Canadian Council on Animal Care

Ottawa, Canada

Canadian Council on Animal Care

Ottawa, Canada
SEARCH FILTERS
Time filter
Source Type

News Article | April 11, 2017
Site: boingboing.net

In a new meta-analysis published in PLOS One, researchers from Purdue, Stanford and the Canadian Council on Animal Care look at the different techniques used to induce laughter in rats in order to improve their wellbeing and capture their laughter, which is delightful. Their conclusion: if you're going to tickle a rat, use the "original" method, developed in 2000 by Jaak Panksepp and Jeff Burgdorf of Bowling Green State University, Ohio, which "mimics rat rough-and-tumble play through contact with the back of the neck and stomach. Each tickling session should last for two minutes, alternating between 15 seconds of rest and 15 seconds of active tickling, with daily sessions for at least five days." Inter-individual differences are one of the most relevant moderators of outcomes of tickling for facility personnel. Rats repeatedly show a large range of 50-kHz vocalizations in response to tickling that impact experimental outcomes. In one study, only high-calling rats showed a positive cognitive bias after tickling [8]; thus low-calling rats may experience tickling differently than high-calling rats. Further investigation is needed to determine if low-calling rats indeed find the tickling intervention positive, neutral, or negative. Since you can also bi-directionally select rats for either a high- or low-calling rate and find similar differences in line bred rats, it seems to indicate these are trait differences. In future studies, we strongly recommend that investigators include calling rate as a continuous covariate in all statistical models and determine the calling rate of control rats after the termination of the experiment. Tickling can be used to determine behavioral traits and subsequently how a trait response to tickling affects response to stress [52]. Selectively bred high-calling rats could also be useful for understanding the importance of playful joy [39]. Tickling rats to investigate the effects of pharmacological substances on positive affect has been used repeatedly. All experiments found differences in 50-kHz vocalizations after application of some substances. One article attempted to use tickling combined with the application of the psychotomimetic drug phencyclidine to model the negative symptoms of schizophrenia, but concluded that it was unclear if this model would be valid or not [53]. Another article successfully concluded that 50-kHz calls in response to tickling were mediated by dopamine release as evidenced by a decrease in calls after application of dopamine agonists [28]. This article was using tickling to model the importance of play behavior during adolescence. Finally, an additional article has used tickling to evaluate calling rates and drug administration to further investigate the effects of trait differences on chronic variable stress as a model of depressions [34]. Overall, tickling is a promising method to evaluate pharmacological compounds designed to improve psychological measures of affect while also considering the individual differences in calling rates. Rat tickling: A systematic review of applications, outcomes, and moderators [Megan R. LaFollette, Marguerite E. O’Haire, Sylvie Cloutier, Whitney B. Blankenberger and Brianna N. Gaskill/PLOS One] What’s the best way to tickle a rat? [Tim Wallace/Cosmos]


News Article | May 23, 2017
Site: www.thefishsite.com

The Center for Aquaculture Technologies Canada (CATC) has received a Certificate of GAP – Good Animal Practice from the Canadian Council on Animal Care (CCAC) for its aquaculture research facility located in Souris, Prince Edward Island. The certificate recognizes the center for the quality of their animal ethics and care in science program. CATC is a full-service contract research and development organization focused on the application of biotechnologies to improve productivity, efficiency and sustainability in aquaculture. Founded in 2012, the company has specific expertise in fish health, nutrition, genomics, and genetics. The Canadian Council on Animal Care (CCAC) is the national peer-review organization responsible for setting, maintaining, and overseeing the implementation of high standards for animal ethics and care in science. Created in 1968, it is an independent, non-profit organization, acting in the interests of the Canadian people. More than 2,000 volunteer experts serve on more than 190 local animal care committees to help fulfill the CCAC’s mandate and deliver its programs in institutions across Canada. The CCAC is committed to continually advancing high standards of animal ethics and care that incorporate the principles of the Three Rs (replacement, reduction, and refinement).


Animals were treated in strict accordance with the guidelines outlined by the Canadian Council on Animal Care (http://www.ccac.ca/), and experiments adhered to protocols approved by the Facility Animal Care Committee of McGill University (protocol no. 1190). Long–Evans rats (80−150 g) and C57/B6 mice (60−90 d) were obtained from Charles River Laboratories. VP-Cre (VP-IRES2-Cre-D) knock-in mice were bred in our colony with either ChETA (R26-CAG-LSL-2XChETA-tdTomato) or ArchT mice (Ai40D; obtained from Jackson Laboratories). V1aR knock-out (V1aR−/−) mice were bred in our colony (obtained from J. N. Crawley)27. All experiments were performed on male animals, except for one experiment (Extended Data Fig. 8) where a female was used. In vitro experiments were performed on mice aged 2−4 months, experiments on rats were done on animals weighing 80−150 g, and in vivo mouse experiments were done on animals aged 2−3 months. Animals were subjected to a strict 12 h:12 h light:dark cycle. C57/B6 mice were individually housed in computer-interfaced metabolic Oxylet cages from PanLab (Harvard Apparatus) to measure water intake. Animals were placed in cages and allowed to habituate to the cages for 4−6 days. To obtain the average circadian profile of water intake, we obtained hourly averages from each subject between ZT6.5 and ZT6.5 on the following day. Data files were analysed using Metabolism (version 2.1.04; PanLab) and Microsoft Excel. Statistical analysis was performed in Sigmaplot (Version 12.3, Systat Software). Since we cannot obtain serial measures of serum osmolality in individual C57/B6 mice, we used a group approach whereby data were collected from multiple (3−18) subjects that were killed at each time point tested. To this end, mice were anaesthetized with isoflurane and rapidly decapitated to obtain blood samples, core body temperature using a digital thermometer, and haematocrit using a ZipCombo Centrifuge from LW Scientific. Blood samples were placed on ice and allowed to clot at 2−4  C for 60 min, after which they were centrifuged for 5 min, and serum osmolality was measured in duplicate using a micro-osmometer (Advanced Instruments). The objective of this experiment (Fig. 1c, d), was to deny the surge in water intake, while preserving water intake levels during the AP equivalent to levels during the BP. Because water intake between ZT21.5 and ZT22.5 is equivalent to water intake between ZT19.5 and ZT21.5 (BP), we allowed water intake to proceed until ZT22.5 before removing access to water. Water was removed from C57/B6 mouse cages at either ZT22.5 (no AP surge allowed) or ZT23.5 (AP surge allowed). Access to water overnight was denied to prevent compensatory drinking and allow a specific evaluation of the impact of the AP surge alone. Animals were then killed at ZT10 and blood samples were collected to measure serum osmolality and haematocrit as explained above. Horizontal hypothalamic slices containing the OVLT and SCN were prepared from 2−4-month-old male ArchT or ChETA mice. These animals were not subjected to any behavioural or optogenetic experiments before slice preparation. Mice anaesthetized with isoflurane were killed by decapitation at ZT18–18.5. The brain was rapidly removed and immersed in near-freezing (0–4 °C) oxygenated (95% O , 5% CO ) artificial mouse cerebrospinal fluid (AMCSF) composed of the following (in mM): 128 NaCl, 3 KCl, 1.23 NaH PO , 1.48 MgCl , 2 CaCl , 25.95 NaHCO and 10 d-glucose (all obtained from Sigma except for NaCl and CaCl , which were purchased from Fisher Scientific). A trimmed block of brain was glued, cortex down with the rostral pole facing upwards, to a mounting block angled at 34° relative to the horizontal plane. A single 350-μm slice was then obtained (Extended Data Fig. 2) and transferred dorsal side up to a beaker containing warmed (32 °C) oxygenated AMCSF and allowed to incubate for 60 min. The slice was then transferred dorsal side up to a recording chamber where it was perfused with warmed (32 °C) oxygenated AMCSF at a rate of 2–3 ml min−1. Cells were observed on a black and white monitor using an Olympus BX51WI upright microscope coupled to a video camera. Electrodes were visually guided to the cell using a motorized micromanipulator (s.d. Instruments) and cell-attached recordings were made using a MultiClamp 700B amplifier (Molecular Devices). Membrane voltage was digitized via a Digidata 1440A interface coupled to a personal computer running Clampex 10.3 software (Molecular Devices). A band-pass filter was applied during cell-attached recordings (800 Hz–1.8 kHz). Patch pipettes were back-filled with AMCSF and their resistance in the bath was 5.5−7.5 MΩ. Cell-attached recordings for firing rates of OVLT neurons during the BP were performed from ZT19.5 to ZT21.5 and during the AP from ZT21.5 to ZT23.5. Cell-attached recordings from OVLT neurons were obtained by making a loose seal. If cells did not fire during the recording, a brief zap of 25 μs was delivered at the end of the recording to evoke firing in order to confirm they were indeed silent cells that were otherwise capable of firing detectable action potentials. The average firing rate was calculated by dividing the total number of spikes recorded by the duration of the recording period (60 s). One cell was excluded from this analysis because its firing rate was more than four times greater than the standard deviation of the group. Evans blue was used to evaluate the boundaries of the OVLT in mice as previously reported for rat28. Briefly, mice were anaesthetized with isoflurane and injected intravenously with 0.2 ml of 1% Evans blue dissolved in PBS. After 15 min, the animals were transcardially perfused with 20 ml PBS, and then the brain was extracted and fixed by immersion for at least 48 h in 4% paraformaldehyde (PFA) dissolved in PBS. Serial sections (50 μm thick) were cut and mounted onto slides, and Evans blue fluorescence was visualized using RS Image (version 1.9.2; Roper Scientific) using a 10× objective (na = 0.4) attached to an Olympus BX51WI upright microscope and a CoolSnap HQ camera (Photometrics). Fluorescence was observed at 700 nm and excited at 650 nm using an X-Cite XLED1 system (Lumen Dynamics, Excelitas Canada) and a BrightLine Pinkel filter set (DA/FI/TR/Cy5-4X-B-OMF; Semrock). C57/B6 mice (60 d) were anaesthetized with isoflurane and stereotaxically injected with FluoSpheres (0.04 μm, yellow-green fluorescent 488 nm, 5% solids, azide free; ThermoFisher Scientific) into the OVLT (100−200 nl; from Bregma with a 7° vertical angle, X: 1.2 mm, Y: 0 mm, Z: −4.6 or −4.7; Extended Data Fig. 3) with a Neuros syringe (0.5 μl, 32 gauge, Hamilton) over 5−10 min. The spheres were allowed to be retrogradely transported for 7 days, after which the animals were anaesthetized with isoflurane and perfused via the heart with 10 ml PBS followed by 300 ml PBS containing 4% PFA. The brains were extracted and postfixed by immersion for 48 h in 4% PFA in PBS. A vibratome was used to obtain serial coronal tissue sections (50 μm thick). Sections were blocked with 10% normal goat serum (in PBS containing 0.3% Triton-X100) and incubated overnight at 4 °C with primary antibodies. Following wash, sections were incubated for 1 h with fluorescently labelled secondary antibodies. Sections were then washed and mounted on coverslips using Prolong Gold Antifade reagent (Life Technologies). All images were acquired using a confocal microscope (FV1000, Olympus Canada). The following primary antibodies were used: PS41 anti-VP neurophysin mouse monoclonal antibody (1:50), and VA4 anti-VP neurophysin rabbit polyclonal antibody (1:1000) developed and contributed by H. Gainer (National Institutes of Health, Bethesda, MD). Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (568 nm and 647 nm; Life Technologies; 1:500). Brains were extracted from wild-type and V1aR−/− mice at ZT21.5–22 (for BP analysis) and ZT23.5–24 (for AP analysis) and immersion fixed in 4% PFA. Tissue sections (50 μm thick) from wild-type and V1aR−/− mice were processed using a rabbit polyclonal c-Fos antibody (EMD Millipore; 1:5,000) with a chicken anti-NeuN (Hexaribonucleotide Binding Protein-3a) polyclonal antibody (ABN91, 1:500; EMD Millipore; in OVLT), or with PS41 (as above) in the SCN. Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (488 nm, 568 nm, and 647 nm; Life Technologies; 1:500). Cells were considered c-Fos-positive if they were >100% above background. For OVLT analysis, cells were counted in a 200 × 200 μm field centred over the nucleus. For SCN, density was assessed over the entire nucleus. Sample size (n) refers to the number of sections analysed, which were obtained from 2 animals in each group. Coronal 300-μm slices were obtained from mouse brain as described above. These animals were not subjected to any behavioural or optogenetic experiments before slice preparation. Cell-attached recordings were obtained from visually identified fluorescent VP cells (see Extended Data Fig. 4). Green fluorescence in ArchT mice was detected using EN GFP 41017 filter cube (Chroma Technology) and red fluorescence in ChETA mice was detected using 49004 (Chroma Technology). Firing rate was assessed as described above. One cell was excluded from this analysis because its firing rate was more than four times greater than the standard deviation of the group. Horizontal hypothalamic slices were obtained from male rats as previously described29. Briefly, rats were killed by decapitation using a small rodent guillotine. The brain was rapidly removed and immersed in near-freezing (0–4 °C) oxygenated (95% O , 5% CO ) artificial rat cerebrospinal fluid (ARCSF) composed of the following (in mM) 120 NaCl, 3 KCl, 1.23 NaH PO , 1.48 MgCl , 2 CaCl , 25.95 NaHCO and 10 d-glucose. A trimmed block of brain was glued cortex-down with the rostral pole facing upwards to a mounting block angled at 38° relative to the horizontal plane. The assembly was then placed in a vibratome and a first cut was made to discard the tissue lying anterior and ventral to the optic tracts and most of the optic chiasma. A single 400-μm slice was then obtained and transferred dorsal side up to a beaker containing warmed (32 °C) oxygenated ARCSF and allowed to rest for 60 min. Slices were then placed in a warmed (32 °C) recording chamber perfused at a rate of 2–3 ml min−1. HEK293 cells (gift from Sal Carbonetto; not tested for mycoplasma) were kept in DMEM (Wysent) at 37 °C and 5% CO . The co-transfection of pGP-CMV-avp 6m (AddGene) and the human V1aR (provided by M. Bouvier, University of Montreal, QC) (2.5 μg each) was done using Lipofectamine 3000 (Invitrogen). 24 to 48 h after transfection the cultures were treated with trypsin and cells were lifted and plated over recently cut rat horizontal brain slices resting in beakers as explained above. Preparations were allowed to rest for 2 h, allowing cells to attach to the slice before starting the experiment. Experiments were completed during the subjective BP (ZT19.5−21.5) when VP release was low. Slices were carefully placed in the recording chamber, and a bipolar electrical stimulating electrode (pair of 65 μm o.d. platinum wires) was placed in the SCN. Electrical pulses (20–80 μA, 0.1−0.5 ms; 10 Hz, 40 s) were delivered via an isolated stimulator (DS2, Digitimer) triggered via a programmable digital timer (D4030, Digitimer). Fluorescence of GCaMP6m in HEK293 cells was observed using the EN GFP 41017 filter cube. Images were collected using Imaging Workbench 6.0 (INDEC BioSystems) at a rate of 1 image every 5 s (exposure 0.2 s). In control conditions, only pGP-CMV-GCaMP6m was transfected and not V1aR. Dose–response analysis and specificity were assessed on HEK293 cells plated on glass coverslips (Extended Data Fig. 5). VP dissolved in water (0.1 mM) was kept frozen until required. All images were analysed using Fiji30. Fluorescence in regions of interests (HEK cells) was corrected for bleaching determined by fitting a single exponential. Background fluorescence was subtracted from all values. Values of fluorescence at various time points were expressed relative to baseline. Changes in fluorescence relative to baseline (average of 30 s before stimulation) were determined from the average of values observed during a 30-s period following the onset of the response. Slices were obtained as mentioned above. Bicuculline was dissolved directly into the ARCSF at the required concentration (10 μM). Kynurenate was first dissolved into a small volume (<0.5 ml) of 1 N NaOH and subsequently diluted into a larger volume of ARCSF at the required concentration (3 mM). All whole-cell experiments were performed in the presence of kynurenate and bicuculline. All recordings were made during subjective night (ZT5−11). Whole-cell recordings from OVLT neurons were made using patch pipettes prepared from glass capillary tubes (1.2-mm outer diameter, A-M Systems) filled with the appropriate internal solution. Pipette resistance in the bath was 3.5−5.5 MΩ. Series resistance was 10−30 MΩ. A bipolar stimulating electrode was placed in the SCN at the beginning of each recording session. Electrical pulses (20–80 μA, 0.1−0.5 ms; 10Hz, 30 s) were delivered as described above. For gap-free whole-cell current clamp recordings, pipettes were back-filled with a solution containing the following (in mM): 140 K+-gluconate, 2 MgCl , 10 HEPES, 2 ATP(Na ), 0.4 GTP(Na ) (pH adjusted to 7.25 with NaOH). Baseline average firing rates were calculated over a window of 60 s immediately preceding SCN stimulation, and the corresponding voltage was obtained from the peak of an all-points voltage histogram. SCN stimulation evoked firing rates were calculated over a window of 60 s during the maximal firing response within 2 min of the end of stimulation. Post-stimulation voltage was obtained during the corresponding period. Current clamp analysis (Fig. 3f) was restricted to cells maintained by current injection between −35 and −50 mV (values not corrected for liquid junction). Aliquots of SR49059 dissolved in DMSO (10 mM) were diluted into ARCSF to achieve a final concentration of 10 μM. For whole-cell voltage clamp experiments, steady state current–voltage (I−V) relations were obtained from the current responses induced by slow voltage ramps (−110 to +10 mV; 2 s, V −50mV). Pipettes were backfilled with solutions corresponding to the experiment in question. K+ internal solutions were composed of the following (in mM): 140 K+-gluconate, 2 MgCl , 10 HEPES, 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Cs+ internal solutions were composed of the following (in mM): 140 CsMeS, 10 HEPES, 2 MgCl , 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Cl− internal solutions were composed of the following (in mM): 100 CsMeS, 40 CsCl, 10 HEPES, 2 MgCl , 2 ATP(Na ), 0.4 GTP(Na ) and 5 QX314-Br (pH adjusted to 7.25 with NaOH). Currents induced in OVLT neurons induced by SCN stimulation were evaluated as the difference current obtained by subtracting the average of two I−V curves taken 1 min after SCN stimulation from the average of two I−V curves recorded preceding SCN stimulation. When required, a lowpass filter was applied to the difference current trace (lowpass 80−200 Hz). SCN-induced changes in membrane conductance were quantified as the slope of the difference current I−V curve, measured over a range of 20 mV below the reversal potential. In the analysis of Fig. 3i, j, two cells were excluded because SCN-induced currents did not show a reversal potential. VP release caused by light-induced depolarization of SCN VP axons was performed using co-transfected HEK293 cells prepared as described above, in horizontal slices prepared from ChETA mice. Blue light (473 nm DPSS Laser system, Laserglow Technologies) was delivered over the OVLT (50 ms, 22 mW, 5 Hz) for 30 s through a fibre-optic probe (slim titanium magnetic receptacle, 200 μm fibre optic diameter/240 μm diameter with coating/5.5 mm length numerical aperture 0.22, Doric Lenses), connected to a mono fibre-optic patchcord (2 m) via a fibre-optic rotary joint. Horizontal slices were prepared from either ChETA or ArchT mice. Cell-attached recordings were performed as previously described. Blue light was delivered over the OVLT as previously described (50 ms, 22 mW, 5 Hz) for 30−60 s in ChETA slices during the BP (ZT19.5−21.5). Additional light intensities were used to determine threshold sensitivity (Extended Data Fig. 9). Yellow light (589 nm, 13 mW, constant light, DPSS laser system, Laserglow Technologies) was delivered over the OVLT in ArchT slices during the AP (ZT21.5−23.5). SR49059 (10 μm) was bath-applied during experiments as noted. Firing rates were calculated by counting the number of spikes during 30−60 s. Firing rates were normalized to the average baseline firing of the time period in question. Coronal slices were prepared from ChETA or ArchT male or female mouse brains. Cell-attached recordings were performed on identified VP neurons as previously described. Once sufficient baseline was recorded (2–3 min), blue light (for ChETA) or yellow light (for ArchT) was delivered to the slice. Analysis of light-induced changes in firing rate was performed by comparing firing rates averaged during 30−60 s periods recorded before and during light stimulation. ChETA and ArchT male mice (60–90 d) were stereotaxically implanted with a slim magnetic receptacle fibre-optic cannulas (5.5 mm, Doric Lenses) above the OVLT (from bregma with a 7° vertical angle, X: 1.18 mm, Y: 0 mm, Z: –4.5; ref. 31). Cannulas were initially glued to the brain using Metabond (C&B Metabond, Parkell), allowed to dry, then covered with a generous coat of dental cement (Stoelting). Animals recovered for 7 days, after which they were handled for one week to allow habituation to handling and to the fibre-optic patchcord. For testing, animals were placed in metabolic cages on Thursday afternoons. On Mondays, the animals were trained by being connected to the patchcord during the appropriate test period (2.5 h), 1 h post-handling rest, 1 h baseline, 30 min test. Testing started on the following Tuesday. ChETA mice were tested from ZT18.5 to ZT21, and ArchT mice were tested from ZT20.5 to ZT23. During the test period they received either blue light (22 mW continuous or 50 ms, 22 mW, 5 Hz), or yellow light (13 mW continuous) on separate days. Water intake analysis was performed as described above. Following the last day of testing, animals were anaesthetized and decapitated. Optical implants were removed and brains were fixed by immersion for at least 48 h in 4% PFA dissolved in PBS. Serial coronal sections (50 μm thick) were cut to determine the position of the tip of the fibre-optic cannula. Experiments were rejected if the fibre-optic tip terminated rostral or caudal to the OVLT, or more than 200 μm dorsal from the dorsal surface of the OVLT. Serial coronal sections (50 μm thick) were cut from an ArchT mouse brain to analyse the expression of GFP in VP neurons. Sections were processed for immunohistochemistry as described above. A chicken anti-GFP primary antibody (1:1,000, AB13970, Abcam) was used to enhance detection of the fluorescence reporter and the PS41 mouse monoclonal anti-VP neurophysin antibody (1:50; H. Gainer, NIH32, 33) was used to detect VP. Secondary antibodies were fluorescently labelled Alexa Fluor-conjugated (568 nm, and 647 nm; Life Technologies; 1:500). Images were analysed using ImageJ 1.50a (NIH) to count the number of VP-labelled SCN neurons and anti-GFP-labelled SCN neurons. As previously described34, single OVLT neurons were aspirated from the slice using large autoclaved micropipettes (1−2 MΩ), which were backfilled with 1.5 μl of a solution containing RNaseIN (10 U μl−1; Life Technologies). Upon contact and gigaseal formation, cells that fired action potentials (neurons) were sucked by negative pressure to collect cytoplasm, then lifted and completely suctioned into the electrode. The contents were then expelled by positive pressure into a 250-μl microcentrifuge tube containing 0.5 μl DNase I (1 U μl−1; Fisher Scientific) and 1 × MgCl buffer and stored over dry ice. Tubes were incubated at 37 °C for 30 min, and the reaction was stopped by adding 1 μl EDTA (25 mM) and incubated at 65 °C for 10 min. The RT reaction was then performed by adding 1 μl 50 μM Random Hexamer primers (Life Technologies), 0.25 μl RNaseIN (10 U μl−1), 1 μl 0.1M DTT, 1 μl 50 mM MgCl2, 1 μl 10 mM (each) dNTPs mix (QIAGEN), 2 μl 5 × First Strand Buffer, and 0.25 μl SuperscriptIII (200 U μl−1; ThermoFisher). The mix was incubated at 50 °C for 2 h and then the cDNA was stored at −20 °C. Nested PCR and nested multiplex single-cell PCR were performed using the following primers: Avpr1a ForOUT3 5′ATCCCATCCAAAACCACTCTGAGCG3′; Avpr1a RevOUT3 5′GGTAACACTTGGAAGAAGGCGACCG3′; Avpr1a ForIN3 5′GAAGAGAGCGAGGTAAGGAAGGACGG3′; Avpr1a RevIN3 5′TGCGGGATGTCTTGCGTGGC3′; V1v ForOUT 5′ATGTGGTAGACATGAGGGAGCTAGAGGC3′; V1v RevOUT 5′AATCTTCCCACTGCTGGCAGCC3′; V1v ForIN 5′TCCAGGGACTAGCCTCATTGGTGGG3′; V1v RevIN 5′TGAGTTCTTCTAGCTTCAGTGTGGGGTG3′. All group data are reported or displayed as means ± s.e.m. and the exact sample size is provided for each experimental group or condition either in the text or as indicated within or below bar graphs. Information about sample collection is also provided where relevant (for example, number of trials per animals, or sections per brain). Differences between groups (two-sided) were compared using Sigmaplot 12.0 (Systat Software). The software first assessed normality of the data distribution. In all cases where the normality test failed, a suitable non-parametric test was performed. All tests used for comparisons are specified in the text. No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.


News Article | November 30, 2016
Site: www.nature.com

The following strains of mice were used (see details in following sections): Swiss Webster females and males, C57BL/6J or C57BL6/N males, B6.Cg-Tg(Pou5f1-GFP)1Scho25 males, CD-1 females and males. 6–10-week-old female mice, and 6-week- to 6-month-old male mice were used. Animals were maintained on 12 h light–dark cycle and provided with food and water ad libitum in individually ventilated units (Techniplast at TCP, Laboratory Products at UCSF) in the specific-pathogen-free facilities at UCSF and at TCP. All procedures involving animals were performed in compliance with the protocol approved by the IACUC at UCSF, as part of an AAALAC-accredited care and use program (protocol AN091331-03); and according to the Animals for Research Act of Ontario and the Guidelines of the Canadian Council on Animal Care. Animal Care Committee reviewed and approved all procedures conducted on animals at TCP. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. No statistical methods were used to predetermine sample size estimate. Unless otherwise indicated, Swiss Webster females were mated to Swiss Webster males, or to C57BL/6 males homozygous for an Oct4-GFP transgene (B6.Cg-Tg(Pou5f1-GFP)1Scho)25. Preimplantation embryos were collected at indicated time-points after detection of the copulatory plug by flushing oviducts (E1.5–E2.5) or uteri (E3.5) of pregnant females using M2 medium (Zenith Biotech) supplemented with 2% BSA (Sigma). Subsequent embryo culture was performed in 4-well plates in 5% O , 5% CO at 37 °C in KSOMAA Evolve medium (Zenith Biotech) with 2% BSA and the following inhibitors, after optimization of concentrations: 200 nM INK128 (Medchem Express), 2.5 μM 10058-F4 (Sigma), 100 ng ml−1 cycloheximide (Amresco), 50 μM Anacardic Acid (Sigma). Other mTOR inhibitors (AZD2014, Everolimus and Rapamycin (Medchem Express) and RapaLink-1 (gift of K. Shokat)) and autophagy inhibitors chloroquine (Sigma) and SBI-0206965 (Medchem Express) were used at the indicated concentrations under same culture conditions. Diapause was induced as previously described9 after natural mating of Swiss Webster mice. Briefly, pregnant females were injected at E2.5 and EDG5.5 with 10 μg tamoxifen (intra-peritoneally) and at E2.5 only with 3 mg medroxyprogesterone 17-acetate (subcutaneously). Diapaused blastocysts were flushed from uteri in M2 media after 4 days of diapause at EDG8.5. Both surgical and non-surgical embryo transfers (NSET) were performed. For surgical transfers, superovulated CD-1 females were mated to C57BL/6J or C57BL6/N males and embryos were flushed at E3.5. Embryo culture (as described above) and surgical embryo transfer into the uteri of 2.5 days post coitus pseudopregnant CD-1 females previously mated with vasectomized CD-1 males was performed essentially as described26. For NSET, Swiss Webster females were mated to vasectomized CD-1 males and transfer was performed at E2.5 of surrogate according to manufacturer’s instructions (ParaTechs, Lexington). Before embryo transfer, embryos were cultured in KSOMAA, 2% BSA without inhibitor for 1 h. In the cases indicated (Extended Data Fig. 1a), Caesarian delivery was performed at E20, followed by fostering to Swiss Webster females. Coat colour markers (agouti versus albino) were used to distinguish transferred embryos after birth. ES cell derivation was performed as previously described27. Swiss Webster females were naturally mated to Swiss Webster-C57BL/6 males heterozygous for an Oct4-GFP transgene (B6.Cg-Tg(Pou5f1-GFP)1Scho)25. Blastocysts were collected by flushing uteri of pregnant females at E3.5, and were seeded on feeders either immediately or after culturing for 7 days in KSOMAA, 2% BSA, 200 nM INK128. Imaging of fluorescence driven by the Oct4-GFP transgene and alkaline phosphatase activity (VECTOR Red AP Substrate Kit, Vector Laboratories) was performed using a Leica DM IRB microscope. For immunofluorescence stainings, normal (E3.5), in vivo diapaused or ex vivo paused embryos were fixed in 4% paraformaldehyde for 15 min, washed with PBS and permeabilized with 0.2% Triton X-100 in PBS for 15 min. After blocking in PBS, 2.5% BSA, 5% donkey serum for 1 h, embryos were incubated overnight at 4 °C with the following primary antibodies in blocking solution: phospho-4EBP1 (Thr37/46, clone 236B4), phospho-Akt (Ser473), phospho-Ulk1 (Ser757), Nanog, c-Parp, c-Caspase3 (all from Cell Signaling), H3K4me3, H4K16ac, H4K5/8/12ac, H3K9me3 (all from Millipore), Oct4 and Rex1 (Santa Cruz Biotechnology) and H3K36me2 (Abcam). Embryos were washed in PBS-Tween20, 2.5% BSA, incubated with fluorescence-conjugated secondary antibodies (Invitrogen) for 2 h at room temperature, and mounted in VectaShield mounting medium with DAPI (Vector Laboratories). For labelling nascent transcription or translation, embryos were labelled in their respective culture medium for 20 min with EU (5-ethynyl uridine) or HPG (l-homopropargylglycine) following the manufacturer’s instructions for Click-iT RNA and protein labelling kits (Thermo Fisher Scientific). Imaging was performed using a Leica SP5 confocal microscope with automated z-stacking at 10 μm intervals. Cell Profiler Software28 was used for image quantification and Prism (Graphpad Software) was used for plotting data points. Datasets do not show similar variance between control and paused/diapaused embryos in all cases, therefore we applied Welch’s correction to the statistical analysis. E14 (from B. Skarnes, Sanger Institute), Oct4-GiP (from A. Smith, University of Cambridge) and v6.5 (from R. Blelloch, UCSF) ES cell lines were used. ‘Serum’ cells were cultured in ES-FBS medium: DMEM GlutaMAX with Na Pyruvate (Thermo Fisher Scientific), 15% FBS (Atlanta Biologicals), 0.1 mM non-essential amino acids, 50 U ml−1 penicillin/streptomycin (UCSF Cell Culture Facility), 0.1 mM EmbryoMax 2-Mercaptoethanol (Millipore) and 2,000 U ml−1 ESGRO supplement (LIF, Millipore). ‘2i’ cells were cultured in ES-2i medium: DMEM/F-12, Neurobasal medium, 1× N2/B27 supplements (Thermo Fisher Scientific), 1 μM PD0325901, 3 μM CHIR99021 (Selleck Chemicals), 50 μM Ascorbic acid (Sigma) and 2,000 U ml−1 ESGRO supplement (LIF) (Millipore). ‘Paused’ cells were cultured in ES-FBS medium containing 200 nM INK128 (Medchem). ES cells can also be paused in 2i medium, but the mTOR inhibitor needs to be removed at each passaging and reintroduced after colony formation to avoid major cell death (Extended Data Fig. 6a). The cell lines have not been authenticated. E14 and v6.5 tested negative for mycoplasma contamination. Oct4-GiP was not tested. R1 (129S1×129X1)29 and G4 (129S6×B6N)30 ES cells were used for morula aggregations. ES cells were cultured in DMEM containing 10% FBS (Wisent, lot-tested to support generation of germline chimaeras), 10% KnockOut Serum Replacement, 2 mM GlutaMAX, 1 mM Na Pyruvate, 0.1 mM non-essential amino acids, 0.1 mM 2-Mercaptoethanol (all Thermo Fisher Scientific), 1,000 U ml−1 LIF (Millipore). G4 ES cells were grown on MEF obtained from TgN(DR4)1Jae/J mice at all times except one passage on gelatinized tissue culture plates before aggregation. R1 ES cells were cultured in feeder-free conditions on gelatinized tissue culture plates. CD-1 (ICR) (Charles River) outbred albino stock was used as embryo donors for aggregation with ES cells and as pseudopregnant recipients. Details of morula aggregation can be found in26. Briefly, embryos were collected at E2.5 from superovulated CD-1(ICR) female mice. Zonae pellucidae of embryos were removed by the treatment with acid Tyrode’s solution (Sigma). ES cell colonies were treated with 0.05% Trypsin-EDTA to lift loosely connected clumps. Each zona-free embryo was aggregated with 10-15 ES cells inside depression well made in the plastic dish with an aggregation needle (BLS Ltd, Hungary) and cultured overnight in microdrops of KSOMAA covered by embryo-tested mineral oil (Zenith Biotech) at 37 °C in 94% air/6% CO . The following morning morulae and blastocysts were transferred into the uteri of E2.5 pseudopregnant CD-1(ICR) females previously mated with vasectomized males. Chimaeras were identified at birth by the presence of black eyes and later by the coat pigmentation. Chimeric males with more than 50% coat colour contribution were individually bred with CD-1(ICR) females. Germline transmission of ES cell genome was determined by eye pigmentation of pups at birth and later by the coat pigmentation. 1 × 106 cells were collected and lysed in RIPA buffer containing 1× Protease Inhibitor Cocktail, 1 mM PMSF, 5 mM NaVO and 5 mM NaF. Extracts were loaded into 4–15% Mini-Protean TGX SDS Page gels (Bio-Rad). Proteins were transferred to PVDF membranes. Membranes were blocked in 5% milk/PBS-T buffer for 30 min and incubated either overnight at 4 °C or 1 h at room temperature with the following antibodies: 4EBP1 (total or pThr37/46), S6K1 (total or pThr389), Akt (total or pSer473), mTOR (total or pSer2448) (Cell Signaling Technology), Gapdh (Millipore) and anti-rabbit/mouse secondary antibodies (Jackson Labs). Membranes were incubated with ECL or ECL Plus reagents and exposed to X-ray films (Thermo Fisher Scientific). 4 × 105 cells were seeded on 6-well plates. After overnight culture, cells were incubated for 1 h with 5-ethynyl-2-deoxyuridine (EdU) diluted to 10 μM in the indicated ES cell media. All samples were processed according to the manufacturer’s instructions (Click-iT EdU Alexa Fluor 488 Imaging Kit, Thermo Fisher Scientific). EdU incorporation was detected by Click-iT chemistry with an azide-modified Alexa Fluor 488. Cells were resuspended in EdU permeabilization/wash reagent and incubated for 30 min with FxCycle Violet Stain (Thermo Fisher Scientific). For EdU dilution experiments, ES cells were labelled for 90 min in serum, and afterwards were split into either serum or pause conditions; EdU analysis was done every 12 h for 48 h. Flow cytometric was performed on a LSRII flow cytometer (BD) and analysed using FlowJo v10.0.8. Data sets show similar variance. Total nascent transcription (Ethynyl Uridine, EU) or translation (l-homopropargylglycine, HPG) were assessed in ES cells using the Click-iT RNA Alexa Fluor 488 HCS Assay kit according to the manufacturer’s instructions (Thermo Fisher Scientific). Samples were analysed on a BD LSRII. Datasets show similar variance. After overnight culture on a 96-well plate, ESCs were washed once with PBS and trypsinized to single cells. They were resuspended in 10 μl of Annexin V diluted 1:100 in Binding Buffer (BioLegend) and incubated for 10 min in the dark. Cells were resuspended in 90 μl of binding buffer with Sytox Blue (Thermo Fisher Scientific) at 1:10,000. Data were collected on a BD LSRII. Datasets show similar variance. Three replicates were used for all samples. Freshly collected single-cell suspensions were sorted on a FACSAriaII cell sorter to collect 105 cells for each sample. Total RNA was isolated using the RNeasy kit (Qiagen). All samples were spiked-in with ERCC control RNAs (Thermo Fisher Scientific) following manufacturer’s recommendations. mRNA isolation and library preparation were performed on 250 ng total RNA from all samples using NEBNext Ultra Directional RNA library prep kit for Illumina (New England Biolabs). Samples were sequenced at The Center for Advanced Technology, UCSF on Illumina HiSeq2500. Single-end 50-bp reads were mapped to the mm10 mouse reference genome using Tophat2 (ref. 31) with default parameters. We used Cuffnorm and Cuffdiff with the gtf file from UCSC mm10 (Illumina iGenomes July 17, 2015 version) as transcript annotation to evaluate relative expression level of genes (fragments per kilobase of transcript per million mapped reads (FPKM)) and call differentially expressed genes. The alignment rate exceeded 96% in all of our samples, yielding ~40 million aligned reads per sample. Data from ref. 20 and ref. 6 were downloaded from GEO and ArrayExpress, respectively, and processed with the same pipeline as our data. The absolute abundance of mRNA transcripts was estimated using the ERCC92 RNA spike-in32. ERCC92 contains 92 synthetic sequences with lengths ranging from 250 to 2,000 bp and concentration ranging over several orders of magnitude. ERCC sequences were designed to mimic mammalian mRNA, but are not homologous to the mouse genome, ensuring their unique mappability. We aligned the reads to the 92 reference spike-in sequences and compared the abundance of these sequences between different samples. As ERCC sequence abundances followed a highly linear trend in all pairs of samples across at least 5 orders of magnitude (Pearson correlation coefficient larger than 99.7%, see Extended Data Fig. 7), we assessed the absolute abundance of mRNA as the number of mRNA fragments per kilobase of transcript per 10 thousand mapped reads of ERCC. The overall abundance of ERCC spike-in sequences in our samples varied from 0.3% to 0.5% of aligned reads. To facilitate better comparison between our data and data from ref. 20 and to reduce possible batch effects, in Fig. 4e, we followed the ‘batch mean-centering’ approach widely used in microarray gene expression data analysis for batch effect removal33. Specifically, we separately mean-centred the log (FPKM + 1) value of each gene by subtracting the mean log (FPKM + 1) across all our samples (serum, 2i and paused) and across the samples from ref. 20. The numerical values of the mean-centred expression may not be directly comparable across all samples, because they may still have different dynamic ranges in different batches. We therefore used 1 − Spearman correlation coefficient as distance in the hierarchical clustering. In Fig. 4c, we identified 5,992 genes with robust expression (cell-number-normalized expression value >50 in serum, 2i, or paused states). The cell-number-normalized expression value of each gene was standardized across the 9 samples by subtracting the mean and then dividing by the standard deviation. Hierarchical clustering was performed using the standardized expression values using Euclidean metric and average linkage. In Fig. 4e, in order to compare our samples with those from ref. 20, we used the log (FPKM + 1) value of each gene. Hierarchical clustering was performed using mean-centred (within each batch) expression values of 9,418 genes robustly expressed (FPKM >10) in at least one cell state (serum, 2i, paused, diapause EPI, E2.5 MOR, E3.5 ICM, E4.5 EPI, E4.5 PrE, E5.5 EPI, or ESC 2i/LIF). 1 − Spearman correlation coefficient was used as distance and average linkage was used. For each of the 3,772 gene ontology terms that are associated with at least 10 genes34, we defined the gene ontology term expression as the mean FPKM values of genes associated with the corresponding term. In Fig. 4f, the log fold-change of gene ontology term expressions between paused ES cells and serum ES cells was plotted on the y axis against that between various samples in ref. 20 and E4.5 EPI on the x axis. The Spearman correlation coefficient of the 3,772 gene ontology terms is indicated. Extended Data Figure 10a was generated similarly, but with the log fold-change of gene ontology term expressions between Myc DKO and wild-type cells from ref. 6 on the y axis. For each of the 281 KEGG pathways that contain at least 10 genes35, we defined the pathway expression as the mean FPKM values of genes associated with the corresponding pathway. In Extended Data Fig. 9b, the log fold change of pathway expressions between paused ES cells and serum ES cells was plotted on the y axis against that between various samples in ref. 20 and E4.5 EPI. The Spearman correlation coefficient of the 281 pathways was indicated. Extended Data Fig. 10c was generated similarly, but with the log fold change of pathway expressions between Myc dKO and wild-type cells from ref. 6 on the y axis. Custom codes used for the RNA-seq analysis are available upon request. RNA-seq data have been deposited in Gene Expression Omnibus (GEO) under accession number GSE81285. RNA-seq data from refs 6 and 20 are available under the accession numbers GSE74337 and E-MTAB-2958. The authors declare that all other data supporting the findings of this study are available within the paper and its supplementary information files.


No statistical methods were used to predetermine sample size. YapΔ/Δ and TazΔ/Δ mice were generated by crossing Yap or Taz floxed mice30 with the villin-cre line (Jackson Laboratory), the villin-creERT2 line (S. Robine, Institut Curie-CNRS) or the Lgr5-creERT line (Jackson Laboratory). The Rosa26-lox-STOP-lox-rtta-IRES-EGFP and Rosa26 lacZ mouse lines were obtained from Jackson Laboratory. The YapTg transgenic line described in this study was generated by introducing a HA-tagged wild-type Yap cDNA downstream of 7 Tet-repressor elements in the pTRE2 vector (J. Whitsett, Cincinnati Children’s Hospital Medical Center). The transgenic Yap construct was linearized and microinjected in ICR embryos. As shown in Extended Data Fig. 3a, activation of Cre deletes a neo cassette and allows for expression of the rtTA gene. In the presence of doxycycline the rtTA activates transcription of HA-Yap. Apc floxed mice were obtained from O. Sansom (Beatson Institute). Lats1 and Lats2 floxed alleles were obtained from R. Johnson (MD Anderson Cancer Center) and crossed with villin-creERT2 mice to obtain Lats1Δ/Δ;Lats2Δ/Δ mice. To measure polyp formation, YapΔ/Δ mice were backcrossed to a Bl/6 background for 4 generations before crossing to ApcMin/+ mice. Polyps from Yap+/+ (Yap+/+;villin-cre;ApcMin/+), Yap+/Δ (Yapfl/+;villin-cre;ApcMin/+) and YapΔ/Δ (Yapfl/fl;villin-cre;ApcMin/+) mice were counted 16 weeks after birth or when animals appeared moribund. Survival of ApcMin mice was measured by the number of days before mice were euthanized due to poor health. In vivo assays comparing control and Yap mutant animals were performed between age- and sex-matched pairs. No method of randomization was followed and no animals were excluded in this study. The investigators were not blinded to allocation during experiments and outcome assessment. Inducible Cre-mediated deletion of genes was performed by intraperitoneal injections of >5-week-old mice with 200 μl tamoxifen in corn oil at 10 mg ml−1. To create mosaic expression of Yap, Yapfl/fl;villin-creERT2 mice were induced with a single injection of 200 μl of tamoxifen at a suboptimal dose typically between 0.5 and 2.0 mg ml−1. For in vivo regeneration assays, mice were given a single dose of 10 or 12 Gy using a GammaCell 40 irradiator. Animals were maintained and handled under procedures approved by the Canadian Council on Animal Care. The immunohistochemistry stainings and standard colorimetric in situ hybridization were carried out according to methods described elsewhere31. Staining experiments were repeated on independent tissue sections prepared from separate mice as indicated by n values in figure legends. The following primary antibodies were used for immunostaining: rat anti-Ki67 (Dako, Cat. no. M7249, 1:1,000), rabbit anti-Yap/Taz (Cell Signaling, Cat. no. 8418, 1:100), rabbit anti-Yap (Cell Signaling, Cat. no. 14074, 1:300), mouse anti-Yap (Santa Cruz, Cat. no. sc-101199, 1:100), rabbit anti-Lef (Cell Signaling, Cat. no. 2230, 1:300), phosphor-Egfr (Tyr1092) (Abcam, Cat. no. ab40815, 1:300), anti-cleaved caspase-3 (Cell Signaling, Cat. no. 9664, 1:300) and anti-lysozyme (Dako, Cat. no. A0099, 1:1,000). Detection of primary antibodies was achieved using the Dako Envision plus system. Multi-colour fluorescence in situ hybridization with tyramide signal amplification (TSA) was done essentially as described elsewhere32, 33, 34. In brief, RNA probes from hybridized sections were detected using appropriate hapten-specific HRP-conjugated antibodies (anti-digoxigenin-HRP (Roche, Cat. no. 11207733910, 1:500), anti-dinitrophenyl-HRP (PerkinElmer, Cat. no. NEL747A001KT, 1:300), and anti-fluorescein-HRP (Life Technologies, A21253, 1:500)). After overnight incubation with antibodies at 4°C (or 2 h at room temperature for anti-fluorescein-HRP detection of cryptin1) sections were washed in PBS, and rinsed twice in 100 mM borate pH 8.5 plus 0.1% BSA. TSA reaction was performed by applying 300 μl per slide of the following mixture: 100 mM borate pH 8.5, 2% dextran sulfate, 0.1% Tween-20 and 0.003% H O , 450 μg ml−1 4-iodophenol: 1:250 Tyramide product (that is, DyLight633-tyramide, Dylight488-tyramide, Dylight 555-tyramide). The TSA reaction was allowed to proceed for 20 min and then terminated by washing slides in 100 mM glycine pH 2.0 for 15 min. Sections were washed further in PBS for the next round of detection. To synthesize tyramide products, the following succinimidyl esters were used for conjugation with tyramine: DyLight 633 NHS-Ester (Thermo Scientific Cat#46414), DyLight 550 NHS-Ester (Thermo Scientific Cat#62262), DyLight 488 NHS-Ester (Thermo Scientific Cat. no. 46402). The synthesis reaction was carried out as described previously32. The following in situ hybridization probes were obtained from the collection of MGC clones at the Lunenfeld Tanenbaum Research Institute: TweakR (BC025860), Ly6c1 (BC092082), Edn1 (BC029547), Areg (BC009138), Ereg (BC027838), Il1rn (BC042532), Il33 (BC003847), Msln (BC023753) and Cyr61 (BC066019). The Olfm4 and cryptdin1 probes were a gift from H. Clevers (Hubrecht Institute). Before fixing organoids, 10 μM Edu was added to the culture media for 1 h. Then organoids were fixed in 10% buffered formalin for 30 min, permeabilized in 0.5% Triton for 20 min and blocked in 2% BSA. Incorporated Edu was detected using the ClickIt EDU Imaging kit (Invitrogen) according to the manufacturer’s instructions. The primary antibodies used for immunostaining were mouse anti-Yap (Santa Cruz, Cat # sc-101199, 1:100), mouse anti-HA (Sigma-Aldrich, Cat. no. H9658, 1:1,000), and chicken anti-β-gal (Abcam, Cat. no. ab9361, 1:300). The secondary antibodies used in immunostaining were: CF555-donkey anti-mouse (Biotium, Cat. no. 20037, 1:400) and CF647 donkey anti-rabbit (Biotium, Cat. no. 20047, 1:400). Organoids were counterstained with 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich) before mounting onto slides for visualization. Images were acquired using a 20×/NA oil immersion objective lens (HCX PL APO, Leica), an EM-CCD camera (ImagEM, Hamamatsu) on an inverted microscope (DMIRE2, Leica) with a spinning disk confocal scanner (CSU10, Yokogawa) and Volocity. De novo crypts were scored as any protrusions, typically containing Paneth cells, budding from the initial sphere formed after seeding isolated crypts. Crypts were counted from bright-field images using Image J. At least four independent cultures derived from four different mice per genotype were used for quantification. Survival of crypts in Fig. 1 was determined by Ki67 staining of cross-sections of proximal portions of the small intestine at 3 days post-irradiation (10 Gy or 12 Gy). Values in Fig. 1b represent average number of fully labelled Ki67+ crypts per intestinal circumference based on counts from at least two sections per mouse and assays were repeated in 6 independent mice per genotype for both 10 Gy and 12 Gy treatments. The percentage of surviving Yap-positive versus negative Lgr5+ ISCs in Fig. 1d was performed by counting 587 β-gal+ crypts from a total of 7 untreated YapΔLgr5-cre mice and 394 β-gal+ crypts from a total of 9 irradiated YapΔLgr5-cre mice. In Yap;ApcΔLgr5-cre mice tumour initiating cells were visualized by staining for the Wnt target gene, Lef. As shown in Extended Data Fig. 10b, Lef is undetected in wild-type crypts and highly upregulated in Apc-null cells and thus serves as a robust marker of Apc deletion31. The percentage of Paneth cells in Lef+ foci (Fig. 4a) was assessed by preparing consecutive sections stained for Lyz, Lef and Yap, respectively. Lysozyme-positive Paneth cells from a total of 207 Yap wild-type and 201 Yap mutant Lef+ foci were counted from 5 Yap;ApcΔLgr5-cre mice (10–16 days after tamoxifen injection) using Image J and the percentage of total cells within the boundaries of a given Lef+ lesion was calculated. Relative activation of Egfr was quantified in consecutive sections from 5 Yap;ApcΔLgr5-cre mice stained for Lef, Yap and phospho-Egfr. For assessing Phospho-Egfr, staining intensity in Lef+ foci was assessed in a blinded fashion. For this, consecutive sections stained for Yap were masked from the observer scoring phospho-Egfr staining intensity. Lef+ foci were scored as ‘+’ if phospho-Egfr expression was elevated compared to wild-type adjacent crypts at comparable levels within the crypt–villus axis (see Extended Data Fig. 10f, panels xi and xii). Lef+ foci were scored as ‘++’ if staining intensity was very strong even relative to the stem cell compartment in normal crypts and/or displayed prominent apical staining (see Yap-positive foci in Fig. 4c, panel iv, and Extended Data Fig. 10f, panels v and vi). Lef+ foci were scored as ‘–’ if staining intensity was undetected or unchanged relative to adjacent wild-type crypts (see Yap mutant foci in Fig. 4c and Extended Data Fig. 10f). In Extended Data Fig. 1, caspase 3 and BrdU positive crypt cells were counted from at least six sections per mouse in 4 independent mice per genotype and expressed as a percentage of total crypt cells. All data are presented as average values with s.e.m. Mann–Whitney (two-tailed) U-test was used to determine statistical significance. Calculations were performed using GraphPad Prism 5 software. RNA was isolated from organoids cultured for 24 h after seeding in Matrigel. RNA samples were pooled from at least three organoid cultures derived from at least three independent mice per genotype (Yapfl/+;villin-cre, Yapfl/fl;villin-cre and YapTg). Quality of RNA was verified by running samples on a Bioanalyzer. High-throughput sequencing was performed using the Illumina HiSeq 2000 at the Lunenfeld Tanenbaum Research Institute (LTRI) sequencing facility. Raw sequencing reads in Fastq formats were mapped onto mouse genome (mm9) using Tophat 1.4.1 and the RPKMs (reads per kilobase of exon model per million mapped reads) were calculated using a customized script. RNA-seq data are presented in Supplementary Table 1. Combined fold change presented in Extended Data Fig. 3d and Supplementary Table 1 was calculated using the following formula: combination fold change = log [(YapΔ/Δ/Yap+/Δ)/(Dox+/Dox−)]. R, Cluster 3.0 and Java TreeView were used for data visualization. Gut organoids were cultured according to a previously described protocol established by Sato and Clevers7. Briefly, crypts were harvested by incubating opened small intestines in PBS containing 2 mM EDTA. The epithelium was released by vigorous shaking and crypts separated using a 70 μm cell strainer. Crypts were seeded in growth factor reduced Matrigel (BD Biosciences) and grown in Advanced DMEM/F12 (Invitrogen) supplemented with 2 mM GlutaMax (Invitrogen), 100 U ml−1 Penicillin/100 μg ml−1 Streptomycin (Invitrogen), N2 Supplement (Invitrogen), B-27 Supplement (Invitrogen Cat), mouse recombinant Egf (R&D Systems), 100 ng ml−1 mouse recombinant Noggin (Peprotech), 150 ng ml−1 human Rsp1 (R&D Systems). Apc-deficient organoids were harvested from Yapfl/+;Apcfl/fl;villin-creERT, Yapfl/fl;Apcfl/fl;villin-creERT or YapTg;Apcfl/fl;villin-creERT mice injected with tamoxifen and seeded 48 h later in basal growth medium without Egf, Rsp1 or Noggin. To induce Yap expression in YapTg organoids, 1.5 μg ml−1 doxycycline was added to the culture medium on day 0. Egf (R&D Systems, Cat. no. AF2028), Areg (R&D Systems, Cat. no. AF989) and Ereg (R&D Systems, Cat. no. 1068-EP-050) were added to the culture medium at a final concentration of 0.5 μg ml−1. The following inhibitors were used: PD153053 (0.5 μM, Tocris Bioscience), U0126 (10 μM, Merck Millipore). To examine pErk1/2 levels, organoids were harvested at day 2 in cold PBS containing 5 mM EDTA, 1 mM NaVO , 1.5 mM NaF and protease inhibitors. Organoids were incubated at 4°C for 30 min to dissolve Matrigel and then lysed in TNTE buffer (50 mM Tris/HCl pH 7.6, 150 mM NaCl, 0.5% Triton X-100, 1 mM EDTA) containing standard protease and phosphatase inhibitors. Protein concentrations were measured and samples were subjected to SDS–PAGE. Total RNA was extracted by removing culture medium and directly lysing organoids in wells using RTL buffer of the Rneasy Mini Kit (Qiagen). RNA was purified using columns and genomic DNA was removed by treatment with RNase-Free DNase (Qiagen).


Griffin G.,Canadian Council on Animal Care | MacArthur Clark J.,Animals in Science Regulation Unit | Zurlo J.,Johns Hopkins Center for Alternatives to Animal Testing | Ritskes-Hoitinga M.,Review Centre
OIE Revue Scientifique et Technique | Year: 2014

The principles of humane experimental technique, first described by Russell and Burch in 1959, focus on minimising suffering to animals used for scientific purposes. Internationally, as these principles became embedded in the various systems of oversight for the use of animals in science, attention focused on how to minimise pain, distress and lasting harm to animals while maximising the benefits to be obtained from the work. Suffering can arise from the experimental procedures, but it can also arise from the manner in which the animals are housed and cared for. Increased attention is therefore being paid to the entire lifetime experience of an animal, in order to afford it as good a quality of life as possible. Russell and Burch were also concerned that animals should not be used if alternatives to such use were available, and that animals were not wasted through poor-quality science. This concept is being revisited through new efforts to ensure that experiments are well designed and properly reported in the literature, that all results - positive, negative or neutral - are made available to ensure a complete research record, and that animal models are properly evaluated through periodic systematic reviews. These efforts should ensure that animal use is truly reduced as far as possible and that the benefits derived through the use of animals truly outweigh the harms.


Avey M.T.,University of Ottawa | Avey M.T.,Ottawa Hospital Research Institute | Griffin G.,Canadian Council on Animal Care
PLoS ONE | Year: 2016

There are two components to the review of animal based protocols in Canada: review for the merit of the study itself, and review of the ethical acceptability of the work. Despite the perceived importance for the quality assurance these reviews provide; there are few studies of the peer-based merit review system for animal-based protocols for research and education. Institutional animal care committees (ACC)s generally rely on the external peer review of scientific merit for animal-based research. In contrast, peer review for animal based teaching/training is dependent on the review of pedagogical merit carried out by the ACC itself or another committee within the institution. The objective of this study was to evaluate the views of ACC members about current practices and policies as well as alternate policies for the review of animal based teaching/training. We conducted a national web-based survey of ACC members with both quantitative and qualitative response options. Responses from 167 ACC members indicated broad concerns about administrative burden despite strong support for both the current and alternate policies. Participants' comments focused mostly on the merit review process (54%) relative to the efficiency (21%), impact (13%), and other (12%) aspects of evaluation. Approximately half (49%) of the comments were classified into emergent themes that focused on some type of burden: burden from additional pedagogical merit review (16%), a limited need for the review (12%), and a lack of resources (expertise 11%; people/money 10%). Participants indicated that the current system for pedagogical merit review is effective (60%); but most also indicated that there was at least some challenge (86%) with the current peer review process. There was broad support for additional guidance on the justification, criteria, types of animal use, and objectives of pedagogical merit review. Participants also supported the ethical review and application of the Three Rs in the review process. A clear priority from participants in the survey was updating guidance to better facilitate the merit review process of animal-based protocols for education. Balancing the need for improved guidance with the reality of limited resources at local institutions will be essential to do this successfully; a familiar dilemma to both scientists and policy makers alike. © 2016 Avey, Griffin. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.


Avey M.T.,Ottawa Hospital Research Institute | Fenwick N.,Canadian Council on Animal Care | Griffin G.,Canadian Council on Animal Care
Journal of the American Association for Laboratory Animal Science | Year: 2015

In 1959, Russell and Burch published The Principles of Humane Experimental Technique, which included concrete advice on factors that they considered would govern progress in the implementation of these principles (enunciated as the 3Rs [Replacement, Reduction, and Refinement in animal-based studies]). One challenge to the implementation of the 3Rs was identified as information retrieval. Here, we further explore this challenge - the need for 'research on research' - and the role that systematic reviews and reporting guidelines can play in implementation of the 3Rs. First, we examine the 2-fold nature of the challenge of information retrieval: 1) the identification of relevant publications spread throughout a large population of nonrelevant publications and 2) the incomplete reporting of relevant details within those publications. Second, we evaluate how systematic reviews and reporting guidelines can be used generally to address this challenge. Third, we assess the explicit reporting of the 3Rs in a cohort of preclinical animal systematic reviews. Our results show that Reduction methods are the most commonly reported by authors of systematic reviews but that, in general, reporting on how findings relate to the 3Rs is limited at best. Although systematic reviews are excellent tools for resolving the challenge of information retrieval, their utility for making progress in implementation of the 3Rs may be limited unless authors improve their reporting of these principles. Copyright 2015 by the American Association for Laboratory Animal Science.


Ormandy E.H.,University of British Columbia | Griffin G.,Canadian Council on Animal Care
ATLA Alternatives to Laboratory Animals | Year: 2016

When asked about the use of animals in biomedical research, people often state that the research is only acceptable if pain and distress are minimised. However, pain is caused when the aim is to study pain itself, resulting in unalleviated pain for many of the animals involved. Consequently, the use of animals in pain research is often considered contentious. To date, no research has explored people's views toward different types of animal-based pain research (e.g. chronic or acute pain). This study used a webbased survey to explore people's willingness to support the use of mice in chronic versus acute pain research. The majority of the participants opposed the use of mice for either chronic (68.3%) or acute (63.1%) pain research. There was no difference in the levels of support or opposition for chronic versus acute pain research. Unsupportive participants justified their opposition by focusing on the perceived lack of scientific merit, or the existence of non-Animal alternatives. Supporters emphasised the potential benefits that could arise, with some stating that the benefits outweigh the costs. The majority of the participants were opposed to pain research involving mice, regardless of the nature and duration of the pain inflicted, or the perceived benefit of the research. A better understanding of public views toward animal use in pain research may provide a stronger foundation for the development of policy governing the use of animals in research where animals are likely to experience unalleviated pain.


Fenwick N.,Canadian Council on Animal Care | Danielson P.,University of British Columbia | Griffin G.,Canadian Council on Animal Care
PLoS ONE | Year: 2011

The 'Three Rs' tenet (replacement, reduction, refinement) is a widely accepted cornerstone of Canadian and international policies on animal-based science. The Canadian Council on Animal Care (CCAC) initiated this web-based survey to obtain greater understanding of 'principal investigators' and 'other researchers' (i.e. graduate students, post-doctoral researchers etc.) views on the Three Rs, and to identify obstacles and opportunities for continued implementation of the Three Rs in Canada. Responses from 414 participants indicate that researchers currently do not view the goal of replacement as achievable. Researchers prefer to use enough animals to ensure quality data is obtained rather than using the minimum and potentially waste those animals if a problem occurs during the study. Many feel that they already reduce animal numbers as much as possible and have concerns that further reduction may compromise research. Most participants were ambivalent about re-use, but expressed concern that the practice could compromise experimental outcomes. In considering refinement, many researchers feel there are situations where animals should not receive pain relieving drugs because it may compromise scientific outcomes, although there was strong support for the Three Rs strategy of conducting animal welfare-related pilot studies, which were viewed as useful for both animal welfare and experimental design. Participants were not opposed to being offered "assistance" to implement the Three Rs, so long as the input is provided in a collegial manner, and from individuals who are perceived as experts. It may be useful for animal use policymakers to consider what steps are needed to make replacement a more feasible goal. In addition, initiatives that offer researchers greater practical and logistical support with Three Rs implementation may be useful. Encouragement and financial support for Three Rs initiatives may result in valuable contributions to Three Rs knowledge and improve welfare for animals used in science. © 2011 Fenwick et al.

Loading Canadian Council on Animal Care collaborators
Loading Canadian Council on Animal Care collaborators