BME
Hungary
BME
Hungary

Time filter

Source Type

News Article | August 24, 2016
Site: www.nature.com

Mice were bred in specified-pathogen-free facilities at the University Hospital Zurich and Washington University, and housed in groups of 3–5, under a 12 h light/12 h dark cycle (from 7 a.m. to 7 p.m.) at 21 ± 1 °C, with sterilized chow food (Kliba No. 3431, Provimi Kliba) and water ad libitum. Animal care and experimental protocols were in accordance with the Swiss Animal Protection Law, and approved by the Veterinary Office of the Canton of Zurich (permits 123, 130/2008, 41/2012 and 90/2013). The following mice were used in the present study: C57BL/6J, PrnpZH1/ZH1 (ref. 3), co-isogenic C57BL/6J PrnpZH3/ZH3 and PrnpWT/WT control mice6 and Schwann cell-specifc DhhCre::Gpr126fl/fl mutants3, 4. Mice of both genders were used for experiments unless specified. Archival tissues from previous studies1, 6 were also analysed in the current study. No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment except where stated. Sciatic nerves from postnatal day 2–5 were dissected using microsurgical techniques. Nerves were dissociated in serum-free DMEM supplemented with 0.05% collagenase IV (Worthington) for 1 h in the incubator. Sciatic nerves were mechanically dissociated using fire-polished Pasteur pipettes. Cells were filtered in a 40-μM cell strainer and washed in Schwann cell culture medium (DMEM, Pen-Strep, Glutamax, FBS 10%) by centrifugation at 300g for 10 min. Resuspended cells were plated on 3.5 cm Petri dishes previously coated with poly-l-lysine 0.01% (w/v) and laminin (1 mg/ml). Laminin (Cat. No: L2020; from Engelbreth-Holm-Swarm murine sarcoma basement membrane) and poly- l-lysine were obtained from Sigma-Aldrich. Full-length recombinant PrP (recPrP, residues 23–231) and globular domain (GD, residues 121–231) were purified as previously described21, 22, 23. The generation of the GST fusion FT-PrP expression vector (pGEX-KG FT-PrP) was described previously; a modified purification protocol was used24. The FT-PrP expression vector was transformed into BL21 (DE3) strain of Escherichia coli (Invitrogen). Bacteria were grown in Luria-Bertani medium to an OD of 0.6, and the expression of the fusion protein was induced with 0.5 mM isopropyl-1-thio-β-d-galactopyranoside (AppliChem). Cells were then grown for another 4 h at 37 °C and 100 rpm shaking. Cells were pelleted at 5,000g for 20 min at 4 °C (Sorvall centrifuge, DuPont). The pellet was resuspended on ice in lysis buffer (phosphate-buffered saline supplemented with complete protease inhibitors (EDTA-free, Roche), phenylmethyl sulfonyl fluoride (Sigma) and 150 μM lysozyme (Sigma)) and incubated on ice for 30 min. Triton-X 100 (1%), MgCl (10 mM) and DNase I (5 μg/ml, Roche) were added, and the lysate was incubated on ice for 30 min. The lysate was than centrifuged for 20 min at 10,000g at 4 °C. Glutathione sepharose beads were washed with PBS and incubated with the cell lysate for 1 h at 4 °C on a rotating device. Beads were packed into a column and washed with PBS until a stable baseline was reached as monitored by absorbance at A using an ÄKTAprime (GE healthcare). The fusion protein was cleaved on the beads with 5 U/ml Thrombin (GE Healthcare) for 1 h at room temperature under agitation. For thrombin removal, benzamidine sepharose beads were added and incubated for 1 h at 4 °C on a rotating wheel. Protein preparations were analysed by 12% NuPAGE gels followed by Coomassie- or silver-staining. To achieve a higher purity of the protein, we next applied the protein to a sulfopropyl (SP) sepharose column equilibrated with 50 mM Tris-HCl buffer, pH 8.5. Elution was performed with a linear NaCl gradient of 0–1,000 mM. Fractions containing the protein were collected and concentrated (AMICON; MWCO 3500). The protein was then injected in 500 μl portions into a size-exclusion chromatography system (TSK-GEL G2000SW column (Tosoh Bioscience)) and eluted with a linear gradient using PBS. Pure fractions were combined, concentrated and stored at −20 °C. The purity of FT-PrP was >95–98% as judged by a silver-stained 12% NuPAGE gel. SW10 cells and clones derived from them were all grown in DMEM medium supplemented with 10% fetal bovine serum (FBS), penicillin-streptomycin and Glutamax (all obtained from Invitrogen). HEK293T cells, its clonal variant HEK293(H) cells and clones derived therefrom overexpressing various GPCRs were grown in DMEM-F12 medium supplemented with 10% FCS, penicillin-streptomycin and Glutamax (all obtained from Invitrogen). All cell lines were regularly monitored for mycoplasma contamination. The authenticity of SW10 and its derivatives was established by monitoring the expression of Schwann-cell specific markers (Extended Data Fig. 6a). Human Gpr126 (NM_020455), Gpr124, Gpr64, Gpr56, Gpr133, Gpr56 and Gpr176 expression plasmids (pCGpr126-V5, pCGpr124-V5, pCGpr65-V5, pCGpr56-V5, pCGpr133-V5, pCGpr56-V5 and pCGpr176-V5) were generated by PCR amplification of the respective cDNA followed by TOPO cloning into the pCDNA3.1/V5-His-TOPO vector. The cDNA was in frame with the V5 tag (sequence: GKPIPNPLLGLDST) at the C terminus. HEKGPR126 and HEKGPR176 cells were generated by transfecting 1 μg of plasmid into one well of a subconfluent 6-well plate using 3 μl Fugene (Roche) according to the manufacturer’s protocol. Twenty-four hours after transfection, cells were transferred to a 10-cm dish and grown in selective medium containing 0.4 mg/ml G418 (Invitrogen) until emergence of resistant colonies. A limiting dilution was carried out to obtain clonal lines. Membrane expression of the transgene was assessed in the selected clones by confocal microscopy using 1:100 diluted anti-V5 antibody (Invitrogen) and the Cytofix/Cytoperm kit (Pharmingen Cat. Nr. 554714), according to the manufacturer’s protocol. Cerebellar granule neurons were generated from 7–8-day-old PrnpZH1/ZH1 mice as described previously25. Cultures were plated at 350,000 cells per cm2 in Basal Medium Eagle (BME) (Invitrogen) with 10% (v/v) FCS and maintained at 37 °C in 5% CO . pCDNA-PrPC was generated by cloning murine PrPC into pCDNA3.1 vector as described previously26. A site-specific mutagenesis kit (Stratagene) was used to induce alanine substitutions of QPSPG and KKRPK domains in PrPC. Primers used for generating the Ala-QPSPG plasmid were: forward, GTG GAA GCC GGT ATC CCG GGG CGG CAG CCG CTG CAG GCA ACC GTT ACC C; reverse, GGG TAA CGG TTG CCT GCA GCG GCT GCC GCC CCG GGA TAC CGG CTT CCA C. Primers for Ala-KKRPK were: forward, CTA TGT GGA CTG ATG TCG GCC TCT GCG CAG CGG CGC CAG CGC CTG GAG GGT GGA ACA CCG; reverse, CGG TGT TCC ACC CTC CAG GCG CTG GCG CCG CTG CGC AGA GGC CGA CAT CAG TCC ACA TAG. Transfections were performed with Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. 3 μg of DNA was used per well of a 6-well plate. Cells were washed 24 h after transfection using PBS, and fresh medium was added to the cells. HEK293T and HEKGPR126 cells growing in T75 flasks at 50% density were treated with recombinant FT or GD (2 μM, 20 min). Cells were washed twice in PBS and lysed in IP buffer: 1% Triton X-100 in PBS, 1× protease inhibitors (Roche) and Phospho stop (Roche) for 20 min on ice followed by centrifugation at 5000 rpm for 5 min at 4 °C. BCA assays were performed to quantify the amount of protein, and 500 μg of protein was used for immunoprecipitations. 2 μg anti-V5 antibody was added to the cell lysate and incubated on a wheel rotator overnight at 4 °C. On the following day, Protein G dynabeads (Invitrogen) were added to the samples and incubated for a further 3 h on the wheel at 4 °C. Beads were washed three times for 5 min each using the IP buffer followed by addition of 2× sample buffer containing DTT (1 mM final). Samples were heated at 95 °C for 5 min, loaded on 4–12% Novex Bis-tris gels (Invitrogen), and migrated for 1.5 h at 150 V followed by western blotting. Immunoprecipitations were performed by adding 2 μg of POM2 antibody to 500 μl of cell medium and incubating overnight on a wheel rotator at 4 °C. Protein G beads were then added, and incubation on a wheel rotator at 4 °C was performed again. RNA extraction and quantitative PCR were performed as described previously1. The following primers were used: EGR2 forward: 5′-AATGGCTTGGGACTGACTTG-3′; EGR2 reverse: 5′-GCCAGAGAAACCTCCATT-3′; GAPDH forward: 5′-CCACCCCAGCAAGGAGAC-3′; GAPDH reverse: 5′-GAAATTGTGAGGGAGATGCT-3′. Adult zebrafish were maintained in the Washington University Zebrafish Consortium facility ( http://zebrafishfacility.wustl.edu/) and all experiments were performed in compliance with institutional protocols. Embryos were collected from harem matings or in vitro fertilization, raised at 28.5 °C, and staged according to standard protocols27. The gpr126st49 and gpr126st63 mutants were described previously7, 8. gpr126st63 or gpr126st49 mutants were collected from homozygous mutant crosses and wild-type larvae were collected from AB* strain crosses and raised to 50 hpf. FT treatment of gpr126 mutants was performed as previously described15. Briefly, egg water was replaced with either 20 μM FT in egg water or egg water containing an equivalent volume of DMSO. At 55 hpf, larvae were washed twice and raised in egg water to 5 dpf. Wild-type and gpr126 larvae were fixed in 2% paraformaldehyde plus 1% tricholoroacetic acid in phosphate buffered saline, and Mbp and acetylated tubulin immunostaining was performed as described previously8, 28. Expression scoring was performed with observers blinded to treatment according to the following rubric: strong, strong and consistent expression throughout PLLn; some, weak but consistent expression in PLLn; weak, weak and patchy expression in PLLn; none, no expression in PLLn. n = three independent replicate gpr126st63 assays and one gpr126st49 assay. n = 87 DMSO-treated gpr126st63 larvae, 81 Prp-FT-treated gpr126st63 larvae, 27 DMSO-treated gpr126st49 larvae, 25 Prp-FT-treated gpr126st49 larvae. Fluorescent nerve images were analysed using the Fiji software29. A rectangular region-of-interest (ROI) was drawn longitudinally over the fluorescent nerve. The longitudinal grey-scale histogram of the myelin basic protein (Mbp) was normalized pixel-by-pixel to the corresponding intensity of the acetylated tubulin (AcTub). The size of the measured ROIs was kept constant across different treatment modalities. SW10 cells were grown in P75 flasks at 50% density, rinsed with PBS, and detached from culture flasks with dissociation buffer containing EDTA (GIBCO). After detaching, cells were washed to remove residual EDTA and counted using a Neubauer chamber. Batches of 105 SW10 cells were transferred to FACS tubes, treated with HA-tagged recombinant peptides for 20 min, washed, and incubated with Alexa-488 conjugated anti-HA antibody for 30 min. After further washes and centrifugations, cells were resuspended in 200 μl FACS buffer (PBS +10% FBS) and analysed with a FACS Canto II cytofluorimeter (BD Biosciences). Data were analysed using FloJo software. Schwann cells were lysed in cell-lysis buffer (Tris-HCl 20 mM, NaCl 137 mM, Triton-X-100 1%) supplemented with protease inhibitor cocktail (Roche complete mini). The lysate was homogenized by passing several times through a 26G syringe, and cleared by centrifugation at 8,000g, 4 °C for 2 min. in a tabletop centrifuge (Eppendorf 5415R). Protein concentration was measured with the BCA assay (Thermo Scientific). 10 μg total protein was boiled in 4 × LDS (Invitrogen) at 95 °C for 5 min. After a short centrifugation, samples were loaded on a gradient of 4–12% Novex Bis-Tris Gel (Invitrogen) for electrophoresis at constant voltage of 200 V. Gels were transferred to PVDF membranes with the iBlot system (Life technologies). Membranes were blocked with 5% Top-Block (Sigma) in PBS-T for 1h at room temperature. Primary antibody was incubated overnight in PBS-T with 5% Top-Block. Membranes were washed three times with PBS-T for 10 min and incubated for 1 h with secondary antibodies coupled to horseradish peroxidase at room temperature. After three washes with PBS-T, the membranes were developed with a Crescendo chemiluminescence substrate system (Millipore). Signals were detected using a Stella 3200 imaging system (Raytest). Monoclonal antibodies against PrPC were obtained and used as described previously4. Fab3 and Fab71 antibodies were generated using the phage display technology and their epitopes were mapped with overlapping peptides. Anti AKT, p-AKT were obtained from Cell signaling and used at 1:2,000 dilutions for western blotting. The anti-p75NGF receptor antibody was obtained from Abcam and used at a 1:200 dilution for immunofluorescence. Anti V5 antibody was from Invitrogen and used at a dilution of 1:500 for western blot and 2 μg antibody was used for immunoprecipitation on 500 μg of cell lysate. In the direct cAMP ELISA assay, cAMP levels were assessed with a colorimetric competitive immunoassay (Enzo Life Sciences). Quantitative determination of intracellular cAMP was performed in cells or tissues lysed in 0.1 M HCl to stop endogenous phosphodiesterase activity and to stabilize the released cAMP. SW10 or HEK293T cells (100,000 cells per well) were plated in 6-well plates to ~50% density. Cells were treated with conditioned medium or recombinant peptides (2 μM, unless specified) for 20 min unless otherwise mentioned. Cells were lysed with 0.1 M HCl lysis buffer (Direct cAMP ELISA kit, Enzo). To ensure complete detachment of cells, cell scrapers were used. Lysates were homogenized with a 26G needle and syringe before clearing by centrifugation at 600g for 10 min. The subsequent steps were performed according to the manufacturer’s protocol based on competition of sample cAMP with a cAMP-alkaline phosphatase conjugate. To measure in vivo cAMP changes, BL6, PrnpZH3/ZH3 or PrnpZH1/ZH1 mice were intravenously injected with 600 μg of either FT or, as a control, uncharged FT ( ). Twenty minutes after infusion, mice were killed and all organs were collected. For cAMP assays, organs were homogenized in 0.1 M HCl. Subsequent steps were performed according to the manufacturer’s protocols as described above. Cyclic AMP levels were calculated using a cAMP standard curve in the case of ELISA based assay. Finally, cAMP concentrations were normalized to total protein content in each sample. cAMP changes are represented as fold changes to the respective controls. For each experiment, at least three independent biological replicates were used. For in vivo assays, groups of 8–16 mice were used for each experiment. For normalization purposes, the median value of the respective control sample was defined as 1. All measurements within each panel were normalized to this control value. For in vivo assays, sample sets were coded and investigators were blinded to their identities. The assignment of codes to sample identities was performed only after the cAMP values were plotted for each set. We designed two CRISPR short-guide RNA (sgRNAs) against exon 2 of Gpr126 (upper Guide CCTGTGTTCCTCTCTCAGGT and lower Guide AACAGGAACAGCAGGGCGCT). The DNA sequences corresponding to the sgRNAs were cloned into expression plasmids and transfected with EGFP-expressing Cas9-nickase plasmids. Single EGFP-expressing Schwann cells were isolated with a FACS sorter (Aria III). To determine the exact sequence of indels induced by genome editing, we amplified the sgRNA-targeted locus by PCR and subcloned the fragments into blunt-TOPO vectors. Ten colonies per cell line were sequenced and showed distinct indels on each allele. A clonal subline devoid of Gpr126 was used for further studies. This cell line possessed insertions on both the alleles; a 49-bp insertion at position 118 and a 5-bp insertion at position 84 on each allele. Both insertions led to a frameshift and to the generation of premature stop codons leading to early translation termination. Luciferase reporter constructs were generated containing a 1.3-kB sequence upstream of the transcription-starting site of Egr2. SW10 Schwann cells were transfected with Egr2 reporter construct and a renilla plasmid using lipofectamine 2000. After one day in vitro, Schwann cells were treated with recombinant full-length PrP (23–231), the globular domain of PrP (121–231) or PBS control. Luciferase activity was measured 24 h after stimulation with Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s recommendations. Results were normalized to renilla transfection controls. Glass coverslips were placed in 12-well plates (Thermo Scientific) and coated with 0.01% w/v Poly-l-lysine solution (Sigma) overnight at room temperature. Coverslips were washed three times with ddH O and dried for 2 h in a laminar-flow hood. Schwann cells were seeded and cultured at 50% density. Cells were treated with recombinant FT-PrP, full length recPrP or C1-PrP for 20 min, and washed with serum-free DMEM. Cells were further washed with PBS followed by fixation with 4% paraformaldehyde. Fixed cells were incubated in blocking buffer (PBS+10% FBS) for 1 h. Cells were treated with various primary antibodies followed by washes and incubation with Alexa 488 and Alexa 647 tagged rabbit or mouse secondary antibodies (Life Technologies). Imaging was performed by Leica SP2 confocal microscope using a 20× objective; images were processed by Image J software. Transmission electron microscopy was performed as previously described6. Briefly, mice under deep anaesthesia were subjected to transcardial perfusion with PBS heparin and sciatic nerves were fixed in situ with 2.5% glutaraldehyde plus 2% paraformaldehyde in 0.1 M phosphate buffer, pH 7.4 and embedded in Epon. Ultrathin sections were mounted on copper grids coated with Formvar membrane and contrasted with uranyl acetate/lead citrate. Micrographs were acquired using a Hitachi H-7650 electron microscope (Hitachi High-Tech, Japan) operating at 80 kV. Brightness and contrast were adjusted using Photoshop. For quantification of Remak bundles and onion bulb-like structures, images were captured at 1,500× magnification and axon numbers and abnormal onion bulb-like structures were counted manually. Quantification was performed in a blinded fashion by assigning numbers to the images and upon completion of quantification genotypes were revealed. HA-tagged and untagged synthetic peptides were produced by EZ Biosciences. A stock solution of 2 mM was prepared by dissolving the peptides in PBS and they were used at a final concentration of 2 μM unless specified. The sequences of all the peptides used in this study can be found in Extended Data Table 1.


WiseGuyReports.Com Publish a New Market Research Report On – “Ammonium Nitrate Explosive Market by Manufacturers,Types,Regions and Applications Research Report Forecast to 2021”. Ammonium nitrate explosive is a mixed explosive whose main component is ammonium nitrate. It has found wide use in coal mining, quarrying, metal mining, and civil construction in undemanding applications. Scope of the Report:  This report focuses on the Ammonium Nitrate Explosive in Global market, especially in North America, Europe and Asia-Pacific, Latin America, Middle and Africa. This report categorizes the market based on manufacturers, regions, type and application. For more information or any query mail at [email protected] Market Segment by Regions, regional analysis covers  North America (USA, Canada and Mexico)  Europe (Germany, France, UK, Russia and Italy)  Asia-Pacific (China, Japan, Korea, India and Southeast Asia)  Latin America, Middle and Africa Market Segment by Applications, can be divided into  Coal Mining  Quarrying  Metal Mining  Civil construction 1 Manufacturers Profiles  1.1 Orica  1.1.1 Business Overview  1.1.2 Ammonium Nitrate Explosive Type and Applications  1.1.2.1 Type 1  1.1.2.2 Type 2  1.1.2 Orica Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.2 IPL (Dyno Nobel)  1.2.1 Business Overview  1.2.2 Ammonium Nitrate Explosive Type and Applications  1.2.2.1 Type 1  1.2.2.2 Type 2  1.2.2 IPL (Dyno Nobel) Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.3 ENAEX  1.3.1 Business Overview  1.3.2 Ammonium Nitrate Explosive Type and Applications  1.3.2.1 Type 1  1.3.2.2 Type 2  1.3.2 ENAEX Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.4 MAXAM  1.4.1 Business Overview  1.4.2 Ammonium Nitrate Explosive Type and Applications  1.4.2.1 Type 1  1.4.2.2 Type 2  1.4.2 MAXAM Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.5 AEL  1.5.1 Business Overview  1.5.2 Ammonium Nitrate Explosive Type and Applications  1.5.2.1 Type 1  1.5.2.2 Type 2  1.5.2 AEL Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.6 Sasol  1.6.1 Business Overview  1.6.2 Ammonium Nitrate Explosive Type and Applications  1.6.2.1 Type 1  1.6.2.2 Type 2  1.6.2 Sasol Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.7 EPC-UK  1.7.1 Business Overview  1.7.2 Ammonium Nitrate Explosive Type and Applications  1.7.2.1 Type 1  1.7.2.2 Type 2  1.7.2 EPC-UK Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.8 BME Mining  1.8.1 Business Overview  1.8.2 Ammonium Nitrate Explosive Type and Applications  1.8.2.1 Type 1  1.8.2.2 Type 2  1.8.2 BME Mining Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.9 NOF CORPORATION  1.9.1 Business Overview  1.9.2 Ammonium Nitrate Explosive Type and Applications  1.9.2.1 Type 1  1.9.2.2 Type 2  1.9.2 NOF CORPORATION Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.10 Solar Explosives  1.10.1 Business Overview  1.10.2 Ammonium Nitrate Explosive Type and Applications  1.10.2.1 Type 1  1.10.2.2 Type 2  1.10.2 Solar Explosives Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.11 Austin  1.11.1 Business Overview  1.11.2 Ammonium Nitrate Explosive Type and Applications  1.11.2.1 Type 1  1.11.2.2 Type 2  1.11.2 Austin Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.12 Yunnan Anning Chemical  1.12.1 Business Overview  1.12.2 Ammonium Nitrate Explosive Type and Applications  1.12.2.1 Type 1  1.12.2.2 Type 2  1.12.2 Yunnan Anning Chemical Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.13 Aihui Jiangnan Chemical  1.13.1 Business Overview  1.13.2 Ammonium Nitrate Explosive Type and Applications  1.13.2.1 Type 1  1.13.2.2 Type 2  1.13.2 Aihui Jiangnan Chemical Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.14 Guizhou Jiulian  1.14.1 Business Overview  1.14.2 Ammonium Nitrate Explosive Type and Applications  1.14.2.1 Type 1  1.14.2.2 Type 2  1.14.2 Guizhou Jiulian Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.15 Gezhouba Explosive  1.15.1 Business Overview  1.15.2 Ammonium Nitrate Explosive Type and Applications  1.15.2.1 Type 1  1.15.2.2 Type 2  1.15.2 Gezhouba Explosive Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.16 Hunan Nanling civilian blasting equipment  1.16.1 Business Overview  1.16.2 Ammonium Nitrate Explosive Type and Applications  1.16.2.1 Type 1  1.16.2.2 Type 2  1.16.2 Hunan Nanling civilian blasting equipment Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.17 Shengli Group  1.17.1 Business Overview  1.17.2 Ammonium Nitrate Explosive Type and Applications  1.17.2.1 Type 1  1.17.2.2 Type 2  1.17.2 Shengli Group Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.18 China Coal Pingshuo Group  1.18.1 Business Overview  1.18.2 Ammonium Nitrate Explosive Type and Applications  1.18.2.1 Type 1  1.18.2.2 Type 2  1.18.2 China Coal Pingshuo Group Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.19 Yahua  1.19.1 Business Overview  1.19.2 Ammonium Nitrate Explosive Type and Applications  1.19.2.1 Type 1  1.19.2.2 Type 2  1.19.2 Yahua Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.20 Poly Explosives Group  1.20.1 Business Overview  1.20.2 Ammonium Nitrate Explosive Type and Applications  1.20.2.1 Type 1  1.20.2.2 Type 2  1.20.2 Poly Explosives Group Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.21 Fujian Haixia Technolocy  1.21.1 Business Overview  1.21.2 Ammonium Nitrate Explosive Type and Applications  1.21.2.1 Type 1  1.21.2.2 Type 2  1.21.2 Fujian Haixia Technolocy Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.22 Anhui Leiming Kehua  1.22.1 Business Overview  1.22.2 Ammonium Nitrate Explosive Type and Applications  1.22.2.1 Type 1  1.22.2.2 Type 2  1.22.2 Anhui Leiming Kehua Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.23 Hubei Kailong Chemical  1.23.1 Business Overview  1.23.2 Ammonium Nitrate Explosive Type and Applications  1.23.2.1 Type 1  1.23.2.2 Type 2  1.23.2 Hubei Kailong Chemical Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.24 Shanxi Tond Chemical  1.24.1 Business Overview  1.24.2 Ammonium Nitrate Explosive Type and Applications  1.24.2.1 Type 1  1.24.2.2 Type 2  1.24.2 Shanxi Tond Chemical Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.25 Shanxi Coking Coal Group  1.25.1 Business Overview  1.25.2 Ammonium Nitrate Explosive Type and Applications  1.25.2.1 Type 1  1.25.2.2 Type 2  1.25.2 Shanxi Coking Coal Group Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share  1.26 Shaanxi Hongqi Industrial Explosive Group  1.26.1 Business Overview  1.26.2 Ammonium Nitrate Explosive Type and Applications  1.26.2.1 Type 1  1.26.2.2 Type 2  1.26.2 Shaanxi Hongqi Industrial Explosive Group Ammonium Nitrate Explosive Sales, Price, Revenue and Market Share 2 Global Ammonium Nitrate Explosive Market Competition, by Manufacturer      2.1 Global Ammonium Nitrate Explosive Sales and Market Share by Manufacturer      2.2 Global Ammonium Nitrate Explosive Revenue and Market Share by Manufacturer 3 Global Ammonium Nitrate Explosive Market Analysis by Regions        3.1.1 Global Ammonium Nitrate Explosive Sales by Regions (2011-2016)        3.1.2 Global Ammonium Nitrate Explosive Revenue by Regions (2011-2016)      3.2 North America (USA, Canada and Mexico) Ammonium Nitrate Explosive Sales and Growth (2011-2016)      3.3 Europe (Germany, France, UK, Russia and Italy) Ammonium Nitrate Explosive Sales and Growth (2011-2016)      3.4 Asia-Pacific (China, Japan, Korea, India and Southeast Asia) Ammonium Nitrate Explosive Sales and Growth (2011-2016)      3.5 Latin America, Middle and Africa Ammonium Nitrate Explosive Sales and Growth (2011-2016)      3.6 Ammonium Nitrate Explosive Sales and Growth (2011-2016) 4 North America (USA, Canada and Mexico) Ammonium Nitrate Explosive by Countries      4.1 North America (USA, Canada and Mexico) Ammonium Nitrate Explosive Sales, Revenue and Market Share by Countries        4.1.1 North America (USA, Canada and Mexico) Ammonium Nitrate Explosive Sales by Countries (2011-2016)        4.1.2 North America (USA, Canada and Mexico) Ammonium Nitrate Explosive Revenue by Countries (2011-2016)      4.2 USA Ammonium Nitrate Explosive Sales and Growth (2011-2016)      4.3 Canada Ammonium Nitrate Explosive Sales and Growth (2011-2016)      4.4 Mexico Ammonium Nitrate Explosive Sales and Growth (2011-2016) For more information or any query mail at [email protected] Wise Guy Reports is part of the Wise Guy Consultants Pvt. Ltd. and offers premium progressive statistical surveying, market research reports, analysis & forecast data for industries and governments around the globe. Wise Guy Reports features an exhaustive list of market research reports from hundreds of publishers worldwide. We boast a database spanning virtually every market category and an even more comprehensive collection of market research reports under these categories and sub-categories.


Wiseguyreports.Com Adds “Mining Explosive -Market Demand, Growth, Opportunities and analysis of Top Key Player Forecast to 2021” To Its Research Database The Mining Explosive is the time and place where a retail transaction is completed. At the point of sale, the merchant would calculate the amount owed by the customer and indicate the amount, and may prepare an invoice for the customer (which may be a cash register printout), and indicate the options for the customer to make payment. It is also the point at which a customer makes a payment to the merchant in exchange for goods or after provision of a service. After receiving payment, the merchant may issue a receipt for the transaction, which is usually printed, but is increasingly being dispensed with or sent electronically. This report focuses on the Mining Explosive in Global market, especially in North America, Europe and Asia-Pacific, Latin America, Middle and Africa. This report categorizes the market based on manufacturers, regions, type and application. Market Segment by Regions, regional analysis covers North America (USA, Canada and Mexico) Europe (Germany, France, UK, Russia and Italy) Asia-Pacific (China, Japan, Korea, India and Southeast Asia) Latin America, Middle and Africa Market Segment by Applications, can be divided into Coal Mining Quarrying and Nonmetal Mining Metal Mining There are 13 Chapters to deeply display the global Mining Explosive market. Chapter 1, to describe Mining Explosive Introduction, product scope, market overview, market opportunities, market risk, market driving force; Chapter 2, to analyze the top manufacturers of Mining Explosive, with sales, revenue, and price of Mining Explosive, in 2015 and 2016; Chapter 3, to display the competitive situation among the top manufacturers, with sales, revenue and market share in 2015 and 2016; Chapter 4, to show the global market by regions, with sales, revenue and market share of Mining Explosive, for each region, from 2011 to 2016; Chapter 5, 6, 7 and 8, to analyze the key regions, with sales, revenue and market share by key countries in these regions; Chapter 9 and 10, to show the market by type and application, with sales market share and growth rate by type, application, from 2011 to 2016; Chapter 11, Mining Explosive market forecast, by regions, type and application, with sales and revenue, from 2016 to 2021; Chapter 12 and 13, to describe Mining Explosive sales channel, distributors, traders, dealers, appendix and data source. 1 Market Overview 1 1.1 Mining Explosive Introduction 1 1.2 Market Analysis by Type 2 1.2.1 Ammonium Nitrate Explosives (Powder) 4 1.2.2 ANFO 4 1.2.3 Emulsion Explosive 5 1.3 Market Analysis by Applications 5 1.3.1 Coal Mining 7 1.3.2 Quarrying and Nonmetal Mining 7 1.3.3 Metal Mining 8 1.4 Market Analysis by Regions 9 1.4.1 North America (USA, Canada and Mexico) 9 1.4.1.1 USA 9 1.4.1.2 Canada 10 1.4.1.3 Mexico 10 1.4.2 Europe (Germany, France, UK, Russia and Italy) 11 1.4.2.1 Germany 11 1.4.2.2 France 11 1.4.2.3 UK 12 1.4.2.4 Russia 12 1.4.2.5 Italy 13 1.4.3 Asia-Pacific (China, Japan, Korea, India and Southeast Asia) 13 1.4.3.1 China 13 1.4.3.2 Japan 14 1.4.3.3 Korea 14 1.4.3.4 India 15 1.4.3.5 Southeast Asia 15 1.4.4 Latin America, MEA 16 1.4.3.1 Brazil 16 1.4.3.2 Egypt 16 1.4.3.3 Saudi Arabia 17 1.4.3.4 South Africa 17 1.4.3.5 Nigeria 18 1.5 Market Dynamics 18 1.5.1 Market Opportunities 18 1.5.2 Market Risk 18 1.5.3 Market Driving Force 19 2 Major Manufacturers Analysis of Mining Explosive 20 2.1 Orica 20 2.1.1 Company Profile 20 2.1.2 Product Information 21 2.1.2.1 Amex™ Mining Explosives Overview 21 2.1.2.2 Apex™ Mining Explosives Overview 21 2.1.2.3 Conepak™ / MiniCone Pak™ Mining Explosives Overview 22 2.1.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 23 2.2 IPL (Dyno Nobel) 23 2.2.1 Company Profile 23 2.2.2 Product Information 24 2.2.2.1 TITAN 1000 Mining Explosives Overview 24 2.2.2.2 DYNOMIX Mining Explosives Overview 25 2.2.2.3 TITAN 1000ΔΕMining Explosives Overview 26 2.2.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 27 2.3 MAXAM 28 2.3.1 Company Profile 28 2.3.2 Product Information 29 2.3.2.1 ANFO Mining Explosives Overview 29 2.3.2.2 RIOFRAG™ Mining Explosives Overview 29 2.3.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 30 2.4 AEL 31 2.4.1 Company Profile 31 2.4.2 Product Information 32 2.4.2.1 S100 Mining Explosives Overview 32 2.4.2.2 Mining Explosives Overview 33 2.4.2.3 S200 Plus Range Mining Explosives Overview 34 2.4.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 35 2.5 ENAEX 36 2.5.1 Company Profile 36 2.5.2 Product Information 37 2.5.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 37 2.6 Sasol 37 2.6.1 Company Profile 37 2.6.2 Product Information 38 2.6.2.1 Expanfo™ Anfo Mining Explosives Overview 38 2.6.2.2 Expan™ Ammonium Nitrate Mining Explosives Overview 39 2.6.2.3 Emex® Jumbo Mining Explosives Overview 39 2.6.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 40 2.7 Yunnan Civil Explosive 40 2.7.1 Company Profile 40 2.7.2 Product Information 42 2.7.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 42 2.8 Solar Explosives 42 2.8.1 Company Profile 42 2.8.2 Product Information 43 2.8.2.1 Large Dia Slurry Mining Explosives Overview 43 2.8.2.2 Small Dia Mining Explosives Overview 44 2.8.2.3 Bulk Mining Explosives Overview 44 2.8.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 45 2.9 Gezhouba Explosive 45 2.9.1 Company Profile 45 2.9.2 Product Information 46 2.9.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 47 2.10 EPC-UK 47 2.10.1 Company Profile 47 2.10.2 Product Information 48 2.10.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 48 2.11 Anhui Jiangnan 49 2.11.1 Company Profile 49 2.11.2 Product Information 50 2.11.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 50 2.12 Guizhou Jiulian 50 2.12.1 Company Profile 50 2.12.2 Product Information 51 2.12.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 52 2.13 Nanling Civil Explosive 52 2.13.1 Company Profile 52 2.13.2 Product Information 53 2.13.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 54 2.14 BME Mining 55 2.14.1 Company Profile 55 2.14.2 Product Information 56 2.14.2.1 MegamiteTM Mining Explosives Overview 56 2.14.2.2 PanexTM Mining Explosives Overview 57 2.14.2.3 HEF 100 Mining Explosives Overview 58 2.14.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 58 2.15 NOF Corporation 59 2.15.1 Company Profile 59 2.15.2 Product Information 60 2.15.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 60 2.16 IDEAL 61 2.16.1 Company Profile 61 2.16.2 Product Information 62 2.16.3 Mining Explosive Sales, Price, Revenue, Gross Margin and Market Share 62 For more information, please visit https://www.wiseguyreports.com/sample-request/718346-global-mining-explosive-market-forecast-to-2021


NEW YORK--(BUSINESS WIRE)--Please replace the release issued March 1, 2017 at 5pm ET with the following corrected version due to multiple revisions. DISTRIBUTION DATES AND AMOUNTS ANNOUNCED FOR CERTAIN BLACKROCK CLOSED-END FUNDS (AMENDED AND RESTATED PRESS RELEASE) Certain BlackRock closed-end funds (the “Funds”) announced distributions today as detailed below. BlackRock Debt Strategies Fund, Inc. (NYSE:DSU) and BlackRock Resources & Commodities Strategy Trust (NYSE:BCX) announced increases in their monthly distribution rates and several municipal Funds announced decreases in their monthly distribution rates. Generally, these distribution changes were made in order to better align the applicable Funds’ distribution rates with their current and projected level of earnings. This amended and restated press release is to correct the distribution rate for BlackRock Debt Strategies Fund, Inc. (NYSE: DSU) announced in the press release dated March 1, 2017. * In order to comply with the requirements of Section 19 of the Investment Company Act of 1940, as amended, each of the Funds noted above posted to the DTC bulletin board and sent to its shareholders of record as of the applicable record date a Section 19 notice with the previous distribution payment. The Section 19 notice was provided for informational purposes only and not for tax reporting purposes. This information can be found in the “Closed-End Funds” section of www.blackrock.com. As applicable, the final determination of the source and tax characteristics of all distributions in 2017 will be made after the end of the year. BlackRock Resources & Commodities Strategy Trust (NYSE:BCX), BlackRock Enhanced Equity Dividend Trust (NYSE:BDJ), BlackRock Energy and Resources Trust (NYSE:BGR), BlackRock International Growth and Income Trust (NYSE:BGY), BlackRock Health Sciences Trust (NYSE:BME), BlackRock Global Opportunities Equity Trust (NYSE:BOE), BlackRock Utility and Infrastructure Trust (NYSE:BUI), BlackRock Enhanced Capital and Income Fund, Inc. (NYSE:CII), BlackRock Science and Technology Trust (NYSE:BST) and BlackRock Enhanced Government Fund, Inc. (NYSE:EGF) (collectively, the “Plan Funds”) have adopted a level distribution plan (a “Plan”) and employ a managed distribution and/or an option over-write policy to support a level distribution of income, capital gains and/or return of capital. The fixed amounts distributed per share are subject to change at the discretion of each Plan Fund’s Board of Directors/Trustees. Under its Plan, each Plan Fund will distribute all available investment income to its shareholders, consistent with its investment objectives and as required by the Internal Revenue Code of 1986, as amended. If sufficient investment income is not available on a monthly basis, each Plan Fund will distribute long-term capital gains and/or return capital to its shareholders in order to maintain a level distribution. The Plan Funds’ estimated sources of the distributions paid as of February 28, 2017 and for their current fiscal year are as follows: 1The Plan Fund estimates that it has distributed more than its income and net-realized capital gains in the current fiscal year; therefore, a portion of your distribution may be a return of capital. A return of capital may occur, for example, when some or all of the shareholder’s investment is paid back to the shareholder. A return of capital distribution does not necessarily reflect the Plan Fund's investment performance and should not be confused with ‘yield’ or ‘income’. When distributions exceed total return performance, the difference will reduce the Plan Fund’s net asset value per share. The amounts and sources of distributions reported are only estimates and are not provided for tax reporting purposes. The actual amounts and sources of the amounts for tax reporting purposes will depend upon each Plan Fund’s investment experience during the remainder of its fiscal year and may be subject to changes based on tax regulations. Each Plan Fund will send you a Form 1099-DIV for the calendar year that will tell you how to report these distributions for federal income tax purposes. *Portfolio launched within the past 5 years; the performance and distribution rate information presented for this Fund reflects data from inception to 1/31/2017. Shareholders should not draw any conclusions about a Plan Fund’s investment performance from the amount of the Plan Fund’s current distributions or from the terms of a Plan Fund’s Plan. BlackRock is a global leader in investment management, risk management and advisory services for institutional and retail clients. At December 31, 2016, BlackRock’s AUM was $5.1 trillion. BlackRock helps clients around the world meet their goals and overcome challenges with a range of products that include separate accounts, mutual funds, iShares® (exchange-traded funds), and other pooled investment vehicles. BlackRock also offers risk management, advisory and enterprise investment system services to a broad base of institutional investors through BlackRock Solutions®. As of December 31, 2016, the firm had approximately 13,000 employees in more than 30 countries and a major presence in global markets, including North and South America, Europe, Asia, Australia and the Middle East and Africa. For additional information, please visit the Company’s website at www.blackrock.com| Twitter: @blackrock_news | Blog: www.blackrockblog.com| LinkedIn: www.linkedin.com/company/blackrock BlackRock will update performance and certain other data for the Funds on a monthly basis on its website in the “Closed-end Funds” section of www.blackrock.com as well as certain other material information as necessary from time to time. Investors and others are advised to check the website for updated performance information and the release of other material information about the Funds. This reference to BlackRock’s website is intended to allow investors public access to information regarding the Funds and does not, and is not intended to, incorporate BlackRock’s website in this release. This press release, and other statements that BlackRock or a Fund may make, may contain forward-looking statements within the meaning of the Private Securities Litigation Reform Act, with respect to a Fund’s or BlackRock’s future financial or business performance, strategies or expectations. Forward-looking statements are typically identified by words or phrases such as “trend,” “potential,” “opportunity,” “pipeline,” “believe,” “comfortable,” “expect,” “anticipate,” “current,” “intention,” “estimate,” “position,” “assume,” “outlook,” “continue,” “remain,” “maintain,” “sustain,” “seek,” “achieve,” and similar expressions, or future or conditional verbs such as “will,” “would,” “should,” “could,” “may” or similar expressions. BlackRock cautions that forward-looking statements are subject to numerous assumptions, risks and uncertainties, which change over time. Forward-looking statements speak only as of the date they are made, and BlackRock assumes no duty to and does not undertake to update forward-looking statements. Actual results could differ materially from those anticipated in forward-looking statements and future results could differ materially from historical performance. With respect to the Funds, the following factors, among others, could cause actual events to differ materially from forward-looking statements or historical performance: (1) changes and volatility in political, economic or industry conditions, the interest rate environment, foreign exchange rates or financial and capital markets, which could result in changes in demand for the Funds or in a Fund’s net asset value; (2) the relative and absolute investment performance of a Fund and its investments; (3) the impact of increased competition; (4) the unfavorable resolution of any legal proceedings; (5) the extent and timing of any distributions or share repurchases; (6) the impact, extent and timing of technological changes; (7) the impact of legislative and regulatory actions and reforms, including the Dodd-Frank Wall Street Reform and Consumer Protection Act, and regulatory, supervisory or enforcement actions of government agencies relating to a Fund or BlackRock, as applicable; (8) terrorist activities, international hostilities and natural disasters, which may adversely affect the general economy, domestic and local financial and capital markets, specific industries or BlackRock; (9) BlackRock’s ability to attract and retain highly talented professionals; (10) the impact of BlackRock electing to provide support to its products from time to time; and (11) the impact of problems at other financial institutions or the failure or negative performance of products at other financial institutions. Annual and Semi-Annual Reports and other regulatory filings of the Funds with the Securities and Exchange Commission (“SEC”) are accessible on the SEC's website at www.sec.gov and on BlackRock’s website at www.blackrock.com, and may discuss these or other factors that affect the Funds. The information contained on BlackRock’s website is not a part of this press release.


News Article | December 7, 2016
Site: www.businesswire.com

NEW YORK--(BUSINESS WIRE)--Certain BlackRock closed-end funds (the “Funds”) announced distributions today as detailed below. BlackRock Health Sciences Trust (NYSE:BME) also announced a special distribution. * In order to comply with the requirements of Section 19 of the Investment Company Act of 1940, as amended, each of the Funds noted above posted to the DTC bulletin board and sent to its shareholders of record as of the applicable record date a Section 19 notice with the previous distribution payment. The Section 19 notice was provided for informational purposes only and not for tax reporting purposes. This information can be found in the “Closed-End Funds” section of www.blackrock.com. As applicable, the final determination of the source and tax characteristics of all distributions in 2016 will be made after the end of the year. BlackRock Resources & Commodities Strategy Trust (NYSE:BCX), BlackRock Enhanced Equity Dividend Trust (NYSE:BDJ), BlackRock Energy and Resources Trust (NYSE:BGR), BlackRock International Growth and Income Trust (NYSE:BGY), BlackRock Health Sciences Trust (NYSE:BME), BlackRock Global Opportunities Equity Trust (NYSE:BOE), BlackRock Utility and Infrastructure Trust (NYSE:BUI), BlackRock Enhanced Capital and Income Fund, Inc. (NYSE:CII), and BlackRock Science and Technology Trust (NYSE:BST) (collectively, the “Plan Funds”) have adopted a level distribution plan (a “Plan”) and employ a managed distribution and/or an option over-write policy to support a level distribution of income, capital gains and/or return of capital. The fixed amounts distributed per share are subject to change at the discretion of each Plan Fund’s Board of Directors/Trustees. Under its Plan, each Plan Fund will distribute all available investment income to its shareholders, consistent with its investment objectives and as required by the Internal Revenue Code of 1986, as amended. If sufficient investment income is not available on a monthly basis, each Plan Fund will distribute long-term capital gains and/or return capital to its shareholders in order to maintain a level distribution. The Plan Funds’ estimated sources of the distributions paid as of November 30, 2016 and for their current fiscal year are as follows: The amounts and sources of distributions reported are only estimates and are not provided for tax reporting purposes. The actual amounts and sources of the amounts for tax reporting purposes will depend upon each Plan Fund’s investment experience during the remainder of its fiscal year and may be subject to changes based on tax regulations. Each Plan Fund will send you a Form 1099-DIV for the calendar year that will tell you how to report these distributions for federal income tax purposes. Shareholders should not draw any conclusions about a Plan Fund’s investment performance from the amount of the Plan Fund’s current distributions or from the terms of a Plan Fund’s Plan. BlackRock is a global leader in investment management, risk management and advisory services for institutional and retail clients. At September 30, 2016, BlackRock’s AUM was $5.1 trillion. BlackRock helps clients around the world meet their goals and overcome challenges with a range of products that include separate accounts, mutual funds, iShares® (exchange-traded funds), and other pooled investment vehicles. BlackRock also offers risk management, advisory and enterprise investment system services to a broad base of institutional investors through BlackRock Solutions®. As of September 30, 2016, the firm had approximately 13,000 employees in 30 countries and a major presence in global markets, including North and South America, Europe, Asia, Australia and the Middle East and Africa. For additional information, please visit the Company’s website at www.blackrock.com | Twitter: @blackrock_news | Blog: www.blackrockblog.com | LinkedIn: www.linkedin.com/company/blackrock BlackRock will update performance and certain other data for the Funds on a monthly basis on its website in the “Closed-end Funds” section of www.blackrock.com as well as certain other material information as necessary from time to time. Investors and others are advised to check the website for updated performance information and the release of other material information about the Funds. This reference to BlackRock’s website is intended to allow investors public access to information regarding the Funds and does not, and is not intended to, incorporate BlackRock’s website in this release. This press release, and other statements that BlackRock or a Fund may make, may contain forward-looking statements within the meaning of the Private Securities Litigation Reform Act, with respect to a Fund’s or BlackRock’s future financial or business performance, strategies or expectations. Forward-looking statements are typically identified by words or phrases such as “trend,” “potential,” “opportunity,” “pipeline,” “believe,” “comfortable,” “expect,” “anticipate,” “current,” “intention,” “estimate,” “position,” “assume,” “outlook,” “continue,” “remain,” “maintain,” “sustain,” “seek,” “achieve,” and similar expressions, or future or conditional verbs such as “will,” “would,” “should,” “could,” “may” or similar expressions. BlackRock cautions that forward-looking statements are subject to numerous assumptions, risks and uncertainties, which change over time. Forward-looking statements speak only as of the date they are made, and BlackRock assumes no duty to and does not undertake to update forward-looking statements. Actual results could differ materially from those anticipated in forward-looking statements and future results could differ materially from historical performance. With respect to the Funds, the following factors, among others, could cause actual events to differ materially from forward-looking statements or historical performance: (1) changes and volatility in political, economic or industry conditions, the interest rate environment, foreign exchange rates or financial and capital markets, which could result in changes in demand for the Funds or in a Fund’s net asset value; (2) the relative and absolute investment performance of a Fund and its investments; (3) the impact of increased competition; (4) the unfavorable resolution of any legal proceedings; (5) the extent and timing of any distributions or share repurchases; (6) the impact, extent and timing of technological changes; (7) the impact of legislative and regulatory actions and reforms, including the Dodd-Frank Wall Street Reform and Consumer Protection Act, and regulatory, supervisory or enforcement actions of government agencies relating to a Fund or BlackRock, as applicable; (8) terrorist activities, international hostilities and natural disasters, which may adversely affect the general economy, domestic and local financial and capital markets, specific industries or BlackRock; (9) BlackRock’s ability to attract and retain highly talented professionals; (10) the impact of BlackRock electing to provide support to its products from time to time; and (11) the impact of problems at other financial institutions or the failure or negative performance of products at other financial institutions. Annual and Semi-Annual Reports and other regulatory filings of the Funds with the Securities and Exchange Commission (“SEC”) are accessible on the SEC's website at www.sec.gov and on BlackRock’s website at www.blackrock.com, and may discuss these or other factors that affect the Funds. The information contained on BlackRock’s website is not a part of this press release.


News Article | February 28, 2017
Site: www.businesswire.com

NEW YORK--(BUSINESS WIRE)--Today, BlackRock Resources & Commodities Strategy Trust (NYSE: BCX), BlackRock Enhanced Equity Dividend Trust (NYSE: BDJ), BlackRock Energy and Resources Trust (NYSE: BGR), BlackRock International Growth and Income Trust (NYSE: BGY), BlackRock Health Sciences Trust (NYSE: BME), BlackRock Global Opportunities Equity Trust (NYSE: BOE), BlackRock Utility and Infrastructure Trust (NYSE: BUI), BlackRock Enhanced Capital and Income Fund, Inc. (NYSE: CII), BlackRock Science and Technology Trust (NYSE: BST), and BlackRock Enhanced Government Fund, Inc. (NYSE: EGF) (collectively, the “Funds”) paid the following distributions per share: Each of the Funds has adopted a level distribution plan (the “Plan”) and employs a managed distribution and/or an option over-write policy to support a level distribution of income, capital gains and/or return of capital. The fixed amounts distributed per share are subject to change at the discretion of each Fund’s Board of Directors/Trustees. Under its Plan, each Fund will distribute all available investment income to its shareholders, consistent with its primary investment objectives and as required by the Internal Revenue Code of 1986, as amended. If sufficient investment income is not available on a monthly basis, the Funds will distribute long-term capital gains and/or return capital to their shareholders in order to maintain a level distribution. The Funds’ estimated sources of the distributions paid this month and for their current fiscal year are as follows: 1The Fund estimates that it has distributed more than its income and net-realized capital gains in the current fiscal year; therefore, a portion of your distribution may be a return of capital. A return of capital may occur, for example, when some or all of the shareholder’s investment is paid back to the shareholder. A return of capital distribution does not necessarily reflect the Fund's investment performance and should not be confused with ‘yield’ or ‘income’. When distributions exceed total return performance, the difference will reduce the Fund’s net asset value per share. The amounts and sources of distributions reported are only estimates and are not provided for tax reporting purposes. The actual amounts and sources of the amounts for tax reporting purposes will depend upon each Fund’s investment experience during the remainder of its fiscal year and may be subject to changes based on tax regulations. The Fund will send you a Form 1099-DIV for the calendar year that will tell you how to report these distributions for federal income tax purposes. * Portfolio launched within the past 5 years; the performance and distribution rate information presented for this Fund reflects data from inception to 1/31/2017. Shareholders should not draw any conclusions about a Fund’s investment performance from the amount of the Fund’s current distributions or from the terms of the Fund’s Plan. BlackRock is a global leader in investment management, risk management and advisory services for institutional and retail clients. At December 31, 2016, BlackRock’s AUM was $5.1 trillion. BlackRock helps clients around the world meet their goals and overcome challenges with a range of products that include separate accounts, mutual funds, iShares® (exchange-traded funds), and other pooled investment vehicles. BlackRock also offers risk management, advisory and enterprise investment system services to a broad base of institutional investors through BlackRock Solutions®. As of December 31, 2016, the firm had approximately 13,000 employees in more than 30 countries and a major presence in global markets, including North and South America, Europe, Asia, Australia and the Middle East and Africa. For additional information, please visit the Company’s website at www.blackrock.com| Twitter: @blackrock_news | Blog: www.blackrockblog.com| LinkedIn: www.linkedin.com/company/blackrock BlackRock will update performance and certain other data for the Funds on a monthly basis on its website in the “Closed-end Funds” section of www.blackrock.com as well as certain other material information as necessary from time to time. Investors and others are advised to check the website for updated performance information and the release of other material information about the Funds. This reference to BlackRock’s website is intended to allow investors public access to information regarding the Funds and does not, and is not intended to, incorporate BlackRock’s website in this release. This press release, and other statements that BlackRock or a Fund may make, may contain forward-looking statements within the meaning of the Private Securities Litigation Reform Act, with respect to a Fund’s or BlackRock’s future financial or business performance, strategies or expectations. Forward-looking statements are typically identified by words or phrases such as “trend,” “potential,” “opportunity,” “pipeline,” “believe,” “comfortable,” “expect,” “anticipate,” “current,” “intention,” “estimate,” “position,” “assume,” “outlook,” “continue,” “remain,” “maintain,” “sustain,” “seek,” “achieve,” and similar expressions, or future or conditional verbs such as “will,” “would,” “should,” “could,” “may” or similar expressions. BlackRock cautions that forward-looking statements are subject to numerous assumptions, risks and uncertainties, which change over time. Forward-looking statements speak only as of the date they are made, and BlackRock assumes no duty to and does not undertake to update forward-looking statements. Actual results could differ materially from those anticipated in forward-looking statements and future results could differ materially from historical performance. With respect to the Funds, the following factors, among others, could cause actual events to differ materially from forward-looking statements or historical performance: (1) changes and volatility in political, economic or industry conditions, the interest rate environment, foreign exchange rates or financial and capital markets, which could result in changes in demand for the Funds or in a Fund’s net asset value; (2) the relative and absolute investment performance of a Fund and its investments; (3) the impact of increased competition; (4) the unfavorable resolution of any legal proceedings; (5) the extent and timing of any distributions or share repurchases; (6) the impact, extent and timing of technological changes; (7) the impact of legislative and regulatory actions and reforms, including the Dodd-Frank Wall Street Reform and Consumer Protection Act, and regulatory, supervisory or enforcement actions of government agencies relating to a Fund or BlackRock, as applicable; (8) terrorist activities, international hostilities and natural disasters, which may adversely affect the general economy, domestic and local financial and capital markets, specific industries or BlackRock; (9) BlackRock’s ability to attract and retain highly talented professionals; (10) the impact of BlackRock electing to provide support to its products from time to time; and (11) the impact of problems at other financial institutions or the failure or negative performance of products at other financial institutions. Annual and Semi-Annual Reports and other regulatory filings of the Funds with the Securities and Exchange Commission (“SEC”) are accessible on the SEC's website at www.sec.gov and on BlackRock’s website at www.blackrock.com, and may discuss these or other factors that affect the Funds. The information contained on BlackRock’s website is not a part of this press release.


News Article | February 15, 2017
Site: marketersmedia.com

— This report studies sales (consumption) of Mining Explosive in Global market, especially in United States, China, Europe and Japan, focuses on top players in these regions/countries, with sales, price, revenue and market share for each player in these regions, covering Market Segment by Regions, this report splits Global into several key Regions, with sales (consumption), revenue, market share and growth rate of Mining Explosive in these regions, from 2011 to 2021 (forecast), like Split by product Types, with sales, revenue, price and gross margin, market share and growth rate of each type, can be divided into Ammonium Nitrate Explosives (Powder) ANFO Emulsion Explosive Split by applications, this report focuses on sales, market share and growth rate of Mining Explosive in each application, can be divided into Coal Mining Quarrying and Nonmetal Mining Metal Mining Global Mining Explosive Sales Market Report 2017 1 Mining Explosive Overview 1.1 Product Overview and Scope of Mining Explosive 1.2 Classification of Mining Explosive 1.2.1 Ammonium Nitrate Explosives (Powder) 1.2.2 ANFO 1.2.3 Emulsion Explosive 1.3 Application of Mining Explosive 1.3.1 Coal Mining 1.3.2 Quarrying and Nonmetal Mining 1.3.3 Metal Mining 1.4 Mining Explosive Market by Regions 1.4.1 United States Status and Prospect (2012-2022) 1.4.2 China Status and Prospect (2012-2022) 1.4.3 Europe Status and Prospect (2012-2022) 1.4.4 Japan Status and Prospect (2012-2022) 1.4.5 Southeast Asia Status and Prospect (2012-2022) 1.4.6 India Status and Prospect (2012-2022) 1.5 Global Market Size (Value and Volume) of Mining Explosive (2012-2022) 1.5.1 Global Mining Explosive Sales and Growth Rate (2012-2022) 1.5.2 Global Mining Explosive Revenue and Growth Rate (2012-2022) 9 Global Mining Explosive Manufacturers Analysis 9.1 Orica 9.1.1 Company Basic Information, Manufacturing Base and Competitors 9.1.2 Mining Explosive Product Type, Application and Specification 9.1.2.1 Product A 9.1.2.2 Product B 9.1.3 Orica Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.1.4 Main Business/Business Overview 9.2 IPL (Dyno Nobel) 9.2.1 Company Basic Information, Manufacturing Base and Competitors 9.2.2 Mining Explosive Product Type, Application and Specification 9.2.2.1 Product A 9.2.2.2 Product B 9.2.3 IPL (Dyno Nobel) Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.2.4 Main Business/Business Overview 9.3 MAXAM 9.3.1 Company Basic Information, Manufacturing Base and Competitors 9.3.2 Mining Explosive Product Type, Application and Specification 9.3.2.1 Product A 9.3.2.2 Product B 9.3.3 MAXAM Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.3.4 Main Business/Business Overview 9.4 AEL 9.4.1 Company Basic Information, Manufacturing Base and Competitors 9.4.2 Mining Explosive Product Type, Application and Specification 9.4.2.1 Product A 9.4.2.2 Product B 9.4.3 AEL Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.4.4 Main Business/Business Overview 9.5 ENAEX 9.5.1 Company Basic Information, Manufacturing Base and Competitors 9.5.2 Mining Explosive Product Type, Application and Specification 9.5.2.1 Product A 9.5.2.2 Product B 9.5.3 ENAEX Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.5.4 Main Business/Business Overview 9.6 Sasol 9.6.1 Company Basic Information, Manufacturing Base and Competitors 9.6.2 Mining Explosive Product Type, Application and Specification 9.6.2.1 Product A 9.6.2.2 Product B 9.6.3 Sasol Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.6.4 Main Business/Business Overview 9.7 Yunnan Civil Explosive 9.7.1 Company Basic Information, Manufacturing Base and Competitors 9.7.2 Mining Explosive Product Type, Application and Specification 9.7.2.1 Product A 9.7.2.2 Product B 9.7.3 Yunnan Civil Explosive Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.7.4 Main Business/Business Overview 9.8 Solar Explosives 9.8.1 Company Basic Information, Manufacturing Base and Competitors 9.8.2 Mining Explosive Product Type, Application and Specification 9.8.2.1 Product A 9.8.2.2 Product B 9.8.3 Solar Explosives Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.8.4 Main Business/Business Overview 9.9 Gezhouba Explosive 9.9.1 Company Basic Information, Manufacturing Base and Competitors 9.9.2 Mining Explosive Product Type, Application and Specification 9.9.2.1 Product A 9.9.2.2 Product B 9.9.3 Gezhouba Explosive Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.9.4 Main Business/Business Overview 9.10 EPC-UK 9.10.1 Company Basic Information, Manufacturing Base and Competitors 9.10.2 Mining Explosive Product Type, Application and Specification 9.10.2.1 Product A 9.10.2.2 Product B 9.10.3 EPC-UK Mining Explosive Sales, Revenue, Price and Gross Margin (2012-2017) 9.10.4 Main Business/Business Overview 9.11 Anhui Jiangnan 9.12 Guizhou Jiulian 9.13 Nanling Civil Explosive 9.14 BME Mining 9.15 NOF Corporation 9.16 IDEAL 9.17 Sichuan Yahua 9.18 AUSTIN 9.19 Kailong Chemical 9.20 Leiming Kehua 9.21 TOD Chemical For more information, please visit https://www.wiseguyreports.com/sample-request/961233-global-mining-explosive-sales-market-report-2017


News Article | November 2, 2016
Site: www.nature.com

No statistical methods were used to predetermine sample size. U2OS, HeLa 1.3, HeLa S3, DLD-1, and 293T cell lines were grown in DMEM (Thermo Fisher) with 10% calf serum and 1% penicillin/streptomycin. VA13, GM847, LM216T, and LM216J cell lines were grown in DMEM (Thermo Fisher) with 10% FBS and 1% penicillin/streptomycin. SKNFI cell line was grown in RPMI (Thermo Fisher) with 10% FBS and 1% penicillin/streptomycin. VA13 cell line refers to WI-38 VA-13 subline 2RA. LM216T/J are matched lines. Cell lines were obtained from ATCC and tested negative for Mycoplasma using the MycoAlert PLUS Mycoplasma Detection Kit (Lonza). The U2OS TRF1–FokI inducible cell line was authenticated by STR analysis (ATCC). Other lines were validated by ALT characteristics. None of the cell lines used is listed as commonly misidentified by the International Cell Line Authentication Committee (ICLAC). Cells were pulsed with 100 μM BrdU (Sigma) for 2 h before fixation. After permeabilization, cells were denatured with 500 U ml−1 DNaseI (Roche) in 1× reaction buffer (20 mM Tris-HCl (pH 8.4), 2 mM MgCl , 50 mM KCl in PBST) for 10–25 min at 37 °C in a humidified chamber. Coverslips were then washed and incubated with anti-BrdU antibody (BD) for 20 min at 37 °C followed by secondary antibody and telomere FISH. For metaphases, cells pulsed with BrdU were treated with 100 ng ml−1 colcemid for 90 min followed by 75 mM KCl for 30 min. Cells were fixed in 3:1 methanol:acetic acid, dropped onto slides, and allowed to dry overnight. Denaturation was performed with 2 N HCl for 30 min at room temperature followed by antibody incubations as described above. BrdU pulldown was adapted from a published protocol34. Cells were pulsed with 100 μM BrdU (Sigma) for 2 h before collection. Genomic DNA (gDNA) was isolated using phenol–chloroform extraction followed by resuspension in TE buffer. gDNA was then sheared into 100–300 bp fragments using a Covaris S220 sonicator. 1–4 μg sheared gDNA was denatured for 10 min at 95 °C and cooled in an ice-water bath. Denatured gDNA was incubated with 2 μg anti-IgG (Sigma) or anti-BrdU antibody (BD) diluted in immunoprecipitation buffer (0.0625% (v/v) Triton X-100 in PBS) rotating overnight at 4 °C. The next day, samples were incubated with 30 μl Protein G magnetic beads (Pierce) that had been pre-bound to a bridging antibody (Active Motif) for 1 h rotating at 4 °C. Beads were subsequently washed three times with immunoprecipitation buffer and once with TE buffer. Beads were then incubated twice in elution buffer (1% (w/v) SDS in TE) for 15 min at 65 °C. Pooled eluate was cleaned with ChIP DNA Clean & Concentrator kit (Zymo). Samples, along with 10% inputs, were diluted into 2× SSC buffer, treated at 95 °C for 5 min, and dot-blotted onto an Amersham Hybond-N+ nylon membrane (GE). The membrane was then denatured in a 0.5 N NaOH 1.5 M NaCl solution, neutralized, and ultraviolet crosslinked. The membrane was hybridized with 32P-labelled (TTAGGG) oligonucleotides, unless otherwise noted, in PerfectHyb Plus Hybridization Buffer (Sigma) overnight at 37 °C. The next day, the membrane was washed twice in 2× SSC buffer, exposed onto a storage phosphor screen (GE Healthcare) and scanned using STORM 860 with ImageQuant (Molecular Dynamics). All quantifications were performed in Fiji and normalized to 10% input. The SMARD assay was performed as previously described4, 5. U2OS cells were induced with TRF1–FokI for 20 min or 2 h and were subsequently labelled by incubating with 30 μM IdU for 2 h, followed by 30 μM CIdU for the next 2 h. After pulsing, 106 labelled cells per condition were embedded in 1% agarose and lysed using detergents (100 mM EDTA, 0.2% sodium deoxycholate, 1% sodium lauryl sarcosine and 0.2 mg ml−1 Proteinase K). The plugs were then washed several times with TE, treated with 100 μM PMSF, and then washed again with TE buffer followed by incubation with 1× Cut-Smart buffer (NEB) for 30 min. The DNA in the plugs was then digested overnight at 37 °C using 50 U of both MboI and AluI (NEB) per plug. The digested plugs were then cast into a 0.7% low-melting point agarose gel and a distinct fragment running above 10 kb (containing telomeric DNA defined by Southern blotting) was excised, melted and stretched on slides coated with 3-aminopropoyltriethoxysilane (Sigma-Aldrich). After denaturation of the DNA strands using alkali buffer (0.1 M NaOH in 70% ethanol and 0.1% β-mercaptoethanol), the DNA was fixed using 0.5% glutaraldehyde and incubated overnight with biotin-OO-(CCCTAA) locked nucleic acid (LNA) probe (Exiqon) at 37 °C. Telomere FISH probes were then detected using the Alexa Fluor 405-conjugated streptavidin (Thermo-Fisher) followed by sequential incubation with the biotinylated anti-avidin antibody (Vector Laboratories) and additional Alexa 405-conjugated streptavidin. IdU and CldU were visualized using mouse anti-IdU (BD) and rat anti-CIdU (Serotec) monoclonal antibodies followed by Alexa Fluor 568-goat anti-mouse and Alexa Fluor 488-goat anti-rat secondary antibodies (Life Technologies). Images were acquired using the NIS-element software (Nikon) and a Nikon eclipse 80i microscope equipped with a 63× objective and a Cool Snap camera (MYO). For calculating the length of the telomeres and replication tracts, the line-scan function from Image J was used. For conversion of microns to kilobases, as 10 bp (equals one turn of the helix) has a linear length of 3.4 nm, 0.26 microns corresponded to 1 kb of DNA. Death domain (DD)–Oestrogen receptor (ER)–mCherry–TRF1–FokI and Flag–TRF1–FokI constructs were cloned as previously described7. Doxycycline-inducible TRF1–FokI lines were generated using the Tet-On 3G system. Briefly, Flag–DD–ER–mCherry–TRF1–FokI was cloned into the pLenti CMV TRE3G Puro Dest vector, which was introduced into cells engineered to co-express the reverse tetracycline transactivator 3G (rtTA3G). N-terminal GFP-tagged proteins were generated by PCR amplification and ligation of cDNAs from the ProQuest HeLa cDNA Library (Invitrogen) into the pDEST53 (Invitrogen) mammalian expression vector. CRISPR lines were generated using a two-vector system (pLentiCas9-Blast and pLentiGuide-Puro). POLD3 reconstitution vector was generated by cloning POLD3 cDNA (RefSeq NM_006591.2) into the pOZ–N–Flag–HA retroviral vector followed by site-directed mutagenesis of siRNA binding sites. Sanger sequencing of POLD3 CRISPR clones was performed on gDNA fragments cloned into a TOPO TA vector (Thermo Fisher). Transient plasmid transfections were carried out with LipoD293 (Signagen), and siRNA transfections with Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s instructions. Analyses were performed 16 h after transfection of plasmids, and 72 h after siRNA transfection. All siRNAs were used at a final concentration of 20 nM. The following primers were used for qRT–PCR: The following siRNA sequences were used: The following CRISPR sgRNA sequences were used: The following antibodies were used: anti-BrdU (mouse B44, BD 347580; rat BU1/75, AbD Serotec OBT0030G), anti-ATRX (rabbit H-300, Santa Cruz sc-15408), anti-53BP1 (rabbit, Novus NB100-904), anti-γH2AX (mouse JBW301, Millipore 05-636), anti-Flag (mouse M2, Sigma F1804), anti-PML (mouse PG-M3, Santa Cruz sc-966), anti-Rad51 (rabbit H-92, Santa Cruz sc-8349; mouse 14B4, Abcam ab-213), anti-Hop2/PSMC3IP (rabbit, Novus NBP1-92301), anti-POLD3 (mouse 3E2, Abnova H00010714-M01), anti-POLD1 (mouse 607, Abcam ab10362; rabbit, Bethyl A304-005A), anti-POLD2 (rabbit, Bethyl A304-322A), anti-POLD4 (mouse 2B11, Abnova H00057804-M01A), anti-POLE (mouse 93H3A, Pierce MA5-13616; rabbit, Novus NBP1-68470), anti-POLE3 (rabbit, Bethyl A301-245A), anti-POLA1 (rabbit, Bethyl A302-851A), anti-MCM7 (rabbit, Bethyl A302-584A), anti-MCM4 (rabbit, Bethyl A300-193A), anti-MCM5 (rabbit, Abcam ab75975), anti-RFC1 (rabbit, Bethyl A300-320A), anti-PCNA (mouse PC10, CST #2586) anti-ATR (goat N-17, Santa Cruz sc-1887), anti-PRIM1 (rabbit H300, Santa Cruz sc-366482), anti-Rad17 (goat, Bethyl A300-151A), anti-REV3L (rabbit, GeneTex GTX100153), anti-POLH (rabbit, Bethyl A301-231A), anti-REV1 (rabbit H300, Santa Cruz sc-48806) anti-GAPDH (rabbit 14c10, CST #2118), anti-αTubulin (mouse TU-02, Santa Cruz sc-8035). Doxycycline was used at a concentration of 40 ng ml−1 for 16–24 h to induce expression of TRF1–FokI. Shield-1 (Cheminpharma LLC) and 4-hydroxytamoxifen (4-OHT) (Sigma-Aldrich) were both used at a concentration of 1 μM for 2 h, unless otherwise stated, in to allow for TRF1–FokI stabilization and translocation into the nucleus. RO-3306 (Selleck Chemicals) was used at a concentration of 10 μM for 20–24 h. G2 enrichment was confirmed by propidium iodide staining and flow cytometry. Colcemid (Roche) was used at a concentration of 100 ng ml−1. The ATR inhibitor VE-821 (Selleck Chemicals) and Chk1 inhibitor LY2603618 (Selleck Chemicals) were used at a concentration of 5 μM and 1 μM respectively for 24 h. Cells were lysed in RIPA buffer supplemented with cOmplete protein inhibitor cocktail (Roche) and Halt phosphatase inhibitor cocktail (Thermo) on ice and subsequently spun down at max speed at 4 °C. The supernatant was removed and protein concentration determined using the Protein Assay Dye Reagent (Bio-Rad). 20–40 μg of protein was run on a 4–12% Bis–Tris gel (Invitrogen). Proteins were transferred onto an Amersham Protran 0.2 μm nitrocellulose membrane (GE) and blocked with 5% milk. Membranes were incubated with primary antibodies overnight at 4 °C. The next day membranes were incubated with secondary antibodies for 1 h at room temperature and subsequently developed using Western Lightning Plus-ECL (Perkins Elmer) or SuperSignal West Femto (Thermo). Cells grown on coverslips were fixed in 4% paraformaldehyde for 10 min at room temperature. Coverslips were then permeabilized in 0.5% Triton X-100 for 5 min at 4 °C (for most antibodies) or 100% cold methanol for 10 min at −20 °C (for anti-PCNA). Primary antibody incubation was performed at 4 °C in a humidified chamber overnight unless otherwise indicated. Coverslips were washed and incubated with appropriate secondary antibody for 20 min at 37 °C, then mounted onto glass slides using Vectashield mounting medium with DAPI (Vector Labs). For immunofluorescence–FISH, coverslips were re-fixed in 4% paraformaldehyde for 10 min at room temperature after secondary antibody binding. Coverslips were then dehydrated in an ethanol series (70%, 90%, 100%) and allowed to air dry. Dehydrated coverslips were denatured and incubated with TelC–Cy3 peptide nucleic acid (PNA) probe (Panagene) in hybridization buffer (70% deionized formamide, 10 mM Tris (pH 7.4), 0.5% Roche blocking solution) overnight at room temperature in a humidified chamber. The next day, coverslips were washed and mounted as described above. Images were acquired with a QImaging RETIGA-SRV camera connected to a Nikon Eclipse 80i microscope. For TIF assay, cells were scored for co-localized 53BP1 and telomere foci by immunofluorescence–FISH. For APB assay, cells were scored for the number of PML–telomere colocalizations by immunofluorescence–FISH. Hop2 immunofluorescence and CO–FISH experiments were performed as previously described7. Telomere gels were performed using telomere restriction fragment (TRF) analysis. Genomic DNA was digested using AluI and MboI (NEB). 4–10 μg of DNA was run on a 1% PFGE agarose gel (Bio-Rad) in 0.5× TBE buffer using the CHEF-DRII system (Bio-Rad) at 6 V cm−1; initial switch time 5 s, final switch time 5 s, for 16 h at 14 °C. The gel was then dried for 4 h at 50 °C, denatured in a 0.5 N NaOH 1.5 M NaCl solution, and neutralized. Gel was hybridized with 32P-labelled (CCCTAA) oligonucleotides in Church buffer overnight at 42 °C. The next day, the membrane was washed four times in 4× SSC buffer, exposed onto a storage phosphor screen (GE Healthcare) and scanned using STORM 860 with ImageQuant (Molecular Dynamics). Telomere length was determined using TeloTool software35. C-circle assay was performed as previously described28. Genomic DNA was digested using AluI and MboI (NEB). 30 ng of digested DNA was combined with 0.2 mg ml−1 BSA, 0.1% Tween, 1 mM each dNTP without dCTP, 1× ϕ29 Buffer (NEB) and 7.5 U ϕ29 DNA polymerase (NEB). Samples were incubated for 8 h at 30 °C followed by 20 min at 65 °C. Samples were then diluted in 2× SSC buffer and dot-blotted onto an Amersham Hybond-N+ nylon membrane (GE). Membrane was ultraviolet crosslinked and then hybridized with 32P-labelled (CCCTAA) oligonucleotides in PerfectHyb Plus Hybridization Buffer (Sigma) overnight at 37 °C. The next day, the membrane was washed twice in 2× SSC buffer, exposed onto a storage phosphor screen (GE Healthcare) and scanned using STORM 860 with ImageQuant (Molecular Dynamics). Cells were lysed in HEPES immunoprecipitation buffer (10 mM HEPES (pH 8), 2 mM EDTA, 0.1% NP-40) supplemented with 5 mM DTT, 1 mM PMSF, and 1× cOmplete protein inhibitor cocktail (Roche) on ice and subsequently spun down at max speed at 4 °C. The supernatant was removed and protein concentration determined using the Protein Assay Dye Reagent (Bio-Rad). 25 μg protein was removed for input. 500 μg protein was diluted to 1 mg ml−1 in HEPES immunoprecipitation buffer and pre-cleared with 10 μl Protein G magnetic beads (Pierce) for 1 h rotating at 4 °C. Protein lysate was then incubated with 10 μg anti-IgG (Sigma) or anti-POLD1 antibody (Abcam) rotating overnight at 4 °C. The next day, samples were incubated with 30 μl Protein G magnetic beads (Pierce) that had been pre-bound to a bridging antibody (Active Motif) for 1 h rotating at 4 °C. Beads were subsequently washed five times with HEPES immunoprecipiation buffer. Proteins were eluted by incubating beads with 2× sample buffer with BME for 5 min at 95 °C. Samples were analysed by western blot. ChIP was performed as previously described and analysed by western blot and dot blot36. 400 ng of genomic DNA was diluted into 2× SSC buffer, treated at 95 °C for 5 min, and dot-blotted onto an Amersham Hybond-N+ nylon membrane (GE). Membrane was then denatured in a 0.5 N NaOH 1.5 M NaCl solution, neutralized, and UV crosslinked. Membrane was hybridized with 32P-labelled (CCCTAA) , or Alu repeat oligonucleotides in PerfectHyb Plus Hybridization Buffer (Sigma) overnight at 37 °C. The next day, the membrane was washed twice in 2× SSC, exposed onto a storage phosphor screen (GE Healthcare) and scanned using STORM 860 with ImageQuant (Molecular Dynamics). Live cell imaging was performed and analysed as previously described7. Fixed cell and live cell images were captured at 60× and 100× magnification, respectively. Microscope images and dot blots were prepared and analysed using Fiji. Southern blot telomere gel images were prepared using Fiji and were not cropped to exclude any part of the presented lanes. Western blot gel images were prepared using Adobe Photoshop and cropped to present relevant bands. Uncropped western blot images are shown in Supplementary Fig. 1. All statistical analysis was done using GraphPad Prism 5 software. Unpaired t-tests were used to generate two-tailed P values.


DUBLIN--(BUSINESS WIRE)--Research and Markets has announced the addition of the "The Mining Explosives Market in South Africa for Coal, Iron Ore, Gold and PGMs, Forecast to 2020" report to their offering. The South African mining explosives market for coal, iron ore, PGMs, and gold was worth $530.7 million in 2015 and its growth will be limited (CAGR of 1.2%) over the next five years. This is due to the global oversupply of metals and minerals and low commodity prices that are hindering the growth of explosives in the local mining sector. Mining of major commodities is expected to gradually regain momentum, as global demand and prices slowly recover, although this falls outside the current forecast period. Worth $223.8 million in 2015, the bulk emulsion explosives segment is expected to reach $238.6 million by 2020 at a CAGR of 1.3%. In comparison, the packaged explosives segment is expected to grow from $149.3 million in 2015 to $158.2 million by 2020 at a CAGR of 1.2%, while initiating systems will expand from $157.5 million in 2015 to $167.6 million by 2020 at a CAGR of 1.2%. The South African mining explosives market is a very competitive and price-sensitive market. Weak global demand for commodities, combined with low commodity prices, has forced mining companies to take a closer look at reducing variable costs to ensure the viability of mining operations. The top three market participants (AEL Mining Services, BME South Africa, and Sasol Explosives) had a combined revenue market share of over 82.0% in 2015. Major contract gains or losses periodically shift the market shares between the top three competitors, but ultimately these competitors dominate the market. With slow, stagnant growth in mining production and in both green and brownfield projects, competitor growth is dependent on the status of these contracts. - At what rate is the South African mining explosives market growing or declining and are growth changes expected during the forecast period? - What product and technology trends are evident in the local mining explosives market and how does it affect surface and underground mining activities? - How does underground and surface mining impact the use of explosives? - Which product segments (bulk explosives, cartridges, and initiating systems/devices) and major commodities (coal, iron ore, gold, and PGMs) contribute the most to the mining explosives market? Is this likely to change during the forecast period (2016 to 2020)? - What does the mining explosives market's competitive landscape look like? Who are the important market competitors and what products or services do they offer? - Considering weak global commodity prices and their impact on the local mining industry, what are the ramifications for the South African mining explosives market in terms of volumes sold and competitive strategies employed? Are there growth opportunities? For more information about this report visit http://www.researchandmarkets.com/research/ssf52v/the_mining


News Article | February 28, 2017
Site: www.theguardian.com

Helping black and minority ethnic (BME) people to progress in their careers at the same rate as their white counterparts could add £24bn to UK economy each year, a government-backed review has found. The report into race in the workplace found recruitment processes, a tendency by managers to promote people similar to themselves and, in some cases, outright discrimination had all held back workers from BME backgrounds. The report’s author, businesswoman Ruby McGregor-Smith, called on employers to come clean about their lack of diversity by publishing a breakdown of their workforce by race and pay band. She urged the government to make such reporting law if employers do not do it voluntarily. “We don’t need to write another report in a year’s time. We just need to do it, or legislate,” she said before the review’s publication on Tuesday. “The time for talk on race in the workplace is over, it’s time to act. No one should feel unable to reach the top of any organisation because of their race.” McGregor-Smith, a Conservative peer and former chief executive of the facilities management company Mitie, was asked to conduct her review by the former business secretary Sajid Javid. Her findings lay bare the scale of the challenge if the government and employers are to help workers from minority backgrounds have the same opportunities as their white counterparts. It found the employment rate for ethnic minorities workers was only 62.8% compared with 75.6% for white workers of 75.6%. While 14% of the working age population were from a BME background, they made up only 10% of the workforce and held only 6% of top management positions. People from BME backgrounds were also more likely to work in lower paid and lower skilled jobs despite being more likely to have a degree, the report found. McGregor-Smith, who became the first Asian woman to run a FTSE 250 company when she took over at Mitie in 2007, said her own experience had shown there was little diversity at the top of British business but she was still surprised by the extent of both conscious and unconscious bias uncovered by her report. She said there were some organisations that stood out as promoting more inclusive workplaces with schemes such as mentoring and training courses that help tackle bias and she called for those to be highlighted in an annual best 100 employers list. But there was no one sector that was ahead on tackling a lack racial diversity. “It’s everywhere. I’ll go to a big business event and I realise there’s not anyone who looks like me,” said McGregor-Smith. Her review seeks to make an economic case for more diverse workforces, estimating that GDP would be 1.3% higher – equivalent to about £24bn a year – if BME individuals were immediately fully represented across the workforce in the same proportions as white individuals. She emphasised that there was also a moral case for more inclusive workplaces but said that making the business case would spur employers into action. The report also highlighted research showing that companies with more racial diversity were more likely to enjoy higher-than-average financial returns. One of her key recommendations is for the government to provide free online training to help people recognise and change any biased attitudes they might have – often without realising it. “Overt racism that we associate with the 1970s does still disgracefully occur, but unconscious bias is much more pervasive and potentially more insidious because of the difficulty in identifying it or calling it out,” her report says. “Race, gender or background should be irrelevant when choosing the right person for a role – few now would disagree with this. But organisations and individuals tend to hire in their own image, whether consciously or not.” She also called on the public sector to set good examples on hiring, mentoring and promotion and to ensure that when government contracts are awarded they go to bidders who show a commitment to diversity. In its response to the review, the government said it would not move straight away to legislate on the reporting of racial diversity and instead preferred a voluntary system. But it did not rule out laws in the future. “We ... believe a non-legislative solution is the right approach for now, but will monitor progress and stand ready to act if sufficient progress is not delivered,” the business minister Margot James wrote to McGregor-Smith. • Employers with more than 50 staff members should publish five-year targets on diversity, nominate a board member to deliver them and report against the targets annually. • If employers do not act voluntarily, government should legislate to force organisations with more than 50 employees to publish a breakdown of their workforce by race and pay band. • Government should provide free, online unconscious bias training courses to help people identify where they might be behaving and thinking in ways that act as a barrier to a more inclusive workplace. • All organisations should ensure all employees have unconscious bias training. • Employers should ensure proportional representation on long and short lists for jobs, and reject lists that do not reflect the local working age population. The report notes the proportion of working age people from a BME background in London and Birmingham is already more than 40%, with Manchester not far behind, and says that workforces in those cities should reflect that. • Job specifications should be drafted in plain English and provide an accurate reflection of essential and desirable skills to ensure applications from a wider set of individuals. • Larger employers should ensure the selection and interview process is done by more than one person, and should ideally include individuals from different backgrounds. • The charity Business in the Community should publish a list of the top 100 BME employers.

Loading BME collaborators
Loading BME collaborators