Time filter

Source Type

Nishi-Tokyo-shi, Japan

Omori M.,Gyoutoku Sougou Hospital | Watanabe M.,Showa University | Matsumoto K.,Showa University | Honda H.,Showa University | And 2 more authors.
Therapeutic Apheresis and Dialysis

The aim of this study was to investigate the relationship between serum apolipoprotein (apo) A-IV levels and markers for atherosclerosis, including carotid intima-media thickness (CIMT) and the ankle-brachial index (ABI), in hemodialysis patients. We performed a cross-sectional study involving 116 maintenance hemodialysis patients (70 males; median age, 64 years), measuring CIMT, ABI, the usual laboratory examinations, and serum apo A-IV before the dialysis session. The apo A-IV concentration was measured by a noncompetitive ELISA. Serum apo A-IV concentrations were significantly lower in hemodialysis patients with cardiovascular disease and plaque in the carotid artery. The apo A-IV level was positively associated with urea nitrogen and creatinine, and negatively associated with age, interleukin-6, the neutrophil/lymphocyte ratio, and maximum CIMT. Moreover, serum apo A-IV concentrations were significantly lower in the low ABI group. On logistic analysis, patients with high apo A-IV levels had a lower odds ratio for atherosclerosis (maximum CIMT > 1.0) and cardiovascular disease compared to patients with low apo A-IV levels. On stepwise multivariate regression analysis, the serum apo A-IV level was independently associated with creatinine, the neutrophil/lymphocyte ratio, and the maximum CIMT. Serum apo A-IV is associated with atherosclerotic lesions in hemodialysis patients. Apo A-IV levels may be useful for estimating the risk of cardiovascular disease in dialysis patients. © 2010 International Society for Apheresis. Source

Hayashi S.,Tokyo Medical and Dental University | Imoto I.,Tokyo Medical and Dental University | Imoto I.,Tokushima University | Aizu Y.,BML | And 26 more authors.
Journal of Human Genetics

Recent advances in the analysis of patients with congenital abnormalities using array-based comparative genome hybridization (aCGH) have uncovered two types of genomic copy-number variants (CNVs); pathogenic CNVs (pCNVs) relevant to congenital disorders and benign CNVs observed also in healthy populations, complicating the screening of disease-associated alterations by aCGH. To apply the aCGH technique to the diagnosis as well as investigation of multiple congenital anomalies and mental retardation (MCA/MR), we constructed a consortium with 23 medical institutes and hospitals in Japan, and recruited 536 patients with clinically uncharacterized MCA/MR, whose karyotypes were normal according to conventional cytogenetics, for two-stage screening using two types of bacterial artificial chromosome-based microarray. The first screening using a targeted array detected pCNV in 54 of 536 cases (10.1%), whereas the second screening of the 349 cases negative in the first screening using a genome-wide high-density array at intervals of approximately 0.7 Mb detected pCNVs in 48 cases (13.8%), including pCNVs relevant to recently established microdeletion or microduplication syndromes, CNVs containing pathogenic genes and recurrent CNVs containing the same region among different patients. The results show the efficient application of aCGH in the clinical setting. © 2011 The Japan Society of Human Genetics All rights reserved. Source

Tada T.,Japan National Institute of Infectious Diseases | Miyoshi-Akiyama T.,Japan National Institute of Infectious Diseases | Shimada K.,Japan National Institute of Infectious Diseases | Shimojima M.,BML | Kirikae T.,Japan National Institute of Infectious Diseases
Antimicrobial Agents and Chemotherapy

Forty-nine clinical isolates of multidrug-resistant Acinetobacter baumannii were obtained from 12 hospitals in 7 prefectures throughout Japan. Molecular phylogenetic analysis revealed the clonal spread of A. baumannii sequence type 208 (ST208) and ST455 isolates harboring the armA gene and ST512 harboring the armA and blaOXA-72 genes. These findings show that A. baumannii isolates harboring armA are disseminated throughout Japan, and this is the first report to show that A. baumannii strains harboring blaOXA-72 and armA are emerging in hospitals in Japan.copy; 2014, American Society for Microbiology. Source

Takahashi Y.,Teikyo University | Takahashi Y.,Chiba University | Ishiwada N.,Chiba University | Tanaka J.,Chiba University | And 5 more authors.
Pediatrics International

Streptococcus gallolyticus subsp. pasteurianus was formerly classified as S. bovis biotype II/2, which is recognized as a rare cause of neonatal sepsis and meningitis. Since the taxonomy classification change, there have not been many reports of meningitis due to S. gallolyticus subsp. pasteurianus. Moreover, the pathogenesis of late onset S. gallolyticus subsp. pasteurianus meningitis in infants is unclear. Here we report a case of meningitis in a 5-week-old infant with preceding diarrhea. S. bovis biotype II/2 was isolated from the blood, cerebrospinal fluid and stool, and then was identified as S. gallolyticus subsp. pasteurianus on 16S rRNA gene sequencing. Isolates from all three sample types had identical profiles on pulsed-field gel electrophoresis. The intestinal tract was thought to be the source of the infection. © 2014 The Authors. Pediatrics International © 2014 Japan Pediatric Society. Source

News Article
Site: http://www.nature.com/nature/current_issue/

cDNAs encoding K63-Super-UIM (wild type and mutant) and the Vps27-based K63 binder18 containing C-terminal His tags were produced as synthetic genes (Eurofins) and inserted into pDONR221 by BP reactions (Invitrogen). By means of LR reactions (Invitrogen) the inserts were then transferred to the Champion pET104 BioEase Gateway Biotinylation System (Invitrogen) for recombinant protein production or pcDNA-DEST53 (Invitrogen) for GFP-tagged constitutive mammalian expression. For inducible expression of GFP-tagged K63-Super-UIM, the GFP-K63-Super-UIM complementary DNA was inserted into pcDNA4/TO (Invitrogen). Plasmids encoding HA-tagged wild-type and catalytically inactive (CI) RNF8 (C403S), wild-type and CI (C16S/C19S) forms of RNF168, and UBC13, as well as chimaeras between RNF8 and different E2 enzymes were described previously1, 4, 16. The *FHA mutation (R42A) in HA–RNF8ΔR–UBC13 was generated by site-directed mutagenesis. RNF8 constructs were made resistant to RNF8-siRNA by introducing three silent mutations (bold) in the siRNA targeting sequence (5′-TGCGGAGTATGAGTACGAG-3′) in the plasmids by site-directed mutagenesis. The RNF168 UDM1 (amino acids 110–201) and UDM2 (amino acids 419–487) fragments were amplified by PCR and inserted into either pTriEx-5 (Novagen) for Strep- and His-tagged expression in Escherichia coli and mammalian cells, or pEGFP-C1 (Clontech) for expression of GFP-tagged versions. The Strep–RNF168 UDM1 mutants used in this study (*UMI (L149A) and *MIU1 (A179G)) were generated using the QuikChange site-directed mutagenesis kit (Stratagene). Constructs encoding GFP–H1 isoforms were cloned by inserting the respective cDNAs into the BglII and BamHI sites of pEGFP-C1 (Clontech). A plasmid encoding HMGB1–GFP was provided by M. Bianchi. A Flag–HMGB1 expression construct was generated by inserting the HMGB1 open reading frame (ORF) into pFlag–CMV2 (Sigma). All constructs were verified by sequencing. Plasmid transfections were done with FuGene 6 (Promega) or Genejuice (Novagene), siRNA transfections were done with Lipofectamine RNAiMAX (Invitrogen), according to the manufacturers’ instructions. siRNA sequences used in this study were as follows. Non-targeting control (CTRL), 5′-GGGAUACCUAGACGUUCUATT-3′; UBC13, 5′-GAGCAUGGACUAGGCUAUATT-3′; RNF8, 5′-UGCGGAGUAUGAAUAUGAATT-3′; RNF168, 5′-GUGGAACUGUGGACGAUAATT-3′ or 5′-GGCGAAGAGCGAUGGAAGATT-3′; histone H1(#1), 5′-GCUACGACGUGGAGAAGAATT-3′; H1(#2), 5′-GCUCCUUUAAACUCAACAATT-3′; H1(#3), 5′-GAAGCCAAGCCCAAGGUUATT-3′; H1(#4), 5′-CCUUUAAACUCAACAAGAATT-3′; H1(#5), 5′-CCUUCAAACUCAACAAGAATT-3′; H1(#6), 5′-UCAAGAGCCUGGUGAGCAATT-3′; H1(#7), 5′-GGACCAAGAAAGUGGCCAATT-3′; H1(#8), 5′-GCAUCAAGCUGGGUCUCAATT-3′; H1(#9), 5′-CAGUGAAACCCAAAGCAAATT-3′; H1(#10) (specific for H1x), 5′-CCUUCAAGCUCAACCGCAATT-3′; 53BP1, 5′-GAACGAGGAGACGGUAAUATT-3′; USP7, 5′-GGCGAAGUUUUAAAUGUAUTT-3′; and USP9x, 5′-GCAGUGAGUGGCUGGAAGUTT-3′. Human U2OS, HCT116 and RPE1 cells were obtained from ATCC. U2OS and HCT116 were cultured in DMEM containing 10% FBS and 1×penicillin–streptomycin, while RPE1 cells were grown in a 1:1 mixture of Ham’s F12 and DMEM supplemented with 10% FBS and 1×penicillin–streptomycin. Serum-starvation of RPE1 cells was done by incubating cells for 24 h in medium supplemented with 0.25% FBS. A HCT116 UBC13-knockout cell line was generated using CRISPR–Cas9 technology14, 15. A donor plasmid bearing a splice acceptor site and a puromycin resistance marker, flanked by homology arms, was co-transfected with pX300 (ref. 14) targeting the GGCGCGCGGGAATCGCGGCG sequence within the first intron of the UBC13 gene. To generate cell lines capable of doxycycline-induced expression of GFP-tagged K63-Super-UIM, U2OS cells were transfected with GFP–K63-Super-UIM plasmid and pcDNA6/TR and positive clones were selected with Zeocin (Invitrogen) and Blasticidin S (Invitrogen). Stable U2OS cell lines expressing RNF8 or RNF168 shRNA in a doxycycline-inducible manner or Strep–HA–ubiquitin were described previously1, 4, 31. All cell lines were regularly tested for mycoplasma infection. Unless otherwise indicated, cells were exposed to DSBs using IR (4 Gy for microscopy experiments and 10 Gy for biochemical analyses) or laser micro-irradiation (as described previously32), and collected 1 h later. Purified biotinylated K63-Super-UIM wild-type and mutant proteins containing an N-terminal, biotinylated BioEase tag and a C-terminal His -tag were obtained by expressing the proteins in an E. coli strain expressing the BirA biotin ligase. Bacteria were grown in LB medium containing 0.5 mM biotin, induced with 0.25 mM isopropyl-β-d-thiogalactoside (IPTG) for 3 h at 30 °C, and then lysed by French press. The K63-Super-UIM constructs were purified using immobilized metal affinity chromatography (IMAC) followed by size-exclusion chromatography (SEC). Purity and complete biotinylation of the proteins was verified by mass spectrometry. Recombinant Strep–His –RNF168 UDM-1/2 was produced in Rosetta2(DE3)pLacI (Novagen) bacteria induced with 0.5 mM IPTG for 3 h at 30 °C, lysed using Bugbuster (Novagen) supplemented with Protease Inhibitor Cocktail without EDTA (Roche). The proteins were purified on Ni2+-NTA-agarose (Qiagen). Recombinant human UBA1, UBCH5c, UBC13, MMS2, RNF8 and ubiquitin used for in vitro ubiquitylation assays were purified as described8. Antibodies used in this study included: UBC13 (#4919, Cell Signaling), MCM6 (sc-9843, Santa Cruz), 53BP1 (sc-22760, Santa Cruz), γ-H2A.X (05-636, Millipore; or 2577, Cell Signaling), H2A.X (2595, Cell Signaling), MDC1 (ab11171, Abcam), conjugated ubiquitin (FK2) (BML-PW8810-0500, Enzo Life Sciences), HA (11867423991, Roche; and sc-7392, Santa Cruz), Myc (sc-40, Santa Cruz), His (631212, Clontech), GFP (sc-9996, Santa Cruz; 11814460001, Roche), ubiquitin (sc-8017, Santa Cruz), histone H1.2 (ab17677, Abcam), histone H1x (A304-604A, Bethyl Labs), histone H1 (pan, #AE-4 clone) (ab7789, Abcam), histone H2A (07-146, Millipore), histone H2B (ab1790, Abcam), histone H3 (ab1791, Abcam), histone H4 (ab7311, Abcam), cyclin A (sc-751, Santa Cruz), actin (MAB1501, Millipore), BRCA1 (sc-6954, Santa Cruz), RNF168 for immunofluorescence (06-1130, Millipore) and antibody to RNF168 (ref. 5) used for immunoblots were gifts from D. Durocher. Antibody to RNF8 has been described previously1. For pull-down of K63-ubiquitylated proteins, cells were lysed in high-stringency buffer (50 mM Tris, pH 7.5; 500 mM NaCl; 5 mM EDTA; 1% NP40; 1 mM dithiothreitol (DTT); 0.1% SDS) containing 1.25 mg ml−1 N-ethylmaleimide, 50 μM DUB inhibitor PR619 (LifeSensors), and protease inhibitor cocktail (Roche). Recombinant biotionylated K63-Super-UIM (25 μg ml−1) was added immediately upon lysis, followed by sonication and centrifugation. Streptavidin M-280 Dynabeads (Invitrogen) was added to immobilize the K63-Super-UIM, and bound material was washed extensively in high-stringency buffer. A Benzonase (Sigma) and MNase (NEB) treatment step was included to remove any contaminating nucleotides. Proteins were resolved by SDS–PAGE and analysed by immunoblotting. Where indicated, bound complexes were subjected to deubiquitylation by incubation with USP2cc (1 μM, Boston Biochem) in DUB buffer (50 mM HEPES, pH 7.5; 100 mM NaCl; 1 mM MnCl ; 0.01% Brij-35; 2 mM DTT) overnight at 30 °C before boiling in Laemmli Sample Buffer. Immunoblotting, Strep-Tactin pull-downs, and chromatin enrichment were done essentially as described32. Briefly, Strep–RNF168 UDM pull-down experiments from cells were performed after lysing cells in EBC buffer (50 mM Tris, pH 7.4; 150 mM NaCl; 0.5% NP-40; 1 mM EDTA) containing 1.25 mg ml−1 NEM, 50 μM PR619 (LifeSensors) and protease inhibitor cocktail (Roche). The soluble fraction was subsequently used for immunoprecipitation using Strep-Tactin sepharose (IBA). After washing in EBC buffer, proteins were eluted and analysed by immunoblotting. To isolate Strep–HA–ubiquitin-conjugated proteins, cells were lysed in denaturing buffer (20 mM Tris, pH 7.5; 50 mM NaCl; 1 mM EDTA; 1 mM DTT; 0.5% NP-40; 0.5% sodium deoxycholate; 0.5% SDS) containing 1.25 mg ml−1 NEM, 50 μM PR619 (LifeSensors) and protease inhibitor cocktail (Roche). After sonication and centrifugation, Strep–HA–ubiquitin-conjugated proteins were immobilized on Strep-Tactin sepharose (IBA). After extensive washing in denaturing buffer, proteins were eluted and analysed by immunoblotting. For chromatin fractionation, cells were first lysed in buffer 1 (100 mM NaCl; 300 mM sucrose; 3 mM MgCl ; 10 mM PIPES, pH 6.8; 1 mM EGTA; 0.2% Triton X-100) containing protease, phosphatase and DUB inhibitors and incubated on ice for 5 min. After centrifugation, the soluble proteins were removed and the pellet was resuspended in buffer 2 (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 5 mM EDTA; 1% Triton X-100; 0.1% SDS) containing protease, phosphatase and DUB inhibitors. Lysates were then incubated 10 min on ice, sonicated, and solubilized chromatin-enriched fractions were collected after centrifugation. For immunofluorescence staining, cells were fixed in 4% paraformaldehyde for 15 min, permeabilized with PBS containing 0.2% Triton X-100 for 5 min, and incubated with primary antibodies diluted in DMEM for 1 h at room temperature. After staining with secondary antibodies (Alexa Fluor; Life Technologies) for 1 h, coverslips were mounted in Vectashield mounting medium (Vector Laboratories) containing nuclear stain DAPI. Images of GFP–K63-Super-UIM were all obtained from a stable cell line where GFP–K63-Super-UIM was induced by incubating with 1 μg ml−1 doxycycline for approximately 24 h unless otherwise stated. Images were acquired with an LSM 780 confocal microscope (Carl Zeiss Microimaging) mounted on Zeiss-Axiovert 100M equipped with Plan-Apochromat 40×/1.3 oil immersion objective, using standard settings. Image acquisition and analysis was carried out with ZEN2010 software. For ImageJ-based image analysis, images were acquired with an AF6000 wide-field microscope (Leica Microsystems) equipped with a Plan-Apochromat 40×/0.85 CORR objective, using the same microscopic settings. Fluorescence intensities of the micro-irradiated region (demarcated by γ-H2AX positivity) and the nucleus were first corrected for the general image background. Using these values, relative recruitment to DNA damage sites (relative fluorescence units (RFUs)) was calculated by normalizing the nuclear-background-corrected signal at the micro-irradiated region to that of the nuclear background. Finally, the RFU of the protein of interest was normalized to the RFU of the γ-H2AX signal and plotted as the average of biological triplicates. Fluorescense recovery after photobleaching (FRAP) was performed essentially as described33. Briefly, U2OS cells stably expressing GFP–H1 were grown in glass-bottom dishes (LabTek) in the presence of CO -independent medium. A 2-μm-wide rectangular strip spanning the entire width of the cell was bleached by excitation with the maximal intensity of a 488 nm laser line, after which 95 frames of the bleached region were acquired at 4 s intervals. Mean fluorescence intensities were processed, normalized and analysed as described33. Binding of K63-Super-UIM to di-ubiquitin (Ub ) linkages (Boston Biochem) was done by incubating 100 ng Ub with 2.5 μg K63-Super-UIM immobilized on Streptavidin M-280 Dynabeads (Invitrogen) in buffer A (50 mM Tris, pH 7.5; 10% glycerol; 400 mM NaCl; 0.5% NP40; 2 mM DTT; 0.1 mg ml−1 BSA). After extensive washing, bound complexes were resolved by SDS–PAGE and analysed by immunoblotting. Binding of RNF168 UDM1/2 to di-ubiquitin (Ub ) linkages was analysed by incubating 100 ng Ub with 5 μg Strep–RNF168–UDM1/2 immobilized on Strep-Tactin sepharose (IBA BioTAGnology) in buffer B (50 mM Tris, pH 8; 5% glycerol; 0.5% NP40; 2 mM DTT; 0.1 mg ml−1 BSA; 2 mM MgCl , supplemented with 250 mM KCl for UDM1 binding and 100 mM KCl for UDM2 binding). After extensive washing, bound complexes were resolved by SDS–PAGE and analysed by immunoblotting. Where indicated, UDM1/2 binding to K63-linked Ub was analysed in the presence of increasing KCl concentrations (75 mM, 150 mM and 250 mM). To analyse binding of RNF168 UDM1/2 to recombinant histones, purified Strep–RNF168 UDM1/2 (10 μg) was pre-bound to Strep-Tactin sepharose in buffer C (for binding to H1.0) (50 mM, Tris pH 8; 5% glycerol; 150 mM KCl; 0.5% NP40; 2 mM DTT; 0.1 mg ml−1 BSA) or D (for binding to H2A) (50 mM, Tris pH 8; 5% glycerol; 75 mM KCl; 0.05% NP40; 2 mM DTT; 0.1 mg ml−1 BSA), and incubated with 500 ng recombinant histone H1.0 or H2A (New England Biolabs). Bound complexes were washed and analysed by immunoblotting. To analyse binding of LRM1 and LRM2 peptides to histone H1.0 or H2A, magnetic Streptavidin beads were incubated with buffer E (25 mM, Tris pH 8.5; 5% glycerol; 50 mM KCl; 0.5% TX-100; 1 mM DTT; 0.1 mg ml−1 BSA) in the absence (control) or presence of 1.5 μg purified, biotinylated RNF168 LRM1 (amino acids 110–133) or LRM2 (amino acids 463–485) peptide. Samples were then incubated with 250 ng recombinant H2A or H1.0 for 2 h at 4 °C, and immobilized complexes were washed and analysed by SDS–PAGE and Colloidal Blue staining (Invitrogen). For in vitro ubiquitylation assays, histone-H1-containing oligonucleosomes (10 µM) were purified in the presence of 55 mM iodoacetamide, essentially as described previously34, with the exception that micrococcal nuclease digestion was stopped with 20 mM EGTA and dialysis was started right after the second homogenization in buffer containing 50 mM Tris, pH 7.5; 150 mM NaCl; 1 mM TCEP; and 340 mM sucrose. Dialysed samples were then incubated with DUB inhibitor (Ubiquitin-PA35, 20 μM) for 20 min at room temperature. Nuclesomes were incubated with 0.5 µM human UBA1, 5 µM UBCH5c, 1 µM UBC13–MMS2 complex, 5 µM RNF8 fragment (purified as described previously8) and 75 µM ubiquitin in reaction buffer (50 mM Tris, pH 7.5; 100 mM NaCl; 3 mM ATP; 3 mM MgCl; 1 mM TCEP) at 31 °C. Samples were analysed by immunoblot analysis. For SILAC experiments, U2OS or HCT116 cells were grown in medium containing unlabelled l-arginine and l-lysine (Arg0/Lys0) as the light condition, or isotope-labelled variants of l-arginine and l-lysine (Arg6/Lys4 or Arg10/Lys8) as the heavy condition36. SILAC-labelled HCT116 wild-type and UBC13-knockout cells were lysed in modified RIPA buffer (50 mM Tris-HCl, pH 7.5; 150 mM NaCl; 1% Nonidet P-40; 0.1% sodium-deoxycholate; 1 mM EDTA) supplemented with protease inhibitors (complete protease inhibitor mixture tablets, Roche Diagnostics) and N-ethylmaleimide (5 mM). Lysates were incubated for 10 min on ice and cleared by centrifugation at 16,000g. An equal amount of protein from the two SILAC states was mixed and precipitated by adding fivefold acetone and incubating at −20 °C overnight. Precipitated proteins were dissolved in denaturing buffer (6 M urea; 2 M thiourea; 10 mM HEPES, pH 8.0), reduced with DTT (1 mM) and alkylated with chloroacetamide (5.5 mM). Proteins were digested with lysyl endoproteinase C (Lys-C) for 6 h, diluted fourfold with water and digested overnight with trypsin. The digestion was stopped by addition of trifluoroacetic acid (0.5% final concentration), incubated at 4 °C for 2 h and centrifuged for 15 min at 4,000g. Peptides from the cleared solution were purified by reversed-phase Sep-Pak C18 cartridges (Waters Corporation). Diglycine-lysine modified peptides were enriched using the Ubiquitin Remnant Motif Kit (Cell Signaling Technology), according to the manufacturer’s intructions. Briefly, peptides were eluted from the Sep-Pak C18 cartridges with 50% acetonitrile, which was subsequently removed by centrifugal evaporation. Peptides were incubated with 40 μl of anti-di-glycine-lysine antibody resin in immunoaffinity purification (IAP) buffer for 4 h at 4 °C. Beads were washed three times with IAP buffer, two times with water and peptides eluted with 0.15% trifluoroacetic acid. Eluted peptides were fractionated by microcolumn-based strong cation exchange chromatography (SCX) and cleaned by reversed-phase C18 stage-tips. SILAC-labelled cells were lysed in high-stringency RIPA buffer (50 mM Tris-HCl, pH 7.5; 500 mM NaCl; 1% Nonidet P-40; 0.1% sodium-deoxycholate; 1 mM EDTA) containing 1.25 mg ml−1 N-ethylmaleimide, 50 μM DUB inhibitor PR619 (LifeSensors), and protease inhibitor cocktail (Roche). Lysates from different SILAC states were separately incubated for 10 min on ice and cleared by centrifugation at 16,000g. Extracts (5 mg) were incubated for 4 h at 4 °C with K63-Super-UIM immobilized to Streptavidin beads (approximately 5 μg K63-Super-UIM per experiment). Beads were washed three times with high-stringency RIPA, beads from the different SILAC conditions were mixed, and proteins were eluted with SDS sample buffer, incubated with DTT (10 mM) for 10 min at 70 °C and alkylated with chloroacetamide (5.5 mM) for 60 min at 25 °C. Proteins were separated by SDS–PAGE using a 4–12% gradient gel and visualized with colloidal blue stain. Gel lanes were sliced into six pieces, and proteins were digested in-gel using standard methods37. Peptides were analysed on a quadrupole Orbitrap (Q Exactive, Thermo Scientific) mass spectrometer equipped with a nanoflow HPLC system (Thermo Scientific). Peptide samples were loaded onto C18 reversed-phase columns and eluted with a linear gradient (1–2 h for in-gel samples, and 3–4 h for di-glycine-lysine enriched samples) from 8 to 40% acetonitrile containing 0.5% acetic acid. The mass spectrometer was operated in a data-dependent mode automatically switching between MS and MS/MS. Survey full scan MS spectra (m/z 300–1200) were acquired in the Orbitrap mass analyser. The 10 most intense ions were sequentially isolated and fragmented by higher-energy C-trap dissociation (HCD). Peptides with unassigned charge states, as well as peptides with charge state less than +2 for in-gel samples and +3 for di-glycine-lysine enriched samples were excluded from fragmentation. Fragment spectra were acquired in the Orbitrap mass analyser. Raw MS data were analysed using MaxQuant software (version Parent ion and tandem mass spectra were searched against protein sequences from the UniProt knowledge database using the Andromeda search engine. Spectra were searched with a mass tolerance of 6 ppm in the MS mode, 20 ppm for MS/MS mode, strict trypsin specificity and allowing up to two missed cleavage sites. Cysteine carbamidomethylation was searched as a fixed modification, whereas amino-terminal protein acetylation, methionine oxidation and N-ethylmaleimide modification of cysteines, and di-glycine-lysine were searched as variable modifications. Di-glycine-lysines were required to be located internally in the peptide sequence. Site localization probabilities were determined using MaxQuant (PTM scoring algorithm) as described previously38. A false discovery rate of less than 1% was achieved using the target-decoy search strategy39 and a posterior error probability filter. Information about previously known protein–protein interactions among putative UBC13-dependent K63-Super-UIM interacting proteins was extracted using the HIPPIE database40 (version 1.6), and interactions were visualized in Cytoscape41. The Gene Ontology (GO) biological process term analysis for UBC13-dependent K63-Super-UIM interacting proteins was filtered for categories annotated with at least 20 and not more than 300 genes. Redundant GO terms (less than 30% unique positive-scoring genes compared to more significant GO term) were removed and the five most significant (Fisher’s exact t-test) remaining GO term categories depicted. To determine the variation within the quantification of ubiquitin linkage types, an F-test was performed and the P values were adjusted using the Bonferroni method. A significant difference in the variances between K48 and K11, and K48 and K6 ubiquitin linkages was detected. To test the significance of the difference between the SILAC ratios measured for ubiquitin linkage types, the Welch two-sample t-test was performed and the obtained P values were adjusted using the Bonferroni method.

Discover hidden collaborations