BSA
Montreal, Canada
Montreal, Canada

The British South Africa Company was established following the amalgamation of Cecil Rhodes' Central Search Association and the London-based Exploring Company Ltd which had originally competed to exploit the expected mineral wealth of Mashonaland but united because of common economic interests and to secure British government backing. The company received a Royal Charter in 1889 modelled on that of the British East India Company. Its first directors included the Duke of Abercorn, Rhodes himself and the South African financier Alfred Beit. Rhodes hoped BSAC would promote colonisation and economic exploitation across much of south-central Africa, as part of the "Scramble for Africa". However, his main focus was south of the Zambezi, in Mashonaland and the coastal areas to its east, from which he believed the Portuguese could be removed by payment or force, and in the Transvaal, which he hoped would return to British control.It has been suggested that Rhodes' ambition was to create a zone of British commercial and political influence from "Cape to Cairo", but this was far beyond the resources of any commercial company to achieve and would not have given investors the financial returns they expected. BSAC was created in the expectation that the gold fields of Mashonaland would provide funds for the development of other areas of Central Africa, including the mineral wealth of Katanga. When the expected wealth of Mashonaland did not materialise and Katanga was acquired by the Congo Free State, the company had little money left after building railways for significant development, particularly in areas north of the Zambezi. BSAC regarded its lands north of the Zambezi as territory to be held as cheaply as possible for future, rather than immediate, exploitation.As part of administering Southern Rhodesia until 1923 and Northern Rhodesia until 1924, BSAC formed what were originally paramilitary forces, but which later included more normal police functions. In addition to the administration of Southern and Northern Rhodesia, BSAC claimed extensive landholdings and mineral rights in both the Rhodesias and, although its land claims in Southern Rhodesia were nullified in 1918, its land rights in Northern Rhodesia and its mineral rights in Southern Rhodesia had to be bought out in 1924 and 1933 respectively, and its mineral rights in Northern Rhodesia lasted until 1964. BSAC also created the Rhodesian railway system and owned the railways there until 1947. Wikipedia.


Time filter

Source Type

News Article | February 15, 2017
Site: www.nature.com

Polybrene, bafilomycin A, nocodazole and cyclohexamide were purchased from Sigma. CLAAAP (protease inhibitor cocktail) and PhosStop (phosphatase inhibitor) were purchased from Roche. Cytochalasin D was obtained from Fluka. Each antibody was obtained as follows: α-tubulin (B-5-1-2, Santa Cruz Biotechnology), AIF (sc-13116, Santa Cruz Biotechnology), β-actin (AC-74, Sigma), calnexin (ADI-SPA-860, ENZO Life Sciences), catalase (219010, Millipore), Drp1 (611113, BD Transduction Laboratories), FLAG (M2, Sigma), GFP for western blots (JL-8, Clontech), GFP (anti FP) for electron microscopy and immunoprecipitation (A6455, Life Technology), IP R1 (8568, Cell Signalling), KDEL (ab50601, Abcam), Lamp1b (H5G11, Santa Cruz Biotechnology), MCU (HPA016480, Sigma), MUL1 (HPA017681, Sigma), myc (4A6, Upstate), PEX14 (ABC142, Millipore), PMP70 (sab4200181, Sigma), PRDX3 (ref. 30), Tom20 (FL-145, Santa Cruz Biotechnology), ubiquitin (P4D1-A11, Millipore), VDAC1 (20B12AF2, Abcam), Vps35 (2D3, Novus). The human peroxisomal biogenesis-deficient fibroblast cell line PBD400-T1 was derived from a patient with Zellweger syndrome carrying a single nucleotide insertion (c542insT) leading to a premature stop codon in the core peroxin gene PEX3 (called Pex3mut), a gift from P. Kim (Univ. Toronto, Canada). Pex16mut cells were derived from a patient with Zellweger syndrome carrying a terminating mutation in PEX16, R176ter (GM06231 cells, Coriell Institute, called Pex16mut), which were immortalized as described in ref. 31. Control human fibroblasts (cell line MCH64) were obtained from Montreal Children’s Hospital. The cell lines were validated using qRT–PCR to confirm the loss of Pex3 or Pex16 (data shown in Extended Data Fig. 1a). Cells were maintained in DMEM (GIBCO) supplied with 10% fetal bovine serum (Wisent Bio Products) and non-essential amino acids (GIBCO) in 5.0% CO at 37 °C. Cells were tested for mycoplasma contamination using MycoAlert Mycoplasma Detection kit (Lonza). Transfection with plasmid DNA or siRNA was performed with Lipofectamine 3000, Nucleofector (Lonza) or RNAiMAX (Invitrogen) following the manufacturer’s instructions. Addition of drugs to monitor peroxisome biogenesis was performed using the following conditions: 0.02% DMSO, 20 nM bafilomycin A, 2 μM MG132, 1 μM cytochalasin D or 1.5 μM nocodazole for 14 h. Series of ON-TARGETplus siRNAs were purchased from Dharmacon. Non-targeting control pool (D-001810-10), targeted sequences are as follows: ON-TARGETplus DNML1 siRNA smart pool (J-012092-09 – 12, GUUAACCCGUGGAUGAUAA, CGUAAAAGGUUGCCUGUUA, CAUCAGAGAUGUUUACCA, GGAGCCAGCUAGAUAUUAA), ON-TARGETplus smart pool siVps35 (GAACAUAUUGCUACCAGUA, GAAAGAGCAUGAGUUGUUA, GUUGUAAACUGUAGGGAUG, GAACAAAUUUGGUGCGCCU), ON-TARGETplus siPEX19 (J-012594-05, J-012594-06, J-012594-07, J-012594-08) C-terminal YFP-fused Pex3 (UniProtKB: P56589) and Pex16 (UniprtoKB: Q9Y5Y5) (obtained from P. Kim12, GFP tag switched for YFP using standard procedures) were subcloned into D2-MCS viral vector (BioVector) under the control of a CMV promoter. Ad-GFP, Ad-Pex3–YFP and Ad-Pex16–YFP were used to infect cells at 50, 500 and 200 pfu per cell, respectively, in the presence of 4 μg/ml polybrene. Medium was replaced 1 day after infection. Cells were fixed with pre-warmed 5% PFA that was added directly to cells just after removing the culture medium without PBS wash. After incubation at 37 °C for 15 min, PFA was quenched with 50 mM NH Cl/PBS for 10 min at room temperature. Cells were permeabilized with 0.1% Triton X-100/PBS (v/v) for 10 min at room temperature and blocked with 5% FBS/PBS for 10 min at room temperature. Cells were incubated with appropriate primary antibodies for 2 h. After the wash with PBS, cells were incubated with secondary antibodies for 1 h. Cells were observed with spinning confocal microscopy (Olympus IX81 with Andor/Yokogawa spinning disk system (CSU-X), sCMOS camera and 100× or 60× objective lenses (NA1.4)). For quantification analysis, more than 30 cells in each condition were randomly chosen and counted based on the definitions on main figures (stages of de novo synthesis: Fig. 1a; localization of Pex3–YFP: Fig. 2b, left). Cells plated in a glass-bottom cell culture dish (MatTek) were infected with adenoviruses. Twenty-four hours after infection, cells were incubated with 100 nM MitoTracker Deep Red FM (Molecular Probes) for 20 min at 37 °C. Cells were washed in DMEM and observed in DMEM containing no phenol red (31053028, GIBCO) supplied with 10% FBS and 2 mM l-glutamine, NEAA and 10 mM HEPES pH 7.4 using a spinning disk confocal microscope (described above) with a 100× objective and EMCCD camera. For long-term imaging (40–48 h), infected cells in phenol red-free medium were monitored with Viva View FL Incubator microscope fitted with a 40× objective (Olympus) beginning 24 h after initial infection. Pex3mut and Pex16mut cells were transfected with Pex16–mRFP and infected with Ad-Pex3–YFP. Sixteen hours later, cells were trypsinized and co-plated into a glass bottom cell culture dish (MatTek). One day after that, cells were fused with 50% (w/v) PEG (Fluka, MW: 1,500 Da) in MEM (Invitrogen) containing medium for 1 min. After extensive washing (5×) with DMEM, cells were monitored with the spinning disk confocal microscope beginning 1 h after whole-cell fusion32. Cells prepared for electron microscopy were infected as indicated for 1 day before processing to capture the early events in peroxisomal biogenesis. As previously described33, cells were fixed with 5% PFA and 1.6% glutaraldehyde (GA) in 0.1 M sodium cacodylate buffer (pH 7.4) for 10 min at room temperature, then further fixed at 4 °C in the same buffer overnight. After washing with 0.1 M cacodylate buffer, cells were fixed with 1% osmium tetroxide for 60 min at 4 °C. Cells were washed with water, stained with saturated aqueous uranyl acetate for 45 min at room temperature, and then gradually dehydrated with a series of increasing concentrations of ethanol (70–100%). After dehydrating with 100% acetone, cells were gradually embedded in Spurr’s resin, and polymerized for 48 h at 60 °C. Samples were sectioned to a 100-nm thickness and sections were mounted on 200-mesh copper grids. Sections were imaged at 120 kV using a FEI Tecnai 12 TEM outfitted with an AMT XR80C CCD Camera System, housed in the Facility for Electron Microscopy Research (FEMR) at McGill University. The sizes of pre-peroxisomes on mitochondria were measured with ImageJ (NIH). For immuno-gold labelling, cells infected with Ad-Pex3–YFP or Ad-Pex16–YFP for 24 h were fixed in 5% PFA and 0.1% GA in PBS for 15 min at 37 °C. After washing with PBS, aldehydes were quenched with 50 mM glycine in PBS. Cells were permeabilized with 0.1% saponin and 5% BSA in PBS for 30 min at room temperature. Cells were incubated with anti GFP-antibody for 1 h at room termperature. After washing with 1% BSA in PBS, cells were incubated with 1.4 nm nanogold-conjugated goat anti-rabbit IgG for one hour at room temperature. After washing with PBS, cells were post-fixed with 1.6% GA in PBS for 10 min at room temperature. Cells were washed with water, then nanogold particles were enhanced using the HQ Silver Enhancement Kit (Nanoprobes) according to the manufacturer’s instructions. Cells were stored in 1.6% GA in 0.1 M sodium cacodylate at 4 °C overnight and processed as for conventional TEM (described above). Cells resuspended in ice-cold homogenization buffer (HB, 10 mM HEPES-KOH pH 7.4, 220 mM manitol, 70 mM sucrose, protease inhibitor cocktail) were homogenized with a 27-G needle (BD). Post-nuclear supernatants after centrifugation at 800g for 10 min were centrifuged at 2,300g for 10 min. Supernatants were further centrifuged at 23,000g for 15 min and at 100,000g for 1 h. After each centrifugation, pellets were resuspended in HB. Protein concentrations were measured by the Bradford method and analysed by immunoblotting. Twenty-five micrograms of 2.3 K for mitochondrial or 23 K for peroxisomal fractions suspended in 40 μl of mitochondrial isolation buffer (MIB, 10 mM HEPES pH 7.4, 68 mM sucrose, 80 mM KCl, 0.5 mM EDTA, 2 mM Mg(CH COO) ) containing varying amounts of trypsin (Sigma) were incubated on ice for 20 min. Digestion was terminated by adding soybean trypsin inhibitor (2.5 mg/ml, Sigma). For alkaline carbonate extraction, 50 μg of each fraction suspended in 50 μl of 0.1 M Na CO pH 11.5 was incubated on ice for 30 min. Soluble and membrane fractions were separated by centrifugation at 200,000g for 15 min at 4 °C. Cell-free mitochondrial import assays were performed as previously described34, with some modifications. In brief, Pex3– and Pex16–myc-His inserted into pCDNA3.1 myc-His (-) B (Invitrogen) were linearized by AglII restriction enzyme (NEB) before in vitro transcription. Capped RNA was synthesized in vitro using T7 polymerase (Promega). For the co-translational import assay, synthesized RNA was incubated with rabbit reticulocyte lysate (RRL, Promega) and 14.4 μg of canine pancreas microsomes35, 36 for 30 min at 30 °C. Microsomes were collected by centrifugation at 100,000g for 15 min after washing with MIB twice. For post-translational import into isolated mitochondria, synthesized RNA was incubated with RRL for 30 min at 30 °C. Reaction products were incubated with 50 μg mitochondria isolated from mouse heart34 in 50 μl reaction mix (10 mM HEPES pH 7.4, 110 mM Mannitol, 68 mM sucrose, 80 mM KCl, 0.5 mM EGTA, 2 mM Mg(CH COO) , 0.5 mM GTP, 2 mM K HPO , 1 mM ATP (K+), 0.08 mM ADP, 5 mM sodium succinate) for 30 min at 30 °C. Mitochondria were washed with MIB twice and subjected to further analysis for suborganellular localization as described above or directly analysed by immunoblotting. Pex3mut cells infected with Ad-GFP or Ad-Pex3–YFP for 10 h were further treated with or without 500 nM MG132 for 14 h. Cells were lysed with 0.1% SDS lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 5 mM EDTA, 0.1% SDS, 1% Triton-X 100, protease inhibitor cocktail and PhosStop). Soluble fractions were obtained by centrifugation at 20,000g for 20 min at 4 °C. Non-specific binding proteins were removed by rotating with protein-G sepharose (GE Healthcare) for 1 h at 4 °C. Lysates were subjected to immunoprecipitation using rabbit polyclonal anti-GFP antibodies (Invitrogen). Immmunoprecipitates were eluted by adding SDS–PAGE sample buffer and analysed by immunoblotting. Total RNA was isolated from each cell using RNeasy kit (QIAGEN). qRT–PCR and data analysis were performed at IRIC Genomics Platform (University de Montreal). Primers are as follows: ACTB (endogenous control) (Fw: attggcaatgagcggttc, Rv: tgaaggtagtttcgtggatgc), GAPDH (endogenous control) (Fw: agccacatcgctcagacac, Rv: gcccaatacgaccaaatcc), Pex19 (Fw: gcaagtcggaggtagcaaga, Rv: ctttatcgaaatcatcaagagcac), Pex3 (Fw: aaccagaggacttgcaatatgac, Rv: tgctgcattaaggcctctct), Pex16 (Fw: aggtgtggggtgaagtgg, Rv: caggagcatccgcagtaca). The means of each condition were calculated from three independent experiments, counting at least 30 cells per condition to generate enough power for statistical significance. P values for data comparison were calculated by Student’s t-test. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. All data shown here have been reproduced at least three times by the authors. All data supporting the findings of this study are available within the paper and the supplementary information files.


Scientific understanding of the role of humans in influencing and altering the global climate has been evolving for over a century. That understanding is now extremely advanced, combining hundreds of years of observations of many different climatic variables, millions of years of paleoclimatic evidence of past natural climatic variations, extended application of fundamental physical, chemical, and biological processes, and the most sophisticated computer modeling ever conducted. There is no longer any reasonable doubt that humans are altering the climate, that those changes will grow in scope and severity in the future, and that the economic, ecological, and human health consequences will be severe. While remaining scientific uncertainties are still being studied and analyzed, the state of the science has for several decades been sufficient to support implementing local, national, and global policies to address growing climate risks. This is the conclusion of scientific studies, syntheses, and reports to policymakers extending back decades. Because of the strength of the science, and the depth of the consensus about climate change, the scientific community has worked hard to clearly and consistently present the state of understanding to the public and policymakers to help them make informed decisions. The scientific community does this in various ways. Individual scientists speak out, presenting scientific results to journalists and the public. Scientists and scientific organizations prepare, debate, and publish scientific statements and declarations based on their expertise and concerns. And national scientific organizations, especially the formal “Academies of Sciences,” prepare regular reports on climate issues that are syntheses of all relevant climate science and knowledge. The number and scope of these statements is truly impressive. Not a single major scientific organization or national academy of science on earth denies that the climate is changing, that humans are responsible, and that some form of action should be taken to address the risks to people and the planet. This consensus is not to be taken lightly. Indeed, this consensus is an extraordinarily powerful result given the contentious nature of science and the acclaim that accrues to scientists who find compelling evidence that overthrows an existing paradigm (as Galileo, Darwin, Einstein, Wegener, and others did in their fields). In a peculiar twist, some have tried to argue that acceptance of the strength of the evidence and the massive consensus in the geoscience community about human-caused climate change is simply “argument from consensus” or “argument from authority” – a classic potential “logical fallacy.” Indeed, the mere fact that nearly 100 percent of climate and geoscience professions believe humans are changing the climate does not guarantee that the belief is correct. But arguing that something is false simply because there is a strong consensus for it is an even worse logical fallacy, especially when the consensus is based on deep, extensive, and constantly tested scientific evidence. In fact, this false argument has a name: the Galileo Gambit. It is used by those who deny well-established scientific principles such as the theory of climate change as follows: Because Galileo was mocked and criticized for his views by a majority, but later shown to be right, current minority views that are mocked and criticized must also be right. The obvious flaw in the Galileo Gambit is that being criticized for one’s views does not correlate with being right – especially when the criticism is based on scientific evidence. Galileo was right because the scientific evidence supported him, not because he was mocked and criticized. The late professor Carl Sagan addressed this use of the Galileo Gambit in a humorous way when he noted: These statements and declarations about climate change by the world’s leading scientific organizations represent the most compelling summary of the state of knowledge and concern about the global geophysical changes now underway, and they provide the foundation and rationale for actions now being debated and implemented around the world. The world ignores them at its peril. Here, based on information available as of early January 2017, is a synthesis, listing, and links for these public positions and declarations. These statements are summarized below for more than 140 of the planet’s national academies and top scientific health, geosciences, biological, chemical, physical, agricultural, and engineering organizations. Each statement is archived online as noted in the links. Abbreviated sections of statements only are presented, but readers should consult the full statements for context and content. Also, scientific organizations and committees periodically update, revise, edit, and re-issue position statements. Please send me any corrections, updates, additions, and changes. The AAN is a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ Rising global temperatures are causing major physical, chemical, and ecological changes in the planet. There is wide consensus among scientific organizations and climatologists that these broad effects, known as “climate change,” are the result of contemporary human activity. Climate change poses threats to human health, safety, and security, and children are uniquely vulnerable to these threats… The social foundations of children’s mental and physical health are threatened by the specter of far-reaching effects of unchecked climate change, including community and global instability, mass migrations, and increased conflict. Given this knowledge, failure to take prompt, substantive action would be an act of injustice to all children… Pediatricians have a uniquely valuable role to play in the societal response to this global challenge… [The AAP is also a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/] The scientific evidence is clear: global climate change caused by human activities is occurring now, and it is a growing threat to society. Accumulating data from across the globe reveal a wide array of effects: rapidly melting glaciers, destabilization of major ice sheets, increases in extreme weather, rising sea level, shifts in species ranges, and more. The pace of change and the evidence of harm have increased markedly over the last five years. The time to control greenhouse gas emissions is now. [The AAAS has also signed onto more recent letters on climate from an array of scientific organizations, including the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] There is widespread scientific agreement that the world’s climate is changing and that the weight of evidence demonstrates that anthropogenic factors have and will continue to contribute significantly to global warming and climate change. It is anticipated that continuing changes to the climate will have serious negative impacts on public, animal and ecosystem health due to extreme weather events, changing disease transmission dynamics, emerging and re-emerging diseases, and alterations to habitat and ecological systems that are essential to wildlife conservation. Furthermore, there is increasing recognition of the inter-relationships of human, domestic animal, wildlife, and ecosystem health as illustrated by the fact the majority of recent emerging diseases have a wildlife origin. Consequently, there is a critical need to improve capacity to identify, prevent, and respond to climate-related threats.  The following statements present the American Association of Wildlife Veterinarians (AAWV) position on climate change, wildlife diseases, and wildlife health…. The American Geophysical Union (AGU) notes that human impacts on the climate system include increasing concentrations of greenhouse gases in the atmosphere, which is significantly contributing to the warming of the global climate. The climate system is complex, however, making it difficult to predict detailed outcomes of human-induced change: there is as yet no definitive theory for translating greenhouse gas emissions into forecasts of regional weather, hydrology, or response of the biosphere. As the AGU points out, our ability to predict global climate change, and to forecast its regional impacts, depends directly on improved models and observations. The American Astronomical Society (AAS) joins the AGU in calling for peer-reviewed climate research to inform climate-related policy decisions, and, as well, to provide a basis for mitigating the harmful effects of global change and to help communities adapt and become resilient to extreme climatic events. In endorsing the “Human Impacts on Climate” statement, the AAS recognizes the collective expertise of the AGU in scientific subfields central to assessing and understanding global change, and acknowledges the strength of agreement among our AGU colleagues that the global climate is changing and human activities are contributing to that change. Careful and comprehensive scientific assessments have clearly demonstrated that the Earth’s climate system is changing in response to growing atmospheric burdens of greenhouse gases (GHGs) and absorbing aerosol particles. (IPCC, 2007) Climate change is occurring, is caused largely by human activities, and poses significant risks for—and in many cases is already affecting—a broad range of human and natural systems. (NRC, 2010a) The potential threats are serious and actions are required to mitigate climate change risks and to adapt to deleterious climate change impacts that probably cannot be avoided. (NRC, 2010b, c) This statement reviews key probable climate change impacts and recommends actions required to mitigate or adapt to current and anticipated consequences. …comprehensive scientific assessments of our current and potential future climates clearly indicate that climate change is real, largely attributable to emissions from human activities, and potentially a very serious problem. This sober conclusion has been recently reconfirmed by an in-depth set of studies focused on “America’s Climate Choices” (ACC) conducted by the U.S. National Academies (NRC, 2010a, b, c, d). The ACC studies, performed by independent and highly respected teams of scientists, engineers, and other skilled professionals, reached the same general conclusions that were published in the latest comprehensive assessment conducted by the International Panel on Climate Change (IPCC, 2007)… The range of observed and potential climate change impacts identified by the ACC assessment include a warmer climate with more extreme weather events, significant sea level rise, more constrained fresh water sources, deterioration or loss of key land and marine ecosystems, and reduced food resources— many of which may pose serious public health threats. (NRC, 2010a) The effects of an unmitigated rate of climate change on key Earth system components, ecological systems, and human society over the next 50 years are likely to be severe and possibly irreversible on century time scales… [The ACS has also signed onto more recent letters on climate from an array of scientific organizations, including the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] THAT: The American College of Preventive Medicine (ACPM) accept the position that global warming and climate change is occurring, that there is potential for abrupt climate change, and that human practices that increase greenhouse gases exacerbate the problem, and that the public health consequences may be severe. THAT: The ACPM staff and appropriate committees continue to explore opportunities to address this matter, including sessions at Preventive Medicine conferences and the development of a policy position statement as well as other modes of communicating this issue to the ACPM membership. [The ACPM is also a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/] Humanity is the major influence on the global climate change observed over the past 50 years. Rapid societal responses can significantly lessen negative outcomes. Human activities are changing Earth’s climate. At the global level, atmospheric concentrations of carbon dioxide and other heat‐trapping greenhouse gases have increased sharply since the Industrial Revolution. Fossil fuel burning dominates this increase. Human‐caused increases in greenhouse gases are responsible for most of the observed global average surface warming of roughly 0.8°C (1.5°F) over the past 140 years. Because natural processes cannot quickly remove some of these gases (notably carbon dioxide) from the atmosphere, our past, present, and future emissions will influence the climate system for millennia. Extensive, independent observations confirm the reality of global warming. These observations show large‐scale increases in air and sea temperatures, sea level, and atmospheric water vapor; they document decreases in the extent of mountain glaciers, snow cover, permafrost, and Arctic sea ice. These changes are broadly consistent with long understood physics and predictions of how the climate system is expected to respond to human‐caused increases in greenhouse gases. The changes are inconsistent with explanations of climate change that rely on known natural influences… [The AGU has also signed onto more recent letters on climate from an array of scientific organizations, including the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] [The AIBS is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] The Governing Board of the American Institute of Physics has endorsed a position statement on climate change adopted by the American Geophysical Union (AGU) Council in December 2003. AGU is one of ten Member Societies of the American Institute of Physics. The statement follows: Human activities are increasingly altering the Earth’s climate. These effects add to natural influences that have been present over Earth’s history. Scientific evidence strongly indicates that natural influences cannot explain the rapid increase in global near-surface temperatures observed during the second half of the 20th century. Human impacts on the climate system include increasing concentrations of atmospheric greenhouse gases (e.g., carbon dioxide, chlorofluorocarbons and their substitutes, methane, nitrous oxide, etc.), air pollution, increasing concentrations of airborne particles, and land alteration. A particular concern is that atmospheric levels of carbon dioxide may be rising faster than at any time in Earth’s history, except possibly following rare events like impacts from large extraterrestrial objects… The ALA is a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ If physicians want evidence of climate change, they may well find it in their own offices. Patients are presenting with illnesses that once happened only in warmer areas. Chronic conditions are becoming aggravated by more frequent and extended heat waves. Allergy and asthma seasons are getting longer. Spates of injuries are resulting from more intense ice storms and snowstorms. Scientific evidence shows that the world’s climate is changing and that the results have public health consequences. The American Medical Association is working to ensure that physicians and others in health care understand the rise in climate-related illnesses and injuries so they can prepare and respond to them. The Association also is promoting environmentally responsible practices that would reduce waste and energy consumption. Amicus Brief filed before the Supreme Court in support of the Clean Power Plan. Failure to uphold the Clean Power Plan would undermine [the] EPA’s ability to carry out its legal obligation to regulate carbon emissions that endanger human health and would negatively impact the health of current and future generations. Carbon emissions are a significant driver of the anthropogenic greenhouse gas emissions that cause climate change and consequently harm human health. Direct impacts from the changing climate include health-related illness, declining air quality and increased respiratory and cardiovascular illness. Changes in climate also facilitate the migration of mosquito-borne diseases, such as dengue fever, malaria and most recently the Zika Virus. “In surveys conducted by three separate U.S. medical professional societies,” the brief said, “a significant majority of surveyed physicians concurred that climate change is occurring … is having a direct impact on the health of their patients, and that physicians anticipate even greater climate-driven adverse human health impacts in the future.” [This statement is considered in force until August 2017 unless superseded by a new statement issued by the AMS Council before this date.] …Warming of the climate system now is unequivocal, according to many different kinds of evidence.  Observations show increases in globally averaged air and ocean temperatures, as well as widespread melting of snow and ice and rising globally averaged sea level. Surface temperature data for Earth as a whole, including readings over both land and ocean, show an increase of about 0.8°C (1.4°F) over the period 1901-2010 and about 0.5°C (0.9°F) over the period 1979–2010 (the era for which satellite-based temperature data are routinely available). Due to natural variability, not every year is warmer than the preceding year globally. Nevertheless, all of the 10 warmest years in the global temperature records up to 2011 have occurred since 1997, with 2005 and 2010 being the warmest two years in more than a century of global records. The warming trend is greatest in northern high latitudes and over land. In the U.S., most of the observed warming has occurred in the West and in Alaska; for the nation as a whole, there have been twice as many record daily high temperatures as record daily low temperatures in the first decade of the 21st century… There is unequivocal evidence that Earth’s lower atmosphere, ocean, and land surface are warming; sea level is rising; and snow cover, mountain glaciers, and Arctic sea ice are shrinking. The dominant cause of the warming since the 1950s is human activities. This scientific finding is based on a large and persuasive body of research. The observed warming will be irreversible for many years into the future, and even larger temperature increases will occur as greenhouse gases continue to accumulate in the atmosphere. Avoiding this future warming will require a large and rapid reduction in global greenhouse gas emissions. The ongoing warming will increase risks and stresses to human societies, economies, ecosystems, and wildlife through the 21st century and beyond, making it imperative that society respond to a changing climate. To inform decisions on adaptation and mitigation, it is critical that we improve our understanding of the global climate system and our ability to project future climate through continued and improved monitoring and research. This is especially true for smaller (seasonal and regional) scales and weather and climate extremes, and for important hydroclimatic variables such as precipitation and water availability… Technological, economic, and policy choices in the near future will determine the extent of future impacts of climate change. Science-based decisions are seldom made in a context of absolute certainty. National and international policy discussions should include consideration of the best ways to both adapt to and mitigate climate change. Mitigation will reduce the amount of future climate change and the risk of impacts that are potentially large and dangerous. At the same time, some continued climate change is inevitable, and policy responses should include adaptation to climate change. Prudence dictates extreme care in accounting for our relationship with the only planet known to be capable of sustaining human life. [The AIBS is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] Earth’s changing climate is a critical issue and poses the risk of significant environmental, social and economic disruptions around the globe. While natural sources of climate variability are significant, multiple lines of evidence indicate that human influences have had an increasingly dominant effect on global climate warming observed since the mid-twentieth century. Although the magnitudes of future effects are uncertain, human influences on the climate are growing. The potential consequences of climate change are great and the actions taken over the next few decades will determine human influences on the climate for centuries. As summarized in the 2013 report of the Intergovernmental Panel on Climate Change (IPCC), there continues to be significant progress in climate science. In particular, the connection between rising concentrations of atmospheric greenhouse gases and the increased warming of the global climate system is more compelling than ever. Nevertheless, as recognized by Working Group 1 of the IPCC, scientific challenges remain in our abilities to observe, interpret, and project climate changes. To better inform societal choices, the APS urges sustained research in climate science. The APS reiterates its 2007 call to support actions that will reduce the emissions, and ultimately the concentration, of greenhouse gases as well as increase the resilience of society to a changing climate, and to support research on technologies that could reduce the climate impact of human activities. … The APA is a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ [This policy builds upon and replaces existing policies 20078 (Addressing the Urgent Threat of Global Climate Change to Public Health and the Environment) and 9510 (Global Climate Change)] Public Health Opportunities to Address the Health Effects of Climate Change Climate change poses major threats to human health, human and animal populations, ecological stability, and human social, financial, and political stability and well-being. Observed health impacts of climate change include increased heat-related morbidity and mortality, expanded ranges and frequency of infectious disease outbreaks, malnutrition, trauma, violence and political conflict, mental health issues, and loss of community and social connections. Certain populations will experience disproportionate negative effects, including pregnant women, children, the elderly, marginalized groups such as racial and ethnic minorities, outdoor workers, those with chronic diseases, and those in economically disadvantaged communities. Climate change poses significant ethical challenges as well as challenges to global and health equity. The economic risks of inaction may be significant, yet many strategies to combat climate change offer near- and long-term co-benefits to health, producing cost savings that could offset implementation costs. At present, there are major political barriers to adopting strategies to mitigate and adapt to climate change. Recognizing the urgency of the issue and importance of the public health role, APHA, the Centers for Disease Control and Prevention, and others have developed resources and tools to help support public health engagement. APHA calls for individual, community, national, and global action to address the health risks posed by climate change. The public health community has critical roles to play, including advocating for action, especially among policymakers; engaging in health prevention and preparedness efforts; conducting surveillance and research on climate change and health; and educating public health professionals. [The APHA is also a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/] [The APHA is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] Letter to EOS of the Council of the AQA The available scientific evidence clearly shows that the Earth on average is becoming warmer… Few credible scientists now doubt that humans have influenced the documented rise of global temperatures since the Industrial Revolution. The first government led U.S. Climate Change Science Program synthesis and assessment report supports the growing body of evidence that warming of the atmosphere, especially over the past 50 years, is directly impacted by human activity. In 2003, the ASM issued a policy report in which they recommend “reducing net anthropogenic CO emissions to the atmosphere” and “minimizing anthropogenic disturbances of” atmospheric gases: “Carbon dioxide concentrations were relatively stable for the past 10,000 years but then began to increase rapidly about 150 years ago… as a result of fossil fuel consumption and land use change. Of course, changes in atmospheric composition are but one component of global change, which also includes disturbances in the physical and chemical conditions of the oceans and land surface. Although global change has been a natural process throughout Earth’s history, humans are responsible for substantially accelerating present-day changes. These changes may adversely affect human health and the biosphere on which we depend. Outbreaks of a number of diseases, including Lyme disease, hantavirus infections, dengue fever, bubonic plague, and cholera, have been linked to climate change.” A comprehensive body of scientific evidence indicates beyond reasonable doubt that global climate change is now occurring and that its manifestations threaten the stability of societies as well as natural and managed ecosystems. Increases in ambient temperatures and changes in related processes are directly linked to rising anthropogenic greenhouse gas (GHG) concentrations in the atmosphere. The potential related impacts of climate change on the ability of agricultural systems, which include soil and water resources, to provide food, feed, fiber, and fuel, and maintenance of ecosystem services (e.g., water supply and habitat for crop landraces, wild relatives, and pollinators) as well as the integrity of the environment, are major concerns. Around the world and in the United States (US), agriculture—which is comprised of field, vegetable, and tree crops, as well as livestock production—constitutes a major land use which influences global ecosystems. Globally, crop production occupies approximately 1.8 Billion (B) hectares out of a total terrestrial land surface of about 13.5 B hectares. In addition, animal production utilizes grasslands, rangelands, and savannas, which altogether cover about a quarter of the Earth’s land. Even in 2010, agriculture remains the most basic and common human occupation on the planet and a major contributor to human well-being. Changes in climate are already affecting the sustainability of agricultural systems and disrupting production. [The May 2011 statement was also signed by the Crop Science Society of America and the Soil Science Society of America.] [The ASoA is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] There is strong evidence that the climate is changing and will continue to change.  Climate scientists project that there will be substantial increases in temperature with related increases in atmospheric water vapor and increases in extreme precipitation amounts and intensities in most geographic regions as a result of climate change.  However, while there is clear evidence of a changing climate, understanding the significance of climate change at the temporal and spatial scales as it relates to engineering practice is more difficult. There is an increasing demand for engineers to address future climate change into project design criteria; however, current practices and rules governing such practices do not adequately address concerns associated with climate change… Climate change poses a potentially serious impact on worldwide water resources, energy production and use, agriculture, forestry, coastal development and resources, flood control and public infrastructure… The ASIH is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The ASN is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf [The ASPB is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] Adopted by the ASA Board of Directors The American Statistical Association (ASA) recently convened a workshop of leading atmospheric scientists and statisticians involved in climate change research. The goal of this workshop was to identify a consensus on the role of statistical science in current assessments of global warming and its impacts. Of particular interest to this workshop was the recently published Fourth Assessment Report of the United Nations’ Intergovernmental Panel on Climate Change (IPCC), endorsed by more than 100 governments and drawing on the expertise of a large portion of the climate science community. Through a series of meetings spanning several years, IPCC drew in leading experts and assessed the relevant literature in the geosciences and related disciplines as it relates to climate change. The Fourth Assessment Report finds that “Warming of the climate system is unequivocal, as is now evident from observations of increases in global average air and ocean temperatures, widespread melting of snow and ice, and rising mean sea level. … Most of the observed increase in globally averaged temperatures since the mid-20th century is very likely due to the observed increase in anthropogenic greenhouse gas concentrations. … Discernible human influences now extend to other aspects of climate, including ocean warming, continental-average temperatures, temperature extremes, and wind patterns. [The ASA is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] After people, water is our most critical and strategic natural resource, yet the U.S. lack a national strategy for water resources management. In addition, Americans are the world’s largest water consumers. Threats of an aging infrastructure, climate change and population growth are so significant that the nation can no longer afford to postpone action. It’s imperative that a focused effort be articulated and initiated to create and demonstrate strategies to sustain U.S. water resources. The country’s future growth and prosperity depend on it. The ATS is also a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ The ASLO is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The ATBC is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The AERC is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The AAFA is a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ There is broad scientific consensus that coral reefs are heavily affected by the activities of man and there are significant global influences that can make reefs more vulnerable such as global warming… It is highly likely that coral bleaching has been exacerbated by global warming. There is almost total consensus among experts that the earth’s climate is changing as a result of the build-up of greenhouse gases. The IPCC (involving over 3,000 of the world’s experts) has come out with clear conclusions as to the reality of this phenomenon. One does not have to look further than the collective academy of scientists worldwide to see the string (of) statements on this worrying change to the earth’s atmosphere… Given the observed damage caused by a temperature increase of ~1°C above pre-industrial levels, we urge all possible actions to keep future warming below the 1.5°C target set by the Paris Agreement. The following proposed initiatives will act to reduce the severity of climate-inflicted damage on reefs, helping to avoid total ecological collapse. The ACRS strongly supports the following proposed actions… The AIP supports a reduction of the green house gas emissions that are leading to increased global temperatures, and encourages research that works towards this goal… Research in Australia and overseas shows that an increase in global temperature will adversely affect the Earth’s climate patterns. The melting of the polar ice caps, combined with thermal expansion, will lead to rises in sea levels that may impact adversely on our coastal cities. The impact of these changes on biodiversity will fundamentally change the ecology of Earth… Human health is ultimately dependent on the health of the planet and its ecosystem. The AMA recognises the latest findings regarding the science of climate change, the role of humans, past observations and future projections. The consequences of climate change have serious direct and indirect, observed and projected health impacts both globally and in Australia. There is inequity in the distribution of these health impacts both within and between countries, with some groups being particularly vulnerable. In recognition of these issues surrounding climate change and health, the AMA believes that: Global climate has changed substantially. Global climate change and global warming are real and observable… Human influence has been detected in the warming of the atmosphere and the ocean globally, and in Australia. It is now certain that the human activities that have increased the concentration of greenhouse gases in the atmosphere contribute significantly to observed warming. Further it is extremely likely that these human activities are responsible for most of the observed global warming since 1950. The warming associated with increases in greenhouse gases originating from human activity is called the enhanced greenhouse effect…. Our climate is very likely to continue to change as a result of human activity. Global temperature increases are already set to continue until at least the middle of this century even if emissions were reduced to zero. The magnitude of warming and related changes can be limited depending on the total amount of carbon dioxide and other greenhouse gases ultimately emitted as a result of human activities; future climate scenarios depend critically on future changes in emissions… BioQUEST is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The BSA is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf We, the members of the Board of Trustees of CFCAS and Canadian climate science leaders from the public and academic sectors in Canada, concur with The Joint Science Academies statement that “climate change is real” and note that the 2004 Arctic Climate Impact Assessment concluded that Arctic temperatures have risen at almost twice the rate of the rest of the world over the past few decades. Furthermore, we endorse the assessment of climate science undertaken by the Intergovernmental Panel on Climate Change (IPCC) and its conclusion that “There is new and stronger evidence that most of the warming observed over the last 50 years is attributable to human activities.” There is now increasing unambiguous evidence of a changing climate in Canada and around the world… There is an increasing urgency to act on the threat of climate change. Significant steps are needed to stop the growth in atmospheric greenhouse gas concentrations by reducing emissions. Since mitigation measures will become effective only after many years, adaptive strategies as well are of great importance and need to begin now…. …Since the industrial revolution of the early 19th century, human activities have also markedly influenced the climate. This well-documented human-induced change is large and very rapid in comparison to past changes in the Earth’s climate… Even if the human-induced emission of greenhouse gases into the atmosphere were to cease today, past emissions have committed the world to long-term changes in climate. Carbon dioxide emitted from the combustion of fossil fuels will remain in the atmosphere for centuries to millennia, and the slow ocean response to atmospheric warming will cause the climate change to persist even longer. Further CO2 emissions will lead to greater human-induced change in proportion to total cumulative emissions. Meaningful interventions to mitigate climate change require a reduction in emissions. To avoid societally, economically, and ecologically disruptive changes to the Earth’s climate, we will have little choice but to leave much of the unextracted fossil fuel carbon in the ground… The urgent challenges for the global community, and Canadians in particular, are to learn how to adapt to the climate changes to which we are already committed and to develop effective and just responses to avoid further damaging climate change impacts for both present and future generations. The COL is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf A comprehensive body of scientific evidence indicates beyond reasonable doubt that global climate change is now occurring and that its manifestations threaten the stability of societies as well as natural and managed ecosystems. Increases in ambient temperatures and changes in related processes are directly linked to rising anthropogenic greenhouse gas (GHG) concentrations in the atmosphere. The potential related impacts of climate change on the ability of agricultural systems, which include soil and water resources, to provide food, feed, fiber, and fuel, and maintenance of ecosystem services (e.g., water supply and habitat for crop landraces, wild relatives, and pollinators) as well as the integrity of the environment, are major concerns. Around the world and in the United States (US), agriculture—which is comprised of field, vegetable, and tree crops, as well as livestock production—constitutes a major land use which influences global ecosystems. Globally, crop production occupies approximately 1.8 Billion (B) hectares out of a total terrestrial land surface of about 13.5 B hectares. In addition, animal production utilizes grasslands, rangelands, and savannas, which altogether cover about a quarter of the Earth’s land. Even in 2010, agriculture remains the most basic and common human occupation on the planet and a major contributor to human well-being. Changes in climate are already affecting the sustainability of agricultural systems and disrupting production. [The May 2011 Statement was also signed by the American Society of Agronomy and the Soil Science Society of America.] [The CSSA is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] Ecosystems are already responding to climate change. Continued warming—some of which is now unavoidable—may impair the ability of many such systems to provide critical resources and services like food, clean water, and carbon sequestration. Buffering against the impacts of climate change will require new strategies to both mitigate the extent of change and adapt to changes that are inevitable. The sooner such strategies are deployed, the more effective they will be in reducing irreversible damage. Ecosystems can be managed to limit and adapt to both the near- and long-term impacts of climate change. Strategies that focus on restoring and maintaining natural ecosystem function (reducing deforestation, for example) are the most prudent; strategies that drastically alter ecosystems may have significant and unpredictable impacts… The Earth is warming— average global temperatures have increased by 0.74°C (1.3°F) in the past 100 years. The scientific community agrees that catastrophic and possibly irreversible environmental change will occur if average global temperatures rise an additional 2°C (3.6°F). Warming to date has already had significant impacts on the Earth and its ecosystems, including increased droughts, rising sea levels, disappearing glaciers, and changes in the distribution and seasonal activities of many species… Most warming seen since the mid 1900s is very likely due to greenhouse gas emissions from human activities. Global emissions have risen rapidly since pre-industrial times, increasing 70% between 1970 and 2004 alone… Even if greenhouse gas emissions stop immediately, global temperatures will continue to rise at least for the next 100 years. Depending on the extent and effectiveness of climate change mitigation strategies, global temperatures could rise 1-6°C (2-10°F) by the end of the 21st century, according to the Intergovernmental Panel on Climate Change. Swift and significant emissions reductions will be vital in minimizing the impacts of warming… [The ESA is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] Engineers Australia accepts the comprehensive scientific basis regarding climate change, the influence of anthropogenic global warming, and that climate change can have very serious community consequences. Engineers are uniquely placed to provide both mitigation and adaptation solutions for this serious global problem, as well as address future advances in climate change science. This Climate Change Policy Statement has been developed to enable organisational governance on the problem, and provide support for members in the discipline and practice of the engineering profession. Building upon a long history of Engineers Australia policy development, and as the largest technically informed professional body in Australia, Engineers Australia advocates that Engineers must act proactively to address climate change as an ecological, social and economic risk… The ESA is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf Human activity is most likely responsible for climate warming. Most of the climatic warming over the last 50 years is likely to have been caused by increased concentrations of greenhouse gases in the atmosphere. Documented long-term climate changes include changes in Arctic temperatures and ice, widespread changes in precipitation amounts, ocean salinity, wind patterns and extreme weather including droughts, heavy precipitation, heat waves and the intensity of tropical cyclones. The above development potentially has dramatic consequences for mankind’s future… The EFG recognizes the work of the IPCC and other organizations, and subscribes to the major findings that climate change is happening, is predominantly caused by anthropogenic emissions of CO2, and poses a significant threat to human civilization. Anthropogenic CO2 emissions come from fossil carbon sources, such as coal, oil, natural gas, limestone and carbonate rocks. Thriving and developing economies currently depend on these resources. Since geologists play a crucial role in their exploration and exploitation, we feel praised by the increasing welfare, but also implicated by the carbon curse. It is clear that major efforts are necessary to quickly and strongly reduce CO2 emissions. The EFG strongly advocates renewable and sustainable energy production, including geothermal energy, as well as the need for increasing energy efficiency. Impacts of ocean acidification may be just as dramatic as those of global warming (resulting from anthropogenic activities on top of natural variability) and the combination of both are likely to exacerbate consequences, resulting in potentially profound changes throughout marine ecosystems and in the services that they provide to humankind… Since the beginning of the industrial revolution the release of carbon dioxide (CO ) from our industrial and agricultural activities has resulted in atmospheric CO  concentrations that have increased from approximately 280 to 385 parts per million (ppm). The atmospheric concentration of CO  is now higher than experienced on Earth for at least the last 800,000 years (direct ice core evidence) and probably the last 25 million years, and is expected to continue to rise at an increasing rate, leading to significant temperature increases in the atmosphere and ocean in the coming decades… Ocean acidification is already occurring today and will continue to intensify, closely tracking atmospheric CO2 increase. Given the potential threat to marine ecosystems and its ensuing impact on human society and economy, especially as it acts in conjunction with anthropogenic global warming, there is an urgent need for immediate action. This rather new recognition that, in addition to the impact of CO  as a greenhouse gas on global climate change, OA is a direct consequence of the absorption of anthropogenic CO  emissions, will hopefully help to set in motion an even more stringent CO  mitigation policy worldwide. The only solutions to avoid excessive OA are a long-term mitigation strategy to limit future release of CO  to the atmosphere and/or enhance removal of excess CO  from the atmosphere. The emission of anthropogenic greenhouse gases, among which carbon dioxide is the main contributor, has amplified the natural greenhouse effect and led to global warming. The main contribution stems from burning fossil fuels. A further increase will have decisive effects on life on earth. An energy cycle with the lowest possible CO2 emission is called for wherever possible to combat climate change. The forthcoming United Nations Climate Change Conference (Paris, December 2015) will be held with the objective of achieving a binding and global agreement on climate-related policy from all nations of the world. This conference, seeking to protect the climate, will be a great opportunity to find solutions in the human quest for sustainable energy as a global endeavour. The Energy Group of the European Physical Society (EPS) welcomes the energy policy of the European Union (EU) to promote renewable energies for electricity generation, together with energy efficiency measures. This policy needs to be implemented by taking into account the necessary investments and the impact on the economical position of the EU in the world. Since the direct impact of any EU energy policy on world CO2 emissions is rather limited, the best strategy is to take the lead in mitigating climate change and in developing an energy policy that offers an attractive and economically viable model with reduced CO2 emissions and lower energy dependence… The scientific evidence is now overwhelming that climate change is a serious global threat which requires an urgent global response, and that climate change is driven by human activity… Enough is now known to make climate change the challenge of the 21st century, and the research community is poised to address this challenge… There is now convincing evidence that since the industrial revolution, human activities, resulting in increasing concentrations of greenhouse gases have become a major agent of climate change. These greenhouse gases affect the global climate by retaining heat in the troposphere, thus raising the average temperature of the planet and altering global atmospheric circulation and precipitation patterns. While on-going national and international actions to curtail and reduce greenhouse gas emissions are essential, the levels of greenhouse gases currently in the atmosphere, and their impact, are likely to persist for several decades. On-going and increased efforts to mitigate climate change through reduction in greenhouse gases are therefore crucial… The European Space Sciences Committee (ESSC) supports the Article (2) agreement on climate change of the Declaration of the ‘2015 Budapest World Science Forum on the enabling power of science’ urges such a universal agreement aiming at stabilising atmospheric concentrations of greenhouse gases and reducing the amount of airborne particles. The ESSC encourages countries to reduce their emissions in order to avoid dangerous anthropogenic interference with the climate system, which could lead to disastrous consequences. Such consequences, albeit from natural evolution, are witnessed in other objects of our Solar System. Global climate change is real and measurable. Since the start of the 20th century, the global mean surface temperature of the Earth has increased by more than 0.7°C and the rate of warming has been largest in the last 30 years… Key vulnerabilities arising from climate change include water resources, food supply, health, coastal settlements, biodiversity and some key ecosystems such as coral reefs and alpine regions. As the atmospheric concentration of greenhouse gases increases, impacts become more severe and widespread. To reduce the global net economic, environmental and social losses in the face of these impacts, the policy objective must remain squarely focused on returning greenhouse gas concentrations to near pre-industrial levels through the reduction of emissions… The spatial and temporal fingerprint of warming can be traced to increasing greenhouse gas concentrations in the atmosphere, which are a direct result of burning fossil fuels, broad-scale deforestation and other human activity. Decades of scientific research have shown that climate can change from both natural and anthropogenic causes. The Geological Society of America (GSA) concurs with assessments by the National Academies of Science (2005), the National Research Council (2011), the Intergovernmental Panel on Climate Change (IPCC, 2013) and the U.S. Global Change Research Program (Melillo et al., 2014) that global climate has warmed in response to increasing concentrations of carbon dioxide (CO2) and other greenhouse gases. The concentrations of greenhouse gases in the atmosphere are now higher than they have been for many thousands of years. Human activities (mainly greenhouse-gas emissions) are the dominant cause of the rapid warming since the middle 1900s (IPCC, 2013). If the upward trend in greenhouse-gas concentrations continues, the projected global climate change by the end of the twenty-first century will result in significant impacts on humans and other species. The tangible effects of climate change are already occurring. Addressing the challenges posed by climate change will require a combination of adaptation to the changes that are likely to occur and global reductions of CO2 emissions from anthropogenic sources… [The GSA is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] The HCWH is a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ The HCCC is a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ Human activities have increased the concentration of these atmospheric greenhouse gases, and although the changes are relatively small, the equilibrium maintained by the atmosphere is delicate, and so the effect of these changes is significant. The world’s most important greenhouse gas is carbon dioxide, a by-product of the burning of fossil fuels. … Professional engineers commonly deal with risk, and frequently have to make judgments based on incomplete data. The available evidence suggests very strongly that human activities have already begun to make significant changes to the earth’s climate, and that the longterm risk of delaying action is greater than the cost of avoiding/minimising the risk. Scientific evidence is overwhelming that current energy trends are unsustainable. Immediate action is required to effect change in the timeframe needed to address significant ecological, human health and development, and energy security needs. Aggressive changes in policy are thus needed to accelerate the deployment of superior technologies. With a combination of such policies at the local, national, and international level, it should be possible—both technically and economically—to elevate the living conditions of most of humanity, while simultaneously addressing the risks posed by climate change and other forms of energy-related environmental degradation and reducing the geopolitical tensions and economic vulnerabilities generated by existing patterns of dependence on predominantly fossil-fuel resources… The Study Panel believes that, given the dire prospect of climate change, the following three recommendations should be acted upon without delay and simultaneously: Taking into account the three urgent recommendations above, another recommendation stands out by itself as a moral and social imperative and should be pursued with all means available While the Earth’s climate has changed many times during the planet’s history because of natural factors, including volcanic eruptions and changes in the Earth’s orbit, never before have we observed the present rapid rise in temperature and carbon dioxide (CO ). Human activities resulting from the industrial revolution have changed the chemical composition of the atmosphere…. Deforestation is now the second largest contributor to global warming, after the burning of fossil fuels. These human activities have significantly increased the concentration of “greenhouse gases” in the atmosphere… As the Earth’s climate warms, we are seeing many changes: stronger, more destructive hurricanes; heavier rainfall; more disastrous flooding; more areas of the world experiencing severe drought; and more heat waves. As reported by the Intergovernmental Panel on Climate Change (IPCC), most of the observed global warming since the mid-20th century is very likely due to human-produced emission of greenhouse gases and this warming will continue unabated if present anthropogenic emissions continue or, worse, expand without control. CAETS, therefore, endorses the many recent calls to decrease and control greenhouse gas emissions to an acceptable level as quickly as possible. There is now strong evidence that significant global warming is occurring. The evidence comes from direct measurements of rising surface air temperatures and subsurface ocean temperatures and, indirectly, from increases in average global sea levels, retreating glaciers, and changes in many physical and biological systems. It is very likely that most of the observed increase in global temperatures since the mid-twentieth century is due to human-induced increases in greenhouse gas concentrations in the atmosphere (IPCC 2007). Human activities are now causing atmospheric concentrations of greenhouse gases – including carbon dioxide, methane, tropospheric ozone, and nitrous oxide – to rise well above pre-industrial levels. Carbon dioxide levels have increased from 280 ppm in 1750 to over 380 ppm today, higher than any previous levels in at least the past 650,000 years. Increases in greenhouse gases are causing temperatures to rise; the Earth’s surface warmed by approximately 0.6°C over the twentieth century. The Intergovernmental Panel on Climate Change (IPCC) has forecast that average global surface temperatures will continue to increase, reaching between 1.1°C and 6.4°C above 1990 levels, by 2100. The uncertainties about the amount of global warming we face in coming decades can be reduced through further scientific research. Part of this research must be better documenting and understanding past climate change. Research on Earth’s climate in the recent geologic past provides insights into ways in which climate can change in the future. It also provides data that contribute to the testing and improvement of the computer models that are used to predict future climate change. Reduce the causes of climate change The scientific understanding of climate change is now sufficiently clear to justify nations taking prompt action. A lack of full scientific certainty about some aspects of climate change is not a reason for delaying an immediate response that will, at a reasonable cost, prevent dangerous anthropogenic interference with the climate system. It is vital that all nations identify cost-effective steps that they can take now to contribute to substantial and long-term reduction in net global greenhouse gas emissions. Action taken now to reduce significantly the build-up of greenhouse gases in the atmosphere will lessen the magnitude and rate of climate change. Fossil fuels, which are responsible for most of carbon dioxide emissions produced by human activities, provide valuable resources for many nations and will provide 85% of the world energy demand over the next 25 years (IEA 2004). Minimizing the amount of this carbon dioxide reaching the atmosphere presents a huge challenge but must be a global priority. The advances in scientific understanding of the Earth system generated by collaborative international, regional, and national observations and research programs; and The comprehensive and widely accepted and endorsed scientific assessments carried out by the Intergovernmental Panel on Climate Change and regional and national bodies, which have firmly established, on the basis of scientific evidence, that human activities are the primary cause of recent climate change; Continuing reliance on combustion of fossil fuels as the world’s primary source of energy will lead to much higher atmospheric concentrations of greenhouse gases, which will, in turn, cause significant increases in surface temperature, sea level, ocean acidification, and their related consequences to the environment and society; Stabilization of climate to avoid “dangerous anthropogenic interference with the climate system”, as called for in the UN Framework Convention on Climate Change, will require significant cutbacks in greenhouse gas emissions during the 21st century; and Mitigation of and adaptation to climate change can be made more effective by reducing uncertainties regarding feedbacks and the associated mechanisms; Nations collectively to begin to reduce sharply global atmospheric emissions of greenhouse gases and absorbing aerosols, with the goal of urgently halting their accumulation in the atmosphere and holding atmospheric levels at their lowest practicable value; National and international agencies to adequately support comprehensive observation and research programs that can clarify the urgency and extent of needed mitigation and promote adaptation to the consequences of climate change; Resource managers, planners, and leaders of public and private organizations to incorporate information on ongoing and projected changes in climate and its ramifications into their decision-making, with goals of limiting emissions, reducing the negative consequences of climate change, and enhancing adaptation, public well-being, safety, and economic vitality; and Organizations around the world to join with IUGG and its member Associations to encourage scientists to communicate freely and widely with public and private decision-makers about the consequences and risks of on-going climate change and actions that can be taken to limit climate change and promote adaptation; and To act with its member Associations to develop and implement an integrated communication and outreach plan to increase public understanding of the nature and implications of human-induced impacts on the Earth system, with the aim of reducing detrimental consequences. The LMS is a signatory to the July 21, 2015 UK science communiqué on climate change The NACCHO is a signatory to the April 2016 declaration: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ The National Association of Geoscience Teachers (NAGT) recognizes: (1) that Earth’s climate is changing, (2) that present warming trends are largely the result of human activities, and (3) that teaching climate change science is a fundamental and integral part of earth science education. The core mission of NAGT is to “foster improvement in the teaching of the earth sciences at all levels of formal and informal instruction, to emphasize the cultural significance of the earth sciences and to disseminate knowledge in this field to the general public.” The National Science Education Standards call for a populace that understands how scientific knowledge is both generated and verified, and how complex interactions between human activities and the environment can impact the Earth system. Climate is clearly an integral part of the Earth system connecting the physical, chemical and biological components and playing an essential role in how the Earth’s environment interacts with human culture and societal development. Thus, climate change science is an essential part of Earth Science education and is fundamental to the mission set forth by NAGT. In recognition of these imperatives, NAGT strongly supports and will work to promote education in the science of climate change, the causes and effects of current global warming, and the immediate need for policies and actions that reduce the emission of greenhouse gases. The NAHN is a signatory to the April 2016 declaration: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ The NAML is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The NEHA is a signatory to the April 2016 declaration: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ The NMA is a signatory to the April 2016 declaration: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ Many national science academies have published formal statements and declarations acknowledging the state of climate science, the fact that climate is changing, the compelling evidence that humans are responsible, and the need to debate and implement strategies to reduce emissions of greenhouse gases. A few examples of joint academy statements are listed here. Following the release of the third in the ongoing series of international reviews of climate science conducted by the Intergovernmental Panel on Climate Chang (IPCC), seventeen national science academies issued a joint statement, entitled “The Science of Climate Change,” acknowledging the IPCC study to be the scientific consensus on climate change science. The statement was signed by: Australian Academy of Sciences, Royal Flemish Academy of Belgium for Sciences and the Arts, Brazilian Academy of Sciences, Royal Society of Canada, Caribbean Academy of Sciences, Chinese Academy of Sciences, French Academy of Sciences, German Academy of Natural Scientists Leopoldina, Indian National Science Academy, Indonesian Academy of Sciences, Royal Irish Academy, Accademia Nazionale dei Lincei (Italy), Academy of Sciences Malaysia, Academy Council of the Royal Society of New Zealand, Royal Swedish Academy of Sciences, Turkish Academy of Sciences, and Royal Society (UK). Eleven national science academies, including all of the largest emitters of greenhouse gases, signed a statement that the scientific understanding of climate change was sufficiently strong to justify prompt action. The statement explicitly endorsed the IPCC consensus and stated: “…there is now strong evidence that significant global warming is occurring. The evidence comes from direct measurements of rising surface air temperatures and subsurface ocean temperatures and from phenomena such as increases in average global sea levels, retreating glaciers, and changes to many physical and biological systems. It is likely that most of the warming in recent decades can be attributed to human activities (IPCC 2001). This warming has already led to changes in the Earth’s climate.” The statement was signed by the science academies of: Brazil, Canada, China, France, Germany, India, Italy, Japan, Russia, the United Kingdom, and the United States. In 2007, seventeen national academies issued a joint declaration reconfirming previous statements and strengthening language based on new research from the fourth assessment report of the IPCC, including the following: “It is unequivocal that the climate is changing, and it is very likely that this is predominantly caused by the increasing human interference with the atmosphere. These changes will transform the environmental conditions on Earth unless counter-measures are taken.” The thirteen signatories were the national science academies of Brazil, Canada, China, France, Germany, Italy, India, Japan, Mexico, Russia, South Africa, the United Kingdom, and the United States. In 2007, the Network of African Science Academies submitted a joint “statement on sustainability, energy efficiency, and climate change:” “A consensus, based on current evidence, now exists within the global scientific community that human activities are the main source of climate change and that the burning of fossil fuels is largely responsible for driving this change. The Intergovernmental Panel on Climate Change (IPCC) reached this conclusion with “90 percent certainty” in its Fourth Assessment issued earlier this year. The IPCC should be congratulated for the contribution it has made to public understanding of the nexus that exists between energy, climate and sustainability.” The thirteen signatories were the science academies of Cameroon, Ghana, Kenya, Madagascar, Nigeria, Senegal, South Africa, Sudan, Tanzania, Uganda, Zambia, Zimbabwe, as well as the African Academy of Sciences. In 2008, the thirteen signers of the 2007 joint academies declaration issued a statement reiterating previous statements and reaffirming “that climate change is happening and that anthropogenic warming is influencing many physical and biological systems.” Among other actions, the declaration urges all nations to “(t)ake appropriate economic and policy measures to accelerate transition to a low carbon society and to encourage and effect changes in individual and national behaviour.” The thirteen signatories were the national science academies of Brazil, Canada, China, France, Germany, Italy, India, Japan, Mexico, Russia, South Africa, the United Kingdom, and the United States. In May 2009, thirteen national academies issued a joint statement that said among other things: “The IPCC 2007 Fourth Assessment of climate change science concluded that large reductions in the emissions of greenhouse gases, principally CO2, are needed soon to slow the increase of atmospheric concentrations, and avoid reaching unacceptable levels. However, climate change is happening even faster than previously estimated; global CO2 emissions since 2000 have been higher than even the highest predictions, Arctic sea ice has been melting at rates much faster than predicted, and the rise in the sea level has become more rapid. Feedbacks in the climate system might lead to much more rapid climate changes. The need for urgent action to address climate change is now indisputable.” The thirteen signatories were the national science academies of Brazil, Canada, China, France, Germany, Italy, India, Japan, Mexico, Russia, South Africa, the United Kingdom, and the United States. In addition to the statement signed in 2001 by the Royal Flemish Academy of Belgium for Sciences and the Arts, the Academie Royale des Sciences, des Lettres & des Beaux-arts de Belgique (the French language academy in Belgium) issued a formal statement: In July 2015, the Royal Society and member organizations issued a joint “U.K. Science Communiqué on Climate Change.” In part, that statement reads: “The scientific evidence is now overwhelming that the climate is warming and that human activity is largely responsible for this change through emissions of greenhouse gases. Governments will meet in Paris in November and December this year to negotiate a legally binding and universal agreement on tackling climate change. Any international policy response to climate change must be rooted in the latest scientific evidence. This indicates that if we are to have a reasonable chance of limiting global warming in this century to 2°C relative to the pre-industrial period, we must transition to a zero-carbon world by early in the second half of the century. To achieve this transition, governments should demonstrate leadership by recognising the risks climate change poses, embracing appropriate policy and technological responses, and seizing the opportunities of low-carbon and climate-resilient growth.” It was signed by: The Academy of Medical Sciences (UK), The Academy of Social Sciences (UK), The British Academy for the Humanities and Social Sciences, The British Ecological Society, The Geological Society (UK), The Challenger Society for Marine Sciences, The Institution of Civil Engineers (UK), The Institution of Chemical Engineers, The Institution of Environmental Sciences, The Institute of Physics, The Learned Society of Wales, London Mathematical Society, Royal Astronomical Society, Royal Economic Society, Royal Geographic Society, Royal Meteorological Society, Royal Society, Royal Society of Biology, Royal Society of Chemistry, Royal Society of Edinburgh, Society for General Microbiology, Wellcome Trust, Zoological Society of London Climate change is occurring, is caused largely by human activities, and poses significant risks for — and in many cases is already affecting — a broad range of human and natural systems. The compelling case for these conclusions is provided in Advancing the Science of Climate Change, part of a congressionally requested suite of studies known as America’s Climate Choices. While noting that there is always more to learn and that the scientific process is never closed, the book shows that hypotheses about climate change are supported by multiple lines of evidence and have stood firm in the face of serious debate and careful evaluation of alternative explanations. [The U.S. National Academies of Sciences have also signed a long series of statements with other national academies around the world in support of the state-of-the-science.] The NSCA is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf Acid rain, toxic air pollutants, and greenhouse gas emissions are a major threat to human health and welfare, as well as plant and animal life. Based on recognized adequate research of the causes and effects of the various forms of air pollution, the federal government should establish environmentally and economically sound standards for the reduction and control of these emissions. The OBFS is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The PHI is a signatory to the April 2016 declaration: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ The RAS is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The RES is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The RGS is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The Fourth Assessment Report (AR4) of the Inter-Governmental Panel on Climate Change (IPCC) is unequivocal in its conclusion that climate change is happening and that humans are contributing significantly to these changes. The evidence, from not just one source but a number of different measurements, is now far greater and the tools we have to model climate change contain much more of our scientific knowledge within them. The world’s best climate scientists are telling us it’s time to do something about it. Carbon Dioxide is such an important greenhouse gas because there is an increasing amount of it in the atmosphere from the burning of fossil fuels and it stays in the atmosphere for such a long time; a hundred years or so. The changes we are seeing now in our climate are the result of emissions since industrialisation and we have already set in motion the next 50 years of global warming – what we do from now on will determine how worse it will get. The RMS is also a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The RS is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF Climate change is one of the defining issues of our time. It is now more certain than ever, based on many lines of evidence, that humans are changing Earth’s climate. The atmosphere and oceans have warmed, accompanied by sea-level rise, a strong decline in Arctic sea ice, and other climate-related changes. The evidence is clear. We strongly support the introduction of policies to significantly reduce UK and global greenhouse gas emissions, as we feel that the consequences of climate change will be severe. We believe that biologists have a crucial role to play in developing innovative biotechnologies to generate more efficient and environmentally sustainable biofuels, and to capture and store greenhouse gases from power stations and the atmosphere. It is important for the government to continue to consult scientists, to review policy, and to encourage new technologies so as to ensure the best possible strategies are used to combat this complex issue. We are in favour of reducing energy demands, in particular by improvements in public transport and domestic appliances. As some degree of climate change is inevitable, we encourage the development of adaptation strategies to reduce the effects of global warming on our environment. There is an overwhelming scientific consensus worldwide, and a broad political consensus, that greenhouse gas emissions are affecting global climate, and that measures are needed to reduce these emissions significantly so as to limit the extent of climate change. The term ‘climate change’ is used predominantly to refer to global warming and its consequences, and this policy briefing will address these issues. Although long-term fluctuations in global temperature occur due to various factors such as solar activity, there is scientific agreement that the rapid global warming that has occurred in recent years is mostly anthropogenic, i.e. due to human activity. The absorption and emission of solar radiation by greenhouse gases causes the atmosphere to warm. Human activities such as fossil fuel consumption and deforestation have elevated atmospheric levels of greenhouse gases such as carbon dioxide, methane and nitrous oxide significantly since pre-industrial times. The RSB is also a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The RSC is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The RSE is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF Warming of the climate system is unequivocal, and since the 1950s, many of the observed changes are unprecedented over decades to millennia. The atmosphere and oceans have warmed, the amounts of snow and ice have diminished, and sea level has risen. Global surface temperatures have warmed, on average, by around one degree Celsius since the late 19th century. Much of the warming, especially since the 1950s, is very likely a result of increased amounts of greenhouse gases in the atmosphere, resulting from human activity. The Northern Hemisphere have warmed much faster than the global average, while the southern oceans south of New Zealand latitudes have warmed more slowly. Generally, continental regions have warmed more than the ocean surface at the same latitudes. Global sea levels have risen around 19 cm since the start of the 20th century, and are almost certain to rise at a faster rate in future. Surface temperature is projected to rise over the 21st century under all assessed emission scenarios. It is very likely that heat waves will occur more often and last longer, and that extreme precipitation events will become more intense and frequent in many regions. The ocean will continue to warm and acidify, and global mean sea level will continue to rise. Relatively small changes in average climate can have a big effect on the frequency of occurrence or likelihood of extreme events. How the future plays out depends critically on the emissions of greenhouses gases that enter the atmosphere over coming decades. New Zealand is being affected by climate change and impacts are set to increase in magnitude and extent over time. Floods, storms, droughts and fires will become more frequent unless significant action is taken to reduce global emissions of greenhouse gases, which are changing the climate. Even small changes in average climate conditions are likely to lead to large changes in the frequency of occurrence of extreme events. Our societies are not designed to cope with such rapid changes. The SGM is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The SIAM is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The SMB is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The SSAR is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The Society of American Foresters (SAF) believes that climate change policies and actions should recognize the role that forests play in reducing greenhouse gas (GHG) emissions through 1) the substitution of wood products for nonrenewable building materials, 2) forest biomass substitution for fossil fuel-based energy sources, 3) reducing wildfire and other disturbance emissions, and 4) avoided land-use change. SAF also believes that sustainably managed forests can reduce GHG concentrations by sequestering atmospheric carbon in trees and soil, and by storing carbon in wood products made from the harvested trees. Finally, climate change policies can invest in sustainable forest management to achieve these benefits, and respond to the challenges and opportunities that a changing climate poses for forests. Of the many ways to reduce GHG emissions and atmospheric particulate pollution, the most familiar are increasing energy efficiency and conservation, and using renewable energy sources as a substitution for fossil fuels. Equally important is using forests to address climate change. Forests play an essential role controlling GHG emissions and atmospheric GHGs, while simultaneously providing essential environmental and social benefits, including clean water, wildlife habitat, recreation, and forest products that, in turn, store carbon. Finally, changes in long-term patterns of temperature and precipitation have the potential to dramatically affect forests nationwide through a variety of changes to growth and mortality (USDA Forest Service 2012). Many such changes are already evident, such as longer growing and wildfire seasons, increased incidence of pest and disease, and climate-related mortality of specific species (Westerling et al. 2006). These changes have been associated with increasing concentrations of atmospheric carbon dioxide (CO2) and other GHGs in the atmosphere. Successfully achieving the benefits forests can provide for addressing climate change will therefore require explicit and long-term policies and investment in managing these changes, as well as helping private landowners and public agencies understand the technologies and practices that can be used to respond to changing climate conditions… The SoN is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf The SSB is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf A comprehensive body of scientific evidence indicates beyond reasonable doubt that global climate change is now occurring and that its manifestations threaten the stability of societies as well as natural and managed ecosystems. Increases in ambient temperatures and changes in related processes are directly linked to rising anthropogenic greenhouse gas (GHG) concentrations in the atmosphere. The potential related impacts of climate change on the ability of agricultural systems, which include soil and water resources, to provide food, feed, fiber, and fuel, and maintenance of ecosystem services (e.g., water supply and habitat for crop landraces, wild relatives, and pollinators) as well as the integrity of the environment, are major concerns. Around the world and in the United States (US), agriculture—which is comprised of field, vegetable, and tree crops, as well as livestock production—constitutes a major land use which influences global ecosystems. Globally, crop production occupies approximately 1.8 Billion (B) hectares out of a total terrestrial land surface of about 13.5 B hectares. In addition, animal production utilizes grasslands, rangelands, and savannas, which altogether cover about a quarter of the Earth’s land. Even in 2010, agriculture remains the most basic and common human occupation on the planet and a major contributor to human well-being. Changes in climate are already affecting the sustainability of agricultural systems and disrupting production. [The May 2011 Statement was also signed by the American Society of Agronomy and the Crop Science Society of America.] [The SSSA is also a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf] The AMS is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The AoSS is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The BAHSS is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The BES is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The CSMS is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The last century has seen a rapidly growing global population and much more intensive use of resources, leading to greatly increased emissions of gases, such as carbon dioxide and methane, from the burning of fossil fuels (oil, gas and coal), and from agriculture, cement production and deforestation. Evidence from the geological record is consistent with the physics that shows that adding large amounts of carbon dioxide to the atmosphere warms the world and may lead to: higher sea levels and flooding of low-lying coasts; greatly changed patterns of rainfall; increased acidity of the oceans; and decreased oxygen levels in seawater… There is now widespread concern that the Earth’s climate will warm further, not only because of the lingering effects of the added carbon already in the system, but also because of further additions as human population continues to grow… [The GS is also a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF] The IoP is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The ICE is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The ICE is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The IES is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF The LSoW is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF Human activities over the past 100 years have caused significant changes in the earth’s climatic conditions, resulting in severe alterations in regional temperature and precipitation patterns that are expected to continue and become amplified over the next 100 years or more. Although climates have varied since the earth was formed, few scientists question the role of humans in exacerbating recent climate change through the increase in emissions of greenhouse gases (e.g., carbon dioxide, methane, water vapor). Human activities contributing to climate warming include the burning of fossil fuels, slash and burn agriculture, methane production from animal husbandry practices, and land-use changes. The critical issue is no longer “whether” climate change is occurring, but rather how to address its effects on wildlife and wildlife- habitats… The TFAA is a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ The USCHA is a signatory to the April 2016 statement: http://www.lung.org/our-initiatives/healthy-air/outdoor/climate-change/declaration-on-climate-change.html?referrer=https://www.google.com/ The UCAR is a signatory to the June 28, 2016 letter to the U.S. Congress: https://www.eurekalert.org/images/2016climateletter6-28-16.pdf Wellcome is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF Now that the world has negotiated the Paris agreement to mitigate GHGs and pursue adaptation to the changing climate, the focus must now turn towards implementation to turn the words into action. The world’s engineers are a human resource that must be tapped to contribute to this implementation. All countries use engineers to deliver services that provide the quality of life that society enjoys, in particular, potable water, sanitation, shelter, buildings, roads, bridges, power, energy and other types of infrastructure. There are opportunities to achieve GHG reduction as well as improving the climate resilience of this infrastructure through design, construction and operation all of which require the expertise and experience of engineers. Engineers are problem-solvers and seek to develop feasible solutions that are cost-effective and sustainable. Engineers serve the public interest and offer objective, unbiased review and advice. Having their expertise to evaluate the technical feasibility and economic viability of proposals to reduce GHGs and to adapt to climate change impacts should be pursued. Engineers input and action is required to implement solutions at country and local levels. The international organization known as the World Federation of Engineering Organizations consist of members of national engineering organizations from over 90 developing and developed countries representing more than 20 million engineers. The WFEO offers to facilitate contact and engagement with these organizations to identify subject matter experts that will contribute their time and expertise as members of the engineering profession. The expertise of the world’s engineers is needed to help successfully implement the Paris agreement. We encourage all countries to engage their engineers in this effort. The WFEO is prepared to assist in this effort. The WFEO consists of national members representing more than 85 countries as well as 10 regional engineering organizations. These members collectively engage with more than 20 million engineers worldwide who are committed to serve the public interest through Codes of Practice and a Code of Ethics that emphasize professional practice in sustainable development, environmental stewardship and climate change. WFEO, the International Council for Science (ICSU) and the International Social Science Council (ISSC) are co-organizing partners of the UN Major Group on Scientific and Technological Communities, one of the nine major groups of civil society recognized by the United Nations. Engineers acknowledge that climate change is underway and that sustained efforts must be undertaken to address this worldwide challenge to society, our quality of life and prosperity. Urgent actions are required and the engineering profession is prepared to do its part towards implementing cost-effective, feasible and sustainable solutions working in partnership with stakeholders. Noting the conclusions of the United Nations’ Intergovernmental Panel on Climate Change (IPCC) and other climatologists that anthropogenic greenhouse gases, which contribute to global climate change, have substantially increased in atmospheric concentration beyond natural processes and have increased by 28 percent since the industrial revolution….Realizing that subsequent health effects from such perturbations in the climate system would likely include an increase in: heat-related mortality and morbidity; vector-borne infectious diseases,… water-borne diseases…(and) malnutrition from threatened agriculture….the World Federation of Public Health Associations…recommends precautionary primary preventive measures to avert climate change, including reduction of greenhouse gas emissions and preservation of greenhouse gas sinks through appropriate energy and land use policies, in view of the scale of potential health impacts… Over the last 50 years, human activities – particularly the burning of fossil fuels – have released sufficient quantities of carbon dioxide and other greenhouse gases to trap additional heat in the lower atmosphere and affect the global climate. In the last 130 years, the world has warmed by approximately 0.85oC. Each of the last 3 decades has been successively warmer than any preceding decade since 1850. Sea levels are rising, glaciers are melting and precipitation patterns are changing. Extreme weather events are becoming more intense and frequent… Many policies and individual choices have the potential to reduce greenhouse gas emissions and produce major health co-benefits. For example, cleaner energy systems, and promoting the safe use of public transportation and active movement – such as cycling or walking as alternatives to using private vehicles – could reduce carbon emissions, and cut the burden of household air pollution, which causes some 4.3 million deaths per year, and ambient air pollution, which causes about 3 million deaths every year. In 2015, the WHO Executive Board endorsed a new work plan on climate change and health. This includes: Partnerships: to coordinate with partner agencies within the UN system, and ensure that health is properly represented in the climate change agenda. Awareness raising: to provide and disseminate information on the threats that climate change presents to human health, and opportunities to promote health while cutting carbon emissions. Science and evidence: to coordinate reviews of the scientific evidence on the links between climate change and health, and develop a global research agenda. Support for implementation of the public health response to climate change: to assist countries to build capacity to reduce health vulnerability to climate change, and promote health while reducing carbon emissions. Climate change is the greatest threat to global health in the 21st century. Health professionals have a duty of care to current and future generations. You are on the front line in protecting people from climate impacts – from more heat-waves and other extreme weather events; from outbreaks of infectious diseases such as malaria, dengue and cholera; from the effects of malnutrition; as well as treating people that are affected by cancer, respiratory, cardiovascular and other non-communicable diseases caused by environmental pollution. Already the hottest year on record, 2015 will see nations attempt to reach a global agreement to address climate change at the United Nations Climate Change Conference (COP) in Paris in December. This may be the most important health agreement of the century: an opportunity not only to reduce climate change and its consequences, but to promote actions that can yield large and immediate health benefits, and reduce costs to health systems and communities… Since the beginning of the 20th century, scientists have been observing a change in the climate that cannot be attributed solely to natural influences. This change has occurred faster than any other climate change in Earth’s history and will have consequences for future generations. Scientists agree that this climate change is anthropogenic (human-induced). It is principally attributable to the increase of certain heat absorbing greenhouse gases in our atmosphere since the industrial revolution. The ever-increasing amount of these gases has directly lead to more heat being retained in the atmosphere and thus to increasing global average surface temperatures. The partners in the WMO Global Atmosphere Watch (GAW) compile reliable scientific data and information on the chemical composition of the atmosphere and its natural and anthropogenic change. This helps to improve the understanding of interactions between the atmosphere, the oceans and the biosphere. The World Meteorological Organization has published a detailed analysis of the global climate 2011-2015 – the hottest five-year period on record  – and the increasingly visible human footprint on extreme weather and climate events with dangerous and costly impacts. The record temperatures were accompanied by rising sea levels and declines in Arctic sea-ice extent, continental glaciers and northern hemisphere snow cover. All these climate change indicators confirmed the long-term warming trend caused by greenhouse gases. Carbon dioxide reached the significant milestone of 400 parts per million in the atmosphere for the first time in 2015, according to the WMO report which was submitted to U.N. climate change conference. The Zoological Society is a signatory to the July 21, 2015 UK science communiqué on climate change. https://royalsociety.org/~/media/policy/Publications/2015/21-07-15-climate-communique.PDF [Edited, compiled by Dr. Peter Gleick. Please send any corrections, additions, updates…]


No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. Male heterozygous ythdf2+/− fish in the *AB background were custom made by ZGeneBio. TALEN mutagenesis was performed to mutate ythdf2 (Ensembl ENSDART00000127043) with L1 recognition sequence 5′-GGACCTGGCCAATCCCC-3′, R1 recognition sequence 5′-GGCACAGTAATGCCACC-3′, and spacer sequence 5′-TCCCAATTCAGGAATG-3′. Purchased fish were outcrossed to in-house wild-type *AB fish. Embryos were obtained from natural crosses, were raised under standard conditions, and were staged according to literature26. Embryos were reared at 28.5 °C and all experiments and observations were performed as close to this temperature as possible. Fish lines were maintained in accordance with AAALAC research guidelines, under a protocol approved by the University of Chicago IACUC (Institutional Animal Care & Use Committee). The open reading frame of zebrafish ythdf2 was purchased from Open Biosystems (clone 5601005) and subcloned into a pCS2+ vector using restriction enzyme sites of BamHI and XhoI. The resulting vector was linearized by HindIII and used as a template for ythdf2 probe preparation. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription using standard reagents and methods. In situ hybridization protocol was followed essentially as previously reported27. All experiments were repeated at least once from biological samples. Control and ythdf2 morpholinos (5′-TGGCTGACATTTCTCACTCCCCGGT-3′) were obtained from Gene Tools (Oregon). 3 ng of either control or gene-specific morpholino was injected into *AB wild-type embryos at the one-cell stage. GFP and mCherry were subcloned into pCS2+ vectors and linearized by NotI. GFP-m6A, GFP-A, and mCherry-capped and polyadenylated mRNA was generated by in vitro transcription using mMessage mMachine SP6 kit (Thermo Fisher) and Poly(A) tailing kit (Thermo Fisher) according to the manufacturer’s protocol. Products were purified with the MEGAclear transcription clean-up kit (Thermo Fisher) and used for injections directly. For GFP-m6A, we spiked 6 nmol m6ATP into the 100 nmol ATP supplied in the transcription reaction, in order to ensure that less than 0.3% of GFP mRNAs are without m6A on average. (GFP mRNA is 942 nt; each mRNA has 1.89 m6A on average.) 35 pg of either GFP reporter mRNA and 10 pg of mCherry mRNA were injected together in 1.25 nl into embryos at the one-cell stage. ythdf2 mRNA containing the ythdf2 5′ UTR and a 3′ Flag tag, which was used to rescue the mutant phenotype and validate the knockdown efficiency of ythdf2 MO, was constructed in pCS2+ vector (forward primer: 5′-CGTACGGATCCTGTCTGATCTGCAGCTGTAG-3′; reverse primer: 5′-CGATGCTCGAGTTACTTGTCATCGTCGTCCTTGTAATCTATTCCAGATGGAGCAAGGC-3′) and prepared in the same way as mCherry mRNAs. Antibodies used in this study are listed below in the format of name (application; catalogue number; supplier): mouse anti-Flag HRP conjugate (Western; A5892; Sigma), rabbit anti-m6A (m6A-seq and m6A-CLIP-seq; 202003; Synaptic Systems), rabbit anti-histone H3 (IF; ab5176; Abcam), and anti-rabbit Alexa Fluor 488 (IF; ab150077; Abcam). All images were observed with a Leica MZFLIII microscope and captured with a Nikon D5000 digital camera using Camera Control Pro (Nikon) software. For fluorescent microscopy, standard ET-GFP and TXR LP filters (Leica) were used. For bright field imaging of live embryos, only saturation was adjusted and was adjusted identically for all images. For fluorescent imaging of live embryos, no image processing was performed. For fluorescent imaging of fixed embryos, contrast and exposure were adjusted for all to obtain the lowest amount of background while preserving the morphology of all visible nuclei. All experiments were repeated at least once from biological samples. To compare the total amount of DNA in wild-type and mutant embryos at different time points during the MZT, 10 embryos per time point per condition were dechorionated and pipetted into standard DNA lysis buffer. The number of embryos in each tube was counted twice to ensure uniformity. Proteinase K was added to 100 μg ml−1 and the embryos were incubated for 4 h at ~55 °C with occasional mixing. Proteinase K was inactivated by a 10-min incubation at 95 °C and the DNA was then phenol-chloroform-extracted, ethanol-precipitated, and resuspended in 100 μl Tris (pH 8.5) and 1 mM EDTA using standard procedures. Double-stranded DNA content was measured with NanoDrop. Three biological replicates (comprised of the offspring of three different fish mating pairs of the appropriate genotype) were measured for each time point for both the control and experimental samples. Biological replicates were averaged together to determine the average DNA amount per time point per genotype and to compute standard errors of the mean. All DNA values were normalized to that of wild-type embryos at 2.5 h.p.f. Embryos were collected into standard 2× protein sample buffer with added β-mercaptoethanol and protease inhibitors and immediately put on ice for a few minutes. The embryo mixtures were carefully but thoroughly pipetted up and down to dissolve and homogenize the embryos, and then samples were heated at 95 °C for 5 min and frozen at −80 °C. Before use, samples were again heated for 5 min and then centrifuged at 12,000 r.p.m. to remove debris. Supernatants were loaded into a 10-well, 1.5 mm Novex 4–20% Tris-Glycine Mini Protein Gel (Thermo Fisher) with 6 embryos per well. The gel was transferred onto a nitrocellulose membrane using iBlot2 gel transfer system (Thermo Fisher) set to P3 for 7 min with iBlot2 mini gel transfer stacks (Thermo Fisher). Membranes were blocked in 5% BSA, 0.05% Tween-20 in PBS for 1 h, and then incubated overnight at 4 °C with anti-Flag–HRP conjugate (Sigma) diluted 1:10,000 in 3% BSA. Proteins were visualized using the SuperSignal West Pico Luminol/Enhancer solution (Thermo Fisher) in FluorChem M system (ProteinSimple). mRNA isolation for LC-MS/MS: total RNA was isolated from zebrafish embryos with TRIzol reagent (Invitrogen) and Direct-zol RNA MiniPrep kit (Zymo). mRNA was extracted by removal of contaminating rRNA using RiboMinus Eukaryote Kit v2 (Thermo Fisher) for two rounds. Total RNA isolation for RT–qPCR: we followed the instruction of Direct-zol RNA MiniPrep kit (Zymo) with DNase I digestion step. Total RNA was eluted with RNase-free water and used for RT–qPCR directly. 100–200 ng of mRNA was digested by nuclease P1 (2 U) in 25 μl of buffer containing 10 mM of NH OAc (pH 5.3) at 42 °C for 2 h, followed by the addition of NH HCO (1 M, 3 μl, freshly made) and alkaline phosphatase (0.5 U). After an additional incubation at 37 °C for 2 h, the sample was diluted to 50 μl and filtered (0.22 μm pore size, 4 mm diameter, Millipore), and 5 μl of the solution was injected into LC-MS/MS. Nucleosides were separated by reverse-phase ultra-performance liquid chromatography on a C18 column with on-line mass spectrometry detection using an Agilent 6410 QQQ triple-quadrupole LC mass spectrometer in positive electrospray ionization mode. The nucleosides were quantified by using the nucleoside to base ion mass transitions of 282 to 150 (m6A), and 268 to 136 (A). Quantification was performed in comparison with the standard curve obtained from pure nucleoside standards running on the same batch of samples. The ratio of m6A to A was calculated on the basis of the calibrated concentrations9. Total RNA was isolated from fish embryos collected at different time points with TRIzol reagent and Direct-zol RNA MiniPrep kit. For each time point, ~200 embryos were collected to ensure RNA yield and that samples were representative. mRNA was further purified using RiboMinus Eukaryote Kit v2. RNA fragmentation was performed by sonication at 10 ng μl−1 in 100 μl RNase-free water using Bioruptor Pico (Diagenode) with 30 s on/off for 30 cycles. m6A-immunoprecipitation (IP) and library preparation were performed according to the previous protocol17. Sequencing was carried out on Illumina HiSeq 2000 according to the manufacturer’s instructions. Additional high-throughput sequencing of zebrafish methylome was carried out using a modified m6A-seq method, which is similar to previously reported methods19, 20. Briefly, total RNA and mRNA were purified as previously described for m6A-seq. Purified mRNA (1 μg) was mixed with 2.5 μg of affinity purified anti-m6A polyclonal antibody (Synaptic Systems) in IPP buffer (150 mM NaCl, 0.1% NP-40, 10 mM Tris-HCl (pH 7.4)) and incubated for 2 h at 4 °C. The mixture was subjected to UV-crosslinking in a clear flat-bottom 96-well plate (Nalgene) on ice at 254 nm with 0.15 J for 3 times. The mixture was then digested with 1 U μl−1 RNase T1 at 22 °C for 6 min followed by quenching on ice. Next, the mixture was immunoprecipitated by incubation with protein-A beads (Invitrogen) at 4 °C for 1 h. After extensive washing, the mixture was digested again with 10 U μl−1 RNase T1 at 22 °C for 6 min followed by quenching on ice. After additional washing and on-bead end-repair, the bound RNA fragments were eluted from the beads by proteinase K digestion twice at 55 °C for 20 and 10 min, respectively. The eluate was further purified using RNA clean and concentrator kit (Zymo Research). RNA was used for library generation with NEBNext multiplex small RNA library prep kit (NEB). Sequencing was carried out on Illumina HiSeq 2000 according to the manufacturer’s instructions. Total RNA was isolated from wild-type and mutant fish embryos collected at different time points with TRIzol reagent and Direct-zol RNA MiniPrep kit. For each time points, ~20 embryos were collected to ensure RNA yield and that samples were representative. mRNA was further purified using RiboMinus Eukaryote Kit v2. RNA fragmentation was performed using Bioruptor Pico as described previously. Fragmented mRNA was used for library construction using TruSeq stranded mRNA library prep kit (Illumina) according to manufacturer’s protocol. Sequencing was carried out on Illumina HiSeq 2000 according to the manufacturer’s instructions. All samples were sequenced by Illumina Hiseq 2000 with single-end 50-bp read length. The deep-sequencing data were mapped to zebrafish genome version 10 (GRCz10). (1) For m6A-seq, reads were aligned to the reference genome (danRer10) using Tophat v2.0.14 (ref. 28) with parameter -g 1–library-type = fr-firststrand. RefSeq Gene structure annotations were downloaded from UCSC Table Browser. The longest isoform was used if the gene had multiple isoforms. Aligned reads were extended to 150 bp (average fragments size) and converted from genome-based coordinates to isoform-based coordinates, in order to eliminate the interference from introns in peak calling. The peak-calling method was modified from published work18. To call m6A peaks, the longest isoform of each gene was scanned using a 100 bp sliding window with 10 bp step. To reduce bias from potential inaccurate gene structure annotation and the arbitrary usage of the longest isoform, windows with read counts less than 1 out of 20 of the top window in both m6A-IP and input sample were excluded. For each gene, the read counts in each window were normalized by the median count of all windows of that gene. A Fisher exact test was used to identify the differential windows between IP and input samples. The window was called as positive if the FDR < 0.01 and log (enrichment score) ≥ 1. Overlapping positive windows were merged. The following four numbers were calculated to obtain the enrichment score of each peak (or window): (a) reads count of the IP samples in the current peak or window, (b) median read counts of the IP sample in all 100 bp windows on the current mRNA, (c) reads count of the input sample in the current peak/window, and (d) median read counts of the input sample in all 100 bp windows on the current mRNA. The enrichment score of each window was calculated as (a × d)/(b × c). (2) For m6A-CLIP-seq, after removing the adaptor sequence, the reads were mapped to the reference genome (danRer10) using Bowtie2. Peak calling method was similar to the previous study19. Briefly, mutations were considered as signal and all mapped reads were treated as background. A Gaussian Kernel density estimation was used to identify the binding regions. The motif analysis was performed using HOMER29 to search motifs in each set of m6A peaks. The longest isoform of all genes was used as background. (3) For mRNA-seq, reads were mapped with Tophat and Cufflink (v2.2.1) was used to calculate the FPKM of each gene to represent their mRNA expression level30. (4) For fish gene group categorization, we used the input mRNA-seq data from m6A-seq. FPKM of all genes were first normalized to the highest value of five time points, with only genes with FPKM >1 analysed. Then Cluster3.0 (ref. 31) was used to divide all genes into six clusters, with the parameters: adjust data – normalize genes; k-means cluster – organize genes, 6 clusters, 100 number; k-means – Euclidean distance. The result clustered file with clustered number was merged with original FPKM values, imported and processed in R, and plotted in Excel. (5) For GO analysis, the list of target genes was first uploaded into DAVID32, 33 and analysed with functional annotation clustering. The resulting file was downloaded and extracted with GO terms and corresponding P values. The new list (contains GO terms with P < 0.01) was imported into REVIGO34 and visualized with the interactive graph, which was used as the final output figures. Methylated genes (at each time point) were defined as overlapped gene targets between m6A-seq and m6A-CLIP-seq. Ythdf2-regulated genes were defined as overlapped gene targets between the lists of the top 20% upregulated genes in both ythdf2 knockout and MO-injected samples. The most stringent Ythdf2 target genes at 4 h.p.f. (135) were defined in the main text, as overlapped genes of methylated genes at 4 h.p.f. (3,237) and Ythdf2-regulated genes at 4 h.p.f. (876). All the raw data and processed files have been deposited in the Gene Expression Omnibus (http://www.ncbi.nlm.nih.gov/geo) and accessible under GSE79213. A summary of sequenced samples and processed FPKM data are included as Supplementary Data 2. One set of representative experiment results from at least two independent experiments were shown where applicable. Quantitative reverse-transcription PCR (RT–qPCR) was performed to assess the relative abundance of mRNA. All RNA templates used for RT–qPCR were pre-treated with on-column DNase I digestion in the purification step. RT–qPCR primers were designed to span exon-exon junctions to only detect mature mRNA. RT–qPCR was performed by using SuperScript III one-step RT–PCR system (Thermo Fisher) with 50–100 ng total RNA template. Actb1 was used as an internal control as it showed relative invariant expression during the studied time period according to pilot RT–qPCR data. P values were determined using two-sided Student’s t-test for two samples with equal variance. *P < 0.05; **P < 0.01; ***P < 0.001. The sequences of primers used in this study are listed below: actb1: forward 5′-CGAGCAGGAGATGGGAACC-3′, reverse 5′-CAACGGAAACGCTCATTGC-3′; buc: forward 5′-CAAGTTACTGGACCTCAGGATC-3′, reverse 5′-GGCAGTAGGTAAATTCGGTCTC-3′; zgc:162879: forward 5′-TCCTGAATGTCCGTGAATGG-3′, reverse 5′-CCCTCAGATCCACCTTGTTC-3′; mylipa: forward 5′-CCAAACCAGACAACCATCAAC-3′, reverse 5′-CACTCCACCCCATAATGCTC-3′; vps26a: forward 5′-AAATGACAGGAATAGGGCCG-3′, reverse 5′-CAGCCAGGAAAAGTCGGATAG-3′; tdrd1: forward 5′-TACTTCAACACCCGACACTG-3′, reverse 5′-TCACAAGCAGGAGAACCAAC-3′; setdb1a: forward 5′-CTTCTCAACCCAAAACACTGC-3′, reverse 5′-CTATCTGAAGAGACGGGTGAAAC-3′; mtus1a: forward 5′-TGGAGTATTACAAGGCTCAGTG-3′, reverse 5′-TTATGACCACAGCGACAGC-3′; GFP: forward 5′-TGACATTCTCACCACCGTGT-3′, reverse 5′-AGTCGTCCACACCCTTCATC-3′. High-throughput sequencing data that support the findings of this study have been deposited at GEO under the accession number GSE79213. All the other data generated or analysed during this study are included in the article and Supplementary Information.


News Article | February 22, 2017
Site: www.nature.com

The study was approved by the ethics committee of the medical faculty and the university clinics of the University of Tübingen and strictly adhered to Good Clinical Practice and the principles of the Declaration of Helsinki. The study is registered at ClinicalTrials.gov (https://clinicaltrials.gov/ct2/show/NCT02115516) and in the EudraCT database, number 2013-003900-38. The study was carried out under FDA IND 15862 and with approval of the Paul-Ehrlich-Institute. Volunteers were healthy, 18–45 years old, malaria-naive adults. The full list of inclusion and exclusion criteria is given in the clinical trial protocol (Supplementary Information). All volunteers, except those in the second part who received the every 5-day regimen, received 10 mg kg−1 or 620 mg chloroquine base (Resochin, Bayer) loading dose 2 days before the first dose of PfSPZ Challenge, whichever dose was less, followed by weekly doses of 5 mg kg−1 or 310 mg through 5 days after the last dose of PfSPZ Challenge. Volunteers who were immunized on days 0, 5, and 10 received chloroquine on days 0 (loading dose), 5, 10, and 15. Randomization was performed on the day of first immunization by an independent party through provision of sealed envelopes to the syringe preparation team members, who diluted PfSPZ Challenge12, 13, 34 or loaded placebo (normal saline) into syringes at an allocation ratio of 9:5, PfSPZ:placebo. Only the syringe preparation team was aware of allocation to the intervention and had no other role in the trial. The rest of the team remained blinded until completion of CHMI of group III. PfSPZ Challenge dose escalation for groups I, II, and III was staggered by at least four weeks and in each group three sentinel volunteers (PfSPZ:placebo, 2:1) received injections one to seven days before the main group. For group I, II, and III the three immunizations were given at 28-day intervals and CHMI by DVI of 3.2 × 103 PfSPZ was done 8–10 weeks following the last immunization. In the second part the three immunizations were administered at 14-day and 5-day intervals and CHMI was done at 10 weeks post immunization. Chloroquine concentrations were measured by mass spectrometry in the blood of selected volunteers on the day before CHMI to exclude carry-over from the immunization period. Following CHMI volunteers were regularly visited for 20 weeks. The primary efficacy endpoint was the proportion of volunteers with thick blood smears positive for Pf within 21 days of CHMI, primary safety endpoint was occurrence of related grade 3 or serious adverse events from first chloroquine dose until the end of the follow-up. We performed a randomized, placebo-controlled, double-blind trial in healthy, malaria-naive, 18–45 year olds (TÜCHMI-002; ClinicalTrials.gov ID: NCT02115516). Between 1 May and 4 July 2014, 42 volunteers were randomized to receive either three doses of normal saline (placebo) or 3.2 × 103 PfSPZ (PfSPZ Challenge12, 13, 34) (group I), 1.28 × 104 PfSPZ (group II), or 5.12 × 104 PfSPZ (group III) by DVI12, 13 at four-week intervals (Extended Data Fig. 2). All volunteers received oral chemoprophylaxis with chloroquine starting with a loading dose (10 mg kg−1 chloroquine base or 620 mg, whichever dose was less) two days before first PfSPZ inoculation followed by weekly maintenance doses (5 mg kg−1) through five days after last PfSPZ inoculation; total of 10 doses. Chloroquine is not active against SPZ or liver-stage parasites35 and Pf asexual blood-stage parasites leave the liver between days 5 and 6 following inoculation36; hence dosing five days following inoculation ensured high drug levels upon liver egress. Dose-escalation was staggered in four-week intervals and at each dose escalation the ratio of placebo-immunized to PfSPZ-CVac-immunized subjects was 5:9. Following PfSPZ dose escalation, accelerated regimens (14- and 5-day intervals) were assessed using essentially the same procedures. A full report will be published separately. Eight to ten weeks after last vaccine or placebo dose (51–67 days after last chloroquine dose), protective efficacy was assessed by CHMI using DVI with PfSPZ Challenge12, 13. Daily thick blood smears were performed as previously described37 from day 6 to 21, following each DVI for immunization and CHMI, during antimalarial treatment and at each late follow-up visit. Slides were considered positive when at least two readers detected two unambiguous parasites, each. A negative slide was defined as no observed parasites in the volume of blood required to detect with 95% probability less than 10 parasites per μl (~0.5 μl). In case of discordance, a third reading was performed. In addition, 1.2 ml blood was sampled in EDTA tubes (Sarstedt) for nucleic acid extraction at the same time-points. DNA extraction control 610 (Bioline) was added and total nucleic acid (DNA and RNA) was isolated from 0.5 ml blood using the QIAamp DNA blood mini kit (Qiagen) according to the manufacturer’s specifications but without addition of RNase. Parasitaemia was calculated from a standard curve generated from serially diluted (2–20,000 parasites per ml) Pf 3D7 ring-stage synchronized cultured parasites, counted by microscopy and cytometry. All purified nucleic acid samples were stored at –20 °C until time of use. Reverse transcription quantitative polymerase chain reaction (RT–qPCR) was performed using TaqMan RNA-to-CT 1-Step Kit using published primers and probes38, with a different fluorophore and addition of a minor groove binder (probe: VIC-ATGGCCGTTTTTAGTTCGTG-NFQMGB; primers: 5′-GCTCTTTCTTGATTTCTTGGATG-3′ and 5′-AGCAGGTTAAGATCTCGTTCG-3′). Reactions were done in 384 wells at 48 °C for 20 min (reverse transcription), 96 °C for 10 min (enzyme activation), and 45 cycles of 95 °C for 15 s, 62 °C 1 min. Samples were run as triplicates with no-template control, no-RT control and positive controls in the same plate. Amplification controls were assessed manually and cycle values (C ) were calculated with the second derivative maximum method (LightCycler 480 software; version 1.5.1.62). The assay was validated in accordance to MIQE guidelines38, 39 and had a lower limit of quantification of 3 parasites per ml. qPCR results were not reported to the clinical and microscopy teams during the study period to maintain blinding of the study. Sample size was calculated with the intention to show, with a power of 80% and a two-tailed alpha of 5%, a difference in proportion of infected volunteers of 25% or less of immunized volunteers and 99% in controls, allocated in a 2:1 ratio (8 PfSPZ:4 controls), allowing for one dropout in each group (9:5). Clinical data were captured on paper case report forms and transferred to an electronic database (OpenClinica; version 3.2) by double data entry. Efficacy data were reported as proportions (primary) and time to parasitaemia. Safety and tolerability data were listed and reported as summary statistics. Results of immunological assays were explored by post hoc analyses and used to generate hypotheses about correlates and immunological mechanisms of protection. Analyses were coded in R (version 3.2.3)40 when not otherwise stated. Where possible, estimate and 95% confidence interval are given. Box plots display median (middle line), 25th (lower hinge) and 75th (upper hinge) quartile. Whiskers extend to values within 1.5× the inter-quartile ranges of the lower and upper hinges, respectively. A two-sided P value less than 5% was considered statistically significant. Flow cytometry data were analysed with Pestle v1.7, SPICE v5.3 (ref. 41) and Prism 6 (GraphPad). Graphs were rendered in FlowJo, SPICE, and Prism. For vaccine immunogenicity, comparisons to pre-vaccine were performed using Wilcoxon signed rank test with Bonferroni correction for multiple comparisons or two-way ANOVA with Bonferroni correction, as specified in the text. Immune responses assessed at baseline, two weeks after final immunization, and at the time of CHMI were compared to outcome (parasitaemia or no parasitaemia) after CHMI. Assessment of immune responses that correlated with sterile protection was made using a stratified Wilcoxon test controlling for vaccine dose group as a covariate. Sera were assessed for vaccine-induced antibodies by ELISA (enzyme-linked immunosorbent assay), immunofluorescence assay, inhibition of sporozoite invasion assay and protein arrays representing 91% of the Pf proteome. ELISAs were performed for antigens first expressed in PfSPZ (PfCSP, PfSSP2/TRAP, PfCelTOS, PfMSP5, PfAMA1), early liver stages (PfEXP1 and PfLSA1) and late liver stages (PfMSP1 and PfEBA175). The ELISA methods for each antigen are described below. Recombinant (r) proteins used in ELISA assays are listed in Supplementary Table 7. 96-well plates (Nunc Maxisorp Immuno Plate) were coated overnight at 4 °C with 0.5 μg to 2.0 μg recombinant proteins (Supplementary Table 7) in 50 μl per well in coating buffer (KPL). Plates were washed three times with 2 mM imidazole, 160 mM NaCl, 0.02% Tween 20, 0.5 mM EDTA and blocked with 1% Bovine Serum Albumin (BSA) blocking buffer (KPL) containing 1% or 5% non-fat dry milk (Supplementary Table 7) for 1 h at 37 °C. Plates were washed three times and serially diluted serum samples (in triplicates) were added and incubated at 37 °C for 1 h. After three washes, peroxidase labelled goat anti-human IgG (KPL) was added at a dilution of 0.05 μg ml−1 to 0.2 μg ml−1 (Supplementary Table 7) and incubated at 37 °C for 1 h. Plates were washed three times, ABTS peroxidase substrate was added for plate development, and the plates were incubated for defined periods at 22 °C room temperature (Supplementary Table 7). The plates were read with a Spectramax Plus384 microplate reader (Molecular Devices) at 405 nm. The data were collected using Softmax Pro GXP v5 and fit to a 4-parameter logistic curve, to calculate the serum dilution at OD 1.0. A negative control (pooled serum from non-immune individuals from malaria free area) was included in all assays. The following positive control sera were used for the different antigens: serum from an individual with anti-PfCSP antibodies for PfCSP; pooled sera from individuals immunized with PfLSA-1 and PfEBA-175 subunit vaccines respectively for PfLSA1 and PfEBA175; pooled sera from volunteers from a malaria-endemic area (acquired from a blood bank in Kenya) for PfAMA1, PfEXP1, and PfMSP1. No positive control sera were available for PfMSP5, PfSSP2/TRAP or PfCelTOS. Samples were considered positive if the difference between the post-immunization OD 1.0 and the pre-immunization OD 1.0 (net OD 1.0) was ≥50 and the ratio of post-immunization OD 1.0 to pre-immunization OD 1.0 (ratio) was ≥3. Purified PfSPZ (NF54 strain) from aseptic Anopheles stephensi mosquitoes produced by Sanaria were resuspended in phosphate buffered saline (PBS (pH 7.4)) to obtain 5 × 103 PfSPZ per 40 μl. 40 μl (5 × 103 PfSPZ) were added to each well of Greiner cellstar clear-bottom black 96-well plates (Sigma-Aldrich). After addition of the suspension, plates were left at room temperature for 12–18 h for air-drying. 50 μl of sera diluted in PBS with 2% BSA were added to each well of the 96-well plate containing air-dried PfSPZ. Sera samples were added at twofold dilutions starting at 1:50. After adding samples, plates were incubated at 37 °C for 1 h. Plates were washed in PBS three times on an Aquamax Microplate washer. Alexa Fluor 488 conjugated goat anti-human IgG (Molecular Probes) was diluted to 1:250 in PBS with 2% BSA and 50 μl was added to each well. The plates were then incubated for 1 h at 37 °C. Plates were washed three times with PBS on an Aquamax Microplate washer. 100 μl PBS was added to each well. The plates were sealed using a plate sealer and stored in the dark at 4 °C until data acquisition. Samples were assessed by scanning the plates using an Acumen eX3 laser scanning imaging cytometer. The positive control was pooled human serum taken two weeks after the last immunization from 12 uninfected volunteers immunized 4 or 5 times with 1.35 × 105 PfSPZ Vaccine5. The Acumen image cytometer scans the entire surface area of each well in a 96-well plate and the fluorescence intensity values (arbitrary units) therefore represent the signal from all 5 × 103 PfSPZ that were seeded in each well. The data obtained from the Acumen image cytometer were plotted to fit a 4-parameter sigmoidal curve in GraphPad Prism software using serum dilution (log transformed) as the x axis variable and arbitrary fluorescence units (AFU) on the y axis. Over many iterations during development of this assay we have determined that sera from naive volunteers in the USA and Europe, including pre-immune sera, always register an arbitrary fluorescence value less than 2 × 105 even at the highest concentration (1:50 dilution, see above) used in this assay. Moreover, for sera that react to PfSPZ, 2 × 105 AFU falls in the exponential portion of their sigmoidal curves. Therefore, 2 × 105 was chosen as a threshold in the automated immunofluorescence assay and the results for each volunteer for antibodies to PfSPZ are reported as the reciprocal serum dilution at which fluorescence intensity was equal to 2 × 105 AFU. HC-04 (1F9) (ref. 42) cells (hepatocytes) were obtained from the Naval Medical Research Center. Master and working cell banks were produced, and after establishing they were free of mycoplasma, were quality control released. For the assay they were cultured in complete medium (10% FBS in DMEM/F12 with 100 units per ml penicillin and 100 μg per ml streptomycin; Gibco by Life Technologies) in Entactic-Collagen IV-Laminin (ECL)-coated 96-well clear bottom black well plates (Greiner Bio-One North America) at a density of 2.5 × 104 cells per well, and incubated for 24 h at 37 °C, 5% CO with 85% relative humidity. Twenty-four hours later cells were infected with 104 aseptic, purified, cryopreserved PfSPZ per well, without or with sera diluted in a 12-point series from subjects immunized with PfSPZ Vaccine. The assay control included PfSPZ added with media alone. All subjects were assessed at pre-immunization (baseline), post-immunization and pre-CHMI time points. Three hours later, PfSPZ that had not invaded the HC-04 cells were removed by washing three times with Dulbecco’s phosphate-buffered saline (DPBS), and the cultures were fixed using 4% paraformaldehyde for 15 min at room temperature. Differential immunostaining was performed to differentiate between PfSPZ inside the hepatocytes versus PfSPZ outside the hepatocytes. PfSPZ outside the hepatocytes were stained with an anti-PfCSP mAb (2A10, 6.86 μg ml−1) (Protein Potential LLC, with permission from New York University School of Medicine) conjugated with Alexa Fluor 633 (far-red) (1 μg ml−1; custom-conjugated at GenScript). The hepatocytes were then permeabilized with 0.1% Triton X-100 for 10 min at room temperature, and the PfSPZ inside the hepatocytes were stained with the anti-PfCSP mAb (2A10, 6.86 μg ml−1) conjugated with Alexa Fluor 488 (green; 1 μg ml−1, conjugated from Genscript). The numbers and intensity of infected hepatocytes (green only) were counted by scanning the plates using an Acumen eX3 laser scanning imaging cytometer. The data obtained from the Acumen image cytometer were plotted to fit a 4-parameter sigmoidal curve in GraphPad Prism software using serum dilution (log transformed) as the x axis variable and arbitrary fluorescence units on the y axis. 75% inhibition was interpolated from the sigmoidal curves as the reciprocal serum dilution at which the fluorescent intensity of infected wells with serum was 25% of the negative control without serum. The number of invaded PfSPZ scored in this assay in the absence of sera ranged from 400–600 (intensity of 1–3 × 106 fluorescence units) (4% to 6% of those added to the wells). A whole-proteome microarray with 91% coverage of the Pf proteome (PfWPM) was produced by Antigen Discovery, Inc. (ADI). Proteins were expressed as previously described43 from a library of Pf partial or complete open reading frames (ORFs) cloned into a T7 expression vector pXI using an in vitro transcription and translation (IVTT) system, the Escherichia coli cell-free Rapid Translation System (RTS) kit (5 Prime). The library was created through an in vivo recombination cloning process with PCR-amplified Pf ORFs, and a complementary linearized expressed vector transformed into chemically competent E. coli was amplified by PCR and cloned into pXI vector using a high-throughput PCR recombination cloning method described elsewhere44. Each expressed protein includes a 5′ polyhistidine (HIS) epitope and 3′ haemagglutinin (HA) epitope. After expressing the proteins according to manufacturer’s instructions, translated proteins were printed onto nitrocellulose-coated glass AVID slides (Grace Bio-Labs) using an Omni Grid Accent robotic microarray printer (Digilabs, Inc.). Microarray chip printing and protein expression were quality checked by probing random slides with anti-HIS and anti-HA monoclonal antibodies with fluorescent labelling. PfWPM chips contained 7,455 Pf peptide fragments, representing proteins from 4,805 unique genes, 302 IgG positive control spots and 192 spotted IVTT reactions without Pf ORFs (IVTT controls). For each PfWPM chip, 3 replicates were printed per microarray slide on 3 nitrocellulose pads. IgG-positive control spots were included as an assay control, whereas IVTT control spots were included as a sample-level normalization factor. Serum samples were diluted 1:100 in a 3 mg ml−1 E. coli lysate solution in protein arraying buffer (Maine Manufacturing) and incubated at room temperature for 30 min. Chips were rehydrated in blocking buffer for 30 min. Blocking buffer was removed, and chips were probed with pre-incubated serum samples using sealed, fitted slide chambers to ensure no cross-contamination of sample between pads. Chips were incubated overnight at 4 °C with agitation. Chips were washed five times with TBS-0.05% Tween 20, followed by incubation with biotin-conjugated goat anti-human IgG (Jackson ImmunoResearch) diluted 1:200 in blocking buffer at room temperature. Chips were washed three times with TBS-0.05% Tween 20, followed by incubation with streptavidin-conjugated SureLight P-3 (Columbia Biosciences) at room temperature protected from light. Chips were washed three times with TBS-0.05% Tween 20, three times with TBS, and once with water. Chips were air dried by centrifugation at 1,000g for 4 min and scanned on a ScanArray Express HT spectral scanner (Perkin-Elmer), and spot and background intensities were measured using an annotated grid file (.GAL). Data were exported and normalized using the IVTT control spots for statistical analysis in R40. Raw spot and local background fluorescence intensities, spot annotations and sample phenotypes were imported and merged in R, where all subsequent procedures were performed40. Foreground spot intensities were adjusted by local background by subtraction, and negative values were converted to 1. Next, all foreground values were transformed using the base 2 logarithm (log ). The dataset was normalized to remove systematic effects by subtracting the median signal intensity of the IVTT controls for each sample. As the IVTT control spots carry the chip, sample and batch-level systematic effects, but also antibody background activity to the IVTT system, this procedure normalizes the data and provides a relative measure of the specific antibody binding to the non-specific antibody binding to the IVTT controls (a.k.a. background). With the normalized data, a value of 0.0 means that the intensity is no different than the background and a value of 1.0 indicates a doubling with respect to background. A seropositivity threshold was established for each protein on the chip using the top 2.5th percentile of the pre-immunization samples for each protein. Reactive antigens were defined as those that had seropositive responses after immunization and before CHMI, but which did not show seropositive responses in the mock-immunization group. PBMCs were isolated by density-gradient centrifugation from heparinized whole blood. Assessment of cellular immune responses using multi-parameter flow cytometry was performed on PBMCs from cryopreserved samples at the completion of the study, as described6. In brief, PBMCs were thawed and rested in complete RPMI for 8 h followed by stimulation for 17 h with: (1) 1.5 × 105 viable, irradiated, aseptic, purified, cryopreserved PfSPZ from a single production lot; (2) PfSPZ Vaccine diluent (1% human serum albumin, HSA, CSL Behring); (3) 2 × 105 lysed RBC, >90% infected with late-stage schizonts (PfRBC) from a single production lot; or (4) 2 × 105 donor-matched uninfected erythrocytes from a single production lot. For the last 5 h of the stimulation, 10 μg ml−1 Brefeldin A (BD) was added to the culture. After stimulation, cells were stained as previously described45. The staining panels are shown in Supplementary Table 8 and the antibody clones and manufacturers are shown in Supplementary Table 9. Briefly, cells were surface stained with CCR7 at 37 °C for 20 min. Dead cells were identified by Aqua Live-Dead dye (Invitrogen), as per manufacturer’s instructions. This was followed by 15 min surface staining at room temperature for CD4, CD8, CD14, CD38, CD45RA, CD56, CD57, CD127, CD161, TCR-γδ, TCR-Vδ1, TCR-Vδ2, TCR-Vγ9, TCR-Vα7.2, CXCR6, or PD-1. Cells were washed, fixed, and permeabilized using Cytofix/Cytoperm kit (BD) and stained intracellularly for CD3, IFN-γ, IL-2, TNF-α, IL-4, IL-10, perforin, or Ki-67. Cells were washed, fixed in 0.5% paraformaldehyde, and measured on a modified LSR II (BD). Flow cytometry data were analysed using FlowJo v9.9 (Tree Star) blinded to vaccination group and CHMI outcome. All antigen-specific cytokine frequencies are reported after background subtraction of identical gates from the same sample incubated with the control antigen stimulation (HSA or uninfected erythrocytes). The data that support the findings of these studies are available in part on request from the corresponding author (S.L.H.) subject to restrictions. Some data are not publicly available, as they contain information that could compromise research participant privacy/consent.


Prologue rappelle qu'est tenu à jour sur son site internet un tableau récapitulatif des OCA, des BSA et du nombre d'actions en circulation. Les termes et conditions des OCA et des BSA tels que modifiés par l'avenant conclu ce jour sont également disponibles sur le site internet de Prologue. A propos de Prologue Prologue est un groupe international spécialisé dans les logiciels, les services IT et la formation professionnelle. Le groupe a développé des offres à forte valeur ajoutée dans les domaines des télécommunications (téléphonie VoIP, SMS, fax, courriel, image, vidéo, etc.), du multimédia (plateforme collaborative Adiict), de la dématérialisation de transactions et des échanges d'information (EDI, facture fiscale, opérations bancaires, administration, santé, taxes, etc.), et du Cloud Computing. Le groupe est présent en France, en Espagne, en Pologne, aux Etats-Unis et en Amérique Latine. Les technologies du groupe sont utilisées par des entreprises prestigieuses en France et à l'étranger comme : Generali, Société Générale, Orange, SFR, LVMH, Vilmorin, Immobilière 3F, MASSA Autopneu, J.C. Decaux, Facom, Telefonica, REALE Assurances, Toyota, Adecco, TINSA, Inter-parfums, NEXITY, Jones Lang Lasalle, AENA, ATOS, EMC, Blédina, Siemens, Liebherr Aerospace, Eurocopter, Kone, Uponor, Cadyssa / Bodybel.


News Article | February 23, 2017
Site: www.businesswire.com

ST. JOHN’S, Newfoundland--(BUSINESS WIRE)--Verafin, North America’s leading cross-institutional BSA/AML and fraud detection solution provider, continues to shape and enhance the future of the fight against financial crime. In its Fall 2016 Semiannual Risk Prospective the Office of the Comptroller of the Currency (OCC) highlighted difficulties associated with Bank Secrecy Act (BSA) compliance and operational risk resulting from a heightened environment of cybersecurity threats as key risks for banks of all sizes. In an environment where banks must “continually up their game” to protect themselves from the latest criminal attacks, over 1500 financial institutions now look to Verafin and its innovative FRAMLx (cross-institutional Fraud detection + AML) solution. One bank that recently chose Verafin as its preferred BSA/AML software provider is Bank of the Ozarks, an $18B in assets bank headquartered in Little Rock, Arkansas. Bank of the Ozarks, established in 1903, is a high-performing regional bank with 249 locations across nine states – recognized for the past four consecutive years by Bank Director magazine as the nation’s top performing bank in its asset category. “We’ve been using Verafin for a little over six months now and the team here is really impressed,” says Ashley Wisdom, Corporate BSA Officer. “The alerts are very high quality, meaning we’re now able to focus our attention on truly unusual activity. Plus, with the wide range of tools available to us in Verafin, from BSA/AML compliance to fraud detection, we can quickly access the information we need to make better investigative decisions - putting together a more complete picture in less time.” Wisdom continues, “Another thing that stands out is Verafin’s innovative approach. The software is constantly being enhanced, the updates are seamless, and their customer support is second-to-none.” Throughout the past year and into 2017, Verafin has structured its development teams to achieve more dynamic and user-focused enhancements of its fraud and suspicious activity detection functionality. Two primary factors in the success of Verafin’s enhancements are the “Financial crime is always changing,” says Brendan Brothers, Verafin Co-founder. “That’s why innovation is vital and why we treat it as a cornerstone of our approach to developing the industry’s leading BSA/AML and fraud detection solution. “Over the past year we’ve put a lot of focus on expanding our analytics to create highly targeted suspicious activity alerts. We’ve built a lot of momentum and the results we’re seeing from our users are very exciting. It’s motivating to know our software is having such a positive impact and is helping so many financial institutions successfully prevent financial crime.” About Bank of the Ozarks Bank of the Ozarks, Inc. shares trade on the NASDAQ Global Select Market under the symbol “OZRK.” The Company owns a state-chartered subsidiary bank that conducts banking operations through 249 offices in Arkansas, Georgia, Florida, North Carolina, Texas, Alabama, South Carolina, New York and California. The Company can be found at www.bankozarks.com and on Facebook, Twitter and LinkedIn. Verafin is an industry leader in cloud-based Fraud Detection and Anti-Money Laundering (FRAMLx) collaboration software with a customer base of over 1500 financial institutions across North America. Verafin is the exclusive provider for the CBA, FBA, IBA, MBA, CUNA Strategic Services, a preferred service provider of the ICBA, in addition to industry endorsements in 44 states across the U.S. Verafin's innovative crime-fighting solution includes FRAMLxchange, the secure information-sharing network available to any 314(b)-registered institution.


News Article | February 24, 2017
Site: www.prweb.com

The Greater Niagara Frontier Council (GNFC) will be holding one of its largest annual fundraising events, Fire and Ice, which will take place on Thursday March 16th at the Hotel at the Lafayette, 391 Washington Street Buffalo 14203, from 6pm to 9pm. The Chair for the event will once again be Eagle Scout and local attorney, William Mattar. All proceeds of this event go directly to support our local Western New York Scouting programs. “We are very excited to host Fire and Ice in the heart of downtown Buffalo’s resurgence, which also happens to be the center of Scouting’s resurgence in Western New York,” said Mattar. Tickets are $195 each or $350 per couple and are available at http://www.wnyscouting.org. In addition there are a number of sponsorships available for the event. To help everyone enjoy the evening safely, complimentary service from Designated Drivers of Buffalo will be available, courtesy of William Mattar. Fire & Ice celebrates the Scouting experience and the positive impact Scouting has on our youth, their families, and our volunteers. Attendees will come together for an evening of music, themed food stations, cocktails, and auctions, all set in a unique and exciting social atmosphere. “We owe the yearly success of this exciting event to all the volunteers, sponsors, and supporters of Scouting. Today’s scouts are tomorrow’s leaders. The support we receive for fundraising events such as Fire & Ice helps maintain scouting programs for area youth and nurture the future of our communities,” said Mattar. Since the GNFC was founded over 100 years ago, tens of thousands of youth in our region have gone through their various Scouting programs. The Boy Scouts of America is the nation’s premier values-based youth development organization. The mission of the BSA is to prepare young people to make ethical and moral choices over their lifetimes by instilling in them the values of the Scout Oath and Law. For more information please contact Ken Liszewski at 716-512-6209 or Kenneth.Liszewski(at)scouting(dot)org. About William Mattar: William Mattar has represented those injured in motor vehicle accidents since 1990. The firm is actively involved in community events and has established a number of programs and campaigns such as the Safe & Sober Free Ride Home Program on New Year’s Eve, the In the Heat, Check the Seat Campaign and the Pencils 4 Schools Campaign. Learn more about the firm’s community involvement, and how you can participate, by visiting http://www.WilliamMattar.com.


Patent
Bsa | Date: 2012-04-18

A magazine for an airgun comprising a housing (2) and a magazine rotor (3) rotatably mounted therein. The magazine rotor (3) including a plurality of bores (7) therethrough, each bore forming a chamber (7) for receiving an airgun pellet. The magazine (1) includes an indexing arrangement including a biasing element to index the magazine rotor (3). At least one of the bores (7) includes a lead-in portion (8) adapted and arranged such that when contacted by a bolt of an airgun when the magazine (1) is mounted in an airgun, the magazine rotor (3) is rotated against the force of the biasing element.


News Article | March 2, 2017
Site: globenewswire.com

WOODBRIDGE, N.J., March 02, 2017 (GLOBE NEWSWIRE) -- John W. Alexander, Chairman and Chief Executive Officer of Northfield Bank, announced today that Christopher Donohue has been promoted to Senior Vice President responsible for Bank Secrecy Act (BSA) compliance and bank security.  As the Bank Secrecy Act Officer, Mr. Donohue is responsible for developing, implementing and administering all aspects of the BSA Compliance Program.  In addition, he handles branch and company wide security matters.  Mr. Donohue joined Northfield Bank in 2012 as Vice President of BSA and transitioned to the joint role that included security in 2014.  Prior to joining Northfield, Chris had a 28 year career in law enforcement, criminal justice, and the investigation of financial crimes. “Chris is a valuable member of the Northfield team and his expertise in managing our Bank Secrecy Act/Anti-Money Laundering Program has been instrumental in ensuring our continued compliance with this complicated area, which allows us to continue to implement our strategic plan,” stated Alexander. Mr. Donohue frequently volunteers his time speaking to community groups about financial literacy, fraud, and elder financial abuse. Chris resides in Lacey, NJ with his wife and children. About Northfield Bank Northfield Bank, founded in 1887, is a $3.8 billion financial institution which operates 38 full service banking offices in Western and Central New Jersey, Staten Island, and Brooklyn.  For more information about Northfield Bank, please visit www.eNorthfield.com


News Article | February 23, 2017
Site: www.prweb.com

Black Swan Advisors (BSA), long known for its in-depth review of the home building industry, has recently completed a similar study of the Non Traded REIT Industry (NTRs). This Study 1 was completed to provide guidance to investors looking for entry opportunities to the NTRs industry, and for existing shareholders to consider various exit strategies given the poor recent performance of these NTRs The NTR Study (Study 1) was undertaken to review existing and future financial conditions in NTRs companies. The Study was completed using the SEC reported financial statements and other materials for 45 selected NTRs, mostly the small and medium sized companies ($500M to $1.5 B in assets). The financial data was aggregated for all companies and broken into 3 segments by size of assets. Operating Statements, Balance Sheets, and Cash Flow statements were used to evaluate each company against the aggregated figures. BSA also initiated a proprietary algorithm to evaluate each of the companies and industry segments. The algorithm uses 18 financial metrics, weighted for their importance to future value, to determine a company by company rating. These rankings are not done in accordance with any financial industry standards but are based on the financial importance ascribed to each by BSA based on its 40 year experience in the real estate industry. Some of the 18 financial metrics used include; Dividends paid coverage ratio Various leverage ratios Property level operating income, including return on cost Property level capitalization rates Share ownership by insiders Various per share valuations, including book value (net worth based), Recent prices of shares traded, and share valuations based on recent company generated appraisals, if available. From this data for the 45 companies, BSA has determined that there are a number of trends in place and evolving which current and future NTR investors should be watching, such as; 1) There are a number of significant new regulations being imposed on the industry, which will place more importance on the timing, accuracy, and thoroughness of reporting. 2) There is an increased emphasis on property valuations, including new standards for annual portfolio appraisals or valuations using new industry standard methods. 3) The NTR industry sold approximately $100 B in new equity over the last 10 years, coupled with $100 B in new debt, and purchased some $200 B in real estate assets, mostly completed income properties, apartments, office/industrial, self-storage, and miscellaneous other products, mostly located in non-coastal markets. 4) The non-coastal markets are experiencing (see other BSA Study 1, released concurrently, on population and workforce growth rates) significantly higher population and workforce growth over the least 5 years, based on the movement of people and jobs from coastal markets to non-coastal markets (Fly-Over Country), characterized by lower tax rates (combined income, death, sales taxes, and property taxes), right to work laws, lower cost of living, and majority GOP controlled state governments. See next Study 2 for more detail on locations. 5) Sales of new shares have dropped dramatically over the last 4 years, from $20 Billion + in 2013 to less than $5 Billion in 2016. This reduced source of marginal liquidity is forcing changes in business plans across the industry. Reduced marginal liquidity will impose reduced distributions for those NTRs not covering prior distributions with real earnings. 6) Due to poor industry performance, new share sales in 2017 are likely to drop further. Without new share sales additional property acquisitions will be reduced or non-existent. 7) NTRs for 2015 operated at highly negative cash flows. 8) NTR 2015 distributions could not be made at reported levels without New share sales. 9) NTRs appear to be at maximum leverage, so additional borrowing may not be a source of meeting marginal liquidity requirements. Property level capitalization rates are at the 5.5% to 6.5% level, with some higher. Cash available for distribution to shareholders is reduced by high organization costs and fees. 10) There is virtually no coverage of this industry by traditional financial industry analysts, thereby reducing the information readily available. The BSA Study is likely the only industry wide study completed in the last 2 years. 11) There are no major institutional shareholders who have taken major shareholder positions in any of the NTRS in the study. 12) Retail shareholders have almost no choices for liquidity as the shares are not listed on recognized exchanges. Sales of shares on secondary market maker sites are usually completed at substantial (-25%) discounts from prior sales, and usually are at a substantial discount to book value and appraisal adjusted book value. 13) The BSA Study also compared the 45 NTRs to 13 Publicly Traded REITs, and found the following observations; REIT properties tend to be larger, in coastal major market cities, and have stronger management REIT properties have higher operating margins at the property level although they still produce lower cap rates due to the high prices paid for properties. 14) REITs have much lower fee structures than NTRs. 15) REITs generally cover their dividends with current operations (FFO) 16) NTRs generally underperform REITs on most financial measurements. Based on this Study, BSA has identified a number of new opportunities to invest in NTRs in 2017 for institutional investors. Interested parties should contact BSA for further discussions regarding these opportunities. On a very limited basis, BSA may be able to assist current retail investors with liquidation or other investment strategies. The BSA Study is not publicly available, and may only be accessed as a client of BSA. For additional information, contact;     Charles J. McLaughlin     President

Loading BSA collaborators
Loading BSA collaborators