Time filter

Source Type

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Vector expressing both gRNA and mCherry (pCAGmCherry-gRNA) was generated as previously described30. To construct gRNA expression vectors, each 20 bp target sequence was sub-cloned into pCAGmCherry-gRNA or gRNA_Cloning Vector (Addgene 41824). The CRISPR/Cas9 target sequences (20 bp target and 3 bp PAM sequence (underlined)) used in this study include: scramble, GCTTAGTTACGCGTGGACGA ; mutant GFP, CAGGGTAATCTCGAGAGCTT ; MH1, GCCGCTTTACTTAGGTCCCC ; and MH2, GGAGATCCACTCTCGAGCCC ; for PITCh donor: mouse Tubb3, AGCTGCGAGCAACTTCACTT ; human TUBB3, AGCTGCGAGCAGCTTCACTT ; human KCNQ1, AGTACGTGGGCCTCTGGGGG ; the downstream of CAG promoter in Ai14 mouse, TAGGAACTTCTTAGGGCCCG ; rat Mertk for HITI, GAGGACCACTGCAACGGGGC ; rat Mertk for HDR, TCAGGTGCTTAGGCATTTCG . The Scramble-gRNA target sequence we designed is an artificial sequence that does not exist in human, mouse and rat genomes. We used the off-target finder software Cas-OFFinder (http://www.rgenome.net/cas-offinder/) to confirm that there were no genomic target sites within 2-bp mismatches. We have confirmed that the Scramble-gRNA can cut its target site in the donor vector (Extended Data Fig. 1b). pMDLg/pRRE, pRSV-Rev and pMD2.G (Addgene 12251, 12253 and 12259) were used for packaging lentiviruses. pEGIP*35 and tGFP (Addgene 26776 and 26864) were used for examining HDR and HITI efficiencies. To construct IRESmCherry-0c, IRESmCherry-1c, IRESmCherry-2c, IRESmCherry-MH, IRESmCherry-HDR-0c and IRESmCherry-HDR-2c, IRES and mCherry sequences were amplified with Cas9 target sequence by PCR from pEGIP*35 and pCAGmCherry-gRNA, respectively and co-integrated into pCR-bluntII vector (Invitrogen) with zero, one or two CAS9/gRNA target sequences. Cas9 expression plasmid (hCas9) was purchased from Addgene (41815). To generate different NLS-dCas9 constructs, pMSCV-LTR-dCas9-VP64-BFP (Addgene 46912) was used to amplify dCas9, which was subsequently subcloned into pCAG-containing plasmid with different NLS and 3×Flag tag. To construct pCAG-Cas9 (no NLS), pCAG-1NLS-Cas9-1NLS and pCAG-1BPNLS-Cas9-1BPNLS, D10A and H840A mutations of dCas9 plasmids were exchanged to wild-type sequence by In-Fusion HD Cloning kit (Clontech). Then, pCAG-Cas9-2AGFP (no NLS), pCAG-1NLS-Cas9-1NLS-2AGFP and pCAG-1BPNLS-Cas9-1BPNLS-2AGFP were constructed by adding 2AGFP downstream of Cas9. To construct pCAG-floxSTOP-1BPNLS-Cas9-1BPNLS, 1BPNLS-Cas9-1BPNLS was amplified by PCR and exchanged with GFP of pCAG-floxSTOP-EGFP-N1 vector31. To construct HITI donor plasmids for mouse and human Tubb3 gene (Tubb3-1c, Tubb3-2c, Tubb3-2cd, hTUBB3-1c and hTUBB3-2c) and PITCh donor (Tubb3-MH), GFP was subcloned into pCAG-floxSTOP plasmid with one or two CAS9/gRNA target sequences. To construct HDR donor for mouse Tubb3 gene (Tubb3-HR), GFP, 5′ and 3′ homology arms were amplified from pCAG-GFP-N1 or mouse genome, then subcloned into pCAG-floxSTOP plasmid. pCAG-ERT2-Cre-ERT2 was purchased from Addgene (13777). PX551 and PX552 were purchased from Addgene (60957 and 60958). To construct AAV-Cas9, nEF (hybrid EF1α/HTLV) promoter (Invivogen) was exchanged with Mecp2 promoter of PX551. To construct donor/gRNA AAVs for HITI, donor DNA sandwiched by Cas9/gRNA target sequence, gRNA expression cassette and GFPKASH (or mCherryKASH) expression cassettes were subcloned between ITRs of PX552, and generated pAAV-mTubb3, pAAV-Ai14-HITI, pAAV-Ai14-luc, pAAV-Ai14-scramble and pAAV-rMertk-HITI. For pAAV-rMertk-HITI, exon 2 of rat Mertk gene including the surrounding intron is sandwiched by Cas9/gRNA target sequence, which is expected to integrate within intron 1 of Mertk by HITI. For HDR AAV (pAAV-Ai14-HDR and pAAV-rMertk-HDR), the homology arms were amplified by PCR from mouse and rat genome DNA, and subcloned into AAV backbone plasmid. The plasmids described in this manuscript will be available to academic researchers through Addgene. Genomic DNAs were extracted using Blood & Tissue kit (QIAGEN) or PicoPure DNA Extraction Kit (Thermo Fisher Scientific). Genomic PCRs were performed using PrimeSTAR GXL DNA polymerase (Takara). Genomic DNA from the transfected HEK293 lines was extracted and bisulphite converted using the Zymo EZ DNA methylation-direct Kit (Zymo Research). The DNA methylation profile of mCherry was analysed by TOPO cloning as described previously32. H1 hES cells were purchased from WiCell Research, and maintained in hES cell medium33. HEK293 cell was purchased from ATCC. Cell lines were authenticated by STR analysis. Mycoplasma contamination was checked every 2 months and was found to be negative in all cell lines used. All AAVs were packaged with serotypes 8 or 9 and were generated by the Gene Transfer Targeting and Therapeutics Core (GT3) at the Salk institute for biological studies. ICR, C57BL/6 and ROSA-LSL-tdTomato (known as Ai14)20 mice were purchased from the Jackson laboratory. Some timed pregnant ICR mice were purchased from SLC Japan (Sizuoka, Japan). RCS and Brown Norway rats were purchased from the Jackson laboratory. All mice used in this study were from mixed gender, mixed strains and P1 to 12 weeks old. All mouse experiments were approved by the IACUC committee or the RIKEN Center for Developmental Biology and conform to regulatory standards. All rat procedures were conducted with the approval and under the supervision of the Institutional Animal Care Committee at the University of California San Diego and adhered to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The midday of the vaginal plug was designated as embryonic day 0.5 (E0.5). Construction and production of minicircle DNA vectors were performed as previously described34. Briefly, to construct pre-minicircle plasmids (pIRESmCherry-MC, pIRESmCherry-MC-scramble, pTubb3-MC, pTubb3-MC-scramble, pAi14-GFPNLS-MC, pAi14-GFPNLS-MC-scramble, pAi14-luc-MC and pAi14-luc-MC-scramble), IRESmCherry, GFP or luciferase genes with Cas9/gRNA targeting sequence were cloned into ApaI and SmaI sites of the minicircle producer plasmid pMC.BESPX (a gift from M. Kay, Stanford University School of Medicine). The final minicircle constructs were introduced into the E. coli strain 3S2T (a gift from M. Kay) and amplified overnight in Terrific Broth (pH 7.0) (Fisher Scientific). The minicircle production was induced by mixing the overnight TB culture with an equal volume of minicircle induction mix comprising fresh LB and 20% l-arabinose (SBI), followed by a 5 h incubation at 32 °C with shaking at 250 r.p.m. Minicircle DNA was isolated with EndoFree Plasmid Mega Kit (QIAGEN) following the manufacturer’s protocol except that the volumes of P1, P2 and P3 buffers were doubled. To confirm the function of the Scramble-gRNA, we performed Surveyor assay in GFP-correction HEK293 line. Briefly, Cas9, Scramble-gRNA, and different donor DNA (IRESmCherry-MC or IRESmCherry-MC-scramble) were transfected into GFP-correction HEK293 line. Three days later, genomic DNA was extracted with DNeasy Blood & Tissue kit. To examine the activity of the generated nuclear localized Cas9, we performed Surveyor assay in human H1 ES cells. Briefly, each 1.5 × 107 feeder-free cultured H1 ES cells were dissociated by TrypLE (Invitrogen), and resuspended in 1 ml of MEF-conditioned medium containing 10 μM ROCK inhibitor Y-27632 (Biomol Inc.). Cells were electroporated with 25 μg of pCAGmCherry-KCNQ1 and 25 μg of different Cas9 (pCAG-Cas9-2AGFP, pCAG-1NLS-Cas9-1NLS-2AGFP or pCAG-1BPNLS-Cas9-1BPNLS-2AGFP), and were plated onto 100-mm dishes pre-coated with Matrigel. Two days after electroporation, the cells were dissociated by TrypLE, and Cas9 and gRNA expressing cells were sorted out as GFP/mCherry double-positive cells by BD influx cell sorter (BD), and genomic DNA extracted with DNeasy Blood & Tissue kit. The extracted genomic DNA from the transfected GFP-correction HEK293 line and human H1 ES cells were used for Surveyor assay with SURVEYOR Mutation Detection Kits (Transgenomic) as described previously35. To assess the knock-in efficiency in dividing cells and optimize the HITI method, we established a mutated GFP gene-based reporter system in HEK293. Briefly, pEGIP*35 was co-transfected with pMDLg/pRRE, pRSV-Rev and pMD2.G, packaged and purified as lentiviral vectors according to a published protocol36. HEK293 cells were transduced in suspension with lentiviral EGIP*35 vector and 4 μg ml−1 polybrene for 1 h. After brief centrifugation to remove any residual lentiviral vector, the cells were seeded in 100-mm dishes. Three days after transduction, puromycin (1–2 μg ml−1; Invitrogen) was added to the medium. After 10 days, single colonies were individually picked up and expanded as GFP-correction HEK293 line. Primary neurons were obtained from the cortex of E14.5 ICR mouse brains. After the embryo retrieval, all dissection procedures were performed in a cold solution of 1× phosphate-buffered saline (PBS) with 2% glucose (Gibco). Cortical tissue was dissociated by trypsinization, and 1.5 × 105 cells cm−2 were plated over coated poly-d-lysine coverslips (Neuvitro) with Neurobasal media (Gibco) supplemented with 2% B27 (Gibco) and 0.25% Glutamax (Gibco). The cultures were incubated at standard conditions (37 °C in humidified 5% CO /95% air atmosphere). Half volume of culture media was replaced every 3 days. The differentiation protocol from human ES cells to pan neurons was described previously37. Lipofectamine 3000 (Invitrogen), CombiMag Reagent in combination with Lipofectamine 2000 (OZBiosciences) and DNA-In Neuro Transfection Regent (Amsbio) were used for transfection of HEK293 cells, mouse primary cells and human ES cell-derived pan neurons, respectively. Transfection complexes were prepared following the manufacturer’s instructions. To measure the targeted gene knock-in efficiency in GFP-correction HEK293 line, we co-transfected hCas9, gRNA (mutant GFP-gRNA, Scramble-gRNA, MH1-gRNA and/or MH2-gRNA) and donor DNA. Promoterless IRESmCherry plasmids with zero, one, or two CRISPR/Cas9 target sites (IRESmCherry-0c, IRESmCherry-1c and IRESmCherry-2c, respectively) and a minicircle donor (IRESmCherry-MC) were used to measure HITI efficiency. HDR-donors (tGFP and IRESmCherry-HDR-0c) were used to measure HDR efficiency. A PITCh-donor (IRESmCherry-MH) was used to measure PITCh efficiency. IRESmCherry-HDR-2c was used as HDR and HITI dual donors. IRESmCherry-0c and IRESmCherry-MC-scramble were used as genome DNA cut only and donor DNA cut only controls, respectively. The Scramble-gRNA target sequence is an artificial sequence that does not exist in both human and mouse genomes. The Scramble-gRNA was transfected with IRESmCherry-MC-scramble. The MH1-gRNA and MH2-gRNA were co-transfected with IRESmCherry-MH. For other donor shown in Fig. 1a, the mutant GFP-gRNA was co-transfected. The efficiencies of targeted gene knock-in via HDR, PITCh and HITI were determined by calculating the percentage of GFP+ or mCherry+ cells by FACS LSR Fortessa (BD) and the percentages of PITCh, HITI (without indel) or HITI (with indel) per mCherry+ cells were determined by Sanger sequencing. The transfected cells were separated into mCherry+ and mCherry− populations by FACS via BD Influx (BD), and ~500 cells were plated onto 100-mm dishes pre-coated with wild-type HEK293 cells. Two days after transduction, puromycin (2 μg ml−1; Invitrogen) was added to the medium. After 2 weeks, genome-edited HEK293 clones were manually picked and further analysed by PCR and sequencing to determine the genotype. Cells were fixed in 4% paraformaldehyde (PFA) at room temperature for 15 min. Then cells were blocked and permeabilized with 5% Bovine Serum Albumin (BSA) and 0.1% Triton X-100 in PBS for 50 min with shaking at room temperature. Primary antibodies were diluted in 2.5% BSA/PBS and cells were incubated overnight at 4 °C in a wet chamber with anti-GFP (Aves) and anti-βIII tubulin (Sigma) antibodies. Next day, cells were washed with 0.2% Tween 20 in PBS, and incubated for 1 h at room temperature with the secondary antibodies Alexa Fluor 488 (Thermo Fisher) or Alexa Fluor 647 (Thermo Fisher). After a second round of washing with 0.2% Tween 20 in PBS, the cells were mounted using DAPI-Vector Shield mounting media (Vector) and stored at 4 °C. To examine cell proliferation status, we added 2 μM EdU (Invitrogen) in the transfected neurons, and detected EdU positive cells by Click-iT EdU kit (Invitrogen). Animals were harvested after transcardial perfusion using PBS followed by 4% PFA. Organs were dissected out and post-fixed with 2% PFA and 15% sucrose in PBS at 4 °C for 16–20 h, then immersed in 30% sucrose in PBS at 4 °C before sectioning. Mouse brains were fixed in 1% PFA in 0.1 M phosphate buffer (pH 7.4) at 4 °C for 24 h followed by cryoprotection in 25% sucrose overnight at 4 °C. For neonatal brain, brains were embedded in OCT compound (Sakura Tissue-Tek) and sectioned by Cryostat (14 μm). Well-dried sections were washed 3 times with PBST (1% Tween 20 in PBS) and treated with blocking buffer (2% donkey serum and 0.2% Triton X-100 in PBS, pH 7.4) for 1 h at room temperature, followed by incubation with primary antibodies diluted in the same buffer overnight at 4 °C. The primary antibodies used were Anti-GFP (Aves) and anti-mCherry (Abcam). Sections were washed three times in PBST and treated with secondary antibodies conjugated to Alexa Fluor 488 or Alexa Fluor 546 (Thermo Fisher) for 1 h at room temperature. After wash, the sections were mounted with mounting medium (PermaFluor, Thermo scientific). For adult brain, 50 μm coronal brain sections were prepared using a freezing microtome and stored in PBS with 0.01% sodium azide at 4 °C. Free-floating sections were incubated at 4 °C for 16–48 h with goat anti-GFP (Rockland) primary antibodies in PBS/0.5% normal donkey serum/0.1% Triton X-100, followed by the appropriate secondary antibodies conjugated with Alexa Fluor 488 at room temperature for 2–3 h. Sections were counterstained with 10 μM DAPI in PBS for 30 min to visualize cell nuclei. Immunostained tissue sections were mounted on slides with polyvinyl alcohol mounting medium containing DABCO and allowed to air-dry overnight. For other tissues, the harvested tissues were embedded in OCT compounds and frozen. Serial or axial frozen sections (thickness 10–20 μm) were prepared using a cryostat, which were then placed on silanized slides and air-dried. The sections were washed with PBS, followed by 1 h room temperature incubation by blocking buffer containing 3% normal goat serum, 0.3% and Triton X-100 in PBS, then incubated with the first antibody solution overnight. The primary antibodies used were anti-GFP, anti-mCherry, anti-dystrophin (Sigma), anti-actin, anit-smooth-muscle antibody (Sigma) and anti-human-serum-albumin antibody (R&D). After wash, the sections were immunostained with secondary antibody solution for 1 h at room temperature. The secondary antibodies used were Alexa Fluor 488, 568 or 647. After sequential washing with 0.2% Tween 20/PBS, 0.05% Tween 20/PBS, and PBS, the sections were mounted with DAPI Fluoromount-G (Southern Biotech). For rat, retinal cryosections were rinsed in PBS and blocked in 0.5% Triton X-100 in 5% BSA in PBS for 1 h at room temperature. Anti-Mertk antibody (eBioscience) was diluted in 5% BSA in PBS and incubated with sections overnight at 4 °C. The sections were then washed three times with PBS, incubated with IgG secondary antibody tagged with Alexa Fluor 555 (Thermo Fisher) in PBS at room temperature for 1 h, and washed with PBS. Cell nuclei were counterstained with DAPI. Sections were mounted with Fluoromount-G (SouthernBiotech) and coverslipped. Images were captured by Keyence BZ-9000 microscope. To measure intracellular localization of dCas9, we followed a previous report16. In brief, the dCas9-transfected HEK293 cells were fixed with 4% PFA and stained with anti-Flag (Sigma) and DAPI (Vector). The intensity of fluorescence was measured using the PlotProfile tool of ImageJ software. Values were obtained independently in cytoplasmic and nuclear compartments in single transfected cells. Relative fluorescence values of nuclear intensity were divided by the values found in cytoplasm to obtain the nuclear/cytoplasm ratio. The experimental procedures for in utero electroporation have been described previously38. E15.5 pregnant ICR mice were anaesthetized by 500 μl IP injection of 10% Nembutal (Dainippon sumitomo kagaku). 1 μl of DNA mixture, containing the pCAG-1BPNLS-Cas9-1BPNLS (0.5 μg μl−1), mouse Tubb3 gene target pCAGmCherry-gRNA (0.5 μg μl−1) and either donor cut-only control donor (Tubb3-MC-scramble), minicircle donor (Tubb3-MC), 2-cut (Tubb3-2c) or HDR donor (Tubb3-HDR) vectors (0.8 μg μl−1) was injected into the hemisphere of the fetal brain. For visually confirming the injection, 0.005% fast green solution (Wako) was mixed with the DNA. Fetuses were tweezed by paddles of the tweezer electrodes (CUY21 electroporator, NEPA GENE). For tamoxifen (TAM) inducible Cre-dependent Cas9 expression system, fetuses were injected with 1 μl of DNA mixture into the hemisphere, containing the pCAG-floxSTOP-1BPNLS-Cas9-1BPNLS (0.5 μg μl−1), pCAG-ERT2CreERT2 (0.5 μg μl−1), pCAG-mcherry-U6-gRNA (0.5 μg μl−1) and either minicircle donor (Tubb3-MC) or HDR donor (Tubb3-HDR) vectors (0.8 μg μl−1). 50 μl of 10 mg ml−1 tamoxifen (Sigma) dissolved in corn oil were injected to P10 and P11 electroporated pups for induction of the Cas9 expression. The GFP knock-in efficiency was measured by the percentage of GFP+ cells among transfected cells (mCherry+). The DNA mixtures were transfected by in utero electroporation at E15.5 of mouse brain and the mice were euthanized at P10. The collected brains from P10 mice were trypsinized for 40 min at 37 °C, then dissociated to single cells by pipetting. About 22,000 electroporated cells were collected by FACS sorting (SH-800, Sony). Total RNA was extracted from the sorted cells with RNeasy mini kit (Qiagen) and cDNA was synthesized by SuperScript VILO (Invitrogen). RT–PCR was performed with PrimeSTAR GXL polymerase as following the manufacturer’s protocol with 10% of 5 M betaine solution (Sigma). The DNA mixture for Scramble control (25 μg of pCAG-1BPNLS-Cas9-1BPNLS, 25 μg of Scramble-gRNA-mCherry and 10 μg of Ai14-GFPNLS-MC-scramble), without Cas9 (25 μg of empty vector, 25 μg of Ai14gRNA-mCherry and 10 μg of Ai14-luc-MC or Ai14-GFP-MC) and with Cas9 (25 μg of pCAG-1BPNLS-Cas9-1BPNLS, 25 μg of Ai14gRNA-mCherry and 10 μg of Ai14-luc-MC or Ai14-GFP-MC) were prepared in 25 μl TE. Wild-type or Ai14 mice were anaesthetized with intraperitoneal injection of ketamine (100 mg kg−1) and xylazine (16 mg kg−1). For quadriceps muscle electroporation, a small portion of the quadriceps muscle was surgically exposed in the hind limb. Plasmid DNA mixture was injected into the muscle using a 29-gauge insulin syringe. One minute following plasmid DNA injection, a pair of electrodes was inserted into the muscle to a depth of 5 mm to encompass the DNA injection site and muscle was electroporated using an Electro Square Porator T820 (BTX Harvard Apparatus). Electrical stimulation was delivered twenty pulses at 100 V for 20 ms. After electroporation, skin was closed and mice were recovered on a 37 °C warm pad. For panniculus carnosus muscle electroporation, the hair of back skin was depilated with depilatory cream. The above mixture of DNA solutions were conjugated and subcutaneously injected to right and left side, respectively. The injected areas of skin and subcutaneous tissue was vertically sandwiched by plate-and-fork type electrodes, consist of a pair of stainless-steel tweezers, one with a rectangular plate, 10 mm long and 5 mm wide, and the other with a fork consisting of three straight needles at 2.5 mm intervals, which are 10 mm long and 0.5 mm in diameter. The interface of skin and the rectangular electrode was covered with electroconductive gel (SpectraGel 360, Parker Labs). Twenty 18 V/50 ms/1 Hz square pulses followed by another 20 pulses of the opposite polarity were delivered using Electro Square Porator T820. Two weeks after the electroporation, mice were euthanized, and tissues were obtained. The DNA mixture without Cas9 (100 μg of empty vector, 100 μg of Ai14gRNA-mCherry and 50 μg of Ai14-luc-MC) and with Cas9 (100 μg of pCAG-1BPNLS-Cas9-1BPNLS, 100 μg of Ai14gRNA-mCherry and 50 μg of Ai14-luc-MC) were prepared in 200 μl saline. A midline laparotomy was performed and the right kidney of wild-type or Ai14 mouse was exteriorized. After exposure of kidney, mice were intravenously injected with plasmid DNA mixture, immediately followed by pressing the right kidney gripped between thumb and index finger 20 times for a period of 1 s each as described previously39. The DNA mixture for Scramble control (100 μg of pCAG-1BPNLS-Cas9-1BPNLS, 100 μg of Scramble-gRNA-mCherry and 50 μg of Ai14-GFPNLS-MC-scramble), without Cas9 (100 μg of empty vector, 100 μg of Ai14gRNA-mCherry and 50 μg of Ai14-GFP-MC) and with Cas9 (100 μg of pCAG-1BPNLS-Cas9-1BPNLS, 100 μg of Ai14gRNA-mCherry and 50 μg of Ai14-GFP-MC) were prepared in 200 μl saline. A midline laparotomy was performed. The right kidney of Ai14 mouse was exteriorized and subsequently decapsulated, leaving the adrenal gland intact. The exposed kidney was pricked with electrode needles after injection of plasmid DNA mixture from tail vein and subsequently received electroporation 100 V, 50 ms pulse, six times using an Electro Square Porator T820. Mice were examined at 2 weeks after DNA transfection or electroporation by BLI performed using an IVIS Kinetic 2200 (Caliper Life sciences). Mice were IP injected with 150 mg kg−1 d-Luciferin (BIOSYNTH), anaesthetized with isoflurane and dorsal images were then captured 10 min post luciferin injection. Primary cultures of neurons were used after three days in culture, the AAV solution (without Cas9, AAV-mTubb3 (1.5 × 1010 GC); with Cas9, AAV-Cas9 (1.5 × 1010 GC) and AAV-mTubb3 (1.5 × 1010 GC)) was added and cultures were kept at standard conditions for 5 days, following immunocytochemistry or DNA extraction. C57BL/6 mice received AAV8 injections at P75. We used 1:1 mixture of AAV-Cas9 (1.5 × 1013 GC ml−1) and AAV-mTubb3 (2.3 × 1013 GC ml−1). As a control, 1:1 mixture of AAV-mTubb3 and HBSS buffer was used. Mice were anaesthetized with 100 mg kg−1 of ketamine and 10 mg kg−1 of xylazine cocktail via intra-peritoneal injections and mounted in a stereotax (David Kopf Instruments Model 940 series) for surgery and stereotaxic injections. Virus was injected into the centre of V1, using the following coordinates: 3.4 mm rostral, 2.6 mm lateral relative to bregma and 0.5–0.7 mm ventral from the pia. We injected 200 nl of AAVs using air pressure by picospritzer (General Valve Corp). To prevent virus backflow, the pipette was left in the brain for 5–10 min after completion of injection. Mice were housed for two weeks to allow for gene knock-in. Ai14 mice were anaesthetized with intraperitoneal injection of ketamine (100 mg kg−1) and xylazine (16 mg kg−1). A small portion of the quadriceps muscle was surgically exposed in the hind limb. The AAV8 mixture (without Cas9, AAV-Ai14-HITI (1.5 × 1010 GC); with Cas9, AAV-Cas9 (1.5 × 1010 GC) and AAV-Ai14-HITI (1.5 × 1010 GC)) was were injected into the quadriceps muscle using a 29 Gauge insulin syringe. After AAV injection, skin was closed and mice were recovered on a 37 °C warm pad. The newborn (P1) of Ai14 mice were used for IV AAV8 or AAV9 injection following a previous report40. The AAV mixtures (without Cas9, AAV-Ai14-HITI (5 × 1010 or 2 × 1011 GC); with Cas9, AAV-Cas9 (5 × 1010 or 2 × 1011 GC) and AAV-Ai14-HITI (5 × 1010 or 2 × 1011 GC); Scramble control, AAV-Cas9 (5 × 1010 GC) and AAV-Ai14-Scramble (5 × 1010 GC); HDR, AAV-Cas9 (5 × 1010 GC) and AAV-Ai14-HDR (5 × 1010 GC)) were injected via temporal vein of the P1 mouse. The AAV8 mixtures (without Cas9, AAV-Ai14-luc (2 × 1011 GC); with Cas9, AAV-Cas9 (2 × 1011 GC) and AAV-Ai14-luc (2 × 1011 GC)) were injected via tail vein for luciferase knock-in. The AAV mixtures (without Cas9, AAV-Ai14-HITI (2 × 1011 GC); with Cas9, AAV-Cas9 (2 × 1011 GC) and AAV-Ai14-HITI (2 × 1011 GC)) were injected via tail vein for GFP knock-in. For immunocytochemical analyses, the cells and tissues were visualized by confocal microscopy using a Zeiss LSM 780 Laser Scanning Confocal or Olympus FV1000 confocal microscope (Olympus). At least five pictures were obtained from each group and animal. We analysed at least three animals. Pictures were analysed with ZEN 2 (blue edition) and NIH ImageJ (FIJI) software. For the mouse primary neurons and human pan neurons analyses, the total number of positive cells for each marker were directly counted with the multi-point tool of NIH ImageJ software. The percentage of GFP+ cells was calculated among transfected cells (mCherry+) or total cells (DAPI+). The intracellular distribution of GFP was observed in around 100 independent events for each condition, where the focused cell was observed at different stacks to determine the presence or absence of GFP at the nucleus space. To assess the efficiency of GFP knock-in in brain after local AAV injection, we counted number of GFP+, mCherry+ and DAPI+ cells of 300 μm within injection sites and determined the GFP knock-in efficiency per infected cells or per cell. To assess the efficiency of GFP knock-in in liver, heart and muscle after systemic AAV injection, we counted the number of GFP+ and DAPI+ cells and determined the GFP knock-in efficiency per cell. To collect GFP-positive single cells from muscle and heart of AAV-injected mouse, animals were harvested after transcardial perfusion using PBS. Organs were dissected out and isolated as single cells with published methods41, 42. The single nuclei per cell was confirmed by fluorescent microscope with DAPI staining and separated by BD influx cell sorter. Each single GFP+ cell was sorted into 5 μl of lysis buffer from PicoPure DNA Extraction Kit by BD influx cell sorter and used as a template for first round of PCR to amplify the target genome with PrimeSTAR GXL polymerase following the manufacturer’s protocol. The first round of PCR product was purified using Agencourt AMPure XP (Beckman Coulter), then subject to second round PCR and sequencing to confirm the genotype. Based on sequencing result of 5′ junction end, single cell genotyping can separate biallelic GFP knock-in, monoallelic GFP knock-in with indels at another target, monoallelic GFP knock-in without indels at another target, and unknowns. The top 12 predicted off-target sites were searched using The CRISPR Design Tool43. The on-target and potential off-target regions were amplified using PrimeSTAR GXL DNA polymerase from the liver DNA via IV injection and used for library construction. Equal amounts of the genomic DNA was used to amplify genomic regions flanking the on-target and top 12 predicted off-target nuclease binding sites for library construction. Next, PCR amplicons from previous step were purified using Agencourt AMPure XP, then subject to second round PCR to attach Illumina P5 adapters and sample-specific barcodes. The purified PCR products were pooled at equal ratio for single-end sequencing using Illumina MiSeq at the Zhang laboratory (UCSD). The raw reads were mapped to mouse reference genome mm9 or custom built Ai14 mouse genome using BWA44. High quality reads (score >30) were analysed for indel events and Maximum Likelihood Estimate (MLE) calculation as previously described43. As next generation sequencing analysis of indels cannot detect large size deletion and insertion events, CRISPR/Cas9 targeting efficiency and activity shown above is underestimated. Congenic RCS rats at 21 days old were used in the study and divided into three groups. RCS group is non-injection control. The Cas9 + HITI group received a subretinal injection of 2 μl of AAV8 mixture (AAV-Cas9 (1.5 × 1010 GC) and AAV-rMertk-HITI (1.5 × 1010 GC)) in the eyes. The Cas9 + HDR group received a subretinal injection of 2 μl of AAV8 mixture (AAV-Cas9 (1.5 × 1010 GC) and AAV-rMertk-HDR (1.5 × 1010 GC)) in the eyes. Wild-type rats without an injection served as a normal control. Experimental rats were anaesthetized with an intraperitoneal injection of a mixture of ketamine and xylazine. Pupils were dilated with 1% topical tropicamide. Subretinal injection was performed under direct visualization using a dissecting microscope with a pump microinjection apparatus (Picospritzer III; Parker Hannifin Corporation) and a glass micropipette (internal diameter ~50–75 μm). Two microlitres of AAV mixture was injected into the subretinal space through a small scleral incision. A successful injection was judged by creation of a small subretinal fluid bleb. Fundus examination was performed immediately following injection, and rats showing any sign of retinal damage such as bleeding were discarded and excluded from the final animal counts. To monitor the efficacy of gene knock-in in vision rescue, ERG studies were performed at 4 weeks after treatment before the animals were euthanized for histology. The dark-adapted ERG response was recorded as described previously45. In brief, rats were dark-adapted for 14 h before the commencement of each ERG recording session. They were deeply anaesthetized as described for the surgical procedure above. Eyes were treated with 1% topical tropicamide to facilitate pupillary dilation. Each rat was tested in a fixed state and manoeuvred into position for examination within a Ganzfeld bowl (Diagnosys LLC). One active lens electrode was placed on each cornea, with a subcutaneously placed ground needle electrode positioned in the tail and the reference electrodes placed subcutaneously in the head region approximately between the two eyes. Light stimulations were delivered with a xenon lamp at 0.01 and 0.3 cds m−2 in a Ganzfeld bowl. For the flicker ERG measurement, rats were adapted at a background light of 10 cds m−2, and light stimulation was set at 30 cds m−2. The recordings were processed using software supplied by Diagnosys. Following ERG recordings, rats were euthanized and retinal cross-sections were prepared for histological evaluation of ONL preservation. Rats were euthanized with CO , and eyeballs were dissected out and fixed in 4% PFA. Cornea, lens, and vitreous were removed from each eye without disturbing the retina. The remaining retina-containing eyecup was infiltrated with 30% sucrose and embedded in OCT compound. Horizontal frozen sections were cut on a cryostat. Retinal cross-sections were prepared for histological evaluation by staining with haematoxylin and eosin (H&E). Following ERG recordings, rats were euthanized. DNA and RNA were isolated from retina-choroid complex using an AllPrep DNA/RNA Mini Kit (Qiagen). DNA was further used for PCR and TOPO sequencing. cDNA was synthesized from RNA using a Superscript III reverse transcriptase kit (Invitrogen) according to the manufacturer’s instructions. Quantitative PCR was performed via 40 cycle amplification using following primers (MertK-F1: GCATTTCGTGGTGGAAAGAT, MertK-R1: TGGGATCAGACACAACCTCTC) and Power SYBR Green PCR Master Mix on a 7500 Real-Time PCR System (Applied Biosystems). Measurements were performed in triplicate and normalized to endogenous GAPDH levels. The relative fold change in expression was calculated using the ΔΔC method (C values <30). The analysis for insertion and deletion (indel) events and Maximum Likelihood Estimate (MLE) calculation were done as previously described43. All custom scripts can be provided upon request. Raw Illumina sequencing reads for this study have been deposited in the National Center for Biotechnology Information Short Read Archive and accessible through SRA accession number SRP069844.


News Article | November 16, 2016
Site: www.eurekalert.org

LA JOLLA--(November 16, 2016) Salk Institute researchers have discovered a holy grail of gene editing--the ability to, for the first time, insert DNA at a target location into the non-dividing cells that make up the majority of adult organs and tissues. The technique, which the team showed was able to partially restore visual responses in blind rodents, will open new avenues for basic research and a variety of treatments, such as for retinal, heart and neurological diseases. "We are very excited by the technology we discovered because it's something that could not be done before," says Juan Carlos Izpisua Belmonte, a professor in Salk's Gene Expression Laboratory and senior author of the paper published on November 16, 2016 in Nature. "For the first time, we can enter into cells that do not divide and modify the DNA at will. The possible applications of this discovery are vast." Until now, techniques that modify DNA--such as the CRISPR-Cas9 system--have been most effective in dividing cells, such as those in skin or the gut, using the cells' normal copying mechanisms. The new Salk technology is ten times more efficient than other methods at incorporating new DNA into cultures of dividing cells, making it a promising tool for both research and medicine. But, more importantly, the Salk technique represents the first time scientists have managed to insert a new gene into a precise DNA location in adult cells that no longer divide, such as those of the eye, brain, pancreas or heart, offering new possibilities for therapeutic applications in these cells. To achieve this, the Salk researchers targeted a DNA-repair cellular pathway called NHEJ (for "non-homologous end-joining"), which repairs routine DNA breaks by rejoining the original strand ends. They paired this process with existing gene-editing technology to successfully place new DNA into a precise location in non-dividing cells. "Using this NHEJ pathway to insert entirely new DNA is revolutionary for editing the genome in live adult organisms," says Keiichiro Suzuki, a senior research associate in the Izpisua Belmonte lab and one of the paper's lead authors. "No one has done this before." First, the Salk team worked on optimizing the NHEJ machinery for use with the CRISPR-Cas9 system, which allows DNA to be inserted at very precise locations within the genome. The team created a custom insertion package made up of a nucleic acid cocktail, which they call HITI, or homology-independent targeted integration. Then they used an inert virus to deliver HITI's package of genetic instructions to neurons derived from human embryonic stem cells. "That was the first indication that HITI might work in non-dividing cells," says Jun Wu, staff scientist and co-lead author. With that feat under their belts, the team then successfully delivered the construct to the brains of adult mice. Finally, to explore the possibility of using HITI for gene-replacement therapy, the team tested the technique on a rat model for retinitis pigmentosa, an inherited retinal degeneration condition that causes blindness in humans. This time, the team used HITI to deliver to the eyes of 3-week-old rats a functional copy of Mertk, one of the genes that is damaged in retinitis pigmentosa. Analysis performed when the rats were 8 weeks old showed that the animals were able to respond to light, and passed several tests indicating healing in their retinal cells. "We were able to improve the vision of these blind rats," says co-lead author Reyna Hernandez-Benitez, a Salk research associate. "This early success suggests that this technology is very promising." The team's next steps will be to improve the delivery efficiency of the HITI construct. As with all genome editing technologies, getting enough cells to incorporate the new DNA is a challenge. The beauty of HITI technology is that it is adaptable to any targeted genome engineering system, not just CRISPR-Cas9. Thus, as the safety and efficiency of these systems improve, so too will the usefulness of HITI. "We now have a technology that allows us to modify the DNA of non-dividing cells, to fix broken genes in the brain, heart and liver," says Izpisua Belmonte. "It allows us for the first time to be able to dream of curing diseases that we couldn't before, which is exciting." Other researchers on the study were Euiseok J. Kim, Fumiyuki Hatanaka, Mako Yamamoto, Toshikazu Araoka, Masakazu Kurita, Tomoaki Hishida, Mo Li, Emi Aizawa, April Goebl, Rupa Devi Soligalla, Concepcion Rodriguez Esteban, Travis Berggren and Edward M. Callaway of the Salk Institute; Yuji Tsunekawa and Fumio Matsuzaki of RIKEN Center for Developmental Biology; Pierre Magistretti of King Abdullah University of Science and Technology; Jie Zhu, Tingshuai Jiang, Xin Fu, Maryam Jafari and Kang Zhang of Shiley Eye Institute and Institute for Genomic Medicine, University of California San Diego; Zhe Li, Shicheng Guo, Song Chen and Kun Zhang of Institute of Engineering in Medicine, University of California San Diego; Jing Qu and Guang-Hui Liu of Chinese Academy of Sciences; Jeronimo Lajara, Estrella Nuñez and Pedro Guillen of Universidad Catolica San Antonio de Murcia; and Josep M. Campistol of the University of Barcelona. The work and the researchers involved were supported in part by the National Institutes of Health, The Leona M. and Harry B. Helmsley Charitable Trust, the G. Harold and Leila Y. Mathers Charitable Foundation, The McKnight Foundation, The Moxie Foundation, the Dr. Pedro Guillen Foundation and Universidad Catolica San Antonio de Murcia, Spain. Every cure has a starting point. The Salk Institute embodies Jonas Salk's mission to dare to make dreams into reality. Its internationally renowned and award-winning scientists explore the very foundations of life, seeking new understandings in neuroscience, genetics, immunology and more. The Institute is an independent nonprofit organization and architectural landmark: small by choice, intimate by nature and fearless in the face of any challenge. Be it cancer or Alzheimer's, aging or diabetes, Salk is where cures begin. Learn more at: salk.edu.


News Article | February 15, 2017
Site: www.nature.com

Stem-cell trial Japan is resuming pioneering clinical research using induced pluripotent stem (iPS) cells. A team led by Masayo Takahashi at the RIKEN Center for Developmental Biology in Kobe will make suspensions of iPS cells derived from retinal cells, and transplant them into people with age-related macular degeneration, an eye condition that can cause blindness. Takahashi started a similar study in 2014 — the first to use iPS cells in humans — but the cells prepared for the second patient were found to have genetic abnormalities and no other participants were recruited. On 1 February, Japan’s health ministry approved a new five-patient study. This time the team will use banked iPS cells created from anonymous, healthy donor cells rather than from the participants themselves. Martian polar ice cap sculpted by wind A seasonal layer of carbon dioxide frost coats Mars’s northern polar ice cap in this image, which was released on 2 February by the European Space Agency (ESA). Each winter, carbon dioxide precipitates out of the cold atmosphere and onto the ice cap. The image is a composite of pictures taken between 2004 and 2010 by ESA’s Mars Express spacecraft. The distinctive spiral troughs were probably carved by wind. Radar investigation by Mars Express and NASA’s Mars Reconnaissance Orbiter revealed that the ice cap consists of many layers of ice and dust extending to a depth of about 2 kilometres. GM wheat trial A UK research laboratory has been granted permission to begin field trials of a wheat plant that has been genetically modified (GM) to improve photosynthesis. Scientists at Rothamsted Research in Harpenden have already shown that wheat plants modified with a gene from stiff brome grass (Brachypodium distachyon) are more efficient at photosynthesis in greenhouses than conventional wheat, and they now hope to see improved yields from plants grown outside in more realistic conditions. In 2012, GM trials at Rothamsted attracted small but high-profile protests. The lab’s researchers have been among the leading advocates of such trials in Europe. Swedish stimulus The Swedish government unveiled plans on 2 February to make the country carbon neutral in less than two decades. A law expected to pass through parliament in March would set a binding target of reducing domestic greenhouse-gas emissions from industry and transport by 85% by 2045, relative to 1990 levels. Remaining emissions would be offset by natural carbon capture through forestation and by investment abroad. On announcing the move, Sweden’s environment minister, Isabella Lövin, said that her country wants to set an example at a time when climate action in the United States is threatening to lose momentum. Romanian protests Angry Romanian scientists have called on their new government to reverse its order for national science-advisory bodies to immediately stop their work, pending reorganization. The government made the order on 31 January, when it also issued a decree giving amnesty to some officials accused of corruption; this was later withdrawn after mass protests. An open letter signed by nearly 600 academics and their supporters says that the councils, which are non-political, should be immune to government change. Signatories fear that the proposed reorganization may allow amnesty for politicians who have committed scientific misconduct. UK science czar The UK government’s chief scientific adviser has been appointed to possibly the biggest science job in the country. The government announced on 2 February that Mark Walport will take the helm of a new body called UK Research and Innovation (UKRI), which is expected to oversee a pot of more than £6 billion (US$7.5 billion) in government science spending when it comes into being in 2018. Walport’s appointment is significant because there are fears that UKRI could reduce the freedom of the nine individual bodies that currently allocate much government science funding. Researcher on trial An Iranian researcher in disaster medicine, who is accused of collaboration with a “hostile government”, has been threatened with the death sentence by a judge on Iran’s revolutionary court, according to close contacts of the scientist. Ahmadreza Djalali, who had been affiliated with research institutes in Italy, Sweden and Belgium, was arrested in April 2016 during an academic visit to Iran. According to sources close to Djalali, he has been kept in solitary confinement for three months in a Tehran prison and was forced to sign a confession. Djalali’s trial is scheduled to start later this month. Ice station The British Antarctic Survey (BAS) announced on 2 February that it had completed moving its Halley VI research station 23 kilometres across the floating ice platform on which it rests. The 13-week operation, which used tractors to tow the station’s 8 modules (pictured), was prompted by fears about a growing crack in the Brunt ice shelf. Staff were evacuated last month for the coming Antarctic winter after another unpredictable crack in the ice was discovered. The base, which is designed to be relocated periodically, is ready for re-occupation in November, the BAS said. Borehole record The Iceland Deep Drilling Project completed the deepest-ever geothermal well on 25 January. After 168 days of drilling, the well bottomed out at 4,659 metres, just shy of its 5-kilometre goal. But temperatures and pressures were so high at the bottom of the well that fluids were observed behaving in a ‘supercritical’ fashion — as neither liquid nor gas — an observation that was one of the project’s goals. The well, on Iceland’s volcanic Reykjanes peninsula, is being used to explore the source of geothermal systems and to see whether supercritical fluids can be tapped as an energy resource. India’s budget Health research, biotechnology and space science are the main beneficiaries of robust budget increases announced by the Indian government on 1 February. Overall, science spending in 2017 by eight ministries (excluding nuclear and defence research) will increase by 11% — well above the projected 5% inflation rate — to 360 billion rupees (US$5.3 billion). Health research, including the fight against diseases such as leprosy and measles, will get 31% more government funding. Biotechnology will get an extra 22%, and India’s aspirations in space, including plans to land a rover on the Moon in 2018, will benefit from a 21% budget increase for space science. Dual tribute The CRISPR gene-editing system, which has transformed biological research and biomedicine, drew yet more major prizes last week. On 31 January, the Madrid-based BBVA Foundation announced that its €400,000 (US$427,000) Frontiers of Knowledge Award in Biomedicine would be shared by Francisco Mojica, Emmanuelle Charpentier and Jennifer Doudna. Mojica discovered the CRISPR repeating DNA sequences that some bacteria use to fight viral infections. Charpentier and Doudna developed the universal CRISPR editing tool — for which they have also won the ¥50-million (US$445,000) Japan Prize, announced on 2 February. They share it with cryptographer Adi Shamir. Women, non-Asian ethnic minorities and disabled people are under-represented in science and engineering in the United States, according to the National Center for Science and Engineering Statistics (NCSES). Women receive about half of all science and engineering degrees but hold less than 30% of jobs in these areas. White men, who in 2015 comprised only 31% of the US population, held nearly half of these jobs. Although female and minority representation has risen, disparities remain. 11–15 February Biophysicists gather in New Orleans, Louisiana, for the Biophysical Society’s 61st annual meeting. go.nature.com/2jtfz17 12–16 February At an international meeting in Queenstown, New Zealand, scientists discuss the latest research in advanced materials and nanotechnology. confer.co.nz/amn8 15 February India’s Polar Satellite Launch Vehicle launches a high-resolution Earth-observation satellite from the Satish Dhawan Space Center in Sriharikota. go.nature.com/2jteerk


News Article | November 1, 2016
Site: www.eurekalert.org

Researchers at the RIKEN Center for Developmental Biology have succeeded in creating a new model system that can be used to develop drug therapies for genetic disorders like spinocerebellar ataxia type 6 (SCA6). Published in Cell Reports, the study shows how stem cells from patients with SCA6 can be transformed into mature Purkinje cells -- the same type of neuron that starts dying when people develop SCA6 later in life. With this setup, the team discovered that mature Purkinje cells with the SCA6 mutation became vulnerable when deprived of thyroid hormone. SCA6 is a movement disorder characterized by death of Purkinje cells in the cerebellum, a brain region that controls our ability to produce smooth movements. No effective treatment or cure exists for this neurodegenerative disorder, and animal models have proved inconclusive. As an alternative, the team led by Keiko Muguruma focused their efforts on making a disease model based on human Purkinje cells grown in culture. As Muguruma explains, "we succeeded in generating Purkinje cells with full sets of SCA6 patient genes. Unlike animal models, these patient-derived Purkinje cells will be extremely useful for investigating disease mechanisms and for developing effective drug therapies." The disease manifests in middle age and results from mutations that increase the number of times a particular section of the CACNA1A gene are repeated. The researchers first induced skin or blood cells from patients and control participants to become pluripotent stem cells. Then they used techniques recently developed in their lab to create self-organizing cerebellar tissue and Purkinje cells. When tested, the team found that while both types of mature Purkinje cells seemed outwardly similar, they differed in how much the CACNA1A gene was expressed. The patient-derived cells contained more of the protein encoded by the CACNA1A gene than the normal cells. When immature cells were tested, protein expression levels were similar, regardless of their origins. The part of the CACNA1A protein that contains the excessively repeated section is called α1ACT. When researchers compared expression of this fragment between normal and patient-derived cells, they found that it was expressed much less in the SCA6 Purkinje cells. Because α1ACT normally binds to DNA in the nucleus and triggers the expression of other proteins that are important for normal Purkinje-cell development, these proteins were also expressed much less in the cells that contained the mutation. Again, when the team looked at immature Purkinje cells, α1ACT expression was similar for all groups. "This new system is particularly useful for drug discovery," notes Muguruma. "Using it, we were able to demonstrate that patient-derived Purkinje cells show a vulnerability to nutrient depletion and that this vulnerability can be suppressed by several compounds." Knowing that thyroid hormone is important for proper maturation and maintenance of Purkinje cells, the researchers deprived mature neurons of the hormone and found that many of the patient-derived cells died, while those that survived showed physical abnormalities. Purkinje cells without the mutation were unaffected. Further testing showed that even when deprived of thyroid hormone, negative changes in SCA6 Purkinje cells could be prevented using thyroid releasing hormone. Similar results occurred with Riluzole, a drug often used to treat another neuromuscular disorder called ALS -- also known as Lou Gehrig's disease. Decreased thyroid gland activity, a condition known as hypothyroidism, also occurs with age, and might be linked to SCA6 onset. Muguruma cautions, "there are some reports that hypothyroidism is related to cerebellar ataxia and cerebellar atrophy, but we do not yet know whether the SCA6 disease phenotypes are causally linked to decreased thyroid hormone." Now that they have proved the usefulness of this model system, Muguruma and her colleagues can continue to investigate how thyroid releasing hormone was able to protect the cells, and ultimately find a cure for this type of spinocerebellar ataxia.


News Article | September 21, 2016
Site: www.biosciencetechnology.com

Stem cell-based transplantation approaches hold great potential for treating a wide range of eye diseases, but progress has been limited by concerns about cost, safety, and effectiveness. In two related studies published Sept. 15 in Stem Cell Reports, the journal of the International Society for Stem Cell Research (ISSCR), scientists in Japan overcame a part of these concerns by demonstrating the successful transplantation of stem cell-derived retinal cells generated from immunologically matched donor animals without the need for harmful immunosuppressants. "Our findings address a major controversy in the stem cell transplantation field by showing that retinal cell grafts are attacked by the immune system if the donor and recipient are not immune-matched, and that matching prevents immune attacks against the grafts without the need for immunosuppressants," says first author Sunao Sugita of the RIKEN Center for Developmental Biology. "This approach could potentially be used to treat age-related macular degeneration and other retinal diseases in humans." In recent years, induced pluripotent stem cells (iPSCs) have generated a great deal of interest as a potentially unlimited source of various cell types for transplantation. This approach involves genetically reprogramming skin cells taken from adult donors to an embryonic stem cell-like state and then converting these immature cells into specialized cell types found in different parts of the body. In a procedure called autologous cell replacement therapy, iPSC-derived cells generated from a patient are transplanted back into that same patient's own body, thereby minimizing the potential for graft rejection by the immune system. However, this approach is costly and not suitable for patients who need grafts immediately. An attractive alternative is allogeneic cell replacement therapy, which involves transplanting iPSC-derived cells generated from one patient into a different patient's body. Although this strategy is less costly and more widely applicable, it raises concerns about the potential for immune rejection of grafts and the need for immunosuppressants, which can increase the risk of cancer and serious infections. There has been an ongoing controversy as to whether the safety and effectiveness of allogeneic cell replacement therapy could be improved through the use of iPSC-derived cells generated from immunologically matched donors. In the new study, Sugita and senior author Masayo Takahashi, who leads the Laboratory for Retinal Regeneration at RIKEN, directly addressed this controversy, focusing on retinal pigment epithelial cells. The researchers transplanted iPSC-derived retinal pigment epithelial cells generated from donor monkeys into the eyes of recipient monkeys. In some cases, the donors and recipients were immunologically matched, that is, their cells expressed the same major histocompatibility complex (MHC) proteins; in other cases, the grafts were mismatched, signaling to the immune system that a foreign substance was present in the body. Transplantation of MHC-mismatched grafts produced retinal tissue damage and clear signs of immune rejection. In contrast, MHC-matched grafts produced no signs of immune rejection and survived until the final evaluation six months after the procedure, even though no immunosuppressants were used. "I was surprised that the immune system of recipients rejected grafts from mismatched donors, since retinal pigment epithelial cells are able to suppress the activation of inflammatory cells," Sugita says. "However, our results clearly demonstrate that the transplanted grafts do not survive because of the immune attacks." In a related study, the researchers provided a molecular explanation for these findings. Human iPSC-derived retinal pigment epithelial cells activate MHC-mismatched human T cells, but not immunologically matched human T cells. One major limitation of the new research is that the monkeys used were not disease models. The researchers are currently developing animal models of age-related macular degeneration to determine how they respond to transplantation of iPSC-derived cells from matched donors. In addition to preclinical studies, the researchers are planning clinical protocols for the transplantation of iPSC-derived retinal pigment epithelial cells in MHC-matched patients with age-related macular degeneration. "We are hopeful that this approach will prevent immune rejection, prolong graft survival, and improve quality of life for many patients with ocular diseases," Sugita says.


News Article | November 15, 2016
Site: www.sciencedaily.com

Some animals can enter a hibernation-like state called daily torpor that reduces the amount of energy needed to survive when food is unavailable. Using a combination of experimental data and mathematical modeling, researchers at the RIKEN Center for Developmental Biology have determined that the largest factor that contributes to daily torpor is reduced sensitivity of the thermoregulatory system. Published in Scientific Reports, the study shows that during daily torpor, the body's compensatory response to lowered temperature is much less than during normal active periods. Depending on environmental conditions and the availability of food, many animals can slow down their metabolism to save energy. For some animals, this hypometabolism takes the form of seasonal hibernation, which can last weeks to months. Perhaps less well-known, other animals can enter a state called daily torpor in which metabolism is dramatically reduced from several minutes to a few hours. "While hibernation is associated with the winter season and cold temperatures," notes first author Genshiro Sunagawa, "we were surprised to discover that instances of daily torpor could be induced at temperatures as high as 24°C (75°F), provided mice did not receive food for 24 hours." Many researchers believe that the mechanisms underlying hibernation and daily torpor overlap to some extent, but daily torpor in particular is still not well understood because the available time for taking measurements is usually very small. Sunagawa and team leader Masayo Takahashi developed a system that can automatically record the metabolic activity and body temperature of mice and identify periods of daily torpor. This method uses values provided by a mouse's own measurements over a single day to model the expected levels of oxygen consumption and body temperature when the mouse is fully active. The scientists could then detect instances of daily torpor throughout subsequent days as the times when the actual measurements fell below these expected values. This new individualized system outperformed other methods and overcomes the difficulties that arise from variation between individuals and species. Scientists agree that three factors influence the regulation of body temperature during hibernation. The first is the ease with which the body loses heat, the second is the reference temperature, and the third is the sensitivity of temperature regulation. Similar to how a thermostat controls the air conditioning in your house, when body temperature gets too low, negative feedback tells the body to raise the temperature. However, if the sensitivity of the system is reduced, a similar drop in temperature will not trigger the response, and temperatures will continue to drop. Both the reference temperature and thermoregulatory sensitivity have been shown to drop substantially in hibernation. In contrast, Sunagawa used another mathematical model to show that the major factor affecting daily torpor is reduced sensitivity of the heat producing system. While the reference temperature was only about 10% lower during torpor, the sensitivity of the system dropped by about 92%. The authors speculate that the difference between daily torpor and hibernation is likely due to the speed at which the animals need to enter and come out of the different states. Because mice enter and come out of daily torpor within hours, the reference temperature cannot drop as much as it does in hibernation. According to Sunagawa, "these findings will help propel research in hypometabolism because it shows that torpid animals share similar mechanisms with hibernators in heat production regulation. This will justify investigating mice as a model animal for active hypometabolism." When animals enter torpor, they greatly reduce oxygen consumption. Understanding how this process works could have implications for human medicine. As Sunagawa explains, "in the long term, this small study is going to be the big first step for next-generation hypometabolism medicine. Simplification of general anesthesia and preventing excessive damage after stroke are easy-to-imagine applications of artificial hypometabolism. Additionally, when regenerative medicine becomes a reality, it will aid in stocking tissues safely and efficiently before transplantation."


News Article | September 19, 2016
Site: www.gizmag.com

In research that could significantly improve the viability of human retinal cell transplant methods and help restore eyesight in patients with diseases such as macular degeneration, a team at Japan's RIKEN Center for Developmental Biology (CDB) has used a genetic matching technique to overcome the problems of rejection and the use of immunosuppressant drugs when transplanting retinal pigment cells derived from the stem cells of one monkey into the eyes of other monkeys. Whilst a great deal of promise is shown in the reprogramming of adult human cells into stem cells which can then be used to grow into any number of new and different cells, rejection of cells not taken from the original recipient means that immune-suppressing drugs or a lot of expensive, time-consuming cell matching and manipulation techniques are required. To avoid tissue rejection problems after implantation, it's possible to grow retinal pigment cells from induced pluripotent stem cells (iPSCs) created using the patient's own skin cells. However, producing iPSCs in this way is both costly and very slow as the cells grow at the same rate as they do normally in the body, which means a patient can face a wait of a year or more before the cells are ready for transplantation. "In order to make iPSC transplantation a practical reality, the current goal is to create banks of iPSC-derived tissues that can be transplanted into anyone as they are needed," said Dr. Sunao Sugita of RIKEN. "However, immune responses and tissue rejection are big issues to overcome when transplanting tissue derived from other individuals." The new RIKEN research uses a technique known as Major histocompatibility complex (MHC) matching. MHCs are a collection of proteins found on the surface of a cell that play a particular role in cell recognition in the immune system. Also known as human leukocyte antigens (HLAs) in people, genetic variations of these proteins mean that often only the MHCs particular to the original cells will be recognized by the T cells of the host immune system, meaning that any other transplanted cells with different MHCs will be rejected. To test their assumptions on MHC matching, the RIKEN team employed matched retinal pigment cells cultivated from monkey iPSCs in the Kyoto University iPS Cell Research and Application cell bank. These cells were transplanted into the subretinal space (generally between the retina and the retinal pigment epithelium) of monkeys that were either matched or not matched genetically with the MHCs present. In the MHC-matched monkeys, the team found that the transplanted cells remained viable and without rejection for at least six months, and without the need of immunosuppressant drugs. Further examination in the laboratory of the MHC-matched cells showed that immune system T cells recognized the iPSC-derived retinal pigment cells and did not reject them. In the MHC-mismatched monkeys, examination revealed only inflammatory cells and a subsequent failure of the transplanted grafts. It is this stability of tenure in situ without the need for immunosuppressants that makes the RIKEN research such an important step toward curing age-related blindness caused by macular degeneration. Other methods, such as optogenetic therapy also show promise in this area, but they can be slow and difficult; a bank of MHC-matched IPSCs readily available to be transplanted, on the other hand, would be a boon to a greater percentage of the population. The RIKEN researchers have also observed similar results in concurrently run research where they replicated the laboratory (in vitro) experiments with HLA-matched or unmatched retinal pigment cells and human T cells, and they have already begun a clinical transplant trial involving patients with age-related macular degeneration. "Now that we have established the lack of immune response in monkeys and in human cells in vitro, using the iPS cell bank appears to be a viable solution, at least in the case of retinal pigment epithelial cell transplantation," said Dr Sugita. "In the next clinical trial we plan to use allogeneic iPS-retinal pigment epithelial cells from HLA homozygote donors. The clinical data after the transplantation will allow us to see if the iPS cell bank is truly useful or not. If so, I think this type of transplantation can become standard treatment within five years."


News Article | April 2, 2016
Site: news.yahoo.com

In a lab in Japan, researchers have grown complex skin tissue, complete with hair follicles and sweat glands, according to a new study. The researchers implanted the tissue into living mice, and found that the tissue formed connections with the animals' nerves and muscle fibers. The findings may one day help researchers create better skin transplants for human patients with severe burns or skin diseases. Prior to the new study, researchers had already developed a more basic type of skin substitute that had been used successfully in human patients, said Takashi Tsuji, a team leader at RIKEN Center for Developmental Biology in Japan. But that skin had only one or two layers of tissue, and lacked features such as hair follicles and the glands that secrete sweat and oil called sebum, he said. In the new research, the scientists generated skin that had not only those features but also all three layers of tissue that normal skin has. [5 Ways Skin Can Signal Health Problems] The work began with cells collected from mouse gums. The researchers used chemicals to transform these cells into cells that were similar to stem cells. Then, the researchers used these cells to generate three-layered, fully functioning skin tissue in lab dishes. Then, they transplanted this tissue, complete with hair follicles and glands that produce sebum, into mice. The researchers found that the tissue made normal connections with surrounding nerves and muscle tissues in the mice, and those connections allowed the tissue to function normally. The mice's immune systems did not reject the transplanted tissues. Moreover, 14 days after the tissue had been transplanted, the researchers noticed that hair had sprouted from the bioengineered hair follicles and started to grow. [Top 3 Techniques for Creating Organs in the Lab] "Our present outcomes indicate a proof of concept of regenerative therapy of [a] fully functional and integrated skin organ system that will have a potential for the application of the future clinical treatment," Tsuji told Live Science. However, the researchers noted that, to generate human tissue for use in people, they would have to start with human cells, and would still have to figure out how to grow skin tissue from those cells, the researchers said. Besides its potential application in human patients, the newly developed skin tissue also could be used as an alternative to testing cosmetics on animals, the researchers said. The researchers are currently trying to generate other organs that are associated with skin tissue, such as teeth and salivary glands, Tsuji said. The new study was published today (April 1) in the journal Science Advances. Copyright 2016 LiveScience, a Purch company. All rights reserved. This material may not be published, broadcast, rewritten or redistributed.


News Article | September 22, 2016
Site: www.rdmag.com

Stem cell-based transplantation approaches hold great potential for treating a wide range of eye diseases, but progress has been limited by concerns about cost, safety, and effectiveness. In two related studies published Sept. 15 inStem Cell Reports, the journal of the International Society for Stem Cell Research (ISSCR), scientists in Japan overcame a part of these concerns by demonstrating the successful transplantation of stem cell-derived retinal cells generated from immunologically matched donor animals without the need for harmful immunosuppressants. "Our findings address a major controversy in the stem cell transplantation field by showing that retinal cell grafts are attacked by the immune system if the donor and recipient are not immune-matched, and that matching prevents immune attacks against the grafts without the need for immunosuppressants," says first author Sunao Sugita of the RIKEN Center for Developmental Biology. "This approach could potentially be used to treat age-related macular degeneration and other retinal diseases in humans." In recent years, induced pluripotent stem cells (iPSCs) have generated a great deal of interest as a potentially unlimited source of various cell types for transplantation. This approach involves genetically reprogramming skin cells taken from adult donors to an embryonic stem cell-like state and then converting these immature cells into specialized cell types found in different parts of the body. In a procedure called autologous cell replacement therapy, iPSC-derived cells generated from a patient are transplanted back into that same patient's own body, thereby minimizing the potential for graft rejection by the immune system. However, this approach is costly and not suitable for patients who need grafts immediately. An attractive alternative is allogeneic cell replacement therapy, which involves transplanting iPSC-derived cells generated from one patient into a different patient's body. Although this strategy is less costly and more widely applicable, it raises concerns about the potential for immune rejection of grafts and the need for immunosuppressants, which can increase the risk of cancer and serious infections. There has been an ongoing controversy as to whether the safety and effectiveness of allogeneic cell replacement therapy could be improved through the use of iPSC-derived cells generated from immunologically matched donors. In the new study, Sugita and senior author Masayo Takahashi, who leads the Laboratory for Retinal Regeneration at RIKEN, directly addressed this controversy, focusing on retinal pigment epithelial cells. The researchers transplanted iPSC-derived retinal pigment epithelial cells generated from donor monkeys into the eyes of recipient monkeys. In some cases, the donors and recipients were immunologically matched, that is, their cells expressed the same major histocompatibility complex (MHC) proteins; in other cases, the grafts were mismatched, signaling to the immune system that a foreign substance was present in the body. Transplantation of MHC-mismatched grafts produced retinal tissue damage and clear signs of immune rejection. In contrast, MHC-matched grafts produced no signs of immune rejection and survived until the final evaluation six months after the procedure, even though no immunosuppressants were used. "I was surprised that the immune system of recipients rejected grafts from mismatched donors, since retinal pigment epithelial cells are able to suppress the activation of inflammatory cells," Sugita says. "However, our results clearly demonstrate that the transplanted grafts do not survive because of the immune attacks." In a related study, the researchers provided a molecular explanation for these findings. Human iPSC-derived retinal pigment epithelial cells activate MHC-mismatched human T cells, but not immunologically matched human T cells. One major limitation of the new research is that the monkeys used were not disease models. The researchers are currently developing animal models of age-related macular degeneration to determine how they respond to transplantation of iPSC-derived cells from matched donors. In addition to preclinical studies, the researchers are planning clinical protocols for the transplantation of iPSC-derived retinal pigment epithelial cells in MHC-matched patients with age-related macular degeneration. "We are hopeful that this approach will prevent immune rejection, prolong graft survival, and improve quality of life for many patients with ocular diseases," Sugita says.


News Article | November 15, 2016
Site: www.eurekalert.org

Some animals can enter a hibernation-like state called daily torpor that reduces the amount of energy needed to survive when food is unavailable. Using a combination of experimental data and mathematical modeling, researchers at the RIKEN Center for Developmental Biology have determined that the largest factor that contributes to daily torpor is reduced sensitivity of the thermoregulatory system. Published in Scientific Reports, the study shows that during daily torpor, the body's compensatory response to lowered temperature is much less than during normal active periods. Depending on environmental conditions and the availability of food, many animals can slow down their metabolism to save energy. For some animals, this hypometabolism takes the form of seasonal hibernation, which can last weeks to months. Perhaps less well-known, other animals can enter a state called daily torpor in which metabolism is dramatically reduced from several minutes to a few hours. "While hibernation is associated with the winter season and cold temperatures," notes first author Genshiro Sunagawa, "we were surprised to discover that instances of daily torpor could be induced at temperatures as high as 24°C (75°F), provided mice did not receive food for 24 hours." Many researchers believe that the mechanisms underlying hibernation and daily torpor overlap to some extent, but daily torpor in particular is still not well understood because the available time for taking measurements is usually very small. Sunagawa and team leader Masayo Takahashi developed a system that can automatically record the metabolic activity and body temperature of mice and identify periods of daily torpor. This method uses values provided by a mouse's own measurements over a single day to model the expected levels of oxygen consumption and body temperature when the mouse is fully active. The scientists could then detect instances of daily torpor throughout subsequent days as the times when the actual measurements fell below these expected values. This new individualized system outperformed other methods and overcomes the difficulties that arise from variation between individuals and species. Scientists agree that three factors influence the regulation of body temperature during hibernation. The first is the ease with which the body loses heat, the second is the reference temperature, and the third is the sensitivity of temperature regulation. Similar to how a thermostat controls the air conditioning in your house, when body temperature gets too low, negative feedback tells the body to raise the temperature. However, if the sensitivity of the system is reduced, a similar drop in temperature will not trigger the response, and temperatures will continue to drop. Both the reference temperature and thermoregulatory sensitivity have been shown to drop substantially in hibernation. In contrast, Sunagawa used another mathematical model to show that the major factor affecting daily torpor is reduced sensitivity of the heat producing system. While the reference temperature was only about 10% lower during torpor, the sensitivity of the system dropped by about 92%. The authors speculate that the difference between daily torpor and hibernation is likely due to the speed at which the animals need to enter and come out of the different states. Because mice enter and come out of daily torpor within hours, the reference temperature cannot drop as much as it does in hibernation. According to Sunagawa, "these findings will help propel research in hypometabolism because it shows that torpid animals share similar mechanisms with hibernators in heat production regulation. This will justify investigating mice as a model animal for active hypometabolism." When animals enter torpor, they greatly reduce oxygen consumption. Understanding how this process works could have implications for human medicine. As Sunagawa explains, "in the long term, this small study is going to be the big first step for next-generation hypometabolism medicine. Simplification of general anesthesia and preventing excessive damage after stroke are easy-to-imagine applications of artificial hypometabolism. Additionally, when regenerative medicine becomes a reality, it will aid in stocking tissues safely and efficiently before transplantation." Reference: Sunagawa GA, Takahashi M (2016). Hypometabolism during daily torpor in mice is dominated by reduction in the sensitivity of the thermoregulatory system. Scientific Reports. doi: 10.1038/srep37011

Loading Center for Developmental Biology collaborators
Loading Center for Developmental Biology collaborators