dr. Jeffrey W. Chell of the National Marrow Donor Program; Dr. Maria Brown of Rush University Medical Center; Dr. Bruno Medeiros of Stanford University Medical Center; Dr. Mikkael Sekeres of Cleveland Clinic; Dr. Tara Lin of the University of Kansas Cancer Center; Dr. Geoffrey Uy of Washington University School of Medicine in St. Louis; Dr. Bayard L. Powell of Wake Forest Baptist Health; Dr. Jonathan Kolitz of Norwell Health; Dr. Richard A. Larson of the University of Chicago; Dr. Richard M. Stone of Dana-Farber Cancer Institute; Dr. David Claxton of Penn State Cancer Institute; Dr. James Essell of Oncology Health Care; Dr. Selina Luger from Penn Medicine; Dr. Sanjay Mohan from Vanderbilt University and Vanderbilt-Ingram Cancer Center; Anna Moseley, M.S. of Fred Hutchinson Cancer Research Center; Dr. Harry Erba of University of Alabama at Birmingham School of Medicine; and Frederick R. Appelbaum of Fred Hutchinson Cancer Research Center. S1203 was supported by the National Cancer Institute through grants CA180888; CA180819; CA18020; CA180821; CA180863; CA077202; and CCSRI 021039. SWOG is part of the National Cancer Institute's National Clinical Trials Network, the nation's oldest and largest cancer research network, and is a major part of the cancer research infrastructure in the U.S. and the world. SWOG has over 12,000 members in 46 states and six foreign countries who design and conduct cancer clinical trials to improve the lives of people with cancer. Founded in 1956, SWOG's 1,300 trials have led to the approval of 14 cancer drugs, changed more than 100 standards of cancer care, and saved more than 2 million years of human life. Learn more at swog.org.


News Article | December 5, 2016
Site: www.eurekalert.org

SAN DIEGO, CA - Early intervention with an immunotherapy-based drug combination may prevent progression of high-risk "smoldering" multiple myeloma to the full-blown disease, according to researchers from Dana-Farber Cancer Institute. The interim results of a phase 2 clinical trial are to be presented at the 58th annual meeting of the American Society of Hematology in San Diego on December 5, 2016. According to Irene Ghobrial, MD, first author of the report, the findings represent "a promising starting point for the paradigm shift towards early therapeutic intervention in patients with high-risk smoldering multiple myeloma." Ghobrial is also co-principal investigator of the Center for Prevention of Progression of Blood Cancers at Dana-Farber/Brigham and Women's Cancer Center. The combination of the immunotherapy agent elotuzumab with lenalidomide and dexamethasone was well tolerated, with a low rate of grade 3 or 4 toxicities, the study found. Individuals are said to have smoldering multiple myeloma if they have evidence of disease in the bone marrow and other pathological signs putting them at risk of developing myeloma, the incurable blood cancer diagnosed in about 30,000 people annually, with 12,650 deaths expected in 2016, according to the American Cancer Society. Smoldering multiple myeloma patients with high-risk indicators have a 50 percent chance of progressing to symptomatic multiple myeloma within two years. A number of clinical trials are evaluating whether early intervention during the smoldering phase is safe and can prevent myeloma progression. Ghobrial presented data on 47 of the 50 patients enrolled in the study to date, including 23 patients who completed nine treatment cycles. The drug combination caused tumor shrinkage in 82.6 percent of the latter group of patients, with 34.8 percent complete and very good partial responses. "Many of these patients are in remission at a median follow-up time of seven months," said Ghobrial. "Some patients have been followed for 23 months, and we haven't seen progression to symptomatic disease in any patient." "The early results suggest better results than those from a previous trial in which patients received a combination of lenalidomide and dexamethasone," said Ghobrial. "While the interim results are very exciting, I think we need a randomized phase 3 trial before we can make [early intervention] the standard of care." Senior authors of the report are Kenneth C. Anderson, MD, and Paul Richardson, MD, of Dana-Farber. From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world.


News Article | December 12, 2016
Site: www.eurekalert.org

(MEMPHIS, Tenn. - December 12, 2016) A team of scientists has developed a model system in mice that allows them to look closely at how a protein often mutated in human cancer exerts its tumor-silencing effects. Not all cancers are caused by direct changes in the genetic code. Cancers also arise from epigenetic events that influence gene expression in other ways. The new findings, reported online in Nature Genetics, shed light on how epigenetic processes contribute to gene regulation and the onset of colon cancer. "ARID1A mutations occur in a broad range of human cancers, and it is important to have experimental systems where we can look at how mutation of this gene contributes to disease," said Charles W. M. Roberts, M.D., Ph.D., corresponding author of the study and executive vice president and director of the Comprehensive Cancer Center at St. Jude Children's Research Hospital. "Our results represent an advance in modeling colon cancer and implicate enhancer-mediated gene regulation as a principal tumor suppressor function of ARID1A." ARID1A is a component of the SWI/SNF chromatin remodeling complex. Chromatin remodeling, which controls how much "read access" the cellular transcription machinery has to DNA sequences, can have profound consequences on gene expression. Genes encoding chromatin remodeling proteins are some of the most frequently mutated genes in human cancer. The researchers showed that ARID1A functions as a tumor suppressor in the colon of mice but not in the small intestine. They discovered that enhancers, short regions of DNA that specify which genes are turned on in each cell type, were an important part of the interaction of ARID1A with the SWI/SNF chromatin remodeling complex. Peter J. Park of Harvard Medical School and one of the authors of the study remarked: "Our work showed that when ARID1A is absent, the SWI/SNF chromatin remodeling complex is lost from thousands of enhancers, resulting in reduced expression of nearby genes." The scientists revealed a broad role for ARID1A in regulating active enhancers whereby loss of ARID1A impairs control of cell identity in the colon and promotes cancer formation. The new system will be useful in future work. "The system we have developed will be extremely useful to understand why chromatin remodelers are so frequently mutated in cancer, to reveal mechanisms that cause colon cancer growth, and to study potential therapeutic interventions," said Roberts. The other authors are Radhika Mathur, Burak Han Alver and Agoston Agoston of Harvard Medical School; Adrianna San Roman and Ramesh A. Shivdasani of Harvard Medical School and Dana-Farber Cancer Institute; and Boris Wilson, Xiaofeng Wang of Dana-Farber Cancer Institute. The research was funded in part by the National Institutes of Health (grants R01CA172152 and R01DK081113), the National Cancer Institute (Cancer Center Support Grant P30CA06516), The Cure AT/RT Now Foundation, the Avalanna Fund, the Garrett B. Smith Foundation, Miles for Mary, the Lind Family, Claudia Adams Barr, Alex's Lemonade Stand and ALSAC. St. Jude Children's Research Hospital is leading the way the world understands, treats and cures childhood cancer and other life-threatening diseases. It is the only National Cancer Institute-designated Comprehensive Cancer Center devoted solely to children. Treatments developed at St. Jude have helped push the overall childhood cancer survival rate from 20 percent to 80 percent since the hospital opened more than 50 years ago. St. Jude freely shares the breakthroughs it makes, and every child saved at St. Jude means doctors and scientists worldwide can use that knowledge to save thousands more children. Families never receive a bill from St. Jude for treatment, travel, housing and food--because all a family should worry about is helping their child live. To learn more, visit stjude.org or follow St. Jude at @stjuderesearch.


News Article | December 22, 2016
Site: www.eurekalert.org

BOSTON -- Despite many successes in treating pediatric cancer, young children remain at high risk for developing severe, long-lasting impairments in their brain, heart, and other vital organs from chemotherapy and radiation treatments. In adults, however, these tissues are relatively spared. This disparity, which has never been explained, creates a complicated balancing act for doctors - administering doses high enough to have a chance of curing young cancer patients while minimizing the risk of long-term cognitive and heart damage. This "therapeutic window" is particularly narrow in infants and young children compared to adults, whose vital organs are more resilient to intense treatment. Now, scientists at Dana-Farber Cancer Institute say they have discovered a potential explanation for why brain and heart tissues in very young children are more sensitive to collateral damage from cancer treatment than older individuals. Reporting in Cancer Cell, they show that the tissues in these still-developing organs are more prone to apoptosis, or programmed cell death, when subjected to toxic stresses like chemotherapy and radiation. Apoptosis, in which molecular signals order cells to self-destruct, plays an important role in deciding the "fate" of a developing cell - that is, its final form and function in the body. For example, apoptosis allows the "pruning" of brain cell connections that aren't needed or productive in the fully formed brain. But active apoptosis in the early brain "also sets the stage for extremely high sensitivity to any type of damage or stress, especially that induced by radiation or chemotherapy," said Kristopher A. Sarosiek, PhD, an assistant professor of radiation biology at the Harvard T.H. Chan School of Public Health, and first author of the paper. He was formerly a postdoctoral fellow in the Dana-Farber laboratory of Anthony Letai, MD, PhD, who is senior author of the publication. Cancer cells, however, often die through apoptosis when attacked by chemotherapy, radiation, and other treatments, although cancer cells try to escape the death orders by activating "pro-survival" signals to countermand the death commands. Letai previously developed a test called BH3 profiling that can measure inside any cell the relative dominance of pro-survival or pro-death signals, which are mediated by a family of proteins. Proteins called BAX and BAK are key "executioner" molecules that signal cells to self-destruct. A cancer cell in which apoptotic death signals are dominant, is said to be "highly primed" for self-destruction and therefore easily killed by therapy, while a cell with low priming is more resistant to death or damage. In the new study, the researchers measured the priming of cells in normal cells and tissues. They found that in most normal adult tissues, including the brain and the heart, the machinery needed to perform apoptosis is nearly completely absent. In contrast, this molecular machinery is abundant in newborn and very young rodents. As a result, brain and heart cells were therefore much more vulnerable to undergoing cell death when exposed to chemotherapy or radiation. After determining in mouse models that heart and brain cells grew more resistant to treatment toxicity with age, the scientists tested the hypothesis in human cells. They obtained fresh samples of tissue that had been removed from brains of children and adults during surgery to prevent intractable epileptic seizures. As in the mice, the youngest human brain cells were more highly primed with apoptotic machinery and vulnerable to chemotherapy and radiation damage. Human brain and heart cells are most highly primed for apoptosis until 4 to 6 years of age, said the researchers, making that period prior to that the most risky for treatment-related damage. After that, priming continues to be reduced, but tissues don't become firmly resistant to damage until closer to adulthood, they said. Because they identified the apoptosis molecules involved in tissue damage, the study "has uncovered some opportunities to selectively block apoptosis in our healthy tissues and prevent toxicity from radiation or chemotherapy while still maintaining sensitivity within cancer cells," said Sarosiek. "We are actively pursuing the identification of new medicines that can be used exactly for this purpose." From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world.


News Article | November 30, 2016
Site: www.eurekalert.org

BOSTON -- Researchers led by scientists at Dana-Farber Cancer Institute say they have identified unique genomic changes that may be integral to testicular cancer development and explain why the great majority are highly curable with chemotherapy - unlike most solid tumors. The findings may shed light on factors in other cancers that influence their sensitivity to chemotherapy, according to a report in Nature. Cancers of the testes are known as germ cell tumors (germ cells produce sperm and eggs). In 2016, about 8,720 new cases are expected in the U.S., with about 380 deaths. Although they are rare, primary testicular germ cell tumors are the most common solid cancers in young men. Most of the tumors are highly sensitive to chemotherapy, and more than 80 percent of patients with germ cell tumors are cured, even when the cancer has metastasized. However, a significant number become chemotherapy-resistant, and about 10 percent of patients with metastatic germ cell tumors die as a result. Previous studies of the genomes of testicular tumors revealed mutations and chromosome damage, but haven't pinpointed specific alterations or events linked to chemosensitivity or resistance. The new research was carried out by scientists led by Eliezer Van Allen, MD, of Dana-Farber and the Broad Institute of MIT and Harvard, and Christopher Sweeney, MBBS, of Dana-Farber. In a comprehensive search for the critical genomic and molecular features of these cancers, the scientists analyzed samples of 59 tumors from 49 patients treated between 1997 and 2014 at Dana-Farber/Brigham and Women's Cancer Center (DF/BWCC) over a period. The samples were studied with whole-exome DNA sequencing and RNA transcriptome analysis, and the findings were correlated with clinical outcomes data. Although mutated genes are the main drivers of many cancers, "we didn't find any one gene that really explains" the formation of testicular cancers, said Sweeney. One feature of the tumors that had been previously reported was a gain of extra DNA copies on one arm of chromosome 12, in a segment labeled 12p. Chromosomes carry two versions, or alleles, of DNA, one from each parent. In the new study, however, the scientists found there were many chromosome changes with multiple parts of the genome having gain of one parental allele while simultaneously losing a copy of the other parental allele - a type of chromosomal damage called reciprocal loss of heterozygosity (RLOH). The gain and loss of DNA copies shows that the tumors' chromosomes "are profoundly deranged," said Van Allen, and represents "a hallmark feature we hadn't noticed before." This abnormality maybe linked to the development of germ cell tumors and cause them to be sensitive to chemotherapy, Van Allen said, but exactly how it does so remains to be discovered. The analysis revealed another feature of the chemosensitive germ cell tumors - they possessed intact copies of the p53 gene. This gene directs cells to make a tumor-suppressor protein that clamps down on renegade cells so they can't form tumors. Many cancers contain mutated or lost p53 genes, indicating they have lost this protective factor. Moreover, the researchers discovered that in contrast to most types of cancer, testicular tumor cells are already poised on the brink of self-destruction by apoptosis. Apoptosis, also known as programmed cell death, is the body's quality control process that gets rid of unneeded and dangerously abnormal cells. Many cancers have evolved strategies for blocking the cell's orders to self-destruct. The study results suggest that most testicular tumors may be highly susceptible to chemotherapy because their cells are already highly "primed" for apoptotic death, although why this is so hasn't been determined. In another part of the study, the scientists studied 13 germ cell tumor samples taken from five patients over time, spanning from before they underwent treatment to after the tumors became drug-resistant. As the cancers progressed, they showed increases in chromosomal abnormalities seen in all the tumors. The cells of the germ cell tumors also became more "differentiated" - a trait that's usually associated with less-aggressive cancers; this observation remains a puzzle, the authors said, but may explain the resistance of these tumors to chemotherapy. Because of their rarity, germ cell tumors haven't been as intensively studied as other forms of cancer, and research funding is more scarce, Sweeney said. The new study, he said, "gives us insights into germ cell tumor biology that haven't been found to this degree and provide a strong base to explore these very interesting findings further." First authors of the report are Amaro Taylor-Weiner of Harvard University and the Broad, and Travis Zack, PhD, of Harvard University and Harvard Medical School. The research was supported by National Institutes of Health grants U54 HG003067 and 1K08 CA188615. From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world.


News Article | December 5, 2016
Site: www.eurekalert.org

SAN DIEGO, CA - A significant percentage of lymphoma patients undergoing transplants with their own blood stem cells carry acquired genetic mutations that increase their risks of developing second hematologic cancers and dying from other causes, according to a study from Dana-Farber Cancer Institute. The mutations were found in about 30 percent of 401 patients with non-Hodgkin lymphoma (NHL) whose blood was sampled at the time they received autologous transplants, the scientists reported at the 58th annual meeting of the American Society of Hematology in San Diego, December 5, 2016. Patients older than 60 were more likely to carry the mutations, which occurred in several different genes, and were acquired, not inherited. Transplant recipients who were mutation carriers had a higher risk - 14.4 percent versus 4.4 percent - of developing a second blood cancer over the next 10 years compared with those lacking the mutation. The second cancers were acute myeloid leukemia (AML) and myelodysplastic syndrome. Carriers of the mutations were also less likely to survive for 10 years (30.6 percent versus 60.9 percent) than individuals lacking the mutations. The greater mortality in mutation carriers wasn't only due to second cancers, but was also the result of other conditions such as heart attacks and strokes, for reasons the scientists say aren't yet clear. The most commonly mutated gene in the transplant patients was PPM1D, which plays a key role in cells' DNA damage repair toolkit. The mutations cause an abnormal condition called CHIP (clonal hematopoiesis of indeterminate potential), an age-related phenomenon that occurs in 10 to 15 percent of patients over age 65. In clonal hematopoiesis, some blood-forming stem cells acquire mutations and spawn clones - subpopulations of identical cells that expand because they have gained a competitive advantage over normal stem cells. Individuals with CHIP don't have symptoms or obvious abnormalities in their blood counts, but researchers are studying whether CHIP in some cases might represent the earliest seeds of blood cancers. The new study is the first to systematically look at how CHIP influences outcomes in patients undergoing autologous stem cell transplants, according to the report, whose first author is Christopher J. Gibson, MD, of Dana-Farber. The senior author is Benjamin L. Ebert, MD, PhD, of Dana-Farber/Brigham and Women's Cancer Center. Gibson noted that 30 percent of the patients with CHIP had more than one mutation, and those patients had even greater odds of developing second cancers and their overall survival was worse than individuals having only one mutation. The CHIP mutations may be caused by a combination of aging and prior treatment with chemotherapy for their disease, and could also be related to the lymphoma itself, Gibson said. The authors said the study findings may have clinical implications. "They suggest the need to specifically study the connection between CHIP and lymphoma more deeply, which could be accomplished by assessing CHIP in patients with newly diagnosed lymphoma prior to the administration of any chemotherapy or mobilizing agents," they wrote. "They also suggest the need to consider alternative therapeutic approaches" for lymphoma patients who have a high risk of developing second cancers and are being considered for autologous stem cell transplants. From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world.


News Article | November 17, 2016
Site: www.eurekalert.org

BOSTON -- Researchers leading the largest genomic tumor profiling effort of its kind say such studies are technically feasible in a broad population of adult and pediatric patients with many different types of cancer, and that some patients can benefit by receiving precision drugs targeted to their tumors' mutations or being enrolled in clinical trials. Published online by JCI Insight, it is the first report of "clinical implementation of tumor profiling in an enterprise-wide, unselected cancer patient population," according to the authors. The report contains data on 3,727 patients whose samples were analyzed during the first year of the Profile program at Dana-Farber/Brigham and Women's Cancer Center and Boston Children's Hospital. Unlike most other genomic testing programs, Profile tumor analysis is offered to all patients regardless of age, cancer type, or stage of the cancer. While determining the genetic makeup of a patient's tumor is a critical tool for precision cancer medicine, the report's authors noted several challenges and unanswered questions about large-scale clinical application of the methods. Just over half of patients in the study who gave consent and had tumor profiling ordered by a physician actually received results, due to a variety of technical and logistical factors. For example, a patient's cancer sample might not have had sufficient material for study or for DNA sequencing. And in only a minority of cases - about 10 percent across the cohort, the researchers estimated - was the test information used in caring for the patient, although in some cancer types genomic results were used in a much higher percent of cases. Reasons for the attrition rate included absence of effective drugs, timing of genomic testing in the course of a patient's disease, less-than-optimal access to targeted drugs or clinical trials, and patient and provider preferences. Identifying these barriers allows researchers to develop and implement new solutions, with the goal of improving the rate of use of the genomic results, the authors said. Overall, the turnaround time from receiving the sample to issuing a report of the findings was 5.3 weeks - a timespan the researchers said they have since shortened to less than three weeks. Profile tumor genotyping, which started in 2011, uses a platform called OncoPanel that comprehensively sequences hundreds of known cancer-related genes in a patient sample to look for mutations or other genetic alterations that drive tumors and which might be "actionable" - that is, potentially helpful in guiding the choice of a precision treatment or in enrolling the patient in appropriate clinical drug trials. Although 3,727 cases were reported in this paper, more than 15,000 individual tumors have been analyzed to date. "A widespread genomic profiling initiative is expensive, and this cost has been borne by our institutions," said Laura MacConaill, PhD, of Dana-Farber Cancer Institute and Brigham and Women's Hospital (BWH), the scientific director of the Profile program and corresponding author of the publication. First author of the report is Lynette M. Sholl, MD, of BWH. MacConaill noted that the results of Profile genomic testing are being used to further research within the institutions and are being shared more widely with initiatives like Project GENIE of the American Association for Cancer Research (AACR), which will help advance the field of precision medicine. The study wasn't designed to measure whether tumor profiling made a difference in how patients fared, but "it nonetheless lays the groundwork for more systematic study of the impact of genomics on clinical practice and patient outcomes," the report said. According to the report, at least one actionable mutation was discovered in about two-thirds of patient samples. In 20 percent of cases, such mutations could inform treatment decisions, such as matching a patient's tumor profile to a targeted drug or improving the original diagnosis. In the remaining cases, the information could lead to referring the patient to clinical trials of approved or investigational drugs. Tumor profiling can also reveal rare mutations and other changes that make some cancers unusually responsive to targeted drugs - knowledge that can be applied to patients with a variety of cancer types. The report gave some examples of how genomic testing clarified or changed a patient's diagnosis, which in turn altered treatment and prognosis. The authors concluded that "Genomic results may alter management in diverse scenarios; however, additional barriers must be overcome to enable precision cancer medicine on a large scale." This work was supported by Dana-Farber, Brigham and Women's Hospital, and grant support from the National Cancer Institute (5R33CA155554 and 5K23CA157631). From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world. Brigham and Women's Hospital (BWH) is a 793-bed nonprofit teaching affiliate of Harvard Medical School and a founding member of Partners HealthCare. BWH has more than 4.2 million annual patient visits and nearly 46,000 inpatient stays, is the largest birthing center in Massachusetts and employs nearly 16,000 people. The Brigham's medical preeminence dates back to 1832, and today that rich history in clinical care is coupled with its national leadership in patient care, quality improvement and patient safety initiatives, and its dedication toresearch, innovation, community engagement and educating and training the next generation of health care professionals. Through investigation and discovery conducted at its Brigham Research Institute (BRI), BWH is an international leader in basic, clinical and translational research on human diseases, more than 3,000 researchers, including physician-investigators and renowned biomedical scientists and faculty supported by nearly $666 million in funding. For the last 25 years, BWH ranked second in research funding from the National Institutes of Health (NIH) among independent hospitals. BWH is also home to major landmark epidemiologic population studies, including the Nurses' and Physicians' Health Studies and the Women's Health Initiative as well as the TIMI Study Group, one of the premier cardiovascular clinical trials groups. For more information, resources and to follow us on social media, please visit BWH's online newsroom.


News Article | April 8, 2016
Site: www.fastcompany.com

Nearly 40% of men and women will be diagnosed with cancer in their lifetimes, with about 1.7 million of those cases expected in 2016 in the United States (according to the National Cancer Institute). These patients are hoping for better treatments and, hopefully someday, cures. They could also be valuable resources, helping experts develop better therapies, if only staff at research centers like Dana-Farber Cancer Institute in Boston could study their unique cases. Even patients with the same diagnosis, such as breast cancer, have different genetic makeups, both in their healthy cells and in their tumors. These differences provide clues to new genetic factors that may cause the disease, why some patients respond especially well to certain treatments, why some tumors are so resistant to treatment, and how people of different ages or ethnicities are affected. "A very small fraction of adult cancer patients in the U.S. gets seen at these big centers, probably less than 15%," says Nikhil Wagle, an oncologist at Dana Farber specializing in breast cancer. "The vast majority…get treated in community hospitals where they get clinical care, but their tissue [sample] goes to the pathology department and sits there." It's a classic "long tail" problem: There's a large community of people, but they are spread out. So Broad Institute/Dana-Farber Integrative Cancer Biology Program in Cambridge, Massachusetts, formed the Metastatic Breast Cancer Project to find a long tail solution: Find people on the Internet. "The traditional way is that when a patient is at [a research] institution, someone will approach them and ask them in person," says Wagle. "We're trying to complement that by doing this 21st century, go directly to patients." That strategy has already netted about 1,700 people (both women and men) with metastatic breast cancer—cancer that has spread beyond the breast, threatening other parts of the body. Wagle says that 95% of them have provided some information about their condition, and that more than 900 have agreed to share medical records, tumor samples, and saliva (for genetic sequencing). Those are huge numbers for the coalition's first study project, just launched in October 2015. This is not a "build it and they will come" approach. Sending out a tweet and creating a hashtag isn't going get people to come flocking (although the team has also done that, at @MBC_Project and #mbcproject). "I've seen a lot of other people trying to do research studies or recruitment efforts in the space of social media just by launching something without patient input, and they haven't been necessarily as successful," says Corrie Painter, a cancer researcher and Wagle's partner on the project. Instead, they spent a year finding allies. "We built a lot of in-person support among movers and shakers in the metastatic breast cancer community," says Wagle, "people who have blogs or highly followed Twitter feeds or had their own Facebook pages." Early supporters included the Metastatic Breast Cancer network; and the project now has 15 support organizations. Painter already had personal experience with online support networks. "I'm six years out of a very rare cancer called angiosarcoma," she says. "I currently don't have disease, but it's a highly aggressive, very rare, understudied cancer." Angiosarcoma, which affects the inner lining of blood vessels, will be the next outreach project, expected to launch at the end of the summer. It's a perfect candidate because it is so rare: It takes the power of the Internet to find enough patients for a meaningful study. In dealing with and advocating for her condition, Painter has worked through the Angiosarcoma cancer group on Facebook. "As I build this study, I am building it out with them," says Painter. "When it comes from the patients themselves, it's so much more powerful." She was a postdoc at UMASS Medical School studying cancer immunology when she applied for the job at the Broad. "As a scientist, as an insider, I just really felt very strongly…that doing traditional academic medicine was not going to be impactful," says Painter. One thing researchers decided along with patients was to set a low barrier for entry. People who sign up online get a link to a participant consent form and then provide the names of the places where they've been treated and of the doctors who have treated them. Staff at the Broad (rhymes with "road") Institute then call to get all the records, as well as already-biopsied tumor samples it can do advanced genetic analysis on. "What's sad is that somehow it's easier for the doctor or another hospital to get someone's records than it is [for patients] to get their own records," says Wagle. Participants also provide a bit of saliva in a kit that the Broad Institute sends them. One of the most valuable things patients provide—one that these studies are especially good at collecting—is continual feedback. Researchers can ask patients about other medical conditions they have and request additional records. "We can create this really detailed genomic map of their tumor, connected to all of their clinical information," says Wagle, "and then, if we want, connected to additional questions we can ask the patients." All this data will feed both into studies at the institute as well as an open database of anonymized records that any cancer researchers can access. By the end of 2016 the goal is for the Broad to have its own data portal and also contribute records to a new, soon-to-launched U.S. government database called the "National Cancer Institute Genomic Data Commons." The institute will add new data every six months. "If patients are willing to share their samples, share their stories, and share their data, and they are willing to selflessly give them up, we shouldn't hoard them," says Wagle. Once the word gets to patients, they have been very willing to join in, say the researchers. "We felt that the community of patients with metastatic breast cancer were crying out for more research and would rally around this kind of idea," says Wagle. That made this condition a good one to start with, he says, but the Broad Institute wants to expand to several other cancer types, beyond the upcoming angiosarcoma project. The Broad Institute's approach caught the eye of the White House, which listed it as an example of innovation during its Precision Medicine Initiative summit in February. PMI is an overarching concept that medical treatments should be targeted to and customized for individual patients—for example, by sequencing their unique genetic makeup. It overlaps with the White House's Cancer Moonshot, led by Vice President Joe Biden, and focuses on tailored treatments that go beyond using general approaches like high doses of popular chemotherapy drugs. Both White House projects also emphasize bringing in as wide a coalition as possible, including government, industry, and patients themselves. The Obama administration has made a big push to bring outside tech experts into government—especially after the disastrous debut of the original Healthcare.gov site. This includes bringing in a lot of young people—those millennials for whom things like social media are second nature. But you don't have to be young to network online, say Wagle, an enthusiastic Twitter user who is about to turn 38, and Painter, a Facebook aficionado in her early 40s. "We're non-millennials who like social media," says Wagle. "Just don't ask us to start our Snapchat channel, because we don't know how to do that."


News Article | November 15, 2016
Site: www.eurekalert.org

BOSTON -- An experimental kidney cancer drug outperformed the standard first-line therapy for patients with metastatic disease who are considered at risk for poorer than average outcomes, according to results of a randomized phase II clinical trial by researchers at Dana-Farber Cancer Institute. Individuals who received the drug, cabozantinib, had a longer time to progression - the interval before their cancer worsened - than those taking sunitinib (Sutent), the drug that has been the standard initial treatment for metastatic kidney cancer for the past decade. Preliminary data also showed that cabozantinib was associated with 20 percent lower risk of death during the study. Toni K. Choueiri, MD, director of the Lank Center for Genitourinary Oncology at Dana-Farber, is lead author on a report in the Journal of Clinical Oncology summarizing results of the multicenter trial; senior authors are from Duke University Medical Center and Memorial Sloan Kettering Cancer Center. "These results are very relevant to our practice and our kidney cancer patients - they may change the standard," Choueiri said. "The results also demonstrate that studies sponsored by the National Cancer Institute can accrue rapidly and yield highly relevant results to the field." Metastatic clear cell renal cell carcinoma (RCC), is largely incurable, but researchers have identified factors used to classify patients as good, intermediate, or poor risk in terms of potential outcomes. The clinical trial included 157 patients, 81 percent considered to be intermediate risk and 19 percent poor risk, who had no previous treatment. In 36 percent of patients, the cancer had spread to the bone - a harbinger of worse outcome. The most effective drugs for metastatic kidney cancer at present are agents that block angiogenesis by targeting vascular endothelial growth factor (VEGF) and its receptors. Such compounds are designed to interrupt blood supply to the tumors, slowing their growth or shrinking them. Both sunitinib and cabozantinib inhibit VEGF; cabozantinib also blocks the MET and AXL oncogenes, both involved in resistance to VEGF inhibitors. Cabozantinib, made by Exelixis, Inc., received Food and Drug Administration approval earlier in 2016 for second-line treatment of advanced kidney cancer. The current trial, known as A031203 CABOSUN, is comparing cabozantinib and sunitinib as initial treatment. The primary endpoint of the trial is progression-free survival, which was a median 8.2 months for cabozantinib and 5.6 months for sunitinib. Cabozantinib reduced the rate of disease progression or death by 34 percent compared with sunitinib. The overall response rate was better for cabozantinib patients, 46 percent of whom had complete or partial responses compared to 18 percent in the sunitinib group. The trial wasn't designed to compare overall survival rates between the drugs, but the researchers said preliminary data with a relatively short follow-up showed cabozantinib treatment was associated with a 20 percent decrease in the risk of death. The safety and side effects profiles of the two drugs were similar and comparable to those observed in kidney cancer patients treated with other VEGF inhibitors, the investigators said. Patients stopped treatment because of adverse events at equivalent rates with the two drugs. The research was supported by National Institutes of Health grants U109CA180821 and U10CA180882. From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world's leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report's Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women's Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston's Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute's work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world.


News Article | September 15, 2016
Site: www.biosciencetechnology.com

Although targeted drugs like Gleevec have revolutionized the treatment of chronic myelogenous leukemia (CML), patients generally must take them for the rest of their lives and may cease benefiting from them over time. In new research that could suggest a road to a cure, scientists at Harvard-affiliated Dana-Farber Cancer Institute and Boston Children’s Hospital have found that CML stem cells die when a protein called Ezh2 is inhibited. Drugs that target the protein are currently in clinical trials for other cancers. The findings, reported online today in the journal Cancer Discovery, raise the prospect that Ezh2 blockers, in combination with Gleevec and similar drugs, could eradicate the disease in some patients relatively rapidly or could be an effective therapy for those who become resistant to Gleevec-like agents, the authors write. In a paper published simultaneously by Cancer Discovery, a team of Scottish scientists report similar findings using a different research approach. “The vast majority of patients with CML do remarkably well on imatinib [Gleevec] and similar drugs: The disease is well-controlled and side effects are tolerable,” said Stuart Orkin, the study’s senior author and a pediatric hematologist/oncologist at Dana-Farber/Boston Children’s Cancer and Blood Disorders Center. “In only 10-20 percent of patients, however, are the leukemia cells fully cleared from the body. The other 90 percent retain a reservoir of leukemic stem cells — which initiate the disease — and must stay on the drugs permanently.” CML is a slowly progressing type of blood cancer that develops in the bone marrow. Primarily occurring in adults, it is rare in children. Over time, some patients develop resistance to Gleevec and other drugs that block BCR-ABL, the misbegotten “fusion” protein that drives CML growth. Although second- and third-line targeted therapies can often return the disease to remission, some patients don’t benefit from these drugs or develop severe side effects. The new study grew out of efforts to discover whether different types of cancer are susceptible to Ezh2 inhibitors. In laboratory experiments, the Dana-Farber/Boston Children’s researchers found that not only is Ezh2 overabundant in leukemia stem cells, but it helps them survive and give rise to full-fledged CML cells. Follow-up studies in mice showed that inactivating Ezh2 through gene-editing techniques caused CML stem cells to die, halting the disease at its source. “The stem cells’ dependence on Ezh2 suggests they will be especially vulnerable to drugs that target the protein,” Orkin said. “Such drugs are already in clinical trials for other diseases, including lymphoma and some solid tumors.” Epizyme, a biopharmaceutical company based in Cambridge, Mass., recently opened a pediatric trial of an Ezh2 inhibitor for children with rhabdoid and other tumors. Dana-Farber/Boston Children’s is a site in the multicenter Phase 1 trial. Although adding Ezh2-targeting agents to the standard drug regimen for CML has the potential to dramatically shorten the treatment period for many patients, ethical considerations may lead to the agents’ first being tested in patients who don’t respond to Gleevec and similar drugs, either initially or after drug resistance develops, Orkin said. “Our findings suggest inhibition of Ezh2 should be considered as a way to eradicate CML when used in combination with current targeted therapies. It offers a promising approach to shortening the duration of therapy in order to achieve a cure. If successful, the cost savings of such an approach could also be significant.” The study was funded in part by the National Institutes of Health and Hyundai Hope on Wheels.


WINNIPEG, MB--(Marketwired - November 14, 2016) - 3D Signatures Inc. (TSX VENTURE: DXD) (the "Company" or "3DS") is pleased to introduce its Clinical and Scientific Advisory Board (CSAB), comprised of world-renowned physicians and researchers. The CSAB, made up of external experts, will serve as a resource to Dr. Sabine Mai, Director and Chair of 3DS' Clinical and Scientific Advisory Board and 3DS' CEO, Jason Flowerday. The CSAB will help guide the clinical development of 3DS' proprietary genomic analysis software from research, right through to validation and regulatory approval. The Company is currently focused on Prostate Cancer, Hodgkin's Lymphoma, Multiple Myeloma, and Alzheimer's disease. Dr. Sabine Mai is a tenured Professor of Physiology and Pathophysiology, Biochemistry and Medical Genetics, Human Anatomy and Cell Science, University of Manitoba. She is also Director of The Genomic Centre for Cancer Research and Diagnosis (GCCRD) at University of Manitoba. Dr. Mai is an internationally known researcher who has more than one hundred publications related to research on Genomic Instability and the 3D nuclear organization in cancer and Alzheimer's disease. Most recently she has contributed to a library of patents related to her work on 3D Genomic Analysis. She is the recipient of numerous academic awards including the Braidwood Jackson Memorial Award; the Dr. Saul Highman Memorial Award; the Rh Award (Basic Science); the J&J Cognition Challenge (2013). She was recognized in 2015 as one of the Top 100: Canada's Most Powerful Women and has recently accepted an Editorial Board Member position with Genes, Chromosomes and Cancer, a high-profile peer-reviewed academic journal. Dr. Anderson is the Kraft Family Professor of Medicine at Harvard Medical School, as well as Director of the Lebow Institute for Myeloma Therapeutics and Jerome Lipper Multiple Myeloma Center at Dana-Farber Cancer Institute. He is a Doris Duke Distinguished Clinical Research Scientist and American Cancer Society Clinical Research Professor. After graduating from Johns Hopkins Medical School, he trained in internal medicine at Johns Hopkins Hospital, and then completed hematology, medical oncology, and tumor immunology training at the Dana-Farber Cancer Institute. Over the last three decades, he has focused his laboratory and clinical research studies on multiple myeloma. He has developed laboratory and animal models of the tumor in it is microenvironment which have allowed for both identification of novel targets and validation of novel targeted therapies, and has then rapidly translated these studies to clinical trials culminating in FDA approval of novel targeted therapies. His paradigm for identifying and validating targets in the tumor cell and its milieu has transformed myeloma therapy and markedly improved patient outcome. Dr. Klotz is internationally recognized for his contributions to the treatment of prostate cancer, notably for pioneering the adoption of Active Surveillance as a standard aspect of patient care. Dr. Klotz obtained his medical degree and residency training from the University of Toronto with a special fellowship in uro-oncology and tumour biology at Memorial Sloan Kettering Cancer Centre, New York. He is a widely published uro-oncologist who serves on the board or heads many medical/scientific organizations. He is a Professor, Department of Surgery, University of Toronto, past Chief of Urology, Sunnybrook Health Sciences Centre, Toronto, and Chairman, World Uro-Oncology Federation. Dr. Klotz was awarded the Order of Canada in 2014 for his contribution to prostate cancer treatment. Dr. Knecht established himself as a prominent haematologist through his ground-breaking translational research on lymphoma biology. His current focus is on the molecular events leading to the transition from the mononuclear Hodgkin to the multinuclear Reed-Sternberg cell and the impact of 3D nuclear telomere organization on this transformation. Dr. Knecht received his medical degree from the University of Zurich, Switzerland with post-graduate work under both Maxime Seligmann (Haematology) and Karl Lennert (Haematopathology) in Paris and Kiel, respectively. Dr. Knecht is currently a Professor of Medicine and Chief, Division of Haematology at McGill University and Jewish General Hospital, Montreal. Dr. Drachenberg is a urologic oncologist and researcher and strong proponent of Active Surveillance for prostate cancer patients. Dr. Drachenberg attended medical school at the University of British Columbia and urology residency at Dalhousie University. He is an American Foundation of Urology Scholar with fellowship training in urologic oncology at the National Cancer Institute in Bethesda, Maryland. He founded the laparoscopic urology program and prostate brachytherapy, cryotherapy, and HIFU programs at the University of Manitoba where he works as assistant professor of surgery and director of research for the Manitoba Prostate Center and Section of Urology and Chair of the Genito-Urinary disease site group, CancerCare Manitoba. Dr. Kotb completed his medical residency training in Paris, France, and then became a staff member at Paris XI University. He joined the Hematology-Oncology team at Sherbrooke University (QC, Canada) in 2005 as an Assistant, then Associate Professor. He also worked as the Director of Hematology undergraduate education, Head of the supra-regional team of Hematological Neoplasia and Head of the Institutional Oncology Quality Sub-committee. Late 2011, he moved to British Columbia to work at the BC Cancer Agency as an Oncologist/Hematologist, Associate Professor at the University of British Columbia and affiliate Professor at the University of Victoria. He joined the team at CancerCare Manitoba in September 2014. His practice and research activity will be focused on lymphoid neoplasia, primarily myeloma and lymphoma. Dr. Cremer is an internationally-recognized scientist specializing in the study of nuclear architecture. He is one of the pioneers of interphase cytogenetics and comparative genomic hybridization (CGH). These methods have become widely used tools for cytogenetic analyses of chromosomal imbalances. He is a corresponding member of the Heidelberg Academy for Sciences and Humanities since 2000, a member of Germany's National Academy of Sciences Leopoldina since 2006, and an honorary member of both the European Cytogenetics Association (ECA) and the German Society of Human Genetics since 2011, as well as the recipient of the medal of Honor of this Society. Dr. Cremer is an independent expert to 3DS. "The newly formed CSAB will be invaluable in guiding our clinical programs," said Dr. Sabine Mai, Company Director and Chair of 3DS' Clinical and Scientific Advisory Board. "Each member is a distinguished leader in their field and can bring insights that will help us achieve our objectives: to validate and secure the approval of accurate and minimally invasive first-in-class biomarkers that allow clinicians to personalize treatments and improve outcomes for cancer and Alzheimer's disease patients." The Company recently announced participation in a major clinical trial for prostate cancer diagnosis and management known as PRECISE (PRostate Evaluation for Clinically Important disease MRI vs Standard Evaluation procedures). The trial marks the Company's first step toward validation and approval of clinical risk assessment tests for prostate cancer. It is currently being tested as a new blood-based biomarker to accurately stratify Prostate Cancer patients into risk groups. Such a tool does not currently exist for prostate cancer patients. For more information about the PRECISE Trial and Prostate Cancer Canada, please visit their website at http://www.prostatecancer.ca. 3DS (TSX VENTURE: DXD) is a personalized medicine company with a proprietary software platform based on the three-dimensional analysis chromosomal signatures. The technology is well developed and supported by 16 clinical studies on over 1,500 patients on 13 different cancers and Alzheimer's disease. Depending on the desired application, the technology can measure the stage of disease, rate of progression of disease, drug efficacy, and drug toxicity. The technology is designed to predict the course of disease and to personalize treatment for the individual patient. For more information, visit the Company's new website at http://www.3dsignatures.com. This news release includes forward-looking statements that are subject to risks and uncertainties. Forward-looking statements involve known and unknown risks, uncertainties, and other factors that could cause the actual results of the Company to be materially different from the historical results or from any future results expressed or implied by such forward-looking statements. All statements within, other than statements of historical fact, are to be considered forward looking. In particular, the Company's statements that it expects to benefit greatly from its association with the individuals named in this news release is forward-looking information. Although 3DS believes the expectations expressed in such forward-looking statements are based on reasonable assumptions, such statements are not guarantees of future performance and actual results or developments may differ materially from those in forward-looking statements. Risk factors that could cause actual results or outcomes to differ materially from the results expressed or implied by forward-looking information include, among other things: market demand; technological changes that could impact the Company's existing products or the Company's ability to develop and commercialize future products; competition; existing governmental legislation and regulations and changes in, or the failure to comply with, governmental legislation and regulations; the ability to manage operating expenses, which may adversely affect the Company's financial condition; the Company's ability to successfully maintain and enforce its intellectual property rights and defend third-party claims of infringement of their intellectual property rights; adverse results or unexpected delays in clinical trials; changes in laws, general economic and business conditions; and changes in the regulatory regime. There can be no assurances that such statements will prove accurate and, therefore, readers are advised to rely on their own evaluation of such uncertainties. We do not assume any obligation to update any forward-looking statements. Neither the TSX Venture Exchange nor its Regulation Service Provider (as that term is defined in the policies of the TSX Venture Exchange) accepts responsibility for the adequacy or accuracy of this release.


News Article | November 1, 2016
Site: www.eurekalert.org

BOSTON - Implanted medical devices like catheters, surgical mesh and dialysis systems are ideal surfaces on which bacteria can colonize and form hard-to-kill sheets called biofilms. Known as biofouling, this contamination of devices is responsible for more than half of the 1.7 million hospital-acquired infections in the United States each year. In a report published in Biomaterials today, a team of scientists at Beth Israel Deaconess Medical Center (BIDMC), the Wyss Institute for Biologically Inspired Engineering and the John A. Paulson School of Engineering and Applied Sciences (SEAS) at Harvard University has demonstrated that an innovative, ultra-low adhesive coating prevented bacteria from attaching to surfaces treated with it, reducing bacterial adhesion by more than 98 percent in laboratory tests. "Device related infections remain a significant problem in medicine, burdening society with millions of dollars in health care costs," said Elliot Chaikof, MD, PhD, chair of the Roberta and Stephen R. Weiner Department of Surgery and Surgeon-in-Chief at BIDMC and an associate faculty member at the Wyss Institute. "Antibiotics alone will not solve this problem. We need to use new approaches to minimize the risk of infection, and this strategy is a very important step in that direction." The self-healing slippery surface coatings - known as 'slippery liquid-infused porous surfaces' (SLIPS) - were developed by Joanna Aizenberg, PhD, a Wyss Institute core faculty member, Professor of Chemistry and Chemical Biology and the Amy Smith Berylson Professor of Materials Science at SEAS at Harvard University. Inspired by the carnivorous Nepenthes pitcher plant that uses the slippery surface of its leaves to trap insects, Aizenberg engineered surface coatings that work to repel a variety of substances across a broad range of temperature, pressure and other environmental conditions. They are stable when exposed to UV light, and are low-cost and simple to manufacture. The current study is the first to demonstrate that SLIPS not only limit the ability of bacteria to adhere to surfaces, but also impede infection in an animal model. "We are developing SLIPS recipes for a variety of medical applications by working with different medical-grade materials, ensuring the stability of the coating, and carefully pairing the non-fouling properties of the SLIPS materials to specific contaminates, environments and performance requirements," said Aizenberg. "Here we have extended our repertoire and applied the SLIPS concept very convincingly to medical-grade lubricants, demonstrating its enormous potential in implanted devices prone to bacterial fouling and infection." In a series of trials, the researchers tested three SLIPS lubricants for their anti-adhesive qualities. First, they incubated disks of SLIPS-coated medical material ePTFE - a microporous form of Teflon - in a broth of Staphylococcus aureus (S. aureus), a generally harmless bacterium found in the nose and on skin, but one of the most common causes of hospital-acquired infections. After 48 hours, the three variations of SLIPS-treated disks demonstrated 98.3, 99.1 and 99.7 percent reductions in bacterial adhesion. To test the material's stability, the scientists performed the same experiment after soaking the SLIPS-coated samples for up to 21 days in a solution meant to simulate conditions inside a living mammal. After exposing these disks to S. aureus for 48 hours, the researchers found similar, nearly 100 percent reductions in bacterial adhesion. Widely used clinically, medical mesh is particularly susceptible to bacterial infection. In another set of experiments to test the material's biocompatibility, Chaikof and colleagues implanted small squares of SLIPS-treated mesh into murine models, injecting the site with S. aureus 24 hours later. Three days later, when the researchers removed the implanted mesh, they found little to no infection, compared with an infection rate of more than 90 percent among controls. "Today, patients who receive implants often require antibiotics to keep the risk of bacterial infection at bay," the authors wrote. "SLIPS coatings one day could obviate the widespread use of antibiotics and minimize the development of antibiotic resistant micro-organisms." "SLIPs have many promising medical applications that are in a very early stage of evaluation," said Chaikof. "Clearly, there's more work to be done before its introduction into the clinic, but this is one of a few studies that reinforces the exciting opportunities presented by this strategy to improve device performance and clinical outcomes." Study coauthors include Jiaxuan Chen, PhD, of BIDMC and Wyss; Caitlin Howell, PhD, of Wyss and SEAS; Carolyn A. Haller, PhD, of BIDMC and Wyss; Madhukar S. Patel, MD, of BIDMC, Wyss and Massachusetts General Hospital; Perla Ayala, PhD, of BIDMC and Wyss; Katherine A. Moravec, Erbin Dai, MD, and Liying Liu, MD, all of BIDMC; Irini Sotiri, BS, of Wyss and SEAS; Michael Aizenberg of the Wyss Institute; and Joanna Aizenberg of the Wyss Institute, SEASE and the Kavali Institute for Bionano Science and Technology. This work was supported by the Defense Advanced Research Projects Agency (Grant N66001-11-1-4180, Contract HR0011-13-C-0025), the National Institutes of Health (T32 HL 008843-21A1), the American College of Surgeons Resident Research Scholarship to M.S.P.; and the National Institutes of Health (T35 HL 110843) to K.A.M. Beth Israel Deaconess Medical Center is a patient care, teaching and research affiliate of Harvard Medical School and consistently ranks as a national leader among independent hospitals in National Institutes of Health funding. BIDMC is in the community with Beth Israel Deaconess Hospital-Milton, Beth Israel Deaconess Hospital-Needham, Beth Israel Deaconess Hospital-Plymouth, Anna Jaques Hospital, Cambridge Health Alliance, Lawrence General Hospital, MetroWest Medical Center, Signature Healthcare, Beth Israel Deaconess HealthCare, Community Care Alliance and Atrius Health. BIDMC is also clinically affiliated with the Joslin Diabetes Center, Hebrew Rehabilitation Center and is a research partner of Dana-Farber/Harvard Cancer Center and the Jackson Laboratory. BIDMC is the official hospital of the Boston Red Sox. For more information, visit http://www. . The Wyss Institute uses Nature's design principles to develop bioinspired materials and devices that will transform medicine and create a more sustainable world. Wyss researchers are developing innovative new engineering solutions for healthcare, energy, architecture, robotics, and manufacturing that are translated into commercial products and therapies through collaborations with clinical investigators, corporate alliances, and formation of new startups. The Wyss Institute creates transformative technological breakthroughs by engaging in high risk research, and crosses disciplinary and institutional barriers, working as an alliance that includes Harvard's Schools of Medicine, Engineering, Arts & Sciences and Design, and in partnership with Beth Israel Deaconess Medical Center, Brigham and Women's Hospital, Boston Children's Hospital, Dana-Farber Cancer Institute, Massachusetts General Hospital, the University of Massachusetts Medical School, Spaulding Rehabilitation Hospital, Boston University, Tufts University, Charité - Universitätsmedizin Berlin, University of Zurich and Massachusetts Institute of Technology. For more information, visit wyss.harvard.edu SEAS serves as the connector and integrator of Harvard's teaching and research efforts in engineering, applied sciences, and technology. Through collaboration with researchers from all parts of Harvard, other universities, and corporate and foundational partners, we bring discovery and innovation directly to bear on improving human life and society.


WILMINGTON, Del.--(BUSINESS WIRE)--AstraZeneca and its hematology Center of Excellence, Acerta Pharma, today announced preliminary results from the Phase I/II ACE-CL-001 clinical trial of acalabrutinib in subsets of patients with two difficult-to-treat forms of chronic lymphocytic leukemia (CLL), the most common type of leukemia in adults.1 The trial includes data from individuals with intolerance to ibrutinib and those with Richter transformation, when CLL transforms into a more aggressive lymphoma.2 Findings were shared with the medical community during two oral presentations at the 58th American Society of Hematology (ASH) Annual Meeting in San Diego, California. Acerta Pharma Chief Executive Officer, Flavia Borellini, PhD, said: “ The data at ASH further validate previous clinical trial findings and continue to demonstrate the potential of acalabrutinib in the treatment of B-cell malignancies.” Investigator Jennifer R. Brown, MD, PhD and, Director, Chronic Lymphocytic Leukemia Center, Dana-Farber Cancer Institute, said: “ The acalabrutinib data in patients in difficult-to-manage settings support the continued exploration of acalabrutinib’s potential for the treatment of CLL.” Acalabrutinib is an investigational, highly selective, potent Bruton tyrosine kinase (BTK) inhibitor shown to minimize off-target activity in pre-clinical studies.3,4,5 The Phase I/II findings presented at ASH are part of an extensive and ongoing clinical development program for acalabrutinib in B-cell cancers including CLL, mantle cell lymphoma (MCL), Waldenström macroglobulinemia, follicular lymphoma and diffuse large B-cell lymphoma. Results for acalabrutinib in patients intolerant to ibrutinib The ibrutinib-intolerant cohort included 33 patients with relapsed or refractory CLL intolerant to ibrutinib. In this population with difficult-to-treat disease and limited treatment options, a 79% overall response rate was achieved with acalabrutinib.6 The median progression free survival has not yet been reached, with 81% of responding patients achieving a duration of response ≥12 months on acalabrutinib treatment,6 which may allow for continuation of BTK inhibitor therapy. In this cohort of patients, the most common adverse events included diarrhea (52% overall; 0% ≥ Grade 3), headache (39% overall; 0% ≥ Grade 3), cough (24% overall; 0% ≥ Grade 3), increased weight (24% overall; 0% ≥ Grade 3) and nausea (21% overall; 0% ≥ Grade 3).6 Serious adverse events occurred in 33% of patients.6 Thirty six percent of patients had a recurrence of an adverse event they had experienced during previous treatment with ibrutinib, most of which were of decreased or the same severity.6 No patients discontinued acalabrutinib due to a recurrent adverse event.6 Results for acalabrutinib in patients with aggressive transformation of CLL In a separate presentation, preliminary data showed the clinical activity of acalabrutinib monotherapy in a cohort of 29 patients with Richter transformation, or other transformations—aggressive B-cell malignancies associated with an aggressive clinical course and poor prognosis.7 Of the 21 Richter transformation patients evaluable for efficacy measures, the overall response rate was 38% and the median progression-free survival was 2.1 months (95% CI, 1.8 to 3.7).7 The median duration of response on acalabrutinib treatment was 5.2 months (range 0.3 – 6.5+).7 In this cohort of patients, the most common adverse events were headache (41% overall; 0% ≥ Grade 3), diarrhea (35% overall; 0% ≥ Grade 3), anemia (31% overall; 14% ≥ Grade 3), fatigue (24% overall; 7% ≥ Grade 3), arthralgia (joint pain) (17% overall; 3% ≥ Grade 3) and back pain (17% overall; 10% ≥ Grade 3).7 Serious adverse events occurred in 55% of patients. No patients discontinued acalabrutinib treatment due to adverse events.7 Chronic lymphocytic leukemia (CLL) is the most common type of leukemia in adults and accounts for approximately one in four cases of leukemia.1,8 The average age at the time of diagnosis is approximately 71 years of age.8 In CLL, too many blood stem cells in the bone marrow become abnormal lymphocytes and these abnormal cells have difficulty fighting infections.9 As the number of abnormal cells grows there is less room for healthy white blood cells, red blood cells and platelets.9 This could result in anaemia, infection and uncontrolled bleeding.9 Approximately 2% to 10% of CLL patients develop Richter transformation, where CLL transforms into an aggressive lymphoma, most often diffuse large B-cell lymphoma.10 Prognosis for patients with Richter transformation is poor, with median overall survival of approximately eight months.11 B-cell receptor signaling through Bruton tyrosine kinase (BTK) is one of the essential growth pathways for CLL. Acalabrutinib (ACP-196) is an investigational, highly selective, potent Bruton tyrosine kinase (BTK) inhibitor shown to minimize off-target activity in pre-clinical studies.3,4,5 Studies of acalabrutinib have demonstrated clinical activity in monotherapy with an expected tolerability profile in people with previously untreated or relapsed or refractory CLL, including those with del17p.4,12 Acalabrutinib is in ongoing clinical development for the treatment of a range of B-cell cancers including CLL, MCL, Waldenström macroglobulinemia, follicular lymphoma and diffuse large B-cell lymphoma, with both monotherapy and combination therapy strategies. The acalabrutinib development program also includes monotherapy and combination studies in solid tumors. In total, more than 20 acalabrutinib clinical trials with more than 2,000 patients are underway. Acerta Pharma, a member of the AstraZeneca Group, is a leader in the field of covalent binding technology and is applying this technology to create novel selective therapies intended for the treatment of cancer and autoimmune diseases. The company has operations in Oss, the Netherlands and multiple US sites. The US headquarters is in Redwood City, CA. For more information, please visit www.acerta-pharma.com. AstraZeneca acquired a majority stake interest in Acerta Pharma and its cornerstone asset, acalabrutinib, in February 2016. Acerta Pharma serves as AstraZeneca’s hematology Center of Excellence. AstraZeneca has a deep-rooted heritage in Oncology and offers a quickly growing portfolio of new medicines that has the potential to transform patients’ lives and the Company’s future. With at least six new medicines to be launched between 2014 and 2020, and a broad pipeline of small molecules and biologics in development, we are committed to advance New Oncology as one of AstraZeneca’s six Growth Platforms focused on lung, ovarian, breast and blood cancers. In addition to our core capabilities, we actively pursue innovative partnerships and investments that accelerate the delivery of our strategy as illustrated by our investment in Acerta Pharma in hematology. By harnessing the power of four scientific platforms–Immuno-Oncology, the genetic drivers of cancer and resistance, DNA damage response and antibody drug conjugates–and by championing the development of personalized combinations, AstraZeneca has the vision to redefine cancer treatment and one day eliminate cancer as a cause of death. AstraZeneca is a global, science-led biopharmaceutical company that focuses on the discovery, development and commercialization of prescription medicines, primarily for the treatment of diseases in three main therapy areas - Oncology, Cardiovascular & Metabolic Diseases and Respiratory. The Company also is selectively active in the areas of autoimmunity, neuroscience and infection. AstraZeneca operates in over 100 countries and its innovative medicines are used by millions of patients worldwide. For more information, please visit www.astrazeneca-us.com and follow us on Twitter @AstraZenecaUS. 1 Leukemia & Lymphoma Society. Chronic Lymphocytic Leukemia. https://www.lls.org/leukemia/chronic-lymphocytic-leukemia. Accessed December 2016. 2 National Cancer Institute. NCI Dictionary of Cancer Terms: Richters Syndrome. https://www.cancer.gov/publications/dictionaries/cancer-terms?CdrID=489396 Accessed October 2016. 3 Covey T, Barf T, Gulrajani M, Krantz F, van Lith B, Bibikova E, et al. Abstract 2596: ACP-196: a novel covalent Bruton’s tyrosine kinase (Btk) inhibitor with improved selectivity and in vivo target coverage in chronic lymphocytic leukemia (CLL) patients. Cancer Res. 2015;75(15 Supplement):2596. 4 Byrd JC, Harrington B, O'Brien S, Jones JA, Schuh A, Devereux S, et al. Acalabrutinib (ACP-196) in relapsed chronic lymphocytic leukemia. N Engl J Med. 2016;374(4):323–332. 5 Harrington BK, Gulrajani M, Covey T, Kaptein A, Van Lith B, Izumi R, et al. ACP-196 is a second generation inhibitor of Bruton tyrosine kinase (BTK) with enhanced target specificity. Blood. 2015;126(23):2908. 6 Global Data on File. AstraZeneca Pharmaceuticals LP, DoFP Acalabrutinib ASH 2016 Awan F et al IBR Intolerant 1Dec16 7 Global Data on File. AstraZeneca Pharmaceuticals LP, DoFP Acalabrutinib ASH 2016 Hillmen P et al RT 1Dec16 8 American Cancer Society. What are the key statistics for chronic lymphocytic leukemia? http://www.cancer.org/cancer/leukemia-chroniclymphocyticcll/detailedguide/leukemia-chronic-lymphocytic-key-statistics. Accessed December 2016. 9 National Cancer Institute. Chronic Lymphocytic Leukemia Treatment (PDQ®)–Patient Version. https://www.cancer.gov/types/leukemia/patient/cll-treatment-pdq Accessed October 2016. 10 Parikh S, et al. How we treat Richter syndrome. Blood. 2014; 123 (11): 1647-1657. 11 Langerbeins P, et al. Poor efficacy and tolerability of R-CHOP in relapsed/refractory chronic lymphocytic leukemia and Richter transformation. Am J Hematol. 2014; 89 (12): E239-E243. 12 Byrd JC. Acalabrutinib, a second-generation bruton tyrosine kinase (Btk) inhibitor, in previously untreated chronic lymphocytic leukemia (CLL) [abstract]. In: 2016 ASCO Meeting. http://meetinglibrary.asco.org/content/171180-176. Accessed Nov 28, 2016.


NEW YORK, Feb. 28, 2017 (GLOBE NEWSWIRE) -- Checkpoint Therapeutics, Inc. (“Checkpoint”) (OTCQX:CKPT), a Fortress Biotech (NASDAQ:FBIO) company, today announced that the U.S. Patent and Trademark Office has issued a composition of matter patent for CK-101 (also known as RX518), Checkpoint’s oral, third-generation epidermal growth factor receptor (EGFR) inhibitor product candidate under development for the treatment of patients with EGFR mutation-positive non-small cell lung cancer (NSCLC). U.S. Patent No. 9,550,770 specifically covers the compound, CK-101, and a broad range of related compounds, salts, pharmaceutical compositions and various dosage forms of such pharmaceutical compositions. Pursuant to Checkpoint’s existing license agreement with NeuPharma, Inc., the U.S. patent protects CK-101 through at least August 2034, exclusive of any additional patent-term extensions that might become available. "We are excited to announce the issuance of the first U.S. patent for CK-101, which affords broad, foundational composition of matter protection for our compound," commented James F. Oliviero, President and CEO of Checkpoint. “We plan to continue to expand and fortify our intellectual property estate for CK-101 in the U.S. and abroad as we advance CK-101 through clinical development.” CK-101 is currently being studied in the Phase 1 dose-escalation portion of a Phase 1/2 clinical study. The Phase 1 portion of the study is evaluating the safety and tolerability of ascending doses of CK‐101 in patients with advanced solid tumors to determine the maximum tolerated dose and/or recommended Phase 2 dose. The Phase 2 portion of the study is expected to commence in the second half of 2017 and will evaluate the safety and efficacy of CK-101 in patients with EGFR T790M mutation-positive NSCLC. Checkpoint’s common stock currently trades on the OTCQX® Best Market under the ticker symbol “CKPT.” About Checkpoint Therapeutics Checkpoint Therapeutics, Inc. (“Checkpoint”), a Fortress Biotech company, is an innovative, immuno-oncology biopharmaceutical company focused on the acquisition, development and commercialization of novel, non-chemotherapy, immune-enhanced combination treatments for patients with solid tumor cancers. Checkpoint aims to acquire these technologies by licensing the rights or otherwise acquiring an ownership interest in the technologies, funding the research and development and eventually either out-licensing or bringing the technologies to market.  Currently, Checkpoint is developing a portfolio of fully human immuno-oncology targeted antibodies generated in the laboratory of Dr. Wayne Marasco, M.D., Ph.D., of the Department of Cancer Immunology and AIDS at the Dana-Farber Cancer Institute. These technologies licensed from Dana-Farber include antibodies targeting programmed death-ligand 1 (PD-L1); glucocorticoid-induced, TNFR-related protein (GITR); and carbonic anhydrase IX (CAIX). Checkpoint plans to develop these novel immuno-oncology and checkpoint inhibitor antibodies on their own and in combination with each other, as data suggests that combinations of these targets may work synergistically together. Checkpoint has also licensed and is developing three oral, small-molecule, targeted anti-cancer agents, including an inhibitor of epidermal growth factor receptor (EGFR) mutations, an inhibitor of the bromodomain and extra-terminal (BET) protein, BRD4, and an inhibitor of poly (ADP-ribose) polymerase (PARP). Checkpoint will also seek to add additional immuno-oncology drugs and targeted therapies to its pipeline in order to create wholly-owned proprietary combinations that leverage the immune system and complimentary mechanisms. Checkpoint is headquartered in New York City. For more information, visit www.checkpointtx.com. About Fortress Biotech Fortress Biotech, Inc. (“Fortress”) is a biopharmaceutical company dedicated to acquiring, developing and commercializing novel pharmaceutical and biotechnology products. Fortress develops and commercializes products both within Fortress and through certain of its subsidiary companies, also known as Fortress Companies. Additionally, Fortress recently acquired a controlling interest in National Holdings Corporation, a diversified independent brokerage company (together with its subsidiaries, “NHLD”). In addition to its internal development programs, Fortress leverages its biopharmaceutical business expertise and drug development capabilities and provides funding and management services to help the Fortress Companies achieve their goals. Fortress and the Fortress Companies may seek licensings, acquisitions, partnerships, joint ventures and/or public and private financings to accelerate and provide additional funding to support their research and development programs. For more information, visit www.fortressbiotech.com. Forward-Looking Statements This press release may contain “forward-looking statements” within the meaning of Section 27A of the Securities Act of 1933 and Section 21E of the Securities Exchange Act of 1934. Such statements include, but are not limited to, any statements relating to our growth strategy and product development programs and any other statements that are not historical facts. Forward-looking statements are based on management’s current expectations and are subject to risks and uncertainties that could negatively affect our business, operating results, financial condition and stock price. Factors that could cause actual results to differ materially from those currently anticipated are: the risk that Checkpoint will not be able to advance its research programs; risks related to the timing of starting and completing of clinical trials; risks inherent in research and development activities; risks related to its growth strategy; its ability to obtain, perform under and maintain financing and strategic agreements and relationships; uncertainties relating to preclinical and clinical testing; its dependence on third-party suppliers; its ability to attract, integrate, and retain key personnel; the early stage of products under development; its need for substantial additional funds; government regulation; patent and intellectual property matters; competition; as well as other risks described in Checkpoint’s public filings and reports. Checkpoint expressly disclaims any obligation or undertaking to release publicly any updates or revisions to any forward-looking statements contained herein to reflect any change in our expectations or any changes in events, conditions or circumstances on which any such statement is based, except as required by law.


KENILWORTH, N.J.--(BUSINESS WIRE)--Merck & Co., Inc. (NYSE:MRK), known as MSD outside the United States and Canada, today announced results of the pivotal Phase 3 clinical study of letermovir, an investigational antiviral medicine for the prevention of clinically-significant cytomegalovirus (CMV) infection in adult (18 years and older) CMV-seropositive recipients of an allogeneic hematopoietic stem cell transplant (HSCT), also known as bone marrow transplant (BMT). The study met its primary efficacy endpoint, showing that significantly fewer patients with undetectable CMV DNA at the start of study treatment developed clinically significant CMV infection through Week 24 post-HSCT (using a non-complete equals failure approach, in which patients who discontinued from the study prior to Week 24 post-transplant or had a missing outcome at Week 24 post-transplant were counted as failures). In the study, letermovir prophylaxis was associated with lower all-cause mortality through Week 24 post-HSCT. Based on these results, Merck plans to submit regulatory applications for the approval of letermovir in the United States and European Union (EU) in 2017. Results from the study were presented for the first time at the BMT Tandem Meetings, the combined annual meetings of the Center for International Blood & Marrow Transplant Research (CIBMTR) and the American Society for Blood and Marrow Transplantation (ASBMT), in Orlando, Fla., Feb. 22-26. “ These results showed that letermovir prophylaxis beginning after HSCT and continuing through Day 100 post-transplant significantly reduced CMV infection requiring preemptive antiviral therapy through Week 24 post-transplant,” said Dr. Francisco M. Marty, associate professor of medicine at Harvard Medical School and attending physician in transplant and oncology infectious diseases at Dana-Farber Cancer Institute and Brigham and Women’s Hospital, who presented the data. “ In this study, letermovir was associated with lower all-cause mortality. Based on these findings, letermovir as primary prophylaxis of CMV infection represents a potential new strategy for the prevention of CMV in this high-risk patient population.” CMV is the most common clinically significant viral infection in allogeneic HSCT recipients. HSCT is a medical procedure in the field of hematologic oncology, most often performed for the treatment of patients with certain cancers of the blood or bone marrow, such as leukemia and lymphoma. While preemptive therapy (treatment when CMV DNA is detected in the blood) with antiviral medicines can reduce the incidence of CMV disease, CMV reactivation post-HSCT is associated with higher mortality despite the use of preemptive therapy. “ There is an unmet need for therapeutic options in the prevention of CMV infection in hematopoietic stem cell transplant recipients,” said Dr. Nicholas Kartsonis, vice president, infectious disease clinical research, Merck Research Laboratories. “ As part of Merck’s long-standing commitment to developing innovative approaches in the fight against infectious diseases, we look forward to submitting regulatory applications for letermovir this year.” CMV seropositive HSCT recipients 18 years or older who had undetectable plasma CMV DNA within 5 days of randomization were eligible for the study. Patients were randomized in a 2:1 ratio to receive either letermovir or placebo administered once daily, either in oral tablet or intravenous formulation, through Week 14 (Day 100) post-HSCT. Letermovir was dosed at 480 mg/day (or 240 mg/day if the patient was on the immunosuppressant medication cyclosporine). Letermovir was started after HSCT; as early as on the day of transplant and no later than 28 days post-transplant. Patients were assessed weekly through Week 14 and biweekly through Week 24 for the primary efficacy endpoint of clinical significant CMV infection. Patients who developed clinically significant CMV infection, defined as the onset of CMV disease or initiation of anti-CMV preemptive therapy based on documented viremia (as measured by the central laboratory) and the clinical condition of the patient, discontinued study drug and received anti-CMV preemptive therapy. Patients continued to be followed for safety every other month through Week 48 post-HSCT. The primary endpoint of the study was the proportion of patients with clinically significant CMV infection through Week 24 post-HSCT among patients with undetectable CMV DNA at the start of study treatment. Patients who discontinued the study early for any reason or who had missing data at Week 24 post-HSCT were considered study failures. All adverse events were analyzed through 14 days after the last dose of study drug. The study met its primary efficacy endpoint, showing that of 495 treated patients who had undetectable CMV DNA at the start of study treatment, significantly fewer patients developed clinically significant CMV infection in the letermovir arm (37.5%, n=122/325) compared to the placebo arm (60.6%, n=103/170) through Week 24 post-HSCT [treatment difference: -23.5 (95% confidence interval -32.5 to -14.6), one-sided p<0.0001]. Efficacy was consistently demonstrated across patient subgroups. Letermovir demonstrated significant benefit compared to placebo in time to clinically significant CMV infection through Week 24 post-HSCT in both patients at higher risk and lower risk for CMV disease at baseline (log-rank two-sided p<0.0001 for both groups). In addition, a secondary endpoint evaluating the end-of-treatment period (at Week 14 post-HSCT) showed that significantly fewer patients developed clinically significant CMV infection in the letermovir arm (19.1%, n=62/325) compared to the placebo arm (50.0%, n=85/170) through Week 14 (Day 100) post-HSCT [treatment difference: -31.3 (95% confidence interval -39.9 to -22.6), one-sided p<0.0001]. In this study, letermovir was associated with lower all-cause mortality through Week 24 post-HSCT (9.8%, n=32/325) compared to placebo (15.9%, n=27/170), log-rank two-sided p=0.0317. The most common adverse events of any severity reported for the letermovir and placebo arms, respectively, were: graft-versus-host disease (GVHD) (39.1%, 38.5%), diarrhea (26.0%, 24.5%) and nausea (26.5%, 23.4%). Common adverse events that were reported more frequently in the letermovir arm than the placebo arm included: vomiting (18.5%, 13.5%), cough (14.2%, 10.4%) and peripheral edema (14.5%, 9.4%). The most common serious adverse events reported for the letermovir and placebo arms, respectively, were: infection (20.6%, 18.8%), GVHD (9.9%, 10.4%) and acute kidney injury (1.3%, 4.7%). Letermovir was not associated with myelotoxicity or nephrotoxicity. Letermovir is an investigational once-daily antiviral medicine under development for the prevention of CMV infection and disease. It is a member of a new class of non-nucleoside CMV inhibitors (3,4 dihydro-quinazolines) and inhibits viral replication by specifically targeting the viral terminase complex. Letermovir has no activity against other viruses. Letermovir has been granted orphan designation by the European Medicines Agency, the U.S. Food and Drug Administration (FDA) and the Japanese Ministry of Health, Labour and Welfare for the prevention of CMV infection and disease in at-risk populations. Letermovir also has been granted Fast Track designation by the FDA. Under an agreement signed in 2012, Merck (through a subsidiary) purchased worldwide rights to develop and commercialize letermovir from AiCuris GmbH & Co KG (www.aicuris.com). CMV is a common virus that infects people of all ages. Many adults in the United States are CMV seropositive, meaning they have CMV antibodies in their blood, indicating a previous exposure or primary infection to CMV. People with normal immune systems rarely develop CMV symptoms after initial infection, with the virus typically remaining inactive or latent in the body for life. A weakened immune system may give the virus a chance to reactivate, potentially leading to symptomatic disease or a secondary infection due to other pathogens. CMV disease can lead to end-organ damage, including gastrointestinal tract disease, pneumonia or retinitis. Transplant recipients who develop CMV infection post-transplant are at increased risk for injury to a transplanted organ. In severely immunocompromised patients, CMV infection can be life-threatening. For over a century, Merck has been a global health care leader working to help the world be well. Merck is known as MSD outside the United States and Canada. Through our prescription medicines, vaccines, biologic therapies, and animal health products, we work with customers and operate in more than 140 countries to deliver innovative health solutions. We also demonstrate our commitment to increasing access to health care through far-reaching policies, programs and partnerships. For more information, visit www.merck.com and connect with us on Twitter, Facebook, YouTube and LinkedIn. This news release of Merck & Co., Inc., Kenilworth, N.J., USA (the “company”) includes “forward-looking statements” within the meaning of the safe harbor provisions of the U.S. Private Securities Litigation Reform Act of 1995. These statements are based upon the current beliefs and expectations of the company’s management and are subject to significant risks and uncertainties. There can be no guarantees with respect to pipeline products that the products will receive the necessary regulatory approvals or that they will prove to be commercially successful. If underlying assumptions prove inaccurate or risks or uncertainties materialize, actual results may differ materially from those set forth in the forward-looking statements. Risks and uncertainties include but are not limited to, general industry conditions and competition; general economic factors, including interest rate and currency exchange rate fluctuations; the impact of pharmaceutical industry regulation and health care legislation in the United States and internationally; global trends toward health care cost containment; technological advances, new products and patents attained by competitors; challenges inherent in new product development, including obtaining regulatory approval; the company’s ability to accurately predict future market conditions; manufacturing difficulties or delays; financial instability of international economies and sovereign risk; dependence on the effectiveness of the company’s patents and other protections for innovative products; and the exposure to litigation, including patent litigation, and/or regulatory actions. The company undertakes no obligation to publicly update any forward-looking statement, whether as a result of new information, future events or otherwise. Additional factors that could cause results to differ materially from those described in the forward-looking statements can be found in the company’s 2015 Annual Report on Form 10-K and the company’s other filings with the Securities and Exchange Commission (SEC) available at the SEC’s Internet site (www.sec.gov).


KENILWORTH, N.J. & WOODCLIFF LAKE, N.J.--(BUSINESS WIRE)--Merck (NYSE:MRK), known as MSD outside the United States and Canada, and Eisai Inc. today announced new interim data investigating Merck’s anti-PD-1 therapy, KEYTRUDA® (pembrolizumab), in combination with Eisai’s microtubule dynamics inhibitor, HALAVEN® (eribulin), in patients with metastatic triple-negative breast cancer (TNBC). Findings presented during the 2016 San Antonio Breast Cancer Symposium (SABCS) were based on interim data from 39 evaluable patients and showed an overall response rate (ORR) of 33.3% (n=13/39; 95% CI, 19.5-48.1), with one complete response and 12 partial responses (Abstract #: P5-15-02). ORR was similar between PD-L1-positive and -negative cohorts [PD-L1 positive=29.4% (n=5/17; 95% CI, 11.1-51.1); PD-L1 negative=33.3% (n=6/18; 95% CI, 14.1-54.6)]. HALAVEN and KEYTRUDA are not approved for use in combination. The most common treatment-emergent adverse events (incidence greater than or equal to 35%) for the combination regimen were fatigue (n=29; 74.4%), nausea (n=20; 51.3%), peripheral neuropathy (n=17; 43.6%), neutropenia (n=15; 38.5%), and alopecia (n=14; 35.9%), with grade 3 or higher treatment-emergent adverse events observed in 66.7% (n=26) of patients. The two most common grade 3 or higher treatment-emergent adverse events observed were neutropenia (n=12; 30.8%) and fatigue (n=3; 7.7%). The possible immune-mediated adverse events of clinical interest with KEYTRUDA (grade 3/4) included rash (n=2; 5.1%), pneumonitis (n=1; 2.6%), hyperglycemia (n=1; 2.6%), renal failure (n=1; 2.6%) and rash generalized (n=1; 2.6%). Events of clinical interest for HALAVEN (grade 3/4) included neutropenia (n=11, 28.2%), febrile neutropenia (n=1; 2.6%), and peripheral neuropathy (n=1; 2.6%). There were 10 discontinuations due to treatment-emergent adverse events and no treatment-related deaths. “ Little progress has been made in metastatic triple-negative breast cancer, which is an aggressive and difficult-to-treat cancer. This initial evaluation of the combination of KEYTRUDA and HALAVEN is encouraging and represents an important part of our multi-pronged effort to bring forward new potential approaches for patients with this type of cancer,” said Roger Dansey, M.D., senior vice president and therapeutic area head, oncology late-stage development, Merck Research Laboratories. “ Patients with metastatic triple-negative breast cancer have a limited number of treatment options, making clinical study of new potential therapeutic approaches essential,” said Alton Kremer, M.D., Ph.D., chief clinical officer and chief medical officer, Oncology Business Group at Eisai. “ With this ongoing study, we hope to learn more about the potential of HALAVEN as part of a combination regimen with KEYTRUDA, with the long-term goal of addressing the unmet medical needs of patients with metastatic triple-negative breast cancer.” “ In addition to anti-mitotic effects, in preclinical and translational studies, eribulin induced tumor vascular remodeling, reduction of hypoxia and promotion of the less aggressive epithelial phenotype in advanced breast cancer tumor tissue. We look forward to further understanding how these effects of eribulin on tumor biology and microenvironment may impact the effect of pembrolizumab on the immune system’s T cells,” said Sara Tolaney, M.D., MPH, medical oncologist, Dana-Farber Cancer Institute, Boston, and the principal investigator of the study. HALAVEN (eribulin mesylate) Injection is approved by the U.S. Food and Drug Administration (FDA) for the treatment of patients with metastatic breast cancer who have previously received at least two chemotherapeutic regimens for the treatment of metastatic disease. Prior therapy should have included an anthracycline and a taxane in either the adjuvant or metastatic setting. KEYTRUDA (pembrolizumab) is not indicated in any type of breast cancer. This release discusses investigational uses for FDA-approved products. This release is not intended to convey conclusions about efficacy or safety. There is no guarantee that any investigational uses of such FDA-approved products will successfully complete clinical development or gain FDA approval. The single-arm, multi-center phase 1b/2 study (ClinicalTrials.gov Identifier: NCT02513472) is investigating the combination of KEYTRUDA (pembrolizumab) (200 mg intravenously on Day 1) with HALAVEN (eribulin mesylate) Injection (1.4 mg/m2 intravenously on Day 1 and Day 8) in 21-day cycles in 95 patients with metastatic TNBC who had previously been treated with up to two lines of chemotherapy. The primary endpoint of the phase 1b portion of the study is to assess the safety and tolerability of the combination; for the phase 2 portion of the study, the primary endpoint is investigator-assessed ORR and secondary endpoints include progression-free survival, overall survival and duration of response as well as efficacy in a subset of patients with PD-L1-positive tumors. The results presented at SABCS were based on a planned interim analysis. At the time of data cutoff (July 12, 2016), 89 patients were enrolled, 39 of whom were evaluable. The study is being conducted under an existing clinical trial collaboration agreement between the two companies. Breast cancer is a malignant tumor that begins in the cells of the breast. In 2016, an estimated 246,660 women will be diagnosed with breast cancer in the United States, and nearly 40,450 women will die from the disease. Triple-negative breast cancer is an aggressive type of breast cancer where the cancer cells do not have estrogen or progesterone receptors and do not have HER2, a growth-promoting protein. Approximately 12% of breast cancer patients are diagnosed with triple-negative breast cancer. Triple-negative breast cancer tends to grow and spread quickly. Specifically, patients with triple-negative breast cancer are nearly two times more likely to have distant metastatic disease than those with most other types of breast cancer. Metastatic breast cancer is an advanced stage of the disease that occurs when cancer spreads beyond the breast to other parts of the body. It is estimated that approximately five percent to 10 percent of women with breast cancer will have metastatic disease at the time of diagnosis. Of these women, an estimated one in five is expected to survive five years. KEYTRUDA is a humanized monoclonal antibody that works by increasing the ability of the body’s immune system to help detect and fight tumor cells. KEYTRUDA blocks the interaction between PD-1 and its ligands, PD-L1 and PD-L2, thereby activating T lymphocytes which may affect both tumor cells and healthy cells. KEYTRUDA (pembrolizumab) is administered as an intravenous infusion over 30 minutes every three weeks for the approved indications. KEYTRUDA for injection is supplied in a 100 mg single use vial. KEYTRUDA is indicated for the treatment of patients with unresectable or metastatic melanoma at a dose of 2 mg/kg every three weeks until disease progression or unacceptable toxicity. KEYTRUDA is indicated for the first-line treatment of patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have high PD-L1 expression [tumor proportion score (TPS) ≥50%] as determined by an FDA-approved test, with no EGFR or ALK genomic tumor aberrations. KEYTRUDA is also indicated for the treatment of patients with metastatic NSCLC whose tumors express PD-L1 (TPS ≥1%) as determined by an FDA-approved test, with disease progression on or after platinum-containing chemotherapy. Patients with EGFR or ALK genomic tumor aberrations should have disease progression on FDA-approved therapy for these aberrations prior to receiving KEYTRUDA. In metastatic NSCLC, KEYTRUDA is administered at a fixed dose of 200 mg every three weeks until disease progression, unacceptable toxicity, or up to 24 months in patients without disease progression. KEYTRUDA is indicated for the treatment of patients with recurrent or metastatic head and neck squamous cell carcinoma (HNSCC) with disease progression on or after platinum-containing chemotherapy. This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials. In HNSCC, KEYTRUDA is administered at a fixed dose of 200 mg every three weeks until disease progression, unacceptable toxicity, or up to 24 months in patients without disease progression. KEYTRUDA (pembrolizumab) can cause immune-mediated pneumonitis, including fatal cases. Pneumonitis occurred in 94 (3.4%) of 2799 patients receiving KEYTRUDA, including Grade 1 (0.8%), 2 (1.3%), 3 (0.9%), 4 (0.3%), and 5 (0.1%) pneumonitis, and occurred more frequently in patients with a history of prior thoracic radiation (6.9%) compared to those without (2.9%). Monitor patients for signs and symptoms of pneumonitis. Evaluate suspected pneumonitis with radiographic imaging. Administer corticosteroids for Grade 2 or greater pneumonitis. Withhold KEYTRUDA for Grade 2; permanently discontinue KEYTRUDA for Grade 3 or 4 or recurrent Grade 2 pneumonitis. KEYTRUDA can cause immune-mediated colitis. Colitis occurred in 48 (1.7%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.4%), 3 (1.1%), and 4 (<0.1%) colitis. Monitor patients for signs and symptoms of colitis. Administer corticosteroids for Grade 2 or greater colitis. Withhold KEYTRUDA for Grade 2 or 3; permanently discontinue KEYTRUDA for Grade 4 colitis. KEYTRUDA can cause immune-mediated hepatitis. Hepatitis occurred in 19 (0.7%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.1%), 3 (0.4%), and 4 (<0.1%) hepatitis. Monitor patients for changes in liver function. Administer corticosteroids for Grade 2 or greater hepatitis and, based on severity of liver enzyme elevations, withhold or discontinue KEYTRUDA. KEYTRUDA can cause hypophysitis. Hypophysitis occurred in 17 (0.6%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.2%), 3 (0.3%), and 4 (<0.1%) hypophysitis. Monitor patients for signs and symptoms of hypophysitis (including hypopituitarism and adrenal insufficiency). Administer corticosteroids and hormone replacement as clinically indicated. Withhold KEYTRUDA for Grade 2; withhold or discontinue for Grade 3 or 4 hypophysitis. KEYTRUDA can cause thyroid disorders, including hyperthyroidism, hypothyroidism, and thyroiditis. Hyperthyroidism occurred in 96 (3.4%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.8%) and 3 (0.1%) hyperthyroidism. Hypothyroidism occurred in 237 (8.5%) of 2799 patients receiving KEYTRUDA, including Grade 2 (6.2%) and 3 (0.1%) hypothyroidism. The incidence of new or worsening hypothyroidism was higher in patients with HNSCC occurring in 28 (15%) of 192 patients with HNSCC, including Grade 3 (0.5%) hypothyroidism. Thyroiditis occurred in 16 (0.6%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.3%) thyroiditis. Monitor patients for changes in thyroid function (at the start of treatment, periodically during treatment, and as indicated based on clinical evaluation) and for clinical signs and symptoms of thyroid disorders. Administer replacement hormones for hypothyroidism and manage hyperthyroidism with thionamides and beta-blockers as appropriate. Withhold or discontinue KEYTRUDA (pembrolizumab) for Grade 3 or 4 hyperthyroidism. KEYTRUDA can cause type 1 diabetes mellitus, including diabetic ketoacidosis, which have been reported in 6 (0.2%) of 2799 patients. Monitor patients for hyperglycemia or other signs and symptoms of diabetes. Administer insulin for type 1 diabetes, and withhold KEYTRUDA and administer antihyperglycemics in patients with severe hyperglycemia. KEYTRUDA can cause immune-mediated nephritis. Nephritis occurred in 9 (0.3%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.1%), 3 (0.1%), and 4 (<0.1%) nephritis. Monitor patients for changes in renal function. Administer corticosteroids for Grade 2 or greater nephritis. Withhold KEYTRUDA for Grade 2; permanently discontinue KEYTRUDA for Grade 3 or 4 nephritis. KEYTRUDA can cause other clinically important immune-mediated adverse reactions. For suspected immune-mediated adverse reactions, ensure adequate evaluation to confirm etiology or exclude other causes. Based on the severity of the adverse reaction, withhold KEYTRUDA and administer corticosteroids. Upon improvement to Grade 1 or less, initiate corticosteroid taper and continue to taper over at least 1 month. Based on limited data from clinical studies in patients whose immune-related adverse reactions could not be controlled with corticosteroid use, administration of other systemic immunosuppressants can be considered. Resume KEYTRUDA when the adverse reaction remains at Grade 1 or less following corticosteroid taper. Permanently discontinue KEYTRUDA for any Grade 3 immune-mediated adverse reaction that recurs and for any life-threatening immune-mediated adverse reaction. The following clinically significant immune-mediated adverse reactions occurred in less than 1% (unless otherwise indicated) of 2799 patients: arthritis (1.5%), exfoliative dermatitis, bullous pemphigoid, rash (1.4%), uveitis, myositis, Guillain-Barré syndrome, myasthenia gravis, vasculitis, pancreatitis, hemolytic anemia, and partial seizures arising in a patient with inflammatory foci in brain parenchyma. KEYTRUDA can cause severe or life-threatening infusion-related reactions, which have been reported in 6 (0.2%) of 2799 patients. Monitor patients for signs and symptoms of infusion-related reactions, including rigors, chills, wheezing, pruritus, flushing, rash, hypotension, hypoxemia, and fever. For Grade 3 or 4 reactions, stop infusion and permanently discontinue KEYTRUDA. Based on its mechanism of action, KEYTRUDA can cause fetal harm when administered to a pregnant woman. If used during pregnancy, or if the patient becomes pregnant during treatment, apprise the patient of the potential hazard to a fetus. Advise females of reproductive potential to use highly effective contraception during treatment and for 4 months after the last dose of KEYTRUDA (pembrolizumab). In KEYNOTE-006, KEYTRUDA was discontinued due to adverse reactions in 9% of 555 patients with advanced melanoma; adverse reactions leading to discontinuation in more than one patient were colitis (1.4%), autoimmune hepatitis (0.7%), allergic reaction (0.4%), polyneuropathy (0.4%), and cardiac failure (0.4%). Adverse reactions leading to interruption of KEYTRUDA occurred in 21% of patients; the most common (≥1%) was diarrhea (2.5%). The most common adverse reactions with KEYTRUDA vs ipilimumab were fatigue (28% vs 28%), diarrhea (26% with KEYTRUDA), rash (24% vs 23%), and nausea (21% with KEYTRUDA). Corresponding incidence rates are listed for ipilimumab only for those adverse reactions that occurred at the same or lower rate than with KEYTRUDA. In KEYNOTE-002, KEYTRUDA was discontinued due to adverse reactions in 12% of 357 patients with advanced melanoma; the most common (≥1%) were general physical health deterioration (1%), asthenia (1%), dyspnea (1%), pneumonitis (1%), and generalized edema (1%). Adverse reactions leading to interruption of KEYTRUDA occurred in 14% of patients; the most common (≥1%) were dyspnea (1%), diarrhea (1%), and maculopapular rash (1%). The most common adverse reactions with KEYTRUDA vs chemotherapy were fatigue (43% with KEYTRUDA), pruritus (28% vs 8%), rash (24% vs 8%), constipation (22% vs 20%), nausea (22% with KEYTRUDA), diarrhea (20% vs 20%), and decreased appetite (20% with KEYTRUDA). Corresponding incidence rates are listed for chemotherapy only for those adverse reactions that occurred at the same or lower rate than with KEYTRUDA. KEYTRUDA was discontinued due to adverse reactions in 8% of 682 patients with metastatic NSCLC. The most common adverse event resulting in permanent discontinuation of KEYTRUDA was pneumonitis (1.8%). Adverse reactions leading to interruption of KEYTRUDA occurred in 23% of patients; the most common (≥1%) were diarrhea (1%), fatigue (1.3%), pneumonia (1%), liver enzyme elevation (1.2%), decreased appetite (1.3%), and pneumonitis (1%). The most common adverse reactions (occurring in at least 20% of patients and at a higher incidence than with docetaxel) were decreased appetite (25% vs 23%), dyspnea (23% vs 20%), and nausea (20% vs 18%). KEYTRUDA was discontinued due to adverse reactions in 17% of 192 patients with HNSCC. Serious adverse reactions occurred in 45% of patients. The most frequent serious adverse reactions reported in at least 2% of patients were pneumonia, dyspnea, confusional state, vomiting, pleural effusion, and respiratory failure. The most common adverse reactions (reported in at least 20% of patients) were fatigue, decreased appetite, and dyspnea. Adverse reactions occurring in patients with HNSCC were generally similar to those occurring in patients with melanoma or NSCLC, with the exception of increased incidences of facial edema (10% all Grades; 2.1% Grades 3 or 4) and new or worsening hypothyroidism. It is not known whether KEYTRUDA (pembrolizumab) is excreted in human milk. Because many drugs are excreted in human milk, instruct women to discontinue nursing during treatment with KEYTRUDA and for 4 months after the final dose. Safety and effectiveness of KEYTRUDA have not been established in pediatric patients. For more information about KEYTRUDA, please see the Prescribing Information for KEYTRUDA (pembrolizumab) at http://www.merck.com/product/usa/pi_circulars/k/keytruda/keytruda_pi.pdf and HALAVEN® (eribulin mesylate) is a microtubule dynamics inhibitor indicated for the treatment of patients with: Discovered and developed by Eisai, eribulin is a synthetic analog of halichondrin B, a natural product that was isolated from the marine sponge Halichondria okadai. First in the halichondrin class, Halaven is a microtubule dynamics inhibitor. Eribulin is believed to work primarily via a tubulin-based mechanism that causes prolonged and irreversible mitotic blockage, ultimately leading to apoptotic cell death. Additionally, in preclinical studies of human breast cancer, eribulin demonstrated complex effects on the tumor biology of surviving cancer cells, including increases in vascular perfusion resulting in reduced tumor hypoxia, and changes in the expression of genes in tumor specimens associated with a change in phenotype, promoting the epithelial phenotype, opposing the mesenchymal phenotype. Eribulin has also been shown to decrease the migration and invasiveness of human breast cancer cells. Neutropenia: Severe neutropenia (ANC <500/mm3) lasting >1 week occurred in 12% of patients with mBC and liposarcoma or leiomyosarcoma. Febrile neutropenia occurred in 5% of patients with mBC and 2 patients (0.4%) died from complications. Febrile neutropenia occurred in 0.9% of patients with liposarcoma or leiomyosarcoma, and fatal neutropenic sepsis occurred in 0.9% of patients. Patients with mBC with elevated liver enzymes >3 × ULN and bilirubin >1.5 × ULN experienced a higher incidence of Grade 4 neutropenia and febrile neutropenia than patients with normal levels. Monitor complete blood cell counts prior to each dose, and increase the frequency of monitoring in patients who develop Grade 3 or 4 cytopenias. Delay administration and reduce subsequent doses in patients who experience febrile neutropenia or Grade 4 neutropenia lasting >7 days. Peripheral Neuropathy: Grade 3 peripheral neuropathy occurred in 8% of patients with mBC (Grade 4=0.4%) and 22% developed a new or worsening neuropathy that had not recovered within a median follow-up duration of 269 days (range 25-662 days). Neuropathy lasting >1 year occurred in 5% of patients with mBC. Grade 3 peripheral neuropathy occurred in 3.1% of patients with liposarcoma and leiomyosarcoma receiving Halaven and neuropathy lasting more than 60 days occurred in 58% (38/65) of patients who had neuropathy at the last treatment visit. Patients should be monitored for signs of peripheral motor and sensory neuropathy. Withhold Halaven in patients who experience Grade 3 or 4 peripheral neuropathy until resolution to Grade 2 or less. Embryo-Fetal Toxicity: Halaven can cause fetal harm when administered to a pregnant woman. Advise females of reproductive potential to use effective contraception during treatment with Halaven and for at least 2 weeks following the final dose. Advise males with female partners of reproductive potential to use effective contraception during treatment with Halaven and for 3.5 months following the final dose. QT Prolongation: Monitor for prolonged QT intervals in patients with congestive heart failure, bradyarrhythmias, drugs known to prolong the QT interval, and electrolyte abnormalities. Correct hypokalemia or hypomagnesemia prior to initiating Halaven and monitor these electrolytes periodically during therapy. Avoid in patients with congenital long QT syndrome. In patients with mBC receiving Halaven (eribulin mesylate) Injection, the most common adverse reactions (≥25%) were neutropenia (82%), anemia (58%), asthenia/fatigue (54%), alopecia (45%), peripheral neuropathy (35%), nausea (35%), and constipation (25%). Febrile neutropenia (4%) and neutropenia (2%) were the most common serious adverse reactions. The most common adverse reaction resulting in discontinuation was peripheral neuropathy (5%). In patients with liposarcoma and leiomyosarcoma receiving Halaven, the most common adverse reactions (≥25%) reported in patients receiving Halaven were fatigue (62%), nausea (41%), alopecia (35%), constipation (32%), peripheral neuropathy (29%), abdominal pain (29%), and pyrexia (28%). The most common (≥5%) Grade 3-4 laboratory abnormalities reported in patients receiving Halaven were neutropenia (32%), hypokalemia (5.4%), and hypocalcemia (5%). Neutropenia (4.9%) and pyrexia (4.5%) were the most common serious adverse reactions. The most common adverse reactions resulting in discontinuation were fatigue and thrombocytopenia (0.9% each). Lactation: Because of the potential for serious adverse reactions in breastfed infants from eribulin mesylate, advise women not to breastfeed during treatment with Halaven and for 2 weeks after the final dose. Hepatic and Renal Impairment: A reduction in starting dose is recommended for patients with mild or moderate hepatic impairment and/or moderate or severe renal impairment. For more information about Halaven, click here for the full Prescribing Information. Merck’s goal is to translate breakthrough science into innovative oncology medicines to help people with cancer worldwide. At Merck, helping people fight cancer is our passion and supporting accessibility to our cancer medicines is our commitment. Our focus is on pursuing research in immuno-oncology and we are accelerating every step in the journey – from lab to clinic – to potentially bring new hope to people with cancer. As part of our focus on cancer, Merck is committed to exploring the potential of immuno-oncology with one of the fastest-growing development programs in the industry. We are currently executing an expansive research program that includes nearly 400 clinical trials evaluating our anti-PD-1 therapy across more than 30 tumor types. We also continue to strengthen our immuno-oncology portfolio through strategic acquisitions and are prioritizing the development of several promising immunotherapeutic candidates with the potential to improve the treatment of advanced cancers. For more information about our oncology clinical trials, visit www.merck.com/clinicaltrials. For 125 years, Merck has been a global health care leader working to help the world be well. Merck is known as MSD outside the United States and Canada. Through our prescription medicines, vaccines, biologic therapies, and animal health products, we work with customers and operate in more than 140 countries to deliver innovative health solutions. We also demonstrate our commitment to increasing access to health care through far-reaching policies, programs and partnerships. For more information, visit www.merck.com and connect with us on Twitter, Facebook, YouTube and LinkedIn. At Eisai Inc., human health care (hhc) is our goal. We give our first thought to patients and their families, and helping to increase the benefits health care provides. As the U.S. pharmaceutical subsidiary of Tokyo-based Eisai Co., Ltd., we have a passionate commitment to patient care that is the driving force behind our efforts to discover and develop innovative therapies to help address unmet medical needs. Eisai is a fully integrated pharmaceutical business that operates in two global business groups: oncology and neurology (dementia-related diseases and neurodegenerative diseases). Each group functions as an end-to-end global business with discovery, development, and marketing capabilities. Our U.S. headquarters, commercial and clinical development organizations are located in New Jersey; our discovery labs are in Massachusetts and Pennsylvania; and our global demand chain organization resides in Maryland and North Carolina. To learn more about Eisai Inc., please visit us at www.eisai.com/US. Forward-Looking Statement of Merck & Co., Inc., Kenilworth, N.J., USA This news release of Merck & Co., Inc., Kenilworth, N.J., USA (the “company”) includes “forward-looking statements” within the meaning of the safe harbor provisions of the U.S. Private Securities Litigation Reform Act of 1995. These statements are based upon the current beliefs and expectations of the company’s management and are subject to significant risks and uncertainties. There can be no guarantees with respect to pipeline products that the products will receive the necessary regulatory approvals or that they will prove to be commercially successful. If underlying assumptions prove inaccurate or risks or uncertainties materialize, actual results may differ materially from those set forth in the forward-looking statements. Risks and uncertainties include but are not limited to, general industry conditions and competition; general economic factors, including interest rate and currency exchange rate fluctuations; the impact of pharmaceutical industry regulation and health care legislation in the United States and internationally; global trends toward health care cost containment; technological advances, new products and patents attained by competitors; challenges inherent in new product development, including obtaining regulatory approval; the company’s ability to accurately predict future market conditions; manufacturing difficulties or delays; financial instability of international economies and sovereign risk; dependence on the effectiveness of the company’s patents and other protections for innovative products; and the exposure to litigation, including patent litigation, and/or regulatory actions. The company undertakes no obligation to publicly update any forward-looking statement, whether as a result of new information, future events or otherwise. Additional factors that could cause results to differ materially from those described in the forward-looking statements can be found in the company’s 2015 Annual Report on Form 10-K and the company’s other filings with the Securities and Exchange Commission (SEC) available at the SEC’s Internet site (www.sec.gov).


News Article | October 29, 2016
Site: www.prweb.com

Two leading pediatric clinics are using technology to improve the experience of their small patients and parents. Stanford Children’s Health and Dana-Farber Cancer Institute have employed Versus Advantages™ Clinic, powered by real-time locating system (RTLS) technology, to improve patient flow and expedite visits. Taking children to the doctor can be stressful on both the child and parents, especially during the waiting phase. A long wait in a crowded room of potentially contagious or crying children can try the patience of even the most seasoned parents and clinic staff. At Stanford Children’s Health Specialty Services in Sunnyvale, Calif., the sheer size of the facility makes it important to efficiently locate patients, staff and other assets. The clinic offers more than 20 subspecialties in a two-story, 77,000-square-foot facility. The new facility went live with Versus in May. Both wireless and wired RTLS sensors, installed by Versus Gold System Integrator Comtel Systems Technology, monitor patient wait and alone times, patient-staff interactions, room utilization and more. At the Dana-Farber Jimmy Fund Clinic (JFC) in Boston, Mass., pediatric cancer patients and their families spend a significant amount of time in the clinic receiving complex treatment. Understandably, these families don’t want to spend time unnecessarily. The pediatric clinic sits next door to the 15-floor Yawkey Center for Cancer Care which has used the Advantages™ Clinic patient flow system since 2011. Dana-Farber is expanding Versus into the JFC during a phased roll-out that begins in December. In both facilities, patients may have multiple appointments with several providers, and Advantages is key to giving the entire care team visibility into the overall patient visit. Automated electronic white boards display patient appointment times — via an integration with the Epic electronic medical record (EMR) — as well as the patient’s current location, wait time, alone time, and overall length of stay. Because patients, staff and providers all wear locating badges, the white boards also automatically communicate whether the patient has seen necessary staff, such as medical assistants or technicians, then alerts the care team when the patient is ready for the next stage of care. These workflow cues help all caregivers productively manage their time, efficiently progressing the patient visit. At the Sunnyvale clinic, patient satisfaction scores are among the highest in the Stanford Children’s Health Specialty Services network. In a recent RFID Journal article, Lee Kwiatkowski, Stanford Children's Health's director of ambulatory transformation, attributes the high satisfaction in large part to the efficiency that Versus Advantages provides. While Advantages assists with communication in the moment, it is also collecting a wealth of operational data behind the scenes. Dana-Farber, for example, used the data to reveal how often exam rooms were underutilized within another department. As Dr. Craig Bunnell, CMO Dana-Farber, told Healthcare Technology Management, the data pointed to workflow improvements that ultimately increased capacity by 10 percent. Dana-Farber hopes to similarly use Advantages to improve workflow and to increase patient and provider satisfaction in the JFC. To improve workflow, increase capacity, and enhance both provider and patient satisfaction with RTLS, highly accurate location data must be combined with effective software and analytics. In a recent report from the research firm KLAS, Versus received the highest rating among vendors that provide both hardware and software. Versus also received the highest rating for location accuracy, as well as for many other categories.1 For more on the KLAS report, visit versustech.com/KLAS. Midmark Corporation acquired Versus Technology, Inc. in May, 2016, creating a unique offering of clinical workflow solutions that encompass clinical workflow services, RTLS technology, medical equipment, diagnostic devices and design assistance for improved efficiency within health systems. About Dana-Farber Cancer Institute From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world’s leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report’s Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women’s Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston’s Longwood Medical Area. Dana-Farber is dedicated to a unique 50/50 balance between cancer research and care, and much of the Institute’s work is dedicated to translating the results of its discovery into new treatments for patients in Boston, and around the world. About Comtel Systems Technology Established in 1982, Comtel Systems Technology specializes in advanced systems for: Hospital and Healthcare Facilities, Educational Complexes, as well as Industrial and Commercial Facilities. Located in the heart of the Silicon Valley, Comtel has proudly been serving the Northern California area for over 30 years. Comtel is defined as a technical organization that focuses on providing design, installation, training and on-going maintenance for a wide range of electronic systems. To learn more about Comtel Systems Technology, please visit comtelsys.com. About Versus Technology, Inc. Versus Technology, Inc., a Midmark company, provides healthcare facilities with operational and clinical workflow intelligence using real-time locating system (RTLS) technology. Since its inception in 1988, more than 850 hospitals, clinics and senior care facilities have used Versus solutions to support healthcare’s ultimate goals: enhancing the patient experience while providing high-quality care at lower costs. With enterprise solutions for patient tracking, workflow automation, staff safety, hand hygiene and asset tracking, Versus improves patient flow, communication, and productivity to ultimately increase capacity. To learn more about Versus Technology, Inc., our technology and client successes, visit versustech.com. About Midmark Midmark Corporation, a privately held company founded in 1915, is committed to providing innovative products and workflow solutions to healthcare professionals around the world. Offering full lines of exam and procedures tables, as well as workstations, casework, instrument processing, digital diagnostics solutions, real-time locating system (RTLS) technology and more. Midmark is focused on continuously improving physician workflows and enhancing patient-caregiver interactions. Midmark’s more than 1,500 teammates worldwide are dedicated to redefining the future of the clinical space and making a positive difference in the practice of healthcare. Headquartered in Dayton, Ohio, Midmark maintains production and administrative offices in Versailles, Ohio, as well as six other locations in the United States and international locations in India, Italy and the United Kingdom. To learn more about Midmark, visit midmarkclinicalsolutions.com or midmark.com, and follow Midmark on Facebook, LinkedIn, Twitter and YouTube.


IRVINE, CA--(Marketwired - Mar 2, 2017) - Cannabis Science, Inc. ( : CBIS), a U.S. company specializing in the development of cannabis-based medicines, is pleased to announce that its President, CEO and Co-Founder, Raymond C. Dabney, will be a keynote speaker and panelist at the Global Health Catalyst (GHC) Summit at Harvard Medical School on April 28-30, 2017. Additionally, Cannabis Science's Chief Medical Officer (CMO), Allen Herman, will Co-Chair a special session at the GHC Summit. Both Dabney and Herman previously presented at Harvard Medical School in November 2016. Information on the GHC Summit is available at http://www.globalhealthcatalystsummit.org Dabney will be the keynote speaker and a panelist for a special session on "Cannabis Science Versus Cancer and Other Malignancies." Dabney will discuss how cannabinoids can be used to treat cancer and other diseases, manage the side effects of cancer treatment like radiotherapy and chemotherapy, and potential applications of medical cannabis in global health to close the global pain divide; Cannabis Science's vision for the global health and development impact of cannabinoid-based medicines; and the need for greater public education on the importance of medical cannabis research. Information on this special session can be accessed at: https://www.globalhealthcatalystsummit.org/medical-cannabis Additionally, Dabney will present summit participants with an overview of the company's current drug development program, as well as with an update on Cannabis Science's Collaborative Research Agreement (CRA) with Dana-Farber Cancer Institute (Dana-Farber). In addition to co-chairing the session, Herman will participate in the discussion on the epidemiology of cancer and the utilization of opioids in Africa as opioid utilization rates reflect the pain divide. This conference affords Cannabis Science an opportunity to discuss cutting-edge cannabinoid research with some of the greatest minds in modern medicine globally, as well as to network and explore potential partnerships. In addition, through participation in this Summit, Cannabis Science will give updates on progress in the implementation of Cannabis Science's research agreement with Dana-Farber and a potential consortium agreement involving other institutions. The GHC Summit invitation letters for Mr. Dabney and Dr. Herman can be viewed: https://cannabisscience.com/index.php/events/826-invitation-to-the-2017-global-health-catalyst-cancer-summit-at-harvard-medical-school On January 3, 2017, Cannabis Science entered into a CRA with Dana-Farber, one of the world's leading cancer centers. Under the terms of the CRA, Cannabis Science and Dana-Farber will jointly investigate and develop use of cannabinoids to treat various forms of cancers. "I am excited about Cannabis Science's relationship with Dana-Farber. When I first met Wilfred Ngwa, PhD, Director of Global Health Catalyst at Harvard Medical School and Principal Investigator for the CRA, we immediately realized potential synergies on cancer research interests, and the potential to collaborate to develop cannabinoid-based medicines to treat cancer and control cancer symptoms with minimal side-effects," stated Dabney. Dabney and Ngwa met during the Constituency for Africa's (CFA) annual Ronald H. Brown African Affairs Series in Washington, DC in September 2016, where they both were on the speaking program. Mr. Dabney is a Member of the Board of Directors of CFA, and the Vice Chairman of CFA's African Healthcare Infrastructure Committee (AHIC). Cannabis Science, Inc. takes advantage of its unique understanding of metabolic processes to provide novel treatment approaches to a number of illnesses for which current treatments and understanding remain unsatisfactory. Cannabinoids have an extensive history dating back thousands of years, and currently, there are a growing number of peer-reviewed scientific publications that document the underlying biochemical pathways that cannabinoids modulate. The Company works with leading experts in drug development, medicinal characterization, and clinical research to develop, produce, and commercialize novel therapeutic approaches for the treatment for illnesses caused by infections as well as for age-related illness. Our initial focus is on skin cancers, HIV/AIDS, and neurological conditions. The Company is proceeding with the research and development of its proprietary drugs as a part of this initial focus: CS-S/BCC-1, CS-TATI-1, and CS-NEURO- 1, respectively. This Press Release includes forward-looking statements within the meaning of Section 27A of the Securities Act of 1933 and Section 21E of the Securities Act of 1934. A statement containing words such as "anticipate," "seek," intend," "believe," "estimate," "expect," "project," "plan," or similar phrases may be deemed "forward- looking statements" within the meaning of the Private Securities Litigation Reform Act of 1995. Some or all of the events or results anticipated by these forward-looking statements may not occur. Factors that could cause or contribute to such differences include the future U.S. and global economies, the impact of competition, and the Company's reliance on existing regulations regarding the use and development of cannabis-based drugs. Cannabis Science, Inc., does not undertake any duty nor does it intend to update the results of these forward- looking statements. Safe Harbor Statement. The Private Securities Litigation Reform Act of 1995 provides a 'safe harbor' for forward looking statements. Certain of the statements contained herein, which are not historical facts are forward looking statements with respect to events, the occurrence of which involved risks and uncertainties. These forward-looking statements may be impacted, either positively or negatively, by various factors. Information concerning potential factors that could affect the company is detailed from time to time in the company's reports filed with the Securities and Exchange Commission.


KENILWORTH, N.J.--(BUSINESS WIRE)--Merck (NYSE:MRK), known as MSD outside the United States and Canada, today announced that updated findings from the phase 1b KEYNOTE-028 study investigating the use of KEYTRUDA® (pembrolizumab), the company’s anti-PD-1 therapy, in previously treated patients with advanced small cell lung cancer (SCLC) and malignant pleural mesothelioma, showed clinical activity and durable responses in some patients. These data were featured in oral presentations at the 17th World Conference on Lung Cancer hosted by the International Association for the Study of Lung Cancer. “ As data from our initial trials exploring KEYTRUDA mature, we are encouraged to see durable clinical activity in difficult-to-treat cancers such as small cell lung cancer and malignant pleural mesothelioma, where new treatments are clearly needed,” said Dr. Roger Dansey, senior vice president and therapeutic area head, oncology late-stage development, Merck Research Laboratories. “ With our extensive immuno-oncology research program, we are developing KEYTRUDA across a range of thoracic malignancies, and we have additional studies underway in these two cancer types.” KEYNOTE-028 is an ongoing multi-cohort, non-randomized Phase 1b basket trial evaluating the safety, tolerability, and anti-tumor activity of KEYTRUDA monotherapy (10 mg/kg dosed every two weeks) in more than 450 patients with PD-L1 positive tumors across 20 different types of cancer. PD-L1 positivity was defined as expression in one percent or more of tumor and associated inflammatory cells or positive staining in stroma. The primary outcome measure is overall response rate (ORR), with secondary outcome measures of progression-free survival (PFS), overall survival (OS), and duration of response. The KEYTRUDA (pembrolizumab) clinical development program includes more than 30 tumor types in nearly 400 clinical trials, including more than 200 trials that combine KEYTRUDA with other cancer treatments. Merck has initiated a phase 2 trial, KEYNOTE-158, to further evaluate KEYTRUDA in advanced solid tumors including SCLC and malignant pleural mesothelioma. Data from the SCLC cohort of the KEYNOTE-028 trial were presented in an oral presentation on Dec. 5 by Dr. Patrick Ott, Dana-Farber Cancer Institute. Updated findings from 24 heavily pre-treated patients with advanced SCLC demonstrated a confirmed ORR of 33.3 percent (n=8/24) (95% CI, 15.6%-55.3%), including one complete response and seven partial responses. One patient had stable disease and 13 patients had progressive disease. Responses were durable, with a median duration of response of 19.4 months (95% CI, range: 3.6+ to 20.0+). Additionally, the median PFS was 1.9 months (95% CI, 1.7-5.9), with a six-month PFS rate of 28.6 percent and 12-month PFS rate of 23.8 percent. The median OS was 9.7 months (95% CI, 4.1-NR), with a six-month OS rate of 66.0 percent and a 12-month OS rate of 37.7 percent. The safety profile of KEYTRUDA was consistent with that observed in previously reported studies. Grade 3-5 treatment-related adverse events were asthenia, blood bilirubin increased, colitis and intestinal ischemia (n=1 for all). Some patients experienced adverse events of special interest, including autoimmune thyroiditis, infusion site reaction, cytokine release syndrome and colitis (n=1 for all). “ These long-term data, which show meaningful response rates and durable responses in certain patients with small cell lung cancer, are encouraging,” said Dr. Ott. “ With these findings, we are advancing understanding of the potential for immunotherapy to make a difference for these patients.” Data from the malignant pleural mesothelioma cohort of the KEYNOTE-028 trial were presented in an oral presentation on Dec. 6 by Dr. Evan Alley, Abramson Cancer Center, University of Pennsylvania. Results showed a confirmed ORR of 20.0 percent (n=5/25) (95% CI, 6.8-40.7). All responses were partial responses and 13 patients had stable disease. The median duration of response was 12.0 months (range, 3.7-20.5+). In total, 60.9 percent of evaluable patients experienced a decrease in tumor size. Additionally, the median PFS was 5.4 months (95% CI, 3.4-7.5), with a six-month PFS rate of 45.8 percent and a 12-month PFS rate of 20.8 percent. Median OS was 18.0 months (95% CI, 9.4-NR), with a six-month OS rate of 83.5 percent and a 12-month OS rate of 62.6 percent. The safety profile of KEYTRUDA (pembrolizumab) was consistent with that observed in previously reported studies. Grade 3 treatment-related adverse events were ALT increase, appetite decrease, dyspnea, iridocyclitis, neutrophil count decreased, pyrexia and thrombocytopenia (n=1 for all). Some patients experienced adverse events of special interest, including erythema/erythema multiforme, hypothyroidism, infusion-related reaction, iridocyclitis and rhabdomyolysis (n=1 for all). There were no Grade 4 or 5 treatment-related adverse events and no treatment-related deaths. KEYTRUDA is a humanized monoclonal antibody that works by increasing the ability of the body’s immune system to help detect and fight tumor cells. KEYTRUDA blocks the interaction between PD-1 and its ligands, PD-L1 and PD-L2, thereby activating T lymphocytes which may affect both tumor cells and healthy cells. KEYTRUDA is administered as an intravenous infusion over 30 minutes every three weeks for the approved indications. KEYTRUDA for injection is supplied in a 100 mg single use vial. KEYTRUDA is indicated for the treatment of patients with unresectable or metastatic melanoma at a dose of 2 mg/kg every three weeks until disease progression or unacceptable toxicity. KEYTRUDA is indicated for the first-line treatment of patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have high PD-L1 expression [tumor proportion score (TPS) ≥50%] as determined by an FDA-approved test, with no EGFR or ALK genomic tumor aberrations. KEYTRUDA (pembrolizumab) is also indicated for the treatment of patients with metastatic NSCLC whose tumors express PD-L1 (TPS ≥1%) as determined by an FDA-approved test, with disease progression on or after platinum-containing chemotherapy. Patients with EGFR or ALK genomic tumor aberrations should have disease progression on FDA-approved therapy for these aberrations prior to receiving KEYTRUDA. In metastatic NSCLC, KEYTRUDA is administered at a fixed dose of 200 mg every three weeks until disease progression, unacceptable toxicity, or up to 24 months in patients without disease progression. KEYTRUDA is indicated for the treatment of patients with recurrent or metastatic head and neck squamous cell carcinoma (HNSCC) with disease progression on or after platinum-containing chemotherapy. This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials. In HNSCC, KEYTRUDA is administered at a fixed dose of 200 mg every three weeks until disease progression, unacceptable toxicity, or up to 24 months in patients without disease progression. KEYTRUDA can cause immune-mediated pneumonitis, including fatal cases. Pneumonitis occurred in 94 (3.4%) of 2799 patients receiving KEYTRUDA, including Grade 1 (0.8%), 2 (1.3%), 3 (0.9%), 4 (0.3%), and 5 (0.1%) pneumonitis, and occurred more frequently in patients with a history of prior thoracic radiation (6.9%) compared to those without (2.9%). Monitor patients for signs and symptoms of pneumonitis. Evaluate suspected pneumonitis with radiographic imaging. Administer corticosteroids for Grade 2 or greater pneumonitis. Withhold KEYTRUDA for Grade 2; permanently discontinue KEYTRUDA for Grade 3 or 4 or recurrent Grade 2 pneumonitis. KEYTRUDA can cause immune-mediated colitis. Colitis occurred in 48 (1.7%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.4%), 3 (1.1%), and 4 (<0.1%) colitis. Monitor patients for signs and symptoms of colitis. Administer corticosteroids for Grade 2 or greater colitis. Withhold KEYTRUDA for Grade 2 or 3; permanently discontinue KEYTRUDA for Grade 4 colitis. KEYTRUDA (pembrolizumab) can cause immune-mediated hepatitis. Hepatitis occurred in 19 (0.7%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.1%), 3 (0.4%), and 4 (<0.1%) hepatitis. Monitor patients for changes in liver function. Administer corticosteroids for Grade 2 or greater hepatitis and, based on severity of liver enzyme elevations, withhold or discontinue KEYTRUDA. KEYTRUDA can cause hypophysitis. Hypophysitis occurred in 17 (0.6%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.2%), 3 (0.3%), and 4 (<0.1%) hypophysitis. Monitor patients for signs and symptoms of hypophysitis (including hypopituitarism and adrenal insufficiency). Administer corticosteroids and hormone replacement as clinically indicated. Withhold KEYTRUDA for Grade 2; withhold or discontinue for Grade 3 or 4 hypophysitis. KEYTRUDA can cause thyroid disorders, including hyperthyroidism, hypothyroidism, and thyroiditis. Hyperthyroidism occurred in 96 (3.4%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.8%) and 3 (0.1%) hyperthyroidism. Hypothyroidism occurred in 237 (8.5%) of 2799 patients receiving KEYTRUDA, including Grade 2 (6.2%) and 3 (0.1%) hypothyroidism. The incidence of new or worsening hypothyroidism was higher in patients with HNSCC occurring in 28 (15%) of 192 patients with HNSCC, including Grade 3 (0.5%) hypothyroidism. Thyroiditis occurred in 16 (0.6%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.3%) thyroiditis. Monitor patients for changes in thyroid function (at the start of treatment, periodically during treatment, and as indicated based on clinical evaluation) and for clinical signs and symptoms of thyroid disorders. Administer replacement hormones for hypothyroidism and manage hyperthyroidism with thionamides and beta-blockers as appropriate. Withhold or discontinue KEYTRUDA for Grade 3 or 4 hyperthyroidism. KEYTRUDA can cause type 1 diabetes mellitus, including diabetic ketoacidosis, which have been reported in 6 (0.2%) of 2799 patients. Monitor patients for hyperglycemia or other signs and symptoms of diabetes. Administer insulin for type 1 diabetes, and withhold KEYTRUDA and administer antihyperglycemics in patients with severe hyperglycemia. KEYTRUDA can cause immune-mediated nephritis. Nephritis occurred in 9 (0.3%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.1%), 3 (0.1%), and 4 (<0.1%) nephritis. Monitor patients for changes in renal function. Administer corticosteroids for Grade 2 or greater nephritis. Withhold KEYTRUDA for Grade 2; permanently discontinue KEYTRUDA for Grade 3 or 4 nephritis. KEYTRUDA can cause other clinically important immune-mediated adverse reactions. For suspected immune-mediated adverse reactions, ensure adequate evaluation to confirm etiology or exclude other causes. Based on the severity of the adverse reaction, withhold KEYTRUDA (pembrolizumab) and administer corticosteroids. Upon improvement to Grade 1 or less, initiate corticosteroid taper and continue to taper over at least 1 month. Based on limited data from clinical studies in patients whose immune-related adverse reactions could not be controlled with corticosteroid use, administration of other systemic immunosuppressants can be considered. Resume KEYTRUDA when the adverse reaction remains at Grade 1 or less following corticosteroid taper. Permanently discontinue KEYTRUDA for any Grade 3 immune-mediated adverse reaction that recurs and for any life-threatening immune-mediated adverse reaction. The following clinically significant immune-mediated adverse reactions occurred in less than 1% (unless otherwise indicated) of 2799 patients: arthritis (1.5%), exfoliative dermatitis, bullous pemphigoid, rash (1.4%), uveitis, myositis, Guillain-Barré syndrome, myasthenia gravis, vasculitis, pancreatitis, hemolytic anemia, and partial seizures arising in a patient with inflammatory foci in brain parenchyma. KEYTRUDA can cause severe or life-threatening infusion-related reactions, which have been reported in 6 (0.2%) of 2799 patients. Monitor patients for signs and symptoms of infusion-related reactions, including rigors, chills, wheezing, pruritus, flushing, rash, hypotension, hypoxemia, and fever. For Grade 3 or 4 reactions, stop infusion and permanently discontinue KEYTRUDA. Based on its mechanism of action, KEYTRUDA can cause fetal harm when administered to a pregnant woman. If used during pregnancy, or if the patient becomes pregnant during treatment, apprise the patient of the potential hazard to a fetus. Advise females of reproductive potential to use highly effective contraception during treatment and for 4 months after the last dose of KEYTRUDA. In KEYNOTE-006, KEYTRUDA was discontinued due to adverse reactions in 9% of 555 patients with advanced melanoma; adverse reactions leading to discontinuation in more than one patient were colitis (1.4%), autoimmune hepatitis (0.7%), allergic reaction (0.4%), polyneuropathy (0.4%), and cardiac failure (0.4%). Adverse reactions leading to interruption of KEYTRUDA occurred in 21% of patients; the most common (≥1%) was diarrhea (2.5%). The most common adverse reactions with KEYTRUDA vs ipilimumab were fatigue (28% vs 28%), diarrhea (26% with KEYTRUDA), rash (24% vs 23%), and nausea (21% with KEYTRUDA). Corresponding incidence rates are listed for ipilimumab only for those adverse reactions that occurred at the same or lower rate than with KEYTRUDA. In KEYNOTE-002, KEYTRUDA was discontinued due to adverse reactions in 12% of 357 patients with advanced melanoma; the most common (≥1%) were general physical health deterioration (1%), asthenia (1%), dyspnea (1%), pneumonitis (1%), and generalized edema (1%). Adverse reactions leading to interruption of KEYTRUDA (pembrolizumab) occurred in 14% of patients; the most common (≥1%) were dyspnea (1%), diarrhea (1%), and maculopapular rash (1%). The most common adverse reactions with KEYTRUDA vs chemotherapy were fatigue (43% with KEYTRUDA), pruritus (28% vs 8%), rash (24% vs 8%), constipation (22% vs 20%), nausea (22% with KEYTRUDA), diarrhea (20% vs 20%), and decreased appetite (20% with KEYTRUDA). Corresponding incidence rates are listed for chemotherapy only for those adverse reactions that occurred at the same or lower rate than with KEYTRUDA. KEYTRUDA was discontinued due to adverse reactions in 8% of 682 patients with metastatic NSCLC. The most common adverse event resulting in permanent discontinuation of KEYTRUDA was pneumonitis (1.8%). Adverse reactions leading to interruption of KEYTRUDA occurred in 23% of patients; the most common (≥1%) were diarrhea (1%), fatigue (1.3%), pneumonia (1%), liver enzyme elevation (1.2%), decreased appetite (1.3%), and pneumonitis (1%). The most common adverse reactions (occurring in at least 20% of patients and at a higher incidence than with docetaxel) were decreased appetite (25% vs 23%), dyspnea (23% vs 20%), and nausea (20% vs 18%). KEYTRUDA was discontinued due to adverse reactions in 17% of 192 patients with HNSCC. Serious adverse reactions occurred in 45% of patients. The most frequent serious adverse reactions reported in at least 2% of patients were pneumonia, dyspnea, confusional state, vomiting, pleural effusion, and respiratory failure. The most common adverse reactions (reported in at least 20% of patients) were fatigue, decreased appetite, and dyspnea. Adverse reactions occurring in patients with HNSCC were generally similar to those occurring in patients with melanoma or NSCLC, with the exception of increased incidences of facial edema (10% all Grades; 2.1% Grades 3 or 4) and new or worsening hypothyroidism. It is not known whether KEYTRUDA is excreted in human milk. Because many drugs are excreted in human milk, instruct women to discontinue nursing during treatment with KEYTRUDA and for 4 months after the final dose. Safety and effectiveness of KEYTRUDA have not been established in pediatric patients. Our goal is to translate breakthrough science into innovative oncology medicines to help people with cancer worldwide. At Merck, helping people fight cancer is our passion and supporting accessibility to our cancer medicines is our commitment. Our focus is on pursuing research in immuno-oncology and we are accelerating every step in the journey – from lab to clinic – to potentially bring new hope to people with cancer. As part of our focus on cancer, Merck is committed to exploring the potential of immuno-oncology with one of the fastest-growing development programs in the industry. We are currently executing an expansive research program that includes nearly 400 clinical trials evaluating our anti-PD-1 therapy across more than 30 tumor types. We also continue to strengthen our immuno-oncology portfolio through strategic acquisitions and are prioritizing the development of several promising immunotherapeutic candidates with the potential to improve the treatment of advanced cancers. For more information about our oncology clinical trials, visit www.merck.com/clinicaltrials. For 125 years, Merck has been a global health care leader working to help the world be well. Merck is known as MSD outside the United States and Canada. Through our prescription medicines, vaccines, biologic therapies, and animal health products, we work with customers and operate in more than 140 countries to deliver innovative health solutions. We also demonstrate our commitment to increasing access to health care through far-reaching policies, programs and partnerships. For more information, visit www.merck.com and connect with us on Twitter, Facebook, YouTube and LinkedIn. Forward-Looking Statement of Merck & Co., Inc., Kenilworth, N.J., USA This news release of Merck & Co., Inc., Kenilworth, N.J., USA (the “company”) includes “forward-looking statements” within the meaning of the safe harbor provisions of the U.S. Private Securities Litigation Reform Act of 1995. These statements are based upon the current beliefs and expectations of the company’s management and are subject to significant risks and uncertainties. There can be no guarantees with respect to pipeline products that the products will receive the necessary regulatory approvals or that they will prove to be commercially successful. If underlying assumptions prove inaccurate or risks or uncertainties materialize, actual results may differ materially from those set forth in the forward-looking statements. Risks and uncertainties include but are not limited to, general industry conditions and competition; general economic factors, including interest rate and currency exchange rate fluctuations; the impact of pharmaceutical industry regulation and health care legislation in the United States and internationally; global trends toward health care cost containment; technological advances, new products and patents attained by competitors; challenges inherent in new product development, including obtaining regulatory approval; the company’s ability to accurately predict future market conditions; manufacturing difficulties or delays; financial instability of international economies and sovereign risk; dependence on the effectiveness of the company’s patents and other protections for innovative products; and the exposure to litigation, including patent litigation, and/or regulatory actions. The company undertakes no obligation to publicly update any forward-looking statement, whether as a result of new information, future events or otherwise. Additional factors that could cause results to differ materially from those described in the forward-looking statements can be found in the company’s 2015 Annual Report on Form 10-K and the company’s other filings with the Securities and Exchange Commission (SEC) available at the SEC’s Internet site (www.sec.gov). Please see Prescribing Information for KEYTRUDA (pembrolizumab) at http://www.merck.com/product/usa/pi_circulars/k/keytruda/keytruda_pi.pdf and


KENILWORTH, N.J.--(BUSINESS WIRE)--Merck (NYSE:MRK), known as MSD outside the United States and Canada, announced today updated findings evaluating KEYTRUDA® (pembrolizumab), the company’s anti-PD-1 therapy, in two trials of patients with relapsed or refractory classical Hodgkin lymphoma (cHL). In the KEYNOTE-087 and KEYNOTE-013 trials, KEYTRUDA demonstrated overall response rates (ORR) of 69.0 percent and 58 percent, respectively. KEYNOTE-013, which had a median follow up of 29 months, showed responses of 12 months or greater in 70 percent of patients who responded to therapy. These findings will be presented today at the 58th Annual Meeting of the American Society of Hematology (ASH). Additionally, data from these trials supported the recently announced regulatory filing with the U.S. Food and Drug Administration. “ As the data mature from these two studies, we continue to be encouraged by the response rates, including complete remission and durable responses, in patients with relapsed or refractory classical Hodgkin lymphoma,” said Dr. Roger Dansey, senior vice president and therapeutic area head, oncology late-stage development, Merck Research Laboratories. The KEYTRUDA clinical development program includes more than 30 tumor types in nearly 400 clinical trials, including more than 200 trials that combine KEYTRUDA with other cancer treatments. For hematologic malignancies specifically, Merck is conducting broad immuno-oncology research assessing the role of monotherapy and combination regimens with KEYTRUDA (pembrolizumab). The hematology program includes nearly 40 ongoing studies – including company sponsored, investigator sponsored and collaborative studies; several of these are registration-enabling trials. “ When patients with classical Hodgkin lymphoma do not respond to standard of care chemotherapy or autologous stem cell transplantation, the cancer is difficult to successfully treat. For these patients, who are often in their 20s and 30s, the need to identify new treatment options is urgent,” said Dr. Craig Moskowitz, clinical director, division of hematologic oncology, Memorial Sloan Kettering Cancer Center. “ These data are promising and show that pembrolizumab may provide meaningful clinical benefit to patients with this disease.” Results from the KEYNOTE-087 trial will be presented in an oral presentation by Dr. Moskowitz at 5 p.m. PST (Location: San Diego Convention Center, Room 6B) (Abstract #1107). KEYNOTE-087 is a multicenter, open-label, multi-cohort, activity-estimating phase 2 trial evaluating KEYTRUDA (200 mg fixed dose every three weeks) monotherapy in patients with relapsed or refractory cHL across three cohorts. The primary endpoints include overall safety, tolerability, and ORR (per blinded independent central review, BICR); secondary endpoints include ORR (per investigator review), duration of response (DOR), progression-free survival (PFS) and overall survival (OS). The patient cohorts are intended to assess the outcome measures in: patients whose disease progressed following an autologous stem cell transplantation and subsequent treatment with brentuximab vedotin, an antibody drug conjugate (Cohort 1); patients who failed salvage chemotherapy and were ineligible for a transplant and whose disease progressed following treatment with brentuximab vedotin (Cohort 2); and patients whose disease progressed after transplant and who did not receive brentuximab vedotin after transplant (Cohort 3). Across all 210 enrolled patients, the ORR was 69.0 percent (n=145; 95% CI, 62.3-75.2) by BICR, and the complete remission rate was 22.4 percent (n=47; 95% CI, 16.9-28.6). Across all cohorts, 93 percent of patients experienced a decrease in tumor burden (n=192). Results also included an analysis of patients with primary refractory disease (n=73), defined as failure to achieve complete or partial response to first-line treatment. In this patient population, the ORR (per BICR) was 79.5 percent (n=58; 95% CI, 68.4-88.0). Additionally, an ORR of 67.8 percent (95% CI, 59.6-75.3) was reported in patients who relapsed after three or more lines of prior therapy (n=99/146). The safety profile of KEYTRUDA (pembrolizumab) was consistent with that observed in previously reported studies. The most common treatment-related adverse events were hypothyroidism (12.4%), pyrexia (10.5%), fatigue (9.0%), rash (7.6%), diarrhea (7.1%), headache (6.2%), nausea (5.7%), cough (5.7%) and neutropenia (5.2%). The most common grade 3 or 4 treatment-related adverse events were neutropenia (2.4%), diarrhea (1.0%) and dyspnea (1.0%). Immune-mediated adverse events included pneumonitis (2.9%), hyperthyroidism (2.9%), colitis (1.0%) and myositis (1.0%). There were nine discontinuations because of treatment-related adverse events and no treatment-related deaths. Results from the KEYNOTE-013 trial will be presented in an oral presentation by Dr. Philippe Armand, medical oncologist, Dana-Farber Cancer Institute at 5:15 p.m. PST (Location: San Diego Convention Center, Room 6B) (Abstract #1108). KEYNOTE-013 is an ongoing, multicenter, non-randomized, phase 1b trial of approximately 200 patients evaluating the safety, tolerability, and efficacy of KEYTRUDA (pembrolizumab) monotherapy in patients with blood cancers, including myelodysplastic syndromes, multiple myeloma, classical Hodgkin lymphoma, mediastinal large B cell lymphoma and certain other non-Hodgkin’s lymphoma (or lymphomata). The primary endpoints of the study include overall safety, tolerability, and complete remission rate (as measured by International Harmonization Project Response Criteria); secondary endpoints include ORR, DOR, PFS, and OS. Data from a cohort of the study evaluated KEYTRUDA monotherapy at 10 mg/kg every two weeks in patients with relapsed or refractory cHL who had progressed on or after treatment with brentuximab vedotin after failure of autologous stem cell transplant, or who were transplant-ineligible. Response was assessed at week 12 and every 8 weeks thereafter according to the International Harmonization Project 2007 criteria. Across all 31 patients enrolled in the KEYNOTE-013 classical Hodgkin lymphoma cohort, the ORR was 58 percent (n=18; 95% CI, 39-76) by BICR, and the complete remission rate was 19 percent (n=6; 95% CI, 8-38). Thirty-nine percent of patients achieved partial remission (n=12; 95% CI, 22-58) and 23 percent had stable disease (n=7; 95% CI, 10-41). The median duration of response was not yet reached (range 0.0+ to 26.1+ months) and 70 percent of responding patients had a response of 12 months or greater. The median duration of follow-up was 29 months. Measured by BICR, median PFS was 11.4 months (4.9-27.8). The six-month PFS rate was 66 percent and the 12-month rate was 48 percent. Median OS was not reached. Six-month and 12-month OS rates were 100 percent and 87 percent, respectively. The safety profile of KEYTRUDA was consistent with that observed in previously reported studies. The most common treatment-related adverse events were diarrhea (19%), hypothyroidism (13%), pneumonitis (13%), nausea (13%), fatigue (10%) and dyspnea (10%). The most common grade 3 or 4 treatment-related adverse events were colitis (3%), axillary pain (3%), AST increased (3%), joint swelling (3%), nephrotic syndrome back pain (3%) and dyspnea (3%). Adverse events leading to discontinuation were nephrotic syndrome (grade 3), interstitial lung disease (grade 2) and pneumonitis (grade 2). There were no treatment-related deaths. Hodgkin lymphoma is a type of lymphoma that develops in the white blood cells, called lymphocytes, which are part of the immune system. Hodgkin lymphoma can start almost anywhere – most often in lymph nodes in the upper part of the body, with the most common sites being in the chest, neck or under the arms. In 2016, it is estimated that more than 8,500 people will be diagnosed with Hodgkin lymphoma in the U.S.; cHL accounts for about 95 percent of all cases of Hodgkin lymphoma in developed countries. KEYTRUDA is a humanized monoclonal antibody that works by increasing the ability of the body’s immune system to help detect and fight tumor cells. KEYTRUDA blocks the interaction between PD-1 and its ligands, PD-L1 and PD-L2, thereby activating T lymphocytes which may affect both tumor cells and healthy cells. KEYTRUDA is administered as an intravenous infusion over 30 minutes every three weeks for the approved indications. KEYTRUDA for injection is supplied in a 100 mg single use vial. KEYTRUDA is indicated for the treatment of patients with unresectable or metastatic melanoma at a dose of 2 mg/kg every three weeks until disease progression or unacceptable toxicity. KEYTRUDA is indicated for the first-line treatment of patients with metastatic non-small cell lung cancer (NSCLC) whose tumors have high PD-L1 expression [tumor proportion score (TPS) ≥50%] as determined by an FDA-approved test, with no EGFR or ALK genomic tumor aberrations. KEYTRUDA is also indicated for the treatment of patients with metastatic NSCLC whose tumors express PD-L1 (TPS ≥1%) as determined by an FDA-approved test, with disease progression on or after platinum-containing chemotherapy. Patients with EGFR or ALK genomic tumor aberrations should have disease progression on FDA-approved therapy for these aberrations prior to receiving KEYTRUDA. In metastatic NSCLC, KEYTRUDA is administered at a fixed dose of 200 mg every three weeks until disease progression, unacceptable toxicity, or up to 24 months in patients without disease progression. KEYTRUDA (pembrolizumab) is indicated for the treatment of patients with recurrent or metastatic head and neck squamous cell carcinoma (HNSCC) with disease progression on or after platinum-containing chemotherapy. This indication is approved under accelerated approval based on tumor response rate and durability of response. Continued approval for this indication may be contingent upon verification and description of clinical benefit in the confirmatory trials. In HNSCC, KEYTRUDA is administered at a fixed dose of 200 mg every three weeks until disease progression, unacceptable toxicity, or up to 24 months in patients without disease progression. KEYTRUDA can cause immune-mediated pneumonitis, including fatal cases. Pneumonitis occurred in 94 (3.4%) of 2799 patients receiving KEYTRUDA, including Grade 1 (0.8%), 2 (1.3%), 3 (0.9%), 4 (0.3%), and 5 (0.1%) pneumonitis, and occurred more frequently in patients with a history of prior thoracic radiation (6.9%) compared to those without (2.9%). Monitor patients for signs and symptoms of pneumonitis. Evaluate suspected pneumonitis with radiographic imaging. Administer corticosteroids for Grade 2 or greater pneumonitis. Withhold KEYTRUDA for Grade 2; permanently discontinue KEYTRUDA for Grade 3 or 4 or recurrent Grade 2 pneumonitis. KEYTRUDA can cause immune-mediated colitis. Colitis occurred in 48 (1.7%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.4%), 3 (1.1%), and 4 (<0.1%) colitis. Monitor patients for signs and symptoms of colitis. Administer corticosteroids for Grade 2 or greater colitis. Withhold KEYTRUDA for Grade 2 or 3; permanently discontinue KEYTRUDA for Grade 4 colitis. KEYTRUDA can cause immune-mediated hepatitis. Hepatitis occurred in 19 (0.7%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.1%), 3 (0.4%), and 4 (<0.1%) hepatitis. Monitor patients for changes in liver function. Administer corticosteroids for Grade 2 or greater hepatitis and, based on severity of liver enzyme elevations, withhold or discontinue KEYTRUDA. KEYTRUDA can cause hypophysitis. Hypophysitis occurred in 17 (0.6%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.2%), 3 (0.3%), and 4 (<0.1%) hypophysitis. Monitor patients for signs and symptoms of hypophysitis (including hypopituitarism and adrenal insufficiency). Administer corticosteroids and hormone replacement as clinically indicated. Withhold KEYTRUDA for Grade 2; withhold or discontinue for Grade 3 or 4 hypophysitis. KEYTRUDA (pembrolizumab) can cause thyroid disorders, including hyperthyroidism, hypothyroidism, and thyroiditis. Hyperthyroidism occurred in 96 (3.4%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.8%) and 3 (0.1%) hyperthyroidism. Hypothyroidism occurred in 237 (8.5%) of 2799 patients receiving KEYTRUDA, including Grade 2 (6.2%) and 3 (0.1%) hypothyroidism. The incidence of new or worsening hypothyroidism was higher in patients with HNSCC occurring in 28 (15%) of 192 patients with HNSCC, including Grade 3 (0.5%) hypothyroidism. Thyroiditis occurred in 16 (0.6%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.3%) thyroiditis. Monitor patients for changes in thyroid function (at the start of treatment, periodically during treatment, and as indicated based on clinical evaluation) and for clinical signs and symptoms of thyroid disorders. Administer replacement hormones for hypothyroidism and manage hyperthyroidism with thionamides and beta-blockers as appropriate. Withhold or discontinue KEYTRUDA for Grade 3 or 4 hyperthyroidism. KEYTRUDA can cause type 1 diabetes mellitus, including diabetic ketoacidosis, which have been reported in 6 (0.2%) of 2799 patients. Monitor patients for hyperglycemia or other signs and symptoms of diabetes. Administer insulin for type 1 diabetes, and withhold KEYTRUDA and administer antihyperglycemics in patients with severe hyperglycemia. KEYTRUDA can cause immune-mediated nephritis. Nephritis occurred in 9 (0.3%) of 2799 patients receiving KEYTRUDA, including Grade 2 (0.1%), 3 (0.1%), and 4 (<0.1%) nephritis. Monitor patients for changes in renal function. Administer corticosteroids for Grade 2 or greater nephritis. Withhold KEYTRUDA for Grade 2; permanently discontinue KEYTRUDA for Grade 3 or 4 nephritis. KEYTRUDA can cause other clinically important immune-mediated adverse reactions. For suspected immune-mediated adverse reactions, ensure adequate evaluation to confirm etiology or exclude other causes. Based on the severity of the adverse reaction, withhold KEYTRUDA and administer corticosteroids. Upon improvement to Grade 1 or less, initiate corticosteroid taper and continue to taper over at least 1 month. Based on limited data from clinical studies in patients whose immune-related adverse reactions could not be controlled with corticosteroid use, administration of other systemic immunosuppressants can be considered. Resume KEYTRUDA when the adverse reaction remains at Grade 1 or less following corticosteroid taper. Permanently discontinue KEYTRUDA for any Grade 3 immune-mediated adverse reaction that recurs and for any life-threatening immune-mediated adverse reaction. The following clinically significant immune-mediated adverse reactions occurred in less than 1% (unless otherwise indicated) of 2799 patients: arthritis (1.5%), exfoliative dermatitis, bullous pemphigoid, rash (1.4%), uveitis, myositis, Guillain-Barré syndrome, myasthenia gravis, vasculitis, pancreatitis, hemolytic anemia, and partial seizures arising in a patient with inflammatory foci in brain parenchyma. KEYTRUDA (pembrolizumab) can cause severe or life-threatening infusion-related reactions, which have been reported in 6 (0.2%) of 2799 patients. Monitor patients for signs and symptoms of infusion-related reactions, including rigors, chills, wheezing, pruritus, flushing, rash, hypotension, hypoxemia, and fever. For Grade 3 or 4 reactions, stop infusion and permanently discontinue KEYTRUDA. Based on its mechanism of action, KEYTRUDA can cause fetal harm when administered to a pregnant woman. If used during pregnancy, or if the patient becomes pregnant during treatment, apprise the patient of the potential hazard to a fetus. Advise females of reproductive potential to use highly effective contraception during treatment and for 4 months after the last dose of KEYTRUDA. In KEYNOTE-006, KEYTRUDA was discontinued due to adverse reactions in 9% of 555 patients with advanced melanoma; adverse reactions leading to discontinuation in more than one patient were colitis (1.4%), autoimmune hepatitis (0.7%), allergic reaction (0.4%), polyneuropathy (0.4%), and cardiac failure (0.4%). Adverse reactions leading to interruption of KEYTRUDA occurred in 21% of patients; the most common (≥1%) was diarrhea (2.5%). The most common adverse reactions with KEYTRUDA vs ipilimumab were fatigue (28% vs 28%), diarrhea (26% with KEYTRUDA), rash (24% vs 23%), and nausea (21% with KEYTRUDA). Corresponding incidence rates are listed for ipilimumab only for those adverse reactions that occurred at the same or lower rate than with KEYTRUDA. In KEYNOTE-002, KEYTRUDA was discontinued due to adverse reactions in 12% of 357 patients with advanced melanoma; the most common (≥1%) were general physical health deterioration (1%), asthenia (1%), dyspnea (1%), pneumonitis (1%), and generalized edema (1%). Adverse reactions leading to interruption of KEYTRUDA occurred in 14% of patients; the most common (≥1%) were dyspnea (1%), diarrhea (1%), and maculopapular rash (1%). The most common adverse reactions with KEYTRUDA vs chemotherapy were fatigue (43% with KEYTRUDA), pruritus (28% vs 8%), rash (24% vs 8%), constipation (22% vs 20%), nausea (22% with KEYTRUDA), diarrhea (20% vs 20%), and decreased appetite (20% with KEYTRUDA). Corresponding incidence rates are listed for chemotherapy only for those adverse reactions that occurred at the same or lower rate than with KEYTRUDA. KEYTRUDA was discontinued due to adverse reactions in 8% of 682 patients with metastatic NSCLC. The most common adverse event resulting in permanent discontinuation of KEYTRUDA (pembrolizumab) was pneumonitis (1.8%). Adverse reactions leading to interruption of KEYTRUDA occurred in 23% of patients; the most common (≥1%) were diarrhea (1%), fatigue (1.3%), pneumonia (1%), liver enzyme elevation (1.2%), decreased appetite (1.3%), and pneumonitis (1%). The most common adverse reactions (occurring in at least 20% of patients and at a higher incidence than with docetaxel) were decreased appetite (25% vs 23%), dyspnea (23% vs 20%), and nausea (20% vs 18%). KEYTRUDA was discontinued due to adverse reactions in 17% of 192 patients with HNSCC. Serious adverse reactions occurred in 45% of patients. The most frequent serious adverse reactions reported in at least 2% of patients were pneumonia, dyspnea, confusional state, vomiting, pleural effusion, and respiratory failure. The most common adverse reactions (reported in at least 20% of patients) were fatigue, decreased appetite, and dyspnea. Adverse reactions occurring in patients with HNSCC were generally similar to those occurring in patients with melanoma or NSCLC, with the exception of increased incidences of facial edema (10% all Grades; 2.1% Grades 3 or 4) and new or worsening hypothyroidism. It is not known whether KEYTRUDA is excreted in human milk. Because many drugs are excreted in human milk, instruct women to discontinue nursing during treatment with KEYTRUDA and for 4 months after the final dose. Safety and effectiveness of KEYTRUDA have not been established in pediatric patients. Our goal is to translate breakthrough science into innovative oncology medicines to help people with cancer worldwide. At Merck, helping people fight cancer is our passion and supporting accessibility to our cancer medicines is our commitment. Our focus is on pursuing research in immuno-oncology and we are accelerating every step in the journey – from lab to clinic – to potentially bring new hope to people with cancer. As part of our focus on cancer, Merck is committed to exploring the potential of immuno-oncology with one of the fastest-growing development programs in the industry. We are currently executing an expansive research program that includes nearly 400 clinical trials evaluating our anti-PD-1 therapy across more than 30 tumor types. We also continue to strengthen our immuno-oncology portfolio through strategic acquisitions and are prioritizing the development of several promising immunotherapeutic candidates with the potential to improve the treatment of advanced cancers. For more information about our oncology clinical trials, visit www.merck.com/clinicaltrials. For 125 years, Merck has been a global health care leader working to help the world be well. Merck is known as MSD outside the United States and Canada. Through our prescription medicines, vaccines, biologic therapies, and animal health products, we work with customers and operate in more than 140 countries to deliver innovative health solutions. We also demonstrate our commitment to increasing access to health care through far-reaching policies, programs and partnerships. For more information, visit www.merck.com and connect with us on Twitter, Facebook, YouTube and LinkedIn. Forward-Looking Statement of Merck & Co., Inc., Kenilworth, N.J., USA This news release of Merck & Co., Inc., Kenilworth, N.J., USA (the “company”) includes “forward-looking statements” within the meaning of the safe harbor provisions of the U.S. Private Securities Litigation Reform Act of 1995. These statements are based upon the current beliefs and expectations of the company’s management and are subject to significant risks and uncertainties. There can be no guarantees with respect to pipeline products that the products will receive the necessary regulatory approvals or that they will prove to be commercially successful. If underlying assumptions prove inaccurate or risks or uncertainties materialize, actual results may differ materially from those set forth in the forward-looking statements. Risks and uncertainties include but are not limited to, general industry conditions and competition; general economic factors, including interest rate and currency exchange rate fluctuations; the impact of pharmaceutical industry regulation and health care legislation in the United States and internationally; global trends toward health care cost containment; technological advances, new products and patents attained by competitors; challenges inherent in new product development, including obtaining regulatory approval; the company’s ability to accurately predict future market conditions; manufacturing difficulties or delays; financial instability of international economies and sovereign risk; dependence on the effectiveness of the company’s patents and other protections for innovative products; and the exposure to litigation, including patent litigation, and/or regulatory actions. The company undertakes no obligation to publicly update any forward-looking statement, whether as a result of new information, future events or otherwise. Additional factors that could cause results to differ materially from those described in the forward-looking statements can be found in the company’s 2015 Annual Report on Form 10-K and the company’s other filings with the Securities and Exchange Commission (SEC) available at the SEC’s Internet site (www.sec.gov). Please see Prescribing Information for KEYTRUDA (pembrolizumab) at http://www.merck.com/product/usa/pi_circulars/k/keytruda/keytruda_pi.pdf and


News Article | October 27, 2016
Site: www.eurekalert.org

PHILADELPHIA - Checkpoint inhibitor drugs that boost the immune system to fight cancer owe part of their existence to infectious diseases. Microbes that cause diseases like HIV, malaria, and hepatitis C exploit and often activate the same checkpoint pathways -- cell surface receptors such as CTLA4 and PD-1 -- to slow immune cells and prevent their elimination by the host. T cells that are supposed to clear an infection, instead, become "exhausted." The cell-surface receptors naturally act like brakes to tell the immune system to not react as strongly during normal situations and help the immune system avoid damaging healthy tissue or causing autoimmunity. Blocking PD-1 can reinvigorate exhausted T cells and improve control of chronic infections and cancer. However, whether blocking PD-1 can reprogram exhausted T cells into durable memory T cells is unclear. E. John Wherry, PhD, director of the Institute for Immunology at Penn and the Barbara and Richard Schiffrin President's distinguished professor of Microbiology, in the Perelman School of Medicine at the University of Pennsylvania, and colleagues found that reinvigorating exhausted T cells in mice using a PD-L1 blockade caused very few T memory cells to develop. After the blockade, re-invigorated T cells became re-exhausted if antigen from the virus remained high, and failed to become memory T cells when the virus was cleared. They published their findings in this week's issue of Science. The team found that exhausted T cells acquired an epigenetic profile distinct from effector or memory T cells. These latter two cell types can mount effective immune responses to viruses and tumors; whereas, exhausted T cells fail and memory T cells, in particular, for long-lasting durable effects. Epigenetics is the way chemical modifications to DNA and the proteins binding DNA determine which genes are expressed by a cell type. Epigenetic profiles can be highly stable and confer long-term identity to a cell. (In other words, the reason a liver cell stays a liver cell and doesn't become a lung cell is due largely to epigenetics since both liver and lung cells have the same genes.) "What these new findings on exhausted T cells tells us is that the unique epigenetic profile of exhausted T cells causes these cells to express a different overall set of genes compared to memory or effector T cells," Wherry said. However, this epigenetic pattern was only minimally changed following the PD-L1 blockade. This prevented these exhausted T cells from changing into the more protective effector or memory cell types. "We were surprised that the exhausted T cell epigenetic profile was not reprogrammed," Wherry said. "Instead, the benefit we see after PD-1 pathway blockade is caused by only transient changes in gene expression that is not durable, rather than permanent epigenetic reprogramming." These findings suggested that exhausted T cells are a distinct lineage of T cells in and of themselves instead of just being effector or memory T cells restrained by checkpoint pathways. "We predicted that exhausted T cells would not have a distinct epigenetic profile but have the molecular flexibility to obtain immune memory," Wherry said. "But we found that exhausted T cells are quite set in their ways." "We think this shows that epigenetic fate inflexibility may limit current immunotherapies based on PD-1 checkpoint inhibitors," said first author Kristen Pauken, PhD, a postdoctoral researcher in the Wherry lab. Most cancer patients respond well to PD-1 blockades at first, but the response is not sustained. This study shows how exhausted T cells do not maintain a durable switch to an effector T cell profile, although in the clinic, checkpoint inhibitors are well tolerated and their side effects such as autoimmunity are usually manageable. This lack of durability clinically is not well characterized, but these results suggest it is likely, at least partially, due to the lack of sustained or permanent reprogramming of exhausted T cells. In a companion study also published in Science, Nick Haining, MD, and colleagues from Dana-Farber Cancer Institute, also found a distinct epigenetic landscape for exhausted T cells in mice and humans, and they were able to ascribe key functions in T cell exhaustion to some of these epigenetic changes. Wherry and Pauken are co-authors on this study. Wherry, together with his colleagues in the Parker Institute for Cancer Immunotherapy at Penn, are involved in multiple checkpoint-related trials, in melanoma, lung cancer, renal cell carcinoma, and others, including combining checkpoint blockade with radiation. The ultimate goal is to precisely understand the mechanisms of checkpoint blockade effectiveness and bring next generation, sustainable immunotherapies to even more patients, perhaps using by using epigenetic drugs in combination with checkpoint blockade to allow epigenetic reprogramming of exhausted T cells into durable and functional memory T cells. This research was funded by the Robertson Foundation/Cancer Research Institute Irvington Fellowship, an American Cancer Society Postdoctoral Fellowship, a German Research Foundation Fellowship National Institutes of Health (CA78831, AI105343, AI112521, AI082630, AI115712, AI117950, AI108545). This research was also supported by the Parker Institute for Cancer Immunotherapy. Wherry also has a patent licensing agreement on the PD-1 pathway. Penn Medicine is one of the world's leading academic medical centers, dedicated to the related missions of medical education, biomedical research, and excellence in patient care. Penn Medicine consists of the Raymond and Ruth Perelman School of Medicine at the University of Pennsylvania (founded in 1765 as the nation's first medical school) and the University of Pennsylvania Health System, which together form a $5.3 billion enterprise. The Perelman School of Medicine has been ranked among the top five medical schools in the United States for the past 18 years, according to U.S. News & World Report's survey of research-oriented medical schools. The School is consistently among the nation's top recipients of funding from the National Institutes of Health, with $373 million awarded in the 2015 fiscal year. The University of Pennsylvania Health System's patient care facilities include: The Hospital of the University of Pennsylvania and Penn Presbyterian Medical Center -- which are recognized as one of the nation's top "Honor Roll" hospitals by U.S. News & World Report -- Chester County Hospital; Lancaster General Health; Penn Wissahickon Hospice; and Pennsylvania Hospital -- the nation's first hospital, founded in 1751. Additional affiliated inpatient care facilities and services throughout the Philadelphia region include Chestnut Hill Hospital and Good Shepherd Penn Partners, a partnership between Good Shepherd Rehabilitation Network and Penn Medicine. Penn Medicine is committed to improving lives and health through a variety of community-based programs and activities. In fiscal year 2015, Penn Medicine provided $253.3 million to benefit our community.


News Article | February 27, 2017
Site: www.eurekalert.org

(PRINCETON, N.J., Feb. 27, 2017) - Bristol-Myers Squibb Company (NYSE:BMY) today announced that Columbia University Medical Center and Peter MacCallum Cancer Centre (Peter Mac) have joined the International Immuno-Oncology Network (II-ON), a global peer-to-peer collaboration between Bristol-Myers Squibb and academia that aims to advance Immuno-Oncology (I-O) science and translational medicine to improve patient outcomes. Launched in 2012 by Bristol-Myers Squibb, the II-ON was one of the first networks to bring academia and industry together to further the scientific understanding of I-O, and has expanded from 10 to 15 sites including more than 250 investigators working on over 150 projects across 20 tumor types. The II-ON has generated cutting-edge I-O data that have informed the development of new I-O agents, yielded publications and produced some of the earliest findings on a variety of biomarkers and target identification and validation. "Bristol-Myers Squibb has long believed the future of cancer research is dependent on investments in science and partnerships. We formed the II-ON to facilitate innovation in I-O science and drug discovery by providing a streamlined framework for peer-to-peer collaboration among global cancer research leaders," said Nils Lonberg, Head of Oncology Biology Discovery at Bristol-Myers Squibb. "The significant discoveries generated by the II-ON over the past five years have not only informed our robust early I-O pipeline, but also serve to advance the entire field. We are proud to collaborate with Columbia University Medical Center and Peter Mac, and together with the entire II-ON will continue to lead pioneering research and heighten our collective understanding of the science behind I-O." Through the II-ON, Bristol-Myers Squibb is collaborating with leading cancer research institutions around the world to generate innovative I-O science, launch biology-driven trials and seek out cutting-edge technologies with the goal of translating research findings into clinical trials and, ultimately, clinical practice. "I-O research may be transforming the way we treat cancer," said Charles G. Drake, MD, PhD, Professor of Medicine at Columbia University Medical Center and Director of Genitourinary Oncology and Associate Director for Clinical Research at the Herbert Irving Comprehensive Cancer Center at New York-Presbyterian/Columbia. "The II-ON offers a tremendous opportunity to work smarter and faster along with our colleagues to address fundamental scientific questions in I-O." "We believe the collective knowledge and research power of the II-ON will generate groundbreaking findings in I-O with the potential to improve outcomes for people affected by cancer," said Professor Joe Trapani, Executive Director Cancer Research and Head of the Cancer Immunology Program at Peter MacCallum Cancer Centre, Melbourne, Australia. Building on the success of the II-ON, Bristol-Myers Squibb has invested in several other models of scientific collaboration with academic partners across the globe, including the Global Expert Centers Initiative (GECI) and the Immuno-Oncology Integrated Community Oncology Network (IO-ICON). "We believe a one-size-fits-all research approach does not facilitate innovation," said Lonberg. "Our tailored collaborations with academic centers expand our research capabilities and accelerate our collective ability to deliver potentially life-changing results for patients." The II-ON, formed in 2012, is a global peer-to-peer collaboration between Bristol-Myers Squibb and academia advancing the science of Immuno-Oncology (I-O) through a series of preclinical, translational and biology-focused research objectives. The research in the collaboration is focused on three fundamental scientific pillars: understanding the mechanisms of resistance to immunotherapy; identifying patient populations likely to benefit from immunotherapy; and exploring novel combination therapies that may enhance anti-tumor response through complementary mechanisms of action. The II-ON facilitates the translation of scientific research findings into drug discovery and development, with the goal of introducing new treatment options into clinical practice. In addition to Bristol-Myers Squibb, the II-ON currently comprises 15 leading cancer research institutions, including: Clinica Universidad Navarra, Dana-Farber Cancer Institute, The Earle A. Chiles Research Institute (Providence Health & Services), Institut Gustave Roussy, Istituto Nazionale per lo Studio e la Cura dei Tumori "Fondazione G. Pascale", Bloomberg-Kimmel Institute for Cancer Immunotherapy at the Johns Hopkins Kimmel Cancer Center, Memorial Sloan Kettering Cancer Center, National Cancer Center Japan, The Netherlands Cancer Institute, The Royal Marsden NHS Foundation Trust and The Institute of Cancer Research, University College London, The University of Chicago, West German Cancer Center/University Hospital Essen, and now Columbia University Medical Center and Peter MacCallum Cancer Centre. Bristol-Myers Squibb: At the Forefront of Immuno-Oncology Science & Innovation At Bristol-Myers Squibb, patients are at the center of everything we do. Our vision for the future of cancer care is focused on researching and developing transformational Immuno-Oncology (I-O) medicines that will raise survival expectations in hard-to-treat cancers and will change the way patients live with cancer. We are leading the scientific understanding of I-O through our extensive portfolio of investigational and approved agents - including the first combination of two I-O agents in metastatic melanoma - and our differentiated clinical development program, which is studying broad patient populations across more than 20 types of cancers with 12 clinical-stage molecules designed to target different immune system pathways. Our deep expertise and innovative clinical trial designs uniquely position us to advance the science of combinations across multiple tumors and potentially deliver the next wave of I-O combination regimens with a sense of urgency. We also continue to pioneer research that will help facilitate a deeper understanding of the role of immune biomarkers and inform which patients will benefit most from I-O therapies. We understand making the promise of I-O a reality for the many patients who may benefit from these therapies requires not only innovation on our part, but also close collaboration with leading experts in the field. Our partnerships with academia, government, advocacy and biotech companies support our collective goal of providing new treatment options to advance the standards of clinical practice. Bristol-Myers Squibb is a global biopharmaceutical company whose mission is to discover, develop and deliver innovative medicines that help patients prevail over serious diseases. For more information about Bristol-Myers Squibb, visit us at BMS.com or follow us on LinkedIn, Twitter, YouTube and Facebook. This press release contains "forward-looking statements" as that term is defined in the Private Securities Litigation Reform Act of 1995 regarding the research, development and commercialization of pharmaceutical products. Such forward-looking statements are based on current expectations and involve inherent risks and uncertainties, including factors that could delay, divert or change any of them, and could cause actual outcomes and results to differ materially from current expectations. No forward-looking statement can be guaranteed. Forward-looking statements in this press release should be evaluated together with the many uncertainties that affect Bristol-Myers Squibb's business, particularly those identified in the cautionary factors discussion in Bristol-Myers Squibb's Annual Report on Form 10-K for the year ended December 31, 2016 in our Quarterly Reports on Form 10-Q and our Current Reports on Form 8-K. Bristol-Myers Squibb undertakes no obligation to publicly update any forward-looking statement, whether as a result of new information, future events or otherwise.


PRINCETON, N.J.--(BUSINESS WIRE)--Bristol-Myers Squibb Company (NYSE:BMY) today announced that Columbia University Medical Center and Peter MacCallum Cancer Centre (Peter Mac) have joined the International Immuno-Oncology Network (II-ON), a global peer-to-peer collaboration between Bristol-Myers Squibb and academia that aims to advance Immuno-Oncology (I-O) science and translational medicine to improve patient outcomes. Launched in 2012 by Bristol-Myers Squibb, the II-ON was one of the first networks to bring academia and industry together to further the scientific understanding of I-O, and has expanded from 10 to 15 sites including more than 250 investigators working on over 150 projects across 20 tumor types. The II-ON has generated cutting-edge I-O data that have informed the development of new I-O agents, yielded publications and produced some of the earliest findings on a variety of biomarkers and target identification and validation. “Bristol-Myers Squibb has long believed the future of cancer research is dependent on investments in science and partnerships. We formed the II-ON to facilitate innovation in I-O science and drug discovery by providing a streamlined framework for peer-to-peer collaboration among global cancer research leaders,” said Nils Lonberg, Head of Oncology Biology Discovery at Bristol-Myers Squibb. “The significant discoveries generated by the II-ON over the past five years have not only informed our robust early I-O pipeline, but also serve to advance the entire field. We are proud to collaborate with Columbia University Medical Center and Peter Mac, and together with the entire II-ON will continue to lead pioneering research and heighten our collective understanding of the science behind I-O.” Through the II-ON, Bristol-Myers Squibb is collaborating with leading cancer research institutions around the world to generate innovative I-O science, launch biology-driven trials and seek out cutting-edge technologies with the goal of translating research findings into clinical trials and, ultimately, clinical practice. “I-O research may be transforming the way we treat cancer,” said Charles G. Drake, MD, PhD, Professor of Medicine at Columbia University Medical Center and Director of Genitourinary Oncology and Associate Director for Clinical Research at the Herbert Irving Comprehensive Cancer Center at New York-Presbyterian/Columbia. “The II-ON offers a tremendous opportunity to work smarter and faster along with our colleagues to address fundamental scientific questions in I-O.” “We believe the collective knowledge and research power of the II-ON will generate groundbreaking findings in I-O with the potential to improve outcomes for people affected by cancer,” said Professor Joe Trapani, Executive Director Cancer Research and Head of the Cancer Immunology Program at Peter MacCallum Cancer Centre, Melbourne, Australia. Building on the success of the II-ON, Bristol-Myers Squibb has invested in several other models of scientific collaboration with academic partners across the globe, including the Global Expert Centers Initiative (GECI) and the Immuno-Oncology Integrated Community Oncology Network (IO-ICON). "We believe a one-size-fits-all research approach does not facilitate innovation,” said Lonberg. “Our tailored collaborations with academic centers expand our research capabilities and accelerate our collective ability to deliver potentially life-changing results for patients." The II-ON, formed in 2012, is a global peer-to-peer collaboration between Bristol-Myers Squibb and academia advancing the science of Immuno-Oncology (I-O) through a series of preclinical, translational and biology-focused research objectives. The research in the collaboration is focused on three fundamental scientific pillars: understanding the mechanisms of resistance to immunotherapy; identifying patient populations likely to benefit from immunotherapy; and exploring novel combination therapies that may enhance anti-tumor response through complementary mechanisms of action. The II-ON facilitates the translation of scientific research findings into drug discovery and development, with the goal of introducing new treatment options into clinical practice. In addition to Bristol-Myers Squibb, the II-ON currently comprises 15 leading cancer research institutions, including: Clinica Universidad Navarra, Dana-Farber Cancer Institute, The Earle A. Chiles Research Institute (Providence Health & Services), Institut Gustave Roussy, Istituto Nazionale per lo Studio e la Cura dei Tumori “Fondazione G. Pascale”, Bloomberg-Kimmel Institute for Cancer Immunotherapy at the Johns Hopkins Kimmel Cancer Center, Memorial Sloan Kettering Cancer Center, National Cancer Center Japan, The Netherlands Cancer Institute, The Royal Marsden NHS Foundation Trust and The Institute of Cancer Research, University College London, The University of Chicago, West German Cancer Center/University Hospital Essen, and now Columbia University Medical Center and Peter MacCallum Cancer Centre. Bristol-Myers Squibb: At the Forefront of Immuno-Oncology Science & Innovation At Bristol-Myers Squibb, patients are at the center of everything we do. Our vision for the future of cancer care is focused on researching and developing transformational Immuno-Oncology (I-O) medicines that will raise survival expectations in hard-to-treat cancers and will change the way patients live with cancer. We are leading the scientific understanding of I-O through our extensive portfolio of investigational and approved agents – including the first combination of two I-O agents in metastatic melanoma – and our differentiated clinical development program, which is studying broad patient populations across more than 20 types of cancers with 12 clinical-stage molecules designed to target different immune system pathways. Our deep expertise and innovative clinical trial designs uniquely position us to advance the science of combinations across multiple tumors and potentially deliver the next wave of I-O combination regimens with a sense of urgency. We also continue to pioneer research that will help facilitate a deeper understanding of the role of immune biomarkers and inform which patients will benefit most from I-O therapies. We understand making the promise of I-O a reality for the many patients who may benefit from these therapies requires not only innovation on our part, but also close collaboration with leading experts in the field. Our partnerships with academia, government, advocacy and biotech companies support our collective goal of providing new treatment options to advance the standards of clinical practice. Bristol-Myers Squibb is a global biopharmaceutical company whose mission is to discover, develop and deliver innovative medicines that help patients prevail over serious diseases. For more information about Bristol-Myers Squibb, visit us at BMS.com or follow us on LinkedIn, Twitter, YouTube and Facebook. This press release contains “forward-looking statements” as that term is defined in the Private Securities Litigation Reform Act of 1995 regarding the research, development and commercialization of pharmaceutical products. Such forward-looking statements are based on current expectations and involve inherent risks and uncertainties, including factors that could delay, divert or change any of them, and could cause actual outcomes and results to differ materially from current expectations. No forward-looking statement can be guaranteed. Forward-looking statements in this press release should be evaluated together with the many uncertainties that affect Bristol-Myers Squibb’s business, particularly those identified in the cautionary factors discussion in Bristol-Myers Squibb’s Annual Report on Form 10-K for the year ended December 31, 2016 in our Quarterly Reports on Form 10-Q and our Current Reports on Form 8-K. Bristol-Myers Squibb undertakes no obligation to publicly update any forward-looking statement, whether as a result of new information, future events or otherwise.


NUR FÜR MEDIEN IN EMEA-LÄNDERN - NICHT FÜR MEDIEN IN SCHWEIZ/ÖSTERREICH/USA Die neuen Interimsdaten, die heute auf dem San Antonio Breast Cancer Symposium (SABCS), Texas (USA), vorgestellt wurden, liefern erste Hinweise für die Effektivität der Anwendung von Halaven® (Eribulin) in Kombination mit Pembrolizumab bei Patienten mit metastasiertem, triple-negativem Brustkrebs.[1] Eribulin ist ein Wirkstoff aus der Klasse der Halichondrine. Es wird zur Behandlung von erwachsenen Patienten mit lokal fortgeschrittenem oder metastasiertem Brustkrebs, bei denen nach mindestens einer Chemotherapie eine weitere Progression eingetreten ist, eingesetzt. Die primäre Wirkung von Eribulin beruht auf der Inhibition der Mikrotubuli-Dynamik, darüber hinaus verändert Eribulin das Microenvironment des Tumors hinsichtlich einer Reorganisation der Tumorvaskulatur. Bei Pembrolizumab handelt es sich um einen humanisierten monoklonalen Immunglobulin- (Ig) G4-Antikörper, der gegen den humanen PD-1-Rezeptor an der Zelloberfläche gerichtet ist und möglicherweise als Immuncheckpoint-Inhibitor wirkt. Zusätzlich gibt es Hinweise auf eine antineoplastische Wirkung. "Eisai ist ein in der Onkologie führendes und anerkanntes Unternehmen, das sich als Partner zur Entwicklung innovativer Therapieansätze etabliert hat. Eribulin bietet sich aufgrund seiner multiplen Wirkweise (Mitosehemmung und Veränderung des Tumor-Mikromilieus) als attraktiver Partner für Kombinationsbehandlungen an", kommentiert Alton Kremer, MD, PhD, Chief Clinical Officer und Chief Medical Officer, Oncology Business Group bei Eisai. In der Europäischen Union ist Eribulin zur Behandlung von erwachsenen Patienten mit lokal fortgeschrittenem oder metastasiertem Brustkrebs zugelassen, bei denen nach mindestens einer Chemotherapie zur Behandlung der fortgeschrittenen Brustkrebserkrankung eine weitere Progression eingetreten ist. Die Vortherapien sollen ein Anthrazyklin oder ein Taxan entweder als adjuvante Therapie oder im Rahmen der metastasierten Situation erhalten haben, es sei denn, diese Behandlungen waren ungeeignet für den Patienten.[2] Pembrolizumab wird derzeit ist nicht für die Behandlung von metastasiertem, triple-negativem Brustkrebs geprüft. "In präklinischen und translationalen Studien induzierte Eribulin eine Remodellierung der Tumorvaskulatur, einhergehend mit einer Verringerung der Hypoxie im Tumorgewebe. Eribulin kehrte außerdem die EMT (Epithelial-Mesenchymale-Transition) der Tumorzellen um. Wir stellten daher die Hypothese auf, dass diese Wirkungen von Eribulin auf die Tumorbiologie und die Tumor-Mikroumgebung zu einer erhöhten Verfügbarkeit des Immuncheckpoint-Inhibitors Pembrolizumab bei metastasiertem, triple-negativem Brustkrebs führen und darüber hinaus die T-Zellen des Immunsystems zusätzlich befähigen können, Tumorzellen zu erfassen und anzugreifen", kommentiert Sara Tolaney, MD, MPH, Medical Oncologist, Dana-Farber Cancer Institute, Boston. Anlässlich des SABCS werden die aktuellen Daten einer offenen, einarmigen, multizentrischen Phase Ib/II-Studie zur Behandlung mit Eribulin in Kombination mit Pembrolizumab bei 95 Patienten mit metastasiertem, triple-negativem Brustkrebs vorgestellt. Die in dieser Studie eingeschlossenen Patienten wurden zuvor mit bis zu zwei Chemotherapielinien behandelt. Als primäre Endpunkte der Studie dienten in der Phase-I die Beurteilung der Sicherheit der Kombinationstherapie und in der Phase-II die objektive Ansprechrate. Als sekundäre Endpunkte wurden progressionsfreies Überleben, Gesamtüberleben und Dauer des Ansprechens gewählt.[1] Eine vorgeplante Zwischenanalyse wird auf dem diesjährigen SABCS vorgestellt. Eine Interimsanalyse von 39 auswertbaren Patienten, welche mit der Kombinationstherapie behandelt werden, zeigen eine Gesamtansprechrate von 33,3 %. Ein Patient hatte eine vollständige Remission, und zwölf Patienten zeigten partielle Remission. Darüber hinaus war die Gesamtansprechrate zwischen PD-L1-positiven und -negativen Kohorten vergleichbar. Die häufigsten therapiebedingten Nebenwirkungen (Häufigkeit höher oder gleich 35 %) bei der Kombinationstherapie waren Fatigue(74,4 %), Übelkeit             (51,3 %), periphere Neuropathie (43,6 %), Neutropenie (38,5 %) und Haarausfall(35,9 %), wobei therapiebedingte Nebenwirkungen des Grades 3 und höher bei 66,7 % der Patienten beobachtet wurden. Die zwei am häufigsten beobachteten therapiebedingten Nebenwirkungen des Grades 3 und 4 waren Neutropenie (30,8 %) und Fatigue (7,7 %).[1] Eine weitere Präsentation anlässlich des SABCS behandelt das Design einer Phase-Ib/II-Studie von Eribulin in Kombination mit PEGylierter rekombinanter humaner Hyaluronidase (PEGPH20). In dieser randomisierten globalen Studie werden etwa 114 Patienten mit metastasiertem, humanem epidermalem Wachstumsfaktor-Rezeptor 2-negativem (HER2-) Brustkrebs mit hohen Hyaluronsäurekonzentrationen rekrutiert.[3] Als primärer Endpunkt der Phase-II-Studie dient die objektive Ansprechrate. Sekundäre Endpunkte sind u. a. das progressionsfreie Überleben und das Gesamtüberleben.[3]Diese Studie rekrutiert derzeit Patienten. Die kontinuierliche Weiterentwicklung des Onkologieportfolios unterstreicht Eisais Philosophie der human health care (hhc). Diese setzt sich als Ziel, innovative Lösungen zur Prävention und zur Therapie von Krankheiten sowie zum Schutz der Gesundheit von Menschen auf der ganzen Welt bereitzustellen. Eisai engagiert sich im Therapiegebiet der Onkologie und widmet sich den noch nicht erfüllten medizinischen Bedürfnissen von Menschen mit Krebs und deren Angehörigen. In einer offenen, einarmigen, multizentrischen Ib/II-Studie wurde Eribulin in Kombination mit Pembrolizumab bei 95 Patienten mit metastasiertem Brustkrebs untersucht, die zuvor bis zu zwei Chemotherapielinien durchlaufen haben. Der primäre Endpunkt der Phase-II-Studie war die objektive Ansprechrate. Sekundäre Endpunkte waren u. a. das progressionsfreie Überleben, das Gesamtüberleben und die Dauer des Ansprechens. In dieser Studie waren die häufigsten unerwünschten Ereignisse mit Schweregrad ≥ 3 Neutropenie (31 %) und Fatigue (8 %). Schwerwiegende (nicht tödliche) unerwünschte Ereignisse traten bei 36 % der Patienten auf. Unerwünschte Ereignisse, die zu einer Dosisreduktion führten, wurden bei 56 % der Patienten beobachtet. Jährlich wird bei mehr als 300.000 Frauen in Europa Brustkrebs diagnostiziert. Etwa jede Dritte entwickelt in der Folge die metastasierte Form der Krankheit.[4] In diesem fortgeschrittenen Stadium breitet sich der Krebs über die Brust hinaus auf andere Körperteile aus.[5] Eribulin ist der erste Wirkstoff mit neuartigem Wirkmechanismus aus der Klasse der Halichondrin-ähnlichen Inhibitoren der Mikrotubuli-Dynamik. Strukturell handelt es sich bei Eribulin um ein vereinfachtes, vollsynthetisches Analogon von Halichondrin B, einem Naturprodukt, das aus dem Meeresschwamm Halichondria okadaiisoliert wird. Eribulin hat eine antiproliferative Wirkung auf Krebszellen, indem es die Wachstumsphase der Mikrotubuli-Dynamik hemmt und letztendlich die Zellteilung verhindert und somit zum Zelltod führt. Darüber hinaus deuten präklinische und translationale Studien zu fortgeschrittenem Brustkrebs darauf hin, dass Eribulin eine signifikante Wirkung auf die Tumorbiologie und das Tumormikromilieu hat.[6],[7] Die Europäische Kommission hat im Mai 2016 eine Änderung der Marktzulassung von Eribulin genehmigt. Demnach ist Eribulin nun auch für erwachsene Patienten mit nicht resezierbarem Liposarkom zugelassen, die wegen einer fortgeschrittenen oder metastasierten Tumorerkrankung eine Vortherapie mit Anthrazyklin (sofern sie geeignet war) erhalten haben. Pembrolizumab wird unter dem Namen Keytruda® von Merck, Sharp & Dohme, einer Tochtergesellschaft von Merck $ Co., Inc., Kenilworth, NJ, USA  (außerhalb der USA und Kanadas als MSD bekannt) in der Europäischen Union vertrieben. Pembrolizumab ist als Monotherapie zur Behandlung des fortgeschrittenen (nicht resezierbaren oder metastasierenden) Melanoms bei Erwachsenen angezeigt. Pembrolizumab ist zudem zur Behandlung des lokal fortgeschrittenen oder metastasierenden nicht-kleinzelligen Lungenkarzinoms (NSCLC) mit PD-L1 exprimierenden Tumoren nach mindestens einer vorherigen Chemotherapie bei Erwachsenen angezeigt. Patienten mit EGFR- oder ALK- positiven Tumormutationen sollten vor der Therapie mit Pembrolizumab bereits eine für diese Mutationen zugelassene Therapie erhalten haben. PEGPH20 (PEGylierte rekombinante humane Hyaluronidase) ist ein neues, intravenös verabreichtes Prüfpräparat, das auf den Abbau von Hyaluronsäure (HA), einer Hauptkomponente der extrazellulären Matrix, abzielt. [8] Es könnte in der Lage sein, das Stroma in Tumoren mit hohen Hyaluronsäurekonzentationen umzubauen, um damit den Zugang und die Wirksamkeit von Chemotherapeutika zu verbessern.[9],[10] Eisai engagiert sich in der Entwicklung und Bereitstellung neuer Behandlungen mit hohem Nutzen für Menschen mit Krebs. Die Entwicklung therapeutischer Optionen in der Onkologie ist ein strategisch wichtiges Geschäftsfeld von Eisai in Europa, Nahost, Afrika, Russland und Ozeanien (EMEA). In der Europäischen Union bietet Eisai aktuell drei zugelassene Präparate für vier Indikationen an: Eisai Co., Ltd. ist ein führendes, weltweit agierendes forschungs- und entwicklungsorientiertes (F&E) Pharmaunternehmen mit Hauptsitz in Japan. Eisai hat sein Unternehmensleitbild wie folgt definiert: Im Mittelpunkt stehen die Patienten und ihre Angehörigen sowie die Verbesserung der Gesundheitsfürsorge - wir nennen dies unsere "human health care (hhc)"-Philosophie. Mit mehr als 10.000 Mitarbeiterinnen und Mitarbeitern in unserem weltweiten Netzwerk von Forschungs- und Entwicklungseinrichtungen, Produktionsstätten und Vertriebsniederlassungen arbeiten wir an der Verwirklichung unserer hhc-Philosophie, indem wir innovative Produkte in verschiedenen therapeutischen Bereichen anbieten, in denen ein hoher ungedeckter medizinischer Bedarf besteht, wie etwa der Onkologie und der Neurologie. Als global tätiges pharmazeutisches Unternehmen engagieren wir uns gemäß unserem Unternehmensleitbild für Patienten überall auf der Welt - durch Investitionen und Beteiligungen an partnerschaftlichen Initiativen zur Verbesserung des Zugangs zu Arzneimitteln in Entwicklungs- und Schwellenländern. Weitere Informationen zu Eisai Co., Ltd. finden Sie unter http://www.eisai.com. 3. Alvarez H, Savulsky C, et al. A randomized, open-label, multicenter, phase Ib/II study of eribulin mesylate in combination with PEGylated recombinant human hyaluronidase in patients with human epidermal growth factor receptor 2-negative, high-hyaluronan metastatic breast cancer. San Antonio Breast Cancer Symposium (SABCS) Meeting 2016, Poster#: OT2-02-02 4. World Health Organisation. Atlas of Health in Europe. 2003. World Health Organization, Regional Office of Europe, Copenhagen, Denmark. 6. Ueda S, et al. In vivo imaging of eribulin-induced reoxygenation in advanced breast cancer patients: a comparison to bevacizumab. Br J Cancer. 2016;114:1212-1218. 7. Goto W, Kashiwagi S, Asano Y, et al. Clinical verification of antitumor autoimmune response in eribulin chemotherapy for breast cancer [abstract]. In: Proceedings of the 97th Annual Meeting of the American Association for Cancer Research; 2006 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; 2006. Abstract nr 5127.


News Article | December 12, 2016
Site: www.prnewswire.co.uk

Nuevos datos provisionales de un estudio en fase Ib/II sobre el cáncer de mama avanzado o metastásico triple negativo que investiga la combinación de Halaven® (eribulina)con pembrolizumab como inmunoterapia SOLO PARA LOS MEDIOS DE LA REGIÓN EMEA; NO PARA LOS MEDIOS SUIZOS/AUSTRIACOS/ESTADOUNIDENSES Los nuevos datos presentados hoy en el Simposio sobre Cáncer de Mama de San Antonio (SABCS, San Antonio Breast Cancer Symposium), Texas, EE. UU., aportan datos provisionales sobre el uso de Halaven® (eribulina) con pembrolizumab en pacientes con cáncer de mama metastásico triple negativo.[1] El estudio combina eribulina, un agente de quimioterapia aprobado para el uso con un solo agente en cáncer de mama avanzado o metastásico previamente tratado y el primer inhibidor de la dinámica de los microtúbulos de la clase de las halicondrinas, con pembrolizumab, el inhibidor de punto de control PD-1 que es un anticuerpo monoclonal humanizado de tipo inmunoglobulina G4 dirigido contra el receptor de la membrana celular PD-1 humano. «Eisai es una compañía que ha emergido rápidamente como líder en oncología. Los múltiples mecanismos de acción de eribulina la convierte en un socio atractivo para la investigación en combinación con otros tratamientos», comenta el Dr. Alton Kremer, Director Clínico y Director Médico, Grupo Oncológico de Eisai. En la Unión Europea eribulina está indicada para el tratamiento de pacientes adultos con cáncer de mama localmente avanzado o metastásico, que ha progresado tras al menos un régimen quimioterapéutico para la enfermedad avanzada. El tratamiento previo debe haber incluido una antraciclina y un taxano, en el contexto metastásico o adyuvante, a menos que estos tratamientos no fueran adecuados para las pacientes.[2] Pembrolizumab está en fase de investigación para el tratamiento del cáncer de mama metastásico triple negativo. «En estudios preclínicos y traslacionales, eribulina indujo remodelación vascular del tumor, reducción de la hipoxia y promoción del fenotipo epitelial menos agresivo en los tejidos tumorales de las pacientes con cáncer de mama avanzado. Nuestra hipótesis es que estos efectos de la eribulina en la biología y el microambiente tumoral pueden aumentar la acción farmacológica del inhibidor de puntos de control inmunitario, pembrolizumab, en cáncer de mama metastásico triple negativo y permitir a las células T del sistema inmunitario detectar y atacar a las células tumorales», comenta Sara Tolaney, MD, MPH, Directora Adjunta del Dana-Farber Cancer Institute, Boston. Un estudio en fase Ib/II, multicéntrico, de una sola rama y abierto está investigando la combinación de eribulina y pembrolizumab en 95 pacientes con cáncer de mama metastásico triple negativo previamente tratadas con hasta dos líneas de quimioterapia. El criterio de valoración principal del estudio en la fase I es evaluar la seguridad de la combinación, mientras que el objetivo en la fase II es establecer la tasa de respuesta y los criterios de valoración secundarios son la supervivencia libre de progresión, la supervivencia global y la duración de la respuesta.[1] En esta reunión se presenta un análisis preplanificado provisional. En el SABCS se presentan los datos de un análisis preliminar de 39 pacientes evaluables tratados con el régimen de combinación que muestran una tasa de respuestas objetivas del 33,3%. Un paciente consiguió una respuesta completa y doce más mostraron una respuesta parcial. Además, la tasa de respuestas objetivas fue similar en las cohortes con expresión positiva y negativa de PD-L1. Las reacciones adversas emergentes durante el tratamiento más frecuentes (incidencia igual o superior al 35%) con el régimen de combinación fueron fatiga (74,4%), náuseas (51,3%), neuropatía periférica (43,6%), neutropenia (38,5%) y alopecia (35,9%), observándose reacciones adversas emergentes del tratamiento (RAET) de Grado 3 o superior en el 66,7% de los pacientes. Las dos RAET de grado 3 o superior observadas con mayor frecuencia fueron neutropenia (30,8%) y fatiga (7,7%)[1]. También se presenta en SABCS el diseño de un estudio en fase Ib/II de eribulina en combinación con hialuronidasa humana recombinante PEGilada (PEGPH20). Se trata de un estudio global y aleatorizado que reclutará hasta 114 pacientes con cáncer de mama metastásico negativo para la expresión del receptor 2 del factor de crecimiento (HER-2) y elevada expresión de en ácido hialurónico.[3] El criterio de valoración principal del estudio en fase II será la tasa de respuesta objetiva y los criterios de valoración secundarios incluirán la supervivencia libre de progresión y la supervivencia global.[3] Este estudio está en fase de reclutamiento actualmente. El continuo desarrollo de su cartera oncológica refuerza la misión human health care (hhc) de Eisai, el compromiso de la compañía con el diseño de soluciones innovadoras para la prevención, cura y asistencia de enfermedades de modo que contribuyan a la salud y al bienestar de las personas de todo el mundo. Eisai está comprometida con el área terapéutica de la oncología y con la atención de las necesidades médicas insatisfechas de los pacientes con cáncer y sus familias. Estudio en fase Ib/II para evaluar el mesilato de eribulina en combinación con pembrolizumab en pacientes con cáncer de mama metastásico triple negativo; Tolaney et al (Póster n.º: P5-15-02).[1] El estudio en fase Ib/II, multicéntrico, de una sola rama y abierto investigó la combinación de eribulina y pembrolizumab en 106 pacientes con cáncer de mama metastásico previamente tratadas con hasta dos líneas de quimioterapia. El criterio de valoración principal del estudio en fase II fue la tasa de respuesta objetiva y los criterios de valoración secundarios incluyeron la supervivencia libre de progresión, la supervivencia global y la duración de la respuesta. En este estudio, los acontecimientos adversos más frecuentes de grado 3 o superior incluyeron neutropenia (31%) y fatiga (8%). Se produjeron acontecimientos adversos graves (no mortales) en el 36% de los pacientes y en el 56% de los pacientes se observaron acontecimientos adversos que requirireron un ajuste de dosis. Cada año, se diagnostica cáncer de mama a más de 300.000 mujeres en Europa y aproximadamente un tercio desarrolla posteriormente enfermedad metastásica.[4] En esta etapa avanzada, el cáncer se extiende fuera del pecho afectando a otras partes del organismo.[5] Eribulina es el primer inhibidor de la dinámica de los microtúbulos de la clase de las halicondrinas y cuenta con un novedoso mecanismo de acción. Eribulina es un análogo estructuralmente simplificado y totalmente sintético de la halicondrina B, un producto natural presente en la esponja marina Halichondria okadai. Eribulina ejerce un efecto antiproliferativo sobre las células cancerosas mediante la inhibición de la fase de crecimiento de la dinámica de los microtúbulos, lo que en última instancia impide la división celular y conduce a la muerte celular de las células cancerígenas. Además, estudios preclínicos y traslacionales del cáncer de mama también sugieren importantes efectos no mitóticos en la biología y el microentorno tumoral.[6],[7] La Comisión Europea aprobó en mayo de 2016 una variación de la Autorización de Comercialización de eribulina para pacientes adultos con liposarcomas no extirpables que han recibido un tratamiento previo con antraciclina (salvo que no resultase adecuado) para la enfermedad metastásica o avanzada. La PEGPH20 (hialuronidasa humana recombinante PEGilada) es un nuevo fármaco de investigación administrado por vía intravenosa cuyo objetivo es la degradación del ácido hialurónico (HA), componente principal de la matriz extracelular. PEGPH20 (hialuronidasa humana pegilada recombinante) es un nuevo agente dirigido frente a una diana que degrada el ácido hialurónico (AH) del microambiente tumoral.[8] PEGPH20 puede remodear el estroma de los tumores con alto contenido en AH para aumentar la penetración y la eficacia de los tratamientos antitumorales.[9],[10] En la Unión Europea, pembrolizumab es comercializado con la marca Keytruda® por Merck, Sharp & Dohme Corp., una filial de Merck & Co., Inc., Kenilworth, Nueva Jersey, EE.UU. (conocida como MSD fuera de los EE.UU y Canadá). Pembrolizumab como monoterapia está indicado para el tratamiento de melanoma avanzado (no extirpable y metastásico) en adultos. Pembrolizumab también está indicado para el tratamiento del carcinoma de pulmón no microcítico (CPNM) metastásico o localmente avanzado en adultos cuyos tumores expresan PD-L1 y que han recibido al menos un régimen de quimioterapia previo. Los pacientes con mutaciones tumorales EGFR o ALK positivas también deben haber recibido el tratamiento aprobado para estas mutaciones antes del tratamiento con pembrolizumab. Eisai está comprometida con el desarrollo y la comercialización de nuevos tratamientos beneficiosos para las personas que padecen cáncer. El desarrollo de opciones terapéuticas en oncología es una de las principales áreas estratégicas de Eisai en Europa, Oriente Medio, África, Rusia y Oceanía (EMEA). En la Unión Europea, Eisai cuenta actualmente con tres tratamientos comercializados para cuatro indicaciones: Eisai Co., Ltd. es una compañía farmacéutica líder mundial basada en la investigación y el desarrollo que tiene su sede en Japón. Definimos nuestra misión corporativa como "pensar ante todo en los pacientes y en sus familias y mejorar los beneficios que proporciona la asistencia sanitaria", a lo que llamamos filosofía human health care (hhc). Los más de 10.000 empleados que integran nuestra red global de instalaciones de I+D, centros de fabricación y filiales de comercialización trabajan por materializar nuestra filosofía hhc a través de productos innovadores en diferentes áreas terapéuticas que presentan grandes necesidades médicas no cubiertas, incluidas la oncología y la neurología. Como compañía farmacéutica global, nuestra misión se dirige a pacientes de todo el mundo, mediante nuestra inversión y participación en iniciativas basadas en la colaboración que buscan mejorar el acceso a los medicamentos en los países en desarrollo y emergentes.


FOR EMEA MEDIA ONLY - NOT FOR SWISS/AUSTRIAN/US JOURNALISTS New interim data presented today at the San Antonio Breast Cancer Symposium (SABCS), Texas, USA, investigate the use of Halaven® (eribulin) with pembrolizumab in patients with metastatic triple negative breast cancer.[1] The study combines eribulin, a chemotherapy agent approved for single-agent use in pretreated advanced or metastatic breast cancer and the first in the halichondrin class of microtubule dynamics inhibitors, with pembrolizumab the PD-1 checkpoint inhibitor which is a humanised monoclonal immunoglobulin (Ig) G4 antibody directed against human cell surface receptor PD-1. "Eisai is a company others want to work with and has quickly emerged as a leader in oncology. Eribulin's multiple mechanisms of action make it a compelling partner to investigate in combination with other treatments," comments Alton Kremer, M.D., Ph.D., Chief Clinical Officer and Chief Medical Officer, Oncology Business Group at Eisai. Eribulin is indicated in the European Union for the treatment of adults with locally advanced or metastatic breast cancer who have progressed after at least one chemotherapeutic regimen for advanced disease. Prior therapy should have included an anthracycline and a taxane in either the adjuvant or metastatic setting unless patients were not suitable for these treatments.[3] Pembrolizumab is under investigation for the treatment of metastatic triple negative breast cancer. "In preclinical and translational studies, eribulin induced tumour vascular remodeling, reduction of hypoxia and promotion of the less aggressive epithelial phenotype in advanced breast cancer tumour tissue. We hypothesised that these effects of eribulin on tumour biology and microenvironment may increase the drug delivery of immune checkpoint inhibitor, pembrolizumab, in metastatic triple negative breast cancer and further enhance the possibility that pembrolizumab would enable the immune system's T cells to detect and attack tumour cells," comments Sara Tolaney, MD, MPH, Medical Oncologist, Dana-Farber Cancer Institute, Boston. This single-arm, multicentre phase Ib/II study is investigating the combination of eribulin plus pembrolizumab in 95 patients with metastatic triple negative breast cancer who had previously been treated with up to two lines of chemotherapy. The primary endpoint of the phase I study is to assess the safety and tolerability in combination, while the phase II objectives are response rates, with selected secondary endpoints including progression-free survival, overall survival and duration of response.[1] At SABCS, interim data from 39 evaluable patients treated with the combination regimen, show an overall response rate of 33.3%. One patient showed a complete response and twelve patients showed a partial response. In addition, the overall response rate was similar between PD-L1 positive and negative cohorts. The most common treatment-emergent adverse events (incidence greater than or equal to 35%) for the combination regimen were fatigue (74.4%), nausea (51.3%), peripheral neuropathy (43.6%), neutropenia (38.5%) and alopecia (35.9%), with Grade 3 or higher Treatment-Emergent Adverse Events (TEAEs) observed in 66.7% of patients. The two most common Grade 3 or higher TEAEs observed were neutropenia (30.8%) and fatigue (7.7%).[1] Further presentation at SABCS includes the design of a phase Ib/II study of eribulin in combination with PEGylated recombinant human hyaluronidase (PEGPH20). This is a randomised global study that will enroll approximately 114 patients with human epidermal growth factor receptor 2-negative (HER2-) high hyaluronan metastatic breast cancer, who were previously treated with up to two lines of systemic anticancer therapy in the metastatic setting.[3] The primary endpoint in the phase II study will be the objective response rate, and secondary endpoints will include progression-free survival and overall survival.[3] This study is currently enrolling. The continued development of Eisai's oncology portfolio underscores its human health care (hhc) mission, the company's commitment to innovative solutions in disease prevention, cure and care for the health and wellbeing of people worldwide. Eisai is committed to the therapeutic area of oncology and to addressing the unmet medical needs of people with cancer and their families. Phase Ib/II study to evaluate eribulin mesylate in combination with pembrolizumab in patients with metastatic triple-negative breast cancer; Tolaney et al (Poster#: P5-15-02)[1] The open-label, single-arm, multicentre phase Ib/II study investigated the use of the combination of eribulin in pembrolizumab in 106 patients with metastatic breast cancer who had previously treated with up to two lines of chemotherapy. The primary endpoint of the phase II study was objective response rate and secondary endpoints included progression-free survival, overall survival and duration of response. In this study, the most frequent adverse events of grade 3 or higher included neutropenia (31%) and fatigue (8%). Serious (non-fatal) adverse events occurred in 36% of patients and adverse events leading to dose adjustment were observed in 56% of patients. More than 300,000 women are diagnosed with breast cancer in Europe every year and about one third subsequently develop metastatic disease.[4] At this advanced stage, the cancer spreads beyond the breast to other parts of the body.[5] Eribulin is the first in the halichondrin class of microtubule dynamics inhibitors with a novel mechanism of action. Structurally, eribulin is a structurally simplified, fully synthetic analog of halichondrin B, a natural product isolated from the marine sponge Halichondria okadai. Eribulin exerts antiproliferative effects against cancer cells by inhibiting the growth phase of microtubule dynamics, ultimately preventing cell division and leading to cancer cell death. In addition, preclinical and translational studies in advanced breast cancer also suggest that eribulin has significant non-mitotic effects on tumour biology and the tumour microenvironment.[6],[7] The European Commission approved in May 2016 a variation to the terms of the Marketing Authorisation of eribulin for the treatment of adult patients with unresectable liposarcomas who have received prior anthracycline containing therapy (unless unsuitable) for advanced or metastatic disease. Pembrolizumab is marketed under the brand name Keytruda® by Merck Sharp & Dohme Corp., a subsidiary of Merck & Co., Inc., Kenilworth, NJ, USA (known as MSD outside the US and Canada) in the European Union. Pembrolizumab as monotherapy is indicated for the treatment of advanced (unresectable or metastatic) melanoma in adults. Pembrolizumab is also indicated for the treatment of locally advanced or metastatic non-small cell lung carcinoma (NSCLC) in adults whose tumours express PD-L1 and who have received at least one prior chemotherapy regimen. Patients with EGFR or ALK positive tumour mutations should also have received approved therapy for these mutations prior to receiving pembrolizumab. PEGPH20 (PEGylated recombinant human hyaluronidase) is a novel targeted agent that degrades hyaluronan (HA) within the tumour microenvironment.[8] PEGPH20 may remodel the stroma of high-HA tumours to increase the access and efficacy of anticancer therapies.[9],[10] Eisai is committed to the development and delivery of highly beneficial new treatments for people with cancer. The development of therapeutic options in oncology is a major strategic area for Eisai in Europe, the Middle East, Africa, Russia and Oceania (EMEA). In the European Union, Eisai currently has three marketed treatments across four indications: About Eisai Co., Ltd. Eisai Co., Ltd. is a leading global research and development-based pharmaceutical company headquartered in Japan. We define our corporate mission as "giving first thought to patients and their families and to increasing the benefits health care provides," which we call our human health care (hhc) philosophy. With over 10,000 employees working across our global network of R&D facilities, manufacturing sites and marketing subsidiaries, we strive to realise our hhc philosophy by delivering innovative products in multiple therapeutic areas with high unmet medical needs, including Oncology and Neurology. As a global pharmaceutical company, our mission extends to patients around the world through our investment and participation in partnership-based initiatives to improve access to medicines in developing and emerging countries. For more information about Eisai Co., Ltd., please visit http://www.eisai.com. 1. Tolaney, et al. Phase Ib/II study to evaluate eribulin mesylate in combination with pembrolizumab in patients with metastatic triple-negative breast cancer. San Antonio Breast Cancer Symposium (SABCS) Meeting 2016, Poster#: P5-15-02 3. Alvarez H, Savulsky C, et al. A randomized, open-label, multicenter, phase Ib/II study of eribulin mesylate in combination with PEGylated recombinant human hyaluronidase in patients with human epidermal growth factor receptor 2-negative, high-hyaluronan metastatic breast cancer. San Antonio Breast Cancer Symposium (SABCS) Meeting 2016, Poster#: OT2-02-02 4. World Health Organization. Atlas of Health in Europe. 2003. World Health Organization, Regional Office of Europe, Copenhagen, Denmark. 6. Ueda S, et al. In vivo imaging of eribulin-induced reoxygenation in advanced breast cancer patients: a comparison to bevacizumab. Br J Cancer. 2016;114:1212-1218. 7. Goto W, et al. Clinical verification of antitumor autoimmune response in eribulin chemotherapy for breast cancer. Cancer Research. 2016;76(14):5127-5127


SAN DIEGO--(BUSINESS WIRE)--Celgene Corporation (NASDAQ:CELG), Dana-Farber Cancer Institute and the University of Arkansas for Medical Sciences today announced the creation of the Myeloma Genome Project, a collaborative initiative aimed at compiling the largest dataset of high-quality genomic and clinical data to identify distinct molecular disease segments within multiple myeloma to advance diagnosis, prognosis and treatment of multiple myeloma patients. The initiative seeks to develop clinically relevant tests. Details of the project and initial characterization and preliminary analyses of newly diagnosed myeloma patient data were presented today by Brian Walker, Ph.D., of the University of Arkansas for Medical Sciences at the 58th American Society of Hematology Annual Meeting in San Diego, Calif. “The Myeloma Genome Project is a really exciting initiative that may change the way we manage myeloma patients,” said Gareth Morgan, M.D., Ph.D., Director of the Myeloma Institute at the University of Arkansas for Medical Sciences. Current technologies have discovered five major translocation groups within myeloma patients and these mutations have demonstrated varying effects on prognosis. The Myeloma Genome Project is also looking at minor translocation and mutational groups that are often poorly described due to small sample numbers in limited data sets. The group has established a set of 2,161 patients for which whole exome sequencing (WES; n=1,436), whole genome sequencing (WGS; n=708), targeted panel sequencing (n=993) and expression data from RNA-sequencing and gene expression arrays (n=1,497) were available. The data were collected from the Myeloma XI trial (UK), Intergroupe Francophone du Myeloma/Dana-Farber Cancer Institute, Myeloma Institute at the University of Arkansas for Medical Sciences and the Multiple Myeloma Research Foundation. “Understanding the various subgroups within multiple myeloma that exhibit distinct pathogenesis and clinical behavior is critical when looking to advance new therapies, particularly when considering a targeted approach,” said Rob Hershberg, M.D., Ph.D., Executive Vice President and Chief Scientific Officer at Celgene. “We look forward to the insights that this collaboration will provide for research and for patients.” “The Myeloma Genome Project expects to lead the way towards developing personalized and targeted therapy to improve patient outcomes in myeloma,” said Nikhil Munshi, M.D., Director of Basic and Correlative Science at the Jerome Lipper Multiple Myeloma Center at Dana-Farber Cancer Institute. The Myeloma Genome Project has begun to integrate these diverse, large genomic data sets and is identifying genetic information that may inform clinical targets for therapy. While analyses are not completed, the current efforts clearly demonstrate the feasibility of this approach and the project leaders plan to expand collaboration to include additional investigators and institutions and present updates at future medical and scientific meetings including publications in peer-reviewed journals. Celgene Corporation, headquartered in Summit, New Jersey, is an integrated global biopharmaceutical company engaged primarily in the discovery, development and commercialization of innovative therapies for the treatment of cancer and inflammatory diseases through next-generation solutions in protein homeostasis, immuno-oncology, epigenetics, immunology and neuro-inflammation. For more information, please visit www.celgene.com. Follow Celgene on Social Media: @Celgene, Pinterest, LinkedIn, Facebook and YouTube. From achieving the first remissions in childhood cancer with chemotherapy in 1948, to developing the very latest new therapies, Dana-Farber Cancer Institute is one of the world’s leading centers of cancer research and treatment. It is the only center ranked in the top 4 of U.S. News and World Report’s Best Hospitals for both adult and pediatric cancer care. Dana-Farber sits at the center of a wide range of collaborative efforts to reduce the burden of cancer through scientific inquiry, clinical care, education, community engagement, and advocacy. Dana-Farber/Brigham and Women’s Cancer Center provides the latest in cancer care for adults; Dana-Farber/Boston Children's Cancer and Blood Disorders Center for children. The Dana-Farber/Harvard Cancer Center unites the cancer research efforts of five Harvard academic medical centers and two graduate schools, while Dana-Farber Community Cancer Care provides high quality cancer treatment in communities outside Boston’s Longwood Medical Area. Dana-Farber is dedicated to a unique, 50/50 balance between cancer research and care, and much of the Institute’s work is dedicated to translating the results of its discovery into new treatments for patients locally and around the world. About the University of Arkansas for Medical Sciences The University of Arkansas for Medical Sciences (UAMS) is Arkansas’ only comprehensive academic health center, with colleges of Medicine, Nursing, Pharmacy, Health Professions and Public Health; a graduate school; a hospital; a northwest Arkansas regional campus; a statewide network of regional centers; and seven institutes: the Winthrop P. Rockefeller Cancer Institute, the Jackson T. Stephens Spine & Neurosciences Institute, the Myeloma Institute, the Harvey & Bernice Jones Eye Institute, the Psychiatric Research Institute, the Donald W. Reynolds Institute on Aging and the Translational Research Institute. It is the only adult Level 1 trauma center in Arkansas. UAMS physicians and other professionals provide care to patients at UAMS, Arkansas Children’s Hospital, the VA Medical Center and UAMS regional centers throughout the state. The UAMS Myeloma Institute is the most comprehensive center in the world for research and clinical care related to multiple myeloma and related diseases, such as Castleman Disease and Waldenstrom Macroglobulemia. The institute’s team of scientists and clinicians has pioneered many advances that have become standards of care, leading to improved survival rates. The UAMS Myeloma Institute is known for its “bench to bedside” approach, continually translating advances in the laboratory into breakthrough clinical treatments. Visit www.uams.edu or www.uamshealth.com. Find us on Facebook, Twitter, YouTube or Instagram.


News Article | October 31, 2016
Site: globenewswire.com

WALTHAM, Mass., Oct. 31, 2016 (GLOBE NEWSWIRE) -- TESARO, Inc. (NASDAQ:TSRO), an oncology-focused biopharmaceutical company, today announced the presentation of data from the ENGOT-OV16/NOVA trial of niraparib at the 2016 International Gynecologic Cancer Society (IGCS) Biennial Meeting in Lisbon, Portugal. These data were presented on Sunday, October 30 during the Best Oral session by Dr. Ursula Matulonis, M.D., Medical Director of the Gynecologic Oncology Program at Dana-Farber Cancer Institute and principal investigator on the ENGOT-OV16/NOVA trial, during the Best Oral session. The results were previously published in the New England Journal of Medicine on October 8, 2016 and presented at the ESMO 2016 Congress. “Many women with recurrent ovarian cancer experience a fear of recurrence in between regimens of platinum-based chemotherapy. The availability of an oral maintenance treatment that could lengthen the progression free survival interval between rounds of platinum-based chemotherapy with a tolerable side effect profile could be very empowering for patients,” said Dr. Matulonis. “The data from ENGOT-OV16/NOVA are extremely encouraging and demonstrate the potential of niraparib to offer a meaningful benefit for our patients with ovarian cancer.” “We are grateful for the patients, their families, and the caregivers that participated in the ENGOT-OV16/NOVA study, and we would like to thank our partners at ENGOT for their diligence in executing this trial,” said Mary Lynne Hedley, Ph.D., President and COO of TESARO. “We believe the results of this Phase 3 study demonstrated a meaningful benefit for women with platinum sensitive, recurrent ovarian cancer. We are pleased that the EMA recently accepted for review the MAA for niraparib, and we are on track to complete the rolling NDA submission imminently.” ENGOT-OV16/NOVA is a double-blind, placebo-controlled, international Phase 3 trial of niraparib that enrolled 553 patients with recurrent ovarian cancer who were in response to their most recent platinum-based chemotherapy. This trial was designed to assess progression free survival (PFS) in a broad population of patients who were assigned to one of two cohorts based upon germline BRCA mutation status. The ENGOT-OV16/NOVA trial successfully achieved its primary endpoint in both cohorts, demonstrating that niraparib treatment significantly prolonged PFS compared to control in patients who were germline BRCA mutation (gBRCAmut) carriers and in patients who were not germline BRCA mutation (non-gBRCAmut) carriers. A high proportion of patients in both treatment groups in both cohorts had received three or more prior lines of chemotherapy. The most common (≥10%) treatment-emergent grade 3/4 adverse events in the niraparib arm were thrombocytopenia (33.8%), anemia (25.3%), and neutropenia (19.6%) with treatment discontinuation for these events of 3.3%, 1.4% and 1.9%, respectively. Thrombocytopenia was not associated with grade 3/4 bleeding events. The majority of these hematological laboratory abnormalities occurred within the first three cycles; following dose modifications the incidence of these lab abnormalities decreased and thrombocytopenia and neutropenia were infrequent beyond cycle 3. The rates of MDS/AML in the niraparib (1.4%) and control (1.1%) arms were similar. There were no deaths among patients during study treatment. About the Phase 3 ENGOT-OV16/NOVA Clinical Trial of Niraparib ENGOT-OV16/NOVA is a double-blind, placebo-controlled, international Phase 3 trial of niraparib that enrolled 553 patients with recurrent ovarian cancer who were in a response to their most recent platinum-based chemotherapy. Patients were enrolled into one of two independent cohorts based on germline BRCA mutation status. One cohort enrolled patients who were germline BRCA mutation carriers (gBRCAmut), and the second cohort enrolled patients who were not germline BRCA mutation carriers (non-gBRCAmut) and included patients with HRD-positive and HRD-negative tumors. Within each cohort, patients were randomized 2:1 to receive niraparib or placebo and were treated continuously with placebo or 300 milligrams of niraparib, dosed as three 100 milligram tablets once per day, until progression. The primary endpoint of this study was progression-free survival (PFS). Secondary endpoints include patient-reported outcomes, chemotherapy-free interval length, PFS 2, overall survival, and other measures of safety and tolerability.  More information about this trial is available at http://clinicaltrials.gov/show/NCT01847274. About Niraparib Niraparib is an oral, once-daily PARP inhibitor that is currently being evaluated in four ongoing pivotal trials. TESARO is building a robust niraparib franchise by assessing activity across multiple tumor types and by evaluating several potential combinations of niraparib with other therapeutics. The ongoing development program for niraparib includes a Phase 3 trial in patients with platinum-sensitive, recurrent ovarian cancer (the NOVA trial); a Phase 3 trial in patients with first-line ovarian cancer (the PRIMA trial); a registrational Phase 2 treatment trial in patients with ovarian cancer (the QUADRA trial); and a Phase 3 trial for the treatment of patients with BRCA-mutant breast cancer (the BRAVO trial). Several combination studies are also underway, including trials of niraparib plus pembrolizumab and niraparib plus bevacizumab. Janssen Biotech has licensed rights to develop and commercialize niraparib specifically for patients with prostate cancer worldwide, except in Japan. The U.S. Food and Drug Administration (FDA) has granted Fast Track designation to niraparib for the treatment of patients with recurrent platinum-sensitive ovarian, fallopian tube, or primary peritoneal cancer. TESARO has initiated a rolling submission of a New Drug Application (NDA) for niraparib to the FDA, and intends to complete this submission during the fourth quarter. The Marketing Authorization Application (MAA) for niraparib has been submitted to and accepted for review by the European Medicines Agency (EMA) for the maintenance treatment of patients with platinum-sensitive, recurrent ovarian cancer who are in response to platinum-based chemotherapy. Niraparib is an investigational agent and, as such, has not been approved by the U.S. FDA, the European Medicines Agency (EMA), or any other regulatory agencies. About Ovarian Cancer Approximately 22,000 women are diagnosed each year with ovarian cancer in the United States, and more than 65,000 women are diagnosed annually in Europe. Ovarian cancer is the fifth most frequent cause of cancer death among women. Despite high response rates to platinum-based chemotherapy in the second-line advanced treatment setting, approximately 85% of patients will experience recurrence within two years. If approved, niraparib may address the difficult “watchful waiting” periods experienced by patients with recurrent ovarian cancer in between cycles of platinum-based chemotherapy. About TESARO TESARO is an oncology-focused biopharmaceutical company dedicated to improving the lives of cancer patients by acquiring, developing and commercializing safer and more effective therapeutics. For more information, visit www.tesarobio.com. To the extent that statements contained in this press release are not descriptions of historical facts regarding TESARO, they are forward-looking statements reflecting the current beliefs and expectations of management made pursuant to the safe harbor provisions of the Private Securities Litigation Reform Act of 1995. Words such as "may," "will," "expect," "anticipate," "estimate," "intend," and similar expressions (as well as other words or expressions referencing future events, conditions or circumstances) are intended to identify forward-looking statements. Forward-looking statements in this release involve substantial risks and uncertainties that could cause our clinical development programs, future results, performance or achievements to differ significantly from those expressed or implied by the forward-looking statements. Such risks and uncertainties include, among others, the uncertainties inherent in expectations with respect to regulatory submissions and approvals, and other matters that could affect the availability or commercial potential of our drug candidates. TESARO undertakes no obligation to update or revise any forward-looking statements. TESARO undertakes no obligation to update or revise any forward-looking statements. For a further description of the risks and uncertainties that could cause actual results to differ from those expressed in these forward-looking statements, as well as risks relating to the business of the Company in general, see TESARO's Annual Report on Form 10-K for the year ended December 31, 2015, and its Quarterly Report on Form 10-Q for the quarter ended June 30, 2016.


News Article | February 23, 2017
Site: globenewswire.com

TEL AVIV, Israel, Feb. 23, 2017 (GLOBE NEWSWIRE) -- Cellect Biotechnology Ltd. (Nasdaq:APOP) (TASE:APOP), a developer of stem cells isolation technology, announced today that Dr. Corey Cutler, Senior Physician at the world-renowned U.S. Dana Farber Cancer Institute, and an Associate Professor of Medicine at Harvard Medical School, is joining the Company's Scientific and Medical Advisory Board. Dr. Cutler is a world leader in the field of Stem Cell Transplantation and Graft Versus Host Disease treatment. “I am pleased to join such a distinguished group of physicians, researchers and industry executives as a member of Cellect’s Scientific and Medical Advisory Board,” said Dr. Cutler. “I believe that Cellect’s technology has the potential to transform regenerative medicine, and I look forward to working with the Company as it continues to advance its technology platform and product development programs.” "Dr. Cutler is world renowned for his contributions to innovations within the stem cell transplantation industry to drive potential treatments in cancer and many other medical conditions,” said Dr. Shai Yarkoni, Cellect’s CEO. “We look forward to leveraging his vast expertise as we continue to move forward with the Phase I/II clinical trial of our ApoGraft™ stem cell technology in blood cancer." Cellect's advisory board now includes global leaders and experts in the fields of medical research and drug development. Dr. Cutler joins: Dana-Farber Cancer Institute's ultimate goal is the eradication of cancer, AIDS, and related diseases and the fear that they engender. The mission of Dana-Farber Cancer Institute is to provide expert, compassionate care to children and adults with cancer while advancing the understanding, diagnosis, treatment, cure, and prevention of cancer and related diseases. As an affiliate of Harvard Medical School and a Comprehensive Cancer Center designated by the National Cancer Institute, the Institute also provides training for new generations of physicians and scientists, designs programs that promote public health particularly among high-risk and underserved populations, and disseminates innovative patient therapies and scientific discoveries to our target community across the United States and throughout the world. Cellect Biotechnology is traded on both the NASDAQ and Tel Aviv Stock Exchange (NASDAQ:APOP) (NASDAQ:APOPW) (TASE:APOP). The Company has developed a breakthrough technology for the isolation of stem cells from any given tissue that aims to improve a variety of stem cells applications. The Company’s technology is expected to provide pharma companies, medical research centers and hospitals with the tools to rapidly isolate stem cells for in quantity and quality that will allow stems cell related treatments and procedures. Cellect’s technology is applicable to a wide variety of stem cells related treatments in regenerative medicine and that current clinical trials are aimed at the cancer treatment of bone marrow transplantations. Forward Looking Statements     This press release contains forward-looking statements about the Company’s expectations, beliefs and intentions. Forward-looking statements can be identified by the use of forward-looking words such as “believe”, “expect”, “intend”, “plan”, “may”, “should”, “could”, “might”, “seek”, “target”, “will”, “project”, “forecast”, “continue” or “anticipate” or their negatives or variations of these words or other comparable words or by the fact that these statements do not relate strictly to historical matters. For example, forward-looking statements are used in this press release when we discuss Cellect presenting an opportunity to participate in a medical revolution, Cellect’s technology having the potential to transform regenerative medicine, that Cellect has developed a breakthrough technology for the isolation of stem cells from any given tissue that aims to improve a variety of stem cells applications and that Cellect’s technology is expected to provide pharma companies, medical research centers and hospitals with the tools to rapidly isolate stem cells for in quantity and quality that will allow stems cell related treatments and procedures.. These forward-looking statements and their implications are based on the current expectations of the management of the Company only, and are subject to a number of factors and uncertainties that could cause actual results to differ materially from those described in the forward-looking statements. In addition, historical results or conclusions from scientific research and clinical studies do not guarantee that future results would suggest similar conclusions or that historical results referred to herein would be interpreted similarly in light of additional research or otherwise. The following factors, among others, could cause actual results to differ materially from those described in the forward-looking statements: changes in technology and market requirements; we may encounter delays or obstacles in launching and/or successfully completing our clinical trials; our products may not be approved by regulatory agencies, our technology may not be validated as we progress further and our methods may not be accepted by the scientific community; we may be unable to retain or attract key employees whose knowledge is essential to the development of our products; unforeseen scientific difficulties may develop with our process; our products may wind up being more expensive than we anticipate; results in the laboratory may not translate to equally good results in real clinical settings; results of preclinical studies may not correlate with the results of human clinical trials; our patents may not be sufficient; our products may harm recipients; changes in legislation; inability to timely develop and introduce new technologies, products and applications, which could cause the actual results or performance of the Company to differ materially from those contemplated in such forward-looking statements. Any forward-looking statement in this press release speaks only as of the date of this press release. The Company undertakes no obligation to publicly update or review any forward-looking statement, whether as a result of new information, future developments or otherwise, except as may be required by any applicable securities laws. More detailed information about the risks and uncertainties affecting the Company is contained under the heading “Risk Factors” in Cellect Biotechnology Ltd.'s final prospectus dated July 29, 2016 filed with the U.S. Securities and Exchange Commission, or SEC, which is available on the SEC's website, www.sec.gov, and in the Company’s period filings with the SEC and the Tel-Aviv Stock Exchange.


COMMUNIQUÉ DE PRESSE DESTINÉ AUX MÉDIAS DE LA RÉGION EMOA UNIQUEMENT : NE CONCERNE PAS LES JOURNALISTES SUISSES, AUTRICHIENS ET AMÉRICAINS Les résultats intermédiaires présentés aujourd'hui lors du symposium de San Antonio sur le traitement du cancer du sein (SABCS), au Texas (États-Unis)se révèlent en faveur de l'utilisation d'Halaven® (éribuline) en association avec le pembrolizumab chez les patientes atteintes d'un cancer du sein métastatique triple négatif.[1] L'étude associe l'éribuline, approuvée en monothérapie dans le cancer du sein métastatique ou avancé prétraité et premier médicament inhibiteur de la dynamique des microtubules appartenant à la classe des halichondrines, avec le pembrolizumab, un inhibiteur de contrôle PD-1 qui est une immunoglobuline (Ig) G4 monoclonale humanisée dirigée contre les récepteurs à la surface des cellules humaines PD-1. « Eisai est rapidement apparu comme un des leaders dans le domaine de l'oncologie, et est un partenaire de choix pour de nombreux laboratoires. Le mécanisme d'action multiple d'éribuline en fait un agent priviliégié dans le cadre d'études d'associations médicamenteuses », commente Alton Kremer, directeur général des opérations cliniques et des affaires médicales, du groupe Oncologie au sein d'Eisai. Dans l'Union européenne, l'éribuline est notamment indiquée dans le traitement des patients adultes atteints d'un cancer du sein localement avancé ou métastatique, dont la maladie a progressé après au moins un protocole de chimiothérapie pour le traitement du stade avancé. Le traitement antérieur, en situation adjuvante ou métastatique, doit avoir comporté une anthracycline et un taxane, sauf chez les patients ne pouvant pas recevoir ces traitements.[2] Le pembrolizumab est étudié pour le traitement du cancer du sein métastatique triple négatif. « Différentes études précliniques et translationnelles ont montré que l'éribuline entraînait un remodelage de la vascularisation de la tumeur, une réduction de l'hypoxie, ainsi qu'une promotion du phénotype moins agressif des cellules épithéliales dans les tissus de la tumeur chez les patientes atteintes d'un cancer du sein avancé. Nous avons formulé l'hypothèse que ces effets de l'éribuline sur la tumeur au niveau biologique, ainsi que sur son microenvironnement pourraient potentialiser l'activité du pembrolizumab (inhibiteur de points de contrôle immunitaire), dans le cancer du sein métastatique triple négatif, et améliorer la détection ainsi que l'attaque des cellules T du système immunitaire envers les cellules tumorales », déclare Sara Tolaney, MD, MPH, directrice adjointe du Dana-Farber Cancer Institute, à Boston. L'étude de phase Ib/II multicentrique à bras unique explore l'utilisation de l'éribuline en association avec le pembrolizumab chez 95 patientes atteintes d'un cancer du sein métastatique triple négatif ayant reçu auparavant jusqu'à deux protocoles de chimiothérapie. Le critère d'évaluation principal de l'étude de phase I intégrait l'évaluation de l'innocuité en polythérapie, tandis que les objectifs de la phase II comprenaient les taux de réponse et, comme critères d'évaluation secondaires, la survie sans progression, la survie globale et la durée de la réponse.[1] Une analyse intermédiaire pré-planifiée est présentée lors de cette rencontre. L'analyse intermédiaire, basée sur 39 patients évaluables avec le régime combiné, montre un taux de réponse global de 33,3%. Les résultats incluent un cas de réponse complète et 12 cas de réponse partielle. De plus, le taux de réponse global est similaire entre les patients identifiés comme PD-L1 positifs et PD-L1-négatifs. Les évènements indésirables  les plus fréquemment observés (incidence supérieure ou égale à 35%) pour le régime combiné sont respectivement: fatigue (74,4%), nausée (51,3%), neuropathie périphérique (43,6%), neutropénie (38.5%) et alopécie (35,9%), avec des évènements indésirables de Grade 3 ou supérieur observés chez 66,7% des patients. Les deux évènements indésirables les plus fréquents de Grade 3 ou supérieur sont: neutropénie (10,3%) et fatigue (12,8%).[1] Une autre présentation faite au SABCS a décrit la méthodologie de l'étude de phase Ib/II portant sur l'éribuline en association avec la hyaluronidase humaine recombinante PEGylée (PEGPH20). Il s'agit d'une étude internationale prévue pour être menée auprès de 114 patientes atteintes d'un cancer du sein négatif au récepteur 2 du facteur de croissance épidermique humain (HER2-).[3] Le critère d'évaluation principal de l'étude de phase II sera le taux de réponse objective et les critères d'évaluation secondaires, la survie sans progression et la survie globale. Cette étude en est actuellement à l'étape du recrutement. La poursuite du développement de son portefeuille dans le domaine de l'oncologie souligne la mission d'Eisai axée sur les soins en santé humaine (ou human health care, hhc en anglais), l'engagement du laboratoire est de développer des solutions innovantes dans le but de prévenir, guérir et soigner pour la santé et le bien- à travers le monde. Eisai est engagé dans le domaine thérapeutique de l'oncologie et s'efforce de répondre aux besoins médicaux non satisfaits des patients atteints de cancer et de leurs familles. L'étude de phase Ib/II se concentre sur l'évaluation du mésylate d'éribuline en association avec le pembrolizumab chez les patientes atteinte d'un cancer du sein métastatique triple négatif ; Tolaney et al (Référence de poster : P5-15-02)[1] L'étude de phase Ib/II ouverte multicentrique à bras unique a évalué l'utilisation de l'éribuline en association avec le pembrolizumab chez 106 patientes atteintes d'un cancer du sein métastatique ayant reçu auparavant jusqu'à deux protocoles de chimiothérapie. Le critère d'évaluation principal de l'étude de phase II était le taux de réponse objective, et les critères d'évaluation secondaires, la survie sans progression, la survie globale et la durée de la réponse. Les effets indésirables les plus fréquents de grade 3 ou plus de cette étude comprenaient une neutropénie (31 %) et une fatigue (8 %). Des effets indésirables sérieux (non fatals) ont été observés chez 36 % des patientes, et des effets indésirables entraînant un ajustement de la dose ont été observés chez 56 % des patientes. Chaque année, un cancer du sein est diagnostiqué chez plus de 300 000 femmes en Europe, et près d'un tiers d'entre elles développent des métastases par la suite.[4] Lors de ce stade avancé, le cancer se propage au-delà vers d'autres parties du corps.[5] L'éribuline est le premier médicament inhibiteur de la dynamique des microtubules appartenant à la classe des halichondrines et ayant un mécanisme d'action innovant. D'un point de vue structurel, l'éribuline est un analogue totalement synthétique et structurellement simplifié de l'halichondrine B, substance naturelle isolée à partir d'une éponge marine, Halichondria okadai. L'éribuline a un effet antiprolifératif contre les cellules cancéreuses en inhibant la phase de croissance de la dynamique des microtubules, en empêchant finalement la division cellulaire et en tuant ainsi les cellules cancéreuses. De plus, des études précliniques et translationnelles portant sur le cancer du sein suggèrent également que l'éribuline aurait des effets antimitotiques significatifs sur la tumeur au niveau biologique et sur son microenvironnement.[6],[7] En mai 2016, la Commission européenne a approuvé une modification des conditions de l'autorisation de mise sur le marché de l'éribuline visant le traitement des patients adultes atteints d'un liposarcome non résécable ayant reçu un protocole de chimiothérapie antérieur comportant une anthracycline (sauf chez les patients ne pouvant pas recevoir ce traitement) pour le traitement d'une maladie avancée ou métastatique. Le pembrolizumab est commercialisé sous le nom de marque Keytruda® par Merck, Sharp & Dohme Corp., une filiale de Merck & Co., Inc., Kenilworth, NJ, États- Unis(connu sous le nom MSD en dehors des États-Unis et du Canada) dans l'Union européenne. Le pembrolizumab, est indiqué en monothérapie dans le traitement des patients adultes atteints d'un mélanome avancé (non résécable ou métastatique). Le pembrolizumab est également indiqué dans le traitement des patients adultes atteints d'un cancer bronchique non à petites cellules (CBNPC) localement avancé ou métastatique dont les tumeurs expriment le PD-L1, et ayant reçu  au moins une chimiothérapie antérieure.[4] Les patients présentant des mutations tumorales d'EGFR ou d'ALK doivent également avoir reçu un traitement autorisé pour ces mutations avant de recevoir le pembrolizumab. La PEGPH20 (hyaluronidase humaine recombinante PEGylée) est un nouveau médicament expérimental administré par voie intraveineuse visant à la dégradation de l'acide hyaluronique (AH), un composant majeur de la matrice extracellulaire.[8]La PEGPH20 peut remodeler le stroma des tumeurs avec taux de AH élevés pour favoriser l'accès et l'efficacité des traitements anticancéreux. [9],[10] Eisai développe et propose des traitements novateurs hautement bénéfiques pour les personnes atteintes de cancer. Le développement d'options thérapeutiques dans le domaine de l'oncologie constitue un enjeu stratégique majeur pour Eisai en Europe, au Moyen-Orient, en Afrique (EMOA), en Russie et en Océanie. Dans l'Union européenne, Eisai possède actuellement trois traitements commercialisés, portant sur quatre indications: Eisai Co. Ltd. est l'un des principaux laboratoires pharmaceutiques de recherche et de développement au monde. Son siège social est au Japon. La mission de la société est de « donner la priorité aux patients et à leurs familles et d'augmenter le service médical rendu », et repose sur ce qu'Eisai appelle la philosophie des soins en santé humaine (ou human health care, hhc en anglais). Avec plus de 10 000 collaborateurs au sein de son réseau international de centres de R et D, de sites de production et de filiales commerciales, le groupe s'efforce de mettre en œuvre sa philosophie hhc en développant des produits innovants dans différents domaines thérapeutiques dans lesquels de nombreux besoins médicaux restent insatisfaits, notamment l'oncologie et la neurologie. En raison de son envergure mondiale, Eisai est en mesure d'étendre sa mission aux patients du monde entier, en s'appuyant sur ses investissements et sa participation à des initiatives basées sur des partenariats afin d'améliorer l'accès aux médicaments dans les pays en développement et émergents. Pour de plus amples informations à propos d'Eisai Co. Ltd., veuillez consulter le site http://www.eisai.com. 1. Tolaney, et al. Phase Ib/II study to evaluate eribulin mesylate in combination with pembrolizumab in patients with metastatic triple-negative breast cancer. San Antonio Breast Cancer Symposium (SABCS) Meeting 2016, Poster#: P5-15-02 3. Alvarez H, Savulsky C, et al. A randomized, open-label, multicenter, phase Ib/II study of eribulin mesylate in combination with PEGylated recombinant human hyaluronidase in patients with human epidermal growth factor receptor 2-negative, high-hyaluronan metastatic breast cancer. San Antonio Breast Cancer Symposium (SABCS) Meeting 2016, Poster#: OT2-02-02 4. World Health Organization. Atlas of Health in Europe. 2003. World Health Organization, Regional Office of Europe, Copenhagen, Denmark. 5. Cancer Research UK, Breast Cancer - Outlook by Grade - Available at: http://www.cancerresearchuk.org/about-cancer/type/breast-cancer/treatment/statistics-and-outlook-for-breast-cancer#overall   Accessed November 2016 6. Ueda S, et al. In vivo imaging of eribulin-induced reoxygenation in advanced breast cancer patients: a comparison to bevacizumab. Br J Cancer. 2016;114:1212-1218. 7. Goto W, Kashiwagi S, Asano Y, et al. Clinical verification of antitumor autoimmune response in eribulin chemotherapy for breast cancer [abstract]. In: Proceedings of the 97th Annual Meeting of the American Association for Cancer Research; 2006 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; 2016. Abstract nr 5127.


No statistical methods were used to predetermine sample size. The experiments were not randomized, and the investigators were not blinded to allocation during experiments and outcome assessment. Breast cell lines were obtained from the ATCC and S. Ethier (SUM series). Cells were cultured in media recommended by the provider, their identity was confirmed by STR analysis, and they were regularly tested for mycoplasma. Breast tumour samples were collected using protocols approved by the DF/HCC Institutional Review Board, informed consent was obtained from all patients. Tumours were minced with razor blades and digested with stirring for 3–4 h at 37 °C in DMEM/F12 with 2 mg ml−1 BSA, 2 mg ml−1 collagenase type IV, and 2 mg ml−1 hyaluronidase. After digestion, cells were filtered through 500-μm mesh, washed in DMEM/F12 with 5% FBS, frozen in DMEM/F12 with 5% FBS and 10% DMSO, and stored in liquid nitrogen for subsequent xenograft studies. PDX IDC50 was derived from a primary tumour of highly invasive metaplastic TNBC resistant to chemo and radiation therapy leading to the rapid death of the patient. Exome sequencing of the tumour and xenograft identified numerous mutations including heterozygous frameshift mutation in PTEN (chr10_89701964-89701964_A) and CDH1 chr16_67400242-67400242_C). PDX EL-12-58 was derived from a liver metastasis of a heavily pretreated basal-like TNBC, Oncopanel mutation testing identified homozygous mutations in BRCA2 (p.S1970*), TP53 (p.I232fs), TSC2, FLT3, and ROS1, and lower frequency mutations in RAD21, JAK3, ARID1B, ARID1A, KDM6A. We tested a panel of compounds (synthesized in the Bradner laboratory) in 40 human breast cell lines in a 384-well format at 2,000 cells per well using a semi-automated screen essentially as described5. Cell viability at 72 h was evaluated using ATPlite (Perkin Elmer). SUM149, SUM149R, SUM159, and SUM159R cells were seeded in sterile, white, opaque 384-well microtitre plates (Thermo), using an automated dispensing system (BioTek EL406), at 1,000 cells per well in 50 μl of media. Drugs were delivered in DMSO by robotic pin transfer with a JANUS workstation (100 nl) to achieve a matrix of pairwise dose–response incubations of each compound, each pair having eight replicates. Following 72 h of incubation, ATP levels were determined for treated cells and vehicle controls (ATPlite, PerkinElmer). Data were normalized to vehicle controls. Combination indices were determined using the median-effect principle of Chou & Talalay28 (CalcuSyn Software). Isobologram plots were generated with GraphPad Prism software. Points represent paired values of drug concentrations assessed for synergism. The diagonal line signifies drug additivity. Points above the line represent antagonistic drug combinations, and those below the line represent synergistic drug combinations. Synergy assays were performed in triplicates and repeated 2–3 times. For xenograft assays 5–6-weeks old female CrTac:NCr-Foxn1nu and NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac mice were purchased from Taconic. Tumours were induced by bilateral orthotopic mammary fat pad injection of 1 × 106 cells in 50% Matrigel (BD Biosciences) in DMEM/F12 or Medium 171 (except for IDC50-X cells, which were injected with 3% FBS and 4 mg ml−1 collagen gel in Medium 171). Animal experiments were conducted following protocol 11-023 approved by the Dana-Farber Cancer Institute Animal Care and Use Committee. For all the xenograft studies, the sample size of each group (5–10 mice) is indicated in the figures. We performed pilot experiments using a few (5–10) mice per group followed by larger studies if needed to reach statistical significance and repeated experiments to ensure reproducibility. Due to the nature of the performed experiments, no randomization and no blinding was used as it was deemed unfeasible. However, the resulting tumours were analysed in a blinded manner. Mice were administered JQ1 (50 mg per kg, daily), vehicle only (control) for 14 days beginning at day 14 (SUM159), or doxycycline at day 21 (SUM159-shBRD4) after injection. Mice were euthanized and tumours evaluated 28 and 60 days after injection of parental and TET-inducible shBRD4-expressing SUM159 cells into mammary fat pads. Cell viability and growth assays (Figs 1a, 2a, b, 3d, e, 4c, i, Extended Data Figs 1a, b, 3i, 4d, e, g, h, 10), cycle, apoptosis, and MDR assays were performed in triplicates and repeated 2–3 times. For cell proliferation assays, cells were plated at 500 cells per well in 96-well plates and treated the next day with inhibitors, DMSO or doxycycline (500 ng). Cells were cultured at 37 °C with 5% CO in the media described above, and cell viability was measured using CellTiter-Glo three days after treatments. For cell growth assays, cells were plated at 5,000 (SUM159) or 20,000 (SUM149) cells per well in 6-well plates and treated the next day with inhibitors. Cells were counted every three days by cell counter. Cellular apoptosis was analysed with an APC AnnexinV/7ADD Apoptosis Detection kit (BD Pharmingen). AnnexinV/7AAD assessments and cell cycle graphics were generated using FlowJo software V7.6.1 for Windows (Tree Star). Senescence Beta-gal staining was performed using Senescence β-Galactosidase staining kit from Cell Signaling. Briefly, after JQ1 treatment (500 nM) for 72 h, SUM159 and MDA-MB-231 cells were fixed by fixative solution for 15 min, followed by β-galactosidase solution incubation overnight at 37 °C. The staining was checked under microscope for the development of blue colour. Multi-Drug Resistance Assay was performed with MDR assay kit from Cayman Chemical (600370). Briefly, SUM159 and SUM159R cells were treated with JQ1 or DMSO for 30 min in SUM medium. Verapamil was used as a positive control at 1:1,000 dilution. Calcein AM/Hoechst Dye staining solution was added after that and cells were incubated at 37 °C for 15 min. The cells were analysed by fluorescent microscope and FACS. Cell cycle analysis was performed 72 h after JQ1 treatment or BRD4 downregulation with doxycycline using propidium iodide (PI) staining. Cells were resuspended in 1 ml of growth medium supplemented with 2 μg ml−1 PI (Life Technologies) as final concentration. After 60 min at 37 °C in the dark, analysis was performed on a FACS AriaII cytometer (BD Biosciences). The cell cycle was plotted as histogram after excluding doublets. SUM159 cells were treated with nocodazole (200 ng ml−1) for 12 h and then cells were tapped to detach from the plates. After washing twice with PBS, cells were replated with or without JQ1 in collagen-coated plates. Cells were collected at 0, 3, 6, 12 h time point for FACS and immunoblot analysis. Dynamic BH3 profiling was performed using the JC-1 plate method as previously described18, 19. Briefly, 2.5 × 105 cells were seeded in T25 flasks in the presence of 500 nM or 5 μM JQ1 for 72 or 96 h. Cells were trypsinized, suspended in MEB (150 mM mannitol, 10 mM HEPES, 50 mM KCl, 5 mM succinate, 20 μM EDTA, 20 μM EGTA, 0.1% protease-free BSA, pH 7.5 ± 0.1), and 1–2 × 104 cells were added in 15 μl of MEB to each well of a 384 well Fluotrac 200 plate containing 15 μl per well of either peptides at 2× final concentration, buffer only, or 50 μM alamethicin in MEB supplemented with 2 μM JC-1, 10 mM 2-mercaptoethanol, 20 μg ml−1 oligomycin, and 50 μg ml−1 digitonin. Fluorescence at emission 590 ± 10 nM and excitation 545 ± 10 nM was recorded at 5 min intervals at 32 °C. The area under each curve was normalized to the alamethicin and buffer controls as: % Depolarization = 1 − [(AUC   − AUC  )/(AUC   − AUC )]. Delta priming was calculated per peptide treatment as: Delta Priming = (Depolarization Treated) − (Depolarization Untreated). Positive delta priming indicates an increase in priming due to treatment and an increased potential for apoptosis at later time points. Antibodies used for immunofluorescence were: CK18 (Dako, M7010), CK17 (Dako, M7046), HMW CK (Dako, M0630), LMW CK (Dako, M0631), CD44 (NeoMarkers, MS-668-P1), CD24 (NeoMarkers, MS-1279-P1), pSTAT3 (Cell Signaling, 9145S), VIM (Dako, M073501), CDH1 (BD Biosciences, 610181), Flag (Sigma, F1804), BrdU (Roche, 11170376001), pBRD4 (a gift from C. M. Chiang), and androgen receptor (Cell Signaling, 5153S). Immunofluorescence experiments were performed in cultured cells or in whole sections of formalin-fixed paraffin embedded (FFPE) xenograft tumours. The staining was performed as described29. Antibody dilutions were as follows: pSTAT3 (1:25), CD44 (1:100), CD24 (1:100), CK18 (1:200), CK17 (1:200), HMW CK (1:100), LMW CK (1:100), VIM (1:100), CDH1 (1:100), Flag (1:50), BrdU (1:200), pBRD4 (1:200), and androgen receptor (1:50). The Dana-Farber Breast Cancer Tissue Microarray (TMA) consists of primary TNBC samples from approximately 83 patients who underwent definitive breast surgery at Brigham and Women’s Hospital between 1 January 1997 and 31 December 2005. Formalin-fixed, paraffin-embedded breast cancers were collected from the archives of the Department of Pathology at Brigham and Women’s Hospital. Best blocks and best areas for coring were identified and selected by a breast pathologist (DD) to represent different area of the tumour. Results of immunohistochemical studies for oestrogen (ER) and progesterone receptor (PR) and HER2 and FISH assay results for HER2 were extracted from pathology reports. TMA construction was carried out in the Dana-Farber/Harvard Cancer Center Tissue Microarray Core Facility. Three 0.6 mm cores were taken from different marked areas in each case and placed into a recipient block using a manual arrayer (Beecher Instruments). Specimens are arrayed in triplicate. Participants signed consent for research use of tissue and the linking of tumour specimens to clinical follow-up. Clinical data on these patients was collected retrospectively at first presentation, at 4, 9, 18, 30, and 42 months, and annually thereafter. After 9.3 years median follow up, 24 recurrences and 14 deaths have been recorded. The data elements are the following: staging, tumour pathology, diagnostic and follow-up tests performed, treatments administered (surgery, radiation and systemic therapy), and recurrence. Although the patients in this cohort were not treated as part of a clinical trial protocol, they were treated relatively uniformly as per Dana-Farber clinical practice guidelines. This serves to minimize confounding due to treatment heterogeneity. The TMA was stained with pBRD4 (1:200) antibody and imaged manually on Yokagawa spinning disc confocal microscope. Three images were taken per each core for 240 out of 267 cores, for the remaining 27 one or two images were taken due to tissue loss or low tumour content. Image analysis was performed with ImageJ software macro (code available upon request). Phospho-BRD4 staining mean intensity was calculated per individual nucleus within an image. The mean intensity per image was normalized to nuclei count. For clinical outcome analysis patients were dichotomized as ‘High’/’Low’ pBRD4 by median intensity (Supplementary Table 9). Disease outcomes were evaluated in 83 of 89 TMA samples (3 were not TNBC by definitive pathology, 2 did not have clinical data available, one was a repeat biopsy on a patient). Recurrence-free survival (RFS) was defined as the interval from the date of initial surgical resection to the date of recurrence (local or distant), or date of last known contact if the patient was alive and has not recurred. RFS and overall survival were estimated using the Kaplan–Meier product-limit method, with hazard ratios and 95% confidence intervals from a univariate Cox proportional hazard model. For siRNA transfection cells were plated at 2,000 cells per well in 96-well plates and cultured at 37 °C with 5% CO2 in the media. The next day, cells were transfected in triplicate with siGENOME SMARTpools for the genes of interest or “Non-Targeting siRNA” controls using DharmaFECT 1 (Dharmacon). The sequences of the siRNAs in the SMARTpools are listed in Supplementary Table 10. Cell viability was measured using CellTiter-Glo (Promega) three days after transfections, with the effects of each siRNAs treatment on each cell line compared to the effects of no siRNAs. TET-inducible pLKO-TET-ON lentiviral constructs were packaged by co-transfection of the lentiviral hairpin containing plasmid PLKO.1 and the helper plasmids pCMV-dR8.91 and pMD2.G-VS.V-G into HEK293T cells using Lipofectamine (Life Technologies). Following transduction via spinoculation for 30 min at 1,000g and selection with 1 μg ml−1 puromycin for 72 h (Sigma, St. Louis, MO), knockdown efficacy was determined by western blotting and cells were seeded for proliferation assays as described above. Sequences of shRNAs used are listed in Supplementary Table 10. Full length BRD4 in pCDNA3 was a gift from Dr. French at Brigham and Women’s Hospital, Harvard Medical School. Mutations of BRD4 BD1 (N140A) and BD2 (N433A) bromodomains, 7A and 7D mutants were generated using a Quickchange Multi Site-Directed Mutagenesis Kit (Agilent Technologies) using primers listed in Supplementary Table 10 and subsequently verified by sequencing. Cells were lysed five days after transfection with siRNAs in RIPA buffer. Proteins were resolved in SDS-polyacrylamide gels (4–12%) and transferred to PVDF membranes by using a Tris-glycine buffer system. Membranes were blocked with 5% milk powder in 0.1% Tween20 in PBS (PBS-T) for 1 h at room temperature followed by incubation with primary antibodies at 1:1,000 dilution in 2.5% milk PBS-T. For immunoprecipitation, nuclear extracts were prepared as follow: 1 × 107 cells were resuspended in 5 ml buffer A: 10 mM Tris pH 7.9, 1.5 mM MgCl , 10 mM KCl, 0.05% NP-40, 1 mM DTT, and protease and phosphatase inhibitors. Cells were incubated on ice for 15 min and gently vortexed every 5 min. After centrifugation at 2,000g for 5 min, pellets were suspended in 0.3 ml buffer B (20 mM Tris pH 7.9, 25% glycerol, 0.42 M NaCl, 1.5 mM MgCl , 1 mM KCl, 0.5% NP40, 0.2 mM EDTA, 1 mM DTT, and protease and phosphatase inhibitors) and incubated for 5 min on ice. After centrifugation of the lysates at 14,000g for 10 min at 4 °C, supernatant was diluted with 0.6 ml buffer A, and added NP-40 to final 0.5% and treated with DNase I. The samples were then incubated at 4 °C overnight with BRD4 or Flag antibodies at 1:100 dilution and immunoprecipitates were collected on Dynabeads Protein G for 2 h. Beads were washed with buffer B containing 150 mM NaCl and 0.5% NP-40 three times and then resuspended in gel loading buffer. Immunoblotting and immunoprecipitation experiments were repeated 2–3 times. Antibodies used for immunoblotting, immunoprecipitation and ChIP-seq were as follows: BRD4 (Bethyl, A301-985A), MED1 (Bethyl, A300-793a), BRD3 (Bethyl, A302-368A), BRD2 (Bethyl, A302-583A), MYC (Santa Cruz, sc764), pSTAT3 (Cell Signaling, 9145S), STAT3 (Cell Signaling, 4904), pSTAT5 (Cell Signaling, 9351), pJAK2 (Cell Signaling, 3771), CYCLIN D1 (Cell Signaling, 2922), pH3 (Cell Signaling, 12201), CK2 substrate (Cell Signaling, 8738), PP2A-A (Cell Signaling, 2039), PP2A-C (Cell Signaling, 2038) and pBRD4 was a gift from C. M. Chiang. Antibodies used for ChIP-seq were BRD4 (Bethyl) histone H3K27ac (Abcam, ab4729). CXCR2 inhibitor (239819) and CK2 inhibitor (218860) were from CalBiochem, JAK2 inhibitor (Ruxolitinib, INCB018424), MEK inhibitor (GSK1120212, S2673), ABT-737 (s1002), and PI3K inhibitor (BKM120, S2247) were from Selleckchem, phenothiazine (1525707) and perphenazine (1511000) were from Sigma-Aldrich. Inhibitor treatment for immunoblot analyses was conducted for 3 h. SUM159 and SUM159R cells were grown in R/K-deficient SILAC DMEM (paa; E15-086), 10% dialysed serum (Sigma-Aldrich; F0392), and supplemented with 800 μM l-lysine 13C 15N hydrochloride and 482 μM l-arginine 13C 15N hydrochloride (Cambridge Isotope laboratory) for ‘heavy’-labelled media or 800 μM l-lysine 12C 14N -hydrochloride and 482 μM l-arginine 12C 14N hydrochloride for ‘light’-labelled media. After SILAC labelling, RIME was performed as described20. Word clouds for Extended Data Fig. 7 were generated using R version 3.1.0 and the R package ‘wordcloud’ version 2.5. The size of the tag reflects the square root of the MASCOT score of the protein (the choice of square root is arbitrary, but visually appealing). Experiments were filtered against the Contaminant Repository for Affinity Purification Mass Spectrometry Data30, considering any protein which occurs in at least 20 negative control experiments to be contamination, hence removed from the data set. Refseq protein IDs provided by the contaminant repository were converted to Uniprot IDs found in the mass spec experiments using mappings from the Bioconductor package ‘org.Hs.eg.db’, version 2.14 (Carlson M. org.Hs.eg.db: Genome wide annotation for Human. R package version 3.0.0). SILAC RIME experiments were performed in duplicates and repeated 2–3 times. Chem-seq was performed essentially as described11. BRD4 ChIP-seq: SUM159 and SUM159R cells (4 × 107) were grown in SUM Medium. The media were then removed and replaced with media containing 1% formaldehyde (EM grade; tebu-bio) and crosslinked for 8 min. Crosslinking was quenched by adding glycine to a final concentration of 0.2 M. The cells were washed with ice-cold PBS, harvested in PBS, and the cell pellet was washed with PBS. The nuclear fraction was extracted by first resuspending the pellet in 10 ml of LB1 buffer (50 mM HEPES-KOH (pH 7.5), 140 mM NaCl, 1mM EDTA, 10% glycerol, 0.5% NP-40 or Igepal CA-630, and 0.25% Triton X-100) for 10 min at 4 °C. Cells were pelleted, resuspended in 10 ml of LB2 buffer (10 mM Tris-HCL (pH 8.0), 200 mM NaCl, 1 mM EDTA, and 0.5 mM EGTA), and mixed for 5 min. Cells were pelleted and resuspended in 300 μl of LB3 buffer (10 mM Tris-HCl (pH 8), 100 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 0.1% Na-deoxycholate, and 0.5% N-lauroylsarcosine) and sonicated in a Covaris sonicator for 10 min. A total of 30 μl of 10% Triton X-100 was added, and lysate was centrifuged for 10 min at 20,000 rcf to purify the debris. The supernatant was then incubated with 100 μl of Dynabeads Protein G (Life Technologies, 10003D) prebound with 20 μg BRD4 antibody (Bethyl, A301-985A), and immunoprecipitation (IP) was conducted overnight in the cold room. The beads were washed ten times in 1 ml of RIPA buffer and twice in 100 mM ammonium hydrogen carbonate (AMBIC) solution. DNA was eluted in elution buffer (50 mM Tris-HCl pH 8, 10 mM EDTA, and 1% SDS). Cross-links were reversed overnight at 65 °C. RNA and protein were digested with 0.2 mg ml−1 RNase A for 2 h followed by 0.2 mg ml−1 Proteinase K for 1 h. DNA was purified with phenol-chloroform extraction and ethanol precipitation. Libraries for Illumina sequencing were prepared following the Rubicon ThruPLEX-FD kit for 10–12 cycles. RNA-seq: SUM159 and SUM159R were incubated in biological duplicates for 3, 12 and 24 h with 500 nM of JQ1 or DMSO treatment. Total RNA was extracted using the standard Qiagen RNeasy kit (74106). RNA concentrations were measured and quality controlled on a Bioanalyzer, RNA-Seq libraries were made using Illumina True-Seq RNA kits using the Sciclone NGSx workstation. All RNA-seq and ChIP-seq experiments were performed in duplicates. Accessing data generated in this manuscript. All ChIP-seq, Chem-seq, and RNA-seq data generated in this publication can be found online associated with GEO Publication Reference ID GSE63584 (www.ncbi.nlm.nih.gov/geo/). Supplementary Table 2 lists all sequencing data sets and their corresponding GEO GSM accession IDs. Gene sets and annotations. All analysis was performed using RefSeq (NCBI37/HG19) human gene annotations. RNA-seq data processing and gene expression quantification. All RNA-Seq data sets were aligned to the transcriptome using Tophat231 (version 2.0.11) using the Illumina igenomes NCBI37/HG19 UCSC transcriptome build retrieved from http://ccb.jhu.edu/software/tophat/igenomes.shtml. Alignments were performed using default parameters. Transcript expression quantification was performed using Cufflinks32 (version 2.2.0) with default parameters to generate gene expression values in units of FPKM. ChIP-seq and Chem-seq data processing. All ChIP-seq and Chem-seq data sets were aligned using Bowtie233 (version 2.2.1) to build version NCBI37/HG19 of the human genome or build version NCB37/MM9 of the mouse genome. Alignments were performed using the following criteria: -k 1, with all other parameters set to default. These criteria preserved only reads that mapped uniquely to the genome without any mismatches. Calculating read density. We calculated the normalized read density of a ChIP-seq or Chem-seq data set in any region using the Bamliquidator (version 0.9) read density calculator (https://github.com/BradnerLab/pipeline/wiki/bamliquidator). Briefly, ChIP-Seq reads aligning to the region were extended by 200 bp and the density of reads per base pair (bp) was calculated. The density of reads in each region was normalized to the total number of million mapped reads producing read density in units of reads per million mapped reads per bp (rpm per bp). Identifying ChIP-seq and Chem-seq enriched regions. We used the MACS version 1.4.2 (Model based analysis of ChIP-Seq)34 peak finding algorithm to identify regions of ChIP-Seq enrichment over background. A P value threshold of enrichment of 1 × 10−9 was used for all data sets. The GEO accession number and background used for each data set can be found in the accompanying Supplementary Table 2. Creating heat map representations of ChIP-seq occupancy. Heat maps of ChIP-seq occupancy for various factors were created as described35. Heat maps were created for the ±10 kb region flanking all transcription start sites (TSS) or for the ±10 kb region flanking all TSS distal BET bromodomain bound enhancers. Each row plots a specific TSS or enhancer region. Rows are ranked by peak occupancy of BET bromodomains as determined by Bio-JQ1 Chem-seq signal (Fig. 1d). Correlating BRD4 and H3K27ac occupancy to Bio-JQ1. Occupancy of BRD4 and H3K27ac was correlated to Bio-JQ1 occupancy at all regions of Bio-JQ1 enrichment in SUM159 cells. Pearson correlation statistics are shown (Extended Data Fig. 3a). To quantify changes in BRD4 or H3K27ac occupancy upon JQ1 treatment, all Bio-JQ1 enriched regions were ranked in SUM159 cells and then binned (n = 10). Corresponding box plots of BRD4 or H3K27ac log fold change with or without JQ1 are shown for each bin (Extended Data Fig. 3b). Mapping enhancers and super-enhancers using Bio-JQ1 occupancy or BRD4. Enhancers and super enhancers (SEs) were mapped using the ROSE software package described12, 13 and available at (http://younglab.wi.mit.edu/super_enhancer_code.html). In SUM159 and SUM159R cells, Bio-JQ1 Chem-Seq enriched regions were used to map enhancers and super enhancers (Fig. 1f). In SUM149 cells, BRD4 ChIP-seq enriched regions were used to map enhancers and super enhancers (Extended Data Fig. 3a). Enhancers are defined as regions of Bio-JQ1 binding not contained in promoters. Quantifying changes in gene expression of super enhancer proximal genes. Genes within 50 kb of super enhancer in SUM159 or SUM149 were identified and filtered for expression status (>1 FPKM expression in any sample), and filtered to remove non poly-adenylated transcripts (for example, microRNAs). For SUM159, log fold changes in gene expression at super-enhancer-associated genes or all expressed genes was compared at 3, 12, and 24 h post JQ1 treatment (Fig. 1g). For SUM149, comparisons were made at 12 h post JQ1 treatment (Extended Data Fig. 3f). The statistical significance of differences between distributions of changes was also assessed using a Welch’s two-tailed t test. Identifying differentially expressed genes upon JQ1 treatment. To identify genes differentially regulated by JQ1 treatment in SUM159 or SUM149 cells, all genes with a >1 log fold change in expression were ordered by fold change at 24 h with or without JQ1 for SUM159 or at 12 h with or without JQ1 for SUM149. The log row median normalized fold change for each gene is displayed as a heat map in Extended Data Fig. 3g for SUM159 and in Extended Data Fig. 3h for SUM149. For subsequent gene set and pathway analysis, SUM159 genes with consistent and statistically significantly altered expression were selected using a Welch’s two-tailed t test between DMSO and JQ1 treated expression values at 12 and 24 h. A P value cut-off of 0.01 was applied (Extended Data Fig. 3k). Identifying gained/lost super enhancers between SUM159 and SUM159R. Super enhancer differential regions were defined as in Brown et al. 201436. Briefly, in order to quantify changes in super-enhancers between two conditions, background subtracted ChIP-Seq signal was calculated at the set of all enhancer regions considered super in at least one condition. Gained/lost super-enhancers were determined as those with a greater than log fold change signal in either direction. The log fold change in Bio-JQ1 occupancy at all rank ordered super-enhancer-containing regions is shown in Fig. 2c. Super enhancer regions were classified as either gained, conserved, or lost. Gained/lost regions were classified as those with >1 log fold change in either direction. Conserved regions were classified as those with <0.25 log fold change in either direction. The log fold change in either BRD4 or proximal (within 50 kb of region) gene expression is shown in Extended Data Fig. 5d–f. Quantifying changes in BRD4 and H3K27ac occupancy upon JQ1 treatment in either SUM159 or SUM159R cells at Bio-JQ1 regions. Log fold changes in BRD4 or H3K27ac were quantified at Bio-JQ1 enriched regions in their respective cell line and shown in Extended Data Fig. 5c. Quantifying changes in BRD4 and H3K27ac as a function of Bio-JQ1 or BRD4 occupancy. Bio-JQ1 enriched regions in SUM159 or BRD4 enriched regions in SUM149 were ranked by increasing levels and then distributed into 10 bins. Log fold changes in BRD4 or H3K27ac were quantified in each bin of regions and displayed as a box plot (Extended Data Fig. 3b, c). Quantifying changes in BRD4 occupancy upon JQ1 treatment in all TNBC. Log fold changes in BRD4 upon JQ1 treatment were quantified at BRD4 enriched regions in each respective cell line Extended Data Fig. 6c. All code related to genomic and transcriptome analysis can be found at https://github.com/BradnerLab/TNBC.


News Article | December 5, 2016
Site: www.eurekalert.org

SAN DIEGO, CA (December 5, 2016)--Researchers from Columbia University Medical Center and NewYork-Presbyterian reported that 8 out of 12 patients with relapsed and/or chemotherapy refractory acute myeloid leukemia (AML) or other blood cancers responded to a regimen including the chemotherapy drugs thioguanine and decitabine. Results from this small phase I study were reported at the American Society of Hematology's annual conference. "Outcomes are typically poor for older patients with advanced blood cancers, and new therapies are desperately needed to help patients with these cancers achieve remission," said Mark Frattini, MD, PhD, associate professor of medicine at Columbia University Medical Center (CUMC) and blood cancer specialist at NewYork-Presbyterian. "While our study was small, the response we saw in this phase I, dose-escalating trial was encouraging." Previously, Frattini and colleagues had used a proprietary chemosensitivity screening assay to demonstrate that combining thioguanine and decitabine--chemotherapy drugs that are commonly used as single agents to treat patients with AML--restored therapeutic efficacy in leukemia cells from patients with relapsed and/or refractory disease. In this study, the researchers tested the efficacy of the combination therapy in 12 older patients (median age of 67 years) with relapsed or chemotherapy refractory AML or chronic myelomonocytic leukemia, including 6 patients whose disease progressed after being treated previously with decitabine as a single agent. Of these, 11 patients completed the first treatment cycle, and 6 completed a second cycle, with a median of 3 rounds of treatment. Eight of the 11 evaluable patients responded to the combination therapy, including 6 who achieved a complete remission (5 in complete remission with incomplete count recovery). In addition, all of the patients who had progressed after prior treatment with decitabine alone responded to the combination therapy, demonstrating that the combination could overcome disease resistance to decitabine. Chemosensitivity assay results, obtained before treatment, accurately predicted each patient's response to the combination therapy. After treatment with the combination therapy, 4 of the responders went on to have a stem cell transplant. "The goal of chemotherapy for patients with relapsed and/or refractory AML and other blood cancers is to achieve a remission that enables them to undergo a potentially curative stem cell transplant," said Dr. Frattini. "With our phase I results, we have shown that this combination therapy can get some patients--including those who failed to respond to or progressed after previous chemotherapy treatment with a single agent such as decitabine--to that point. The next challenge for hematologic oncologists is to reduce morbidity and mortality associated with stem cell transplantation." After the study, 2 of the patients who had a stem cell transplant died from transplant-related toxicity, and another relapsed. One patient has remained in remission for more than 2 years. The study is titled, "Final Results of a Phase I Trial of a Pharmacodynamically Conceived Thioguanine/Decitabine Combination in Patients with Advanced Myeloid Malignancies." The other contributors are: Daniel J. Lee (Columbia University Medical Center, New York, NY), Todd L. Rosenblat (CUMC), Mark Lawrence Heaney (CUMC), Joseph G. Jurcic (CUMC), Azra Raza (CUMC), Kristina Gazivoda (CUMC), Katherine Harwood (CUMC), Ryan Shelton (CUMC), Hakim Djaballah (Institut Pasteur Korea, Seoul, Republic of Korea), Joseph M. Scandura (Weill Cornell/NewYork-Presbyterian, New York, NY), and Anthony Letai (Dana-Farber Cancer Institute, Boston, MA). The study was supported by an award from the Herbert Irving Comprehensive Cancer Center at Columbia University Medical Center. Dr. Jurcic's research is funded by Astellas. Dr. Letai receives funding from and is a consultant for from Astra-Zeneca, Tetralogic, and AbbVie. The researchers declare no additional conflicts of interest. Columbia University Medical Center provides international leadership in basic, preclinical, and clinical research; medical and health sciences education; and patient care. The medical center trains future leaders and includes the dedicated work of many physicians, scientists, public health professionals, dentists, and nurses at the College of Physicians and Surgeons, the Mailman School of Public Health, the College of Dental Medicine, the School of Nursing, the biomedical departments of the Graduate School of Arts and Sciences, and allied research centers and institutions. Columbia University Medical Center is home to the largest medical research enterprise in New York City and State and one of the largest faculty medical practices in the Northeast. The campus that Columbia University Medical Center shares with its hospital partner, NewYork-Presbyterian, is now called the Columbia University Irving Medical Center. For more information, visit cumc.columbia.edu or columbiadoctors.org. NewYork-Presbyterian is one of the nation's most comprehensive healthcare delivery networks, focused on providing innovative and compassionate care to patients in the New York metropolitan area and throughout the globe. In collaboration with two renowned medical school partners, Weill Cornell Medicine and Columbia University College of Physicians & Surgeons, NewYork-Presbyterian is consistently recognized as a leader in medical education, groundbreaking research and clinical innovation. NewYork-Presbyterian has four major divisions: NewYork-Presbyterian Hospital is ranked #1 in the New York metropolitan area by U.S. News and World Report and repeatedly named to the magazine's Honor Roll of best hospitals in the nation; NewYork-Presbyterian Regional Hospital Network is comprised of leading hospitals in and around New York and delivers high-quality care to patients throughout the region; NewYork-Presbyterian Physician Services connects medical experts with patients in their communities; and NewYork-Presbyterian Community and Population Health features the hospital's ambulatory care network sites and operations, community care initiatives and healthcare quality programs, including NewYork Quality Care, established by NewYork-Presbyterian, Weill Cornell and Columbia. NewYork-Presbyterian is one of the largest healthcare providers in the U.S. Each year, nearly 29,000 NewYork-Presbyterian professionals deliver exceptional care to more than 2 million patients. For more information, visit http://www. and find us on Facebook, Twitter and YouTube.


News Article | February 20, 2017
Site: www.eurekalert.org

PORTLAND, OR - Nine years ago, SWOG researchers confirmed a new standard of care for patients with incurable gastrointestinal stromal tumors (GIST), who could survive by being treated with imatinib mesylate, the breakthrough drug marketed as Gleevec. SWOG researchers are back with long-term findings from that study, which estimate that nearly one in four patients treated with Gleevec will survive 10 years. Results are published in JAMA Oncology. "This is a really exciting finding," said Dr. Michael Heinrich, a SWOG investigator and a professor of medicine and cell and developmental biology at Oregon Health & Science University, where SWOG is based. "Until Gleevec arrived on the scene 15 years ago, patients with advanced GISTs faced a life expectancy of 18 months. Now we've learned that some might live a decade or longer. And we've come to understand which class of patients benefit the most from Gleevec." In new study results published in JAMA Oncology, researchers from SWOG, the international cancer research community supported by the National Cancer Institute, report a follow-up of patients originally enrolled in S0033, a SWOG-led trial supported by other groups in the NCI's National Clinical Trials Network (NCTN). This was a Phase III study that began in 2000. Initial results published in 2008 confirmed Gleevec as an effective treatment for advanced GIST patients, and recommended that therapy start with a 400 mg daily dose. The SWOG team decided to collect post-study data on S0033 patients, and from 2011 to 2015 gathered information. As part of their research, the team used next-generation DNA sequencing on some tumor tissue samples taken for S0033, which had been deposited in a biospecimen bank. The team reanalyzed tissue from 20 patients originally classified as having a wild-type tumor - one without any mutations of KIT, a gene implicated in 85 to 88 percent of all GISTs. Analysis showed that of the 695 eligible patients originally enrolled in S0033, 189 survived eight years or longer, with a 10-year estimate of overall survival of 23 percent, or nearly one in four patients. DNA sequencing also showed that survival rates were significantly higher for patients with a KIT exon-11 mutant GIST, when compared with patients whose tumor had a KIT exon-9 mutation or with no KIT mutations or mutations in the platelet-derived growth factor receptor gene, or PDGFRA. "Our findings show two things," Heinrich said. "One is that Gleevec has revolutionized treatment for patients with advanced GISTs. Our findings also highlight the importance of banked biospecimens to drive new scientific findings, and how tumor mutation testing can optimize treatment for cancer patients." GISTs are different from more common types of gastrointestinal tumors because of the type of tissue in which they start. GISTs belong to a group of cancers called soft-tissue sarcomas. Soft-tissue sarcomas develop in the tissues that support and connect the body, including muscles, nerves, tendons, and joints. GIST is a rare cancer, with about 6,000 new cases diagnosed in the United States each year. Researchers at Oregon Health & Science University have pioneered the treatment of GISTs. Dr. Brian Druker, director of the OHSU Knight Cancer Institute, conducted the most influential work in the development of Gleevec, and OHSU researchers have been part of major discoveries in the use of the drug to treat GISTs, as well as chronic myeloid leukemia (CML) and acute lymphoblastic leukemia (ALL). Along with Heinrich, lead author of the JAMA Oncology article, the SWOG study team includes: Cathryn Rankin, MS, of Fred Hutchinson Cancer Research Center; Dr. Charles D. Blanke of Knight Cancer Institute; Dr. George Demetri of Dana-Farber Cancer Institute; Dr. Ernest Borden of Cleveland Clinic; Dr. Christopher Ryan of Knight Cancer Institute; Dr. Margaret von Mehren of Fox Chase Cancer Center; Dr. Martin Blackstein of Mount Sinai Hospital; Dr. Dennis Priebat of MedStar Hospital Research Center; Dr. William Tap of Memorial Sloan Kettering Cancer Center; Dr. Robert Maki of Norwell Health and Cold Spring Harbor Laboratory; Dr. Christopher Corless of Knight Cancer Institute; Dr. Jonathan Fletcher of Dana-Farber Cancer Institute; Kouros Owzar, PhD, of Duke University School of Medicine; John Crowley, PhD, of Cancer Research And Biostatistics; Dr. Robert Benjamin of University of Texas MD Anderson Cancer Center; and Laurence Baker, DO, of University of Michigan. Research reported in this article was supported by the NCI of the National Institutes of Health (NIH) in part under award numbers U10CA180888 and U10CA180819. The content is solely the responsibility of the authors and does not necessarily represent the official views of the NIH. Novartis Pharmaceuticals also supported the research. SWOG is a global cancer research community of over 12,000 members in 47 states and six foreign countries who design and conduct publicly funded clinical trials. Since 1956, SWOG trials have led to the approval of 14 cancer drugs, changed more than 100 standards of cancer care, and saved more than 2 million years of human life. The group is a proud member of the NCI's National Clinical Trials Network and the NCI Community Oncology Research Program, and is a major part of the cancer research infrastructure in the U.S. and the world. Headquartered at the Knight Cancer Institute at Oregon Health & Science University in Portland, Ore., SWOG's Statistics and Data Management Center is based at Fred Hutchinson Cancer Research Center in Seattle, Wash. and its Operations Office is located in San Antonio, Texas. Learn more at swog.org.


LONDON--(BUSINESS WIRE)--Hutchison China MediTech Limited (“Chi-Med”) (AIM/Nasdaq: HCM) and AstraZeneca PLC (“AstraZeneca”) will present data from the ongoing Phase II clinical trial of savolitinib in patients with papillary renal cell carcinoma (“PRCC”) at the 2017 Genitourinary Cancers Symposium sponsored by the American Society of Clinical Oncology (“ASCO-GU”), to be held in Orlando, Florida from February 16 to 18, 2017. Savolitinib, a highly selective inhibitor of c-Met receptor tyrosine kinase, has shown early clinical benefit in multiple Phase I and II studies in a number of cancers. It was developed as a potent and highly selective oral inhibitor specifically designed to address issues observed in the clinic with first-generation c-Met inhibitors, including renal toxicity. PRCC, the second most common histologic subtype of renal cell carcinoma (“RCC”), is associated with alterations in the c-Met gene (e.g. mutations, amplifications, and/or chromosomal changes). Therapies that are currently available for RCC patients have demonstrated only modest benefit in PRCC and there are no therapies specifically approved for the treatment of c-Met-driven PRCC. National Comprehensive Cancer Network guidelines recommend enrolling patients in clinical trials for first-line systemic therapy. “There is a clear unmet medical need in PRCC,” said Toni Choueiri, Director of the Lank Center for Genitourinary Oncology, Dana-Farber Cancer Institute. “The dataset from this Phase II study is compelling, with a very clear efficacy signal in MET-driven patients and an encouraging long duration of response, while remaining very well tolerated.” He added, “These results support the initiation of the pivotal Phase III trial in a selected population of MET-driven PRCC. This innovative patient selection approach would be the first ever molecularly selected trial in renal cell carcinoma.” “We are delighted to report this highly encouraging progression-free survival data in Met-driven papillary renal cell carcinoma, a disease with no approved treatment options,” said Christian Hogg, Chief Executive Officer of Chi-Med. “With development of the companion diagnostic assay to screen Met-driven disease now also complete we are preparing for the initiation of our global Phase III study, the first global registration trial for savolitinib.” The current Phase II trial is the largest prospective clinical study ever conducted in PRCC patients. It is a global single arm study of savolitinib in 109 patients with locally advanced or metastatic PRCC and was initiated in May 2014. It is being conducted in 22 clinical centers in the US, Canada, UK, and Spain, and completed enrollment in October 2015. Additional details about this study may be found at clinicaltrials.gov, using identifier NCT02127710. The most recent results of the study will be presented in detail as follows: Once presented, the presentation will be available at www.chi-med.com/news. Further information about ASCO-GU is available at gucasym.org. Chi-Med and AstraZeneca are currently initiating a global pivotal Phase III trial, the first pivotal study ever conducted in c-Met-driven PRCC and the first molecularly selected trial in RCC. Over the course of 2017, Chi-Med and AstraZeneca are also conducting a comprehensive molecular epidemiology study of approximately 300 PRCC patient samples to further understand the correlations between c-Met alterations and patient outcomes, including any predictive biomarkers. A single-arm biomarker-based phase II trial of savolitinib in patients with advanced papillary renal cell cancer (PRCC) 1Dana-Farber Cancer Institute, Boston, US 2Fox Chase Cancer Center, Philadelphia, US 3Sarah Cannon Research Institute, London, UK 4MD Anderson Cancer Centre, Houston, US 5Tom Baker Cancer Center, Calgary, Canada 6Barts Cancer Institute, London, UK 7AstraZeneca, Waltham, US, 8AstraZeneca, Cambridge, UK 9Institute Gustave Roussy, Paris, France 10City of Hope, Duarte, US Background: Savolitinib (HMPL-504/Volitinib, AZD6094) is a potent, selective mesenchymal epithelial transition (“MET”) inhibitor (IC of 4 nM). MET and its ligand, hepatocyte growth factor (“HGF”), are known to play an important role in the molecular events underlying oncogenesis in PRCC, a disease without a clear standard of care and marked by alterations of chromosome 7 (containing both MET and HGF genes) in a majority of patients as well as gene amplification or MET kinase domain mutations (Albiges et al 2014, Linehan et al, 2015). Methods: This study evaluates savolitinib in PRCC patients dosed at 600 mg daily until disease progression. Objective Response Rate (“ORR”) is the primary endpoint. Progression-Free Survival (“PFS”) & Duration of Response are secondary endpoints. Patient Reported Outcome (“PRO”) and Health-Related Quality of Life (“HRQoL”) questionnaires are exploratory endpoints. Eligibility includes naïve and previously treated metastatic PRCC, ECOG PS 0 or 1. Archival tumor was used to centrally confirm PRCC pathology post hoc and to determine MET status using Next Generation Sequencing (Foundation Medicine Inc, US). Results: As of 27 June 2016, 109 patients were dosed. Best response was PR n=8, SD n=43, PD n=48 & 10 patients were not evaluable for response. 44 patients are MET-driven (MET/HGF gene copy number gain or kinase domain mutations), 46 patients were MET-negative, 19 patients are status unknown. MET-driven pts included Papillary Type I & II histologies. All 8 responders were in the MET-driven group, 18% ORR in this subset. Median PFS in the MET-driven group was 6.2 months (95% CI: 4.1–7.0) vs. 1.4 months (95% CI: 1.4–2.7) in the MET-negative group (p=0.002). Overall 10/109 patients had adverse events (“AEs”) leading to discontinuation. 23/109 patients had ≥ Grade 3 toxicity related to savolitinib. The most common AEs (all grades) includes: nausea (39%), fatigue (27%), edema (18%) and abnormal liver function tests (LFTs) (17%). One death from hepatic encephalopathy was considered related to savolitinib. PRO & HRQoL data was not statistically analyzed, descriptive data support main efficacy findings. Conclusions: In the largest biomarker-profiled trial dedicated to PRCC, savolitinib was generally well tolerated with anti-tumor activity in MET-driven patients. These findings warrant further clinical investigation of savolitinib in MET-driven PRCC. About the Unmet Medical Need in c-Met-Driven PRCC Patients Worldwide, about 366,000 new patients are diagnosed with kidney cancer annually, and the total market for kidney cancer treatments is expected to reach US$4.5 billion in 2020, according to Frost & Sullivan. RCC accounts for approximately 80-85% of kidney cancer and has several histological sub-types with different genetic and biochemical characteristics. Among these histologic variants of RCC, clear cell RCC (“ccRCC”) is the most common, accounting for 75-80% of RCC. PRCC is the most common of the non-clear cell renal carcinomas accounting for 10-15% of RCC. The proportion of PRCC patients whose tumors are c-Met-driven has historically been estimated at 40-70%. In the largest study to date, presented at the annual meeting of the American Association for Cancer Research 2014, analysis of 220 frozen tumor samples catalogued in the French RCC Network indicated that 55-60% of PRCC patients showed gains in Chromosome 7 (i.e. c-Met amplification). The biology and molecular characteristics of PRCC are different from those of ccRCC. This results in significantly worse prognosis and treatment outcomes for patients with PRCC when compared to patients with ccRCC. Highlighting the unmet need is the fact that, although there are several drugs approved for use in RCC (the latest being approved in April 2016), these approvals were generally on the basis of studies conducted with a preponderance of ccRCC patients. The need for different agents and more specific data tailored to the PRCC disease setting has been identified as a critical gap in the care of these patients. Chi-Med is an innovative biopharmaceutical company which researches, develops, manufactures and sells pharmaceuticals and healthcare-related consumer products. Its Innovation Platform, Hutchison MediPharma Limited, focuses on discovering and developing innovative therapeutics in oncology and autoimmune diseases for the global market. Its Commercial Platform manufactures, markets, and distributes prescription drugs and consumer health products in China. Chi-Med is majority owned by the multinational conglomerate CK Hutchison Holdings Limited (SEHK: 0001). For more information, please visit: www.chi-med.com. AstraZeneca has a deep-rooted heritage in Oncology and offers a quickly growing portfolio of new medicines that has the potential to transform patients’ lives and the Company’s future. With at least six new medicines to be launched between 2014 and 2020 and a broad pipeline of small molecules and biologics in development, we are committed to advance New Oncology as one of AstraZeneca’s six Growth Platforms focused on lung, ovarian, breast and blood cancers. In addition to our core capabilities, we actively pursue innovative partnerships and investments that accelerate the delivery of our strategy, as illustrated by our investment in Acerta Pharma in hematology. By harnessing the power of four scientific platforms – Immuno-Oncology, the genetic drivers of cancer and resistance, DNA Damage Response and Antibody Drug Conjugates – and by championing the development of personalized combinations, AstraZeneca has the vision to redefine cancer treatment and one day eliminate cancer as a cause of death. AstraZeneca is a global, science-led biopharmaceutical company that focuses on the discovery, development and commercialization of prescription medicines, primarily for the treatment of diseases in three main therapy areas – Oncology, Cardiovascular & Metabolic Diseases and Respiratory. The Company also is selectively active in the areas of autoimmunity, neuroscience and infection. AstraZeneca operates in over 100 countries and its innovative medicines are used by millions of patients worldwide. For more information, please visit www.astrazeneca.com and follow us on Twitter @AstraZeneca. This press release contains forward-looking statements within the meaning of the "safe harbor" provisions of the US Private Securities Litigation Reform Act of 1995. These forward-looking statements reflect Chi-Med’s current expectations regarding future events, including its expectations for the clinical development of savolitinib, plans to initiate clinical studies for savolitinib in PRCC, its expectations as to whether such studies would meet their primary or secondary endpoints, and its expectations as to the timing of the completion and the release of results from such studies. Forward-looking statements involve risks and uncertainties. Such risks and uncertainties include, among other things, assumptions regarding enrollment rates, timing and availability of subjects meeting a study’s inclusion and exclusion criteria, changes to clinical protocols or regulatory requirements, unexpected adverse events or safety issues, the ability of drug candidate savolitinib to meet the primary or secondary endpoint of a study, to obtain regulatory approval in different jurisdictions, to gain commercial acceptance after obtaining regulatory approval, the potential market of savolitinib for a targeted indication and the sufficiency of funding. Existing and prospective investors are cautioned not to place undue reliance on these forward-looking statements, which speak only as of the date hereof. For further discussion of these and other risks, see Chi-Med’s filings with the US Securities and Exchange Commission and on AIM. Chi-Med undertakes no obligation to update or revise the information contained in this press release, whether as a result of new information, future events or circumstances or otherwise.


News Article | February 15, 2017
Site: www.marketwired.com

London: Tuesday, February 14, 2017: Hutchison China MediTech Limited ("Chi-Med") (AIM/Nasdaq: HCM) and AstraZeneca PLC ("AstraZeneca") will present data from the ongoing Phase II clinical trial of savolitinib in patients with papillary renal cell carcinoma ("PRCC") at the 2017 Genitourinary Cancers Symposium sponsored by the American Society of Clinical Oncology ("ASCO-GU"), to be held in Orlando, Florida from February 16 to 18, 2017. Savolitinib, a highly selective inhibitor of c-Met receptor tyrosine kinase, has shown early clinical benefit in multiple Phase I and II studies in a number of cancers. It was developed as a potent and highly selective oral inhibitor specifically designed to address issues observed in the clinic with first-generation c-Met inhibitors, including renal toxicity. PRCC, the second most common histologic subtype of renal cell carcinoma ("RCC"), is associated with alterations in the c-Met gene (e.g. mutations, amplifications, and/or chromosomal changes). Therapies that are currently available for RCC patients have demonstrated only modest benefit in PRCC and there are no therapies specifically approved for the treatment of c-Met-driven PRCC. National Comprehensive Cancer Network guidelines recommend enrolling patients in clinical trials for first-line systemic therapy. "There is a clear unmet medical need in PRCC," said Toni Choueiri, Director of the Lank Center for Genitourinary Oncology, Dana-Farber Cancer Institute. "The dataset from this Phase II study is compelling, with a very clear efficacy signal in MET-driven patients and an encouraging long duration of response, while remaining very well tolerated." He added, "These results support the initiation of the pivotal Phase III trial in a selected population of MET-driven PRCC. This innovative patient selection approach would be the first ever molecularly selected trial in renal cell carcinoma." "We are delighted to report this highly encouraging progression-free survival data in Met-driven papillary renal cell carcinoma, a disease with no approved treatment options," said Christian Hogg, Chief Executive Officer of Chi-Med. "With development of the companion diagnostic assay to screen Met-driven disease now also complete we are preparing for the initiation of our global Phase III study, the first global registration trial for savolitinib." The current Phase II trial is the largest prospective clinical study ever conducted in PRCC patients. It is a global single arm study of savolitinib in 109 patients with locally advanced or metastatic PRCC and was initiated in May 2014. It is being conducted in 22 clinical centers in the US, Canada, UK, and Spain, and completed enrollment in October 2015. Additional details about this study may be found at clinicaltrials.gov, using identifier NCT02127710. The most recent results of the study will be presented in detail as follows: Once presented, the presentation will be available at www.chi-med.com/news. Further information about ASCO-GU is available at gucasym.org. Chi-Med and AstraZeneca are currently initiating a global pivotal Phase III trial, the first pivotal study ever conducted in c-Met-driven PRCC and the first molecularly selected trial in RCC. Over the course of 2017, Chi-Med and AstraZeneca are also conducting a comprehensive molecular epidemiology study of approximately 300 PRCC patient samples to further understand the correlations between c-Met alterations and patient outcomes, including any predictive biomarkers. ABSTRACT A single-arm biomarker-based phase II trial of savolitinib in patients with advanced papillary renal cell cancer (PRCC) 1Dana-Farber Cancer Institute, Boston, US 2Fox Chase Cancer Center, Philadelphia, US 3Sarah Cannon Research Institute, London, UK 4MD Anderson Cancer Centre, Houston, US 5Tom Baker Cancer Center, Calgary, Canada 6Barts Cancer Institute, London, UK 7AstraZeneca, Waltham, US, 8AstraZeneca, Cambridge, UK 9Institute Gustave Roussy, Paris, France 10City of Hope, Duarte, US Background: Savolitinib (HMPL-504/Volitinib, AZD6094) is a potent, selective mesenchymal epithelial transition ("MET") inhibitor (IC of 4 nM). MET and its ligand, hepatocyte growth factor ("HGF"), are known to play an important role in the molecular events underlying oncogenesis in PRCC, a disease without a clear standard of care and marked by alterations of chromosome 7 (containing both MET and HGF genes) in a majority of patients as well as gene amplification or MET kinase domain mutations (Albiges et al 2014, Linehan et al, 2015). Methods: This study evaluates savolitinib in PRCC patients dosed at 600 mg daily until disease progression. Objective Response Rate ("ORR") is the primary endpoint. Progression-Free Survival ("PFS") & Duration of Response are secondary endpoints. Patient Reported Outcome ("PRO") and Health-Related Quality of Life ("HRQoL") questionnaires are exploratory endpoints. Eligibility includes naïve and previously treated metastatic PRCC, ECOG PS 0 or 1. Archival tumor was used to centrally confirm PRCC pathology post hoc and to determine MET status using Next Generation Sequencing (Foundation Medicine Inc, US). Results: As of 27 June 2016, 109 patients were dosed. Best response was PR n=8, SD n=43, PD n=48 & 10 patients were not evaluable for response. 44 patients are MET-driven (MET/HGF gene copy number gain or kinase domain mutations), 46 patients were MET-negative, 19 patients are status unknown. MET-driven pts included Papillary Type I & II histologies. All 8 responders were in the MET-driven group, 18% ORR in this subset. Median PFS in the MET-driven group was 6.2 months (95% CI: 4.1-7.0) vs. 1.4 months (95% CI: 1.4-2.7) in the MET-negative group (p=0.002). Overall 10/109 patients had adverse events ("AEs") leading to discontinuation. 23/109 patients had ≥ Grade 3 toxicity related to savolitinib. The most common AEs (all grades) includes: nausea (39%), fatigue (27%), edema (18%) and abnormal liver function tests (LFTs) (17%). One death from hepatic encephalopathy was considered related to savolitinib. PRO & HRQoL data was not statistically analyzed, descriptive data support main efficacy findings. Conclusions: In the largest biomarker-profiled trial dedicated to PRCC, savolitinib was generally well tolerated with anti-tumor activity in MET-driven patients. These findings warrant further clinical investigation of savolitinib in MET-driven PRCC. About the Unmet Medical Need in c-Met-Driven PRCC Patients Worldwide, about 366,000 new patients are diagnosed with kidney cancer annually, and the total market for kidney cancer treatments is expected to reach US$4.5 billion in 2020, according to Frost & Sullivan. RCC accounts for approximately 80-85% of kidney cancer and has several histological sub-types with different genetic and biochemical characteristics. Among these histologic variants of RCC, clear cell RCC ("ccRCC") is the most common, accounting for 75-80% of RCC. PRCC is the most common of the non-clear cell renal carcinomas accounting for 10-15% of RCC. The proportion of PRCC patients whose tumors are c-Met-driven has historically been estimated at 40-70%. In the largest study to date, presented at the annual meeting of the American Association for Cancer Research 2014, analysis of 220 frozen tumor samples catalogued in the French RCC Network indicated that 55-60% of PRCC patients showed gains in Chromosome 7 (i.e. c-Met amplification). The biology and molecular characteristics of PRCC are different from those of ccRCC. This results in significantly worse prognosis and treatment outcomes for patients with PRCC when compared to patients with ccRCC. Highlighting the unmet need is the fact that, although there are several drugs approved for use in RCC (the latest being approved in April 2016), these approvals were generally on the basis of studies conducted with a preponderance of ccRCC patients. The need for different agents and more specific data tailored to the PRCC disease setting has been identified as a critical gap in the care of these patients. About Chi-Med Chi-Med is an innovative biopharmaceutical company which researches, develops, manufactures and sells pharmaceuticals and healthcare-related consumer products. Its Innovation Platform, Hutchison MediPharma Limited, focuses on discovering and developing innovative therapeutics in oncology and autoimmune diseases for the global market. Its Commercial Platform manufactures, markets, and distributes prescription drugs and consumer health products in China. Chi-Med is majority owned by the multinational conglomerate CK Hutchison Holdings Limited (SEHK: 0001). For more information, please visit: www.chi-med.com. About AstraZeneca in Oncology AstraZeneca has a deep-rooted heritage in Oncology and offers a quickly growing portfolio of new medicines that has the potential to transform patients' lives and the Company's future. With at least six new medicines to be launched between 2014 and 2020 and a broad pipeline of small molecules and biologics in development, we are committed to advance New Oncology as one of AstraZeneca's six Growth Platforms focused on lung, ovarian, breast and blood cancers. In addition to our core capabilities, we actively pursue innovative partnerships and investments that accelerate the delivery of our strategy, as illustrated by our investment in Acerta Pharma in hematology. By harnessing the power of four scientific platforms - Immuno-Oncology, the genetic drivers of cancer and resistance, DNA Damage Response and Antibody Drug Conjugates - and by championing the development of personalized combinations, AstraZeneca has the vision to redefine cancer treatment and one day eliminate cancer as a cause of death. About AstraZeneca AstraZeneca is a global, science-led biopharmaceutical company that focuses on the discovery, development and commercialization of prescription medicines, primarily for the treatment of diseases in three main therapy areas - Oncology, Cardiovascular & Metabolic Diseases and Respiratory. The Company also is selectively active in the areas of autoimmunity, neuroscience and infection. AstraZeneca operates in over 100 countries and its innovative medicines are used by millions of patients worldwide. For more information, please visit www.astrazeneca.com and follow us on Twitter @AstraZeneca. Forward-Looking Statements This press release contains forward-looking statements within the meaning of the "safe harbor" provisions of the US Private Securities Litigation Reform Act of 1995. These forward-looking statements reflect Chi-Med's current expectations regarding future events, including its expectations for the clinical development of savolitinib, plans to initiate clinical studies for savolitinib in PRCC, its expectations as to whether such studies would meet their primary or secondary endpoints, and its expectations as to the timing of the completion and the release of results from such studies. Forward-looking statements involve risks and uncertainties. Such risks and uncertainties include, among other things, assumptions regarding enrollment rates, timing and availability of subjects meeting a study's inclusion and exclusion criteria, changes to clinical protocols or regulatory requirements, unexpected adverse events or safety issues, the ability of drug candidate savolitinib to meet the primary or secondary endpoint of a study, to obtain regulatory approval in different jurisdictions, to gain commercial acceptance after obtaining regulatory approval, the potential market of savolitinib for a targeted indication and the sufficiency of funding. Existing and prospective investors are cautioned not to place undue reliance on these forward-looking statements, which speak only as of the date hereof. For further discussion of these and other risks, see Chi-Med's filings with the US Securities and Exchange Commission and on AIM. Chi-Med undertakes no obligation to update or revise the information contained in this press release, whether as a result of new information, future events or circumstances or otherwise.


News Article | October 11, 2016
Site: www.biosciencetechnology.com

Choosing the best treatment for a cancer patient is often an inexact science. Drugs that work well for some patients may not help others, and tumors that are initially susceptible to a drug can later become resistant. In a new approach to devising more personalized treatments, researchers at MIT and Dana-Farber Cancer Institute have developed a novel way to test tumors for drug susceptibility. Using a device that measures the masses of single cells, they can predict whether a particular drug will kill tumor cells, based on how it affects their growth rates. The researchers successfully tested this approach with a very aggressive type of brain cancer called glioblastoma and a type of blood cancer known as acute lymphoblastic leukemia. They reported their results in the Oct. 10 issue of Nature Biotechnology. “We’ve developed a functional assay that can measure drug response of individual cells while maintaining viability for downstream analysis such as sequencing,” said Scott Manalis, the Andrew (1956) and Erna Viterbi Professor in the MIT departments of Biological Engineering and Mechanical Engineering and a member of MIT’s Koch Institute for Integrative Cancer Research, who is one of the paper’s senior authors. David Weinstock and Keith Ligon of Dana-Farber Cancer Institute are also senior authors of the paper. The lead authors are Mark Stevens, a former MIT graduate student who is now a research scientist at Dana-Farber; MIT graduate student Nigel Chou; and Dana-Farber postdocs Cecile Maire and Mark Murakami. In recent years, scientists have been trying to identify genetic markers in tumors that suggest susceptibility to targeted cancer drugs. However, useful markers have been found for only a small percentage of cancers so far, and even when there is a predictive test, it is not accurate for all patients with that type of cancer. The MIT and Dana-Farber researchers took a different approach, inspired in part by a test that has been used for decades to choose antibiotics to treat bacterial infections. The antibiotic susceptibility test involves simply taking bacteria from a patient, exposing them to a range of antibiotics, and observing whether the bacteria grow or die. To translate that approach to cancer, scientists need a way to rapidly measure cell responses to drugs, and to do it with a limited number of cells available. For the past several years, Manalis’ lab has been developing a device known as a suspended microchannel resonator (SMR), which can measure cell masses 10 to 100 times more accurately than any other technique. This allows the researchers to precisely calculate growth rates of single-cells over short periods of time. In this study, Manalis’ lab worked with Dana-Farber researchers to determine whether drug susceptibility could be predicted by measuring cancer cell growth rates following drug exposure. The team analyzed different subtypes of glioblastoma or leukemia cells that have previously been shown to be either sensitive or resistant to specific  therapies: For glioblastoma, these are drugs called MDM2 inhibitors, and for acute lymphocytic leukemia, the drugs are known as BCR-ABL inhibitors. This allowed the researchers to test whether their approach would yield accurate predictions. After exposing cancer cells to the drug, the researchers waited about 15 hours and then measured the cell’s growth rates. Each cell was measured several times over a period of 15 to 20 minutes, giving the researchers enough data to calculate the mass accumulation rate. They found that cells known to be susceptible to a given therapy changed the way they accumulate mass, whereas resistant cells continued growth as if unaffected. “We’re able to show that cells we know are sensitive to therapy respond by dramatically reducing their growth rate relative to cells that are resistant,” Stevens said. “And because the cells are still alive, we have the opportunity to study the same cells following our measurement.” One major advantage of this technique is that it can be done with very small numbers of cells. In the experiments with leukemia cells, the researchers showed they could get accurate results with a tiny droplet of blood containing about 1,000 cancer cells. Another advantage is the speed at which small changes in cell mass can be measured, says Anthony Letai, an associate professor of medicine at Dana-Farber Cancer Institute, who is working on a different approach to monitoring cancer cells’ reactions to drugs. “This system is well suited to making rapid measurements,” said Letai, who was not involved in this study. “I look forward to seeing them apply this to many more cancers and many more drugs.” The researchers are now using this technique to test cells’ susceptibility and then isolate the cells and sequence the RNA found in them, revealing which genes are turned on. “Now that we have a way to identify cells that are not responding to a given therapy, we are excited about isolating these cells and analyzing them to understand mechanisms of resistance,” Manalis said. In a recent paper in Nature Biotechnology, the researchers reported on a higher throughput version of the SMR device that can do in one day the same number of measurements that took several months with the device used in this study. This is an important step toward making the approach suitable for clinical samples, Manalis says. The research was funded by the Bridge Project, a partnership between MIT’s Koch Institute and Dana-Farber/Harvard Cancer Center, and the National Cancer Institute.


News Article | October 10, 2016
Site: news.mit.edu

Choosing the best treatment for a cancer patient is often an inexact science. Drugs that work well for some patients may not help others, and tumors that are initially susceptible to a drug can later become resistant. In a new approach to devising more personalized treatments, researchers at MIT and Dana-Farber Cancer Institute have developed a novel way to test tumors for drug susceptibility. Using a device that measures the masses of single cells, they can predict whether a particular drug will kill tumor cells, based on how it affects their growth rates. The researchers successfully tested this approach with a very aggressive type of brain cancer called glioblastoma and a type of blood cancer known as acute lymphoblastic leukemia. They reported their results in the Oct. 10 issue of Nature Biotechnology. “We’ve developed a functional assay that can measure drug response of individual cells while maintaining viability for downstream analysis such as sequencing,” says Scott Manalis, the Andrew (1956) and Erna Viterbi Professor in the MIT departments of Biological Engineering and Mechanical Engineering and a member of MIT’s Koch Institute for Integrative Cancer Research, who is one of the paper’s senior authors. David Weinstock and Keith Ligon of Dana-Farber Cancer Institute are also senior authors of the paper. The lead authors are Mark Stevens, a former MIT graduate student who is now a research scientist at Dana-Farber; MIT graduate student Nigel Chou; and Dana-Farber postdocs Cecile Maire and Mark Murakami. In recent years, scientists have been trying to identify genetic markers in tumors that suggest susceptibility to targeted cancer drugs. However, useful markers have been found for only a small percentage of cancers so far, and even when there is a predictive test, it is not accurate for all patients with that type of cancer. The MIT and Dana-Farber researchers took a different approach, inspired in part by a test that has been used for decades to choose antibiotics to treat bacterial infections. The antibiotic susceptibility test involves simply taking bacteria from a patient, exposing them to a range of antibiotics, and observing whether the bacteria grow or die. To translate that approach to cancer, scientists need a way to rapidly measure cell responses to drugs, and to do it with a limited number of cells available. For the past several years, Manalis’ lab has been developing a device known as a suspended microchannel resonator (SMR), which can measure cell masses 10 to 100 times more accurately than any other technique. This allows the researchers to precisely calculate growth rates of single-cells over short periods of time. In this study, Manalis’ lab worked with Dana-Farber researchers to determine whether drug susceptibility could be predicted by measuring cancer cell growth rates following drug exposure. The team analyzed different subtypes of glioblastoma or leukemia cells that have previously been shown to be either sensitive or resistant to specific  therapies: For glioblastoma, these are drugs called MDM2 inhibitors, and for acute lymphocytic leukemia, the drugs are known as BCR-ABL inhibitors. This allowed the researchers to test whether their approach would yield accurate predictions. After exposing cancer cells to the drug, the researchers waited about 15 hours and then measured the cell’s growth rates. Each cell was measured several times over a period of 15 to 20 minutes, giving the researchers enough data to calculate the mass accumulation rate. They found that cells known to be susceptible to a given therapy changed the way they accumulate mass, whereas resistant cells continued growth as if unaffected. “We’re able to show that cells we know are sensitive to therapy respond by dramatically reducing their growth rate relative to cells that are resistant,” Stevens says. “And because the cells are still alive, we have the opportunity to study the same cells following our measurement.” One major advantage of this technique is that it can be done with very small numbers of cells. In the experiments with leukemia cells, the researchers showed they could get accurate results with a tiny droplet of blood containing about 1,000 cancer cells. Another advantage is the speed at which small changes in cell mass can be measured, says Anthony Letai, an associate professor of medicine at Dana-Farber Cancer Institute, who is working on a different approach to monitoring cancer cells’ reactions to drugs. “This system is well suited to making rapid measurements,” says Letai, who was not involved in this study. “I look forward to seeing them apply this to many more cancers and many more drugs.” The researchers are now using this technique to test cells’ susceptibility and then isolate the cells and sequence the RNA found in them, revealing which genes are turned on. “Now that we have a way to identify cells that are not responding to a given therapy, we are excited about isolating these cells and analyzing them to understand mechanisms of resistance,” Manalis says. In a recent paper in Nature Biotechnology, the researchers reported on a higher throughput version of the SMR device that can do in one day the same number of measurements that took several months with the device used in this study. This is an important step toward making the approach suitable for clinical samples, Manalis says. The research was funded by the Bridge Project, a partnership between MIT’s Koch Institute and Dana-Farber/Harvard Cancer Center, and the National Cancer Institute.


News Article | November 11, 2016
Site: www.technologyreview.com

For decades, women have had lots of options for birth control. Today these include the pill, patch, contraceptive sponge, diaphragm, Depo-Provera shot, NuvaRing vaginal ring, and intrauterine devices, or IUDs. For men, there are still just two: a condom or vasectomy. But the reason isn’t because men aren’t willing to use different methods. Research and development for male contraceptives has been slow, and the field is littered with abandoned and unfinished efforts. Investigators working on male contraceptive drugs say there are two major challenges to bringing these products to the market. For one, blocking the production of millions of sperm per day in men versus preventing the release of one egg per month in women is just more complicated, biologically speaking. Secondly, there’s little funding available for clinical trials of these drugs. Most recently, a study published in October and backed by the World Health Organization showed that a hormonal birth control injection for men effectively prevented pregnancy in their female partners. But the trial was stopped in 2011 on the recommendation of an outside panel noting one participant’s suicide and serious side effects in others, including depression. Douglas Colvard, co-author of the study and deputy director of programs at the nonprofit scientific research institute Conrad, says the results were discouraging. The hormonal drug—a combination of progestogen and testosterone—will not be moving forward in clinical trials because Conrad and the WHO have no more funding available to retest another formulation, says Colvard. Hormonal birth control for men, which is intended to suppress sperm formation, is the most widely studied form of a male contraceptive drug and has been investigated for the past four decades. One notable trial in 1,045 Chinese men testing a different injectable hormonal contraceptive was found to effectively and reversibly suppress sperm production. But the company that manufactured the drug, Zhejiang Xian Ju Pharmaceutical, never pursued further testing or regulatory approval for the injectable. “To some extent, why we haven’t seen involvement with pharma companies is that they’ve been disappointed in the past with failed products that have focused primarily on hormonal efforts,” says Aaron Hamlin, executive director of the Male Contraception Initiative, an advocacy group based in Washington, D.C. For example, German pharmaceutical company Schering and Netherlands-based company Organon partnered in 2002 to develop a hormonal male birth control pill, but that effort was dropped just a few years later. Gunda Georg, professor and head of the department of medicinal chemistry at the University of Minnesota, says she is not “not at all hopeful” that hormonal contraceptives for men will make their way to the market given the number of abandoned efforts and potential side effects. Instead, Georg’s lab is studying a non-hormonal male contraceptive option, an investigational drug called gamendazole that stunts the development of sperm. The immature sperm fragments are reabsorbed into the testis, the male organ that produce sperm, and never make it to the semen. In rats, the compound was highly effective and reversible. Georg is planning more studies in monkeys in the hopes of advancing the drug into trials in people. Another non-hormonal contraceptive method, Vasalgel, could be tested in people as soon as 2017. Developed by the Parsemus Foundation, the polymer gel is injected into the vas deferens, the tube that carries sperm to the penis. The gel is similar to an approach being studied in India called RISUG, or reversible inhibition of sperm under guidance. RISUG is in phase III clinical trials in India, but the study has been struggling to enroll enough participants. Elaine Lissner, director and founder of the Parsemus Foundation, says Vasalgel has been effective at stopping sperm production in rabbits, monkeys, baboons, and dogs. But in larger animals, researchers have had trouble reversing its effects, so Lissner says more studies need to be done. Researchers are working on non-hormonal pills, too. A team at Kings College London is studying phenoxybenzamine, which is currently used to treat high blood pressure, as a male contraceptive method. Dubbed the “clean sheets pill,” it’s a fast-acting drug meant to produce a semen-free orgasm. So far, it’s only been tested in animals. In Indonesia, scientists are testing pills synthesized from a shrub called gendarussa in hundreds of men in clinical trials. Gendarussa is thought to work by disrupting an enzyme in the sperm head, weakening its ability to penetrate the ovum. It's in phase III trials in Indonesia, but investigators would need to repeat clinical trials in the U.S. to get approval from the U.S. Food and Drug Administration. And James Bradner, of Harvard Medical School and the Dana-Farber Cancer Institute, discovered a compound called JQ1 that acts as an inhibitor to sperm production and mobility. Injections of the compound given to mice stopped sperm production drastically, and when stopped, sperm count in the mice returned to normal. Bradner and his team believe a pill version could eventually be developed for the same results. What these investigational drugs need to advance to human trials is funding. Lissner says it’s easier to get a $100,000 grant from the National Institutes of Health than it is to raise millions of dollars to conduct later stage clinical trials. NIH spent $424 million in 2015 on this area, but much of that goes to research in female contraception and reproduction. Meanwhile, Colvard’s study published in October on the failed male hormonal injection has faced a backlash because of the trial’s termination. He says the response “obviously speaks to the need for additional funding” for male contraception efforts.


Colleoni M.,Italian National Cancer Institute | Giobbie-Hurder A.,Dana-Farber Cancer Institute
Annals of Oncology | Year: 2010

Endocrine-responsive tumors that are small and without nodal involvement (i.e. tumors classified as pT1 pN0) are a heterogeneous group of tumors that are associated with a low risk of relapse in the majority of the cases. Therefore, the costs and benefits of adjuvant endocrine therapy should be carefully considered within this subgroup of patients. Treatment decisions should take into consideration co-morbidities as well as the presence of other classical risk factors such as HER2 overexpression or extensive peritumoral vascular invasion. Tamoxifen or tamoxifen plus ovarian function suppression should be considered as proper endocrine therapies in premenopausal patients. Ovarian function suppression alone or ovarian ablation might also be considered adequate in selected patients (e.g. very low-risk patients, in the presence of co-morbidities or patient preference). An aromatase inhibitor should form part of standard endocrine therapy for most postmenopausal women with receptor-positive breast cancer, although patients at low risk or with co-morbid musculoskeletal or cardiovascular risk factors may be considered suitable for tamoxifen alone. Tailored endocrine treatments should be considered in patients with endocrine-responsive tumors classified as pT1 pN0. Issues focusing on safety, quality of life and subjective side effects should be routinely discussed. © The Author 2010. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved.


Kajimura S.,University of California at San Francisco | Spiegelman B.M.,Dana-Farber Cancer Institute | Seale P.,University of Pennsylvania
Cell Metabolism | Year: 2015

Since brown adipose tissue (BAT) dissipates energy through UCP1, BAT has garnered attention as a therapeutic intervention for obesity and metabolic diseases including type 2 diabetes. As we better understand the physiological roles of classical brown and beige adipocytes, it is becoming clear that BAT is not simply a heat-generating organ. Increased beige fat mass in response to a variety of external/internal cues is associated with significant improvements in glucose and lipid homeostasis that may not be entirely mediated by UCP1. We aim to discuss recent insights regarding the developmental lineages, molecular regulation, and new functions for brown and beige adipocytes. © 2015 Elsevier Inc.


Dimopoulos M.A.,National and Kapodistrian University of Athens | Richardson P.G.,Dana-Farber Cancer Institute | Moreau P.,University of Nantes | Anderson K.C.,Dana-Farber Cancer Institute
Nature Reviews Clinical Oncology | Year: 2015

Recent developments in the treatment of multiple myeloma have led to improvements in response rates and to increased survival; however, relapse is inevitable in almost all patients. Recurrence of myeloma is typically more aggressive with each relapse, leading to the development of treatment-refractory disease, which is associated with a shorter survival. Several phase II and III trials have demonstrated the efficacy of recently approved agents in the setting of relapsed and/or refractory multiple myeloma, including immunomodulatory agents, such as lenalidomide and pomalidomide, and proteasome inhibitors, such as bortezomib and carfilzomib. Currently, however, there is no standard treatment for patients with relapsed and/or refractory disease. This Review discusses the current treatment landscape for patients with relapsed and/or refractory multiple myeloma and highlights disease-related and patient-related factors - such as pre-existing comorbidities or toxicities - that are important considerations for clinicians when selecting an appropriate treatment regimen.


Freeman G.J.,Dana-Farber Cancer Institute | Casasnovas J.M.,CSIC - National Center for Biotechnology | Umetsu D.T.,Harvard University | Dekruyff R.H.,Harvard University
Immunological Reviews | Year: 2010

The TIM (T cell/transmembrane, immunoglobulin, and mucin) gene family plays a critical role in regulating immune responses, including allergy, asthma, transplant tolerance, autoimmunity, and the response to viral infections. The unique structure of TIM immunoglobulin variable region domains allows highly specific recognition of phosphatidylserine (PtdSer), exposed on the surface of apoptotic cells. TIM-1, TIM-3, and TIM-4 all recognize PtdSer but differ in expression, suggesting that they have distinct functions in regulating immune responses. TIM-1, an important susceptibility gene for asthma and allergy, is preferentially expressed on T-helper 2 (Th2) cells and functions as a potent costimulatory molecule for T-cell activation. TIM-3 is preferentially expressed on Th1 and Tc1 cells, and generates an inhibitory signal resulting in apoptosis of Th1 and Tc1 cells. TIM-3 is also expressed on some dendritic cells and can mediate phagocytosis of apoptotic cells and cross-presentation of antigen. In contrast, TIM-4 is exclusively expressed on antigen-presenting cells, where it mediates phagocytosis of apoptotic cells and plays an important role in maintaining tolerance. TIM molecules thus provide a functional repertoire for recognition of apoptotic cells, which determines whether apoptotic cell recognition leads to immune activation or tolerance, depending on the TIM molecule engaged and the cell type on which it is expressed. © 2010 John Wiley & Sons A/S.


Love M.I.,Dana-Farber Cancer Institute | Love M.I.,Genome Biology Unit | Love M.I.,Max Planck Institute for Molecular Genetics | Huber W.,Genome Biology Unit | Anders S.,Genome Biology Unit
Genome Biology | Year: 2014

In comparative high-throughput sequencing assays, a fundamental task is the analysis of count data, such as read counts per gene in RNA-seq, for evidence of systematic changes across experimental conditions. Small replicate numbers, discreteness, large dynamic range and the presence of outliers require a suitable statistical approach. We present DESeq2, a method for differential analysis of count data, using shrinkage estimation for dispersions and fold changes to improve stability and interpretability of estimates. This enables a more quantitative analysis focused on the strength rather than the mere presence of differential expression. The DESeq2 package is available at http://www.bioconductor.org/packages/release/bioc/html/DESeq2.html. © Love et al.


Ohno H.,University of California at San Francisco | Shinoda K.,University of California at San Francisco | Spiegelman B.M.,Dana-Farber Cancer Institute | Kajimura S.,University of California at San Francisco
Cell Metabolism | Year: 2012

Brown adipose tissue dissipates energy through heat and functions as a defense against cold and obesity. PPARγ ligands have been shown to induce the browning of white adipocytes; however, the underlying mechanisms remain unclear. Here, we show that PPARγ ligands require full agonism to induce a brown fat gene program preferentially in subcutaneous white adipose. These effects require expression of PRDM16, a factor that controls the development of classical brown fat. Depletion of PRDM16 blunts the effects of the PPARγ agonist rosiglitazone on the induced brown fat gene program. Conversely, PRDM16 and rosiglitazone synergistically activate the brown fat gene program in vivo. This synergy is tightly associated with an increased accumulation of PRDM16 protein, due in large measure to an increase in the half-life of the protein in agonist treated cells. Identifying compounds that stabilize PRDM16 protein may represent a plausible therapeutic pathway for the treatment of obesity and diabetes. © 2012 Elsevier Inc.


Chen D.S.,Stanford University | Chen D.S.,Genentech | Irving B.A.,Genentech | Hodi F.S.,Dana-Farber Cancer Institute
Clinical Cancer Research | Year: 2012

The aim of T-cell-based immune therapy for cancer has been to generate durable clinical benefit for patients. Following a generation of therapies that largely showed minimal activity, substantial toxicity, and no biomarkers to identify which patients benefit from treatment, early studies are showing signs that programmed death-ligand 1 (PD-L1) and programmed death-1 (PD-1) inhibitors are highly active. Preclinical and early data from clinical studies suggest that targeting this pathway can induce durable clinical responses in patients in a variety of tumor types, including lung and colon cancer. Furthermore, correlations with tumor PD-L1 expression may enable selection of patients most likely to benefit from treatment. The emerging data not only offer the hope of better cancer therapy but also provide evidence that changes our understanding of how the host immune system interacts with human cancer. ©2012 AACR.


Matthay K.K.,University of California at San Francisco | George R.E.,Dana-Farber Cancer Institute | Yu A.L.,University of California at San Diego
Clinical Cancer Research | Year: 2012

Neuroblastoma, the most common extracranial solid tumor in children, is derived from neural crest cells. Nearly half of patients present with metastatic disease and have a 5-year event-free survival of <50%. New approaches with targeted therapy may improve efficacy without increased toxicity. In this review we evaluate 3 promising targeted therapies: (i) 131I- metaiodobenzylguanidine (MIBG), a radiopharmaceutical that is taken up by human norepinephrine transporter (hNET), which is expressed in 90% of neuroblastomas; (ii) immunotherapy with monoclonal antibodies targeting the GD2 ganglioside, which is expressed on 98% of neuroblastoma cells; and (iii) inhibitors of anaplastic lymphoma kinase (ALK), a tyrosine kinase that is mutated or amplified in ∼10% of neuroblastomas and expressed on the surface of most neuroblastoma cells. Early-phase trials have confirmed the activity of 131I-MIBG in relapsed neuroblastoma, with response rates of ∼30%, but the technical aspects of administering large amounts of radioactivity in young children and limited access to this agent have hindered its incorporation into treatment of newly diagnosed patients. Anti-GD2 antibodies have also shown activity in relapsed disease, and a recent phase III randomized trial showed a significant improvement in event-free survival for patients receiving chimeric anti-GD2 (ch14.18) combined with cytokines and isotretinoin after myeloablative consolidation therapy. A recently approved small-molecule inhibitor of ALK has shown promising preclinical activity for neuroblastoma and is currently in phase I and II trials. This is the first agent directed to a specific mutation in neuroblastoma, and marks a new step toward personalized therapy for neuroblastoma. Further clinical development of targeted treatments offers new hope for children with neuroblastoma. ©2012 AACR.


Barabasi A.-L.,Northeastern University | Barabasi A.-L.,Dana-Farber Cancer Institute | Barabasi A.-L.,Harvard University | Gulbahce N.,Northeastern University | And 3 more authors.
Nature Reviews Genetics | Year: 2011

Given the functional interdependencies between the molecular components in a human cell, a disease is rarely a consequence of an abnormality in a single gene, but reflects the perturbations of the complex intracellular and intercellular network that links tissue and organ systems. The emerging tools of network medicine offer a platform to explore systematically not only the molecular complexity of a particular disease, leading to the identification of disease modules and pathways, but also the molecular relationships among apparently distinct (patho)phenotypes. Advances in this direction are essential for identifying new disease genes, for uncovering the biological significance of disease-associated mutations identified by genome-wide association studies and full-genome sequencing, and for identifying drug targets and biomarkers for complex diseases. © 2011 Macmillan Publishers Limited. All rights reserved.


Lane S.W.,QIMR Berghofer Medical Research Institute | Williams D.A.,Dana-Farber Cancer Institute | Williams D.A.,Harvard Stem Cell Institute | Watt F.M.,King's College London
Nature Biotechnology | Year: 2014

The field of regenerative medicine holds considerable promise for treating diseases that are currently intractable. Although many researchers are adopting the strategy of cell transplantation for tissue repair, an alternative approach to therapy is to manipulate the stem cell microenvironment, or niche, to facilitate repair by endogenous stem cells. The niche is highly dynamic, with multiple opportunities for intervention. These include administration of small molecules, biologics or biomaterials that target specific aspects of the niche, such as cell-cell and cell-extracellular matrix interactions, to stimulate expansion or differentiation of stem cells, or to cause reversion of differentiated cells to stem cells. Nevertheless, there are several challenges in targeting the niche therapeutically, not least that of achieving specificity of delivery and responses. We envisage that successful treatments in regenerative medicine will involve different combinations of factors to target stem cells and niche cells, applied at different times to effect recovery according to the dynamics of stem cell-niche interactions. © 2014 Nature America, Inc.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2013-04-12

The present invention provides novel compounds of formula (I) and pharmaceutical compositions thereof. The inventive compounds are useful as deacetylase inhibitors (e.g., histone deacetylase inhibitors) and may be useful in the treatment of proliferative diseases such as cancer. In particular, the inventive compounds are HDAC6 inhibitors. The invention also provide synthetic methods for preparing the inventive compounds.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2016-04-21

The present invention comprises compositions, methods, and devices for creating an infection-mimicking environment within a polymer scaffold to stimulate antigen-specific dendritic cell activation. Devices of the present invention are used to provide protective immunity to subjects against infection and cancer.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2016-04-21

The present invention comprises compositions, methods, and devices for creating an stimulating an antigen-specific dendritic cell immune response. Devices and methods provide prophylactic and therapeutic immunity to subjects against cancer and infectious agents.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2013-07-24

The invention involves the synthesis of nucleic acid structures of controlled size and shape and comprised of a plurality of oligonucleotides. The structures are formed, at least in part, by the self-assembly of single-stranded oligonucleotides. The location of each oligonucleotide in the resultant structure is known. Accordingly, the structures may be modified with specificity.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2013-11-01

Novel polypeptides and methods of making and using the same are described herein. The polypeptides include cross-linking (hydrocarbon stapling) moieties to provide a tether between two amino acid moieties, which constrains the secondary structure of the polypeptide. The polypeptides described herein can be used to treat diseases characterized by excessive or inadequate cellular death.


Patent
Arizona State University, Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2016-08-10

The present invention provides reagents and methods for breast cancer detection.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2013-03-15

Novel antiviral compounds of Formulae (I)-(III) are provided: (I) (II) (III) The inventive compounds, pharmaceutical compositions thereof, and kits including the inventive compounds are useful for the prevention and treatment of infectious diseases caused by viruses, for example, by Flaviviridae virus (e.g., Dengue virus (DENY)), Kunjin virus, Japanese encephalitis virus, vesicular stomatitis virus (VSV), herpes simplex virus 1 (HSV-1), human cytomegalovirus (HCMV), poliovirus, Junin virus, Ebola virus, Marburg virus (MARV), Lassa fever virus (LASV), Venezuelan equine encephalitis virus (VEEV), or Rift Valley Fever virus (RVFV).


Patent
Novartis, Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2015-10-13

Antibody molecules that specifically bind to PD-L1 are disclosed. Combination therapies comprising the anti-PD-L1 antibody molecules are also disclosed. The anti-PD-L1 antibody molecules can be used to treat, prevent and/or diagnose cancerous or infectious conditions and disorders.


Patent
The Broad Institute Inc., Dana-Farber Cancer Institute, The General Hospital Corporation and President And Fellows Of Harvard College | Date: 2014-11-24

The present invention relates to methods of determining a cancer treatment prognosis for a subject in need thereof by evaluating epigenetic and genetic changes within a tumor sample from the subject. The present invention further provides methods of treating cancer in a subject by evaluating epigenetic and genetic changes within a tumor sample from the subject. In addition, the present invention provides methods of screening test agents to identify agents that decrease tumor cell plasticity.


Patent
Emory University, Dana-Farber Cancer Institute, Brigham, Women's Hospital and President And Fellows Of Harvard College | Date: 2016-08-30

The present invention provides methods and compositions for the treatment, prevention, or reduction of persistent infections, such as chronic infections, latent infections, and slow infections and cancer. The methods and compositions of the invention are also useful for the alleviation of one or more symptoms associated with such infections and cancer.


Patent
Novartis, Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2015-01-23

Antibody molecules that specifically bind to PD-1 are disclosed. The anti-PD-1 antibody molecules can be used to treat, prevent and/or diagnose cancerous or infectious conditions and disorders.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2016-03-23

Stably cross-linked polypeptides related to human MAML are disclosed. These cross-linked polypeptides contain two modified amino acids that form an internal cross-link that stabilise the alpha-helical secondary structure. The use of the stably cross-linked polypeptides in therapy is described.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2011-01-05

Fluorinated deacetylase inhibitors of the general formulae (I), (II), and (III): and pharmaceutically acceptable salts thereof, as described herein, are useful as inhibitors of histone deacetylases or other deacetylases, and thus are useful for the treatment of various diseases and disorders associated with acetylase activity as described herein (e.g., cancer, neurodegenerative diseases, inflammatory diseases).


Krop I.E.,Dana-Farber Cancer Institute | Kim S.-B.,University of Ulsan | Gonzalez-Martin A.,University of Texas M. D. Anderson Cancer Center | LoRusso P.M.,Barbara Ann Karmanos Cancer Institute | And 5 more authors.
The Lancet Oncology | Year: 2014

Background: Patients with progressive disease after two or more HER2-directed regimens for recurrent or metastatic breast cancer have few effective therapeutic options. We aimed to compare trastuzumab emtansine, an antibody-drug conjugate comprising the cytotoxic agent DM1 linked to trastuzumab, with treatment of physician's choice in this population of patients. Methods: This randomised, open-label, phase 3 trial took place in medical centres in 22 countries across Europe, North America, South America, and Asia-Pacific. Eligible patients (≥18 years, left ventricular ejection fraction ≥50%, Eastern Cooperative Oncology Group performance status 0-2) with progressive HER2-positive advanced breast cancer who had received two or more HER2-directed regimens in the advanced setting, including trastuzumab and lapatinib, and previous taxane therapy in any setting, were randomly assigned (in a 2:1 ratio) to trastuzumab emtansine (3·6 mg/kg intravenously every 21 days) or physician's choice using a permuted block randomisation scheme by an interactive voice and web response system. Patients were stratified according to world region (USA vs western Europe vs other), number of previous regimens (excluding single-agent hormonal therapy) for the treatment of advanced disease (two to three vs more than three), and presence of visceral disease (any vs none). Coprimary endpoints were investigator-assessed progression-free survival (PFS) and overall survival in the intention-to-treat population. We report the final PFS analysis and the first interim overall survival analysis. This study is registered with ClinicalTrials.gov, number NCT01419197. Findings: From Sept 14, 2011, to Nov 19, 2012, 602 patients were randomly assigned (404 to trastuzumab emtansine and 198 to physician's choice). At data cutoff (Feb 11, 2013), 44 patients assigned to physician's choice had crossed over to trastuzumab emtansine. After a median follow-up of 7·2 months (IQR 5·0-10·1 months) in the trastuzumab emtansine group and 6·5 months (IQR 4·1-9·7) in the physician's choice group, 219 (54%) patients in the trastuzumab emtansine group and 129 (65%) of patients in the physician's choice group had PFS events. PFS was significantly improved with trastuzumab emtansine compared with physician's choice (median 6·2 months [95% CI 5·59-6·87] vs 3·3 months [2·89-4·14]; stratified hazard ratio [HR] 0·528 [0·422-0·661]; p<0·0001). Interim overall survival analysis showed a trend favouring trastuzumab emtansine (stratified HR 0·552 [95% CI 0·369-0·826]; p=0·0034), but the stopping boundary was not crossed. A lower incidence of grade 3 or worse adverse events was reported with trastuzumab emtansine than with physician's choice (130 events [32%] in 403 patients vs 80 events [43%] in 184 patients). Neutropenia (ten [2%] vs 29 [16%]), diarrhoea (three [<1%] vs eight [4%]), and febrile neutropenia (one [<1%] vs seven [4%]) were grade 3 or worse adverse events that were more common in the physician's choice group than in the trastuzumab emtansine group. Thrombocytopenia (19 [5%] vs three [2%]) was the grade 3 or worse adverse event that was more common in the trastuzumab emtansine group. 74 (18%) patients in the trastuzumab emtansine group and 38 (21%) in the physician's choice group reported a serious adverse event. Interpretation: Trastuzumab emtansine should be considered as a new standard for patients with HER2-positive advanced breast cancer who have previously received trastuzumab and lapatinib. Funding: Genentech. © 2014 Elsevier Ltd.


Patent
Emory University, President And Fellows Of Harvard College, Brigham, Women's Hospital and Dana-Farber Cancer Institute | Date: 2013-12-30

The present invention provides methods and compositions for the treatment, prevention, or reduction of persistent infections, such as chronic infections, latent infections, and slow infections and cancer. The methods and compositions of the invention are also useful for the alleviation of one or more symptoms associated with such infections and cancer.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2012-08-29

The invention relates to methods of treating protein degradation disorders, such cellular proliferative disorders (e.g., cancer) and protein deposition disorders (e.g., neurodegenerative disorders). The invention provides methods and pharmaceutical compositions for treating these diseases using aggresome inhibitors or combinations of aggresome inhibitors and proteasome inhibitors. The invention further relates to methods and pharmaceutical compositions for treating multiple myeloma. New HDAC/TDAC inhibitors and aggresome inhibitors are also provided as well as synthetic methodologies for preparing these compounds.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2012-10-10

The present invention provides compositions and methods to facilitate the identification of compounds that are capable of interacting with a biological macromolecule of interest. In one aspect, a composition is provided that comprises an array of one or more types of chemical compounds attached to a solid support using isocyanate or isothiocyanate chemistry, wherein the density of the array of compounds is at least 1000 spots per cm^(2). In general, these inventive arrays are generated by: (1) providing a solid support, wherein said solid support is functionalized with an isocyanate or isothiocyanate moiety capable of interacting with a desired chemical compound to form a covalent attachment; (2) providing one or more solutions of one or more types of compounds to be attached to the solid support; (3) delivering said one or more types of compounds to the solid support; and (4) catalyzing the attachment of the compound to the solid support, whereby an array is formed and the array of compounds has a density of at least 1000 spots per cm^(2). In another aspect, the present invention provides methods for utilizing these arrays to identify small molecule partners for biological macromolecules of interest.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2016-04-21

The present invention comprises compositions, methods, and devices for creating an infection-mimicking environment within a polymer scaffold to stimulate antigen-specific dendritic cell activation. Devices of the present invention are used to provide protective immunity to subjects against infection and cancer.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2016-04-21

The present invention comprises compositions, methods, and devices for creating an infection-mimicking environment within a polymer scaffold to stimulate antigen-specific dendritic cell activation. Devices of the present invention are used to provide protective immunity to subjects against infection and cancer.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2014-09-11

Cross-linked peptides related to human p53 and bind to HMD2 or a family member of HDM2 useful for promoting apoptosis, e.g., in the treatment of and identifying therapeutic agents that binding to HMD2 or a family member of HDM2.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2014-05-06

HDAC inhibitors of the general formula (I) and (II) and pharmaceutically acceptable salts thereof, as described herein, are useful as inhibitors of histone deacetylases or other deacetylases, and thus are useful for the treatment of various diseases and disorders associated with acetylase/deacetylase activity as described herein (e.g., cancer). In certain embodiments, the compounds of the invention selectively target either a class or isoform of the HDAC family. Another aspect of the invention provides an assay for determining the inhibitory effect of a test compound on an HDAC protein comprising: incubating the HDAC protein with a substrate of general formula (IIIc) in the presence of a test compound; and determining the activity of the HDAC protein.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2013-01-14

The present invention comprises compositions, methods, and devices for creating an stimulating an antigen-specific dendritic cell immune response. Devices and methods provide prophylactic and therapeutic immunity to subjects against cancer and infectious agents.


Patent
Colorado State University, University of Notre Dame and Dana-Farber Cancer Institute | Date: 2013-07-17

Analogs of largazole are described herein. Methods of treating cancer and blood disorders using largazole and largazole analogs and pharmaceutical compositions comprising the same are additionally described herein. Methods for preparing largazole analogs are likewise described.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2011-06-15

Novel polypeptides and methods of making and using the same are described herein. The polypeptides include cross-linking (hydrocarbon stapling) moieties to provide a tether between two amino acid moieties, which constrains the secondary structure of the polypeptide. The polypeptides described herein can be used to treat diseases characterized by excessive or inadequate cellular death.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2010-08-11

HDAC inhibitors of the general formula (I) and (II) and pharmaceutically acceptable salts thereof, as described herein, are useful as inhibitors of histone deacetylases or other deacetylases, and thus are useful for the treatment of various diseases and disorders associated with acetylase/deacetylase activity as described herein (e.g., cancer). In certain embodiments, the compounds of the invention selectively target either a class or isoform of the HDAC family. Another aspect of the invention provides an assay for determining the inhibitory effect of a test compound on an HDAC protein comprising: incubating the HDAC protein with a substrate of general formula (IIIc) in the presence of a test compound; and determining the activity of the HDAC protein.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2015-04-06

The invention relates to methods of treating protein degradation disorders, such cellular proliferative disorders (e.g., cancer) and protein deposition disorders (e.g., neurodegenerative disorders). The invention provides methods and pharmaceutical compositions for treating these diseases using aggresome inhibitors or combinations of aggresome inhibitors and proteasome inhibitors. The invention further relates to methods and pharmaceutical compositions for treating multiple myeloma. New HDAC/TDAC inhibitors and aggresome inhibitors are also provided as well as synthetic methodologies for preparing these compounds.


Patent
President And Fellows Of Harvard College and Dana-Farber Cancer Institute | Date: 2014-03-14

Disclosed herein are pyrimidine compounds of formula I and formula II and methods for treating or preventing a viral infection, such as infections caused by dengue virus in a subject, comprising administering to said subject an effective amount of a pyrimidine compound of formula I or formula II.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2012-07-16

In recognition of the need to develop novel therapeutic agents and efficient methods for the synthesis thereof, the present invention provides novel bifunctional, trifunctional, or multifunctional compounds for inhibiting histone deacetylases, and pharmaceutically acceptable salts and derivatives thereof. The present invention further provides methods for treating disorders regulated by histone deacetylase activity (e.g., proliferative diseases, cancer, inflammatory diseases, protozoal infections, hair loss, etc.) comprising administering a therapeutically effective amount of an inventive compound to a subject in need thereof. The present invention also provides methods for preparing compounds of the invention.


Patent
Dana-Farber Cancer Institute, Boston Childrens Hospital and President And Fellows Of Harvard College | Date: 2013-08-02

The present invention relates to compositions and methods for the immunomodulation mediated by the interaction of PD-L2 and RGMb.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2013-08-02

The present invention is based, in part, on the identification of novel antibodies that have binding affinity for both PD-L1 and PD-L2 and methods of using same. In one aspect, an isolated monoclonal antibody, or antigen-binding fragment thereof, which specifically binds both PD-L1 and PD-L2, is provided. In one embodiment, both PD-L1 and PD-L2 are human PD-L1 and human PD-L2.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2011-06-15

Novel apoptotic polypeptides and methods of making and using the same are described herein. The polypeptides include cross-linking (hydrocarbon stapling) moieties to provide a tether between two amino acid moieties, which constrains the secondary structure of the polypeptide. The polypeptides described herein can be used to treat diseases characterized by excessive or inadequate cellular death.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2012-08-22

Stably cross-linked a polypeptides related to human MAML are described. These cross-linked polypeptides contain at least two modified amino acids that together form an internal cross-link or tether that can help to stabilize the alpha-helical secondary structure that is thought to be important for binding of MAML peptides to the Notch transcription complex, a complex that includes ICN and CSL.


Patent
Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2015-12-09

Cross-linked peptides related to human p53 and bind to HMD2 or a family member of HDM2 useful for promoting apoptosis, e.g., in the treatment of and identifying therapeutic agents that binding to HMD2 or a family member of HDM2.


Patent
Emory University, Dana-Farber Cancer Institute and President And Fellows Of Harvard College | Date: 2016-09-07

PD-1 antagonists are disclosed that can be used to reduce the expression or activity of PD-1 in a subject. An immune response specific to an infectious agent or to tumor cells can be enhanced using these PD-1 antagonists in conjunction with an antigen from the infectious agent or tumor. Thus, subjects with infections, such as persistent infections can be treated using PD-1 antagonists. In additions, subjects with tumors can be treated using the PD-1 antagonists. In several examples, subjects can be treated by transplanting a therapeutically effective amount of activated T cells that recognize an antigen of interest and by administering a therapeutically effective amount of a PD-1 antagonist.


Patent
The Broad Institute Inc., The General Hospital Corporation, Dana-Farber Cancer Institute, Brigham, Women's Hospital, President And Fellows Of Harvard College and Sloan Kettering Institute For Cancer Research | Date: 2013-08-16

This invention relates to high-throughput, semi-automated methods for identifying compounds that are effective in targeting leukemia stem cells, as well as compounds identified by those methods and uses thereof for treating leukemia.


News Article | January 29, 2016
Site: www.biosciencetechnology.com

Researchers at Harvard-affiliated Boston Children’s Hospital have, for the first time, visualized the origins of cancer from the first affected cell and watched its spread in a live animal. Their work, published in the Jan. 29 issue of Science, could change the way scientists understand melanoma and other cancers and lead to new, early treatments before the cancer has taken hold. “An important mystery has been why some cells in the body already have mutations seen in cancer, but do not yet fully behave like the cancer,” said the paper’s first author, Charles Kaufman, a postdoctoral fellow in the Zon Laboratory at Boston Children’s Hospital. “We found that the beginning of cancer occurs after activation of an oncogene or loss of a tumor suppressor, and involves a change that takes a single cell back to a stem cell state.” That change, Kaufman and colleagues found, involves a set of genes that could be targeted to stop cancer from ever starting. The study imaged live zebrafish over time to track the development of melanoma. All the fish had the human cancer mutation BRAFV600E — found in most benign moles — and had also lost the tumor suppressor gene p53. Kaufman and colleagues engineered the fish to light up in fluorescent green if a gene called crestin was turned on — a “beacon” indicating activation of a genetic program characteristic of stem cells. This program normally shuts off after embryonic development, but occasionally, in certain cells and for reasons not yet known, crestin and other genes in the program turn back on. “Every so often we would see a green spot on a fish,” said Leonard Zon, director of the Stem Cell Research Program at Boston Children’s and senior investigator on the study. “When we followed them, they became tumors 100 percent of the time.” When Kaufman, Zon, and colleagues looked to see what was different about these early cancer cells, they found that crestin and the other activated genes were the same ones turned on during zebrafish embryonic development — specifically, in the stem cells that give rise to the pigment cells known as melanocytes, within a structure called the neural crest. “What’s cool about this group of genes is that they also get turned on in human melanoma,” said Zon, who is also a member of the Harvard Stem Cell Institute and a Howard Hughes Medical Institute investigator. “It’s a change in cell fate, back to neural crest status.” Finding these cancer-originating cells was tedious. Wearing goggles and using a microscope with a fluorescent filter, Kaufman examined the fish as they swam around, shooting video with his iPhone. Scanning 50 fish could take two to three hours. In 30 fish, Kaufman spotted a small cluster of green-glowing cells about the size of the head of a Sharpie marker — and in all 30 cases, these spots grew into melanomas. In two cases, he was able to see on a single green-glowing cell and watch it divide and ultimately become a tumor mass. “It’s estimated that only one in tens or hundreds of millions of cells in a mole eventually becomes a melanoma,” said Kaufman, who is also an instructor at the Harvard-affiliated Dana-Farber Cancer Institute. “Because we can also efficiently breed many fish, we can look for these very rare events. The rarity is very similar in both humans and fish, which suggests that the underlying process of melanoma formation is probably much the same in humans.” Zon, the Grousbeck Professor of Pediatric Medicine at Harvard Medical School, and Kaufman believe that their findings could lead to a new genetic test for suspicious moles to see whether the cells are behaving like neural crest cells, indicating that the stem-cell program has been turned on. They are also investigating the regulatory elements that turn on the genetic program (known as super-enhancers). These DNA elements have epigenetic functions that are similar in zebrafish and human melanoma, and could potentially be targeted with drugs to stop a mole from becoming cancerous. Zon and Kaufman posit a new model for cancer formation, going back to a decades-old concept of “field cancerization.” They propose that normal tissue becomes primed for cancer when oncogenes are activated and tumor suppressor genes are silenced or lost, but that cancer develops only when a cell in the tissue reverts to a more primitive, embryonic state and starts dividing. They believe this model may apply to most if not all cancers, not just melanoma. The study was supported by the National Institutes of Health, the National Institute of Arthritis and Musculoskeletal and Skin Diseases, the Ellison Foundation, the Melanoma Research Alliance, the V Foundation, and the Howard Hughes Medical Institute. Zon is a founder and stockholder of Fate, Inc., and Scholar Rock.


News Article | November 1, 2016
Site: www.eurekalert.org

PHILADELPHIA- - (Nov. 1, 2016) -- Treating ovarian cancer with platinum-based chemotherapy drugs such as cisplatin is initially very effective, with about four out of five patients responding favorably. However, most of these patients quickly become resistant to chemotherapy and may not respond as well to this standard treatment for the disease. Researchers at The Wistar Institute have shown that a class of drugs called bromodomain and extraterminal domain (BET) inhibitors can be used in combination with cisplatin to reduce a tumor's resistance to chemotherapy, and therefore increase the effectiveness of the drug and improve long-term survival rates. The results were published in the journal Cancer Research. "There is a tremendous need for novel therapeutic strategies for patients with chemotherapy resistant ovarian cancer, given the prevalence of the clinical challenge and the limited number of other options available," said Rugang Zhang, Ph.D., professor and co-program leader in the Gene Expression and Regulation program at Wistar and lead author of the study. "This study demonstrates how an existing class of targeted therapies could be used to potentiate the tumor suppression induced by cisplatin." Several studies have shown how cancer stem-like cells (CSCs) contribute to chemotherapy resistance. Specifically, an increase in the activity of aldehyde dehyrogenase (ALDH) due to higher levels of ALDH1A1 protein expression appears to increase resistance, while reducing its activity sensitizes epithelial ovarian cancer cells to chemotherapy, making the treatment more effective. Zhang and colleagues were able to show that BET inhibitors are able to suppress the activity of ALDH in epithelial ovarian cancer cells. Prior studies have shown that cisplatin increases ALDH activity, which then leads to cisplatin resistance. They also demonstrated that bromodomain-containing protein 4 (BRD4), one of the members of the BET family that is inhibited by BET inhibiting drugs, is a regulator of ALDH1A1 expression, and the protein is found in higher levels in epithelial ovarian cancer cell lines and high-grade serous epithelial ovarian cancer samples. To test the combination, mice with epithelial ovarian cancer-derived tumor cells were given either the combination of cisplatin and the experimental BET inhibitor JQ1 or cisplatin alone. The group that received the combination therapy experienced significantly extended survival compared with the group of mice that only received cisplatin. Additionally, the outgrowth of tumors in the group of mice that received the combination was significantly delayed. "The use of BET inhibitors for the treatment of cancer appears to be both safe and effective in clinical trials," said Yuhki Yokoyama, Ph.D., a postdoctoral fellow in the Zhang lab and first author of the study. "This combination appears to significantly extend the effectiveness of cisplatin, one of the most important drugs for treating ovarian cancer, and we hope our newly discovered approach will be validated in future clinical trials." This work was supported by the National Institutes of Health/National Cancer Institute R01CA163377, R01CA202919, CA083639, and K99CA194318, U.S. Department of Defense grants OC140632P1 and OC150446, an Ovarian Cancer Research Fund Alliance (OCRFA) Program Project Development award, and The Jayne Koskinas & Ted Giovanis Breast Cancer Research Consortium at Wistar. Hengrui Zhu is an OCRFA Ann Schreiber Mentored Investigator. Co-author Sherry Wu is supported by the OCRFA, Foundation for Women's Cancer, and Cancer Prevention and Research Institute of Texas training grants RP101502 and RP101489. Support for core facilities in this study was provided by Cancer Center Support Grant (CCSG) CA010815 to The Wistar Institute. Co-authors of this study from The Wistar Institute include Hengrui Zhu, Andrew Kossenkov, Jayamanna Wickramasignhe, Xiangfan Yin, Alessandro Gardini, Louise Showe, Qin Liu, David Speicher, Jose R. Conejo-Garcia, and Benjamin Bitler. Other co-authors include Jeong Heon Lee, Zhiguo Zhag and Tamas Ordog from the Mayo Clinic, Sherry Wu and Anil Sood from the University of Texas MD Anderson Cancer Center, Katherine Palozola and Kenneth Zaret from the Perelman School of Medicine at the University of Pennsylvania, James Bradner from Dana-Farber Cancer Institute at Harvard Medical School. The Wistar Institute is an international leader in biomedical research with special expertise in cancer research and vaccine development. Founded in 1892 as the first independent nonprofit biomedical research institute in the United States, Wistar has held the prestigious Cancer Center designation from the National Cancer Institute since 1972. The Institute works actively to ensure that research advances move from the laboratory to the clinic as quickly as possible. wistar.org.


SYDNEY, Oct. 31, 2016 /PRNewswire/ -- Australian oncology-focused biotechnology company, Novogen Ltd (ASX: NRT; NASDAQ: NVGN) today announced that it has entered into a worldwide licensing agreement with Genentech, a member of the Roche Group, to develop and commercialise GDC-0084, a small molecule inhibitor of the phosphoinositide-3-kinase (PI3K) pathway. The lead indication for GDC-0084 is glioblastoma multiforme (GBM), which is the most aggressive form of brain cancer, accounting for approximately 15% of primary brain tumours. Median overall survival is considered to be approximately 12 - 15 months from the time of diagnosis.[1] Therapies targeting the PI3K pathway have been under development by a number of pharmaceutical and biotechnology companies for several years, in various types of cancer. GDC-0084 is distinguished from most molecules in the class by its ability to cross the blood-brain barrier, potentially making it suitable for cancers of the central nervous system. Genentech has completed a phase I study of GDC-0084 in patients with recurrent GBM, and data was presented at the American Society of Clinical Oncology (ASCO) annual meeting in Chicago, IL in June 2016[2]. The study recruited 47 patients at five centres in the United States and Spain, including UCLA, Dana-Farber Cancer Institute, and Massachusetts General Hospital. In addition, GDC-0084 has an open Investigational New Drug (IND) application with the United States Food and Drug Administration (FDA), and the transaction includes a quantity of pre-manufactured drug substance that is expected to be sufficient to support a proposed phase II clinical trial. Novogen CEO, Dr James Garner, commented, "We are excited that Genentech has entrusted us to take forward this promising investigational medicine in one of the most challenging areas of cancer treatment. This is a transformative step for Novogen, and the addition of GDC-0084 to our portfolio strengthens our position as an emerging oncology biotech company. Our pipeline is now diversified across three distinct technology platforms, and we anticipate it will provide a rich flow of value-driving milestones as the company progresses." He added, "The PI3K inhibitor class is well-validated and is of considerable interest to larger pharmaceutical companies. While a number of development candidates are in clinical trials across a range of cancer types, we believe GDC-0084 is well differentiated and represents an important opportunity to contribute to the treatment of patients with glioblastoma." Under the terms of the agreement, Novogen will pay Genentech an upfront payment of US$ 5 million and performance-related consideration linked to regulatory and commercial outcomes. In addition, Genentech will receive royalty payments in-line with industry benchmarks. Genentech will immediately initiate transfer of the IND for GDC-0084 to Novogen, as well as key manufacturing and analytical processes. Novogen anticipates being able to provide an update to the market in the design, project cost, and timelines of the proposed phase II study early in the new year. GDC-0084 is a small molecule inhibitor of the PI3K / AKT / mTOR pathway, which is distinguished from other molecules in the class by its ability to penetrate the blood-brain barrier. The molecule was developed by Genentech, who completed a phase I study in recurrent glioblastoma patients, and was licensed to Novogen in October 2016. A phase II clinical trial is slated to begin in 2017. Novogen Limited (ASX: NRT; NASDAQ: NVGN) is an emerging oncology-focused biotechnology company, based in Sydney, Australia. Novogen has a portfolio of four development candidates, diversified across three distinct technologies, with the potential to yield first-in-class and best-in-class agents across a range of oncology indications. The lead program is GDC-0084, a small molecule inhibitor of the PI3K / AKT / mTOR pathway, which is being developed to treat glioblastoma multiforme. Licensed from Genentech in late 2016, GDC-0084 is anticipated to enter phase II clinical trials in 2017. Three further molecules have been developed in-house from two proprietary drug discovery platforms (superbenzopyrans and anti-tropomyosins) to treat ovarian cancer and a range of solid tumours. Cantrixil, the most advanced of these, is slated to enter clinical trials in late 2016, while Anisina and Trilexium are in preclinical development. For more information, please visit: www.novogen.com


News Article | February 23, 2017
Site: www.eurekalert.org

February 23, 2017 (Cambridge, MA) -- Proteins do most of the work inside the human body, supporting the structure, function, regulation, and repair of organs, tissues and cells. Proteins are synthesized as extended chains of amino acids that must fold into intricate three-dimensional shapes to perform their work. However, protein folding is a very delicate process: crowded conditions within a cell or environmental changes around the cell can drive proteins to misfold and clump together or aggregate--causing disease. To support effective folding, cells deploy protein-folding chaperones to protect them from misfolding and aggregation. The heat-shock proteins 90 and 70 (HSP90 and HSP70) are protein-folding chaperones that together assist a large fraction of the proteins in cells to fold and function. In so doing, these major chaperones have been shown to alter the biological effects of genetic mutations in model organisms such as in plants, yeast, flies and fish. However, it has been unclear whether and how chaperones influence the consequences of genetic mutation in humans. Researchers at the Whitehead Institute have now uncovered a role for HSP90 in humans, not only as a modifier of the effects of mutations, but as a mediator of the impact of the environment on the function of mutant proteins. And these effects of HSP90 can alter the course of human diseases. Their work is discussed in the paper, HSP90 shapes the consequences of human genetic variation, which appears today in Cell. "By helping proteins fold and function, HSP90 influences a range of characteristics in simple organisms on which natural selection can act, and thus alters the course of evolution," says Georgios Karras, lead author of the study and a post-doctoral researcher at Whitehead Institute. "Our work demonstrates that HSP90 plays a similar role in humans, and in doing so it influences how disease-causing mutations manifest within cells and in the clinic. We found that HSP90 exerts a protective role on the functions of mutant proteins it directly binds, buffering the detrimental effects of mutations they carry." While HSP90 may buffer the effect of a mutation, its ability to do so is highly susceptible to environment changes. "HSP90 evolved to cope with environmental stressors that perturb the folding of proteins within cells," says Luke Whitesell, a senior author of the paper and a senior scientist at Whitehead Institute. "Yet, because HSP90's capacity is limited it can also make the mutant protein much more sensitive to environmental challenges. We observed that even mild stresses, such as fever, can provoke major effects in cells expressing HSP90-buffered mutants. This finding may help to explain why mutations can have varied clinical manifestations from person to person." Nevertheless, HSP90 cannot buffer all mutations. Some cause such problems that they cannot be rescued and these tend to be recognized by another chaperone, HSP70. Thus, the severity of the mutations' effects are reflected in the pattern of HSP90 vs. HSP70 binding to the mutant protein. "This pattern fits well with the biochemical roles of HSP90 and HSP70 during protein-folding," Karras notes. "HSP70 binds extended stretches of amino acids that are typically hidden in the core of the normally folded protein, while HSP90 binds to partially folded proteins. A severe mutation that leads to major unfolding and loss-of-function mainly drives HSP70 binding greater than HSP90 binding. Milder mutations have the opposite effect. Based on this pattern, we estimate that HSP90 can influence the consequences of up to 25 percent of missense mutations in some genes." The study was based on data mined from more than 1,500 disease-causing mutations associated with a diverse spectrum of diseases, including the cancer-predisposing syndrome Fanconi Anemia. In the long run, this new understanding of protein folding within cells could help clinicians predict who is at risk to develop a particular disease and who is most likely to respond well to specific treatment approaches. This work was supported by the Fanconi Anemia Research Fund (to S.L.), the Department of Defense (CDMRP BCRP W81XWH-14-1-0157 to S.L.), the Harold and Leila Y. Mathers Foundation, and the NIH (R37HL052725, RO1-DK43889 and PO1HL048546 to A.D.D.; P50HG004233 and R01HG001715 to M.V. and S.L.). S.L. was an investigator of the Howard Hughes Medical Institute. G.I.K. was supported by EMBO and HFSP Long-Term Fellowships. Georgios Karras is a post-doctoral researcher and Luke Whitesell is a senior scientist in the Lindquist lab at Whitehead Institute. 1 Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA 2 Center for Cancer Systems Biology (CCSB), Dana-Farber Cancer Institute, Boston, MA 02215, USA 3 Department of Genetics, Harvard Medical School, Boston, MA 02115, USA 4 Center for DNA Damage and Repair and Department of Radiation Oncology, Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA 02215, USA 5 Department of Biology, Massachusetts Institute of Technology, and Howard Hughes Medical Institute, Cambridge MA 02139, USA 6 Correspondence to: Luke Whitesell: whitesell@wi.mit.edu Georgios Karras: gkarras@wi.mit.edu 7 Lead Contact 8 Deceased Whitehead Institute is a world-renowned non-profit research institution dedicated to improving human health through basic biomedical research. Wholly independent in its governance, finances, and research programs, Whitehead Institute shares a close affiliation with Massachusetts Institute of Technology through its faculty, who hold joint MIT appointments.


News Article | October 31, 2016
Site: www.prnewswire.co.uk

- Licensing of GDC-0084, a small molecule phosphoinositide-3-kinase (PI3K) inhibitor developed by Genentech, is ready to enter a phase II clinical trial in glioblastoma multiforme (GBM) SYDNEY, Oct. 31, 2016 /PRNewswire/ -- Australian oncology-focused biotechnology company, Novogen Ltd (ASX: NRT; NASDAQ: NVGN) today announced that it has entered into a worldwide licensing agreement with Genentech, a member of the Roche Group, to develop and commercialise GDC-0084, a small molecule inhibitor of the phosphoinositide-3-kinase (PI3K) pathway. The lead indication for GDC-0084 is glioblastoma multiforme (GBM), which is the most aggressive form of brain cancer, accounting for approximately 15% of primary brain tumours. Median overall survival is considered to be approximately 12 - 15 months from the time of diagnosis.[1] Therapies targeting the PI3K pathway have been under development by a number of pharmaceutical and biotechnology companies for several years, in various types of cancer. GDC-0084 is distinguished from most molecules in the class by its ability to cross the blood-brain barrier, potentially making it suitable for cancers of the central nervous system. Genentech has completed a phase I study of GDC-0084 in patients with recurrent GBM, and data was presented at the American Society of Clinical Oncology (ASCO) annual meeting in Chicago, IL in June 2016[2]. The study recruited 47 patients at five centres in the United States and Spain, including UCLA, Dana-Farber Cancer Institute, and Massachusetts General Hospital. In addition, GDC-0084 has an open Investigational New Drug (IND) application with the United States Food and Drug Administration (FDA), and the transaction includes a quantity of pre-manufactured drug substance that is expected to be sufficient to support a proposed phase II clinical trial. Novogen CEO, Dr James Garner, commented, "We are excited that Genentech has entrusted us to take forward this promising investigational medicine in one of the most challenging areas of cancer treatment. This is a transformative step for Novogen, and the addition of GDC-0084 to our portfolio strengthens our position as an emerging oncology biotech company. Our pipeline is now diversified across three distinct technology platforms, and we anticipate it will provide a rich flow of value-driving milestones as the company progresses." He added, "The PI3K inhibitor class is well-validated and is of considerable interest to larger pharmaceutical companies. While a number of development candidates are in clinical trials across a range of cancer types, we believe GDC-0084 is well differentiated and represents an important opportunity to contribute to the treatment of patients with glioblastoma." Under the terms of the agreement, Novogen will pay Genentech an upfront payment of US$ 5 million and performance-related consideration linked to regulatory and commercial outcomes. In addition, Genentech will receive royalty payments in-line with industry benchmarks. Genentech will immediately initiate transfer of the IND for GDC-0084 to Novogen, as well as key manufacturing and analytical processes. Novogen anticipates being able to provide an update to the market in the design, project cost, and timelines of the proposed phase II study early in the new year. GDC-0084 is a small molecule inhibitor of the PI3K / AKT / mTOR pathway, which is distinguished from other molecules in the class by its ability to penetrate the blood-brain barrier. The molecule was developed by Genentech, who completed a phase I study in recurrent glioblastoma patients, and was licensed to Novogen in October 2016. A phase II clinical trial is slated to begin in 2017. Novogen Limited (ASX: NRT; NASDAQ: NVGN) is an emerging oncology-focused biotechnology company, based in Sydney, Australia. Novogen has a portfolio of four development candidates, diversified across three distinct technologies, with the potential to yield first-in-class and best-in-class agents across a range of oncology indications. The lead program is GDC-0084, a small molecule inhibitor of the PI3K / AKT / mTOR pathway, which is being developed to treat glioblastoma multiforme. Licensed from Genentech in late 2016, GDC-0084 is anticipated to enter phase II clinical trials in 2017. Three further molecules have been developed in-house from two proprietary drug discovery platforms (superbenzopyrans and anti-tropomyosins) to treat ovarian cancer and a range of solid tumours. Cantrixil, the most advanced of these, is slated to enter clinical trials in late 2016, while Anisina and Trilexium are in preclinical development. For more information, please visit: www.novogen.com


News Article | March 1, 2017
Site: www.eurekalert.org

HOUSTON ? Anyone who uses an employee badge to enter a building may understand how a protein called ENL opens new possibilities for treating acute myeloid leukemia (AML), a fast-growing cancer of bone marrow and blood cells and the second most common type of leukemia in children and adults. Findings from a study at The University of Texas MD Anderson Cancer Center revealed the leukemia-boosting abilities of ENL, which contains a protein component called YEATS that "reads" histone proteins. Histone proteins make up chromatin, large clusters of DNA- and RNA-containing molecules comprising our body's chromosomes. Just as a scanner "reads" data on an identification badge, ENL recognizes a type of histone modification known as acetylation. Research results, which build upon a previous MD Anderson study of histone-reading proteins, are published in the March 1 online issue of Nature. The findings indicated treatment against ENL with a class of experimental drugs called bromodomain and extra-terminal (BET) inhibitors may be effective for treating AML. "Our study showed that ENL is required for disease maintenance in AML," said Xiaobing Shi, Ph.D., associate professor of Epigenetics and Molecular Carcinogenesis. "Depletion of ENL led to anti-leukemic effects, suppressing growth both in vivo and in vitro. Notably, disrupting ENL further sensitized leukemia cells to BET inhibitors." Histone modifications like acetylation serve as docking sites for reader proteins which recognize specific modifications, influencing downstream biological outcomes. While many such reader proteins have been identified for histone modifications called methylation, few are known to recognize histone acetylation. Shi's team employed CRISPR, a gene-editing tool, to deplete ENL and suppress cancer gene expression, which was crucial given that cancer cells often co-opt chromatin regulatory pathways. "Targeting epigenetic readers represents a class of anti-cancer therapy that we believe holds clinical promise," said Hong Wen, Ph.D., research assistant professor of Epigenetics and Molecular Carcinogenesis and co-first author of the paper. "Our study revealed ENL as a chromatin reader that regulates oncogenic programs, thus establishing ENL as a potential drug target for AML." MD Anderson study team members included Xiaolu Wang of the Department of Epigenetics and Molecular Carcinogenesis. Other participating institutions included The Rockefeller University, New York; Memorial Sloan Kettering Cancer Center, New York; Dana-Farber Cancer Institute, Boston; Tsinghua University, Beijing; Baylor College of Medicine, Houston; Icahn School of Medicine at Mount Sinai, New York; and Harvard Medical School; Boston. The study was funded by the National Institutes of Health (P30CA016672, RO1CA204639-01, CA66996, CA140575, 1R01CA204020, R01HG007538 and R01CA193466), the Cancer Prevention Research Institute of Texas (RP160237 and RP170285), the Leukemia and Lymphoma Society (LLS-SCOR 7006-13), the Robert A. Welch Foundation (G1719), the Major State Basic Research Development Program in China (2016FA0500700 and 2015CB910503), and the Tsinghua University Initiative Research program.


News Article | September 7, 2016
Site: www.nature.com

After more than a decade of work, and at a cost of around US$3 billion, the Human Genome Project yielded the DNA base sequence of a representative human genome in 2001. Now, some 15 years later, technological advances have created the next generation of sequencing machines, which are capable of sequencing many genomes in a day at a cost of around $1,000 each (see 'Technological leap'). “The sequencing is almost the easy part now,” says Cordelia Langford, senior scientific operations manager at the Sanger Institute in Hinxton, UK, and a participant in the original Human Genome Project. The technology is not perfect: inaccuracies still creep into the sequencing data, and some regions of DNA cannot be sequenced at all. Then huge analytical effort is required to do something useful with the data generated. Nonetheless, the ability of modern technology to achieve so quickly and cheaply what once took years of enormously expensive work is making the dream of precision medicine more plausible by the day. Genome sequencing reveals the exact order in which nucleotide molecules — each containing one of four bases, adenine (A), cytosine (C), guanine (G) and thymine (T) — are arranged along the strand of DNA. There are about 3 billion bases in a human genome sequence, arranged as complementary pairs that hold matching strands of the DNA double helix together, and they are distributed across 23 pairs of chromosomes. Patients around the world are already benefiting from genome sequencing, and the cost is falling so sharply that the practice could soon become almost routine. The Sanger Institute, for example, is sequencing the genomes of patients with rare diseases and cancer as part of the 100,000 Genomes Project organized by Genomics England. Some participants already benefit from improved diagnosis and treatment, and researchers are discovering more about the genetic variations that cause disease. Sequencing is not the only option in genetic analysis, however. A key part of the Precision Medicine Initiative, run by the US National Institutes of Health, is the more conventional, and arguably less technologically heroic, approach of genotyping. Here, the variants of specific genes that people carry are identified without knowing their full genome sequence. But genotyping requires some idea of what to look for. Sequencing is the only way to uncover everything about the DNA that governs the onset and progression of so many diseases, and to learn how our DNA keeps us healthy. To sequence a genome, you must first smash it into millions of bits. The original method used by the Human Genome Project, known as Sanger sequencing, made copies of parts of the initial fragments of DNA, each copy a single nucleotide longer than the last. These were then laboriously separated on electrophoresis gels and identified by the radioactively or fluorescently labelled nucleotides at the end of each strand. “Each of the fragments had to be sequenced one, or just a few, at a time,” explains Langford. Sanger sequencing is still in use today, albeit in a more automated form. The technological advance that allows genomes to be sequenced in a single day is massively parallel sequencing. Billions of fragments can now be sequenced and read simultaneously, Langford says. The Sanger Institute uses and tests several modern sequencing methods — part of its remit is to assess emerging technologies. Its main workhorse, however, and the method used most often in the 100,000 Genomes Project, is sequencing by synthesis (SBS). This is a finely choreographed cycle in which enzymes build strands of DNA that are complementary to template strands derived from the fragments of the genome being sequenced. Each new strand is built by adding the nucleotides that match the template one by one. At each step, fluorescently labelled nucleotides bring the synthesis process to a temporary halt. An optical analysis system then scans the strands, which are held on a glass plate about the size of a microscope slide, and detects by way of coloured signals which nucleotides have been added. The chemical groups that block further synthesis can then be cut off and washed away, and another cycle of synthesis begins. In this way, nucleotide by nucleotide, base by base, new strands are synthesized as specified by the template strands, and the sequence in which the bases are added is recorded. The technique was invented in the 1990s by University of Cambridge spin-out company Solexa, which was acquired in 2007 by Illumina, a company based in San Diego, California, that now claims a roughly 90% share of sequenced bases worldwide. “Developing the technology required the use of genetic engineering to create enzymes that will work with the modified fluorescent nucleotides,” explains Illumina's chief scientist, David Bentley. These reactions are based on the way DNA is copied in living cells. Crucial to the advancement, Bentley says, has been the move away from natural reagents. The adoption of non-natural chemistry makes modern sequencing reactions robust and efficient enough to operate at the speeds necessary to sequence genomes in hours, rather than years, he says. The next big challenge is one for software: analysing all the sequenced fragments and piecing them back together to form a three-billion-base genome sequence. Langford likens this to completing an incredibly complex jigsaw. But whereas a jigsaw puzzle comes with a complete picture for guidance, all the computer has to help it decide where the fragments should fit is the reference genome, derived from the Human Genome Project. The reference genome is a representative example of a human genome that approximates what the pieces in our individual jigsaws will create, but with slight differences that make us who we are — and these differences are central to the aims of precision medicine. Illumina's SBS is one of several technologies that can read a person's genetic code. Ion-torrent sequencing, for example, is quite similar to SBS: it also reads the sequence piece by piece from a newly synthesized strand of DNA. But rather than use a coloured marker to denote each nucleotide, the signal that distinguishes the bases comes from hydrogen ions that are released into solution when new nucleotides are added. The ions cause a detectable blip in the pH of the solution, and these blips translate into a sequence. The machine washes each nucleotide in turn through the system and monitors which one causes the ion torrent at each stage. The length of the fragments sequenced, and therefore the complexity of piecing together the jigsaw puzzle afterwards, also varies between techniques. Some of the longest fragments are sequenced by biotech company Pacific Biosciences, based in Menlo Park, California. “Our technology delivers DNA sequence reads about one hundred times longer than the short-read technologies used in most next-generation sequencing,” says Jonas Korlach, the company's chief scientific officer. “This makes understanding and assembling the sequence reads into complete genomes much easier.” Reading longer unbroken sections of DNA also helps to reveal complex long-range structural features, but such long-read technologies are often more expensive than other techniques. The UK company Oxford Nanopore Technologies uses a unique system in which DNA strands are fed through tiny protein nanopores that have been inserted into a polymer membrane. Rather than requiring any DNA synthesis, the system simply notes the sequence of nucleotides passing through the nanopore, based on specific electrical signals generated by different combinations of bases. This is the technology behind the company's MinION — a portable sequencing device about the same size as a mobile phone. Clive Brown, chief technology officer at Oxford Nanopore, says that the device weighs less than 100 g; the next-smallest box on the market is 46 kg, he adds. Portability may be most important in remote areas, such as makeshift clinics set up to tackle emerging diseases in developing countries. MinION sequencing, for example, was used to sequence short viral genomes in field hospitals during the 2014 Ebola outbreak in West Africa. Portability is simple to compare across technologies, but not all comparisons are so straightforward. Cost per sequence, for instance, depends as much on how many genomes a lab is sequencing as it does on the system being used. Accuracy can be difficult to pin down too. Manufacturers talk about accuracy of between 90% and 99.9%, often at the higher end of the range, but that still adds up to a large number of individual reads of a sequence that contain errors ( et al. Genome Med. 8, 24; 2016). For this reason, genome sequencing is often repeated multiple times to achieve a truly reliable result. Practitioners talk about sequencing to differing degrees of 'depth', depending on how many times the same DNA is sequenced to increase confidence in the results. It is the accuracy of the final collated analysis that really matters. Regardless of which sequencing technology is used, researchers and clinicians face an important decision about whether to sequence an entire genome or to take a more targeted approach. They can choose to focus on a specific region of interest in a particular chromosome. They can choose to examine only the genes that actually code for proteins or functional RNA molecules, while ignoring the vast bulk of our DNA — often misleadingly called junk DNA — that may have a crucial regulatory role or have no real function. The exome, for example, is the part of the genome comprising only the stretches of DNA called exons that code for protein molecules.Targeting only these regions is like fishing: it requires bait. As Langford explains, an exome bait can be a collection of small sections of synthetic DNA that will bind by base-pairing to regions of DNA in a sample that identify exons. Each piece of exome bait has a corresponding magnetic bead attached to it. An external magnet is used to literally pull down the exon DNA, leaving everything else to be discarded. “It is an absolutely beautifully elegant technology,” says Langford. Researchers can either devise their own baits for the specific parts of the genome they are interested in, or they can buy commercial bait kits that target either the whole exome or specific parts. “Clinical applications will differ as to whether a targeted approach is enough,” says Illumina's Bentley. Looking at whole genomes can detect the unexpected, such as genes that were not suspected of having a role in a disease and whose significance may be missed by a targeted approach. “For some studies exome sequencing may be okay, but it will become increasingly less sufficient as precision medicine builds,” Bentley says. “There will be a moral imperative to try to fully characterize every patient and not miss anything.” Many large medical centres now have dedicated gene-sequencing centres that offer the whole gamut, from whole-genome sequencing to the precise targeting of specific genes. The Dana-Farber Cancer Institute in Boston, Massachusetts, for example, outlines the choices to patients on its website,