Entity

Time filter

Source Type

San Diego, CA, United States

Patent
CoDa Therapeutics | Date: 2015-05-18

Medical devices comprising an anti-connexin agent suitable for introduction into a subject.


Patent
CoDa Therapeutics | Date: 2012-11-19

A therapeutic and/or cosmetic formulation comprising at least one anti-sense polynucleotide to a connexin protein together with a pharmaceutically acceptable carrier or vehicle is useful in site specific down regulation of connexin protein expression, particularly in reduction of neuronal cells death, wound healing, reduction of inflammation, decrease of scar formation and skin rejuvenation and thickening.


Methods and compositions for modulating the activities of connexins are provided, including, for example, for use in post-surgical, trauma, or tissue engineering applications. These compounds and methods can be used therapeutically, for example, to reduce the severity of adverse effects associated diseases and disorders where localized disruption in direct cell-cell communication is desirable.


Patent
CoDa Therapeutics | Date: 2015-05-11

Connexin modulation for the treatment of wounds that do not heal at expected rates, including delayed healing wounds, incompletely healing wounds, and chronic wounds, and associated methods, compositions and articles.


Patent
CoDa Therapeutics | Date: 2013-04-23

The present invention concerns an isolated polynucleotide comprising a nucleotide sequence having substantial homology to any of the following nucleotide sequences: catcgttatgggacta (SEQ ID NO: 2), cattcttgatccttcc (SEQ ID NO: 1), cttttcaatctgactg SEQ ID NO: atgaaaatactcataa (SEQ ID NO: 5), gtgataaaagaaccat (SEQ ID NO: 10), gggttcatgaaagtga (SEQ ID NO: 11), gatgaccctcttatcc (SEQ ID NO: 8), tggaaggaatgtctgg (SEQ ID NO: 4), gcatctgcttccaaca (SEQ ID NO: 3), catcgttaggctagctacaacgatgggacta (SEQ ID NO: 9), tccaccaaggctagctacaacgaccatcaaa (SEQ ID NO: 12), gtcaacaaggctagctacaacgatgagctca (SEQ ID NO: 13), and cttttcaaggctagctacaacgactgactgt (SEQ ID NO: 6), and their use in the treatment of wounds.

Discover hidden collaborations