Campo Experimental Zacatecas INIFAP

Mexico

Campo Experimental Zacatecas INIFAP

Mexico
SEARCH FILTERS
Time filter
Source Type

Mauricio-Castillo J.A.,Autonomous University of Zacatecas | Reveles-Torres L.R.,Campo Experimental Zacatecas INIFAP | Mena-Covarrubias J.,Campo Experimental Zacatecas INIFAP | Arguello-Astorga G.R.,San Luis Potosí Institute of Scientific Research and Technology | And 3 more authors.
Plant Disease | Year: 2017

Geminiviruses in the genus Curtovirus are vectored by the beet leafhopper (Circulifer tenellus Baker) and infect a wide range of dicotyledonous plants. During summer 2014, symptoms of upwardly rolled leaves, yellowing, and stunted growth were observed in ∼14% of chile pepper plants (Capsicum annuum L. var. Pasilla) from 40 ha of commercial fields in the municipality of Villa de Cos, Zacatecas (23°29′30″ N, 102°8′0″ W). Total DNA was extracted from nine symptomatic and four symptomless chile pepper plants and subjected to PCR analysis using two pairs of degenerate primers specific for curtoviruses (Velasquez-Valle et al. 2012): RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). All symptomatic plants produced amplicons of the expected size (1.75 and 1.8 kb, respectively). No PCR products were obtained from the symptomless plants. All the PCR amplicons were cloned separately and directly sequenced. The overlapping DNA fragments isolated from each extract were assembled into a complete genome sequence (2,971 bp). BLAST analysis of all the viral sequences revealed that they shared 99.9% sequence identity to each other and 96% sequence identity with Beet curly top virus (BCTV)-PeYD (GenBank accession no. EU921828). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, Ren, C4, V1, V2, and V3) encoded by the curtovirus detected in chile pepper plants (KX529650) shared 95.3, 97.3, 97.1, 91.8, 94.1, 86.5, and 92% sequence identity, respectively, with the homologous proteins of BCTV-PeYD. Finally, beet leafhoppers were collected from one of the sampled fields and total DNA was isolated from a pool of 25 insects. Amplification of viral DNA using the primers RepQEW-for and CP450-rev and further sequencing of the amplicons confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99.9%) with the virus sequence detected in symptomatic chile pepper plants. Previously, BCTV-PeYD has been reported affecting chile pepper plants in New Mexico (Lam et al. 2009) and spinach and common beet in Arizona (Nischwitz and Olsen 2010). To our knowledge, this is the first report of BCTV-PeYD associated with symptomatic chile peppers in Mexico. The presence of BCTV-PeYD in chile pepper may impose epidemiological constrains to the cultivation of this economically important crop in Mexico. © The American Phytopathological Society.


Velasquez-Valle R.,Campo Experimental Zacatecas INIFAP | Reveles-Torres L.R.,Campo Experimental Zacatecas INIFAP | Salas-Munoz S.,Campo Experimental Zacatecas INIFAP | Mauricio-Castillo J.A.,Autonomous University of Zacatecas | Pappu H.R.,Washington State University
Plant Disease | Year: 2016

Onion (Allium cepa L.) is an important vegetable crop in Mexico and is grown on about 44,000 ha with an annual production of 1,238,000 tonnes. Iris yellow spot virus (IYSV), an important viral pathogen of onion worldwide (Bag et al. 2015; Pappu et al. 2009), was serologically detected in onion plants in the state of Zacatecas in 2010 (Velásquez-Valle and Reveles-Hernández, 2011); however, it was not verified by molecular methods. There was little or no information on the characterization of the viral genome of IYSV infecting onion in Mexico. Based on symptomatic plants, incidence and severity of the disease have varied from year to year. A survey of onion nurseries carried out during January 2014 in the Zacatecas region revealed that 16 out of 18 onion nurseries had at least one plantlet with IYSV-associated lesions (yellow to tan, elongated lesions, mostly isolated, some showing green areas within the extended lesion); no differences in number or size lesions were noticed between purple and white varieties. IYSV was detected using DAS-ELISA (Agdia Inc., Elkhart, IN) in samples from diseased plants collected in these 16 onion nurseries. Incidence ranged from 8.3 to 85% in nurseries with white varieties, while in purple varieties (mainly Mata-Hari) the disease incidence varied from 40 to 73.3%. Adults of Thrips tabaci Lind. were identified in all 18 onion nurseries surveyed. Five onion plants with symptoms indicative of IYSV infection were collected from a commercial field located in the municipality of Fresnillo, central Zacatecas, and separately tested by DAS-ELISA for IYSV presence; positive results were obtained for all five plants. Total nucleic acids were extracted from a combined sample of the five plants and RT-PCR and specific primers were used to amplify the nucleoprotein (N) gene of IYSV. The amplicon was cloned and sequenced. Sequence comparison showed more than 99% nucleotide sequence identity with the corresponding region of IYSV isolates from the United States. In silico RFLP analysis showed that the IYSV isolate from Zacatecas, Mexico (Mexican), belongs to the NL genotype (Iftikhar et al. 2014). Phylogenetic analysis based on N gene sequence showed that the Mexican isolate formed a close cluster with those from Texas and New Mexico. The widespread occurrence of IYSV in onion nurseries highlights the need for implementing an integrated management program to reduce the disease incidence. © 2016 The American Phytopathological Society.

Loading Campo Experimental Zacatecas INIFAP collaborators
Loading Campo Experimental Zacatecas INIFAP collaborators