Time filter

Source Type

Grieve K.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Palazzo L.,Clinique du Trocadero | Dalimier E.,LLTech SAS | Vielh P.,Translational Research Laboratory | Fabre M.,Translational Research Laboratory
Gastrointestinal Endoscopy | Year: 2015

Background Rapid on-site evaluation of cytologic specimens is a way of determining the adequacy of fine-needle aspiration (FNA). However, alternatives may be useful when the presence of a cytotechnologist and/or pathologist is not possible. Objective To evaluate the feasibility of using full-field optical coherence tomography (FFOCT) for FNA specimen quality assessment. Design FFOCT images were acquired on gastric, pancreatic, pelvic, and lymph-node formalin-fixed FNA specimens and were compared with histology of the same samples. Setting Pathology suite in a hospital. Patients Fourteen patients undergoing gastric, pancreatic, pelvic, or lymph-node EUS-guided FNA biopsy. Interventions FFOCT imaging on formalin-fixed samples before histologic procedures. Main Outcome Measurements FFOCT imaging feasibility and visibility of normal and abnormal features on images. Results FFOCT imaging was possible. Blood, mucus, muscle, collagen, and digestive mucosa could be identified as well as abnormal architectural features including infiltrative pancreatic ductal carcinoma and a neuroendocrine neoplasm. Lesions at the individual cell level could not be detected. Limitations The study was performed on a limited number of cases. Conclusion FFOCT offers rapid, noninvasive, nondestructive imaging of FNA biopsy specimens. In the future, it could be performed in the endoscopy suite to improve detection of satisfactory specimens and obviate the need for rapid on-site evaluation. © 2015 American Society for Gastrointestinal Endoscopy.


De Juan Jr. E.,University of California at San Francisco | Spencer R.,Retina Foundation of the Southwest | Barale P.-O.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Da Cruz L.,Moorfields Eye Hospital | Neysmith J.,Second Sight
Graefe's Archive for Clinical and Experimental Ophthalmology | Year: 2013

Background: Retinal tacks, first developed for the treatment of complex retinal detachments, have more recently been used for the fixation of epiretinal electrode arrays as part of implanted visual prostheses. Here, we report on the clinical experience of extracting four such tacks after chronic implantation. The ability to safely extract retinal tacks ensures that epiretinal devices can be repositioned or removed if necessary. Methods: Custom-built, titanium alloy retinal tacks were mechanically removed from the posterior coats after prolonged implantation (up to 19 months). The resulting wound was characterized by clinical evaluation, fundus photography, and fluorescein angiography while being monitored for stability over time. The wounds were also compared to earlier published reports of the healing response around retinal tacks in human subjects. Results: Tack extraction was accomplished successfully, without complication, in all four subjects. The wound site was readily identified by pale scar tissue. No change in the wound size or appearance was noted over many months of post-operative observation (up to 22 months after explant). No adverse effects on overall ocular health were detected. Conclusion: Extraction of retinal tacks from subjects implanted with epiretinal prostheses can be performed without significant complication. The long-term healing response appears to be stable and localized in eyes afflicted with retinitis pigmentosa or choroideremia. There was also minimal, if any, impact on the local circulatory system. These cases suggest that the use of retinal tacks for anchoring epiretinal visual prostheses does not preclude safe repositioning or removal of the device more than a year after implant. © 2013 Springer-Verlag Berlin Heidelberg.


Zmuda M.,University Paris Est Creteil | Tiev K.P.,Center Hospitalier University Saint Antoine | Knoeri J.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Heron E.,University Paris Est Creteil
Ocular Immunology and Inflammation | Year: 2013

Purpose: To report an experience with infliximab in severe corticosteroid-resistant Vogt-Koyanagi-Harada (VKH) disease. Design: Interventional case series. Methods: The medical records of 2 adult patients were reviewed. Results: Both patients had a visual acuity reduced to hand motion perception bilaterally after 1 month of high-dose corticosteroid therapy, due to multiple exudative retinal detachment involving the fovea. Visual acuity and OCT findings improved immediately after the first infliximab infusion, retinal detachments fully resolved after 1 month and visual acuity returned to normal within 6 months. Despite a negative pretreatment screening, one patient developed multivisceral tuberculosis, which led to infliximab discontinuation after the 7th infusion and was cured by a 9-month ambulatory antibiotic regimen. The other patient received 11 well-tolerated infliximab infusions. Respectively, 9 and 4 months after infliximab discontinuation both patients had normal vision and OCT findings. Conclusion: Infliximab showed tremendous therapeutic efficacy in sight-threatening corticosteroid-resistant VKH disease. © Informa Healthcare USA, Inc.


Silverman R.H.,Columbia University | Silverman R.H.,zzi Center For Biomedical Engineering | Urs R.,Columbia University | Roychoudhury A.,Columbia University | And 5 more authors.
Investigative Ophthalmology and Visual Science | Year: 2014

PURPOSE. To develop and evaluate automated computerized algorithms for differentiation of normal and keratoconus corneas based solely on epithelial and stromal thickness data. METHODS. Maps of the corneal epithelial and stromal thickness were generated from Artemis-1 very high-frequency ultrasound arc-scans of 130 normal and 74 keratoconic subjects diagnosed by combined topography and tomography examination. Keratoconus severity was graded based on anterior curvature, minimum corneal thickness, and refractive error. Computer analysis of maps produced 161 features for one randomly selected eye per subject. Stepwise linear discriminant analysis (LDA) and neural network (NN) analysis were then performed to develop multivariate models based on combinations of selected features to correctly classify cases. The sensitivity, specificity, and area under the receiver operating characteristic curve (AUC) were determined for each classifier. RESULTS. Stepwise LDA resulted in a six-variable model that provided an AUC of 100%, indicative of complete separation of keratoconic from normal corneas. Leave-one-out analysis resulted in 99.2% specificity and 94.6% sensitivity. Neural network analysis using the same six variables resulted in an AUC of 100% for the training set. Test set performance averaged over 10 trials gave a specificity of 99.5 6 1.5% and sensitivity of 98.9 6 1.9%. The LDA function values correlated with keratoconus severity grade. CONCLUSIONS. The results demonstrate that epithelial remodeling in keratoconus represents an independent means for differentiation of normal from advanced keratoconus corneas. © 2014 The Association for Research in Vision and Ophthalmology, Inc.


Nordmann J.-P.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Akesbi J.,Center Hospitalier National dOphtalmologie des Quinze Vingts
Journal Francais d'Ophtalmologie | Year: 2011

Adherence to treatment through observance and persistence is mandatory to treat any glaucoma patient. Identifying the factors related to nonadherence is therefore crucial. Factors responsible for poor adherence could be related to the patients (doubt, forgetfulness, denial), environmental factors (cost, competing activities, travel, etc.), the treatment regimen (refill, side effects, complexity), and finally the relation with the physician. Physicians should presume that patients have low adherence to their treatment and give clear and precise information about the expected benefits of the treatment, the disease, and its risks of progression. Combined fixed treatments and preservative-free topical treatments should improve adherence and quality of life by simplifying instillation and tolerance of eye drops. © 2011 Elsevier Masson SAS. Tous droits réservés.


Goldschmidt P.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Einterz E.,Hopital de District de Kolofata
Tropical Medicine and Health | Year: 2014

Background: Health authorities are working toward the global elimination of trachoma by the year 2020 with actions focused on the World Health Organization SAFE strategy (surgery of trichiasis, antibiotics, face washing and environmental changes) with emphasis on hygienist approaches for education. Objectives: The present survey was performed to assess the sustainability of the SAFE strategy 3 years after trachoma was eliminated from 6 villages. Methods: In February 2013 a rapid trachoma assessment was conducted in 6 villages of Kolofata's district, Extreme north Region, Cameroon, where trachoma was eliminated in 2010. A total of 300 children (1-10 years) from 6 villages were examined by trained staff. Results: The prevalence of active trachoma (children aged > 1 and < 10 years) in 2013 was 15% and in at least 25% was observed absence of face washing and flies in their eyes and nose. Income level, quality of roads, hygiene, and illiteracy were similar in all the villages; they did not change between 2010 and 2013 and could not be analyzed as independent risk factors. Discussion: The heterogeneity of methods described for clinical trials makes it inappropriate to conduct meta-analysis for the present and for other SAFE-related trials. The results obtained after implementation the SAFE strategy (recurrence) reveal that the causes (infectious agents and dirtiness) and effects (illness) were not connected by illiterate people living under conditions of extreme poverty. So far, antibiotics, surgery and hygiene education are insufficient for the sustainability of trachoma elimination and highlight that hypothetic-deductive processes seem not operational after implementing the awareness campaigns. Trachoma recurrence detected in 2013 in sedentary populations of Kolofata receiving efficacious treatments against Chlamydia sp. suggest that the elimination goals will be delayed if strategies are limited to medical actions. Restricting efforts to repeated pharmacological and surgical interventions for people infected with susceptible bacteria could be understood as the hidden side of a passive attitude toward basic education actions. © 2014 by The Japanese Society of Tropical Medicine.


Pierru A.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Pierru A.,Saint Roch University Hospital | Carles M.,Saint Roch University Hospital | Gastaud P.,Saint Roch University Hospital | Baillif S.,Saint Roch University Hospital
Investigative Ophthalmology and Visual Science | Year: 2014

Purpose. To compare subfoveal choroidal thickness (SFCT) before and after uneventful cataract surgery using enhanced depth imaging optical coherence tomography (EDI-OCT). Methods. A prospective study was conducted on 115 eyes of 95 patients who had phacoemulsification. Measurements of SFCT were performed preoperatively, 1 day (D1), 7 days (D7), 1 month (M1), and 3 months (M3) after surgery using the EDI-OCT technique. Central retinal thickness (CRT) was measured before surgery and at M1 and M3. Results. The 95 patients had a mean age of 76 ± 8.3 years. The mean SFCT at baseline was 224 ± 75 μm. It showed a negative correlation with age and axial length (P = 0.03). The SFCT significantly increased after surgery with a mean value of 232 ± 76 μm at D1 (P < 0.001), 237 ± 78 μm at M1 (P < 0.001), and 232 ± 76 μm at M3 (P < 0.001). The mean CRT increased from 234 ± 48 μm at baseline to 248 ± 48 μm at M1 (P = 0.005), and 252 ± 81 μm at M3 (P = 0.001). Three (2.6%) patients developed a pseudophakic cystoid macular edema (PCME). The greatest progression of SFCT after phacoemulsification was observed for these patients. It preceded the occurrence of pseudophakic cystoid macular edema (PCME) by 1 month. Conclusions. Mean SFCT increased after cataract surgery. The changes in baseline SFCT were greater in PCME patients and preceded the increase in CRT. © The Association for Research in Vision and Ophthalmology, Inc.


Goldschmidt P.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Degorge S.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Benallaoua D.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Semoun O.,Center Hospitalier National dOphtalmologie des Quinze Vingts | And 6 more authors.
Ophthalmology | Year: 2012

Purpose: The first-line therapy for patients with keratitis is different for bacteria, filamentous fungi, and yeasts. The timely onset of treatments depends on rapid and accurate diagnosis. However, fungal cultures produce high rates of false-negative results. Nucleic acid amplification techniques (polymerase chain reaction [PCR]) improve fungal diagnosis performance, but they require complex postamplification procedures to differentiate filamentous fungi from yeasts or to identify the agent. The objective of this work was to develop a new diagnostic strategy based on real-time PCR high-resolution melting (HRM) analysis that in 1 run (a) detects and semiquantifies yeasts and filamentous fungi, (b) differentiates yeasts from filamentous fungi, and (c) discriminates among relevant species of yeasts. Design: Experimental study to compare HRM diagnosis performances with microscopic examination of corneal scrapings and fungal culture. Participants and Controls: High-resolution melting detection limits and specificity were assessed with (a) isolated strains; (b) agents (other than fungi) producing keratitis; (c) corneal scrapings from fungal keratitis (culture positive and negative); and (d) corneal scrapings from bacterial, viral, or Acanthamoeba keratitis. Methods: The DNA extracted from cornea specimens was mixed with primers diluted in the MeltDoctor HRM Master Mix (Applied Biosystems, Paris, France) in 2 tubes, the first for yeasts, containing the forward primer CandUn (5′CATGCCTGTTTGAGCGTC) and the reverse primer FungUn2 (5′TCCTCCGCTTATTGATATGCT), and the second for filamentous fungi, containing the forward primer FilamUn1 (5′ TGCCTGTCCGAGCGTCAT) and FungUn2. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were monitored by adding internal controls to each sample. Main Outcome Measures: Detection of fungi in corneal samples by HRM. Results: High-resolution melting consistently detects the equivalent of 0.1 colony-forming units /ml of yeasts and filamentous fungi, differentiates filamentous fungi from yeasts, and discriminates among relevant species of yeasts. High-resolution melting sensitivity and specificity were 100% for culture-positive samples, detecting and characterizing fungi in 7 of 10 culture-negative suspected fungal keratitis. Conclusions: High-resolution melting is a new, sensitive, specific, and inexpensive test that detects fungi and differentiates filamentous fungi from yeasts directly from clinical specimens in less than 2.30 hours after DNA extraction. Financial Disclosure(s): The author(s) have no proprietary or commercial interest in any materials discussed in this article. © 2012 American Academy of Ophthalmology.


Reinstein D.Z.,The London Clinic | Reinstein D.Z.,Columbia University | Reinstein D.Z.,Center Hospitalier National dOphtalmologie des Quinze Vingts | Yap T.E.,The London Clinic | And 3 more authors.
Journal of Cataract and Refractive Surgery | Year: 2014

Purpose To measure and compare the interobserver reproducibility of manifest refraction according to a standardized protocol for normal preoperative patients in a refractive surgery practice. Setting Private clinic, London, United Kingdom. Design Retrospective case series. Methods This retrospective study comprised patients attending 2 preoperative refractions before laser vision correction. The first manifest refraction was performed by 1 of 7 optometrists and the second manifest refraction by 1 of 2 surgeons, all trained using a standard manifest refraction protocol. Spherocylindrical data were converted into power vectors for analysis. The dioptric power differences between observers were calculated and analyzed. Results One thousand nine hundred twenty-two consecutive eyes were stratified into a myopia group and a hyperopia group and then further stratified by each surgeon-optometrist combination. The mean surgeon-optometrist dioptric power difference was 0.21 diopter (D) (range 0.15 to 0.32 D). The mean difference in spherical equivalent refraction was 0.03 D, with 95% of all refractions within ±0.44 D for all optometrist-surgeon combinations. The severity of myopic or hyperopic ametropia did not affect the interobserver reproducibility of the manifest refraction. Conclusions There was close agreement in refraction between surgeons and optometrists using a standard manifest refraction protocol of less than 0.25 D. This degree of interobserver repeatability is similar to that in intraobserver repeatability studies published to date and may represent the value of training and the use of a standard manifest refraction protocol between refraction observers in a refractive surgery practice involving co-management between surgeons and optometrists. Financial Disclosure Dr. Reinstein is a consultant to Carl Zeiss Meditec AG and has a proprietary interest in the Artemis technology, Arcscan, Inc., through patents administered by the Cornell Center for Technology Enterprise and Commercialization. No other author has a financial or proprietary interest in any material or method mentioned.


Laroche L.,Center Hospitalier National dOphtalmologie des Quinze Vingts
Revue du Praticien | Year: 2013

Cataract surgery improves vision by restoring eye transparency and also by correcting previous refractive defects. Surgery has only to be done when the patient's quality of life is significantly impaired by vision troubles. Among patients with cognitive and behaviour troubles (i.e Alzheimer disease), surgery may improve cognitive scores, and autonomy. Multifocal intraocular lenses are sometimes indicated for correcting presbyopia. However, impairment of contrast sensitivity is constant, among adverse effects causing sometimes dissatisfaction. Therefore "monovision", with monofocal intraocular lenses may be proposed, in order to manage the loss of accommodation constant after cataract surgey. Patient's satisfaction level is high when the dominant eye is dedicated to far vision, and the other eye to near vision. Combining femtosecond laser technology and cataract surgery may in the future improve reproductibility and surgical outcomes, but is not currently responsible for obvious therapeutic benefits.

Loading Center Hospitalier National dOphtalmologie des Quinze Vingts collaborators
Loading Center Hospitalier National dOphtalmologie des Quinze Vingts collaborators