Clondalkin, Ireland
Clondalkin, Ireland
SEARCH FILTERS
Time filter
Source Type

- Vierzehnter Auftrag für Hochgeschwindigkeitswagen erhöht die Anzahl der nach China gelieferten Wagen auf über 3.000- Die neue Generation umweltfreundlicher Züge der Baureihe CRH sind für fortschrittliches Design und außergewöhnlichen Fahrgastkomfort bekannt


News Article | July 27, 2017
Site: www.marketwired.com

CRH plc, the international building materials group, announces that Maeve Carton, Group Transformation Director, has informed the directors of her intention to retire from the Board and from CRH on 31 August 2017. Since joining CRH in 1988, Maeve held a number of senior financial roles prior to joining the Board as Finance Director in May 2010. She was appointed Group Transformation Director in January 2016. Group Chief Executive Albert Manifold said: "As Group Transformation Director, Maeve's experience and insights have been invaluable as CRH underwent a period of significant change following the major acquisition activity in 2015. Throughout her exemplary career with the Group, and particularly during her over 5 years' service as Finance Director, she has contributed to the development and progress of CRH, and we wish her every happiness in her retirement." About CRH CRH (LSE: CRH, ISE: CRG, NYSE: CRH) is a leading global diversified building materials group, employing c.87,000 people at c.3,800 operating locations in 31 countries worldwide. With a market capitalisation of c.EUR 26 billion (July 2017), CRH is the largest building materials company in North America and the second largest worldwide. The Group has leadership positions in Europe as well as established strategic positions in the emerging economic regions of Asia and South America. CRH is committed to improving the built environment through the delivery of superior materials and products for the construction and maintenance of infrastructure, housing and commercial projects. A Fortune 500 company, CRH is a constituent member of the FTSE 100 index, the EURO STOXX 50 index and the ISEQ 20. CRH's American Depositary Shares are listed on the NYSE. For more information visit www.crh.com


GAD2-IRES-Cre, VGLUT2-IRES-Cre, VGAT-IRES-Cre, GAD1-eGFP, CCK-IRES-Cre, CRH-IRES-Cre, TAC1-IRES-Cre, and HDC-IRES-Cre mice (Jackson stock numbers 010802, 016963, 016962, 007677, 012706, 012704, 021877, and 021198, respectively) were obtained from Jackson Laboratory19, 32, 33 and VGLUT2-eGFP mice were from MMRRC (MMRRC 011835-UCD). PDYN-IRES-Cre mice were obtained from Bradford Lowell34. GAL-Cre mice were obtained from GENSAT (stock number KI87). Mice were housed in 12 h light–dark cycle (lights on 7:00 and off at 19:00) with free access to food and water. Experiments were performed in adult male or female mice (6–12 weeks old). All procedures were approved by Institutional Animal Care and Use Committees of the University of California, Berkeley, University of California, San Francisco, Allen Institute for Brain Science, and Stanford University and were done in accordance with federal regulations and guidelines on animal experimentation. Note that, in different experiments, GAD1, GAD2, and VGAT were used to identify GABAergic neurons. To examine the relationship between GAD1, GAD2, and VGAT in the POA, we quantified the overlap between GAD1 and VGAT on the basis of the double in situ hybridization data from the Allen Mouse Brain Atlas (http://connectivity.brain-map.org/transgenic/experiment/100142488) and found that 95% (327 out of 345) of VGAT-positive neurons also contained GAD1. Comparison between GAD1 and GAD2 expression in the POA (http://connectivity.brain-map.org/transgenic/experiment/100142491) showed that 99% (246 out of 248) of GAD1 neurons also contained GAD2. Together, these data indicate a very high degree of overlap between GAD1, GAD2, and VGAT in the POA. AAV -EF1α-DIO-ChR2–eYFP and AAV -hSyn-FLEX-hM4D(Gi)–mCherry were obtained from the University of North Carolina vector core. The final titre was estimated to be ~1012 genome copies per millilitre. AAV -EF1α-DIO-ChR2–eYFP, AAV -EF1α-DIO–eYFP, AAV -EF1α-DIO-iC++–eYFP, and AAV -EF1α-DIO-iC++–eYFP were obtained from Stanford University virus core. Lentivirus rEIAV-DIO-TLoop-ChR2–eYFP, rEIAV-DIO-TLoop-iC++–eYFP, and rEIAV-DIO-TLoop-nls–eYFP were obtained from Salk virus core and Allen Institute for Brain Science13. Rabies-tracing reagents (AAV-CAG-FLExloxP-TVA–mCherry, AAV-CAG-FLExloxP-RG (RG, rabies glycoprotein) and EnvA-pseudotyped, rabies-glycoprotein-deleted, and GFP-expressing rabies viral particles (RVdG)), cTRIO reagents (CAV-FLExloxP-Flp, AAV-FLExFRT-TVA–mCherry, AAV-FLExFRT-RG, and EnvA-pseudotyped, rabies-glycoprotein-deleted, and GFP-expressing rabies viral particles (RVdG)) and axon arborization analysis reagents (CAV-FLExloxP-Flp and AAV-hSyn1-FLExFRT–mGFP–2A-synaptophysin–mRuby) were obtained from Stanford University15. HSV-LoxSTOPLox-FlagHA-L10a was obtained from the University of California, San Francisco. Mice of a specific genotype were randomly assigned to experimental and control groups. Experimental and control animals were subjected to exactly the same surgical and behavioural manipulations. Data from animals used in experiments were excluded on the basis of histological criteria that included injection sites, virus expression, and optical fibre placement. Only animals with injection sites and optic fibre placement in the region of interest were included. To implant EEG and EMG recording electrodes, adult mice (6–12 weeks old) were anaesthetized with 1.5–2% isoflurane and placed on a stereotaxic frame. Two stainless steel screws were inserted into the skull 1.5 mm from midline and 1.5 mm anterior to the bregma, and two others were inserted 3 mm from midline and 3.5 mm posterior to the bregma. Two EMG electrodes were inserted into the neck musculature. Insulated leads from the EEG and EMG electrodes were soldered to a 2 × 3-pin header, which was secured to the skull using dental cement. For optogenetic activation/inhibition experiments, a craniotomy was made on top of the target region for optogenetic manipulation in the same surgery as for EEG and EMG implant, and 0.1–0.5 μl virus was injected into the target region using Nanoject II (Drummond Scientific) via a micropipette. We then implanted optic fibres bilaterally into the target region. Dental cement was applied to cover the exposed skull completely and to secure the implants for EEG and EMG recordings to the screws. After surgery, mice were allowed to recover for at least 2–3 weeks before experiments. For anti-histamine experiments (Extended Data Fig. 4), triprolidine (Tocris) was administered intraperitoneally at 20 mg per kg (body weight) and brain states were recorded for 3 h. For retrograde tracing in Extended Data Fig. 1a, 0.2–0.3 μl red or green RetroBeads (Lumafluor) was injected into each target region. For optrode recording experiments, the optrode assembly was inserted into the POA at a depth of 4.9 mm. Screws were attached to the skull for EEG recordings, and an EMG electrode was inserted into the neck musculature. The optrode assembly, screws, and EEG/EMG electrodes were secured to the skull using dental cement. These procedures are related to the results in Fig. 3 and Extended Data Fig. 6. For rabies tracing, AAV-CAG-FLExloxP-TVA–mCherry and AAV-CAG-FLExloxP-RG were injected into the TMN of HDC-Cre mice. Two to three weeks later, EnvA-pseudotyped, glycoprotein-deleted, and GFP-expressing rabies viral particles (RVdG) were injected into the TMN, and mice were euthanized 1 week later. These procedures are related to the results in Extended Data Fig. 2. For cTRIO experiments, a retrograde virus CAV-FLExloxP-Flp (5.0 × 1012 genome copies per millilitre) was injected into either the TMN or the PFC of GAD2-Cre mice to express Flp recombinase specifically in GABAPOA→TMN or GABAPOA→PFC neurons, and AAV-FLExFRT-TVA–mCherry (2.6 × 1012 genome copies per millilitre) and AAV-FLExFRT-RG (1.3 × 1012 genome copies per millilitre) were injected into the POA to express TVA (the receptor for the EnvA envelope glycoprotein)–mCherry and rabies glycoprotein in the Flp-expressing neurons. Two to three weeks later, EnvA-pseudotyped, glycoprotein-deleted, and GFP-expressing rabies viral particles (RVdG) (5.0 × 108 colony forming units per millilitre) were injected into the POA, and mice were euthanized 1 week later for histology. These procedures are related to the results in Extended Data Fig. 7. For axon arborization experiments, CAV-FLExloxP-Flp was injected into TMN, and AAV-hSyn1-FLExFRT–mGFP–2A-synaptophysin–mRuby was injected into the POA of GAD2-Cre mice. Mice were euthanized 4–7 weeks later for histology. These procedures are related to the results in Extended Data Fig. 7. For pharmacogenetic experiments, AAV -hSyn-FLEX-hM4D(Gi)–mCherry was injected bilaterally into the POA. These procedures are related to the results in Extended Data Fig. 10. For TRAP experiments, we injected Cre-inducible HSV expressing the large ribosomal subunit protein Rpl10a fused with Flag/haemagglutinin tag (HSV-LoxSTOPLox-FlagHA-L10a) into the TMN of VGAT-Cre mice. After 30–45 days of expression, the POA was dissected, and ribosome immunoprecipitation was performed to pull down the messenger RNAs (mRNAs) attached to Rpl10a. These procedures are related to the results in Fig. 4 and Extended Data Fig. 8. For single-cell RNA-seq experiments, rEIAV-DIO-TLoop-nls–eYFP was injected into the TMN of GAD2-Cre and VGAT-Cre mice. Four weeks later, we dissociated eYFP-labelled POA neurons for single-cell RNA-seq. These procedures are related to the results in Fig. 4 and Extended Data Fig. 8. For immunohistochemistry-detecting peptides, mice received a single intraventricular injection of colchicine (12 μg) 1–2 days before killing. These procedures are related to the results in Fig. 4. The stereotaxic coordinates were as follows. TMN: anteroposterior (AP) −2.45 mm, mediolateral (ML) 1 mm, dorsoventral (DV) 5–5.2 mm from the cortical surface; POA: AP 0 mm, ML 0.7 mm, DV 5.2 mm; PFC: AP +2.0 mm, ML 0.4 mm, DV 2 mm; vlPAG: AP −4.7 mm, ML 0.7 mm, DV 2.3 mm; dorsomedial hypothalamus: AP −1.8 mm, ML 0.4 mm, DV 5.2 mm; habenula: AP −1.8 mm, ML 0.5 mm, DV 2.2 mm. Sleep deprivation started at the beginning of the light period (7:00) and lasted till 13:00. Mice were kept awake by a combination of cage tapping, introduction of foreign objects such as paper towels, cage rotation, and fur stroking with a paintbrush35, gentle handling procedures that have been used extensively to induce sleep deprivation36. EEG and EMG were not recorded during sleep deprivation and recovery. After 6 h of deprivation, sleep-deprived mice were allowed rebound sleep for 4 h before being euthanized by cervical dislocation and decapitation. c-Fos immunohistochemistry was performed as described below. These procedures are related to the results in Extended Data Figs 1 and 2. Behavioural experiments were performed in home cages placed in sound-attenuating boxes. Sleep recordings were performed between 12:00 and 19:00 (light on at 7:00 and off at 19:00). EEG and EMG electrodes were connected to flexible recording cables via a mini-connector. EEG and EMG signals were recorded and amplified using AM Systems, digitally filtered (0.1–1,000 Hz and 10–1,000 Hz for EEG and EMG recordings respectively), and digitized at 600 Hz using LabView. Spectral analysis was performed using fast Fourier transform, and brain states were classified into NREM, REM, and wake states (wake: desynchronized EEG and high EMG activity; NREM: synchronized EEG with high-amplitude, low-frequency (0.5–4 Hz) activity and low EMG activity; REM: high power at theta frequencies (6–9 Hz) and low EMG activity). Brain states were classified into NREM sleep, REM sleep, and wakefulness using custom-written MATLAB software, and the classification was performed without any information about the identity of the animal or laser stimulation timing as previously described25. Each optic fibre (200 μm diameter; ThorLabs) was attached through an FC/PC adaptor to a 473-nm blue laser diode (Shanghai laser), and light pulses were generated using a Master 8 (A.M.P.I.). All photostimulation/inhibition experiments were conducted bilaterally and fibre optic cables were connected at least 2 h before the experiments for habituation. For photostimulation/inhibition experiments in ChR2-, iC++-, or eYFP-expressing mice, light pulses (10 ms per pulse, 10 Hz, 4–8 mW) or step pulses (60 s) were triggered using Master 8 that provided simultaneous input into two blue lasers. In each optogenetic manipulation experiment, inter-stimulation interval for optogenetic manipulation was chosen randomly from a uniform distribution between 15 and 25 min. Custom-made optrodes37 consisted of an optic fibre (200 μm in diameter) glued together with six pairs of stereotrodes. Two FeNiCr wires (Stablohm 675, California Fine Wire) were twisted together and electroplated to an impedance of ~ 600 kΩ using a custom-built plating device. The optrode was attached to a driver to allow vertical movement of the optrode assembly. The optrode was slowly lowered to search for light-responsive neurons. Wires to record cortical EEG and EMG from neck musculatures were also attached for simultaneous recordings. A TDT RZ5 amplifier was used for all the recordings, signals were filtered (0.3–8 kHz) and digitized at 25 kHz. At the end of the experiment, an electrolytic lesion was made by passing a current (100 μA, 10 s) through one or two electrodes to identify the end of the recording tract. Spikes were sorted offline on the basis of the waveform energy and the first three principal components of the spike waveform on each stereotrode channel. For single unit isolation, all channels were separated into groups and spike waveforms were identified either manually using Klusters (http://neurosuite.sourceforge.net/) or automatically using the software klustakwik (http://klustakwik.sourceforge.net/). The quality of each unit was assessed by the presence of a refractory period and quantified using isolation distance and L . Units with an isolation distance <20 and L >0.1 were discarded38. To identify ChR2-tagged neurons, laser pulse trains (10 and/or 20 Hz) were delivered intermittently every minute. A unit was identified as ChR2-expressing if spikes were evoked by laser pulses with short first-spike latency (<6 ms for all units in our sample) and the waveforms of the laser-evoked and spontaneous spikes were highly similar (correlation coefficient >0.9). Mean latency of all identified units was 3.05 ms. Mean correlation coefficient of all identified units was 0.99. To calculate the average firing rate of each unit in each brain state, spikes during the laser pulse trains were excluded. These procedures are related to the results in Fig. 3 and Extended Data Fig. 6. Mice were deeply anaesthetized and transcardially perfused using PBS buffer followed by 4% paraformaldehyde in PBS. Brains were post-fixed in fixative and stored in 30% sucrose in PBS overnight for cryoprotection. Brains were embedded and mounted with Tissue-Tek OCT compound (Sakura Finetek) and 20 μm sections were cut using a cryostat (Leica). Brain slices were washed using PBS, permeabilized using PBST (0.3% Triton X-100 in PBS) for 30 min and then incubated with blocking solution (5% normal goat serum or normal donkey serum in PBST) for 1 h followed by primary antibody incubation overnight at 4 °C using the following antibodies: anti–GFP antibody (A-11122 or A-11120, Life technologies, 1:1,000); anti-cFos antibody (sc-52-G and sc-52, Santa Cruz Biotech, 1:1,000); anti-CCK-8 antibody (20078, Immunostar, 1:500); anti-CRH antibody (sc-1759, Santa Cruz Biotech, 1:500); anti-haemagglutinin antibody (C29F4, Cell Signaling tech, 1:1,000); and anti-HDC antibody (16045, Progen, 1:1,000). The next day, slices were washed with PBS and incubated with appropriate secondary antibodies for 2 h (1:500, all from Invitrogen): A-11008, Alexa Fluor 488 goat anti-rabbit IgG; A-21206, Alexa Fluor 488 donkey anti-rabbit IgG; A-11055, Alexa Fluor 488 donkey anti-goat IgG; A-21202, Alexa Fluor 488 donkey anti-mouse IgG; A-11012, Alexa Fluor 594 goat anti-rabbit IgG; A-21207, Alexa Fluor 594 donkey anti-rabbit IgG; A-11058, Alexa Fluor 594 donkey anti-goat IgG; A-21245, Alexa Fluor 647 goat anti-rabbit IgG. The slices were washed with PBS followed by counterstaining with DAPI or Hoechst and coverslipped. Fluorescence images were taken using a confocal microscope (LSM 710 AxioObserver Inverted 34-Channel Confocal, Zeiss) or Nanozoomer (Hamamatsu). FISH was performed with two methods. First, FISH for CCK, CRH, TAC1, and GAD1 was done using RNAscope assays according to the manufacturer’s instructions (Advanced Cell Diagnostics). Second, to make TAC1, GAD1, and GAD2 FISH probes, DNA fragments containing the coding or untranslated sequences were amplified using PCR from mouse whole brain complementary DNA (cDNA) (Zyagen). A T7 RNA polymerase recognition site was added to the 3′ end of the PCR product. The PCR product was purified using a PCR purification kit (Qiagen). One microgram of DNA was used for in vitro transcription by using digoxigenin (DIG) RNA labelling mix (Roche) and T7 RNA polymerase. After DNase I treatment for 30 min at 37 °C, the RNA probe was purified using probeQuant G-50 Columns (GE Healthcare). Sections (20 μm) were pre-treated with proteinase K (0.1 μg ml−1), acetylated, dehydrated through ethanol (50, 70, 95, and 100%), and air dried. Pre-treated sections were then incubated for 16–20 h at 60 °C, in a hybridization buffer containing sense or anti-sense riboprobes. After the sections were hybridized, they were treated with RNase A (20 μg ml−1) for 30 min at 37 °C and then washed four times in decreasing salinity (from 2× to 0.1× standard saline citrate buffer) and a 30 min wash at 68 °C. Sections were incubated with 3% hydrogen peroxide in PBS for 1 h and washed using PBS. After incubation in the blocking buffer for 1 h (TNB buffer, Perkin Elmer), sections were incubated with anti-DIG-POD antibody (1:500, Roche) in TNB buffer for 2 h. TSA-plus-Fluorescein reagent was used to visualize the signal. For GAD-FISH, anti-DIG-AP antibody (1:500, Roche) and Fast Red TR/Naphthol AS-MX (F4523, Sigma-Aldrich) were used to visualize the signal. After washing the sections in PBS, they were incubated with blocking buffer for 2 h followed by incubation with anti–GFP antibody overnight, and finally incubated with a secondary antibody as described above. To examine the overlap between each peptide marker and GAD, we used CCK-, CRH-, TAC1-, and PDYN-Cre mice injected with AAV-EF1α-DIO-ChR2–eYFP or AAV-EF1α-DIO–eYFP. These procedures are related to the results in Extended Data Figs 2 and 8. For analysis of rabies-tracing data, consecutive 60 μm coronal sections were collected and stained using Hoechst. Slides were scanned using Nanozoomer (Hamamatsu). GFP+ input neurons were counted from the forebrain to the posterior brainstem except sections adjacent to the injection sites (1 mm from the injection site), and grouped into ten regions based on Allen Mouse Brain Atlas (http://mouse.brain-map.org/static/atlas) using anatomical landmarks in the sections visualized by Hoechst staining and autofluorescence. We normalized the number of neurons in each region by the total number of input neurons in the entire brain. These procedures are related to the results in Extended Data Fig. 7. Consecutive 60 μm coronal sections were collected and stained using Hoechst. Slides were scanned using a Nanozoomer (Hamamatsu). All images were acquired using identical settings and were analysed using ImageJ as previously described15. Images were background subtracted (rolling ball radius of 50 pixels), thresholded, and pixels above this threshold were interpreted as positive signals. The mGFP- or eYFP-labelled axon arborization signal was measured for each region and averaged across the five sections. These procedures are related to the results in Extended Data Fig. 7. We adapted a previously described procedure to perform TRAP experiment39. Mice were euthanized at 12:00 to 14:00 and the POA was rapidly dissected on ice with a dissection buffer (1× HBSS, 2.5 mM HEPES (pH 7.4), 4 mM NaHCO , 35 mM glucose, 100 μg ml−1 cycloheximide). Brains from six mice were then pooled, homogenized in the homogenization buffer (10 mM HEPES (pH 7.4), 150 mM KCl, 5 mM MgCl , 100 nM calyculin A, 2 mM DTT, 100 U ml−1 RNasin, 100 μg ml−1 cycloheximide and protease). Homogenates were transferred to a microcentrifuge tube and clarified at 2,000g for 10 min at 4 °C. The supernatant was transferred to a new tube, and 70 μl of 10% NP40 and 70 μl of 1,2-diheptanoyl-sn-glycero-3-phosphocholine (DHPC, 300 mM) per millilitre of supernatant were added. This solution was mixed and then clarified at 17,000g for 10 min at 4 °C. The resulting high-speed supernatant was transferred to a new tube. This supernatant served as the input. A small amount (25 μl) was added to a new tube containing 350 μl of buffer RLT for future input RNA purification. Immunoprecipitation was performed with an anti-Flag antibody loaded beads. The beads were washed four times using 0.15 M KCl Wash buffer (10 mM HEPES (pH 7.4), 350 mM KCl, 5 mM MgCl , 2 mM DTT, 1% NP40, 100 U ml−1 RNasin, and 100 μg ml−1 cycloheximide). After the final wash, the RNA was eluted by addition of buffer RLT (350 μl) to the beads on ice, the beads removed by a magnet, and the RNA purified using the RNeasy Micro Kit (Qiagen) and analysed using an Agilent 2100 Bioanalyzer. cDNA libraries for RNA-seq were prepared with Ovation RNA-Seq System V2 and Ovation Ultralow Library Systems (NuGen), and analysed on an Illumina HiSeq 2500. Gene classification shown in Supplementary Table 1 was performed using PANTHER (http://pantherdb.org/)40. These procedures are related to the results in Fig. 4 and Extended Data Fig. 8. We adapted a previously described procedure to isolate fluorescently labelled neurons from the mouse brain41, 42, 43. Individual adult male mice (postnatal day 56 ± 3) were anaesthetized in an isoflurane chamber, decapitated, and the brain was immediately removed and submerged in fresh ice-cold artificial cerebrospinal fluid (ACSF) containing 126 mM NaCl, 20 mM NaHCO , 20 mM dextrose, 3 mM KCl, 1.25 mM NaH PO , 2 mM CaCl , 2 mM MgCl , 50 μM DL-AP5 sodium salt, 20 μM DNQX, and 0.1 μM tetrodotoxin, bubbled with a carbogen gas (95% O and 5% CO ). The brain was sectioned on a vibratome (Leica VT1000S) on ice, and each slice (300–400 μm) was immediately transferred to an ACSF bath at room temperature. After the brain slicing was complete (not more than 15 min), individual slices of interest were transferred to a small Petri dish containing bubbled ACSF at room temperature. The POA was microdissected under a fluorescence dissecting microscope, and the slices before and after dissection were imaged to examine the location of the microdissected tissue and confirm its location. The dissected tissue pieces were transferred to a microcentrifuge tube and treated with 1 mg ml−1 pronase (Sigma, P6911-1G) in carbogen-bubbled ACSF for 70 min at room temperature without mixing in a closed tube. After incubation, with the tissue pieces sitting at the bottom of the tube, the pronase solution was pipetted out of the tube and exchanged with cold ACSF containing 1% fetal bovine serum. The tissue pieces were dissociated into single cells by gentle trituration through Pasteur pipettes with polished tips of 600, 300, and 150 μm diameter. Single cells were isolated by fluorescence-activated cell sorting into individual wells of 96-well plates or 8-well PCR strips containing 2.275 μl of Dilution Buffer (SMARTer Ultra Low RNA Kit for Illumina Sequencing, Clontech 634936), 0.125 μl RNase inhibitor (SMARTer kit), and 0.1 μl of 1:1,000,000 diluted RNA spike-in RNAs (ERCC RNA Spike-In Mix 1, Life Technologies 4456740). Sorting was performed on a BD FACSAriaII SORP using a 130 μm nozzle, a sheath pressure of 10 p.s.i., and in the single-cell sorting mode. To exclude dead cells, DAPI (DAPI*2HCl, Life Technologies D1306) was added to the single-cell suspension to the final concentration of 2 ng ml−1. Sorted cells were frozen immediately on dry ice and stored at −80 °C. We used the SMARTer kit described above to reverse transcribe single-cell RNA and amplify the cDNA for 19 PCR cycles. To stabilize the RNA after quickly thawing the cells on ice, we immediately added to each sample an additional 0.125 μl of RNase inhibitor mixed with SMART CDS Primer II A. All steps downstream were performed according to the manufacturer’s instructions. cDNA concentration was quantified using Agilent Bioanalyzer High Sensitivity DNA chips. For most samples, 1 ng of amplified cDNA was used as input to make sequencing libraries with a Nextera XT DNA kit (Illumina FC-131-1096). Individual libraries were quantified using Agilent Bioanalyzer DNA 7500 chips. To assess sample quality and adjust the concentrations of libraries for multiplexing on HiSeq, all libraries were sequenced first on Illumina MiSeq to obtain approximately 100,000 reads per library, and then on Illumina HiSeq 2000 or 2500 to generate 100 base pair reads. These procedures are related to the results in Fig. 4 and Extended Data Fig. 8. Since both TRAP and single-cell RNA-seq have technical limitations and are prone to false-positive and false-negative errors, we used the following strategy for identifying markers for POA sleep neurons. (1) To eliminate false-positive errors, the candidate markers with existing Cre lines were tested in optogenetic experiments, and cell types that did not promote sleep were eliminated (for example, GAL, which was found to be enriched in the TRAP experiment). (2) To reduce false-negative errors, we included markers identified by either method in our candidate list, rather than only those identified by both methods. This should have enhanced our chance of finding a useful marker, even if it were missed by one of the methods because of false-negative errors. Of course, this strategy could increase the probability for false-positive errors in our candidate list, but these errors were eliminated by the functional test in (1). To inhibit CCK, CRH, or TAC1 neurons, we injected CNO dissolved in 0.1 ml vehicle solution (PBS with 0.5% dimethyl sulfoxide (DMSO)) into CCK-, CRH- or TAC1-Cre mice expressing hM4Di in the POA, 20 min before the recording session. CNO was administered intraperitoneally at 2.5 mg per kg (body weight). Vehicle solution was injected for the control experiment. These procedures are related to the results in Extended Data Fig. 10. Slice recordings were made at postnatal days 42–50. AAV -EF1α-DIO-ChR2–eYFP (500 nl) was injected into the POA of GAD2-Cre mice, and recording was made 2–3 weeks after injection. Slice preparation was according to procedures described previously44. A mouse was deeply anaesthetized with 5% isoflurane. After decapitation, the brain was dissected rapidly and placed in ice-cold oxygenated HEPES-buffered ACSF (in mM: NaCl 92, KCl 2.5, NaH PO 1.2, NaHCO 30, HEPES 20, glucose 25, sodium ascorbate 5, thiourea 2, sodium pyruvate 3, MgSO ·7H O 10, CaCl ·2H O 0.5, and NAC 12, at pH 7.4, adjusted with 10 M NaOH), and coronal sections of the TMN were made with a vibratome (Leica). Slices (300 μm thick) were recovered in oxygenated NMDG–HEPES solution (in mM: NMDG 93, KCl 2.5, NaH PO 1.2, NaHCO 30, HEPES 20, glucose 25, sodium ascorbate 5, thiourea 2, sodium pyruvate 3, MgSO ·7H O 10, CaCl ·2H O 0.5, and NAC 12, at pH 7.4, adjusted with HCl) at 32 °C for 10 min and then maintained in an incubation chamber with oxygenated standard ACSF (in mM: NaCl 125, KCl 3, CaCl 2, MgSO 2, NaH PO 1.25, sodium ascorbate 1.3, sodium pyruvate 0.6, NaHCO 26, glucose 10, and NAC 10, at pH 7.4, adjusted by 10 M NaOH) at 25 °C for 1–4 h before recording. All chemicals were from Sigma. Whole-cell recordings were made at 30 °C in oxygenated solution (in mM: NaCl 125, KCl 4, CaCl 2, MgSO 1, NaH PO 1.25, sodium ascorbate 1.3, sodium pyruvate 0.6, NaHCO 26, and glucose 10, at pH 7.4). Inhibitory postsynaptic currents were recorded using a caesium-based internal solution (in mM: CsMeSO 125, CsCl 2, HEPES 10, EGTA 0.5, MgATP 4, Na GTP 0.3, sodium phosphocreatine 10, TEACl 5, QX-314 3.5, at pH 7.3, adjusted with CsOH, 290–300 mOsm) and isolated by clamping the membrane potential of the recorded neuron at the reversal potential of the excitatory synaptic currents. The resistance of the patch pipette was 3–5 MΩ. The cells were excluded if the series resistance exceeded 40 MΩ or varied by more than 20% during the recording period. To activate ChR2, we used a mercury arc lamp (Olympus) coupled to the epifluorescence light path and bandpass filtered at 450–490 nm (Semrock), gated by an electromagnetic shutter (Uniblitz). A blue light pulse (5 ms) was delivered through a 40 × 0.8 numerical aperture water immersion lens (Olympus) at a power of 1–2 mW. Data were recorded with a Multiclamp 700B amplifier (Axon instruments) filtered at 2 kHz and digitized with a Digidata 1440A (Axon instruments) at 4 kHz. Recordings were analysed using Clampfit (Axon instruments). These procedures are related to the results in Extended Data Fig. 2. At the end of each recording, cytoplasm was aspirated into the patch pipette, expelled into a PCR tube as described previously45. The single-cell reverse-transcription PCR (RT–PCR) protocol was designed to detect the presence of mRNAs coding for GAPDH, GAD1, VGLUT2, and HDC. First, reverse transcription and the first round of PCR amplification were performed with gene-specific multiplex primer using the SuperScript III One-Step RT–PCR kit (12574-018, Invitrogen) according to the manufacturer’s protocol. Second, nested PCR was performed using GoTaq Green Master Mix (M7121, Promega) with nested primers for each gene. Amplification products were visualized via electrophoresis using 2% agarose gel. Primers (5′>3′) for single-cell RT–PCR were as follows. GAPDH (sense/anti-sense): multiplex, ACTCCACTCACGGCAAATTC/CACATTGGGGGTAG GAACAC; nested, AGCTTGTCATCAACGGGAAG/GTCATGAGCCCTTC CACAAT; Final product 331 base pairs (bp). GAD1 (sense/anti-sense): multiplex, CACAGGTCACCCTCGATTTT/TCTATGCCGCTGAGTTTGTG; nested, TAGCTGGTGAATGGCTGACA/CTTGTAACGAGCAGCCATGA; final product 200 bp. VGLUT2 (sense/anti-sense): multiplex, GCCGCTACATCATAGCCATC/GCTCTCTCCAATGCTCTCCTC; nested, ACATGGTCAACAACAGCACTATC/ATAAGACACCAGAAGCCAGAACA; final product 506 bp. HDC (sense/anti-sense): multiplex, GGAGCCCTGTGAATACCGTG/TCCACTGAAGAGTGAGCCTGA; nested, CGTGAATACTACCGAGCTAGAGG/ACTCGTTCAATGTCCCCAAAG; final product 182 bp. These procedures are related to the results in Extended Data Fig. 2. Statistical analysis was performed using MATLAB, GraphPad Prism, or Python. The selection of statistical tests was based on reported previous studies. All statistical tests were two-sided. The 95% confidence intervals for brain state probabilities were calculated using a bootstrap procedure: for an experimental group of n mice, with mouse i comprising m trials, we repeatedly resampled the data by randomly drawing for each mouse m trials (random sampling with replacement). For each of the 10,000 iterations, we recalculated the mean probabilities for each brain state across the n mice. The lower and upper confidence intervals were then extracted from the distribution of the resampled mean values. To test whether a given brain state was significantly modulated by laser stimulation, we calculated for each bootstrap iteration the difference between the mean probabilities during laser stimulation and the preceding period of identical duration. The investigators were not blinded to allocation during experiments and outcome assessment. To determine the sample size for optogenetic and pharmacogenetic experiments, we first performed pilot experiments with two or three mice. Given the strength of the effect and the variance across this group, we then predicted the number of animals required to reach sufficient statistical power. To determine the sample size (number of units) for optrode recordings, we first recorded from two animals. Given the success rate of finding identified units and the homogeneity of units in the initial data set, we set a target sample size. For rabies-mediated retrograde tracing, histology, and slice recording experiments, the selection of the sample size was based on numbers reported in previous studies. For gene profiling experiments, sample size was not calculated a priori, and the selection of the sample size was based on previous studies. Otherwise, no statistical methods were used to predetermine sample size. The single-cell RNA-seq data have been deposited in the Gene Expression Omnibus under accession number GSE79108. All other data are available from the corresponding author upon reasonable request.


News Article | May 29, 2017
Site: www.sciencedaily.com

If the mother is stressed over a longer period of time during pregnancy, the concentration of stress hormones in amniotic fluid rises, as proven by an interdisciplinary team of researchers from the University of Zurich. Short-term stress situations, however, do not seem to have an unfavorable effect on the development of the fetus. The feeling of constantly being on edge, always having to take care of everything, not being able to find a balance: If an expectant mother is strongly stressed over a longer period of time, the risk of the unborn child developing a mental or physical illness later in life -- such as attention deficit hyperactivity disorder (ADHD) or cardiovascular disease -- increases. The precise mechanism of how stress affects the baby in the womb is not yet been completely clarified. In cooperation with the University Hospital Zurich and the Max Planck Institute Munich, researchers of the University of Zurich have discovered that physical stress to the mother can change the metabolism in the placenta and influence the growth of the unborn child. Stress hormone affects the growth of the fetus When stressed, the human body releases hormones to handle the higher stress, such as the so-called corticotropin-releasing hormone (CRH), which results in an increase in stress hormone cortisol. This mechanism also persists during pregnancy, and the placenta, which supplies the fetus with nutrients, can also emit stress hormone CRH. As a result, a small amount of this hormone enters the amniotic fluid and fetal metabolism. Animal studies have shown that this hormone can boost the development of the unborn child: Unfavorable growth conditions in the woman lead to an increased release of the hormone, thereby improving the chances of survival in case of a premature birth. Under certain circumstances, however, this increase can also have negative consequences: "An excessive acceleration of growth may occur at the expense of the proper maturation of the organs," says Ulrike Ehlert, psychologist and program coordinator. How does mental stress to the mother affect the release of stress hormones in the placenta? The research team tested 34 healthy pregnant women, who took part in amniocentesis within the scope of prenatal diagnostics. Such a test constitutes a stress situation for the expectant mother as her body secretes cortisol in the short term. To determine whether the placenta also releases stress hormones, the researchers compared the cortisol level in the mother's saliva with the CRH level in the amniotic fluid -- and determined that there was no connection: "The baby obviously remains protected against negative effects in case of acute, short-term stress to the mother," Ehlert concludes. Longer-term stress can be measured in amniotic fluid The situation of the results regarding prolonged stress is completely different, as was determined using questionnaires for diagnosing chronic social overload: "If the mother is stressed for a longer period of time, the CRH level in the amniotic fluid increases," says Pearl La Marca-Ghaemmaghami, psychologist and program researcher. This higher concentration of stress hormone in turn accelerates the growth of the fetus. As a result, the effect of the hormone on growth is confirmed, as has been observed in animals such as tadpoles: If their pond is on the verge of drying out, CRH is released in tadpoles, thereby driving their metamorphosis. "The corticotropin-releasing hormone CRH obviously plays a complex and dynamic role in the development of the human fetus, which needs to be better understood," La Marca-Ghaemmaghami summarizes. The psychologists advise pregnant women who are exposed to longer-term stress situations to "seek support from a therapist to handle the stress better." Stress during pregnancy cannot always be avoided, however. "A secure bond between the mother and child after the birth can neutralize negative effects of stress during pregnancy," La Marca-Ghaemmaghami says.


News Article | May 23, 2017
Site: www.prweb.com

The Atlanta Chapter of the Association for Corporate Growth® (ACG), a global professional organization with the mission of Driving Middle-Market Growth®, today announced the 2017 Georgia Fast 40, recognizing the top 40 fastest-growing middle-market companies in Georgia. LocumTenens.com was recognized for its excellence in growth for the 2017 awards. “LocumTenens.com’s growth is a reflection of our associates’ commitment to provide exemplary service to our customers,” said Chris Franklin, president of LocumTenens.com. “We believe this dedication to service and our focus on innovation allow us to remain a leader in our market, providing unique, strategic solutions for our customers’ staffing challenges.” Applicants were required to submit three years of verifiable revenue and employment growth records, which were validated by national accounting firm and founding Diamond sponsor, Cherry Bekaert LLP. An ACG Selection Committee evaluated each application and conducted in-person interviews with all qualified applicants. All companies on the list are for profit, headquartered in Georgia and reported 2016 annual revenues ranging from $15 to $500 million. “These 40 companies represent 9,574 new jobs and $2.03 billion in revenue growth over the last two years alone,” said Justin Palmer, chairman of the 2017 Georgia Fast 40 Awards and Vice President at Genesis Capital, LLC. “We are proud to honor these great companies in our communities.” ACG Atlanta will present the awards at the Georgia Fast 40 Awards Dinner and Gala at Flourish Atlanta on June 22, 2017, at which more than 600 leaders in the Georgia business community will be in attendance. Tables and single tickets can be purchased online at http://www.acg.org/atlanta. Honored companies include: ADAPTURE Advanced Medical Pricing Solutions (AMPS) C2 Educational Systems, Inc. CarePlus Anesthesia Management Chime Solutions ClickDimensions Commissions, Inc. (CINC) Cortland Partners CRH Healthcare, LLC Curant Health Dinova, Inc. Envistacom FactorTrust GPS Hospitality Guardian Pharmacy, LLC Kabbage Inc Intellinet IPG LocumTenens.com Manufacturing Resources International, Inc. Merchants Preferred Lease-Purchase Services MiMedx Mountain Express Oil Company N3 OneDigital Health and Benefits Onepath Optomi, LLC Parkmobile, LLC Paymetric Phobio, LLC PT Solutions Physical Therapy QGenda Riskonnect, Inc. REPAY SecurAmerica Softvision Swift Straw TekStream Solutions, LLC The RADCO Companies VDart Inc About ACG Atlanta ACG comprises more than 14,500 members from corporations, private equity, finance, and professional service firms representing Fortune 500, Fortune1000, FTSE 100, and mid-market companies in 59 chapters in North America and Europe. Founded in 1974, ACG Atlanta is one of the oldest and most active chapters, providing the area's executives and professionals a unique forum for exchanging ideas and experiences concerning organic and acquisitive growth. Programs include Atlanta ACG Capital Connection, The Georgia Fast 40 Honoree Awards and Gala, a Wine Tasting Reception, a Deal of the Year event as well as an active Women’s Forum and Young Professionals group. About LocumTenens.com LocumTenens.com is a full-service healthcare staffing agency, specializing in the temporary placement of physicians, CRNAs, physician assistants and nurse practitioners at healthcare facilities across the U.S. As the industry’s most-visited job board, LocumTenens.com helps healthcare organizations connect with the professionals they need to ensure patients have access to quality care. Founded in 1995, LocumTenens.com is part of the Jackson Healthcare family of companies. Learn more at http://www.locumtenens.com/about.


CRH America expects to pay for all Notes validly tendered and accepted for purchase on May 11, 2017. Citigroup, HSBC, NatWest Markets and Wells Fargo Securities served as dealer managers for the Tender Offer, and D.F. King & Co., Inc. served as the information and tender agent. Capitalized terms used but not otherwise defined in this announcement have the meanings given to them in the Offer to Purchase. DISCLOSURE NOTICE:  Some statements in this news release may constitute forward-looking statements.  These forward-looking statements are subject to risks and uncertainties that may cause actual results to differ materially from those indicated in the forward-looking statements.  A description of risks and uncertainties can be found in the Annual Report on Form 20-F of CRH and its other public filings and press releases.  Except as required by law, neither CRH nor CRH America assumes any obligation to update any forward-looking statements contained in this news release as a result of new information or future events or developments. NOT FOR RELEASE, PUBLICATION OR DISTRIBUTION IN OR INTO, OR TO ANY PERSON RESIDENT AND/OR LOCATED IN, ANY JURISDICTION WHERE SUCH RELEASE, PUBLICATION OR DISTRIBUTION IS UNLAWFUL To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/crh-announces-expiration-of-the-any-and-all-cash-tender-offer-by-crh-america-inc-300454163.html


The Tender Offer will expire at 11:59 p.m., New York City time, on May 8, 2017, unless extended or earlier terminated (such time and date, as the same may be extended, the "Expiration Time"). Holders of Notes must validly tender and not validly withdraw their Notes before 11:59 p.m., New York City time, on May 8, 2017, to receive the Total Consideration. Notes validly tendered may be withdrawn at any time prior to the Expiration Time, but not thereafter. Payment of the Total Consideration to Holders of Notes that are accepted for purchase is expected to be made on May 11, 2017 (the "Settlement Date"). Holders who validly tender and do not validly withdraw their Notes and whose Notes are accepted for purchase in the Offer will also be paid on the Settlement Date accrued and unpaid interest from the last interest payment date up to, but excluding, the Settlement Date. The Tender Offer is subject to the satisfaction or waiver of certain conditions set forth in the Offer to Purchase. CRH America's obligation to accept any Notes tendered and to pay the Total Consideration are set forth solely in the Offer to Purchase, the Letter of Transmittal and the Notice of Guaranteed Delivery. CRH America may amend, extend or terminate the Offer at any time in its sole discretion, subject to applicable law. If CRH America takes any of these actions, a public announcement will be made thereof. CRH America has retained Citigroup, HSBC, NatWest Markets and Wells Fargo Securities to serve as dealer managers for the Tender Offer. D.F. King & Co., Inc. has been retained to serve as the information and tender agent. For additional information regarding the terms of the Tender Offer, please contact: Citigroup at +44 20 7986 8969 (Europe), (800) 558-3745 (toll free) or (212) 723-6106 (collect); HSBC at (888) HSBC-4LM (Toll Free), (212) 525-5552 (collect) or +44 (0) 20 7992 6237 (Europe); NatWest Markets at (203) 897-2963 (collect); or Wells Fargo Securities at (704) 410-4760 (collect) or (866)309-6316 (toll free).  Requests for documents may be directed to D.F. King & Co., Inc. at (866) 796-6869 (toll free), or (212) 269-5550 (collect for banks and brokers) or via email at crh@dfking.com. Capitalized terms used but not otherwise defined in this announcement have the meanings given to them in the Offer to Purchase. This news release is neither an offer to purchase nor a solicitation of an offer to sell Notes, nor is it a solicitation for acceptance of the Tender Offer. CRH America is making the Tender Offer only by, and pursuant to the terms of, the Offer to Purchase, the Letter of Transmittal and Notice of Guaranteed Delivery. The Tender Offer is not being made in any jurisdiction in which the making or acceptance thereof would not be in compliance with the securities, blue sky or other laws of such jurisdiction. None of CRH, its management, CRH America, Citigroup Global Markets Limited, HSBC Securities (USA) Inc., RBS Securities Inc. (marketing name "NatWest Markets") or Wells Fargo Securities or their affiliates, or D.F. King & Co., Inc. makes any recommendation as to whether holders should tender, or refrain from tendering, Notes in response to the Tender Offer. DISCLOSURE NOTICE: Some statements in this news release may constitute forward-looking statements. These forward-looking statements are subject to risks and uncertainties that may cause actual results to differ materially from those indicated in the forward-looking statements. A description of risks and uncertainties can be found in the Annual Report on Form 20-F of CRH and its other public filings and press releases. Except as required by law, neither CRH nor CRH America assumes any obligation to update any forward-looking statements contained in this news release as a result of new information or future events or developments. This communication of this announcement, the Offer to Purchase and any other documents or materials relating to the Tender Offer is not being made, and such documents and/or materials have not been approved, by an authorised person for the purposes of section 21 of the FSMA. Accordingly, such documents and/or materials are not being distributed to, and must not be passed on to, the general public in the United Kingdom. The communication of such documents and/or materials is exempt from the restriction on financial promotions under section 21 of the FSMA on the basis that it is only directed at and may be communicated to (1) those persons who are existing members or creditors of the Group or other persons within Article 43 of the Financial Services and Markets Act 2000 (Financial Promotion) Order 2005, and (2) any other persons to whom these documents and/or materials may lawfully be communicated. Neither this announcement, the Offer to Purchase nor any other documents or materials relating to the Tender Offer have been submitted to or will be submitted for approval or recognition to the Financial Services and Markets Authority (Autorité des services et marchés financiers / Autoriteit voor financiële diensten en markten) and, accordingly, the Tender Offer may not be made in Belgium by way of a public offering, as defined in Articles 3 and 6 of the Belgian Law of April 1, 2007 on public takeover bids as amended or replaced from time to time. Accordingly, the Tender Offer may not be advertised and the Tender Offer will not be extended, and neither this announcement nor any other documents or materials relating to the Tender Offer (including any memorandum, information circular, brochure or any similar documents) has been or shall be distributed or made available, directly or indirectly, to any person in Belgium other than "qualified investors" in the sense of Article 10 of the Belgian Law of June 16, 2006 on the public offer of placement instruments and the admission to trading of placement instruments on regulated markets, acting on their own account. This announcement has been issued only for the personal use of the above qualified investors and exclusively for the purpose of the Tender Offer. Accordingly, the information contained in this announcement may not be used for any other purpose or disclosed to any other person in Belgium. The Tender Offer is not being made, directly or indirectly, to the public in France. Neither this announcement, the Offer to Purchase nor any other documents or offering materials relating to the Tender Offer, has been or shall be distributed to the public in France and only (i) providers of investment services relating to portfolio management for the account of third parties (personnes fournissant le service d'investissement de gestion de portefeuille pour compte de tiers) and/or (ii) qualified investors (investisseurs qualifiés), other than individuals, acting for their own account, all as defined in, and in accordance with, Articles L.411-1, L.411-2 and D.411-1 to D.411-3 of the French Code monétaire et financier, are eligible to participate in the Offer. This announcement has not been and will not be submitted for clearance procedures (visa) of the Autorité des marchés financiers. None of the Tender Offer, this announcement, the Offer to Purchase or any other documents or materials relating to the Tender Offer has been or will be submitted to the clearance procedure of the Commissione Nazionale per le Società e la Borsa ("CONSOB"), pursuant to applicable Italian laws and regulations. The Tender Offer is being carried out in the Republic of Italy ("Italy") as an exempted offer pursuant to article 101-bis, paragraph 3-bis of the Legislative Decree No. 58 of February 24, 1998, as amended (the "Financial Services Act") and article 35-bis, paragraph 4 of CONSOB Regulation No. 11971 of May 14, 1999, as amended (the "CONSOB Regulation"). The Tender Offer is also being carried out in compliance with article 35-bis, paragraph 7 of the CONSOB Regulation. Holders or beneficial owners of the Notes located in Italy can tender the Notes through authorised persons (such as investment firms, banks or financial intermediaries permitted to conduct such activities in Italy in accordance with the Financial Services Act, CONSOB Regulation No. 16190 of October 29, 2007, as amended from time to time, and Legislative Decree No. 385 of September 1, 1993, as amended) and in compliance with applicable laws and regulations or with requirements imposed by CONSOB or any other Italian authority. Each intermediary must comply with the applicable laws and regulations concerning information duties vis-à-vis its clients in connection with the Notes or the Tender Offer. Neither this announcement, the Offer to Purchase nor any other materials relating to the Tender Offer constitute, nor may be used in connection with, an offer or solicitation in any place where offers or solicitations are not permitted by law. Any offer or solicitation in Canada must be made through a dealer that is appropriately registered under the laws of the applicable province or territory of Canada, or pursuant to an exemption from that requirement. The Tender Offer does not constitute an offer to buy or the solicitation of an offer to sell Notes in any circumstances in which such offer or solicitation is unlawful. In those jurisdictions where the securities or other laws require the Tender Offer to be made by a licensed broker or dealer and the Dealer Manager or, where the context so requires, any of its affiliates is such a licensed broker or dealer in that jurisdiction, the Tender Offer shall be deemed to be made on behalf of CRH America, Inc. by such Dealer Manager or affiliate (as the case may be) in such jurisdiction. The distribution of this announcement and the Offer to Purchase in certain jurisdictions may be restricted by law. Persons into whose possession this announcement and the Offer to Purchase comes are required by each of CRH America, the Dealer Managers and the Tender Agent to inform themselves about, and to observe, any such restrictions. To view the original version on PR Newswire, visit:http://www.prnewswire.com/news-releases/crh-announces-total-consideration-for-the-any-and-all-cash-tender-offer-by-crh-america-inc-300453524.html


News Article | May 9, 2017
Site: www.prnewswire.com

Another research by Global Market Insights indicates that strong R&D spending trends for synthetic biology to enable drug and vaccine development, including Europe NEST program will stimulate growth. Organizations including DBT (Department of Biotechnology) and NTBT (National Biotechnology Board) provides funding for promoting biotechnology market share. The U.S. biotechnology market size held a dominant position in terms of industry revenue share, with Europe following. This trend is likely to continue throughout the forecast period. The U.S. will further see increased adoption of products based on these platforms, as growth for personalized medicine becomes a preference. Quest PharmaTech Inc. (TSX-V: QPT) is a pharmaceutical company developing and commercializing products to improve the quality of life. Just this morning the company announced that its subsidiary, OncoQuest Inc. ("OncoQuest"), a biopharmaceutical company focused on the development and commercialization of immunotherapeutic products for the treatment of cancer has completed the enrollment of the first patient in a Phase 1/2 clinical study to evaluate the use of oregovomab in combination with Nivolumab, an anti-PD1 human monoclonal antibody which works as a checkpoint inhibitor in ovarian cancer patients in the recurrent setting. This clinical trial is being conducted at the National Cancer Centre in Singapore ("NCCS"), with Dr. Tira Tan as Principal Investigator, Adjunct Associate Professor John Chia from Oncocare Cancer Centre as the Study Chair, and Dr. Jack Chan as the co-chair. "We are extremely excited about launching this study," noted Dr. John Chia. "Ovarian cancer is a lethal disease, and this trial may offer new hope for our patients. Early clinical data suggests that oregovomab may improve the immune system's processing of cancer antigens, and enhance the immune ability to recognize these cancer targets. We believe that the combination of oregovomab and Nivolumab, which amplifies such immune activity, will have a synergistic effect to elicit a higher quality tumor immune response, and hence improve control of the cancer." This will be the first clinical trial testing the combination of oregovomab with a checkpoint inhibitor as potential treatment of ovarian cancer in the recurrent setting. "We continue to explore the potential of oregovomab in various stages of the progression of ovarian cancer," said Dr. Madiyalakan, CEO of Quest and OncoQuest. In frontline ovarian cancer, OncoQuest has recently announced positive interim results from its randomized controlled multi-center Phase 2 clinical trial with oregovomab as an indirect immunizer, in scheduled combination with carboplatin and paclitaxel. "In the recurrent setting, we are exploring the use of oregovomab with immune adjuvants in two clinical trials. The trial NCCS is conducting is in combination with a checkpoint inhibitor. We are also in the process of initiating a trial in U.S. in combination with a TLR3 agonist, Hiltonol®," continued Dr. Madiyalakan. Theratechnologies Inc. (OTC: THERF) is a specialty pharmaceutical company addressing unmet medical needs to promote healthy living and an improved quality of life among HIV patients. Recently, the company announced that its partner, TaiMed Biologics, Inc., has completed the submission of a Biologics License Application (BLA) to the U.S. Food and Drug Administration (FDA) for ibalizumab for the treatment of multidrug resistant Human Immunodeficiency Virus-1 (MDR HIV-1). If approved, ibalizumab will be the first antiretroviral treatment (ART) with a new mechanism of action to be introduced in nearly 10 years and the only treatment that does not require daily dosing. CRH Medical Corporation (NYSE: CRHM) is a North American company focused on providing gastroenterologists throughout the United States with innovative services and products for the treatment of gastrointestinal diseases. On March 15, 2017, the company announced that it has completed an accretive transaction whereby CRH has acquired a 60% interest in a gastroenterology ("GI") anesthesia practice in Kissimmee Florida ("Kissimmee"). CRH also announces that it has entered into an exclusive agreement to develop and manage a monitored anesthesia care ("MAC", or "Deep Sedation") program with Puget Sound Gastroenterology ("PSG"), located in Washington State. Aurinia Pharmaceuticals Inc. (NASDAQ: AUPH) a clinical stage biopharmaceutical company focused on the global immunology market, today announced additional 48-week results from its global Phase IIb AURA-LV (AURA) study in lupus nephritis (LN) during the National Kidney Foundation 2017 Spring Clinical Meetings in Orlando, FL. In addition to the trial meeting its complete and partial remission ("CR"/"PR") endpoints at 48 weeks, all pre-specified secondary endpoints that have been analyzed to date were also met at 48 weeks. These pre-specified endpoints include: time to CR and PR (speed of remission); reduction in Systemic Lupus Erythematosus Disease Activity Index or SLEDAI score; and reduction in urine protein creatinine ratio (UPCR) over the 48-week treatment period. The data were presented during the late-breaking session by lead author Dr. Samir Parikh, a clinical investigator for the study and Assistant Professor of Clinical Nephrology at the Ohio State University. Concordia International Corp. (NASDAQ: CXRX) together with its subsidiaries is an international specialty pharmaceutical company focused on generic and legacy pharmaceutical products and orphan drugs. On January 3rd, the company announced it has entered into a three-year, co-promotion agreement with RedHill Biopharma Ltd. through which the companies expect to expand sales of Donnatal®, Concordia's product used in the treatment of irritable bowel syndrome. Concordia's North America segment seeks to acquire and manage drugs that are in the maturity or legacy stage of the pharmaceutical product lifecycle and continue on a predictable revenue generation path. These products have a well-established record of safety and efficacy and a history of stable demand. Please Sign Up Now at http://www.FinancialBuzz.com to receive alerts on Trending Financial News from all these companies. "The Latest Buzz in Financial News" Subscribe Now! Watch us report from NYSE https://www.youtube.com/FinancialBuzzMedia Follow us on Twitter for real time Financial News Updates: https://twitter.com/financialbuzz Follow and talk to us on Instagram: https://www.instagram.com/financialbuzz Facebook Like Us to receive live feeds: https://www.facebook.com/Financialbuzz/ FinancialBuzz.com, a leading financial news informational web portal designed to provide the latest trends in Market News, Investing News, Personal Finance, Politics, Entertainment, in-depth broadcasts on Stock News, Market Analysis and Company Interviews. A pioneer in the financially driven digital space, video production and integration of social media, FinancialBuzz.com creates 100% unique original content. FinancialBuzz.com also provides financial news PR dissemination, branding, marketing and advertising for third parties for corporate news and original content through our unique media platform that includes Newswire Delivery, Digital Advertising, Social Media Relations, Video Production, Broadcasting, and Financial Publications. Please Note: FinancialBuzz.com is not a financial advisory or advisor, investment advisor or broker-dealer and do not undertake any activities that would require such registration. The information provided on http://www.FinancialBuzz.com (the "Site") is either original financial news or paid advertisements provided [exclusively] by our affiliates (sponsored content), FinancialBuzz.com, a financial news media and marketing firm enters into media buys or service agreements with the companies which are the subject to the articles posted on the Site or other editorials for advertising such companies. Financialbuzz.com has not been compensated directly by any of the companies mentioned here in this editorial. We are not an independent news media provider and therefore do not represent or warrant that the information posted on the Site is accurate, unbiased or complete. FinancialBuzz.com receives fees for producing and presenting high quality and sophisticated content on FinancialBuzz.com along with other financial news PR media services. FinancialBuzz.com does not offer any personal opinions or bias commentary as we purely incorporate public market information along with financial and corporate news. FinancialBuzz.com only aggregates or regurgitates financial or corporate news through our unique financial newswire and media platform. For this release, FinancialBuzz.com has been compensated four thousand dollars for financial news dissemination and PR services by a third party non affiliate for Quest PharmaTech Inc. Our fees may be either a flat cash sum or negotiated number of securities of the companies featured on this editorial or site, or a combination thereof. The securities are commonly paid in segments, of which a portion is received upon engagement and the balance is paid on or near the conclusion of the engagement. FinancialBuzz.com will always disclose any compensation in securities or cash payments for financial news PR advertising. FinancialBuzz.com does not undertake to update any of the information on the editorial or Site or continue to post information about any companies the information contained herein is not intended to be used as the basis for investment decisions and should not be considered as investment advice or a recommendation. The information contained herein is not an offer or solicitation to buy, hold or sell any security. FinancialBuzz.com, members and affiliates are not responsible for any gains or losses that result from the opinions expressed on this editorial or Site, company profiles, quotations or in other materials or presentations that it publishes electronically or in print. Investors accept full responsibility for any and all of their investment decisions based on their own independent research and evaluation of their own investment goals, risk tolerance, and financial condition. FinancialBuzz.com. By accessing this editorial and website and any pages thereof, you agree to be bound by the Terms of Use and Privacy Policy, as may be amended from time to time. None of the content issued by FinancialBuzz.com constitutes a recommendation for any investor to purchase, hold or sell any particular security, pursue a particular investment strategy or that any security is suitable for any investor. This publication is provided by FinancialBuzz.com. Each investor is solely responsible for determining whether a particular security or investment strategy is suitable based on their objectives, other securities holdings, financial situation needs, and tax status. You agree to consult with your investment advisor, tax and legal consultant before making any investment decisions. We make no representations as to the completeness, accuracy or timeless of the material provided. All materials are subject to change without notice. Information is obtained from sources believed to be reliable, but its accuracy and completeness are not guaranteed. For our full disclaimer, disclosure and Terms of Use, please visit: http://www.financialbuzz.com


News Article | September 21, 2017
Site: www.marketwired.com

CRH plc, the international building materials group, announces that it has reached an agreement to acquire Ash Grove Cement Company ("Ash Grove"), a leading US cement manufacturer headquartered in Overland Park, Kansas, for a total consideration of US$3.5 billion. The proposed transaction is subject to Ash Grove shareholder and regulatory approvals and will be financed through existing financial resources. The transaction is expected to close around year end 2017. Ash Grove operates eight cement plants across eight US states, combined with extensive readymixed concrete, aggregates and associated logistics assets across the US midwest. For the year ended 31 December 2016, Ash Grove reported profit before tax of US$215 million and gross assets of US$2.5 billion1. Albert Manifold, Chief Executive of CRH, commented: "Ash Grove is an excellent addition to CRH's portfolio of businesses across North America as we seek to deploy our capital into high quality businesses that enhance our global asset base and provide opportunities to create shareholder value. We welcome the Ash Grove team to CRH and look forward to further developing our longstanding relationship as part of one company." Charlie Sunderland, Chairman of the Board of Ash Grove, added: "CRH, as our largest customer, has enjoyed a close and highly productive relationship with Ash Grove for many decades. The Board of Directors believes that CRH will be able to bring Ash Grove on the next phase of its development after 135 years in operation and over a century under the stewardship of the Sunderland family". For further information contact CRH plc at +353 1 404 1000 This document contains inside information and has been issued pursuant to Article 2.1(b) of Commission Implementing Regulation (EU) 2016/1055. The date and time of this statement is the same as the date and time that it has been communicated to the media. 1 Based on audited financial statements as of 31 December 2016. Ash Grove intends to make a special dividend of excess cash and certain investments prior to closing. About CRH CRH (LSE: CRH, ISE: CRG, NYSE: CRH) is a leading global diversified building materials group, employing c.87,000 people at c.3,800 operating locations in 31 countries worldwide. With a market capitalisation of c.EUR 25 billion (September 2017), CRH is the largest building materials company in North America and the second largest worldwide. The Group has leadership positions in Europe as well as established strategic positions in the emerging economic regions of Asia and South America. CRH is committed to improving the built environment through the delivery of superior materials and products for the construction and maintenance of infrastructure, housing and commercial projects. A Fortune 500 company, CRH is a constituent member of the FTSE 100 index, the EURO STOXX 50 index, the ISEQ 20 and the Dow Jones Sustainability Index (DJSI) Europe. CRH's American Depositary Shares are listed on the NYSE. For more information visit www.crh.com About Ash Grove Ash Grove is a leader and pioneer in the cement industry. For 135 years, Ash Grove has provided portland and masonry cements to construct highways, bridges, commercial and industrial complexes, single- and multi-family homes, and other important structures fundamental to America's economic vitality and quality of life. In 2016, Ash Grove shipped 8.2 million tons of cement from eight cement plants and two deep-water import terminals located throughout the midwest, Texas and western United States. In addition to cement manufacturing facilities, the company operates 52 readymixed concrete plants, 25 sand and gravel plants, 20 limestone quarries and nine packaged products plants. Learn more at www.ashgrove.com This information is provided by RNS  The company news service from the London Stock Exchange

Loading CRH Inc collaborators
Loading CRH Inc collaborators