Glasgow, United Kingdom
Glasgow, United Kingdom

Coherent, Inc is a company with headquarters located in Santa Clara, California, USA, with other sites located in the US, Europe, and Asia. It was founded in 1966 by Eugene Watson as a spin-off from laser company Spectra-Physics and converted to public ownership in 1970. The company designs, manufactures and markets laser systems and components, laser measurement and control products, optics, and laser accessories, which are used both in industry and scientific research. According to the company's 2011 SEC filing, their markets are the microelectronics industry , scientific research, OEM components, and materials processing . Wikipedia.


Time filter

Source Type

News Article | February 15, 2017
Site: www.nature.com

All mice were females from a mixed background, housed under standard laboratory conditions, and received food and water ad libitum. All experiments were performed in accordance with the guidelines of the Animal Welfare Committee of the Royal Netherlands Academy of Arts and Sciences, The Netherlands. R26-Confetti;R26-CreERT2, R26-TdTomato;R26-CreERT2, and R26-mTmG;R26-CreERT2 mice were injected intraperitoneally with tamoxifen (Sigma Aldrich), diluted in sunflower oil, to activate Cre recombinase at 3 weeks of age. To achieve clonal density labelling (<1 MaSC per duct), R26-Confetti mice were injected with 0.2 mg tamoxifen per 25 g body weight. To label multiple MaSCs per TEB, R26-Confetti mice were injected with 1.5 mg/25 g at 3 weeks. The clonal dose for R26-mTmG and R26-TdTomato reporter mice was 0.2 mg tamoxifen per 25 g body weight and 0.05 mg/25 g tamoxifen, respectively. Lineage-traced mice were euthanized at mid-puberty (5 weeks of age) or at the end of puberty (8 weeks of age) and mammary glands were collected. Experiments were not randomized, sample size was not determined a priori, and investigators were not blinded to experimental conditions except where indicated. Imaging of whole-mount mammary glands was performed using a Leica TCS SP5 confocal microscope, equipped with a 405 nm laser, an argon laser, a DPSS 561 nm laser and a HeNe 633 nm laser. Different fluorophores were excited as follows: DAPI at 405 nm, CFP at 458 nm, GFP at 488 nm, YFP at 514 nm, RFP at 561 nm and Alexa-647 at 633 nm. DAPI was collected at 440–470 nm, CFP at 470–485 nm, GFP at 495–510 nm, YFP at 540–570 nm, RFP at 610–640 nm and Alexa-647 at 650–700 nm. All images were acquired with a 20× (HCX IRAPO N.A. 0.70 WD 0.5 mm) dry objective using a Z-step size of 5 μm (total Z-stack around 200 μm). All pictures were processed using ImageJ software (https://imagej.nih.gov/ij/). Quantitative analysis of the whole-gland reconstructions induced with 0.2 mg tamoxifen per 25 g body weight was performed on 36 glands from nine mice at 8 weeks of age. We counted 11 luminal and 8 basal clones in subtrees starting from level 6. Quantitative analysis of the whole-gland reconstructions induced with 1.5 mg tamoxifen per 25 g body weight was performed for 10 glands from five mice at 8 weeks of age, 5 glands from three mice at 5 weeks of age, and 3 glands from two mice at 8 weeks of age (traced from 5 weeks of age). Clonal analysis and modelling were based on 606 subclones (157 basal subclones and 449 luminal subclones) from four glands from mice at 8 weeks of age. Data were collected at random and all glands induced at a clonal level were included. Subclones were defined as the density of epithelial cells of the same type (basal or luminal) and confetti colour in a given branch of a given level. Although our theoretical description models the distribution of the number of MaSCs in a TEB of level l, as we cannot access this quantity directly experimentally, we use as a proxy the density of labelled cells of a given type and confetti colour in the corresponding branch of level l (that is, the branch that was formed by the TEB considered in the model). Taking the density instead of the absolute number of labelled cells allowed us to correct for the stochastic variation of branch length that we observed (Extended Data Fig. 1e). The fourth and fifth mammary glands were dissected and incubated in a mixture of collagenase I (1 mg/ml, Roche Diagnostics) and hyaluronidase (50 μg/ml, Sigma Aldrich) at 37 °C for optical clearance, fixed in periodate–lysine–paraformaldehyde (PLP) buffer (1% paraformaldehyde (PFA; Electron Microscopy Science), 0.01M sodium periodate, 0.075 M l-lysine and 0.0375 M P-buffer (0.081 M Na HPO and 0.019M NaH PO ; pH 7.4) for 2 h at room temperature, and incubated for 2 h in blocking buffer containing 1% bovine serum albumin (Roche Diagnostics), 5% normal goat serum (Monosan) and 0.8% Triton X-100 (Sigma-Aldrich) in PBS. Primary antibodies were diluted in blocking buffer and incubated overnight at room temperature. Secondary antibodies diluted in blocking buffer were incubated for at least 4 h. Nuclei were stained with DAPI (0.1 μg/ml; Sigma-Aldrich) in PBS. Glands were washed with PBS and mounted on a microscopy slide with Vectashield hard set (H-1400, Vector Laboratories). Primary antibodies: anti-K14 (rabbit, Covance, PRB155P, 1:700) or anti-E-cadherin (rat, eBioscience, 14-3249-82, 1:700). Secondary antibodies: goat anti-rabbit or goat anti-rat, both conjugated to Alexa-647 (Life Technologies, A21245 and A21247 respectively, 1:400). For 5-ethynyl-2-deoxyuridine (EdU) cell-proliferation staining of whole-mount mammary glands, a click-it stain (Click-iT EdU, Invitrogen) was performed according to the manufacturer’s instructions before staining with primary antibodies as described above. Kidneys were dissected from embryos at embryonic day 16, fixed in PLP buffer overnight at 4 °C, and incubated for 4 h in blocking buffer containing 1% bovine serum albumin (Roche Diagnostics), 5% normal goat serum (Monosan) and 0.8% Triton X-100 (Sigma-Aldrich) in PBS. Primary antibodies were diluted in blocking buffer and incubated overnight at room temperature. Secondary antibodies diluted in blocking buffer were incubated for at least 6 h. Nuclei were stained with DAPI (0.1 μg/ml; Sigma-Aldrich) in PBS. 3.5-, 5- or 8-week-old mice (n = 3 mice for each age) were injected intraperitoneally with 0.5 mg EdU (Invitrogen) diluted in PBS. For the EdU pulse-chase experiments, EdU (0.5 mg) was injected intraperitoneally in 4-week-old mice (n = 3). Mice were euthanized 4 or 72 h after EdU injection and the fourth and fifth mammary glands were collected and processed as whole-mount glands. For analysis, 3D tile-scan images of the whole-mount glands were taken and the number of EdU+ TEBs was scored. For the quantification of the fraction of EdU+ cells, 10 EdU+ TEBs per time point were selected in a blinded manner and the number of EdU+ cells was counted manually for each selected TEB. For the pulse-chase experiment, 3 EdU+ TEBs per mouse were selected in a blinded manner and the intensity of 10 randomly picked EdU+ cells was measured for both the tip and the border area of the selected TEB and a two-tailed t-test was performed. Normal distribution was confirmed using a d’Agostino and Pearson omnibus normality test. The variance between the groups was tested with an F-test and was found to be not significantly different. Three-dimensional tile-scan images of whole-mount mammary glands and embryonic kidneys were used to manually reconstruct the ductal network by outlining the ducts. Labelled confetti cells were annotated in the schematic outline of the mammary tree, including information on the confetti colour for the mammary glands (GFP, green; YFP, yellow; RPF, red; and CFP, cyan). Using custom-made. NET software (available upon request from J.v.R.), the length and width of all the ducts, the coordinates of the branch points, and the position of the labelled cells in ducts and in TEBs were scored in these schematic outline images, which was used as input for a schematic representation of the lineage tree. Custom-made Python software (available upon request from E.H.) and the ETE2 python toolkit were used for the conversion and visualization of the schematic mammary gland lineage tree, including linkage between branches, their respective length and number of cells of each confetti colour. To depict the topology of the resulting tree, the Newick format was used to represent hierarchical structures using nested parentheses to encode information about the linkage between branches, their respective length and number of cells of each confetti colour. The origin of the gland was always located at the top of the reconstruction. R26-CreERT2;R26-mTmG mice were intraperitoneally injected with 0.2 mg tamoxifen per 25 g body weight diluted in sunflower oil (Sigma) at 3 weeks of age. At 5 weeks of age, a mammary window was inserted near the fourth and fifth mammary glands (for details, see ref. 31). Mice were anaesthetized using isoflurane (1.5% isoflurane/medical air mixture) and placed in a facemask with a custom designed imaging box. Mice were intraperitoneally injected with AZD-7762 (0.5 mg in PBS, Sigma) every 5 h during the time-lapse imaging. Imaging was performed on an inverted Leica SP8 multiphoton microscope with a chameleon Vision-S (Coherent Inc.), equipped with four HyD detectors: HyD1 (<455 nm), HyD2 (455–490 nm), HyD3 (500–550 nm) and HyD4 (560–650 nm). Different wavelengths between 700 nm and 1,150 nm were used for excitation; collagen (second harmonic generation) was excited with a wavelength of 860 nm and detected in HyD1. GFP and Tomato were excited with a wavelength of 960 nm and detected in HyD3 and HyD4. TEBs and ducts were imaged every 20–30 min using a Z-step size of 3 μm over a minimum period of 8 h. All images were in 12 bit and acquired with a 25× (HCX IRAPO N.A. 0.95 WD 2.5 mm) water objective. Single TEBs and ducts were isolated from 5-week-old MMTV-Cre;R26-loxP-stop-loxP-YFP mice. YFP expression was used to determine the localization and structure of the mammary gland. Single TEBs and pieces of ducts were micro-dissected from the fourth and fifth mammary glands. Single TEBs and ducts were digested in DMEM/F12 (GIBCO, Invitrogen Life Technologies) supplemented with hyaluronidase (300 μg/ml, Sigma Aldrich), and collagenase I (2 mg/ml, Roche Diagnostics) at 37 °C, followed by centrifugation at 550g for 10 min. The fatty layer on top and the aqueous layer in the middle were aspirated, and the remaining pellet was dissolved in 5 mM EDTA/PBS with 5% fetal bovine serum (Sigma) and kept on ice for 10 min before labelling with the following antibodies: anti-mouse CD45-Pacific blue (clone 30-F11, Biolegend), anti-mouse CD31-Pacific blue (clone 390, Biolegend), and rat anti-mouse CD140a-Pacific blue (Clone APA5, BD Bioscience). Cells were incubated for 30 min on ice in the dark, washed once in 5 mM EDTA/PBS with 5% fetal bovine serum (Sigma), and centrifuged at 250g for 5 min. Pellet was dissolved in 5 mM EDTA/PBS with 7-AAD, and sorted on a FACS AriaII Special Ordered Reseach Product (BD Biosciences). A broad FSC SSC gate was followed by a gate excluding doublets. Next, 7-AAD negative cells were gated, and from this population Lin− (CD45−, CD31−, CD140a−) and YFP+ cells were sorted into 384-well plates containing 5 μl of mineral oil that contained a 200-nl droplet of primers, dNTPs and synthetic mRNA molecules (ERCC). Single-cell mRNA sequencing was performed as described previously32. In brief, cells were sorted into 5 μl of mineral oil containing a 200-nl droplet of primers, dNTPs and synthetic mRNA molecules (ERCC). Cells were fused with this droplet by centrifugation and lysed at 65 °C, followed by room temperature and second-strand synthesis aided by a Nanodrop II liquid handling platform. The resulting cDNA was processed following the CEL-Seq2 protocol33. Libraries were sequenced on an Illumina NextSeq with 75-bp paired-end reads. The 5′ mate was used to identify cells and libraries while the 3′ mate was aligned to the mm10 RefSeq mouse transcriptome using BWA34. Analysis was performed using StemID (for details of the methodology, see ref. 26). Endothelial cells, erythrocytes and lymphocytes were filtered from the data based on expression of Cd36 (5 unique transcripts), Beta-s (1,000 unique transcripts) and Cd74 (2 unique transcripts)/Cd52 (1 unique transcript), respectively (27 cells in total). The remaining cells were normalized by down sampling to 3,000 transcripts, after which StemID26 was used for clustering and cell type annotation. Cells with fewer than 3,000 unique transcripts were discarded. In total, 91 cells were included, of which we could assign 36 cells to the luminal lineage (cluster 1 contained 9 cells, cluster 2 contained 17 cells, cluster 3 contained 2 cells and cluster 5 contained 8 cells), 51 cells to the basal lineage (cluster 5 contained 2 cells, cluster 6 contained 14 cells, cluster 7 contained 10 cells, cluster 8 contained 8 cells and cluster 9 contained 17 cells), and 4 cells to a non-epithelial origin (cluster 4). After identifying luminal and basal cell clusters, three cells that were erroneously annotated as basal cells belonging to cluster 8 were manually annotated to belong to luminal cluster 2, based on luminal and basal markers such as K8/K18 and K5/Acta2, respectively. Cluster 5 expressed higher levels of the pre-ribosomal 45S RNA, which is often found in cells of low quality. We therefore chose to omit cluster 5 from further analysis. Differential gene expression between clusters was based on a previous method35 and performed as described previously32. All data analysis with StemID and custom scripts was performed with Rstudio, version 0.99.491. The sequencing data discussed in this publication have been deposited in the Gene Expression Omnibus, and are accessible through GEO Series accession number GSE85875. Source data are available for Figs 1c–f, 2f, 3b, c, e, 4a–c and Extended Data Figs 1e–k, 2c, e–h, 3b–g, 4e, f, 6d, 8f. All other data are available from the author upon reasonable request. Custom-made. NET software to score the length and width of all the ducts, the coordinates of the branch points and the position of the labelled cells in ducts and in TEBs used as input for a schematic representation of the lineage tree is available upon request from J.v.R. Custom-made Python software and the ETE2 Python toolkit used for the conversion and visualization of the schematic mammary gland lineage tree are available upon request from E.H.


The global semiconductor laser market size is expected to reach USD 9.52 billion by 2024, according to a new report by Grand View Research, Inc. The surging acceptance of fiber optic lasers in the communication and connectivity verticals and the growing preference for semiconductor lasers over other light sources are expected to boost the market growth. The increasing deployment of semiconductor laser diodes in various application verticals has further bolstered the industry growth. The growing usage of 3D printing in the healthcare and architectural platforms are expected to increase the demand for semiconductor lasers. The semiconductor lasers can be categorized on the basis of laser types into fiber optic lasers, vertical cavity surface emitting lasers, compact disc lasers, high power diode lasers, red lasers, violet lasers, green lasers, and blue lasers. The fiber optic laser segment is expected to grow at a remarkable pace owing to the enhanced usage in the communication and photonics segments. The recent administrative regulations pertaining to 3D printing in the healthcare vertical in countries such as the U.S. are further expected to throttle the industry growth. These regulations restrict the regulated usage of 3D printing into prosthetic organs’ fabrication and other life science-based solicitations. However, the shortcomings of the functional and efficient usage associated with the semiconductor lasers are expected to pose challenges for the industry. The recent fiber optic high-speed connectivity across the telecom industries, along with the semiconductor laser usage in flat panel displays, is expected to impel the global semiconductor laser market growth. Further key findings from the report suggest: The growth of the semiconductor laser market can be accredited to the inclination toward semiconductor lasers over other light sources and the growing response to the semiconductor laser applications. 3D printing has marked the emergence of technical advancements in the healthcare and architecture era by authorizing enhanced 3D prototyping in the maritime and architectural segments along with the manufacture of prosthetic organs and several other biosciences applications. High power diode lasers and fiber optic lasers are the two major categories of semiconductor lasers that govern the semiconductor laser diode market from an economic aspect. These lasers currently acquire a major market share, which is anticipated to retain over the forecast period. Flat panel displays, connectivity, communication, and photonics applications are anticipated to be developed as the key application segments for the fiber optic semiconductor lasers. North America and Europe are projected to lose a portion of the semiconductor laser market to the Asia Pacific region. This region is expected to witness a growing demand for the semiconductor laser diodes’ solicitations and the associated laser-based technologies, owing to the manufacturing and high industrialization activities in these regions. The key industry participants include Trumpf GmbH + Co. KG, Coherent Inc., Newport Corporation, Sharp Corporation, IPG Photonics Corporation, Axcel Photonics Inc., ASML Holding NV, Rofin-Sinar Technologies Inc., and Sumitomo Electric Industries, Ltd. The semiconductor laser industry has witnessed the escalating M&A activities amongst the laser diode manufacturers with an aim to enrich the product portfolio with proficient and high-power lasers at cost-effective rates. Orbis Research (orbisresearch.com) is a single point aid for all your market research requirements. We have vast database of reports from the leading publishers and authors across the globe. We specialize in delivering customized reports as per the requirements of our clients. We have complete information about our publishers and hence are sure about the accuracy of the industries and verticals of their specialization. This helps our clients to map their needs and we produce the perfect required market research study for our clients.


Filipin III was from Sigma. Amplex Red cholesterol assay kit was from Invitrogen. IL-2 was from Promega. For the flow cytometric analysis, anti-mCD4 (RM4-5), anti-mCD8 (53-6.7), anti-mCD3ε (145-2C11), anti-IFNγ (XMG1.2), anti-TNFα (MP6-XT22), anti-granzyme B (NGZB), anti-CD44 (IM7), anti-CD69 (H1.2F3), anti-PD-1 (J43), anti-CTLA-4 (UC10-4B9), anti-Ki-67 (16A8), anti-FoxP3 (FJK-16 s), anti-Gr1 (RB6-8C5), anti-CD11b (M1/70) and anti-CD45 (30-F11) were purchased from eBioscience. For western blots, anti-pCD3ζ, anti-CD3ζ, anti-pZAP70, anti-ZAP70, anti-pLAT, anti-LAT, anti-pERK1/2 and anti-ERK1/2 were from Cell Signaling Technology. Avasimibe was from Selleck. MβCD-cholesterol and MβCD were from Sigma. Lovastatin was from Sigma. U18666A was from Merck. K604 was chemically synthesized in F.-J. Nan’s laboratory. CP113,818 was a research gift from P. Fabre. MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was from Promega. B16F10, Lewis lung carcinoma and EL-4 cell lines were originally obtained from the American Type Culture Collection, and proved mycoplasma-free. Listeria monocytogenes was provided by Q. Leng. C57BL/6 mice were purchased from SLAC. OT-I TCR transgenic mice were from the Jackson Laboratory. CD4cre transgenic mice was described previously31. InGeneious Labs produced homozygous Acat1flox/flox mouse. To produce this mouse, the Acat1 loxP construct was made by inserting two loxP sites covering Acat1 exon 14, which includes His460 known to be essential for the enzymatic activity32. The construct was injected into embryonic stem cells. The correctly targeted clones as determined by Southern blot and diagnostic PCR were injected into C57BL/6 blastocysts. To remove the Neo marker, the mice were further backcrossed to the C57BL/6 Frt mice. Through mouse crossing, the wild-type Acat1 allele (Acat1+/+), heterozygous Acat1 loxP allele (Acat1flox/+) and homozygous Acat1 loxP allele (Acat1flox/flox) were obtained and confirmed by using diagnostic PCR. Acat1flox/flox mice were crossed with CD4cre transgenic mice to get Acat1CKO mice with ACAT1 deficiency in T cells. Acat1CKO mice were further crossed with OT-I TCR transgenic mice to get Acat1CKO OT-I mice. Animal experiments using Acat1CKO mice were controlled by their littermates with normal ACAT1 expression (Acat1flox/flox). Animal experiments using Acat1CKO OT-I mice were controlled by their littermate with normal ACAT1 and OT-I TCR expression (Acat1flox/flox OT-I). Acat2−/− mice were purchased from Jackson Laboratory. All mice were maintained in pathogen-free facilities at the Institute of Biochemistry and Cell Biology. All animal experiments used mice with matched age and sex. Animals were randomly allocated to experimental groups. The animal experiments performed with a blinded manner were described below. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences. The maximal tumour measurements/volumes are in accordance with the IACUC. All human studies have been approved by the Research Ethical Committee from ChangZheng Hospital, Shanghai, China. Informed consent was obtained from all study subjects. Total RNA was extracted with Trizol (Life technology) from the indicated cells and subjected to quantitative reverse transcription PCR (qRT–PCR) using gene specific primers (5′–3′): Acat1 (forward, GAAACCGGCTGTCAAAATCTGG; reverse, TGTGACCATTTCTGTATGTGTCC); Acat2 (forward, ACAAGACAGACCTCTTCCCTC; reverse, ATGGTTCGGAAATGTTCACC); Nceh (forward, TTGAATACAGGCTAGTCCCACA; reverse, CAACGTAGGTAAACTGTTGTCCC); Srebp1 (forward, GCAGCCACCATCTAGCCTG; reverse, CAGCAGTGAGTCTGCCTTGAT); Srebp2 (forward, GCAGCAACGGGACCATTCT; reverse, CCCCATGACTAAGTCCTTCAACT); Acaca (forward, ATGGGCGGAATGGTCTCTTTC; reverse, TGGGGACCTTGTCTTCATCAT); Fasn (forward, GGAGGTGGTGATAGCCGGTAT; reverse, TGGGTAATCCATAGAGCCCAG); Hmgcs (forward, AACTGGTGCAGAAATCTCTAGC; reverse, GGTTGAATAGCTCAGAACTAGCC); Hmgcr (forward, AGCTTGCCCGAATTGTATGTG; reverse, TCTGTTGTGAACCATGTGACTTC); Sqle (forward, ATAAGAAATGCGGGGATGTCAC; reverse, ATATCCGAGAAGGCAGCGAAC); Ldlr (forward, TGACTCAGACGAACAAGGCTG, reverse, ATCTAGGCAATCTCGGTCTCC); Idol (forward, TGCAGGCGTCTAGGGATCAT; reverse, GTTTAAGGCGGTAAGGTGCCA); Abca1 (forward, AAAACCGCAGACATCCTTCAG; reverse, CATACCGAAACTCGTTCACCC); Abcg1 (forward, CTTTCCTACTCTGTACCCGAGG; reverse, CGGGGCATTCCATTGATAAGG); Ifng (forward, ATGAACGCTACACACTGCATC; reverse, CCATCCTTTTGCCAGTTCCTC). Three methods were used to measure the cholesterol level of T cells. Filipin III was dissolved in ethanol to reach the final concentration of 5 mg ml−1. Cells were fixed with 4% paraformaldehyde (PFA) and stained with 50 μg ml−1 filipin III for 30 min at 4 °C. Images were collected using a Leica SP8 confocal microscope and analysed using a Leica LAS AF software. The total cellular cholesterol level was quantified using the Amplex Red cholesterol assay kit (Invitrogen). To quantify the intracellular cholesterol, CD8+ T cells were fixed with 0.1% glutaraldehyde and then treated with 2 U ml−1 cholesterol oxidase for 15 min to oxidize the plasma membrane cholesterol. The intracellular cholesterol was then extracted with methanol/chloroform (vol/vol, 1: 2), and quantified using the Amplex Red cholesterol assay kit. The value of the plasma membrane cholesterol was obtained by subtracting the intracellular cholesterol from the total cellular cholesterol. Plasma membrane cholesterol level was measured as previously described33. The plasma membrane of CD8+ T cells was biotinylated by 1 mg ml−1 sulfo-NHS-S-biotin, and then the cells were lysed by passing 13 times through a ball-bearing homogenizer. Plasma membrane was isolated from the supernatant of homogenate by streptavidin magnetic beads. Lipids were extracted with hexane/isopropanol (vol/vol, 3: 2), and then were used for measurement of unesterified cholesterol with Amplex Red Cholesterol Assay Kit and choline-containing phospholipids with EnzyChrom Phospholipid Assay Kit. The relative plasma membrane cholesterol level was normalized to the total phospholipids. To deplete cholesterol from the plasma membrane, CD8+ T cells were treated with 0.1–1 mM MβCD for 5 min at 37 °C, and then washed three times with PBS. To add cholesterol to the plasma membrane, CD8+ T cells were incubated with the culture medium supplied with 1–20 μg ml−1 MβCD-coated cholesterol at 37 °C for 15 min. The cells were then washed three times with PBS. Peripheral T cells were isolated from mouse spleen and draining lymph nodes by a CD8+ or CD4+ T-cell negative selection kit (Stem cell). To analyse the tumour-infiltrating T cells, tumours were first digested by collagenase IV (sigma), and tumour-infiltrating leukocytes were isolated by 40–70% Percoll (GE) gradient centrifugation. To measure the effector function of CD8+ T cells, the isolated cells were first stimulated with 1 μM ionomycin and 50 ng ml−1 phorbol 12-myristate 13-acetate (PMA) for 4 h in the presence of 5 μg ml−1 BFA, and then stained with PERCP-conjugated anti-CD8a. Next, cells were fixed with 4% PFA and stained with FITC-conjugated anti-granzyme B, allophycocyanin (APC)-conjugated anti-IFNγ and phycoerythrin (PE)-conjugated anti-TNFα. In general, to gate the cytokine or granule-producing cells, T cells without stimulation or stained with isotype control antibody were used as negative controls. This gating strategy is applicable for most of the flow cytometric analyses. To detect the MDSC cells in the tumour, the Percoll-isolated leukocyte were stained with anti-CD45, anti-CD11b and anti-Ly6G (Gr1), the CD45+ population was gated, after which the MDSC population (CD11b+ Gr1+) in CD45+ were gated. A pan T-cell isolation kit (Miltenyi biotech) was used to deplete T cells from splenocytes isolated from C57BL/6 mice. The T-cell-depleted splenocytes were pulsed with antigenic peptides for 2 h and washed three times. SIINFEKL (OVA or N4), SAINFEKL (A2), SIITFEKL (T4), SIIGFEKL (G4) are four types of agonist antigens with strong to weak TCR affinities. RTYTYEKL (Catnb) is a self-antigen of OT-I TCR. SIIRFEKL (R4) supports the positive selection of OT-I T cells and thus mimics a self-antigen. The T-cell-depleted and antigen-pulsed splenocytes were co-incubated with Acat1CKO OT-I T cells or wild-type OT-I T cells for 24 h. Cytokine production of CD8+ T cells was measured by intracellular staining and flow cytometric analysis. To generate mature CTLs, splenocytes isolated from Acat1CKO OT-I mice or wild-type OT-I mice were stimulated with OVA (N4) for 3 days in the presence of 10 ng ml−1 IL-2. Cells were centrifuged and cultured in fresh medium containing 10 ng ml−1 IL-2 for 2 more days, after which most of the cells in the culture were CTLs. To measure CD8+ T-cell cytotoxicity, EL-4 cells were pulsed with 2 nM antigenic peptide (N4, A2, T4, G4, R4 or Catnb) for 30 min. After washing EL-4 cells and CTLs three times with PBS, we mixed CTLs and antigen-pulsed EL-4 cells (1 × 105) in the killing medium (phenol-free RPMI 1640, 2% FBS), at the ratios of 1:1, 2:1 and 5:1, respectively. After 4 h, the cytotoxic efficiency was measured by quantifying the release of endogenous lactate dehydrogenase (LDH) from EL-4 cells using a CytoTox 96 Non-Radioactive Cytotoxicity kit (Promega). Human peripheral blood mononuclear cells from healthy donators were stimulated with 5 μg ml−1 phytohaemagglutinin (Sigma) for 2 days and then rested for 1 day. Cells were pretreated with vehicle (DMSO), CP113,818 or avasimibe for 12 h and then stimulated with 5 μg ml−1 plate-bound anti-CD3 and anti-CD28 antibodies for 24 h. Intracellular staining and flow cytometry were used to measure cytokine productions of CD8+ T cells. Oxygen consumption rates and extracellular acidification rates were measured in nonbuffered DMEM (sigma) containing either 25 mM or 10 mM glucose, 2 mM l-glutamine, and 1 mM sodium pyruvate, under basal conditions and in response to 1 μM oligomycin (to block ATP synthesis), 1.5 μM FCCP (to uncouple ATP synthesis from the electron transport chain), 0.5 μM rotenone and antimycin A (to block complex I and III of the electron transport chain, respectively), and 200 μM etomoxir (to block mitochondrial fatty acid oxidation) on the XF-24 or XF-96 Extracellular Flux Analyzers (Seahorse Bioscience) according to the manufacturer’s recommendations. B16F10 cells (5 × 103) in 100 μl media containing avasimibe or DMSO were cultured for 24, 48 or 72 h. MTS reagent (20 μl) (CellTiter 96 AQueous One Solution Cell Proliferation Assay, Promega) was added into each well. After a 2–3-h incubation, the absorbance at 490 nm was measured. The effect of avasimibe on cell viability was obtained by normalizing the absorbance of avasimibe-treated cells with that of the DMSO-treated cells. The viability value of DMSO-treated cells was set as 1. L. monocytogenes (2 × 104–7 × 104 colony-forming units (CFU)) expressing a truncated OVA protein were intravenously injected into Acat1CKO and littermate wild-type mice aged 8–10 weeks. On day 6, T cells isolated from spleens were stimulated with 50 ng ml−1 PMA and 1 μM ionomycin for 4 h in the presence of brefeldin A and then assessed by flow cytometry to detect IFNγ production. At the same time, the serum IFNγ level was assessed by ELISA. To detect the antigen-specific response of CD8+ T cells, the splenocytes were stimulated with 1 μM OVA peptide for 24 h. IFNγ production was analysed as mentioned above. To detect the L. monocytogens titre in the livers of infected mice, the livers were homogenized in 10 ml 0.2% (vol/vol) Nonidet P-40 in PBS, and the organ homogenates were diluted and plated on agar plates to determine the CFU of L. monocytogenes. Investigator was blinded to group allocation during the experiment and when assessing the outcome. B16F10 cells were washed three times with PBS, and filtered through a 40-μm strainer. In a skin melanoma model, B16F10 cells (2 × 105) were subcutaneously injected into the dorsal part of mice (aged 8–10 weeks). From day 10, tumour size was measured every 2 days, and animal survival rate was recorded every day. Tumour size was calculated as length × width. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. To analyse effector function of tumour-infiltrating T cells, mice were euthanized on day 16. In the avasimibe therapy, melanoma-bearing mice with similar tumour size were randomly divided into two groups. From day 10, avasimibe was injected intraperitoneally to the mice at the dose of 15 mg kg−1 every 2 days. In a lung-metastatic melanoma model, B16F10 cells (2 × 105) were intravenously injected into mice (aged 8–10 weeks). Animal survival rate was recorded every day. To study tumour growth, mice were euthanized on day 20 and tumour numbers on lungs were counted. Lung-infiltrating T cells were isolated and analysed as mentioned above. In the lung-metastatic melanoma model, investigator was blinded to group allocation during the experiment and when assessing the outcome. B16F10-OVA cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–10 weeks. On day 16, the naive wild-type or Acat1CKO OT-I CD8+ T cells were isolated and labelled with live cell dye CFSE or CTDR (Cell Tracker Deep Red, Life Technologies), respectively. The labelled wild-type and CKO cells were mixed together at a 1:1 ratio, and 1 × 107 mixed cells per mouse were injected intravenously into the B16F10-OVA-bearing mice. After 12 h, blood, spleens, inguinal lymph nodes (draining) and mesenteric lymph nodes (non-draining) of the mice were collected. Single-cell suspensions from these tissues were stained with the anti-CD8a antibody, and the ratio of transferred cells in CD8+ populations was analysed using flow cytometry. The Lewis lung carcinoma cells were washed twice with PBS and filtered through a 40-μm strainer. After which, the Lewis lung carcinoma cells (2 × 106) were intravenously injected into wild-type or Acat1CKO mice at age 8–10 weeks. To detect the tumour multiplicity in the lung, the mice were euthanized at day 35 after tumour inoculation and tumour numbers in the lung were counted. In the avasimibe therapy, mice were randomly divided into two groups. From days 10 to 35 after tumour inoculation, avasimibe was delivered to the mice by intragastric administration at the dose of 15 mg kg−1 every 3 days. B16F10-OVA cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–10 weeks. On day 10, melanoma-bearing mice with similar tumour size were randomly divided into three groups (n = 9–10) and respectively received PBS, wild-type OT-I CTLs (1.5 × 106) or Acat1CKO OT-I CTLs (1.5 × 106) by intravenous injection. From day 13, the tumour size was measured every two days, and the animal survival rate was recorded every day. Tumour size was calculated as length × width. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. B16F10 cells (2 × 105) were injected subcutaneously into C57BL/6 mice at age 8–12 weeks. On day 10, melanoma-bearing mice with similar tumour size were randomly divided into four groups (n = 8–10) and received PBS, avasimibe, anti-PD-1 antibody or both avasimibe and anti-PD-1 antibody, respectively. Avasimibe was delivered every 2 days at the dose of 15 mg kg−1 by intragastric administration. Anti-PD-1 antibody (RMP1-14, Bio X Cell, 200 μg per injection) was injected intraperitoneally every 3 days. The tumour size and survival were measured as mentioned above. Mice with tumour size larger than 20 mm at the longest axis were euthanized for ethical consideration. Super-resolution STORM imaging was performed on a custom modified Nikon N-STORM microscope equipped with a motorized inverted microscope ECLIPSE Ti-E, an Apochromat TIRF 100 × oil immersion lens with a numerical aperture of 1.49 (Nikon), an electron multiplying charge-coupled device (EMCCD) camera (iXon3 DU-897E, Andor Technology), a quad band filter composed of a quad line beam splitter (zt405/488/561/640rpc TIRF, Chroma Technology Corporation) and a quad line emission filter (brightline HC 446, 523, 600, 677, Semrock, Inc.). The TIRF angle was adjusted to oblique incidence excitation at the value of 3,950–4,000, allowing the capture of images at about 1 μm depth of samples. The focus was kept stable during acquisition using Nikon focus system. For the excitation of Alexa647, the 647 nm continuous wave visible fibre laser was used, and the 405 nm diode laser (CUBE 405-100C, Coherent Inc.) was used for switching back the fluorophores from dark to the fluorescent state. The integration time of the EMCCD camera was 90–95 frames per second. To image TCR distribution in the plasma membrane, naive CD8+ T cells or activated CD8+ T cells (stimulated with 10 μg ml−1 anti-CD3 for 10 min at 37 °C) were placed in Ibidi 35 mm μ-Dish and fixed with 4% PFA, followed by surface staining with 5 μg ml−1 anti-mCD3ε (145-2C11) for 4 h at 4 °C, then the cells were stained with 2 μg ml−1 Alexa 647-conjugated goat anti-hamster IgG (the secondary antibody) for 2 h at 4 °C after washing with PBS ten times. Before imaging, the buffer in the dish was replaced with the imaging buffer contained 100 mM β-mercaptoethanolamin (MEA) for a sufficient blinking of fluorophores. Super-resolution images were reconstructed from a series of 20,000–25,000 frames using the N-STORM analysis module of NIS Elements AR (Laboratory imaging s.r.o.). Molecule distribution and cluster position were analysed with MATLAB (MathWorks) based on Ripley’s K function. L(r) − r represents the efficiency of molecule clustering, and r value represents cluster radius. The r value at the maximum L(r) − r value represents the cluster size with the highest probability34. Planar lipid bilayers (PLBs) containing biotinylated lipids were prepared to bind biotin-conjugated stimulating antibody by streptavidin as previously described35, 36. Biotinylated liposomes were prepared by sonicating 1,2-dioleoyl-sn-glycero-3-phosphocholine and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-cap-biotin (25:1 molar ratio, Avanti Polar Lipids) in PBS at a total lipid concentration of 5 mM. PLBs were formed in Lab-Tek chambers (NalgeNunc) in which the cover glasses were replaced with nanostrip-washed coverslips. Coverslips were incubated with 0.1 mM biotinylated liposomes in PBS for 20 min. After washing with 10 ml PBS, PLBs were incubated with 20 nM streptavidin for 20 min, and excessive streptavidin was removed by washing with 10 ml PBS. Streptavidin-containing PLBs were incubated with 20 nM bionylated anti-mCD3ε (145-2C11) (Biolegend). Excessive antibody was removed by washing with PBS. Next, PLBs were treated with 5% FBS in PBS for 30 min at 37 °C and washed thoroughly for TIRFM of T cells. Adhesion ligands necessary for immunological synapse formation were provided by treating the bilayer with serum. Freshly isolated mouse splenocytes were stained with Alexa568-anti-mTCRβ Fab and FITC-anti-mCD8 and washed twice. Anti-mTCRβ antibody was labelled with Alexa568-NHS ester (Molecular probes) and digested to get Fab fragments with Pierce Fab Micro Preparation Kit (Thermo). Cells were then placed on anti-mCD3ε-containing PLBs to crosslink TCR. Time-lapse TIRFM images were acquired on a heated stage with a 3-s interval time at 37 °C, 5% CO , using a Zeiss Axio Observer SD microscopy equipped with a TIRF port, Evolve 512 EMCCD camera and Zeiss Alpha Plan-Apochromat 100 × oil lens. The acquisition was controlled by ZEN system 2012 software. An OPSL laser 488 nm and a DPSS laser 561 nm were used. Field of 512 × 512 pixels was used to capture 6–8 CD8+ T cells per image. Results of synapse formation and TCR movements were the population averages of all CD8+ T cells from 2–3 individual images. The movements of TCR microclusters were splitted into directed, confined and random movement using the method described37. To sort the three movements, the MSD plot of each TCR microcluster was fitted with three functions as described37. The ones with good fit (square of correlation coefficients (R2) ≥ 0.33) were selected for further classification. For a certain TCR microcluster, the movement is defined as random if s.d. < 0.010. The distinction of directed and confined movement depends on which function fit better in the population of those s.d. ≥ 0.010. Images were analysed with Image Pro Plus software (Media Cybernetics), ImageJ (NIH) and MATLAB (MathWorks). In the granule polarization imaging, CTLs stained with Alexa568-anti-mTCRβ Fab were placed on anti-mCD3ε-containing PLBs for indicated time and fixed with 4% PFA. After the permabilization, cells were stained with Alexa488-anti-mCD107a (1D4B) antibody. Three-dimensional spinning-disc confocal microscopy was used to image the granules polarized at 0–2 μm distance from the synapse. The total granule volumes were quantified with Imaris software. The degranulation level was measured as previously described38. OT-I CTLs were mixed with OVA pulsed EL4 cells at 1:1 ratio. The mixed cells were then cultured in the medium supplemented with 1 μg ml−1 Alexa488-anti-CD107a antibody and 2 μM monensin for 1, 2 and 4 h. After which, cells were washed with PBS and further stained with PE–Cy7-anti-CD8a antibody. Flow cytometry was used for assessing the surface and internalized CD107a levels. MATLAB code used to perform STORM and TIRFM data analysis can be accessed by contacting W.L. (liuwanli@biomed.tsinghua.edu.cn). All sample sizes are large enough to ensure proper statistical analysis. Statistical analyses were performed using GraphPad Prism (GraphPad Software, Inc.). Statistical significance was determined as indicated in the figure legends. P < 0.05 was considered significant; *P < 0.05; **P < 0.01; ***P < 0.001. All t-test analyses are two-tailed unpaired t-tests. The replicates in Figs 2, 3b, i, k–o, 4a, b, e–j, l, m and Extended Data Figs 1a, 3a–c, g–l, 4f, 5a–e, 6, 7g, 8, 9e, h, j and 10 were biological replicates. The replicates in Figs 1, 3c, d, p, Fig. 4o, p and Extended Data Figs 1b–i, 2, 3d–f, m, n, 4b–e, 5f, g, 7a, b, i–l and 9a–c were technical replicates. The centre values shown in all figures are average values.


Morioka S.B.,Coherent Inc.
Proceedings of SPIE - The International Society for Optical Engineering | Year: 2011

OPS lasers have found applications in various industrial and scientific laser applications due to their power scaling capability, their wide range of emission wavelengths, physical size and their superior reliability. This paper provides an overview of commercially available OPS lasers and the applications in which they are used including biotechnology, medical, holography, Titanium-Sapphire laser pumping, non-lethal defense, forensics, and entertainment.


Dittmar H.,Laser Zentrum Hannover e.V. | Gabler F.,Coherent Inc. | Stute U.,Laser Zentrum Hannover e.V.
Physics Procedia | Year: 2013

Within this work the ablation behaviour of both carbon and glass fibre reinforced epoxy resin was assessed when ablated by a nanosecond-pulsed laser source emitting radiation in the ultra-violet spectrum. The investigation focussed on the influences of pulse overlap, focus spot diameter and resulting fluence on process quality and machining time. Results showed that ns-pulsed UV-lasers are capable of machining both types of fibre reinforced composites, while achieving good quality surfaces without burn marks or otherwise heat-damaged areas. © 2013 The Authors.


News Article | November 7, 2016
Site: www.prnewswire.com

NEW YORK, Nov. 7, 2016 /PRNewswire/ -- Innoviva Inc. (NASD: INVA) will replace Rofin-Sinar Technologies Inc. (NASD: RSTI) in the S&P SmallCap 600 after the close of trading on Wednesday, November 9. S&P SmallCap 600 constituent Coherent Inc. (NASD: COHR) acquired Rofin-Sinar...


News Article | November 16, 2016
Site: www.prnewswire.co.uk

According to a new report published by Allied Market Research, titled, "Fiber Laser Market by Type, and by Application - Global Opportunity Analysis and Industry Forecast, 2014 - 2022" the fiber laser market is expected to reach $3,113 million by 2022 from $1,443 million in 2015, growing at CAGR of 11.7% from 2016 to 2022. Ultrafast fiber laser segment dominated the market with more than half of the market in terms of revenue in 2015. Summary of the fiber laser market report can be accessed on the website at https://www.alliedmarketresearch.com/fiber-laser-market High beam quality, lower cost of ownership, and eco-friendly technology majorly drive the fiber laser market. The growth in trend of green manufacturing and increase in concern of material manufacturers regarding the impact of their product on environment across various industrial sectors has made fiber lasers an attractive choice for cutting and marking applications. Easily automated and energy efficient fiber laser solutions are increasingly replacing the traditional methods employed for machine marking, such as chemical etching and ink based printing. According to Eswara Prasad, Team Lead, Chemicals & Materials at Allied Market Research, "QCW fiber lasers have shown tremendous growth in last three years substituting traditional YAG lasers which were large, un-reliable, and inefficient, owing to its unique technology and high peak power." Fiber lasers offer excellent beam quality and does not require any complicated optics for beam delivery. They don't contain mirrors or moving parts within the light generating source and offer high wall plug efficiency and ultra-compact footprint, which results in low operating costs and minimal maintenance requirements. Higher speeds and high electrical efficiency at relatively lower running costs boost the demand for fiber lasers across various industrial sectors. Though reduced processing speed while cutting thicker materials and undesired pulse pedestals & nonlinear optical effects restrain the market growth, increase in automobile and mobile electronics applications offer a great potential for the growth of fiber laser market globally. Ultrafast fiber laser segment accounted for more than three-fifths share of the global fiber laser market in 2015. This was attributed to its properties such as compact size, high beam quality, wall plug efficiency, and reliability. In addition, ultrafast lasers are manufactured using the technique of chirped pulse application, which suppresses the undesired pulse pedestals and nonlinear optical effects. Ultrafast laser segment is sub segmented into picosecond fiber laser and femtosecond fiber laser. Femtosecond fiber laser accounted for around three-fourths share of the world ultrafast fiber laser market revenue in 2015. High power application is expected to grow at a CAGR of 15.4% in terms of revenue owing to employment of fiber lasers in cost effective cutting and welding applications. Marking accounts for the second largest share in terms of revenue, attributing to FDA requirement for marking unique identification number on all medical, dental, and surgical devices for patient's safety and trade way marking policy. According to Eswara Prasad, Team Lead, Chemicals & Materials at Allied Market Research, "key players R&D investments with regards to use of fiber lasers as a milling tool in aerospace industry to expand the potential for fiber lasers market." Asia-Pacific and North America collectively contributed more than two-thirds of the market revenue in 2015. In the same year, Asia-Pacific dominated the market, in terms of revenue, owing to increased demand of fiber lasers in electronics and automotive industry. The prominent players profiled in this report include Amonics Ltd. (China), Apollo Instruments Inc. (U.S.), Coherent Inc. (U.S.), IPG Photonics Corporation (U.S.), Jenoptik Laser GmbH (Germany), Keopsys Group (France), NKT Photonics A/S (Denmark), Quantel Group (France), ROFIN-SINAR Technologies Inc. (U.S.), and Toptica Photonics AG (Germany). Summary of Similar Reports can be viewed at Allied Market Research (AMR) is a full-service market research and business-consulting wing of Allied Analytics LLP based in Portland, Oregon. Allied Market Research provides global enterprises as well as medium and small businesses with unmatched quality of "Market Research Reports" and "Business Intelligence Solutions". AMR has a targeted view to provide business insights and consulting to assist its clients to make strategic business decisions and achieve sustainable growth in their respective market domain. We are in professional corporate relations with various companies and this helps us in digging out market data that helps us generate accurate research data tables and confirms utmost accuracy in our market forecasting. Each and every data presented in the reports published by us is extracted through primary interviews with top officials from leading companies of domain concerned. Our secondary data procurement methodology includes deep online and offline research and discussion with knowledgeable professionals and analysts in the industry.


News Article | December 10, 2016
Site: marketersmedia.com

— The report titled “Global Industrial Laser Market: Size, Trends & Forecasts (2016-2020)” provides an in-depth analysis of the global industrial laser market by value, market share by region as well as by players and division of market by product and by process. Complete report on industrial laser market spread across 70 pages providing 4 company profiles and 35 figures and 1 table is now available at http://www.marketreportsonline.com/481198.html. The report provides a detailed description of industrial laser market divided on the basis of product and process. Market value of fibre lasers, CO2 lasers and solid-state lasers have provided with estimated value of these markets in 2016. Furthermore, a division of the market on process: macroprocessing, microprocessing and engraving/marking have also been provided in the report. Regional analysis of Asia-Pacific, North America and China industrial laser market is also provided in the report covering market size for the forecasted period. The report also assesses the key opportunities in the market and outlines the factors that are and will be driving the growth of the industry. Growth of the overall global industrial laser market has also been forecasted for the period 2016-2020, taking into consideration the previous growth patterns, the growth drivers and the current and future trends. The competition in the global industrial laser market is dominated by major players like Trumpf Group, Coherent Inc., IPG Photonics and Han’s Laser Technology. A brief company profiling of these major players has been provided in the report on the basis of of attributes like business overview, financial overview and business strategies adopted by these companies in order to grow in the market. Powerful source of light which has extraordinary properties as compared to normal light sources like mercury lamps and tungsten lamps is known as laser. One of the unique properties of laser light is that its light travel very long distances with a very little deviation. Since the laser was invented 50 years ago, laser technology has transformed a wide range of applications and products in several major industries which includes large manufacturing industries, oil & gas industry, automobile, scientific research, medical and communication and many more industries. Lasers deliver flexible, noncontact and high-speed ways to process and treat various materials. Laser technology provides superior performance and cost effective solution as compared to other non-laser technologies. On the basis of medium, laser is divided into four broad categories: solid laser, liquid laser, gas laser and semiconductor laser. Fibre laser is a type of solid laser which is taking place of conventional lasers like CO2 laser and semiconductor lasers. Purchase a copy of this (Global Industrial Laser Market: Size, Trends & Forecasts 2016-2020) research report at USD 800 (Single User License) http://www.marketreportsonline.com/contacts/purchase.php?name=481198. The global industrial laser market has increased rapidly over the past few years and projections are made that the market would rise in the forecasted period i.e. 2016-2020 tremendously. The market is expected to grow on the back of increasing application of industrial laser in number of major industries like automobile, medical, research and growth of emerging economies. Yet the market faces some challenges which are major hindrances in its growth. These challenges are high initial cost of installation, several environment & health related issues associated with it and limited number of suppliers in the market. Few Points from List of Figures Provided in Industrial Laser Market: Figure 1: Types of Laser by Medium Figure 2: Types of Laser by Wavelength Figure 3: Laser Applications Figure 4: Global Industrial Laser Material Processing Market by Value; 2014-2015 (US$ Billion) Figure 5: Global Industrial Laser Material Processing Market by Value; 2016-2020E (US$ Billion) Figure 6: Global Industrial Laser Processing Revenue by Region; 2015 Figure 7: Global Industrial Laser Market by Value; 2014-2015 (US$ Billion) Figure 8: Global Industrial Laser Market by Value; 2016-2020E (US$ Billion) Figure 9: Global Industrial Laser Revenue by Product; 2015 Figure 10: Global Industrial Laser Revenue by Process; 2015 Figure 11: Global Fibre Laser Market by Value; 2014-2016E (US$ Billion) Figure 12: Global CO2 Laser Market by Value; 2014-2016E (US$ Million) Figure 13: Global Solid-State Laser Market by Value; 2014-2016E (US$ Million) Figure 14: Global Macroprocessing Sector by Value; 2014-2016E (US$ Billion) Figure 15: Global Macroprocessing Sector Revenue by Product; 2015 Figure 16: Global Microprocessing Sector by Value; 2014-2016E (US$ Million) Figure 17: Global Microprocessing Sector Revenue by Product; 2015 Figure 18: Global Engraving Sector by Value; 2014-2016E (US$ Million) Figure 19: Global Engraving Sector Revenue by Product; 2015 Figure 20: APAC Industrial Laser Material Processing Market by Value; 2015-2020E (US$ Billion) Explore more manufacturing & construction market research as well as other newly published reports by Daedal Research at http://www.marketreportsonline.com/publisher/daedal-research-market-research.html. For more information, please visit http://www.marketreportsonline.com/481198.html


This report studies Medical Laser Systems in Global market, especially in North America, Europe, China, Japan, Southeast Asia and India, focuses on top manufacturers in global market, with production, price, revenue and market share for each manufacturer, covering AngioDynamics Inc. Bausch & Lomb Incorporated BIOLASE Inc. Biolitec AG Carl Zeiss Meditec AG Coherent Inc. Palomar Medical Technologies Inc. Nidek Co Ltd. Topcon Corporation Ellex Medical Lasers Limited Novartis AG View Full Report With Complete TOC, List Of Figure and Table: http://globalqyresearch.com/global-medical-laser-systems-market-research-report-2016 Market Segment by Regions, this report splits Global into several key Regions, with production, consumption, revenue, market share and growth rate of Medical Laser Systems in these regions, from 2011 to 2021 (forecast), like North America Europe China Japan Southeast Asia India Split by product type, with production, revenue, price, market share and growth rate of each type, can be divided into Surgical Lasers Aesthetic Lasers Ophthalmic Lasers Diagnostic Lasers Split by application, this report focuses on consumption, market share and growth rate of Medical Laser Systems in each application, can be divided into Medicine Biology Others Global Medical Laser Systems Market Research Report 2016 1 Medical Laser Systems Market Overview 1.1 Product Overview and Scope of Medical Laser Systems 1.2 Medical Laser Systems Segment by Type 1.2.1 Global Production Market Share of Medical Laser Systems by Type in 2015 1.2.2 Surgical Lasers 1.2.3 Aesthetic Lasers 1.2.4 Ophthalmic Lasers 1.2.5 Diagnostic Lasers 1.3 Medical Laser Systems Segment by Application 1.3.1 Medical Laser Systems Consumption Market Share by Application in 2015 1.3.2 Medicine 1.3.3 Biology 1.3.4 Others 1.4 Medical Laser Systems Market by Region 1.4.1 North America Status and Prospect (2011-2021) 1.4.2 Europe Status and Prospect (2011-2021) 1.4.3 China Status and Prospect (2011-2021) 1.4.4 Japan Status and Prospect (2011-2021) 1.4.5 Southeast Asia Status and Prospect (2011-2021) 1.4.6 India Status and Prospect (2011-2021) 1.5 Global Market Size (Value) of Medical Laser Systems (2011-2021) 7 Global Medical Laser Systems Manufacturers Profiles/Analysis 7.1 AngioDynamics Inc. 7.1.1 Company Basic Information, Manufacturing Base and Its Competitors 7.1.2 Medical Laser Systems Product Type, Application and Specification 7.1.2.1 Type I 7.1.2.2 Type II 7.1.3 AngioDynamics Inc. Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.1.4 Main Business/Business Overview 7.2 Bausch & Lomb Incorporated 7.2.1 Company Basic Information, Manufacturing Base and Its Competitors 7.2.2 Medical Laser Systems Product Type, Application and Specification 7.2.2.1 Type I 7.2.2.2 Type II 7.2.3 Bausch & Lomb Incorporated Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.2.4 Main Business/Business Overview 7.3 BIOLASE Inc. 7.3.1 Company Basic Information, Manufacturing Base and Its Competitors 7.3.2 Medical Laser Systems Product Type, Application and Specification 7.3.2.1 Type I 7.3.2.2 Type II 7.3.3 BIOLASE Inc. Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.3.4 Main Business/Business Overview 7.4 Biolitec AG 7.4.1 Company Basic Information, Manufacturing Base and Its Competitors 7.4.2 Medical Laser Systems Product Type, Application and Specification 7.4.2.1 Type I 7.4.2.2 Type II 7.4.3 Biolitec AG Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.4.4 Main Business/Business Overview 7.5 Carl Zeiss Meditec AG 7.5.1 Company Basic Information, Manufacturing Base and Its Competitors 7.5.2 Medical Laser Systems Product Type, Application and Specification 7.5.2.1 Type I 7.5.2.2 Type II 7.5.3 Carl Zeiss Meditec AG Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.5.4 Main Business/Business Overview 7.6 Coherent Inc. 7.6.1 Company Basic Information, Manufacturing Base and Its Competitors 7.6.2 Medical Laser Systems Product Type, Application and Specification 7.6.2.1 Type I 7.6.2.2 Type II 7.6.3 Coherent Inc. Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.6.4 Main Business/Business Overview 7.7 Palomar Medical Technologies Inc. 7.7.1 Company Basic Information, Manufacturing Base and Its Competitors 7.7.2 Medical Laser Systems Product Type, Application and Specification 7.7.2.1 Type I 7.7.2.2 Type II 7.7.3 Palomar Medical Technologies Inc. Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.7.4 Main Business/Business Overview 7.8 Nidek Co Ltd. 7.8.1 Company Basic Information, Manufacturing Base and Its Competitors 7.8.2 Medical Laser Systems Product Type, Application and Specification 7.8.2.1 Type I 7.8.2.2 Type II 7.8.3 Nidek Co Ltd. Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.8.4 Main Business/Business Overview 7.9 Topcon Corporation 7.9.1 Company Basic Information, Manufacturing Base and Its Competitors 7.9.2 Medical Laser Systems Product Type, Application and Specification 7.9.2.1 Type I 7.9.2.2 Type II 7.9.3 Topcon Corporation Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.9.4 Main Business/Business Overview 7.10 Ellex Medical Lasers Limited 7.10.1 Company Basic Information, Manufacturing Base and Its Competitors 7.10.2 Medical Laser Systems Product Type, Application and Specification 7.10.2.1 Type I 7.10.2.2 Type II 7.10.3 Ellex Medical Lasers Limited Medical Laser Systems Production, Revenue, Price and Gross Margin (2015 and 2016) 7.10.4 Main Business/Business Overview 7.11 Novartis AG Global QYResearch ( http://globalqyresearch.com/ ) is the one spot destination for all your research needs. Global QYResearch holds the repository of quality research reports from numerous publishers across the globe. Our inventory of research reports caters to various industry verticals including Healthcare, Information and Communication Technology (ICT), Technology and Media, Chemicals, Materials, Energy, Heavy Industry, etc. With the complete information about the publishers and the industries they cater to for developing market research reports, we help our clients in making purchase decision by understanding their requirements and suggesting best possible collection matching their needs.


News Article | December 16, 2016
Site: marketersmedia.com

— Global Fiber Laser Market is forecasted to grow at a CAGR of 16.24 % during 2016 – 2021. The strong growth is driven by the increasing demand of fiber lasers in various types manufacturing processing. Industrial fiber laser systems are firmly established in material processing operations among manufacturing industries whole across the globe. Browse 63 Figures, 7 Companies Profiles, spreads across 112 pages available at http://www.rnrmarketresearch.com/global-fiber-laser-market-analysis-by-industrial-applications-by-end-user-applications-by-region-by-country-opportunities-and-forecast-2016-2021-by-industrial-applications-macro-processing-micro-proces-na-india-market-report.html. Manufacturing industries use different types of sheet cutting, marking, engraving, bonding, etching etc. Additionally the high power continuous wave fiber lasers are gaining wider acceptance in the market place. In terms of industrial application fiber lasers are widely used in macro processing applications, while advance material processing and scientific applications will create fair opportunities for the fiber lasers. Although, macro processing industrial applications have wider acceptance of fiber lasers, advance applications and marking & engraving industrial application ( precision engineering ) will present fair opportunities for the acceptance of fiber lasers. APAC is predicted to grow with a CAGR of 16.86% during the year 2016-2012F, which is mainly driven by the increase in number of general manufacturing industries along with the rise in the demand of consumer electronics will drive the market. Order a Copy of Report at http://www.rnrmarketresearch.com/contacts/purchase?rname=791528. According to research report, “Global Fiber Laser Market: Analysis By Industrial Applications, By End User Applications, By Region, By Country (2016-2021)”, is projected to exhibit a CAGR of over ~15.43% during 2016 – 2021, largely driven by increased use of fiber lasers in automotive sector, aerospace (drilling), medical industry (laser and cosmetic surgery, precision cutting of medical devices etc.) along with increasing research and developments in the field of industrial lasers. Company Profiles are Coherent Inc., IPG Photonics, Trumpf, Advalue Photonics, Active Fiber Systems, Fujikura Ltd. and Epilog Lasers. List of Figures Figure 1: Global Fiber Laser Market Size, By Value, 2011-2021F (USD Billion ) Figure 2: Global Fiber laser Market , By Region -2015(%) Figure 3: Global Fiber laser Market , By Region -2021F(%) Figure 4: Global Fiber laser Market , By Application -2015(%) Figure 5: Global Fiber laser Market , By Application -2021F(%) Figure 6: Global Fiber Laser Macroprocessing Market Size, By Value, 2011-2021F (USD Million ) Figure 7: Applications of fiber lasers in various process of cutting and welding Figure 8: Global Fiber Laser Microprocessing Market Size, By Value, 2011-2021F (USD Million ) Figure 9: PV Installation By Region-2015 Figure 10: Global Fiber Laser Marking and engraving Market Size, By Value, 2011-2021F (USD Million ) Figure 11: Global Fiber Laser Advance Application Market Size, By Value, 2011-2021F (USD Million ) Figure 12: Global Fiber laser Market , By End User Applications -2015(%) Figure 13: Global Fiber laser Market , By End User Applications -2021F(%) Figure 14: North America Fiber Laser Market Size, By Value, 2011-2021F (USD Billion ) Figure 15: USA- Light Weight Auto Sales (in millions) And more About Us RnRMarketResearch.com is the single source for all market research needs. The database includes 100,000+ market research reports from over 95 leading global publishers & in-depth market research studies of over 5000 micro markets. For more information, please visit http://www.rnrmarketresearch.com/global-fiber-laser-market-analysis-by-industrial-applications-by-end-user-applications-by-region-by-country-opportunities-and-forecast-2016-2021-by-industrial-applications-macro-processing-micro-proces-na-india-market-report.html

Loading Coherent Inc. collaborators
Loading Coherent Inc. collaborators