BML

Tokyo, Japan
Tokyo, Japan

Time filter

Source Type

Dublin and London - November 24, 2016 - Providence Resources P.l.c. (PVR LN, PRP ID), the Irish based Oil and Gas Exploration Company, today provides an update on the Frontier Exploration Licence ("FEL") 2/14 drilling project, which lies in c. 2,250 metre water depth in the southern Porcupine Basin and is located c. 220 kilometres off the south west coast of Ireland.  The licence is operated by Providence Resources P.l.c. ("Providence") (80%) on behalf of its partner Sosina Exploration Limited ("Sosina") (20%), (collectively referred to the "JV Partners").  FEL 2/14 contains the Paleocene "Druid" and the Lower Cretaceous "Drombeg" exploration prospects. On behalf of the JV Partners, Providence has signed a contract for the provision of a Harsh Environment Deepwater Mobile Drilling Unit (the "Contract") with Stena Drillmax Ice Limited ("Stena"), a wholly owned subsidiary of Stena International S.A., for the Stena IceMAX drill-ship. The Stena IceMAX is a modern harsh environment dual derrick drill-ship designed to operate in water depths of up to c. 3 km. The Contract provides for one firm well, plus an additional option, which is electable at the discretion of the JV Partners for the drilling of a second follow-on well.  The operational rig rate is $185,000 per day. In addition to the finalisation of the Contract, other key service contracts are now being prepared for the planned drilling operations.  Based on the latest project timeline and, subject to standard regulatory approvals and consents, the 53/6-A exploration well is currently planned to spud in June 2017. "We are delighted to have signed this rig contract with Stena.  Our previous exploration collaboration project with Schlumberger highlighted the significant hydrocarbon potential of FEL 2/14 which we will now be evaluating using the high specification Stena IceMAX drill-ship. The signing of this rig contract is a major milestone in the project plan to enable the drilling of this high impact exploration well during summer 2017." Providence Resources is an Irish based Oil and Gas Exploration Company with a portfolio of appraisal and exploration assets located offshore Ireland.  Providence's shares are quoted on AIM in London and the ESM in Dublin. Stena Drilling is one of the world's leading companies in the development, construction and operation of offshore drilling rigs and drill-ships. Stena's fleet consists of four ultra-deep-water drill-ships and three semi-submersible rigs. Stena IceMAX is the world's first dynamically positioned, dual mast ice-class drillship. The Stena IceMAX is a Harsh Environment DP Class 3 drillship capable of drilling in water depths up to 10,000ft. The IceMAX has on-board 2 x BOP's, each 18 3/4" x 15,000psi Cameron "TL" BOP c/w ST Locks, and uses Cameron Load King riser.  The vessel was delivered in April 2012. During the initial pre-FEL 2/14 authorisation phase (Licensing Option 11/9 - 2011 through 2013), Providence and Sosina identified two large vertically stacked Paleocene ('Druid') and Lower Cretaceous ('Drombeg') fan systems with notable Class II amplitude versus offset ("AVO") anomalies primarily from 2D seismic data acquired in 2008.  Providence and Sosina subsequently agreed to underwrite a multi-client 3D seismic survey over the area.  This 3D survey was acquired by Polarcus in the summer of 2014 and subsequently processed by ION Geophysical in 2014/15. In September 2015, Providence and Sosina entered into a Strategic Exploration Collaboration Project with Schlumberger. In April 2016, the main results of this Project were announced: · Two fans located c. 1,750 m BML and structurally up-dip from a potential significant fluid escape feature from the underlying pre-Cretaceous Diablo Ridge ·  Cumulative in-place un-risked prospective resources of 3.180 BBO (PMean)             o   Fan 1 - 984 MMBO (PMean)             o   Fan 2 - 2,196 MMBO (PMean) · Pre-stack seismic inversion and regional rock physics analysis shows Druid is consistent with a highly porous (30%) and high net-gross, light oil-filled sandstone reservoir system up to 85 metres thick ·A depth conformant Class II AVO anomaly is present and synthetic forward modelling of an oil-water contact correlates with the observed seismic response ·Spectral decomposition, seismic compactional drape and mounding are reflective of a large sand-rich submarine fan system with no significant internal faulting and clear demonstration of an up-dip trap mechanism ·Geomechanical analysis using regional well and high resolution seismic velocity data indicates that Druid is normally pressured and the top seal is intact ·Located c. 2,750 m BML and structurally up-dip from a potential significant fluid escape feature from the underlying pre-Cretaceous Diablo Ridge ·In-place un-risked prospective resource of 1.915 BBO (PMean) · Pre-stack seismic inversion and regional rock physics analysis shows Drombeg is consistent with a highly porous (20%), light oil-filled sandstone reservoir system up to 45 metres thick ·A depth conformant Class II AVO anomaly is present and spectral decomposition is reflective of a large sand-rich submarine fan system with no significant internal faulting, and supports an up-dip trap mechanism ·Geomechanical analysis using regional well and high resolution seismic velocity data indicates that Drombeg is over-pressured with an intact top seal This announcement has been reviewed by Dr John O'Sullivan, Technical Director, Providence Resources P.l.c.  John is a geology graduate of University College, Cork and holds a Masters in Applied Geophysics from the National University of Ireland, Galway. He also holds a Masters in Technology Management from the Smurfit Graduate School of Business at University College Dublin and a doctorate in Geology from Trinity College Dublin.  John is a Chartered Geologist and a Fellow of the Geological Society of London.  He is also a member of the Petroleum Exploration Society of Great Britain, the Society of Petroleum Engineers and the Geophysical Association of Ireland. John has more than 25 years of experience in the oil and gas exploration and production industry having previously worked with both Mobil and Marathon Oil.  John is a qualified person as defined in the guidance note for Mining Oil & Gas Companies, March 2006 of the London Stock Exchange. Definitions in this press release are consistent with SPE guidelines. SPE/WPC/AAPG/SPEE Petroleum Resource Management System 2007 has been used in preparing this announcement.


PubMed | National Center for Global Health and Medicine, Ohta Nishinouchi Hospital, Kohnodai Hospital, Clinical Center and BML
Type: Clinical Trial | Journal: PloS one | Year: 2015

Oncogenic human papillomavirus (HPV) infection, particularly multiple HPV types, is recognized as a necessary cause of anal cancer. However, a limited number of studies have reported the prevalence of anal HPV infection in Asia. We determined the prevalence, genotypes, and risk factors for anal HPV infection in Japanese HIV-positive men who have sex with men (MSM), heterosexual men, and women.This cross-sectional study included 421 HIV-positive patients. At enrollment, we collected data on smoking, alcohol, co-morbidities, drugs, CD4 cell counts, HIV RNA levels, highly active anti-retroviral therapy (HAART) duration, sexually transmitted infections (STIs), and serological screening (syphilis, hepatitis B virus, Chlamydia trachomatis, Entamoeba histolytica). Anal swabs were collected for oncogenic HPV genotyping.Oncogenic HPV rate was 75.9% in MSM, 20.6% in heterosexual men, and 19.2% in women. HPV 16/18 types were detected in 34.9% of MSM, 17.7% of heterosexual men, and 11.5% of women. Multiple oncogenic HPV (2 oncogenic types) rate was 54.6% in MSM, 8.8% in heterosexual men, and 0% in women. In univariate analysis, younger age, male sex, MSM, CD4 <100, HIV viral load >50,000, no administration of HAART, and having 2 sexually transmitted infections (STIs) were significantly associated with oncogenic HPV infection, whereas higher smoking index and corticosteroid use were marginally associated with oncogenic HPV infection. In multivariate analysis, younger age (OR, 0.98 [0.96-0.99]), MSM (OR, 5.85 [2.33-14.71]), CD4 <100 (OR, 2.24 [1.00-5.01]), and having 2 STIs (OR, 2.81 [1.72-4.61]) were independently associated with oncogenic HPV infection. These 4 variables were also significant risk factors for multiple oncogenic HPV infection.Among Japanese HIV-infected patients, approximately two-thirds of MSM, one-fifth of heterosexual men, and one-fifth of women have anal oncogenic HPV infection. Younger age, MSM, 2 STIs, and immunosuppression confer a higher risk of infection with oncogenic HPV and multiple oncogenic types.


Takahashi Y.,Teikyo University | Takahashi Y.,Chiba University | Ishiwada N.,Chiba University | Tanaka J.,Chiba University | And 5 more authors.
Pediatrics International | Year: 2014

Streptococcus gallolyticus subsp. pasteurianus was formerly classified as S. bovis biotype II/2, which is recognized as a rare cause of neonatal sepsis and meningitis. Since the taxonomy classification change, there have not been many reports of meningitis due to S. gallolyticus subsp. pasteurianus. Moreover, the pathogenesis of late onset S. gallolyticus subsp. pasteurianus meningitis in infants is unclear. Here we report a case of meningitis in a 5-week-old infant with preceding diarrhea. S. bovis biotype II/2 was isolated from the blood, cerebrospinal fluid and stool, and then was identified as S. gallolyticus subsp. pasteurianus on 16S rRNA gene sequencing. Isolates from all three sample types had identical profiles on pulsed-field gel electrophoresis. The intestinal tract was thought to be the source of the infection. © 2014 The Authors. Pediatrics International © 2014 Japan Pediatric Society.


cDNAs encoding K63-Super-UIM (wild type and mutant) and the Vps27-based K63 binder18 containing C-terminal His tags were produced as synthetic genes (Eurofins) and inserted into pDONR221 by BP reactions (Invitrogen). By means of LR reactions (Invitrogen) the inserts were then transferred to the Champion pET104 BioEase Gateway Biotinylation System (Invitrogen) for recombinant protein production or pcDNA-DEST53 (Invitrogen) for GFP-tagged constitutive mammalian expression. For inducible expression of GFP-tagged K63-Super-UIM, the GFP-K63-Super-UIM complementary DNA was inserted into pcDNA4/TO (Invitrogen). Plasmids encoding HA-tagged wild-type and catalytically inactive (CI) RNF8 (C403S), wild-type and CI (C16S/C19S) forms of RNF168, and UBC13, as well as chimaeras between RNF8 and different E2 enzymes were described previously1, 4, 16. The *FHA mutation (R42A) in HA–RNF8ΔR–UBC13 was generated by site-directed mutagenesis. RNF8 constructs were made resistant to RNF8-siRNA by introducing three silent mutations (bold) in the siRNA targeting sequence (5′-TGCGGAGTATGAGTACGAG-3′) in the plasmids by site-directed mutagenesis. The RNF168 UDM1 (amino acids 110–201) and UDM2 (amino acids 419–487) fragments were amplified by PCR and inserted into either pTriEx-5 (Novagen) for Strep- and His-tagged expression in Escherichia coli and mammalian cells, or pEGFP-C1 (Clontech) for expression of GFP-tagged versions. The Strep–RNF168 UDM1 mutants used in this study (*UMI (L149A) and *MIU1 (A179G)) were generated using the QuikChange site-directed mutagenesis kit (Stratagene). Constructs encoding GFP–H1 isoforms were cloned by inserting the respective cDNAs into the BglII and BamHI sites of pEGFP-C1 (Clontech). A plasmid encoding HMGB1–GFP was provided by M. Bianchi. A Flag–HMGB1 expression construct was generated by inserting the HMGB1 open reading frame (ORF) into pFlag–CMV2 (Sigma). All constructs were verified by sequencing. Plasmid transfections were done with FuGene 6 (Promega) or Genejuice (Novagene), siRNA transfections were done with Lipofectamine RNAiMAX (Invitrogen), according to the manufacturers’ instructions. siRNA sequences used in this study were as follows. Non-targeting control (CTRL), 5′-GGGAUACCUAGACGUUCUATT-3′; UBC13, 5′-GAGCAUGGACUAGGCUAUATT-3′; RNF8, 5′-UGCGGAGUAUGAAUAUGAATT-3′; RNF168, 5′-GUGGAACUGUGGACGAUAATT-3′ or 5′-GGCGAAGAGCGAUGGAAGATT-3′; histone H1(#1), 5′-GCUACGACGUGGAGAAGAATT-3′; H1(#2), 5′-GCUCCUUUAAACUCAACAATT-3′; H1(#3), 5′-GAAGCCAAGCCCAAGGUUATT-3′; H1(#4), 5′-CCUUUAAACUCAACAAGAATT-3′; H1(#5), 5′-CCUUCAAACUCAACAAGAATT-3′; H1(#6), 5′-UCAAGAGCCUGGUGAGCAATT-3′; H1(#7), 5′-GGACCAAGAAAGUGGCCAATT-3′; H1(#8), 5′-GCAUCAAGCUGGGUCUCAATT-3′; H1(#9), 5′-CAGUGAAACCCAAAGCAAATT-3′; H1(#10) (specific for H1x), 5′-CCUUCAAGCUCAACCGCAATT-3′; 53BP1, 5′-GAACGAGGAGACGGUAAUATT-3′; USP7, 5′-GGCGAAGUUUUAAAUGUAUTT-3′; and USP9x, 5′-GCAGUGAGUGGCUGGAAGUTT-3′. Human U2OS, HCT116 and RPE1 cells were obtained from ATCC. U2OS and HCT116 were cultured in DMEM containing 10% FBS and 1×penicillin–streptomycin, while RPE1 cells were grown in a 1:1 mixture of Ham’s F12 and DMEM supplemented with 10% FBS and 1×penicillin–streptomycin. Serum-starvation of RPE1 cells was done by incubating cells for 24 h in medium supplemented with 0.25% FBS. A HCT116 UBC13-knockout cell line was generated using CRISPR–Cas9 technology14, 15. A donor plasmid bearing a splice acceptor site and a puromycin resistance marker, flanked by homology arms, was co-transfected with pX300 (ref. 14) targeting the GGCGCGCGGGAATCGCGGCG sequence within the first intron of the UBC13 gene. To generate cell lines capable of doxycycline-induced expression of GFP-tagged K63-Super-UIM, U2OS cells were transfected with GFP–K63-Super-UIM plasmid and pcDNA6/TR and positive clones were selected with Zeocin (Invitrogen) and Blasticidin S (Invitrogen). Stable U2OS cell lines expressing RNF8 or RNF168 shRNA in a doxycycline-inducible manner or Strep–HA–ubiquitin were described previously1, 4, 31. All cell lines were regularly tested for mycoplasma infection. Unless otherwise indicated, cells were exposed to DSBs using IR (4 Gy for microscopy experiments and 10 Gy for biochemical analyses) or laser micro-irradiation (as described previously32), and collected 1 h later. Purified biotinylated K63-Super-UIM wild-type and mutant proteins containing an N-terminal, biotinylated BioEase tag and a C-terminal His -tag were obtained by expressing the proteins in an E. coli strain expressing the BirA biotin ligase. Bacteria were grown in LB medium containing 0.5 mM biotin, induced with 0.25 mM isopropyl-β-d-thiogalactoside (IPTG) for 3 h at 30 °C, and then lysed by French press. The K63-Super-UIM constructs were purified using immobilized metal affinity chromatography (IMAC) followed by size-exclusion chromatography (SEC). Purity and complete biotinylation of the proteins was verified by mass spectrometry. Recombinant Strep–His –RNF168 UDM-1/2 was produced in Rosetta2(DE3)pLacI (Novagen) bacteria induced with 0.5 mM IPTG for 3 h at 30 °C, lysed using Bugbuster (Novagen) supplemented with Protease Inhibitor Cocktail without EDTA (Roche). The proteins were purified on Ni2+-NTA-agarose (Qiagen). Recombinant human UBA1, UBCH5c, UBC13, MMS2, RNF8 and ubiquitin used for in vitro ubiquitylation assays were purified as described8. Antibodies used in this study included: UBC13 (#4919, Cell Signaling), MCM6 (sc-9843, Santa Cruz), 53BP1 (sc-22760, Santa Cruz), γ-H2A.X (05-636, Millipore; or 2577, Cell Signaling), H2A.X (2595, Cell Signaling), MDC1 (ab11171, Abcam), conjugated ubiquitin (FK2) (BML-PW8810-0500, Enzo Life Sciences), HA (11867423991, Roche; and sc-7392, Santa Cruz), Myc (sc-40, Santa Cruz), His (631212, Clontech), GFP (sc-9996, Santa Cruz; 11814460001, Roche), ubiquitin (sc-8017, Santa Cruz), histone H1.2 (ab17677, Abcam), histone H1x (A304-604A, Bethyl Labs), histone H1 (pan, #AE-4 clone) (ab7789, Abcam), histone H2A (07-146, Millipore), histone H2B (ab1790, Abcam), histone H3 (ab1791, Abcam), histone H4 (ab7311, Abcam), cyclin A (sc-751, Santa Cruz), actin (MAB1501, Millipore), BRCA1 (sc-6954, Santa Cruz), RNF168 for immunofluorescence (06-1130, Millipore) and antibody to RNF168 (ref. 5) used for immunoblots were gifts from D. Durocher. Antibody to RNF8 has been described previously1. For pull-down of K63-ubiquitylated proteins, cells were lysed in high-stringency buffer (50 mM Tris, pH 7.5; 500 mM NaCl; 5 mM EDTA; 1% NP40; 1 mM dithiothreitol (DTT); 0.1% SDS) containing 1.25 mg ml−1 N-ethylmaleimide, 50 μM DUB inhibitor PR619 (LifeSensors), and protease inhibitor cocktail (Roche). Recombinant biotionylated K63-Super-UIM (25 μg ml−1) was added immediately upon lysis, followed by sonication and centrifugation. Streptavidin M-280 Dynabeads (Invitrogen) was added to immobilize the K63-Super-UIM, and bound material was washed extensively in high-stringency buffer. A Benzonase (Sigma) and MNase (NEB) treatment step was included to remove any contaminating nucleotides. Proteins were resolved by SDS–PAGE and analysed by immunoblotting. Where indicated, bound complexes were subjected to deubiquitylation by incubation with USP2cc (1 μM, Boston Biochem) in DUB buffer (50 mM HEPES, pH 7.5; 100 mM NaCl; 1 mM MnCl ; 0.01% Brij-35; 2 mM DTT) overnight at 30 °C before boiling in Laemmli Sample Buffer. Immunoblotting, Strep-Tactin pull-downs, and chromatin enrichment were done essentially as described32. Briefly, Strep–RNF168 UDM pull-down experiments from cells were performed after lysing cells in EBC buffer (50 mM Tris, pH 7.4; 150 mM NaCl; 0.5% NP-40; 1 mM EDTA) containing 1.25 mg ml−1 NEM, 50 μM PR619 (LifeSensors) and protease inhibitor cocktail (Roche). The soluble fraction was subsequently used for immunoprecipitation using Strep-Tactin sepharose (IBA). After washing in EBC buffer, proteins were eluted and analysed by immunoblotting. To isolate Strep–HA–ubiquitin-conjugated proteins, cells were lysed in denaturing buffer (20 mM Tris, pH 7.5; 50 mM NaCl; 1 mM EDTA; 1 mM DTT; 0.5% NP-40; 0.5% sodium deoxycholate; 0.5% SDS) containing 1.25 mg ml−1 NEM, 50 μM PR619 (LifeSensors) and protease inhibitor cocktail (Roche). After sonication and centrifugation, Strep–HA–ubiquitin-conjugated proteins were immobilized on Strep-Tactin sepharose (IBA). After extensive washing in denaturing buffer, proteins were eluted and analysed by immunoblotting. For chromatin fractionation, cells were first lysed in buffer 1 (100 mM NaCl; 300 mM sucrose; 3 mM MgCl ; 10 mM PIPES, pH 6.8; 1 mM EGTA; 0.2% Triton X-100) containing protease, phosphatase and DUB inhibitors and incubated on ice for 5 min. After centrifugation, the soluble proteins were removed and the pellet was resuspended in buffer 2 (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 5 mM EDTA; 1% Triton X-100; 0.1% SDS) containing protease, phosphatase and DUB inhibitors. Lysates were then incubated 10 min on ice, sonicated, and solubilized chromatin-enriched fractions were collected after centrifugation. For immunofluorescence staining, cells were fixed in 4% paraformaldehyde for 15 min, permeabilized with PBS containing 0.2% Triton X-100 for 5 min, and incubated with primary antibodies diluted in DMEM for 1 h at room temperature. After staining with secondary antibodies (Alexa Fluor; Life Technologies) for 1 h, coverslips were mounted in Vectashield mounting medium (Vector Laboratories) containing nuclear stain DAPI. Images of GFP–K63-Super-UIM were all obtained from a stable cell line where GFP–K63-Super-UIM was induced by incubating with 1 μg ml−1 doxycycline for approximately 24 h unless otherwise stated. Images were acquired with an LSM 780 confocal microscope (Carl Zeiss Microimaging) mounted on Zeiss-Axiovert 100M equipped with Plan-Apochromat 40×/1.3 oil immersion objective, using standard settings. Image acquisition and analysis was carried out with ZEN2010 software. For ImageJ-based image analysis, images were acquired with an AF6000 wide-field microscope (Leica Microsystems) equipped with a Plan-Apochromat 40×/0.85 CORR objective, using the same microscopic settings. Fluorescence intensities of the micro-irradiated region (demarcated by γ-H2AX positivity) and the nucleus were first corrected for the general image background. Using these values, relative recruitment to DNA damage sites (relative fluorescence units (RFUs)) was calculated by normalizing the nuclear-background-corrected signal at the micro-irradiated region to that of the nuclear background. Finally, the RFU of the protein of interest was normalized to the RFU of the γ-H2AX signal and plotted as the average of biological triplicates. Fluorescense recovery after photobleaching (FRAP) was performed essentially as described33. Briefly, U2OS cells stably expressing GFP–H1 were grown in glass-bottom dishes (LabTek) in the presence of CO -independent medium. A 2-μm-wide rectangular strip spanning the entire width of the cell was bleached by excitation with the maximal intensity of a 488 nm laser line, after which 95 frames of the bleached region were acquired at 4 s intervals. Mean fluorescence intensities were processed, normalized and analysed as described33. Binding of K63-Super-UIM to di-ubiquitin (Ub ) linkages (Boston Biochem) was done by incubating 100 ng Ub with 2.5 μg K63-Super-UIM immobilized on Streptavidin M-280 Dynabeads (Invitrogen) in buffer A (50 mM Tris, pH 7.5; 10% glycerol; 400 mM NaCl; 0.5% NP40; 2 mM DTT; 0.1 mg ml−1 BSA). After extensive washing, bound complexes were resolved by SDS–PAGE and analysed by immunoblotting. Binding of RNF168 UDM1/2 to di-ubiquitin (Ub ) linkages was analysed by incubating 100 ng Ub with 5 μg Strep–RNF168–UDM1/2 immobilized on Strep-Tactin sepharose (IBA BioTAGnology) in buffer B (50 mM Tris, pH 8; 5% glycerol; 0.5% NP40; 2 mM DTT; 0.1 mg ml−1 BSA; 2 mM MgCl , supplemented with 250 mM KCl for UDM1 binding and 100 mM KCl for UDM2 binding). After extensive washing, bound complexes were resolved by SDS–PAGE and analysed by immunoblotting. Where indicated, UDM1/2 binding to K63-linked Ub was analysed in the presence of increasing KCl concentrations (75 mM, 150 mM and 250 mM). To analyse binding of RNF168 UDM1/2 to recombinant histones, purified Strep–RNF168 UDM1/2 (10 μg) was pre-bound to Strep-Tactin sepharose in buffer C (for binding to H1.0) (50 mM, Tris pH 8; 5% glycerol; 150 mM KCl; 0.5% NP40; 2 mM DTT; 0.1 mg ml−1 BSA) or D (for binding to H2A) (50 mM, Tris pH 8; 5% glycerol; 75 mM KCl; 0.05% NP40; 2 mM DTT; 0.1 mg ml−1 BSA), and incubated with 500 ng recombinant histone H1.0 or H2A (New England Biolabs). Bound complexes were washed and analysed by immunoblotting. To analyse binding of LRM1 and LRM2 peptides to histone H1.0 or H2A, magnetic Streptavidin beads were incubated with buffer E (25 mM, Tris pH 8.5; 5% glycerol; 50 mM KCl; 0.5% TX-100; 1 mM DTT; 0.1 mg ml−1 BSA) in the absence (control) or presence of 1.5 μg purified, biotinylated RNF168 LRM1 (amino acids 110–133) or LRM2 (amino acids 463–485) peptide. Samples were then incubated with 250 ng recombinant H2A or H1.0 for 2 h at 4 °C, and immobilized complexes were washed and analysed by SDS–PAGE and Colloidal Blue staining (Invitrogen). For in vitro ubiquitylation assays, histone-H1-containing oligonucleosomes (10 µM) were purified in the presence of 55 mM iodoacetamide, essentially as described previously34, with the exception that micrococcal nuclease digestion was stopped with 20 mM EGTA and dialysis was started right after the second homogenization in buffer containing 50 mM Tris, pH 7.5; 150 mM NaCl; 1 mM TCEP; and 340 mM sucrose. Dialysed samples were then incubated with DUB inhibitor (Ubiquitin-PA35, 20 μM) for 20 min at room temperature. Nuclesomes were incubated with 0.5 µM human UBA1, 5 µM UBCH5c, 1 µM UBC13–MMS2 complex, 5 µM RNF8 fragment (purified as described previously8) and 75 µM ubiquitin in reaction buffer (50 mM Tris, pH 7.5; 100 mM NaCl; 3 mM ATP; 3 mM MgCl; 1 mM TCEP) at 31 °C. Samples were analysed by immunoblot analysis. For SILAC experiments, U2OS or HCT116 cells were grown in medium containing unlabelled l-arginine and l-lysine (Arg0/Lys0) as the light condition, or isotope-labelled variants of l-arginine and l-lysine (Arg6/Lys4 or Arg10/Lys8) as the heavy condition36. SILAC-labelled HCT116 wild-type and UBC13-knockout cells were lysed in modified RIPA buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1% Nonidet P-40; 0.1% sodium-deoxycholate; 1 mM EDTA) supplemented with protease inhibitors (complete protease inhibitor mixture tablets, Roche Diagnostics) and N-ethylmaleimide (5 mM). Lysates were incubated for 10 min on ice and cleared by centrifugation at 16,000g. An equal amount of protein from the two SILAC states was mixed and precipitated by adding fivefold acetone and incubating at −20 °C overnight. Precipitated proteins were dissolved in denaturing buffer (6 M urea; 2 M thiourea; 10 mM HEPES, pH 8.0), reduced with DTT (1 mM) and alkylated with chloroacetamide (5.5 mM). Proteins were digested with lysyl endoproteinase C (Lys-C) for 6 h, diluted fourfold with water and digested overnight with trypsin. The digestion was stopped by addition of trifluoroacetic acid (0.5% final concentration), incubated at 4 °C for 2 h and centrifuged for 15 min at 4,000g. Peptides from the cleared solution were purified by reversed-phase Sep-Pak C18 cartridges (Waters Corporation). Diglycine-lysine modified peptides were enriched using the Ubiquitin Remnant Motif Kit (Cell Signaling Technology), according to the manufacturer’s intructions. Briefly, peptides were eluted from the Sep-Pak C18 cartridges with 50% acetonitrile, which was subsequently removed by centrifugal evaporation. Peptides were incubated with 40 μl of anti-di-glycine-lysine antibody resin in immunoaffinity purification (IAP) buffer for 4 h at 4 °C. Beads were washed three times with IAP buffer, two times with water and peptides eluted with 0.15% trifluoroacetic acid. Eluted peptides were fractionated by microcolumn-based strong cation exchange chromatography (SCX) and cleaned by reversed-phase C18 stage-tips. SILAC-labelled cells were lysed in high-stringency RIPA buffer (50 mM Tris-HCl, pH 7.5; 500 mM NaCl; 1% Nonidet P-40; 0.1% sodium-deoxycholate; 1 mM EDTA) containing 1.25 mg ml−1 N-ethylmaleimide, 50 μM DUB inhibitor PR619 (LifeSensors), and protease inhibitor cocktail (Roche). Lysates from different SILAC states were separately incubated for 10 min on ice and cleared by centrifugation at 16,000g. Extracts (5 mg) were incubated for 4 h at 4 °C with K63-Super-UIM immobilized to Streptavidin beads (approximately 5 μg K63-Super-UIM per experiment). Beads were washed three times with high-stringency RIPA, beads from the different SILAC conditions were mixed, and proteins were eluted with SDS sample buffer, incubated with DTT (10 mM) for 10 min at 70 °C and alkylated with chloroacetamide (5.5 mM) for 60 min at 25 °C. Proteins were separated by SDS–PAGE using a 4–12% gradient gel and visualized with colloidal blue stain. Gel lanes were sliced into six pieces, and proteins were digested in-gel using standard methods37. Peptides were analysed on a quadrupole Orbitrap (Q Exactive, Thermo Scientific) mass spectrometer equipped with a nanoflow HPLC system (Thermo Scientific). Peptide samples were loaded onto C18 reversed-phase columns and eluted with a linear gradient (1–2 h for in-gel samples, and 3–4 h for di-glycine-lysine enriched samples) from 8 to 40% acetonitrile containing 0.5% acetic acid. The mass spectrometer was operated in a data-dependent mode automatically switching between MS and MS/MS. Survey full scan MS spectra (m/z 300–1200) were acquired in the Orbitrap mass analyser. The 10 most intense ions were sequentially isolated and fragmented by higher-energy C-trap dissociation (HCD). Peptides with unassigned charge states, as well as peptides with charge state less than +2 for in-gel samples and +3 for di-glycine-lysine enriched samples were excluded from fragmentation. Fragment spectra were acquired in the Orbitrap mass analyser. Raw MS data were analysed using MaxQuant software (version 1.3.9.21). Parent ion and tandem mass spectra were searched against protein sequences from the UniProt knowledge database using the Andromeda search engine. Spectra were searched with a mass tolerance of 6 ppm in the MS mode, 20 ppm for MS/MS mode, strict trypsin specificity and allowing up to two missed cleavage sites. Cysteine carbamidomethylation was searched as a fixed modification, whereas amino-terminal protein acetylation, methionine oxidation and N-ethylmaleimide modification of cysteines, and di-glycine-lysine were searched as variable modifications. Di-glycine-lysines were required to be located internally in the peptide sequence. Site localization probabilities were determined using MaxQuant (PTM scoring algorithm) as described previously38. A false discovery rate of less than 1% was achieved using the target-decoy search strategy39 and a posterior error probability filter. Information about previously known protein–protein interactions among putative UBC13-dependent K63-Super-UIM interacting proteins was extracted using the HIPPIE database40 (version 1.6), and interactions were visualized in Cytoscape41. The Gene Ontology (GO) biological process term analysis for UBC13-dependent K63-Super-UIM interacting proteins was filtered for categories annotated with at least 20 and not more than 300 genes. Redundant GO terms (less than 30% unique positive-scoring genes compared to more significant GO term) were removed and the five most significant (Fisher’s exact t-test) remaining GO term categories depicted. To determine the variation within the quantification of ubiquitin linkage types, an F-test was performed and the P values were adjusted using the Bonferroni method. A significant difference in the variances between K48 and K11, and K48 and K6 ubiquitin linkages was detected. To test the significance of the difference between the SILAC ratios measured for ubiquitin linkage types, the Welch two-sample t-test was performed and the obtained P values were adjusted using the Bonferroni method.


News Article | December 16, 2015
Site: www.nature.com

The complementary DNA of PALB2 was obtained from the Mammalian Gene Collection (MGC). Full-length PALB2 and BRCA1 were amplified by PCR, subcloned into pDONR221 and delivered into the pDEST-GFP, pDEST-Flag and the mCherry-LacR vectors using Gateway cloning technology (Invitrogen). Similarly, the coiled-coil domain of BRCA1 (residues 1363–1437) was amplified by PCR, subcloned into the pDONR221 vector and delivered into both mCherryLacR and pDEST-GFP vectors. The N-terminal domain of PALB2 was amplified by PCR and introduced into the GST expression vector pET30-2-His-GST-TEV29 using the EcoRI/XhoI sites. The coiled-coil domain of BRCA1 was cloned into pMAL-c2 using the BamHI/SalI sites. Truncated forms of PALB2 were obtained by introducing stop codons or deletions through site-directed mutagenesis. Full-length CtIP was amplified by PCR, subcloned into the pDONR221 and delivered into the lentiviral construct pCW57.1 (a gift from D. Root; Addgene plasmid #41393) using Gateway cloning technology (Invitrogen). The USP11 cDNA was a gift from D. Cortez and was amplified by PCR and cloned into the pDsRed2-C1 vector using the EcoRI/SalI sites. The bacterial codon-optimized coding sequence of pig USP11 was subcloned into the 6×His–GST vector pETM-30-Htb using the BamHI/EcoRI sites. siRNA-resistant versions of PALB2, BRCA1 and USP11 constructs were generated as previously described11. Full-length CUL3 and RBX1 were amplified by PCR from a human pancreas cDNA library (Invitrogen) as previously described30 and cloned into the dual expression pFBDM vector using NheI/XmaI and BssHII/NotI respectively. The NEDD8 cDNA was a gift from D. Xirodimas and was fused to a double StrepII tag at its C terminus in the pET17b vector (Millipore). Human DEN1 was amplified from a vector supplied by A. Echalier and fused to a non-cleavable N-terminal StrepII2× tag by PCR and inserted into a pET17b vector. The pCOOL-mKEAP1 plasmid was a gift from F. Shao. The pcDNA3-HA2-KEAP1 and pcDNA3-HA2-KEAP1ΔBTB were gifts from Y. Xiong (Addgene plasmids #21556 and 21593). gRNAs were synthesized and processed as described previously31. Annealed gRNAs were cloned into the Cas9-expressing vectors pSpCas9(BB)-2A-Puro (PX459) or pX330-U6-Chimeric_BB-CBh-hSpCas9, a gift from F. Zhang (Addgene plasmids #48139 and 42230). The gRNAs targeting the LMNA or the PML locus and the mClover-tagged LMNA or PML are described previously28. The lentiviral packaging vector psPAX2 and the envelope vector VSV-G were a gift from D. Trono (Addgene plasmids #12260 and 12259). His -Ub was cloned into the pcDNA5-FRT/TO backbone using the XhoI/HindIII sites. All mutations were introduced by site-directed mutagenesis using QuikChange (Stratagene) and all plasmids were sequence-verified. All culture media were supplemented with 10% fetal bovine serum (FBS). U-2-OS (U2OS) cells were cultured in McCoy’s medium (Gibco). 293T cells were cultured in DMEM (Gibco). Parental cells were tested for mycoplasma contamination and authenticated by STR DNA profiling. Plasmid transfections were carried out using Lipofectamine 2000 Transfection Reagent (Invitrogen) following the manufacturer’s protocol. Lentiviral infection was carried out as previously described15. U2OS and 293T cells were purchased from ATCC. U2OS 256 cells were a gift from R. Greenberg. We employed the following antibodies: rabbit anti-53BP1 (A300-273A, Bethyl), rabbit anti-53BP1 (sc-22760, Santa Cruz), mouse anti-53BP1 (#612523, BD Biosciences), mouse anti-γ-H2AX (clone JBW301, Millipore), rabbit anti-γ-H2AX (#2577, Cell Signaling Technologies), rabbit anti-KEAP1 (ab66620, Abcam), rabbit anti-NRF2 (ab62352, Abcam), mouse anti-Flag (clone M2, Sigma), mouse anti-tubulin (CP06, Calbiochem), mouse anti-GFP (#11814460001, Roche), mouse anti-CCNA (MONX10262, Monosan), rabbit anti-BRCA2 (ab9143, Abcam), mouse anti-BRCA2 (OP95, Calbiochem), rabbit anti-BRCA1 (#07–434, Millipore), rabbit anti-USP11 (ab109232, Abcam), rabbit anti-USP11 (A301-613A, Bethyl), rabbit anti-RAD51 (#70-001, Bioacademia), mouse anti-BrdU (RPN202, GE Healthcare), mouse anti-FK2 (BML-PW8810, Enzo), rabbit anti-PALB2 (ref. 32), rabbit anti-GST (sc-459, Santa Cruz), rabbit anti-CUL3 (A301-108A, Bethyl), mouse anti-MBP (E8032, NEB), mouse anti-HA (clone 12CA5, a gift from M. Tyers), rabbit anti-ubiquitin (Z0458, Dako) and mouse anti-actin (CP01, Calbiochem). The following antibodies were used as secondary antibodies in immunofluorescence microscopy: Alexa Fluor 488 donkey anti-rabbit IgG, Alexa Fluor 488 donkey anti-goat IgG, Alexa Fluor 555 donkey anti-mouse IgG, Alexa Fluor 555 donkey anti-rabbit IgG, Alexa Fluor 647 donkey anti-mouse IgG, Alexa Fluor 647 donkey anti-human IgG, Alexa Fluor 647 donkey anti-goat IgG (Molecular Probes). All siRNAs employed in this study were single duplex siRNAs purchased from ThermoFisher. RNA interference (RNAi) transfections were performed using Lipofectamine RNAiMax (Invitrogen) in a forward transfection mode. The individual siRNA duplexes used were: BRCA1 (D-003461-05), PALB2 (D-012928-04), USP11 (D-006063-01), CUL1 (M-004086-01), CUL2 (M-007277-00), CUL3 (M-010224-02), CUL4A (M-012610-01), CUL4B (M-017965-01), CUL5 (M-019553-01), KEAP1 (D-12453-02), RAD51 (M-003530-04), CtIP/RBBP8 (M-001376-00), BRCA2 (D-003462-04), 53BP1 (D-003549-01) and non-targeting control siRNA (D-001210-02). Except when stated otherwise, siRNAs were transfected 48 h before cell processing. We employed the following drugs at the indicated concentrations: cycloheximide (CHX; Sigma) at 100 ng ml−1, camptothecin (CPT; Sigma) at 0.2 μM, ATM inhibitor (KU55933; Selleck Chemicals) at 10 μM, ATR inhibitor (VE-821; a gift from P. Reaper) at 10 μM, DNA-PKcs inhibitor (NU7441; Genetex) at 10 μM, proteasome inhibitor MG132 (Sigma) at 2 μM, lovastatin (S2061; Selleck Chemicals) at 40 μM, doxycycline (#8634-1; Clontech), Nedd8-activating enzyme inhibitor (MLN4929; Active Biochem) at 5 μM and olaparib (Selleck) at the indicated concentrations. In most cases, cells were grown on glass coverslips, fixed with 2% (w/v) paraformaldehyde in PBS for 20 min at room temperature, permeabilized with 0.3% (v/v) Triton X-100 for 20 min at room temperature and blocked with 5% BSA in PBS for 30 min at room temperature. Alternatively, cells were fixed with 100% cold methanol for 10 min at −20 °C and subsequently washed with PBS for 5 min at room temperature before PBS-BSA blocking. Cells were then incubated with the primary antibody diluted in PBS-BSA for 2 h at room temperature. Cells were next washed with PBS and then incubated with secondary antibodies diluted in PBS-BSA supplemented with 0.8 μg ml−1 of DAPI to stain DNA for 1 h at room temperature. The coverslips were mounted onto glass slides with Prolong Gold mounting agent (Invitrogen). Confocal images were taken using a Zeiss LSM780 laser-scanning microscope. For G1 versus S/G2 analysis of the BRCA1–PALB2–BRCA2 axis, cells were first synchronized with a double-thymidine block, released to allow entry into S phase and exposed to 2 or 20 Gy of X-irradiation at 5 h and 12 h post-release and fixed at 1 to 5 h post-treatment (where indicated). For the examination of DNA replication, cells were pre-incubated with 30 μM BrdU for 30 min before irradiation and processed as previously described. 293T and U2OS cells were transiently transfected with three distinct sgRNAs targeting either 53BP1, USP11 or KEAP1 and expressed from the pX459 vector containing Cas9 followed by the 2A-Puromycin cassette. The next day, cells were selected with puromycin for 2 days and subcloned to form single colonies or subpopulations. Clones were screened by immunoblot and/or immunofluorescence to verify the loss of 53BP1, USP11 or KEAP1 expression and subsequently characterized by PCR and sequencing. The genomic region targeted by the CRISPR–Cas9 was amplified by PCR using Turbo Pfu polymerase (Agilent) and the PCR product was cloned into the pCR2.1 TOPO vector (Invitrogen) before sequencing. 293T cells were incubated with the indicated doses of olaparib (Selleck Chemicals) for 24 h, washed once with PBS and counted by trypan blue staining. Five-hundred cells were then plated in duplicate for each condition. The cell survival assay was performed as previously described33. GST and MBP fusions proteins were produced as previously described34, 35. Briefly, MBP proteins expressed in Escherichia coli were purified on amylose resin (New England Biolabs) according to the batch method described by the manufacturer and stored in 1× PBS, 5% glycerol. GST proteins expressed in E. coli were purified on glutathione sepharose 4B (GE Healthcare) resin in 50 mM Tris HCl pH 7.5, 300 mM NaCl, 2 mM dithiothreitol (DTT), 1 mM EDTA, 15 μg ml−1 AEBSF and 1× complete protease inhibitor cocktail (Roche). Upon elution from the resin using 50 mM glutathione in 50 mM Tris HCl pH 8, 2 mM DTT, the His –GST tag was cleaved off using His-tagged TEV protease (provided by F. Sicheri) in 50 mM Tris HCl pH 7.5, 150 mM NaCl, 10 mM glutathione, 10% glycerol, 2 mM sodium citrate and 2 mM β-mercaptoethanol. His -tagged proteins were depleted using Ni-NTA-agarose beads (Qiagen) in 50 mM Tris HCl pH 7.5, 300 mM NaCl, 20 mM imidazole, 5 mM glutathione, 10% glycerol, 1 mM sodium citrate and 2 mM β-mercaptoethanol followed by centrifugal concentration (Amicon centrifugal filters, Millipore). GST–mKEAP1 was purified as described previously36, with an additional anion exchange step on a HiTrap Q HP column (GE Healthcare). The GST tag was left on the protein for in vitro experiments. Purification of CUL3 and RBX1 was performed as previously described30. NEDD8 (gift from D. Xirodimas) and DEN1 were expressed in E. coli BL21 grown in Terrific broth media and induced overnight with 0.5 mM isopropyl-β-D-thiogalactoside (IPTG) at 16 °C. Cells were harvested and resuspended in wash buffer (400 mM NaCl, 50 mM Tris-HCl, pH 8, 5% glycerol, 2 mM DTT), supplemented with lysozyme, universal nuclease (Pierce), benzamidine, leupeptin, pepstatin, PMSF and complete protease inhibitor cocktail (Roche), except for DEN1-expressing cells where the protease inhibitors were omitted. Cells were lysed by sonication and the lysate was cleared by centrifugation at 20,000 r.p.m. for 50 min. The soluble supernatant was bound to a 5 ml Strep-Tactin Superflow Cartridge with a flow rate of 3 ml min−1 using a peristaltic pump. The column was washed with 20 column volumes (CV) of washing buffer and eluted with 5 CV washing buffer, diluted 1:2 in water to reduce the final salt concentration, and supplemented with 2.5 mM desthiobiotin. The elution fractions were pooled and concentrated to a total volume of 4 ml using a 3 kDa cut-off Amicon concentrator. DEN1 was further purified over a Superdex 75 size-exclusion column, buffer exchanged into 150 mM NaCl, HEPES, pH 7.6, 2% glycerol and 1 mM DTT. The C-terminal pro-peptide and StrepII2×-tag were removed by incubation with StrepII2×–DEN1 in a 1:20 molar ratio for 1 h at room temperature. The DEN1 cleavage reaction was buffer exchanged on a Zeba MWCO desalting column (Pierce), to remove the desthiobiotin, and passed through a Strep-Tactin Cartridge, which retains the C-terminal pro-peptide and DEN1. The GST-tagged Sus scrofa (pig) USP11 proteins were expressed in E. coli as described37. Cells were lysed by lysozyme treatment and sonication in 50 mM Tris pH 7.5, 300 mM NaCl, 1 mM EDTA, 1 mM AEBSF, 1× Protease Inhibitor mix (284 ng ml−1 leupeptin, 1.37 μg ml−1 pepstatin A, 170 μg ml−1 PMSF and 330 μg ml−1 benzamidine) and 5% glycerol. Cleared lysate was applied to a column packed with glutathione sepharose 4B (GE Healthcare), washed extensively with lysis buffer before elution in 50 mM Tris pH 7.5, 150 mM NaCl, 5% glycerol and 25 mM reduced glutathione. DUB activity was assayed on fluorogenic ubiquitin-AMC (Enzo life sciences), measured using a Synergy Neo microplate reader (Biotek). His -TEV-ubiquitin-G76C was purified on chelating HiTrap resin, following the manufacturer’s instructions, followed by size-exclusion chromatography on a S-75 column (GE healthcare). The protein was extensively dialysed in 1 mM acetic acid and lyophilized. HA-tagged N-terminal fragments of PALB2 (1–103) (1 μM) were in vitro ubiquitylated using 50 μM wild-type (Ubi WT, Boston Biochem) or a lysine-less ubiquitin (Ub-K0, Boston Biochem), 100 nM human UBA1 (E1), 500 nM CDC34 (provided by F. Sicheri and D. Ceccarelli), 250 nM neddylated CUL3/RBX1, 375 nM GST–mKEAP1 and 1.5 mM ATP in a buffer containing 50 mM Tris HCl pH 7.5, 20 mM NaCl, 10 mM MgCl and 0.5 mM DTT. Ubiquitylation reactions were carried out at 37 °C for 1 h, unless stated otherwise. For USP11-mediated deubiquitylation assays, HA–PALB2 (1–103) was first ubiquitylated using lysine-less ubiquitin with enzyme concentrations as described earlier in 50 μl reactions in a buffer containing 25 mM HEPES pH 8, 150 mM NaCl, 10 mM MgCl , 0.5 mM DTT and 1.5 mM ATP for 1.5 h at 37 °C. Reactions were stopped by the addition of 1 unit Apyrase (New England Biolabs). Reaction products were mixed at a 1:1 ratio with wild-type or catalytically inactive (C270S) USP11, or USP2 (provided by F. Sicheri and E. Zeqiraj) using final concentrations of 100 nM, 500 nM and 2,500 nM (USP11) and 500 nM (USP2) and incubated for 2 h at 30 °C in a buffer containing 25 mM HEPES pH 8, 150 mM NaCl, 2 mM DTT, 0.1 mg ml−1 BSA, 0.03% Brij-35, 5 mM MgCl , 0.375 mM ATP. PALB2 in vitro ubiquitylation reaction products were diluted in a buffer at final concentration of 50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgCl , 0.25 mM DTT and 0.1% NP-40. Twenty micrograms MBP or MBP–BRCA1-CC was coupled to amylose resin (New England Biolabs) in the above buffer supplemented with 0.1% BSA before addition of the ubiquitylation products. Pulldown reactions were performed at 4 °C for 2 h, followed by extensive washing. Cells were collected by trypsinization, washed once with PBS and lysed in 500 μl of lysis buffer (20 mM Tris-HCl pH 8.0, 150 mM NaCl, 10% glycerol, 2 mM EDTA, 1% NP-40, complete protease inhibitor cocktail (Roche), cocktail of phosphatase inhibitors (Sigma) and N-ethylmaleimide to inhibit deubiquitylation) on ice. Lysates were centrifuged at 15,000g for 10 min at 4 °C and protein concentration was evaluated using absorbance at 280 nm. Equivalent amounts of proteins (∼0.5–1 mg) were incubated with 2 μg of rabbit anti-PALB2, rabbit anti-USP11 antibody, rabbit anti-GFP antibody or normal rabbit IgG for 5 h at 4 °C. A mix of protein A/protein G-Sepharose beads (Thermo Scientific) was added for an additional hour. Beads were collected by centrifugation, washed twice with lysis buffer and once with PBS, and eluted by boiling in 2× Laemmli buffer before analysis by SDS–PAGE and immunoblotting. For mass spectrometry analysis of Flag–PALB2, 150 × 106 transiently transfected HEK293T cells were lysed in high-salt lysis buffer (50 mM Tris-HCl pH 7.5, 300 mM NaCl, 1 mM EDTA, 1% Triton X-100, 3 mM MgCl , 3 mM CaCl ), supplemented with complete protease inhibitor cocktail (Roche), 4 mM 1,10-Phenantroline, 50 U benzonase and 50 U micrococcal nuclease. Cleared lysates were incubated with Flag-M2 agarose (Sigma), followed by extensive washing in lysis buffer and 50 mM ammoniumbicarbonate. After immunoprecipitation of transiently transfected Flag–PALB2 from siCTRL-transfected or USP11 siRNA-depleted 293T cells, cysteine residues were reduced and alkylated on beads using 10 mM DTT (30 min at 56 °C) and 15 mM 2-chloroacetamide (1 h at room temperature), respectively. Proteins were digested using limited trypsin digestion on beads (1 μg trypsin; Worthington) per sample, 20 min at 37 °C), and dried to completeness. For LC-MS/MS analysis, peptides were reconstituted in 5% formic acid and loaded onto a 12 cm fused silica column with pulled tip packed in-house with 3.5 μm Zorbax C18 (Agilent Technologies). Samples were analysed using an Orbitrap Velos (Thermo Scientific) coupled to an Eksigent nanoLC ultra (AB SCIEX). Peptides were eluted from the column using a 90 min linear gradient from 2% to 35% acetonitrile in 0.1% formic acid. Tandem MS spectra were acquired in a data-dependent mode for the top two most abundant multiply charged peptides and included targeted scans for five specific N-terminal PALB2 tryptic digest peptides (charge state 1+, 2+, 3+), either in non-modified form or including a diGly-ubiquitin trypsin digestion remnant. Tandem MS spectra were acquired using collision-induced dissociation. Spectra were searched against the human Refseq_V53 database using Mascot, allowing up to four missed cleavages and including carbamidomethyl (C), deamidation (NQ), oxidation (M), GlyGly (K) and LeuArgGlyGly (K) as variable modifications. In vitro ubiquitylated HA–PALB2 (1–103) (50 μl total reaction mix) was run briefly onto an SDS–PAGE gel, followed by total lane excision, in-gel reduction using 10 mM DTT (30 min at 56 °C), alkylation using 50 mM 2-chloroacetamide and trypsin digestion for 16 h at 37 °C. Digested peptides were mixed with 20 μl of a mix of 10 unique heavy isotope-labelled N-terminal PALB2 (AQUA) peptides (covering full or partial tryptic digests of regions surrounding Lys 16, 25, 30 or 43, either in non-modified or diG-modified form; 80–1,200 fmol μl−1 per peptide, based on individual peptide sensitivity testing) before loading 6 μl onto a 12 cm fused silica column with pulled tip packed in-house with 3.5 μm Zorbax C18. Samples were measured on an Orbitrap ELITE (Thermo Scientific) coupled to an Eksigent nanoLC ultra (AB SCIEX). Peptides were eluted from the column using a 180 min linear gradient from 2% to 35% acetonitrile in 0.1% formic acid. Tandem MS spectra were acquired in a data-dependent mode for the top two most abundant multiply charged ions and included targeted scans for the ten specific N-terminal PALB2 tryptic digest peptides (charge states 1+, 2+, 3+), either in light or heavy isotope-labelled form. Tandem MS spectra were acquired using collision induced dissociation. Spectra were searched against the human Refseq_V53 database using Mascot, allowing up to two missed cleavages and including carbamidomethyl (C), deamidation (NQ), oxidation (M), GlyGly (K) and LeuArgGlyGly (K) as variable modifications, after which spectra were manually validated. 293 FLIP-IN cells stably expressing His –Ub were transfected with the indicated siRNA and treated with doxycycline (DOX) for 24 h to induce His –Ub expression. Cells were pre-treated with 10 mM N-ethylmaleimide for 30 min and lysed in denaturating lysis buffer (6 M guanidinium-HCl, 0.1 M Na HPO /NaH PO , 10 mM Tris-HCl, 5 mM imidazole, 0.01 M β-mercaptoethanol, complete protease inhibitor cocktail). Lysates were sonicated on ice twice for 10 s with 1 min break and centrifuged at 15,000g for 10 min at 4 °C. The supernatant was incubated with Ni-NTA-agarose beads (Qiagen) for 4 h at 4 °C. Beads were collected by centrifugation, washed once with denaturating lysis buffer, once with wash buffer (8 M urea, 0.1 M Na HPO /NaH PO , 10 mM Tris-HCl, 5 mM imidazole, 0.01 M β-mercaptoethanol, complete protease inhibitor cocktail), and twice with wash buffer supplemented with 0.1% Triton X-100, and eluted in elution buffer (0.2 M imidazole, 0.15 M Tris-HCl, 30% glycerol, 0.72 M β-mercaptoethanol, 5% SDS) before analysis by SDS–PAGE and immunoblotting. Parental U2OS cells and U2OS cells stably expressing wild-type CtIP or CtIP(T847E) mutant were transfected with the indicated siRNA and the PALB2-KR construct, synchronized with a single thymidine block, treated with doxycycline to induce CtIP expression and subsequently blocked in G1 phase by adding 40 μM lovastatin. Cells were collected by trypsinization, washed once with PBS and electroporated with 2.5 μg of sgRNA plasmid and 2.5 μg of donor template using the Nucleofector technology (Lonza; protocol X-001). Cells were plated in medium supplemented with 40 μM lovastatin and grown for 24 h before flow cytometry analysis. PALB2 (1–103) polypeptides, engineered with only one cross-linkable cysteine, were ubiquitylated by cross-linking alkylation, as previously described38, 39, with the following modifications. Purified PALB2 cysteine mutant (final concentration of 600 μM) was mixed with His -TEV-ubiquitin G76C (350 μM) in 300 mM Tris pH 8.8, 120 mM NaCl and 5% glycerol. Tris(2-carboxyethyl)phosphine (TCEP) (Sigma-Aldrich) reducing agent was added to a final concentration of 6 mM to the mixture and incubated for 30 min at room temperature. The bi-reactive cysteine cross-linker, 1,3-dichloroacetone (Sigma-Aldrich), was dissolved in dimethylformamide and added to the protein mix to a final concentration of 5.25 mM. The reaction was allowed to proceed on ice for 1 h, before being quenched by the addition of 5 mM β-mercaptoethanol. His -TEV-ubiquitin-conjugated PALB2 was enriched by passing over Ni-NTA-agarose beads (Qiagen). No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.


Omori M.,Gyoutoku Sougou Hospital | Watanabe M.,Showa University | Matsumoto K.,Showa University | Honda H.,Showa University | And 2 more authors.
Therapeutic Apheresis and Dialysis | Year: 2010

The aim of this study was to investigate the relationship between serum apolipoprotein (apo) A-IV levels and markers for atherosclerosis, including carotid intima-media thickness (CIMT) and the ankle-brachial index (ABI), in hemodialysis patients. We performed a cross-sectional study involving 116 maintenance hemodialysis patients (70 males; median age, 64 years), measuring CIMT, ABI, the usual laboratory examinations, and serum apo A-IV before the dialysis session. The apo A-IV concentration was measured by a noncompetitive ELISA. Serum apo A-IV concentrations were significantly lower in hemodialysis patients with cardiovascular disease and plaque in the carotid artery. The apo A-IV level was positively associated with urea nitrogen and creatinine, and negatively associated with age, interleukin-6, the neutrophil/lymphocyte ratio, and maximum CIMT. Moreover, serum apo A-IV concentrations were significantly lower in the low ABI group. On logistic analysis, patients with high apo A-IV levels had a lower odds ratio for atherosclerosis (maximum CIMT > 1.0) and cardiovascular disease compared to patients with low apo A-IV levels. On stepwise multivariate regression analysis, the serum apo A-IV level was independently associated with creatinine, the neutrophil/lymphocyte ratio, and the maximum CIMT. Serum apo A-IV is associated with atherosclerotic lesions in hemodialysis patients. Apo A-IV levels may be useful for estimating the risk of cardiovascular disease in dialysis patients. © 2010 International Society for Apheresis.


PubMed | French Institute of Health and Medical Research, Tokyo Medical and Dental University, French National Center for Scientific Research, Osaka Bioscience Institute and BML
Type: Journal Article | Journal: Development (Cambridge, England) | Year: 2014

Through intercellular signalling, the somatic compartment of the foetal testis is able to program primordial germ cells to undergo spermatogenesis. Fibroblast growth factor 9 and several members of the transforming growth factor superfamily are involved in this process in the foetal testis, counteracting the induction of meiosis by retinoic acid and activating germinal mitotic arrest. Here, using in vitro and in vivo approaches, we show that prostaglandin D2 (PGD2), which is produced through both L-Pgds and H-Pgds enzymatic activities in the somatic and germ cell compartments of the foetal testis, plays a role in mitotic arrest in male germ cells by activating the expression and nuclear localization of the CDK inhibitor p21(Cip1) and by repressing pluripotency markers. We show that PGD2 acts through its Dp2 receptor, at least in part through direct effects in germ cells, and contributes to the proper differentiation of male germ cells through the upregulation of the master gene Nanos2. Our data identify PGD2 signalling as an early pathway that acts in both paracrine and autocrine manners, and contributes to the differentiation of germ cells in the foetal testis.


News Article | March 1, 2017
Site: globenewswire.com

Bayport Management Ltd ("BML") has mandated ABG Sundal Collier and DNB Markets as Joint Bookrunners to arrange a series of fixed income investor meetings, commencing on Monday, 6 March 2017. A SEK denominated senior unsecured capital markets transaction may follow, subject to markets conditions and final decision by BML. Please feel free to contact David Rajak, Capital Markets and Investor Relations Executive (+27 11 236 7300 / investor@bayportfinance.com), should you have any queries. This information is information that Bayport Management Ltd is obliged to make public pursuant to the EU Market Abuse Regulation. The information was submitted for publication, through the agency of the contact person set out above, at 11.15 am (CET) on 1st March 2017. This notice is issued pursuant to Listing Rule 11.3 and 11.5 of the Stock Exchange of Mauritius Ltd. The Board of Directors of BML accepts full responsibility for the accuracy of the information contained in this communiqué.


Miller N.E.,University of Oxford | Olszewski W.L.,Polish Academy of Sciences | Hattori H.,BML | Miller I.P.,Oxford PharmAssist | And 5 more authors.
American Journal of Physiology - Endocrinology and Metabolism | Year: 2013

Although much is known about the remodeling of high density lipoproteins (HDLs) in blood, there is no information on that in interstitial fluid, where it might have a major impact on the transport of cholesterol from cells. We incubated plasma and afferent (prenodal) peripheral lymph from 10 healthy men at 37°C in vitro and followed the changes in HDL subclasses by nondenaturing two-dimensional crossed immunoelectrophoresis and size-exclusion chromatography. In plasma, there was always initially a net conversion of small pre-(3-HDLs to cholesteryl ester (CE)-rich a-HDLs. By contrast, in lymph, there was only net production of pre-(3-HDLs from a-HDLs. Endogenous cholesterol esterification rate, cholesteryl ester transfer protein (CETP) concentration, CE transfer activity, phospholipid transfer protein (PLTP) concentration, and phospholipid transfer activity in lymph averaged 5.0, 10.4, 8.2, 25.0, and 82.0% of those in plasma, respectively (all P < 0.02). Lymph PLTP concentration, but not phospholipid transfer activity, was positively correlated with that in plasma (r = +0.63, P = 0.05). Mean PLTP-specific activity was 3.5-fold greater in lymph, reflecting a greater proportion of the high-activity form of PLTP. These findings suggest that cholesterol esterification rate and PLTP specific activity are differentially regulated in the two matrices in accordance with the requirements of reverse cholesterol transport, generating lipid-poor pre-(3-HDLs in the extracellular matrix for cholesterol uptake from neighboring cells and converting pre-(3-HDLs to a-HDLs in plasma for the delivery of cell-derived CEs to the liver. © 2013 the American Physiological Society.


Tada T.,Japan National Institute of Infectious Diseases | Miyoshi-Akiyama T.,Japan National Institute of Infectious Diseases | Shimada K.,Japan National Institute of Infectious Diseases | Shimojima M.,BML | Kirikae T.,Japan National Institute of Infectious Diseases
Antimicrobial Agents and Chemotherapy | Year: 2014

Forty-nine clinical isolates of multidrug-resistant Acinetobacter baumannii were obtained from 12 hospitals in 7 prefectures throughout Japan. Molecular phylogenetic analysis revealed the clonal spread of A. baumannii sequence type 208 (ST208) and ST455 isolates harboring the armA gene and ST512 harboring the armA and blaOXA-72 genes. These findings show that A. baumannii isolates harboring armA are disseminated throughout Japan, and this is the first report to show that A. baumannii strains harboring blaOXA-72 and armA are emerging in hospitals in Japan.copy; 2014, American Society for Microbiology.

Loading BML collaborators
Loading BML collaborators