Entity

Time filter

Source Type

CTA
Netherlands

Much of that computing isn't doing much while segregated into individual devices. But many of these gadgets have the potential to get smarter by connecting to their fellows, which in turn could open the door to a brave new "Internet of Things." To see where that might be taking us, there's no better place than the annual gadget extravaganza formerly known as the Consumer Electronics Show—and now simply as CES. The show, which starts Wednesday in Las Vegas, is the place for companies large and small to show off new connected devices. These range from the seemingly trivial—for instance, smart umbrellas that message you if you leave them behind—to the undeniably helpful, such as navigation devices that display driving directions onto your windshield so you don't have to take your eyes off the road. And while traditional consumer electronics such as phones and TVs account for about half of revenue in U.S. consumer tech, they aren't growing as quickly as newer connected devices, according to the Consumer Technology Association, the organizer of CES. For instance, smart home devices, such as cameras, thermostats and locks, are expected to grow 21 percent to 8.9 million units in 2016, or $1.2 billion in revenue. According to the McKinsey Global Institute, a division of the consulting giant McKinsey & Co., the value created by connecting the world's devices could hit $11 trillion annually by 2025, a mind-boggling sum that represents over half of U.S. economic output in a year. Most of the value comes from industrial uses—like cleaner air from smarter energy use and fewer factory shut-downs due to smarter maintenance. But trillions in benefits are expected to come from consumer-bought products: safer streets because of better-driving cars, robots that take care of household chores and health and fitness trackers that let us know when our bodies need medical attention. "There's a big value in avoiding pain and suffering," says report co-author Michael Chui. Of course, people have been making big projections for the Internet of Things for years, yet progress remains halting and fragmentary. Major technology companies can purposefully make it tougher to interact with other companies' gadgets for business reasons. More data can mean less privacy. In recent years, CES has begun catering more heavily to startups hoping to break through the noise. The sprawling show has sections for wearable fitness gadgets, drones, autonomous vehicles, education, virtual reality, video games, robots, 3-D printers and smart homes. That's largely a reaction to the fact that many of technology's biggest names have been no-shows for some time. Apple Inc. has skipped the show since the 1990s, and Microsoft Corp.'s then-CEO Steve Ballmer gave the company's last CES keynote in 2012. Google parent Alphabet Inc. and Amazon.com Inc. hold their own events to release products. And the Consumer Technology Association that runs CES is aiming for attendance this year at or below last year's record 176,000. Shawn DuBravac, the CTA's chief economist, argues the show's maturity is a good thing, its focus transforming over the last two decades from what was "technologically possible" to what's "technologically meaningful." It's no longer about a robot that can walk up steps. It's about robots that actually mow your lawn. It's worth bearing in mind that CES is first and foremost a venue for promoting the tech industry—at least the non-Google/Apple/Amazon/Microsoft part of it. Sometimes the promotion falls flat; 3-D screen technology unveiled at CES in 2010 went from the next big thing to a mostly unused feature. Netbooks introduced in 2009 took a back seat to the iPad released a year later. And concepts such as the smart home have taken a really long time to materialize. For all we know, the Internet of Things could be next on that list. Last summer, two researchers described how they hacked into and took control of a Jeep Cherokee via its cellular connection to the Internet. Cybersecurity firm Rapid7 gave a failing grade to eight of nine popular baby monitors for simple and obvious weaknesses like failing to encrypt Internet-streamed video to prevent eavesdropping or using unchangeable passwords that malicious types could easily find online. Such issues point to a deeper problem: Many would-be connected devices max out their capabilities doing one thing well, leaving little headroom for security protection that wasn't ever necessary in an unconnected world. Such gadgets could offer hackers an easy route into home or work computers. The fact that many such devices are produced by startups, often crowd-funded and on shoestring budgets, means security is often an afterthought. And the more devices there are, the bigger the potential problem. "With the Internet of Things, we really have to think in terms of scale," says Rapid7 senior security consultant Mark Stanislav. Another cautionary note: Regulators are tapping the brakes on entire industries that are getting lavish attention at CES. In December, California's Department of Motor Vehicles released restrictive draft rules for self-driving cars. They would require licensed human drivers to be ready to take the wheel. Google, which has already a prototype autonomous car that lacks a steering wheel, decried the decision, saying such handoffs could create more problems than they solve. Such regulations could also crimp the utility of self-parking cars that can act like robotic valets. Similarly, new drone rules from the Federal Aviation Administration require approval for commercial use and a $5 registration fee for hobbyists. A report released in December by Bard College's Center for the Study of the Drone said there were 241 reports to the FAA of near-collisions between drones and manned aircraft from December 2013 to September 2015. Tougher rules to corral these connected devices could mean that people will be less carefree about buying and using them. That could limit a future where you might casually throw a self-flying drone up into the air for a high-tech selfie. Explore further: 'Internet of Things' to take CES center stage


The CTA forecast that $950 billion will be spent globally on consumer electronics this year in a two percent drop from the $969 billion spent last year, while the number of actual units shipped will see little change. "We are seeing pretty flat demand while we wait for new innovations to reach consumers," CTA senior director of market research Steve Koenig said as the premier Consumer Electronics Show prepared to get under way in Las Vegas. Koenig cautioned that technology spending comparisons were "challenged" by a very strong dollar and prices dropping on market mainstays such as smartphones and tablets. "We really see the global economy starting to get back on track as we wrestle with a range of issues," Koenig said. "I think the biggest thing we are starting to come to grips with is the normalization of the slowdown in China." Smartphones and tablet computers were expected to account for 46 percent of the money spent this year on consumer electronics, but new categories such as "wearables," drones and virtual reality gear should be making their presence felt in the market, according to Koenig. When mobile computers such as laptops are included with smartphones and tablets,the share of sales in the year was predicted to be 58 percent or some $551 billion. "Over half a trillion US dollars," Koenig said of the forecast. "I give you technology's triumvirate: laptops, smartphones and tablets." He wondered aloud regarding the potential for tablets to be squeezed out by large-screen smartphones and portable computers such as the Lenovo Yoga, which are designed with screens that can be removed and used as touch-controled tablets. Smartphone shipments were predicted to cool a bit this year, growing about eight percent to 1.4 billion devices. Smartphone adoption is being pushed by progressively lower prices, which is especially important in markets such as China, Africa, and the Middle East where high-end handsets are out of reach for many people. Meanwhile, the overall category of wearable computers that includes smart watches should continue its "meteoric rise" and there will be "no shortage"of wearable computing gadgets on the CES show floor that officially opens on Wednesday, according to Koenig. Emerging markets were seen as continuing to be central to growth in the consumer electronics market, with India becoming a driving force as China shifts to lower, steady growth after a long run of booming expansion. "Even a small slowdown in China can have really big knock-down effects around the world," Koenig said of the chilling effect it has had on other regions, especially those where exporting commodities is important. "Most companies are going to start looking increasingly to India as the new place for double-digit growth year over year." LCD televisions remain "the king of screens" with sizes trending up. One in every five televisions sold this year was expected to be 50 inches, measured diagonally, or more and feature ultra high-definition 4K resolution. Televisions were likely, once again, to be stars on show floor at CES, but new talent in the form of drones, robots, 3D printers, and virtual reality, along with smart cars and homes were expected to grab attention and momentum. "Make no mistake, innovation is really reshaping the global technology industry," Koenig said.


Mice were bred in specified-pathogen-free facilities at the University Hospital Zurich and Washington University, and housed in groups of 3–5, under a 12 h light/12 h dark cycle (from 7 a.m. to 7 p.m.) at 21 ± 1 °C, with sterilized chow food (Kliba No. 3431, Provimi Kliba) and water ad libitum. Animal care and experimental protocols were in accordance with the Swiss Animal Protection Law, and approved by the Veterinary Office of the Canton of Zurich (permits 123, 130/2008, 41/2012 and 90/2013). The following mice were used in the present study: C57BL/6J, PrnpZH1/ZH1 (ref. 3), co-isogenic C57BL/6J PrnpZH3/ZH3 and PrnpWT/WT control mice6 and Schwann cell-specifc DhhCre::Gpr126fl/fl mutants3, 4. Mice of both genders were used for experiments unless specified. Archival tissues from previous studies1, 6 were also analysed in the current study. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment except where stated. Sciatic nerves from postnatal day 2–5 were dissected using microsurgical techniques. Nerves were dissociated in serum-free DMEM supplemented with 0.05% collagenase IV (Worthington) for 1 h in the incubator. Sciatic nerves were mechanically dissociated using fire-polished Pasteur pipettes. Cells were filtered in a 40-μM cell strainer and washed in Schwann cell culture medium (DMEM, Pen-Strep, Glutamax, FBS 10%) by centrifugation at 300g for 10 min. Resuspended cells were plated on 3.5 cm Petri dishes previously coated with poly-l-lysine 0.01% (w/v) and laminin (1 mg/ml). Laminin (Cat. No: L2020; from Engelbreth-Holm-Swarm murine sarcoma basement membrane) and poly- l-lysine were obtained from Sigma-Aldrich. Full-length recombinant PrP (recPrP, residues 23–231) and globular domain (GD, residues 121–231) were purified as previously described21, 22, 23. The generation of the GST fusion FT-PrP expression vector (pGEX-KG FT-PrP) was described previously; a modified purification protocol was used24. The FT-PrP expression vector was transformed into BL21 (DE3) strain of Escherichia coli (Invitrogen). Bacteria were grown in Luria-Bertani medium to an OD of 0.6, and the expression of the fusion protein was induced with 0.5 mM isopropyl-1-thio-β-d-galactopyranoside (AppliChem). Cells were then grown for another 4 h at 37 °C and 100 rpm shaking. Cells were pelleted at 5,000g for 20 min at 4 °C (Sorvall centrifuge, DuPont). The pellet was resuspended on ice in lysis buffer (phosphate-buffered saline supplemented with complete protease inhibitors (EDTA-free, Roche), phenylmethyl sulfonyl fluoride (Sigma) and 150 μM lysozyme (Sigma)) and incubated on ice for 30 min. Triton-X 100 (1%), MgCl (10 mM) and DNase I (5 μg/ml, Roche) were added, and the lysate was incubated on ice for 30 min. The lysate was than centrifuged for 20 min at 10,000g at 4 °C. Glutathione sepharose beads were washed with PBS and incubated with the cell lysate for 1 h at 4 °C on a rotating device. Beads were packed into a column and washed with PBS until a stable baseline was reached as monitored by absorbance at A using an ÄKTAprime (GE healthcare). The fusion protein was cleaved on the beads with 5 U/ml Thrombin (GE Healthcare) for 1 h at room temperature under agitation. For thrombin removal, benzamidine sepharose beads were added and incubated for 1 h at 4 °C on a rotating wheel. Protein preparations were analysed by 12% NuPAGE gels followed by Coomassie- or silver-staining. To achieve a higher purity of the protein, we next applied the protein to a sulfopropyl (SP) sepharose column equilibrated with 50 mM Tris-HCl buffer, pH 8.5. Elution was performed with a linear NaCl gradient of 0–1,000 mM. Fractions containing the protein were collected and concentrated (AMICON; MWCO 3500). The protein was then injected in 500 μl portions into a size-exclusion chromatography system (TSK-GEL G2000SW column (Tosoh Bioscience)) and eluted with a linear gradient using PBS. Pure fractions were combined, concentrated and stored at −20 °C. The purity of FT-PrP was >95–98% as judged by a silver-stained 12% NuPAGE gel. SW10 cells and clones derived from them were all grown in DMEM medium supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin and Glutamax (all obtained from Invitrogen). HEK293T cells, its clonal variant HEK293(H) cells and clones derived therefrom overexpressing various GPCRs were grown in DMEM-F12 medium supplemented with 10% FCS, penicillin-streptomycin and Glutamax (all obtained from Invitrogen). All cell lines were regularly monitored for mycoplasma contamination. The authenticity of SW10 and its derivatives was established by monitoring the expression of Schwann-cell specific markers (Extended Data Fig. 6a). Human Gpr126 (NM_020455), Gpr124, Gpr64, Gpr56, Gpr133, Gpr56 and Gpr176 expression plasmids (pCGpr126-V5, pCGpr124-V5, pCGpr65-V5, pCGpr56-V5, pCGpr133-V5, pCGpr56-V5 and pCGpr176-V5) were generated by PCR amplification of the respective cDNA followed by TOPO cloning into the pCDNA3.1/V5-His-TOPO vector. The cDNA was in frame with the V5 tag (sequence: GKPIPNPLLGLDST) at the C terminus. HEKGPR126 and HEKGPR176 cells were generated by transfecting 1 μg of plasmid into one well of a subconfluent 6-well plate using 3 μl Fugene (Roche) according to the manufacturer’s protocol. Twenty-four hours after transfection, cells were transferred to a 10-cm dish and grown in selective medium containing 0.4 mg/ml G418 (Invitrogen) until emergence of resistant colonies. A limiting dilution was carried out to obtain clonal lines. Membrane expression of the transgene was assessed in the selected clones by confocal microscopy using 1:100 diluted anti-V5 antibody (Invitrogen) and the Cytofix/Cytoperm kit (Pharmingen Cat. Nr. 554714), according to the manufacturer’s protocol. Cerebellar granule neurons were generated from 7–8-day-old PrnpZH1/ZH1 mice as described previously25. Cultures were plated at 350,000 cells per cm2 in Basal Medium Eagle (BME) (Invitrogen) with 10% (v/v) FCS and maintained at 37 °C in 5% CO . pCDNA-PrPC was generated by cloning murine PrPC into pCDNA3.1 vector as described previously26. A site-specific mutagenesis kit (Stratagene) was used to induce alanine substitutions of QPSPG and KKRPK domains in PrPC. Primers used for generating the Ala-QPSPG plasmid were: forward, GTG GAA GCC GGT ATC CCG GGG CGG CAG CCG CTG CAG GCA ACC GTT ACC C; reverse, GGG TAA CGG TTG CCT GCA GCG GCT GCC GCC CCG GGA TAC CGG CTT CCA C. Primers for Ala-KKRPK were: forward, CTA TGT GGA CTG ATG TCG GCC TCT GCG CAG CGG CGC CAG CGC CTG GAG GGT GGA ACA CCG; reverse, CGG TGT TCC ACC CTC CAG GCG CTG GCG CCG CTG CGC AGA GGC CGA CAT CAG TCC ACA TAG. Transfections were performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. 3 μg of DNA was used per well of a 6-well plate. Cells were washed 24 h after transfection using PBS, and fresh medium was added to the cells. HEK293T and HEKGPR126 cells growing in T75 flasks at 50% density were treated with recombinant FT or GD (2 μM, 20 min). Cells were washed twice in PBS and lysed in IP buffer: 1% Triton X-100 in PBS, 1× protease inhibitors (Roche) and Phospho stop (Roche) for 20 min on ice followed by centrifugation at 5000 rpm for 5 min at 4 °C. BCA assays were performed to quantify the amount of protein, and 500 μg of protein was used for immunoprecipitations. 2 μg anti-V5 antibody was added to the cell lysate and incubated on a wheel rotator overnight at 4 °C. On the following day, Protein G dynabeads (Invitrogen) were added to the samples and incubated for a further 3 h on the wheel at 4 °C. Beads were washed three times for 5 min each using the IP buffer followed by addition of 2× sample buffer containing DTT (1 mM final). Samples were heated at 95 °C for 5 min, loaded on 4–12% Novex Bis-tris gels (Invitrogen), and migrated for 1.5 h at 150 V followed by western blotting. Immunoprecipitations were performed by adding 2 μg of POM2 antibody to 500 μl of cell medium and incubating overnight on a wheel rotator at 4 °C. Protein G beads were then added, and incubation on a wheel rotator at 4 °C was performed again. RNA extraction and quantitative PCR were performed as described previously1. The following primers were used: EGR2 forward: 5′-AATGGCTTGGGACTGACTTG-3′; EGR2 reverse: 5′-GCCAGAGAAACCTCCATT-3′; GAPDH forward: 5′-CCACCCCAGCAAGGAGAC-3′; GAPDH reverse: 5′-GAAATTGTGAGGGAGATGCT-3′. Adult zebrafish were maintained in the Washington University Zebrafish Consortium facility ( http://zebrafishfacility.wustl.edu/) and all experiments were performed in compliance with institutional protocols. Embryos were collected from harem matings or in vitro fertilization, raised at 28.5 °C, and staged according to standard protocols27. The gpr126st49 and gpr126st63 mutants were described previously7, 8. gpr126st63 or gpr126st49 mutants were collected from homozygous mutant crosses and wild-type larvae were collected from AB* strain crosses and raised to 50 hpf. FT treatment of gpr126 mutants was performed as previously described15. Briefly, egg water was replaced with either 20 μM FT in egg water or egg water containing an equivalent volume of DMSO. At 55 hpf, larvae were washed twice and raised in egg water to 5 dpf. Wild-type and gpr126 larvae were fixed in 2% paraformaldehyde plus 1% tricholoroacetic acid in phosphate buffered saline, and Mbp and acetylated tubulin immunostaining was performed as described previously8, 28. Expression scoring was performed with observers blinded to treatment according to the following rubric: strong, strong and consistent expression throughout PLLn; some, weak but consistent expression in PLLn; weak, weak and patchy expression in PLLn; none, no expression in PLLn. n = three independent replicate gpr126st63 assays and one gpr126st49 assay. n = 87 DMSO-treated gpr126st63 larvae, 81 Prp-FT-treated gpr126st63 larvae, 27 DMSO-treated gpr126st49 larvae, 25 Prp-FT-treated gpr126st49 larvae. Fluorescent nerve images were analysed using the Fiji software29. A rectangular region-of-interest (ROI) was drawn longitudinally over the fluorescent nerve. The longitudinal grey-scale histogram of the myelin basic protein (Mbp) was normalized pixel-by-pixel to the corresponding intensity of the acetylated tubulin (AcTub). The size of the measured ROIs was kept constant across different treatment modalities. SW10 cells were grown in P75 flasks at 50% density, rinsed with PBS, and detached from culture flasks with dissociation buffer containing EDTA (GIBCO). After detaching, cells were washed to remove residual EDTA and counted using a Neubauer chamber. Batches of 105 SW10 cells were transferred to FACS tubes, treated with HA-tagged recombinant peptides for 20 min, washed, and incubated with Alexa-488 conjugated anti-HA antibody for 30 min. After further washes and centrifugations, cells were resuspended in 200 μl FACS buffer (PBS +10% FBS) and analysed with a FACS Canto II cytofluorimeter (BD Biosciences). Data were analysed using FloJo software. Schwann cells were lysed in cell-lysis buffer (Tris-HCl 20 mM, NaCl 137 mM, Triton-X-100 1%) supplemented with protease inhibitor cocktail (Roche complete mini). The lysate was homogenized by passing several times through a 26G syringe, and cleared by centrifugation at 8,000g, 4 °C for 2 min. in a tabletop centrifuge (Eppendorf 5415R). Protein concentration was measured with the BCA assay (Thermo Scientific). 10 μg total protein was boiled in 4 × LDS (Invitrogen) at 95 °C for 5 min. After a short centrifugation, samples were loaded on a gradient of 4–12% Novex Bis-Tris Gel (Invitrogen) for electrophoresis at constant voltage of 200 V. Gels were transferred to PVDF membranes with the iBlot system (Life technologies). Membranes were blocked with 5% Top-Block (Sigma) in PBS-T for 1h at room temperature. Primary antibody was incubated overnight in PBS-T with 5% Top-Block. Membranes were washed three times with PBS-T for 10 min and incubated for 1 h with secondary antibodies coupled to horseradish peroxidase at room temperature. After three washes with PBS-T, the membranes were developed with a Crescendo chemiluminescence substrate system (Millipore). Signals were detected using a Stella 3200 imaging system (Raytest). Monoclonal antibodies against PrPC were obtained and used as described previously4. Fab3 and Fab71 antibodies were generated using the phage display technology and their epitopes were mapped with overlapping peptides. Anti AKT, p-AKT were obtained from Cell signaling and used at 1:2,000 dilutions for western blotting. The anti-p75NGF receptor antibody was obtained from Abcam and used at a 1:200 dilution for immunofluorescence. Anti V5 antibody was from Invitrogen and used at a dilution of 1:500 for western blot and 2 μg antibody was used for immunoprecipitation on 500 μg of cell lysate. In the direct cAMP ELISA assay, cAMP levels were assessed with a colorimetric competitive immunoassay (Enzo Life Sciences). Quantitative determination of intracellular cAMP was performed in cells or tissues lysed in 0.1 M HCl to stop endogenous phosphodiesterase activity and to stabilize the released cAMP. SW10 or HEK293T cells (100,000 cells per well) were plated in 6-well plates to ~50% density. Cells were treated with conditioned medium or recombinant peptides (2 μM, unless specified) for 20 min unless otherwise mentioned. Cells were lysed with 0.1 M HCl lysis buffer (Direct cAMP ELISA kit, Enzo). To ensure complete detachment of cells, cell scrapers were used. Lysates were homogenized with a 26G needle and syringe before clearing by centrifugation at 600g for 10 min. The subsequent steps were performed according to the manufacturer’s protocol based on competition of sample cAMP with a cAMP-alkaline phosphatase conjugate. To measure in vivo cAMP changes, BL6, PrnpZH3/ZH3 or PrnpZH1/ZH1 mice were intravenously injected with 600 μg of either FT or, as a control, uncharged FT ( ). Twenty minutes after infusion, mice were killed and all organs were collected. For cAMP assays, organs were homogenized in 0.1 M HCl. Subsequent steps were performed according to the manufacturer’s protocols as described above. Cyclic AMP levels were calculated using a cAMP standard curve in the case of ELISA based assay. Finally, cAMP concentrations were normalized to total protein content in each sample. cAMP changes are represented as fold changes to the respective controls. For each experiment, at least three independent biological replicates were used. For in vivo assays, groups of 8–16 mice were used for each experiment. For normalization purposes, the median value of the respective control sample was defined as 1. All measurements within each panel were normalized to this control value. For in vivo assays, sample sets were coded and investigators were blinded to their identities. The assignment of codes to sample identities was performed only after the cAMP values were plotted for each set. We designed two CRISPR short-guide RNA (sgRNAs) against exon 2 of Gpr126 (upper Guide CCTGTGTTCCTCTCTCAGGT and lower Guide AACAGGAACAGCAGGGCGCT). The DNA sequences corresponding to the sgRNAs were cloned into expression plasmids and transfected with EGFP-expressing Cas9-nickase plasmids. Single EGFP-expressing Schwann cells were isolated with a FACS sorter (Aria III). To determine the exact sequence of indels induced by genome editing, we amplified the sgRNA-targeted locus by PCR and subcloned the fragments into blunt-TOPO vectors. Ten colonies per cell line were sequenced and showed distinct indels on each allele. A clonal subline devoid of Gpr126 was used for further studies. This cell line possessed insertions on both the alleles; a 49-bp insertion at position 118 and a 5-bp insertion at position 84 on each allele. Both insertions led to a frameshift and to the generation of premature stop codons leading to early translation termination. Luciferase reporter constructs were generated containing a 1.3-kB sequence upstream of the transcription-starting site of Egr2. SW10 Schwann cells were transfected with Egr2 reporter construct and a renilla plasmid using lipofectamine 2000. After one day in vitro, Schwann cells were treated with recombinant full-length PrP (23–231), the globular domain of PrP (121–231) or PBS control. Luciferase activity was measured 24 h after stimulation with Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s recommendations. Results were normalized to renilla transfection controls. Glass coverslips were placed in 12-well plates (Thermo Scientific) and coated with 0.01% w/v Poly-l-lysine solution (Sigma) overnight at room temperature. Coverslips were washed three times with ddH O and dried for 2 h in a laminar-flow hood. Schwann cells were seeded and cultured at 50% density. Cells were treated with recombinant FT-PrP, full length recPrP or C1-PrP for 20 min, and washed with serum-free DMEM. Cells were further washed with PBS followed by fixation with 4% paraformaldehyde. Fixed cells were incubated in blocking buffer (PBS+10% FBS) for 1 h. Cells were treated with various primary antibodies followed by washes and incubation with Alexa 488 and Alexa 647 tagged rabbit or mouse secondary antibodies (Life Technologies). Imaging was performed by Leica SP2 confocal microscope using a 20× objective; images were processed by Image J software. Transmission electron microscopy was performed as previously described6. Briefly, mice under deep anaesthesia were subjected to transcardial perfusion with PBS heparin and sciatic nerves were fixed in situ with 2.5% glutaraldehyde plus 2% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 and embedded in Epon. Ultrathin sections were mounted on copper grids coated with Formvar membrane and contrasted with uranyl acetate/lead citrate. Micrographs were acquired using a Hitachi H-7650 electron microscope (Hitachi High-Tech, Japan) operating at 80 kV. Brightness and contrast were adjusted using Photoshop. For quantification of Remak bundles and onion bulb-like structures, images were captured at 1,500× magnification and axon numbers and abnormal onion bulb-like structures were counted manually. Quantification was performed in a blinded fashion by assigning numbers to the images and upon completion of quantification genotypes were revealed. HA-tagged and untagged synthetic peptides were produced by EZ Biosciences. A stock solution of 2 mM was prepared by dissolving the peptides in PBS and they were used at a final concentration of 2 μM unless specified. The sequences of all the peptides used in this study can be found in Extended Data Table 1.


News Article | January 4, 2016
Site: www.techtimes.com

CES 2016, formerly known as the Consumer Electronics Show, is happening at the Las Vegas Convention Center from Jan. 6 to 9 and it will feature some of the newest technologies that companies will be churning out in the coming months, and we have just the thing to prepare you for it. Those who have attended the previous CESs, may want to know that there have been some tighter restrictions put in place for the 2016 event. However, if you're new to CES, it's your lucky day, because we've come up with a quick guide to keep you from getting overwhelmed once you step inside the biggest annual consumer technology show. As already mentioned, CES is the biggest annual consumer technology trade show and, naturally, top tech industries and start-ups are in attendance to show the world what they can offer. Those interested may invest in these technologies, whether as a backer or a consumer. "CES is the world's gathering place for all who thrive on the business of consumer technology. It has served as the proving ground for innovators and breakthrough technologies for almost 50 years... it attracts the world's business leaders and pioneering thinkers to a forum where the industry's most relevant issues are addressed," the CES website describes. What Can You Find In CES? Conceptual technology, technologies under development, technologies you might not be able to afford (yet) but would drool over, cars you may see on the roads in the future, automotive technologies that would go with those cars, Virtual Reality technologies and anything and everything that could turn your normal residence into a "smart home." Apart from seeing technology exhibits, you'll get to witness corporate leaders unveiling their company's new products and discussing tech issues. You'll also find start-up companies trying to get people interested enough in its products so they would have a chance to survive the tough tech market. But of course, you will also find that yourself standing and lining up for hours with more than 170,000 other people. For the experienced CES attendees, it's important to note that the Consumer Technology Association (CTA), the organizer of the CES 2016 and all the previous CES trade shows, is tightening security in light of the recent tragedies around the world. CTA wants attendees to know that luggage and any type of bag with wheels may not be brought inside the CES grounds. You are only allowed to bring up to two (2) bags and all bags must be, at most, 12 inches x 17 inches x 6 inches and CTA suggests that bags should not have a lot of pockets because all bags will be searched and pockets prolong search times. In addition, bag check availability will be extremely limited and "everyone will be subject to metal detector screening and body pat downs," CTA said in its press release. Those who will attend the CES for the first time, will need patience, extra food and comfortable shoes. As stated above, there will be a lot of people in attendance so you'd probably be standing in line at least a third of your time there and losing patience will not do you any good. Check out the exhibitor directory and the exhibit maps so you know where you'd want to go and manage your time properly. If you're not sure where to go, though, CTA created a quiz to determine what kind of CES attendee you are and has suggestions on where to go based on your result. You'll probably be tired after CES 2016 but try to enjoy the experience too. If you can't go, don't fret. CTA will be giving glimpses of the event in their social media accounts. On #Snapchat? Make sure you follow us for live updates from #CES2016 all week long at 'CESOfficial' pic.twitter.com/DpGQk0iKX3


Cleantech Talk #22 is now live, and you can listen below! Hot topics included the Koch Brothers and their latest plan to destroy society (if only those pesky kids didn’t get in the way), Ontario giving EVs some northerly love, and GM going full blast (er… 50% blast) into an EV & alternative powertrain future. As always, you can subscribe to Cleantech Talk on iTunes or SoundCloud, and you can download the current episode here or watch it in the embedded player below. And… Matthew’s helpful show notes are below the player. I’ll just throw in this link to the Joe Romm piece I mention toward the end. Science has established that money bends judgment, as surely as gravity bends light. While many (generally younger) billionaires have made the commendable commitment to donate most of their wealth to charity, many of their peers have not. And in America, there’s no clearer example of how astonishing wealth can bend judgment astonishingly, than the Brothers Koch. Fresh off launching a charm offensive (featuring the best rebranding money can buy) the petroleum plutocrats have returned to old ways, bankrolling a campaign to sing the praises of fossil fuels for transportation, as a defensive move. (As early as 1989, the Kochs – already worth billions — were defrauding a destitute Indian reservation of oil royalties they were legally due. The reservation’s private investigator, Greg Palast, would later be the first to report on the voter purge in Florida prior to the 2000 Presidential election, a story picked up by the BBC, but not any American networks. Go figure.) It looks like the Kochs’ message will be that their opposition to plug-in electric vehicle policy support is rooted in the fact that they’re philosophically against subsidies and regulations, which distort markets. It’s a clever argument, which misdirects the audience away from the bigger point that — like all human constructs — markets are inherently imperfect, and societies have the right to pursue their self-interest in trying to correct those imperfections. It’s also worth pointing out that the American plug-in electric vehicle federal tax credit was enacted as part of the Energy Extension and Improvement Act of 2008, which readers may better know as “that everything-but-the-kitchen-sink law they passed in a panic when the global economy was collapsing”. Many groups and industries were able to get a piece of what they wanted in the legislation, and one can be sure Koch Industries got a massive slice of policy largesse. For all their electric vehicle enthusiasm, listeners will almost certainly have friends and family who aren’t fully bought into the idea of plug-in electric vehicle purchase incentives. (Especially in Ontario, where rebates of up to $14,000 are now possible.) These are the “swing voters” the Kochs are targeting with their pro-petrol pablum. It will be important to emphasize (and re-emphasize) to our consanguines and colleagues that policy support is a short-term phenomenon, because battery costs are dropping faster than pretty much anyone thought possible. When we bring Norway into the conversation (“there’s a country today, where more than 23% of new cars sold last year runs largely or completely on clean hydroelectricity!”) we can also note that Norway’s path to electric transportation has been a long one: the country truly had been “into electric cars before electric cars were cool”. As long ago as the 1994 Winter Olympics, Norwegian entrepreneurs had been hand-building electric vehicles with an eye to eventual commercialization. Alas, the visionaries at Th!nk Global were a bit too far ahead of their time. With the possible exception of “Koch Bros”, “fuel cell” might be the pair of four-letter words most likely to make plug-in electric vehicle advocates see red. It’s unsurprising that automakers would continue to invest in the technology, however, as fuel cells offer a zero-emissions alternative which doesn’t require any behaviour change from the consumer. And as much as early adopters believe it’s easy, painless, and cheaper to make adjustments … we tend to be the minority. (Matthew’s vegetarian and vegan friends have made these exact same points, but in the end he just can’t give up sushi.) The broader auto industry’s shift from fuel cell-centric to battery-focused is probably best exemplified from this story involving the Chicago Transit Authority. After successfully trialing two battery-electric buses in 2014, the CTA recently purchased 27 more, thanks to a modest grant. That’s a more than tenfold increase in a two year timeframe, for one fleet. Nineteen years ago (way back in 1997, kids!) the Chicago Transit Authority purchased three fuel cell electric buses, becoming the first transit authority to run a fuel cell fleet trial. Twenty years later, there’s probably something on the order of a hundred fuel cell electric buses in operation around the world. While most of their technological hurdles have been overcome (and plentiful renewable energy could  make for fossil-free hydrogen fuel) it’s hard to see fuel cells playing more than a supplementary role in zero-emission passenger car transport. But even if plug-in electric vehicles dominate the zero-emission vehicle category, the prudence of being able to offer cars “for every purse and purpose” would seem to ensure that automakers will hedge their zero-emission bets with hydrogen and perhaps other technologies. Image by DonkeyHotey (some rights reserved)    Get CleanTechnica’s 1st (completely free) electric car report → “Electric Cars: What Early Adopters & First Followers Want.”   Come attend CleanTechnica’s 1st “Cleantech Revolution Tour” event → in Berlin, Germany, April 9–10.   Keep up to date with all the hottest cleantech news by subscribing to our (free) cleantech newsletter, or keep an eye on sector-specific news by getting our (also free) solar energy newsletter, electric vehicle newsletter, or wind energy newsletter.  

Discover hidden collaborations