Entity

Time filter

Source Type

CCA
Porto Alegre, Brazil

News Article | November 18, 2015
Site: http://www.techtimes.com/rss/sections/auto.xml

A Range Rover once belonged to England footballer David Beckham goes up on sale next month. This 2007 Range Rover of the renowned football star is going to be part of the Classic Car Auctions (CCA) sales which is slated to kick off on Dec. 5 at the Warwickshire Exhibition Center in the UK "This amazing personalised Range Rover with its impeccable provenance offers a unique future investment opportunity," said Arwel Richards, a CCA Classic car expert. "David Beckham is arguably one of the most famous personalities on earth, and certainly a titan of sport." Richards added that he is looking forward to a great excitement around the sale, taking into consideration that latest sales of celebrity-owned vehicles have far surpassed the actual market values. This car was customized by Kahn Conversions at a whopping price of £100,000 or around $151,970. It is expected to fetch no less than five figures, between £23,000 ($34,959) and £25,000 ($38,000). This car is painted in black, which is Beckham's much-loved color. It comes equipped with a 4.2-liter supercharged V8 petrol engine. It likewise sports a black five-spoke alloy wheels and a specialist Kahn body kit. What makes this custom Range Rover far more fascinating can be found within the auto: a "Designed for David Beckham" plaque. Additionally, it rocks twin rear screens, a bespoke Genesis sound system and hand-stitched quilted leather seats on the inside. The car's floor mats are also stitched with Beckham's name. Furthermore, a PlayStation at the back is additionally offered to keep the kids entertained for several hours. Beckham is listed as the very first owner of the car which has already notched 62,000 miles. Beckham's name is on the V5C certificate, so anybody is confident that he really owned and drove it. The history file of the car incorporates speeding summons in the name of Joanne, David's sister who he eventually gave the car to. Anyone desires to drive and own a supercharged petrol Range Rover. Driving a vehicle which was once owned by this 21st Century icon should indeed be fascinating. Next year, one fortunate buyer will get the chance to drive this Range Rover the Beckham way. Beckham is a former Manchester United, AC Milan, Real Madrid, Paris Saint-Germain and LA Galaxy superstar.


News Article | August 22, 2016
Site: http://www.renewableenergyworld.com

In most states, a city wanting to change its energy future has two options: beg its utility or form its own. But one state-level policy opens a third way for cities to have more choice over their energy options: community choice aggregation (CCA).


News Article | April 5, 2016
Site: http://cleantechnica.com

New York State’s first community choice aggregation (community owned utility) under Governor Cuomo’s watch, is now expected to start supplying customers with electricity on May 1, 2016. The number of participating Sustainable Westcher communities has grown to 20. A number of these have opted to use a normal blend (brown) as their default electricity but 14 Westchester communities opted for 100% green energy as a default. According to Sustainable Westchester Co-Chair Mike Gordon, those 14 communities did not base their choice on the idea “green is the right thing to do,” as the green option was also smarter from a business perspective. “Any contract that you go with, whether it is standard or renewable, it’s fixed. It is a fixed price over the course of the contract and that fixed price is slightly lower if it is brown, or standard mix, however a feature of the contract allows us to either develop contracts and deals with renewable power plants, or to actually finance the development of a new renewable power plant,” he said. “We have the flexibility, over the course of this contract period, to say to the supplier, ‘Hey supplier, You’ve already bought all the energy to fill out this contract, however we have identified another power plant that we want you to buy from. That power plant is telling us that it is costing us let’s say 6 cents a kilowatt hour (kWh) to buy from them and we want you to take that to 6 cents a kWh.” As the supplier has to take this new contract, he may have to sell the electricity he would have used on the open market. “If we don’t like the price they are getting, we’ll go find someone else to give them a better price. If they make money on that deal, 100% of that money goes back to our consumers.” As the current glut will come to an end someday, the “embedded option” in this contract could allow Sustainable Westchester to make a profit. “We could be financing the development and introduction of renewable energy into our portfolio at a profit,” speculated Gordon. When Sustainable Westchester goes online May 1, the following communities will be using green energy as their default power: There are also seven Westchester communities that opted for a basic (brown) default mix: At this point, Sustainable Westchester’s CCA will be starting up with 113,600  customers. 94,600 of them will be in ConEd territory, and the remainder are serviced by New York State Electric and Gas Corporation (NYSEG). Approximately 75,000 of these will be “100% green default customers” unless they choose to opt out. Photo Credit: Mamaroneck, New York by WalkingGeek via Flickr (CC BY SA, 2.0 License)    Get CleanTechnica’s 1st (completely free) electric car report → “Electric Cars: What Early Adopters & First Followers Want.”   Come attend CleanTechnica’s 1st “Cleantech Revolution Tour” event → in Berlin, Germany, April 9–10.   Keep up to date with all the hottest cleantech news by subscribing to our (free) cleantech newsletter, or keep an eye on sector-specific news by getting our (also free) solar energy newsletter, electric vehicle newsletter, or wind energy newsletter.  


News Article
Site: http://www.nature.com/nature/current_issue/

Mice were bred in specified-pathogen-free facilities at the University Hospital Zurich and Washington University, and housed in groups of 3–5, under a 12 h light/12 h dark cycle (from 7 a.m. to 7 p.m.) at 21 ± 1 °C, with sterilized chow food (Kliba No. 3431, Provimi Kliba) and water ad libitum. Animal care and experimental protocols were in accordance with the Swiss Animal Protection Law, and approved by the Veterinary Office of the Canton of Zurich (permits 123, 130/2008, 41/2012 and 90/2013). The following mice were used in the present study: C57BL/6J, PrnpZH1/ZH1 (ref. 3), co-isogenic C57BL/6J PrnpZH3/ZH3 and PrnpWT/WT control mice6 and Schwann cell-specifc DhhCre::Gpr126fl/fl mutants3, 4. Mice of both genders were used for experiments unless specified. Archival tissues from previous studies1, 6 were also analysed in the current study. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment except where stated. Sciatic nerves from postnatal day 2–5 were dissected using microsurgical techniques. Nerves were dissociated in serum-free DMEM supplemented with 0.05% collagenase IV (Worthington) for 1 h in the incubator. Sciatic nerves were mechanically dissociated using fire-polished Pasteur pipettes. Cells were filtered in a 40-μM cell strainer and washed in Schwann cell culture medium (DMEM, Pen-Strep, Glutamax, FBS 10%) by centrifugation at 300g for 10 min. Resuspended cells were plated on 3.5 cm Petri dishes previously coated with poly-l-lysine 0.01% (w/v) and laminin (1 mg/ml). Laminin (Cat. No: L2020; from Engelbreth-Holm-Swarm murine sarcoma basement membrane) and poly- l-lysine were obtained from Sigma-Aldrich. Full-length recombinant PrP (recPrP, residues 23–231) and globular domain (GD, residues 121–231) were purified as previously described21, 22, 23. The generation of the GST fusion FT-PrP expression vector (pGEX-KG FT-PrP) was described previously; a modified purification protocol was used24. The FT-PrP expression vector was transformed into BL21 (DE3) strain of Escherichia coli (Invitrogen). Bacteria were grown in Luria-Bertani medium to an OD of 0.6, and the expression of the fusion protein was induced with 0.5 mM isopropyl-1-thio-β-d-galactopyranoside (AppliChem). Cells were then grown for another 4 h at 37 °C and 100 rpm shaking. Cells were pelleted at 5,000g for 20 min at 4 °C (Sorvall centrifuge, DuPont). The pellet was resuspended on ice in lysis buffer (phosphate-buffered saline supplemented with complete protease inhibitors (EDTA-free, Roche), phenylmethyl sulfonyl fluoride (Sigma) and 150 μM lysozyme (Sigma)) and incubated on ice for 30 min. Triton-X 100 (1%), MgCl (10 mM) and DNase I (5 μg/ml, Roche) were added, and the lysate was incubated on ice for 30 min. The lysate was than centrifuged for 20 min at 10,000g at 4 °C. Glutathione sepharose beads were washed with PBS and incubated with the cell lysate for 1 h at 4 °C on a rotating device. Beads were packed into a column and washed with PBS until a stable baseline was reached as monitored by absorbance at A using an ÄKTAprime (GE healthcare). The fusion protein was cleaved on the beads with 5 U/ml Thrombin (GE Healthcare) for 1 h at room temperature under agitation. For thrombin removal, benzamidine sepharose beads were added and incubated for 1 h at 4 °C on a rotating wheel. Protein preparations were analysed by 12% NuPAGE gels followed by Coomassie- or silver-staining. To achieve a higher purity of the protein, we next applied the protein to a sulfopropyl (SP) sepharose column equilibrated with 50 mM Tris-HCl buffer, pH 8.5. Elution was performed with a linear NaCl gradient of 0–1,000 mM. Fractions containing the protein were collected and concentrated (AMICON; MWCO 3500). The protein was then injected in 500 μl portions into a size-exclusion chromatography system (TSK-GEL G2000SW column (Tosoh Bioscience)) and eluted with a linear gradient using PBS. Pure fractions were combined, concentrated and stored at −20 °C. The purity of FT-PrP was >95–98% as judged by a silver-stained 12% NuPAGE gel. SW10 cells and clones derived from them were all grown in DMEM medium supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin and Glutamax (all obtained from Invitrogen). HEK293T cells, its clonal variant HEK293(H) cells and clones derived therefrom overexpressing various GPCRs were grown in DMEM-F12 medium supplemented with 10% FCS, penicillin-streptomycin and Glutamax (all obtained from Invitrogen). All cell lines were regularly monitored for mycoplasma contamination. The authenticity of SW10 and its derivatives was established by monitoring the expression of Schwann-cell specific markers (Extended Data Fig. 6a). Human Gpr126 (NM_020455), Gpr124, Gpr64, Gpr56, Gpr133, Gpr56 and Gpr176 expression plasmids (pCGpr126-V5, pCGpr124-V5, pCGpr65-V5, pCGpr56-V5, pCGpr133-V5, pCGpr56-V5 and pCGpr176-V5) were generated by PCR amplification of the respective cDNA followed by TOPO cloning into the pCDNA3.1/V5-His-TOPO vector. The cDNA was in frame with the V5 tag (sequence: GKPIPNPLLGLDST) at the C terminus. HEKGPR126 and HEKGPR176 cells were generated by transfecting 1 μg of plasmid into one well of a subconfluent 6-well plate using 3 μl Fugene (Roche) according to the manufacturer’s protocol. Twenty-four hours after transfection, cells were transferred to a 10-cm dish and grown in selective medium containing 0.4 mg/ml G418 (Invitrogen) until emergence of resistant colonies. A limiting dilution was carried out to obtain clonal lines. Membrane expression of the transgene was assessed in the selected clones by confocal microscopy using 1:100 diluted anti-V5 antibody (Invitrogen) and the Cytofix/Cytoperm kit (Pharmingen Cat. Nr. 554714), according to the manufacturer’s protocol. Cerebellar granule neurons were generated from 7–8-day-old PrnpZH1/ZH1 mice as described previously25. Cultures were plated at 350,000 cells per cm2 in Basal Medium Eagle (BME) (Invitrogen) with 10% (v/v) FCS and maintained at 37 °C in 5% CO . pCDNA-PrPC was generated by cloning murine PrPC into pCDNA3.1 vector as described previously26. A site-specific mutagenesis kit (Stratagene) was used to induce alanine substitutions of QPSPG and KKRPK domains in PrPC. Primers used for generating the Ala-QPSPG plasmid were: forward, GTG GAA GCC GGT ATC CCG GGG CGG CAG CCG CTG CAG GCA ACC GTT ACC C; reverse, GGG TAA CGG TTG CCT GCA GCG GCT GCC GCC CCG GGA TAC CGG CTT CCA C. Primers for Ala-KKRPK were: forward, CTA TGT GGA CTG ATG TCG GCC TCT GCG CAG CGG CGC CAG CGC CTG GAG GGT GGA ACA CCG; reverse, CGG TGT TCC ACC CTC CAG GCG CTG GCG CCG CTG CGC AGA GGC CGA CAT CAG TCC ACA TAG. Transfections were performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. 3 μg of DNA was used per well of a 6-well plate. Cells were washed 24 h after transfection using PBS, and fresh medium was added to the cells. HEK293T and HEKGPR126 cells growing in T75 flasks at 50% density were treated with recombinant FT or GD (2 μM, 20 min). Cells were washed twice in PBS and lysed in IP buffer: 1% Triton X-100 in PBS, 1× protease inhibitors (Roche) and Phospho stop (Roche) for 20 min on ice followed by centrifugation at 5000 rpm for 5 min at 4 °C. BCA assays were performed to quantify the amount of protein, and 500 μg of protein was used for immunoprecipitations. 2 μg anti-V5 antibody was added to the cell lysate and incubated on a wheel rotator overnight at 4 °C. On the following day, Protein G dynabeads (Invitrogen) were added to the samples and incubated for a further 3 h on the wheel at 4 °C. Beads were washed three times for 5 min each using the IP buffer followed by addition of 2× sample buffer containing DTT (1 mM final). Samples were heated at 95 °C for 5 min, loaded on 4–12% Novex Bis-tris gels (Invitrogen), and migrated for 1.5 h at 150 V followed by western blotting. Immunoprecipitations were performed by adding 2 μg of POM2 antibody to 500 μl of cell medium and incubating overnight on a wheel rotator at 4 °C. Protein G beads were then added, and incubation on a wheel rotator at 4 °C was performed again. RNA extraction and quantitative PCR were performed as described previously1. The following primers were used: EGR2 forward: 5′-AATGGCTTGGGACTGACTTG-3′; EGR2 reverse: 5′-GCCAGAGAAACCTCCATT-3′; GAPDH forward: 5′-CCACCCCAGCAAGGAGAC-3′; GAPDH reverse: 5′-GAAATTGTGAGGGAGATGCT-3′. Adult zebrafish were maintained in the Washington University Zebrafish Consortium facility ( http://zebrafishfacility.wustl.edu/) and all experiments were performed in compliance with institutional protocols. Embryos were collected from harem matings or in vitro fertilization, raised at 28.5 °C, and staged according to standard protocols27. The gpr126st49 and gpr126st63 mutants were described previously7, 8. gpr126st63 or gpr126st49 mutants were collected from homozygous mutant crosses and wild-type larvae were collected from AB* strain crosses and raised to 50 hpf. FT treatment of gpr126 mutants was performed as previously described15. Briefly, egg water was replaced with either 20 μM FT in egg water or egg water containing an equivalent volume of DMSO. At 55 hpf, larvae were washed twice and raised in egg water to 5 dpf. Wild-type and gpr126 larvae were fixed in 2% paraformaldehyde plus 1% tricholoroacetic acid in phosphate buffered saline, and Mbp and acetylated tubulin immunostaining was performed as described previously8, 28. Expression scoring was performed with observers blinded to treatment according to the following rubric: strong, strong and consistent expression throughout PLLn; some, weak but consistent expression in PLLn; weak, weak and patchy expression in PLLn; none, no expression in PLLn. n = three independent replicate gpr126st63 assays and one gpr126st49 assay. n = 87 DMSO-treated gpr126st63 larvae, 81 Prp-FT-treated gpr126st63 larvae, 27 DMSO-treated gpr126st49 larvae, 25 Prp-FT-treated gpr126st49 larvae. Fluorescent nerve images were analysed using the Fiji software29. A rectangular region-of-interest (ROI) was drawn longitudinally over the fluorescent nerve. The longitudinal grey-scale histogram of the myelin basic protein (Mbp) was normalized pixel-by-pixel to the corresponding intensity of the acetylated tubulin (AcTub). The size of the measured ROIs was kept constant across different treatment modalities. SW10 cells were grown in P75 flasks at 50% density, rinsed with PBS, and detached from culture flasks with dissociation buffer containing EDTA (GIBCO). After detaching, cells were washed to remove residual EDTA and counted using a Neubauer chamber. Batches of 105 SW10 cells were transferred to FACS tubes, treated with HA-tagged recombinant peptides for 20 min, washed, and incubated with Alexa-488 conjugated anti-HA antibody for 30 min. After further washes and centrifugations, cells were resuspended in 200 μl FACS buffer (PBS +10% FBS) and analysed with a FACS Canto II cytofluorimeter (BD Biosciences). Data were analysed using FloJo software. Schwann cells were lysed in cell-lysis buffer (Tris-HCl 20 mM, NaCl 137 mM, Triton-X-100 1%) supplemented with protease inhibitor cocktail (Roche complete mini). The lysate was homogenized by passing several times through a 26G syringe, and cleared by centrifugation at 8,000g, 4 °C for 2 min. in a tabletop centrifuge (Eppendorf 5415R). Protein concentration was measured with the BCA assay (Thermo Scientific). 10 μg total protein was boiled in 4 × LDS (Invitrogen) at 95 °C for 5 min. After a short centrifugation, samples were loaded on a gradient of 4–12% Novex Bis-Tris Gel (Invitrogen) for electrophoresis at constant voltage of 200 V. Gels were transferred to PVDF membranes with the iBlot system (Life technologies). Membranes were blocked with 5% Top-Block (Sigma) in PBS-T for 1h at room temperature. Primary antibody was incubated overnight in PBS-T with 5% Top-Block. Membranes were washed three times with PBS-T for 10 min and incubated for 1 h with secondary antibodies coupled to horseradish peroxidase at room temperature. After three washes with PBS-T, the membranes were developed with a Crescendo chemiluminescence substrate system (Millipore). Signals were detected using a Stella 3200 imaging system (Raytest). Monoclonal antibodies against PrPC were obtained and used as described previously4. Fab3 and Fab71 antibodies were generated using the phage display technology and their epitopes were mapped with overlapping peptides. Anti AKT, p-AKT were obtained from Cell signaling and used at 1:2,000 dilutions for western blotting. The anti-p75NGF receptor antibody was obtained from Abcam and used at a 1:200 dilution for immunofluorescence. Anti V5 antibody was from Invitrogen and used at a dilution of 1:500 for western blot and 2 μg antibody was used for immunoprecipitation on 500 μg of cell lysate. In the direct cAMP ELISA assay, cAMP levels were assessed with a colorimetric competitive immunoassay (Enzo Life Sciences). Quantitative determination of intracellular cAMP was performed in cells or tissues lysed in 0.1 M HCl to stop endogenous phosphodiesterase activity and to stabilize the released cAMP. SW10 or HEK293T cells (100,000 cells per well) were plated in 6-well plates to ~50% density. Cells were treated with conditioned medium or recombinant peptides (2 μM, unless specified) for 20 min unless otherwise mentioned. Cells were lysed with 0.1 M HCl lysis buffer (Direct cAMP ELISA kit, Enzo). To ensure complete detachment of cells, cell scrapers were used. Lysates were homogenized with a 26G needle and syringe before clearing by centrifugation at 600g for 10 min. The subsequent steps were performed according to the manufacturer’s protocol based on competition of sample cAMP with a cAMP-alkaline phosphatase conjugate. To measure in vivo cAMP changes, BL6, PrnpZH3/ZH3 or PrnpZH1/ZH1 mice were intravenously injected with 600 μg of either FT or, as a control, uncharged FT ( ). Twenty minutes after infusion, mice were killed and all organs were collected. For cAMP assays, organs were homogenized in 0.1 M HCl. Subsequent steps were performed according to the manufacturer’s protocols as described above. Cyclic AMP levels were calculated using a cAMP standard curve in the case of ELISA based assay. Finally, cAMP concentrations were normalized to total protein content in each sample. cAMP changes are represented as fold changes to the respective controls. For each experiment, at least three independent biological replicates were used. For in vivo assays, groups of 8–16 mice were used for each experiment. For normalization purposes, the median value of the respective control sample was defined as 1. All measurements within each panel were normalized to this control value. For in vivo assays, sample sets were coded and investigators were blinded to their identities. The assignment of codes to sample identities was performed only after the cAMP values were plotted for each set. We designed two CRISPR short-guide RNA (sgRNAs) against exon 2 of Gpr126 (upper Guide CCTGTGTTCCTCTCTCAGGT and lower Guide AACAGGAACAGCAGGGCGCT). The DNA sequences corresponding to the sgRNAs were cloned into expression plasmids and transfected with EGFP-expressing Cas9-nickase plasmids. Single EGFP-expressing Schwann cells were isolated with a FACS sorter (Aria III). To determine the exact sequence of indels induced by genome editing, we amplified the sgRNA-targeted locus by PCR and subcloned the fragments into blunt-TOPO vectors. Ten colonies per cell line were sequenced and showed distinct indels on each allele. A clonal subline devoid of Gpr126 was used for further studies. This cell line possessed insertions on both the alleles; a 49-bp insertion at position 118 and a 5-bp insertion at position 84 on each allele. Both insertions led to a frameshift and to the generation of premature stop codons leading to early translation termination. Luciferase reporter constructs were generated containing a 1.3-kB sequence upstream of the transcription-starting site of Egr2. SW10 Schwann cells were transfected with Egr2 reporter construct and a renilla plasmid using lipofectamine 2000. After one day in vitro, Schwann cells were treated with recombinant full-length PrP (23–231), the globular domain of PrP (121–231) or PBS control. Luciferase activity was measured 24 h after stimulation with Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s recommendations. Results were normalized to renilla transfection controls. Glass coverslips were placed in 12-well plates (Thermo Scientific) and coated with 0.01% w/v Poly-l-lysine solution (Sigma) overnight at room temperature. Coverslips were washed three times with ddH O and dried for 2 h in a laminar-flow hood. Schwann cells were seeded and cultured at 50% density. Cells were treated with recombinant FT-PrP, full length recPrP or C1-PrP for 20 min, and washed with serum-free DMEM. Cells were further washed with PBS followed by fixation with 4% paraformaldehyde. Fixed cells were incubated in blocking buffer (PBS+10% FBS) for 1 h. Cells were treated with various primary antibodies followed by washes and incubation with Alexa 488 and Alexa 647 tagged rabbit or mouse secondary antibodies (Life Technologies). Imaging was performed by Leica SP2 confocal microscope using a 20× objective; images were processed by Image J software. Transmission electron microscopy was performed as previously described6. Briefly, mice under deep anaesthesia were subjected to transcardial perfusion with PBS heparin and sciatic nerves were fixed in situ with 2.5% glutaraldehyde plus 2% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 and embedded in Epon. Ultrathin sections were mounted on copper grids coated with Formvar membrane and contrasted with uranyl acetate/lead citrate. Micrographs were acquired using a Hitachi H-7650 electron microscope (Hitachi High-Tech, Japan) operating at 80 kV. Brightness and contrast were adjusted using Photoshop. For quantification of Remak bundles and onion bulb-like structures, images were captured at 1,500× magnification and axon numbers and abnormal onion bulb-like structures were counted manually. Quantification was performed in a blinded fashion by assigning numbers to the images and upon completion of quantification genotypes were revealed. HA-tagged and untagged synthetic peptides were produced by EZ Biosciences. A stock solution of 2 mM was prepared by dissolving the peptides in PBS and they were used at a final concentration of 2 μM unless specified. The sequences of all the peptides used in this study can be found in Extended Data Table 1.


News Article
Site: http://www.greentechmedia.com/articles/category/solar

Pacific Gas & Electric has launched a community solar program that allows customers to get half or all of their electricity from the sun. The program is tailored to customers that can’t or don't want to put solar on their roof -- renters in high-rise buildings, for instance. According to the National Renewable Energy Laboratory, approximately half of U.S. households and businesses are unable to install rooftop solar because of ownership, space or shading limitations. A recent survey found that more than 50 percent of PG&E customers say they want to go solar. The community solar program allows customers to buy solar power from entirely new, locally sourced projects, which is a priority for many Californians. “PG&E’s Solar Choice program is all about giving customers more choice and control over their energy, and bringing the benefits of solar to our communities,” said PG&E Senior Vice President and Chief Customer Officer Laurie Giammona, in a statement. “Our customers already enjoy some of the cleanest power in the country. Now, they can directly contribute to bringing more renewable energy onto the electric grid -- a win for our customers and for California.” To participate in the program, customers have to pay a premium. For residences, it’s an additional 3.58 cents per kilowatt-hour; for small businesses, it’s 2.8 cents per kilowatt-hour; and for large businesses, it’s 2.85 cents per kilowatt-hour. “This makes sure that other ratepayers or other customers who choose not to be part of the program aren’t paying for the program,” said Ari Vanrenen, PG&E spokesperson, in an interview. For typical homeowners who use 500 kilowatt-hours of electricity per month, getting 100 percent of their electricity from solar through the PG&E program would cost an extra $18 per month. PG&E expects there to be strong demand. The California utility has already connected more than 215,000 solar customers to the grid, and anticipates that the Solar Choice program will bring solar to 40,000 additional homes and businesses across the company’s service area. “With Solar Choice, customers can really be the change and decide to put more solar on the electric grid,” said Vanrenen. “Before, they didn’t have that option.” Customers in California do have other options, though, even if they can't put solar on their own roof. Increasingly, they’re turning to community choice aggregation (CCA) programs for cleaner, local, more affordable energy. At least two communities in PG&E territory -- Marin County and Sonoma County -- have already set up CCA programs. Participants in CCA programs contract for their own generation and pay a fee to use the utility’s wires and poles. CCAs take time, upfront capital and a lot of commitment to establish, but so far this option has proven cheaper than the status quo. Geof Syphers, CEO of Sonoma Clean Power, said he was happy to see a solar option from PG&E, but noted that CCA customers in his territory have the ability to support an even greener grid. “The purpose of our agency is to address climate change and provide competitive rates, and PG&E providing another option could help achieve those goals,” he wrote in an email. “Although here in Sonoma County, our customers have a better option with EverGreen, our 100 percent renewable product from Sonoma County sources. By the end of 2016, the mix for EverGreen will be 50/50 geothermal and solar, which matches customer loads 24 hours per day, meaning that EverGreen customers do not rely on natural gas plants to support their use of electricity.” According to Vanrenen, the Solar Choice offering isn’t about competing with CCAs. “With Solar Choice, PG&E is really responding to the desire of many of our customers to have more renewable energy options,” she said. California lawmakers recognized this in passing a community solar bill in 2013, with the aim of delivering 600 megawatts of solar energy customers across the state. Regulators specified that utilities are not allowed to build and own the projects. Other states, including Colorado and Minnesota, have also passed community solar legislation. PG&E put out a request for proposals last year, and has already contracted for an initial eight projects to serve the program totaling 50 megawatts. Selected installers include Western Grid Development, Bakersfield PV I and Mirasol Development. These new projects are under construction and expected to be complete by 2018. In the meantime, PG&E has set aside an interim pool of solar resources to serve Solar Choice customers. None of these projects help PG&E meet its California renewable portfolio requirements, which the state recently increased to 50 percent. The Solar Choice program is capped at 272 megawatts. California’s other two investor-owned utilities, Southern California Edison and San Diego Gas & Electric, are also expected to launch community solar programs this year.

Discover hidden collaborations