Winooski, VT, United States
Winooski, VT, United States

Time filter

Source Type

News Article | March 2, 2017
Site: www.prnewswire.co.uk

Research and Markets has announced the addition of the "Global Arthroscopy Market Analysis 2016 - Forecast to 2022" report to their offering. The market assessment is performed through standard and the tailored research methodology approach. The report contains up to date financial data derived from varied research sources to present unique and reliable analysis. Assessment of major trends with potential impact on the market during the next five years, including a deep dive analysis of market segmentation which comprises of sub markets, regional and country level analysis. The report provides a comprehensive outlook about the market share along with strategic recommendations based on the emerging segments. Annual estimations and forecasts are provided from the year 2013 to 2022 for each given segment and sub segments. Market data derived from the authenticated and reliable sources is subjected to validation from the industry experts. The report also analyzes the market by discussing market dynamics such as drivers, constraints, opportunities, threats, challenges and other market trends. Competitive landscaping provides the recent activities performed by the active players in the market. Activities such as product launch, agreements, joint ventures, partnerships, acquisitions and mergers, and other activities. - Market Sizing estimations and forecasts for 6 years across the given market segments - Identifying market dynamics (Drivers, Restraints, Opportunities, Threats, Challenges and Opportunities, ) - Strategic recommendations in key business segments based on the market estimations - Regional and country level market analysis - Competitive landscaping of major market players - Company profiling covering the financials, recent activities and the future strategies 4 Porters Five Force Analysis 4.1 Bargaining power of suppliers 4.2 Bargaining power of buyers 4.3 Threat of substitutes 4.4 Threat of new entrants 4.5 Competitive rivalry 6 Arthroscopy Market, By Application 6.1 Introduction 6.2 Back and Spine Arthroscopy 6.3 Elbow Arthroscopy 6.4 Foot and Ankle Arthroscopy 6.5 Hand and Wrist Arthroscopy 6.6 Hip Arthroscopy 6.7 Knee Arthroscopy 6.8 Shoulder Arthroscopy 6.9 Sports Medicines 9 Vendor Landscaping 9.1 Agreements, Partnerships, Collaborations and Joint Ventures 9.2 Acquisitions & Mergers 9.3 New Product Launch 9.4 Expansions 9.5 Other Key Strategies 10 Company Profiling 10.1 Smith & Nephew plc 10.2 Arthrex Inc. 10.3 Active Implants 10.4 Azellon 10.5 Biomimedica 10.6 BioTek Instruments India Pvt Ltd. 10.7 Bioventus 10.8 Cayenne Medical 10.9 ConMed Corporation 10.10 DePuy Synthes 10.11 DJO Global 10.12 Flexion Therapeutics 10.13 MinInvasive 10.14 NuOrtho Surgical, Inc. 10.15 OrthoSpace 10.16 Stryker Corporation 10.17 Zimmer Biomet For more information about this report visit http://www.researchandmarkets.com/research/klxxjv/global


News Article | October 23, 2015
Site: www.nature.com

No statistical methods were used to predetermine sample size. The experiments were not randomized and the investigators were not blinded to allocation during experiments and outcome assessment. HeLa (cervical cancer) was originally purchased from ATCC and MEF cells were a gift from D. J. Kwiatkowski (Harvard Medical School). Cells were not authenticated recently but tested negative for mycoplasma contamination. Both cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) with 10% fetal bovine serum (FBS). Antibodies used in the experiments are listed below: anti-YTHDF2 (Proteintech 24744-1-AP, 1:1,000 WB, 1:600 IF); anti-Hsp70 (Stressgen SPA-810, 1:1,000 WB); anti-FTO (Phosphosolutions 597-Fto, 1:1,000 WB, 1:600 IF); anti-METTL3 (Abnova H00056339-B01P, 1:1,000 WB, 1:600 IF); anti-METTL14 (sigma HPA038002, 1:1,000 WB, 1:600 IF); anti-WTAP (Santa Cruz sc-374280, 1:1,000 WB, 1:600 IF); anti-m6A (Millipore ABE572, 1:1,000 m6A immunoblotting); Alexa Fluor 546 donkey anti-mouse secondary antibody (Invitrogen A10036. 1:600 IF); Alexa Fluor 546 donkey anti-rabbit secondary antibody (Invitrogen A10040, 1:600 IF). The Fluc reporter with Hsp70 5′UTR has been reported previously23. For Fluc reporters bearing other 5′UTRs, the following primers were used for 5′UTR cloning: Hsc70 (HSPA8) forward, 5′-CCCAAGCTTGGTCTCATTGAACGCGG-3′; reverse, 5′-CGGGATCCCCTTAGACATGGTTGCTT-3′; Tubulin (TUBG2) forward, 5′-GGCAAGCTTTGCGCCTGTGCTGAATTCCAGCTGC-3′; reverse, 5′-GGCGGATCCGCATCGCCGATCAGACCTAG-3′; Hsp105 (HSPH1) forward, 5′-CCCAAGCTTGTAAAATGCTGCAGATTC-3′; reverse, 5′-CGGGATCCCCACCGACATGGCTGGCCCG-3′. All shRNA targeting sequences were cloned into DECIPHER pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro (Cellecta). shRNA targeting sequences listed below were based on RNAi consortium at Broad Institute (http://www.broad.mit.edu/rnai/trc). YTHDF2 (mouse): 5′-GCTCCAGGCATGAATACTATA-3′; FTO (mouse): 5′-GCTGAGGCAGTTCTGGTTTCA-3′; Scramble control sequence: 5′-AACAGTCGCGTTTGCGACTGG-3′. Lentiviral particles were packaged using Lenti-X 293T cells (Clontech). Virus-containing supernatants were collected at 48 h after transfection and filtered to eliminate cells. MEF cells were infected by the lentivirus for 48 h before selection by 1 μg ml−1 puromycin. YTHDF2 and FTO were cloned into vector pGEX-6P-1 using the following primers: YTHDF2 forward, 5′-ATGAATTCCCATCGGCCAGCAGCCTCTTG-3′; reverse, 5′-CCGCTCGAGTTCTATTTCCCACGACCTTGA-3′; FTO forward, 5′-ATGAATTCAGCATGAAGCGCGTCCAGACC-3′; reverse, 5′-CCGCTCGAGCCTCTAGGATCTTGC-3′. The resulting clones were transfected into the Escherichia coli strain BL21 and expression was induced at 22 °C with 1 mM IPTG for 16–18 h. The pellet collected from 1 l of bacteria culture was then lysed in 15 ml PBS (50 mM NaH PO , 150 mM NaCl, pH 7.2, 1 mM PMSF, 1 mM DTT, 1 mM EDTA, 0.1% (v/v) Triton X-100) and sonicated for 10 min. After removing cell debris by centrifugation at 12,000 r.p.m. for 30 min, the protein extract was mixed with 2 ml equilibrated Pierce glutathione agarose and mixed on an end-over-end rotator for 2 h at 4 °C. The resin was washed three times with ten resin-bed volumes of equilibration/wash buffer (50 mM Tris, 150 mM NaCl, pH 8.0). YTHDF2 and FTO protein was cleaved from the glutathione agarose using PreScission Protease (Genscript) in cleavage buffer (50 mM Tris-HCl, pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT) at 4 °C overnight. Cells were lysed on ice in TBS buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA) containing protease inhibitor cocktail tablet, 1% Triton X-100, and 2 U ml−1 DNase. After incubating on ice for 30 min, the lysates were heated for 10 min in SDS/PAGE sample buffer (50 mM Tris (pH 6.8), 100 mM dithiothreitol, 2% SDS, 0.1% bromophenol blue, 10% glycerol). Proteins were separated on SDS–PAGE and transferred to Immobilon-P membranes (Millipore). Membranes were blocked for 1 h in TBS containing 5% non-fat milk and 0.1% Tween-20, followed by incubation with primary antibodies overnight at 4 °C. After incubation with horseradish-peroxidase-coupled secondary antibodies at room temperature for 1 h, immunoblots were visualized using enhanced chemiluminescence (ECLPlus, GE Healthcare). Cells grown on glass coverslips were fixed in 4% paraformaldehyde for 10 min at 4 °C. After permeabilization in 0.2% Triton X-100 for 5 min at room temperature, the cover slips were blocked with 1% BSA for 1 h. Cells were stained with indicated primary antibody overnight at 4 °C, followed by incubation with Alexa Fluor 546 donkey anti-mouse secondary antibody or Alexa Fluor 546 donkey anti-rabbit secondary antibody for 1 h at room temperature. The nuclei were counter-stained with DAPI (1:1,000 dilution) for 10 min. Cover slips were mounted onto slides and visualized using a Zeiss LSM710 confocal microscope. Cells were treated with actinomycin D (5 μg ml−1) for 4 h, 2 h and 0 h before trypsinization and collection. RNA spike-in control was added proportional to the total cell numbers and total RNA was isolated by TRIzol kit (Life Technologies). After reverse transcription, the mRNA levels of transcripts of interest were detected by real-time quantitative PCR. Total RNA was isolated by TRIzol reagent (Invitrogen) and reverse transcription was performed using High Capacity cDNA Reverse Transcription Kit (Invitrogen). Real-time PCR analysis was conducted using Power SYBR Green PCR Master Mix (Applied Biosystems) and carried on a LightCycler 480 Real-Time PCR System (Roche Applied Science). Primers for amplifying each target were: YTHDF2 forward, 5′-CAGTTTGCCTCCAGCTACTATT-3′; reverse, 5′-GCAATGCCATTCTTGGTCTTC-3′; FTO forward, 5′-TCAGCAGTGGCAGCTGAAAT-3′; reverse, 5′-CTTGGATCCTCACCACGTCC-3′; Hsp70 forward, 5′-TGGTGCAGTCCGACATGAAG-3′; reverse, 5′-GCTGAGAGTCGTTGAAGTAGGC-3′; METTL3 forward, 5′-ATCCAGGCCCATAAGAAACAG-3′; reverse, 5′-CTATCACTACGGAAGGTTGGG-3′; METTL14 forward, 5′-CAGGCAGAGCATGGGATATT-3′; reverse, 5′-TCCGACCTGGAGACATACAT-3′; ALKBH5 forward, 5′-AGTTCCAGTTCAAGCCCATC-3′; reverse, 5′-GGCGTTCCTTAATGTCCTGAG-3′; WTAP forward, 5′-CTGGCAGAGGAGGTAGTAGTTA-3′; reverse, 5′-ACTGGAGTCTGTGTCATTTGAG-3′; β-actin forward, 5′-TTGCTGACAGGATGCAGAAG-3′; reverse, 5′-ACTCCTGCTTGCTGATCCACAT-3′; GAPDH forward, 5′-CAAGGAGTAAGAAACCCTGGAC-3′; reverse, 5′-GGATGGAAATTGTGAGGGAGAT-3′; Fluc forward, 5′-ATCCGGAAGCGACCAACGCC-3′; reverse, 5′-GTCGGGAAGACCTGCCACGC-3′. Plasmids containing the corresponding 5′UTR sequences of mouse HSPA1A and full-length firefly luciferase were used as templates. Transcripts with normal m7G cap were generated using the mMessage mMachine T7 Ultra kit (Ambion) and transcripts with non-functional cap analogue GpppA were synthesized using MEGAscript T7 Transcription Kit (Ambion). To obtain mRNAs with the adenosine replaced with m6A, in vitro transcription was conducted in a reaction in which 5% of the adenosine was replaced with N6-methyladenosine. All mRNA products were purified using the MEGAclear kit (Ambion) according to the manufacturer’s instructions. In vitro translation was performed using the Rabbit Reticulocyte Lysate System (Promega) according to the manufacturer’s instructions. Luciferase activity was measured using a luciferase reporter assay system (Promega) on a Synergy HT Multi-detection Microplate Reader (BioTek Instruments). Cells grown in 35-mm dishes were transfected with in-vitro-synthesized mRNA containing the luciferase gene. Luciferase substrate d-luciferin (1 mM, Regis Tech) was added into the culture medium immediately after transfection. Luciferase activity was monitored and recorded using Kronos Dio Luminometer (Atto). For site-specific m6A detection, DNA primers were first 5′ labelled with 32P using T4 polynucleotide kinase (Invitrogen) and purified by ethanol precipitation. The primer 5′-AGGGATGCTCTGGGGAAGGCTGG-3′ was used to detect potential m6A site and the primer 5′-CGCCGCTCGCTCTGCTTCTCTTGTCTTCGCT-3′ was used to detect the non-methylated site. Synthesized mRNA 5′-CGATCCTCGGCCAGG(m6A)CCAGCCTTCCCCAG-3′ and 5′-CGATCCTCGGCCAGGACCAGCCTTCCCCAG-3′ served as positive and negative control templates, respectively. To set up the reaction, a 2 × annealing solution was prepared in a total volume of 8 µl with 1 × Tth buffer (Promega) or AMV buffer (Invitrogen), 1 µl of each radiolabelled primer and 10 µg mRNA from MEF cells that had been heat shock treated. The mixture was heated at 95 °C for 10 min and cooled slowly to room temperature. 3 µl of annealing solution were combined with 2 µl of enzyme and heated at 37 °C (AMV Reverse Transcriptase) or 55 °C (Tth DNA Polymerase) for 2 min. After adding the dTTP solution (final dTTP concentration: 100 µM), the reactions were heated for 5 min at 37 °C (AMV) or 10 min at 55 °C (Tth). Reaction products were resolved on a 20% denaturing polyacrylamide gel and exposed overnight. The ligation method was optimized from previous reports26, 27, 31. The RNA oligonucleotide covering the 82–117 nt region of HSPA1A was synthesized by Thermo Scientific, whereas RNA fragments corresponding to other regions were generated by in vitro transcription. For sequential splint ligation, two DNA bridging oligonucleotides were designed: DNA Bridge 1, 5′-GGTCCTGGCCGAGGATCGGGAACGCGCCGCTCGCTC-3′; DNA Bridge 2, 5′-CTCCGCGGCAGGGATGCTCTGGGGAAGGCTGGTCCT-3′. For 3′ RNA oligonucleotide (donor) phosphorylation, 1 μl of 20 μM donor oligonucleotide was mixed with 1 μl of 10 × PNK buffer, 6 μl of ATP (10 mM), 0.5 μl of RNasin (20 units) and 1 μl of T4 PNK (5 units). The reaction mixture was incubated at 37 °C for 30 min followed by inactivation of T4 PNK at 65 °C for 20 min. Next, the DNA bridge oligonucleotide was hybridized with the 3′ RNA oligonucleotide and the 5′ RNA oligonucleotide (acceptor) at a 1:1.5:2 ratio (5′RNA:bridge:3′RNA). Oligonucleotides were annealed (95°C for 1 min followed by 65 °C for 2 min and 37 °C for 10 min) in the presence of 1 × T4 DNA dilution buffer. To ligate the 5′ and the 3′ RNA together, T4 DNA ligase and the T4 DNA ligation buffer were added and the reaction mixture was incubated at 37 °C for 1 h. The ligation was stopped by adding 1 μl of 0.5 M EDTA followed by phenol-chloroform extraction and ethanol precipitation. Ligation products were analysed by 10% TBE-Urea gels or formaldehyde gels. The expected RNA ligation products in TBE-Urea gels were eluted in RNA gel elution buffer (300 mM NaOAc pH 5.5, 1 mM EDTA and 0.1 U μl−1 SUPERase_In) followed by ethanol precipitation. The final products in formaldehyde gels were isolated by Zymoclean Gel RNA Recovery Kit (Zymo Research). To isolate endogenous Hsp70 mRNA, 400 pmol of biotin-labelled probe (5′-TTCATAACATATCTCTGTCTCTT-3′) was incubated with of 2 mg M-280 Streptavidin Dynabeads (Life Technologies) in 1 ml 1 × B & W buffer (5 mM Tris-HCL pH 7.5, 0.5 mM EDTA and 1 M NaCl) at 4 °C for 1 h. 2 mg total RNA was denatured at 75 °C for 2 min and added to the pre-coated Dynabeads for an additional incubation of 2 h at 4 °C. Captured RNA was eluted by heating beads for 2 min at 90 °C in 10 mM EDTA with 95% formamide followed by TRIzol LS isolation. Isolated RNA was quantified using NanoDrop ND-1000 UV-Vis Spectrophotometer and equal amounts of RNAs were mixed with 2 × RNA Loading Dye (Thermo Scientific) and denatured for 3 min at 70 °C. In-vitro-transcribed mRNA containing 50% N6-methyladenosine or 100% adenosine was used as positive and negative control, respectively. Samples were separated on a formaldehyde denaturing agarose gel and transferred to a positively charged nylon membrane by siphonage in transfer buffer (10 mM NaOH, 3 M NaCl) overnight at room temperature. After transfer, the membrane was washed for 5 min in 2 × SSC buffer and RNA was UV crosslinked to the membrane. Membrane was blocked for 1 h in PBST containing 5% non-fat milk and 0.1% Tween-20, followed by incubation with anti-m6A antibody (1:1,000 dilution) for overnight at 4 °C. After extensive washing with 0.1% PBST three times, the membrane was incubated with HRP-conjugated anti-rabbit IgG (1:5,000 dilution) for 1 h. Membrane was visualized by using enhanced chemiluminescence (ECLPlus, GE Healthcare). Synthesize mRNA (100 pmol) with a single m6A at A103 was label by biotin using the Pierce RNA 3′ End Desthiobiotinylation Kit. Binding of the labelled RNA to streptavidin magnetic beads was performed in RNA capture buffer (20 mM Tris, pH 7.5, 1 M NaCl, 1 mM EDTA) for 30 min at room temperature with rotation. The RNA–protein binding reaction was conducted in protein–RNA binding buffer (20 mM Tris (pH 7.5), 50 M NaCl, 2 mM MgCl , 0.1% Tween-20 Detergent) at 4 °C for 60 min with rotation. After washing three times with the wash buffer (20 mM Tris pH 7.5, 10 mM NaCl, 0.1% Tween-20 Detergent), protein was eluted by Biotin Elution Buffer (Pierce) and detected by western blot. The YTHDF2 and FTO in vitro competition assay was performed in 100 µl of reaction mixture containing 5 µM RNA incorporated with 50% m6A, 283 µM of (NH ) Fe(SO ) ·6H O, 300 µM of α-KG, 2 mM of l-ascorbic acid, 50 µg ml−1 of BSA, and 50 mM of HEPES buffer (pH 7.0). The reaction was incubated for 3 h at room temperature, and quenched by adding 5 mM EDTA followed by heating for 5 min at 95 °C. RNA was isolated by TRIzol LS and quantified using NanoDrop ND-1000 UV-Vis Spectrophotometer. Equal amounts of RNA were used for dot blotting and methylene blue staining was used to show the amount of RNA on hybridization membranes. Sucrose solutions were prepared in polysome buffer (10 mM HEPES, pH 7.4, 100 mM KCl, 5 mM MgCl , 100 µg ml−1 cycloheximide and 2% Triton X-100). A 15%–45% (w/v) Sucrose density gradients were freshly prepared in SW41 ultracentrifuge tubes (Backman) using a Gradient Master (BioComp Instruments). Cells were pre-treated with 100 µg ml−1 cycloheximide for 3 min at 37 °C followed by washing using ice-cold PBS containing 100 µg ml−1 cycloheximide. Cells were then lysed in polysome lysis buffer. Cell debris were removed by centrifugation at 14,000 r.p.m. for 10 min at 4 °C. 500 µl of supernatant was loaded onto sucrose gradients followed by centrifugation for 2 h 28 min at 38,000 r.p.m. 4 °C in a SW41 rotor. Separated samples were fractionated at 0.75 ml min−1 through an automated fractionation system (Isco) that continually monitores OD values. An aliquot of ribosome fraction were used to extract total RNA using Trizol LS reagent (Invitrogen) for real-time PCR analysis. For m6A immunoprecipitation, total RNA was first isolated using TRIzol reagent followed by fragmentation using freshly prepared RNA fragmentation buffer (10 mM Tris-HCl, pH 7.0, 10 mM ZnCl ). 5 µg fragmented RNA was saved as input control for RNA-seq. 1 mg fragmented RNA was incubated with 15 μg anti-m6A antibody (Millipore ABE572) in 1 × IP buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, and 0.1% Igepal CA-630) for 2 h at 4 °C. The m6A-IP mixture was then incubated with Protein A beads for additional 2 h at 4 °C on a rotating wheel. After washing three times with IP buffer, bound RNA was eluted using 100 μl elution buffer (6.7 mM N6-Methyladenosine 5′-monophosphate sodium salt in 1 × IP buffer), followed by ethanol precipitation. Precipitated RNA was used for cDNA library construction and high-throughput sequencing described below. Ribosome fractions separated by sucrose gradient sedimentation were pooled and digested with E. coli RNase I (Ambion, 750 U per 100 A260 units) by incubation at 4 °C for 1 h. SUPERase inhibitor (50 U per 100 U RNase I) was then added into the reaction mixture to stop digestion. Total RNA was extracted using TRIzol reagent. Purified RNA was used for cDNA library construction and high-throughput sequencing described below. Fragmented RNA input and m6A-IP elutes were dephosphorylated for 1 h at 37 °C in 15 µl reaction (1 × T4 polynucleotide kinase buffer, 10 U SUPERase_In and 20 U T4 polynucleotide kinase). The products were separated on a 15% polyacrylamide TBE-urea gel (Invitrogen) and visualized using SYBR Gold (Invitrogen). Selected regions of the gel corresponding to 40–60 nt (for RNA-seq and m6A-seq) or 25–35 nt (for Ribo-seq) were excised. The gel slices were disrupted by using centrifugation through the holes at the bottom of the tube. RNA fragments were dissolved by soaking overnight in 400 μl gel elution buffer (300 mM NaOAc, pH 5.5, 1 mM EDTA, 0.1 U μl−1 SUPERase_In). The gel debris was removed using a Spin-X column (Corning), followed by ethanol precipitation. Purified RNA fragments were re-suspended in nuclease-free water. Poly(A) tailing reaction was carried out for 45 min at 37 °C (1 × poly(A) polymerase buffer, 1 mM ATP, 0.75 U μl−1 SUPERase_ In and 3 U E. coli poly(A) polymerase). For reverse transcription, the following oligonucleotides containing barcodes were used: MCA02, 5′-pCAGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′; LGT03, 5′-pGTGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′; YAG04, 5′-pAGGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′; HTC05, 5′-pTCGATCGTCGGACTGTAGAACTCTØCAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3′. In brief, the tailed-RNA sample was mixed with 0.5 mM dNTP and 2.5 mM synthesized primer and incubated at 65 °C for 5 min, followed by incubation on ice for 5 min. The following was then added to the reaction mix: 20 mM Tris (pH 8.4), 50 mM KCl, 5 mM MgCl , 10 mM DTT, 40 U RNaseOUT and 200 U SuperScript III. The reverse-transcription reaction was performed according to the manufacturer’s instruction. Reverse-transcription products were separated on a 10% polyacrylamide TBE-urea gel as described earlier. The extended first-strand product band was expected to be approximately 100 nt, and the corresponding region was excised. The cDNA was recovered by using DNA gel elution buffer (300 mM NaCl, 1 mM EDTA). First-strand cDNA was circularized in 20 μl of reaction containing 1 × CircLigase buffer, 2.5 mM MnCl , 1 M Betaine, and 100 U CircLigase II (Epicentre). Circularization was performed at 60 °C for 1 h, and the reaction was heat-inactivated at 80 °C for 10 min. Circular single-strand DNA was re-linearized with 20 mM Tris-acetate, 50 mM potassium acetate, 10 mM magnesium acetate, 1 mM DTT, and 7.5 U APE 1 (NEB). The reaction was carried out at 37 °C for 1 h. The linearized single-strand DNA was separated on a Novex 10% polyacrylamide TBE-urea gel (Invitrogen) as described earlier. The expected 100-nt product bands were excised and recovered as described earlier. Single-stranded template was amplified by PCR by using the Phusion High-Fidelity enzyme (NEB) according to the manufacturer’s instructions. The oligonucleotide primers qNTI200 (5′-CAAGCAGAAGACGGCATA- 3′) and qNTI201 (5′-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACG- 3′) were used to create DNA suitable for sequencing, that is, DNA with Illumina cluster generation sequences on each end and a sequencing primer binding site. The PCR contains 1 × HF buffer, 0.2 mM dNTP, 0.5 μM oligonucleotide primers, and 0.5 U Phusion polymerase. PCR was carried out with an initial 30 s denaturation at 98 °C, followed by 12 cycles of 10 s denaturation at 98 °C, 20 s annealing at 60 °C, and 10 s extension at 72 °C. PCR products were separated on a non-denaturing 8% polyacrylamide TBE gel as described earlier. Expected DNA at 120 bp (for Ribo-seq), or 140 bp (for RNA-seq and m6A-seq) was excised and recovered as described earlier. After quantification by Agilent BioAnalyzer DNA 1000 assay, equal amounts of barcoded samples were pooled into one sample. Approximately 3–5 pM mixed DNA samples were used for cluster generation followed by deep sequencing using sequencing primer 5′-CGACAGGTTCAGAGTTCTAC AGTCCGACGATC-3′ (Illumina HiSeq). For Ribo-seq, the sequencing reads were first trimmed by 8 nt from the 3′ end and trimmed reads were further processed by removing the adenosine (A) stretch from the 3′ end (one mismatch was allowed). The processed reads between 25 nt and 35 nt were first mapped by Tophat using parameters (--bowtie1 -p 10 --no-novel-juncs) to mouse transcriptome (UCSC Genes)32. The unmapped reads were then mapped to corresponding mouse genome (mm10). Non-uniquely mapped reads were disregarded for further analysis owing to ambiguity. The same mapping procedure was applied to RNA-seq and m6A-seq. For Ribo-seq, the 13th position (12 nt offset from the 5′ end) of the uniquely mapped read was defined as the ribosome ‘P-site’ position. The RPF density was computed after mapping uniquely mapped reads to each individual mRNA transcript according to the NCBI Refseq gene annotation. Uniquely mapped reads of RNA-seq and Ribo-seq in the mRNA coding region were used to calculate the RPKM values for estimating mRNA expression and translation levels respectively. For m6A-seq, uniquely mapped reads in the 5′UTR were used to calculate the RPKM values for estimating the m6A levels. We used a similar scanning strategy reported previously to identify m6A peaks in the immunoprecipitation sample as compared to the input sample7. In brief, for NCBI RefSeq genes whose maximal read coverage was greater than 15 in the input (RNA-seq), a sliding window of 80 nucleotides with step size of 40 nucleotides was employed to scan the longest isoform (on the basis of coding sequence (CDS) length; in the case of equal CDS, the isoform with longer 5′UTR was selected). For each window, a peak-over-median score (POM) was derived by calculating the ratio of mean read coverage in the window to the median read coverage of the whole gene body. Windows scoring higher than 3 in the IP sample were obtained and all the resultant overlapping m6A peak windows in the IP sample were iteratively clustered to infer the boundary of the m6A-enriched region, as well as peak position with maximal read coverage. Finally, a peak-over-input (POI) score was assigned to each m6A-enriched region by calculating the ratio of POM in the IP sample to that in the input sample. A putative m6A site was defined if the POI score was higher than 3. The peak position of each m6A site was classified into five mutually exclusive mRNA structural regions including TSS (the first 200 nucleotides of mRNA), 5′UTR, CDS, stop codon (a 400 nt window flanking the mRNA stop codon) and 3′UTR. The m6A peaks with POI score higher than 10 were selected for consensus motif finding. We used MEME Suite for motif analysis33. In brief, the flanking sequences of m6A peaks (±40 nt) with POI scores were retrieved from mouse transcritpome and were used as MEME input.


Sheehan A.J.,TGR BioSciences | Goodrich W.,BioTek Instruments Inc. | Banks P.,BioTek Instruments Inc. | Crouch M.F.,TGR BioSciences | Osmond R.I.W.,TGR BioSciences
Assay and Drug Development Technologies | Year: 2013

We describe a cellular assay for detection of phosphorylation of endogenous proteins, whereby cells are seeded, treated, and assayed for modulation of phosphorylation in a single microplate well. The procedure is coupled to a rapid, one-wash sandwich enzyme-linked immuno-sorbent assay, enabling results to be obtained within 3-4 h from cell seeding. The assay was tested in two separate cellular systems, namely, HeLa and MCF-7 cells. When using the one-well protocol with Akt phosphorylation as a model, the response to a number of agonists was the same as the response obtained using cells treated in a separate microplate, using a conventional lysate transfer approach. The assay procedure was automated, and quantitative pharmacological data on three known inhibitors of the PI3-kinase signaling pathway was obtained within 4 h from seeding cells, with six dispense steps, and a single wash cycle. Thus, the protocol affords a reliable means of assaying for cellular signaling events in different cell types, and is amenable to automation. © 2013 Mary Ann Liebert, Inc.


Larson B.,BioTek Instruments Inc. | Berry D.,Global Cell Solutions | Justice B.,Global Cell Solutions | Gainer T.,Life Technologies
Bio Tech International | Year: 2010

A novel three-dimensional (3D) cell culture method, wherein cells are attached to microcarriers, is compared to traditional 2D culture methods. Results suggest that the 3D method offers similar results compared to the 2D method along with improvements in overall cost, time, in situ behaviour and automation-readiness.


Wang D.,U.S. National Institutes of Health | Qian X.,U.S. National Institutes of Health | Rajaram M.,U.S. National Institutes of Health | Rajaram M.,BioTek Instruments Inc. | And 2 more authors.
Oncotarget | Year: 2016

The RHO family of RAS-related GTPases in tumors may be activated by reduced levels of RHO GTPase accelerating proteins (GAPs). One common mechanism is decreased expression of one or more members of the Deleted in Liver Cancer (DLC) family of Rho-GAPs, which comprises three closely related genes (DLC1, DLC2, and DLC3) that are down-regulated in a wide range of malignancies. Here we have studied their comparative biological activity in cultured cells and used publicly available datasets to examine their mRNA expression patterns in normal and cancer tissues, and to explore their relationship to cancer phenotypes and survival outcomes. In The Cancer Genome Atlas (TCGA) database, DLC1 expression predominated in normal lung, breast, and liver, but not in colorectum. Conversely, reduced DLC1 expression predominated in lung squamous cell carcinoma (LSC), lung adenocarcinoma (LAD), breast cancer, and hepatocellular carcinoma (HCC), but not in colorectal cancer. Reduced DLC1 expression was frequently associated with promoter methylation in LSC and LAD, while DLC1 copy number loss was frequent in HCC. DLC1 expression was higher in TCGA LAD patients who remained cancer-free, while low DLC1 had a poorer prognosis than low DLC2 or low DLC3 in a more completely annotated database. The poorest prognosis was associated with low expression of both DLC1 and DLC2 (P < 0.0001). In cultured cells, the three genes induced a similar reduction of Rho-GTP and cell migration. We conclude that DLC1 is the predominant family member expressed in several normal tissues, and its expression is preferentially reduced in common cancers at these sites.

Loading BioTek Instruments Inc. collaborators
Loading BioTek Instruments Inc. collaborators