BioLegend Inc.

San Diego, CA, United States

BioLegend Inc.

San Diego, CA, United States
SEARCH FILTERS
Time filter
Source Type

Human embryonic kidney 293 (HEK293) cells, HEK293FT, OVCAR5, A375, HeLa, and mouse embryonic fibroblasts (MEFs) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% fetal bovine serum (FBS), 100 units of penicillin and 100 mg ml−1 streptomycin. Gβl+/+ and Gβl−/− MEFs were generous gifts from D. M. Sabatini (Whitehead Institute for Biomedical Research, Massachusetts Institute of Technology). Traf2+/+ and Traf2−/− MEFs were obtained from Y. Sun (Department of Radiation Oncology, University of Michigan). Otud7b+/+ and Otud7b−/− MEFs have been described previously29. All the cell lines were routinely tested negative for mycoplasma contamination. Transfection was performed using lipofectamine 2000 reagent as described previously9, 10. For serum starvation, 32 h post-transfection, cells were washed with PBS twice and cultured in FBS-free DMEM for 14–16 h. To initiate growth factor signalling, the medium was added with EGF (Sigma E9644, 100 ng ml−1) or insulin (Invitrogen 41400-045,100 nM) for indicated period of times. Rabbit polyclonal antibody against human OTUD7B was purchased from Cell Signaling Technology (CST). Anti-mouse Otud7b antibody was obtained from Proteintech. Anti-SIN1 antibodies were purchased from CST (12860) or generated (K87) in the B. Su laboratory (Department of Immunobiology and the Vascular Biology and Therapeutics Program, Yale University). Primary antibodies against TRAF2 (4724), RICTOR (9476), RPTOR (2280), mTOR (2983), AKT (pS473) (4051 and 4060), AKT(pT308) (2965), S6K(pT389) (9205), pFOXO1(Thr24)/FOXO3a(Thr32) (9464), AKT (4691), S6K (2708), FOXO1 (9454), GST tag (2625) and Myc Tag (2278 and 2276) were purchased from CST. Primary antibodies against GβL were purchased from CST (3274) and Bethyl (A300-679A). Rabbit polyclonal anti-HA antibody (MMS-101P) was purchased from BioLegend. Mouse monoclonal anti-HA antibody (sc-805) was obtained from Santa Cruz. Rabbit antibody against the Flag epitope (F7425), mouse monoclonal anti-Flag antibody (F3165), mouse monoclonal anti-Flag M2 affinity agarose beads (A2220), mouse monoclonal anti-HA agarose beads (A2095), anti-tubulin antibody (T5168), peroxidase-conjugated secondary anti-mouse (A4416) and anti-rabbit (A4914) antibodies were purchased from Sigma. These primary antibodies were used at a 1:1,000 dilution and secondary antibodies were diluted at 1:3,000 in 5% non-fat milk for immunoblotting analysis. For immunoblot analysis of mouse normal lung and tumour tissues, antibodies for Akt1 (B-1), HSP60 (H1) were purchased from Santa Cruz Biotechnology, Inc. Expression vectors CMV-GST-GβL (amino acid (aa) 1–326), CMV-GST-GβL-ΔWD6 (deleting aa 211–262), CMV-GST-GβL-ΔWD7 (aa 1–271), CMV-GST-GβL-WD6 (aa 211–271), CMV-GST-GβL-WD7 (aa 263–326), CMV-GST-GβL-WD6+7 (aa 211–326) and CMV-GST-UCH-L1 were generated by subcloning the corresponding cDNAs into the pCMV-GST vector via BamHI/BglII and XhoI/SalI sites. HA-GβL (aa 1–326), HA-GβL-ΔWD6 (deleting aa 211–262), HA-GβL-ΔWD7 (aa 1–271), HA-GβL-ΔWD6+7 (aa 1–211), HA-GβL-ΔW297 (aa 1–297), HA-SIN1, HA-RICTOR, HA-Rptor, HA-mTOR, HA-TRAF1, HA-TRAF2 and HA-TRAF3 were constructed by cloning the corresponding cDNAs into pcDNA3-HA vector via BamHI and XhoI sites. Flag-TRAF2 and Flag-TRAF2-ΔRING were kindly gifted by Y. Sun (Department of Radiation Oncology, University of Michigan). Myc-RPTOR, Myc-TRAF2, Myc-TRAF6 or Flag-TRAF6, Flag-SKP2, Flag-RNF168 and Flag-SIN1 were constructed by cloning the corresponding cDNAs into pcDNA3-Myc or pcDNA3-Flag vector via BamHI and XhoI sites. Flag-Myc-OTUB1, Flag-Myc-OTUB2, Flag-Myc-OTUD3, Flag-Myc-OTUD4, Flag-Myc-OTUD5, Flag-Myc-OTUD6A, Flag-Myc-OTUD6B, Flag-Myc-OTUD7A and Flag-Myc-OTUD7B constructs have been described previously31. The HA-GβL(K305R), HA-GβL(K313R), HA-GβL(K305R/K313R) (KRKR), HA-GβL(P265A/E267A) (PEAA), Flag-Myc-OTUD7B(C194A) mutants29, 32 were constructed using the Site-Directed Mutagenesis Kit (Stratagene) following the manufacturer’s instructions. His-Ub, His-Ub(K6R), His-Ub(K11R), His-Ub(K27R), His-Ub(K29R), His-Ub(K33R), His-Ub(K48R), His-Ub(K63R), His-Ub(K0), His-Ub(K48) only and His-Ub(K63) only vectors were provided by P. P. Pandolfi (Beth Israel Deaconess Medical Center, Harvard Medical School). GβL shRNA vectors were purchased from GE Healthcare Dharmacon (Clone ID: TRCN0000039758, TRCN0000039759, TRCN0000039760, TRCN0000039761, TRCN0000039762). Lentiviral shRNA vectors depleting human OTUD7B were from an shRNA library targeting human de-ubiquitinating enzymes (OBS Catalogue number: RHS6054), purchased from Thermo Scientific Open Biosystems. The target sequences are OTUD7B shRNA #1: 5′-CGGCGGAAGGAGAAGTCAA-3′ and OTUD7B shRNA #2: 5′-ACGTCTTTGTCCTTGCTCA-3′. For lentiviral shRNA infection, HEK293FT cells were transfected with shGFP or GβL shRNA or OTUD7B shRNA plenti-puro vectors, together with packing vectors (Δ8.9 and VSVG plasmids) using lipofectamine 2000 reagent as previously described9, 10. To restore GβL expression, GβL mutants resistant to shRNA (GβL-shRes) were constructed from HA-GβL, HA-GβL(PEAA) and HA-GβL(KRKR) vectors using the following primer sets: 5′-CAATAGCACCGGCAACTGCTACGTATGGAATCTGACG-3′ (sense) and 5′-CGTCAGATTCCATACGTAGCAGTTGCCGGTGCTATTG-3′ (antisense). The shRes HA-GβL, HA-GβL(PEAA) and HA-GβL(KRKR) were subcloned into pBabe-hygro retroviral vectors33 and co-transfected with packaging vectors (Retro-VSVG, JK3, and CMV-TAT plasmids) into HEK293FT cells using lipofectamine 2000 reagent. All the constructs were confirmed by DNA sequencing. The cells were infected with various virus particles and selected with medium containing puromycin and/or hygromycin for at least three days. Cellular ubiquitination assays were performed as described previously34. In brief, HEK293 cells were co-transfected with His-Ub and the indicated vectors for 48 h and lysed in denaturing condition (buffer A: 6 M guanidine-HCl, 0.1 M Na HPO /NaH PO , 10 mM imidazole (pH 8.0)). After sonication, the poly-ubiquitinated proteins were purified by incubation with nickel-nitrilotriacetic acid (Ni-NTA) matrices (QIAGEN) for 3 h at room temperature. Histidine pull-down products were washed sequentially once in buffer A, twice in buffer A/TI mixture (buffer A:buffer TI = 1:3), and once in buffer TI (25 mM Tris-HCl and 20 mM imidazole (pH 6.8)). The poly-ubiquitinated proteins were separated by SDS–PAGE for immunoblot analysis. HEK293 cells were transfected with CMV-GST-GβL and ubiquitin expression constructs. Thirty-two hours post-transfection, the cells were serum starved for 16 h, with or without insulin stimulation, and lysed using Triton buffer for GST pull-down. The GST pull-down products were eluted with glutathione-containing buffer and then subjected to Ubiquitin Absolute Quantification (UB-AQUA) mass spectrometry (MS) analysis of ubiquitin chain linkage. For UB-AQUA/PRM, samples were subject to TCA precipitation. Samples were digested first with Lys-C (in 100 mM tetraethylammonium bromide (TEAB), 0.1% Rapigest (Waters Corporation), 10% (vol/vol) acetonitrile (ACN)) for 2 h at 37 °C, followed by the addition of trypsin and further digested overnight. Digests were acidified with an equal volume of 5% (vol/vol) formic acid (FA) to a pH of approximately 2 for 30 min, dried down, and resuspended in 1% (vol/vol) FA. UB-AQUA/PRM was performed largely as described previously but with several modifications35, 36, 37. A collection of 16 heavy-labelled reference peptides36, each containing a single 13C/15N-labelled amino acid, was produced at Cell Signaling Technologies and quantified by amino acid analysis. UB-AQUA peptides from working stocks (in 5% (vol/vol) FA) were diluted into the digested sample (in 1% (vol/vol) FA) to be analysed to an optimal final concentration predetermined for individual peptide. Samples and AQUA peptides were oxidized with 0.05% hydrogen peroxide for 20 min, subjected to C18 StageTip and resuspended in 1% (vol/vol) FA. MS data were collected sequentially by liquid chromatography (LC)/MS on a Q Exactive mass spectrometer (Thermo Fisher Scientific) coupled with a Famos Autosampler (LC Packings) and an Accela600 LC pump (Thermo Fisher Scientific). Peptides were separated on a 100 μm i.d. microcapillary column packed with around 0.5 cm of Magic C4 resin (5 μm, 100 Å; Michrom Bioresources) followed by approximately 20 cm of Accucore C18 resin (2.6 μm, 150 Å; Thermo Fisher Scientific). Peptides were separated using a 45 min gradient of 3–25% ACN in 0.125% FA with a flow rate of about 300 nl min−1. The scan sequence began with an Orbitrap full MS1 spectrum with the following parameters: resolution of 70,000, scan range of 200–1,000 Thomson (Th), AGC target of 1 × 106, maximum injection time of 250 ms, and profile spectrum data type. This scan was followed by 12 targeted MS2 scans selected from a scheduled inclusion list with a 8-min retention time window. Each targeted MS2 scan consisted of high-energy collision dissociation (HCD) with the following parameters: resolution of 17,500, AGC of 1 × 105, maximum injection time of 200 ms, isolation window of 1 Th, normalized collision energy (NCE) of 23, and profile spectrum data type. Raw files were searched, and precursor and fragment ions were quantified using Skyline version 3.5 (ref. 38). Data generated from Skyline were exported into an Excel spreadsheet for further analysis as previously described36. Total UB was determined as the average of the total UB calculated for each individual locus, unless specified otherwise. Samples were subjected to reduction (10 mM TCEP) and alkylation (20 mM chloroacetamide) followed by TCA precipitation. Samples were digested overnight at 37 °C with Lys-C and trypsin (in 100 mM TEAB, 0.1% Rapigest, 10% (vol/vol) acetonitrile (ACN)). Digests were acidified with an equal volume of 5% (vol/vol) formic acid (FA) to a pH of approximately 2 for 30 min, dried down, resuspended in 1% (vol/vol) FA before C18 StageTip (packed with Empore C18; 3M Corporation) desalting. Eluted peptide were resuspended in 1% FA and mass spectrometry data were collected using a Qexactive mass spectrometer (Thermo Fisher Scientific, San Jose, CA) with a Famos Autosampler (LC Packings) and an Accela600 liquid chromatography (LC) pump (Thermo Fisher Scientific). Peptides were separated on a 100 μm inner diameter microcapillary column packed with around 0.5 cm of Magic C4 resin (5 μm, 100 Å, Michrom Bioresources) followed by about 20 cm of Accucore C18 resin (2.6 μm, 150 Å, Thermo Fisher Scientific). Peptides were separated using an 80 min gradient of 3 to 35% acetonitrile in 0.125% formic acid with a flow rate of approximately 300 nl min−1. The scan sequence began with an MS1 spectrum (Orbitrap analysis; resolution 70,000; mass range 300−1,500 m/z; automatic gain control (AGC) target 1 × 106; maximum injection time 250 ms). Precursors for MS2 analysis were selected using a Top20 most abundant peptides. MS2 analysis consisted of high-energy collision-induced dissociation (quadrupole ion trap analysis; AGC 1 × 105; normalized collision energy (NCE) 25; maximum injection time 60 ms; resolution 17,500). Sequest-based identification using a Human UNIPROT database followed by a target decoy-based linear discriminant analysis was used for peptide and protein identification as described39. Parameters used for database searching include: 50 p.p.m. Precursor mass tolerance; 0.03 Da product ion mass tolerance; tryptic digestion with up to three missed cleavages; carboxyamidomethylation of Cys was set as a fixed modification, while oxidation of Met was set as variable modifications. Localization of diGly sites used a modified version of the A-score algorithm as described40, 41. A-scores of 13 were considered localized. The GβLKRKR knock-in cell line was generated following the protocol described previously42. The sgRNA (5′-TCCAGCTTCCTCGGACAACC-3′) targeting the genomic sequence close to the GβL K305/K313 site was designed using the CRISPR design tool (http://crispr.mit.edu) and cloned into GeneArt CRISPR nuclease vector with OFP reporter (Life Technologies, A21174). A 167-nt single-stranded oligodeoxynucleotides (ssODNs) was used as the template with KRKR mutation and a silent change to the PAM site that do not alter the amino acid sequence. The sgRNA construct and the ssODNs were co-transfected into HEK293 cells. Forty-eight hours post-transfection, the OFP-positive cells were enriched by FACS sorting and seeded into a 96-well plate with one cell per well. The genomic DNA of individual clone was extracted using the Quick Extract DNA Extraction Solution (Epicentre, Q09050) and used as the template to amplify the DNA fragment containing the K305/K313 site. The PCR products were cut by BspEI (NEB, R0540L) to screen the potential correct clones. Finally, knock-in mutations were verified by the Sanger sequencing method. The primers for amplification of the genomic DNA were: forward, 5′-GCAGCTTCCCCTCTGCTG-3′; reverse, 5′-AGGGGAGGGTCTGCTCTG-3′. ssODNs: 5′-GCACCAGGCAGTCCCGAGGGGTCACAGGCTAGCCCAGCACACTGTCATTGAAGGCCAGGCAGACAACAGCCCGCTGGTGGCCGCCATACTCTCTCCGGATCTCTCCAGTCTCCACACACCAGAGCCGGGCGAGGTTGTCCGAGGAAGCTGGAGGGGGAGATTGTGCA-3′. To measure the half-life of GβL protein in cells, a cycloheximide (CHX)-based assay was performed following our previously described experimental procedures34. Traf2−/− MEFs, GβLKRKR knock-in HEK293 cells, Otud7b−/− MEFs, and corresponding wild-type cells, or GβL-depleted A375 cells stably expressing GβL or GβL(ΔW297) were cultured in serum-containing medium were washed with phosphate-buffered saline, lysed in 0.5 ml of CHAPS buffer supplemented with protease inhibitors (Complete Mini, Roche) and phosphatase inhibitors (phosphatase inhibitor cocktail set I and II, Calbiochem). Alternatively, HEK293 cells were serum starved for 16 h and stimulated with or without insulin (100 nM) for 15 min, and lysed using CHAPS buffer. The gel filtration chromatography assays were performed as described previously9. In brief, whole-cell lysates (WCL) were filtered through a 0.45 μm syringe filter and protein concentration was adjusted to 8 mg ml−1 with CHAPS buffer. Afterward, 500 μl of the WCL was injected onto a Superdex 200 10/300 GL column (GE Lifesciences cat. no. 17-5175-01). Chromatography was performed on the AKTA-FPLC (GE Lifesciences cat. no. 18-1900-26) with CHAPS buffer. One column volume of eluates was fractionated with 500 μl in each fraction, at the elution speed of 0.3 ml min−1. Aliquots (25 μl each) of each fraction were resolved by SDS–PAGE gels and detected with indicated antibodies. CHAPS buffer (40 mM Tris, pH 7.5, 120 mM NaCl, 1 mM EDTA, 0.3% CHAPS)11, 43, Triton buffer (40 mM Tris, pH 7.5, 120 mM NaCl, 1 mM EDTA, 1% Triton X-100) or EBC buffer (50 mM Tris, pH 7.5, 120 mM NaCl, 0.5% NP-40) was added with protease inhibitors (Complete Mini, Roche) and phosphatase inhibitors (cocktail set I and II, Calbiochem). When analysing mTOR complex formation, cells were lysed using CHAPS buffer to preserve mTOR complex integrity. Under other experimental conditions, WCL were collected using EBC, CHAPS or Triton buffer as indicated. Protein concentrations were measured using Bio-Rad protein assay kit in a spectrophotometer (Beckman Coulter DU-800). To perform immunoprecipitation, same amounts of WCL were incubated with the primary antibodies (1–2 μg) for 4 h at 4 °C. The incubation tubes were added with Protein A/G sepharose beads (GE Healthcare) to incubate for 1 h and washed four times with NETN buffer (20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.5% NP-40) or CHAPS buffer. For western blot analysis, equal amounts of WCL or immunoprecipitate were separated by SDS–PAGE and immunoblotted with indicated antibodies. To examine cell viability, cells were seeded at 3,000 per well in 96-well plates overnight and treated with DMEM medium containing indicated doses of etoposide (Sigma, E1383) or cisplatin (Selleck S1166) for 24 h. The viability was measured using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega), following the manufacturer’s instructions. The indicated tumour cells were plated in six-well plates (300 or 600 cells per well) and maintained for up to 10–12 days. Visible colonies were washed with PBS and fixed with 10% acetic acid/10% methanol for 30 min, and then stained with 0.4% crystal violet/20% ethanol. After washing with distilled water and air-dried, the colonies were quantified and analysed. The anchorage-independent growth capacity of tumour cells was examined by soft agar assays, as described previously9, 10. In brief, each well of six-well plates was coated with the bottom layer noble agar (0.8%). The single tumour cells were seeded into the top layer medium containing 0.4% agar. Specifically, 3 × 104 OVCAR5 cells or 1 × 104 A375 cells were plated in the top layer of each well. The wells were added with 500 μl complete DMEM medium every 3 days. Four weeks later, the cells were stained with iodonitrotetrazolium chloride and visible colonies were counted. The assays were performed in triplicates. All animal experiments were approved by the Beth Israel Deaconess Medical Center IACUC Committee review board. GβL-depleted OVCAR5 cells stably expressing HA-GβL or HA-GβL(KRKR) were mixed with matrigel (1:1) and inoculated into the flank of female nude mice (2.5 × 106 cells per injection, 6 mice for each group). Alternatively, GβL-depleted A375 cells stably expressing HA-GβL or HA-GβL(ΔW297) were injected subcutaneously into female nude mice (5 × 106 cells per mice and 7 mice for each cell line). After tumour establishment, the palpable xenograft nodules were measured for the longest diameter (L) and the shortest diameter (W) every three days using a calliper. The tumour volumes were calculated with the formula: L × W2 × 0.5. After indicated days, the mice were killed humanely. None of the xenograft tumours reached the maximal tumour volume permitted by the institutional IACUC Committee. The xenograft tumours were dissected and weighted. Otud7b−/− mice were generated in B6.129sv genetic background and subsequently backcrossed for four generations to the C57BL/6 background29. KrasLA2 mice (in B6.129s2 background) were described previously44 and provided by the NCI Mouse Repository. The KrasLA2 mice develop tumours in the lung as a result of spontaneous recombination that generates the oncogenic Kras mutant KrasG12D. Otud7b+/− heterozygous mice were crossed with KrasLA2 mice to generate age-matched Otud7b+/+KrasLA2 and Otud7b−/−KrasLA2 mice for experiments. Mice were maintained in specific-pathogen-free facility of the University of Texas MD Anderson Cancer Center, and the experiments were performed according to the Institutional Animal Care and Use Committee. Age-matched Otud7b+/+KrasLA2 and Otud7b−/−KrasLA2 mice killed humanely at the indicated ages for analyses of lung tumours. Following perfusion with PBS, the lungs were removed and fixed in 10% phosphate-buffered formalin (pH 7.4) for histology analyses. For the survival study, Otud7b+/+ and Otud7b−/− mice with KrasG12D were housed in the animal core facility and the monitored every three days for the indicated time period to calculate survival rate. Haematoxylin and eosin (H&E)-stained lung tissue slides were analysed for tumour numbers and size. Total tissue lysates from the lung or dissected tumours were also prepared and subjected to IB assays. Kaplan–Meier survival curves were generated using the Kaplan–Meier Plotter website for lung cancer (Version 2015, http://kmplot.com)45 and statistical significance was determined by the log–rank test. Gene expression and patient survival data were downloaded from public databases including Gene Expression Omnibus (GEO), European Genome–Phenome Archive (EGA), and The Cancer Genome Atlas (TCGA). The majority of experiments were repeated at least three times to obtain data for indicated statistical analyses. No statistical method was used to calculate sample size. Group variation was not estimated before experiments. The experiments were not randomized in the animal studies and investigators were not blind during experiments and outcome assessment. For western blotting data, representative images from 3–5 biological replicate experiments were shown. For quantification analysis, the original western blot images were quantified using ImageJ software to measure the intensity of some key blots for statistical analysis. The number of mice per group was described in the corresponding figure legends and none of the animals was excluded from the experiment. All quantitative data were presented as mean ± s.d. Results were analysed by a two-tailed unpaired or paired Student’s t-test or two-way ANOVA, as appropriate. *P < 0.05; **P < 0.01; ***P < 0.001. For survival analysis, the Kaplan–Meier survival curves were compared using the log–rank test. Uncropped images for immunoblots are provided in Supplementary Fig. 1. Mouse model data are also provided in the Source Data. All other relevant data are available from the corresponding author upon reasonable request.


Mice were maintained and animal experiments performed according to practices prescribed by the National Institutes of Health at Stanford’s Research Animal Facility (protocol 13565) and by the Institutional Animal Care and Use Committee at OncoMed Pharmaceuticals. Additional accreditation of Stanford and OncoMed Pharmaceuticals animal research facilities was provided by the Association for Assessment and Accreditation of Laboratory Animal Care. Animal experiments were performed unblinded except for allograft and patient-derived xenograft tumour growth measurements which were performed blinded. Immunostaining of sections from animal experiments were performed blinded. The TKO SCLC mouse model bearing deletions in p53, Rb, and p130 has been described10. Mice were maintained on a mixed genetic background composed of C57BL/6, 129/SvJ and 129/SvOla. Endogenous Notch activity in TKO tumours was assessed through a GFP reporter expressed from the endogenous Hes1 promoter (Hes1GFP/+ allele11). We also bred in the Rosa26lox-stop-lox-tdTomato (ref. 30) and Rosa26lox-stop-lox-luciferase (refs 31, 32) Cre-reporter alleles to the TKO model to label tumour cells with tdTomato and luciferase, respectively. SCLC tumours were induced in 7- to 10-week-old mice (with no discrimination by sex of mice) by intratracheal instillation with 4 × 107 plaque-forming units of Adeno-CMV-Cre (Baylor College of Medicine, Houston, Texas, USA) or Adeno-CGRP-Cre (University of Iowa). Tumours were collected for analysis after around 5–7 months for Ad-CMV-Cre or 7–8 months for Ad-CGRP-Cre, unless otherwise stated. In accordance with our animal protocol, mice were euthanized when they showed difficulty breathing, regardless of time point. TKO Hes1GFP/+ mice were treated with the γ-secretase inhibitor DBZ (Selleckchem, S2711) as previously described33. Mice were randomized and injected intraperitoneally once per day with 30 μmol per kg (body weight) of DBZ (or DMSO control) for 5 days, and tumours were collected on day 6 for flow cytometry or fixed for histological analyses. TKO or TKO Hes1GFP/+ mice bearing tumours were randomized for treatment. For acute responses, mice were treated with cisplatin (7.5 mg per kg (body weight), Teva) on day 1, and a combination of cisplatin and etoposide (15 mg per kg (body weight), Novaplus) on days 2 and 4. Lungs were fixed for histological analyses a few hours after the last injection. For longer-term chemotherapy experiments, as we observed high toxicity with etoposide administration, TKO Rosa26LSL-luciferase mice were treated weekly for 3 weeks with saline or 5 mg per kg (body weight) cisplatin only. For subcutaneous tumour growth of GFPneg or GFPhigh cells, 2,000 cells were FACS-sorted and implanted subcutaneously on the lower left and right quadrants of 8- to 10-week-old immunocompromised NOD.Cg-PrkdcscidIL2rgtm1Wjl/SzJ (NSG) mice (no selection for sex of mice). Mice were euthanized and tumours were collected after approximately 2 months. The tumours did not exceed the 1.75 cm diameter limit permitted by our animal protocol. For the human patient-derived xenograft and TKO allograft tumour growth models, NOD.CB17-Prkdcscid/NcrCrl (NOD/SCID, Charles River Laboratories) mice were maintained under pathogen-free conditions and provided with sterile food and water ad libitum. Patient-derived xenograft models were established from patient biopsies provided by Molecular Response (San Diego, California, USA). OMP-LU66 was established at OncoMed Pharmaceuticals. For the subcutaneous xenograft studies, 100,000 OMP-LU66 cells in 100 μl 50% Matrigel (BD Biosciences)/50% Hank’s balanced salt solution supplemented with 2% heat-inactivated fetal bovine serum and 20 mM HEPES (Life Technologies) were implanted into the left flank region of 7- to 8-week-old NOD/SCID mice (no selection for sex of mice) with a 25-gauge needle. Using a human Fab phage display library (HuCAL GOLD, MorphoSys AG34), functional anti-Notch antibodies were discovered from selections against recombinant Notch2 extracellular domain (EGF1-12) containing the ligand-binding site. NOD/SCID mice implanted with OMP-LU66 or TKO allografts were randomized and treated with a control antibody or tarextumab (OMP-59R5, 40 mg per kg (body weight), once every 2 weeks) as a single agent or in combination with the chemotherapy agents carboplatin (25 mg per kg (body weight), once-weekly, Teva) and irinotecan (25 mg per kg (body weight), once-weekly, Pfizer). We used carboplatin and irinotecan (instead of cisplatin and etoposide) for these longer-term studies as they are less toxic, better tolerated by the mice, and have been shown to have similar efficacies as cisplatin and etoposide35, 36. To avoid the side effects of total Notch pathway inhibition in vivo37, 38, we sought to reduce Notch signalling with the Notch2/3 antagonist tarextumab. After approximately four cycles, chemotherapy was discontinued and tarextumab dosing was continued until study completion. Mice with tumour volumes at or exceeding the 2,500 mm3 limit permitted by the Institutional Animal Care and Use Committee were euthanized regardless of time point. Tumours were dissected from the lungs of TKO Hes1GFP/+ mice approximately 5–7 months after tumour induction and digested as previously described39. The antibodies used were CD45-PE-Cy7 (eBioscience, clone 30-F11, 1:100), CD31-PE-Cy7 (eBioscience, clone 390, 1:100), TER-119-PE-Cy7 (eBioscience, clone TER-119, 1:100), CD24-APC (eBioscience, clone M1/69, 1:200), Ncam1 (Cedarlane, clone H28-123-16, 1:100), anti-rat-IgG2a-PE (eBioscience, clone r2a-21B2, 1:200), EpCam (eBioscience, clone G8.8, 1:100), and CD44-APC-Cy7 (BioLegend, clone IM7, 1:100). 7-Aminoactinomycin D (1 μg ml−1; Invitrogen) or DAPI was used to label dead cells. FACS was performed using a 100 μm nozzle on a BD FACSAria II using FACSDiva software. The sequential gating strategy is outlined in Extended Data Fig. 1d. Fluorophore compensation was performed for each experiment using either unstained cells or BD CompBeads (BD Biosciences) stained with individual fluorophore-conjugated antibodies, and compensation was calculated by FACSDiva. Data were analysed using FlowJo software and gates were set on the basis of unstained samples. TKO Hes1GFP/+ mice were injected intraperitoneally with 100 mg per kg (body weight) EdU (5-ethynyl-2′-deoxyuridine; Life Technologies) 8 h before euthanasia. GFPneg and GFPhigh tumour cells were sorted by FACS before being fixed and subject to EdU staining using the Click-iT Plus EdU Pacific Blue flow cytometry assay kit (Life Technologies). Propidium iodide was used to stain for total DNA content and percentage EdU incorporation of GFPneg and GFPhigh cells was analysed using a BD FACSAria II. The extracellular domain of rat Dll4 containing affinity-enhancing G28S, F107L, L206P N118I, I143F, H194Y, and K215E mutations (named Dll4 or Dll4 in the manuscript) was cloned into the pAcGp67A vector and modified with a carboxy (C)-terminal 8× His tag19. Dll4 was expressed using baculovirus by infecting 1 l of Hi-Five cells (Invitrogen) from Trichoplusia ni at a density of 2 × 106 cells per millilitre and harvesting cultures after 72 h. The cultures were centrifuged to remove the cells, and proteins were purified from supernatants by nickel and size-exclusion chromatography. The MigR1-ires-GFP (Ctrl) and MigR1-N1ICD-ires-GFP retroviral vectors were gifts from W. S. Pear (University of Pennsylvania, Philadelphia). For doxycycline-inducible expression, we cloned N1ICD into the pLIX-403 vector (a gift from D. Root, Addgene 41395). For Rest overexpression, we cloned the Nrsf(Rest) fragment from pHR′-NRSF-CITE-GFP (a gift from J. Nadeau, Addgene 21310 (ref. 40)) into the MigR1-ires-GFP or pLIX-403 vectors. Ascl1 (1: CTCCAACGACTTGAACTCTAT; 2: CCACGGTCTTTGCTTCTGTTT) and Rest (1: GTGTAATCTACAATACCATTT; 2: CCCAAGACAAAGACAAGTAAA) short hairpin RNAs (shRNAs) were obtained from the MISSION shRNA library (Sigma-Aldrich). Guide RNA (sgRNA) against Rest (CATCATCTGCACGTACACGA) was designed using the sgRNA Designer (Broad Institute) and cloned into the lentiCRISPR v2 backbone (a gift from F. Zhang, Addgene 52961 (ref. 41)). Except for 293T cells that were grown in DMEM, all cell lines were grown in RPMI-1640 medium supplemented with 10% bovine growth serum (BGS) (Fisher Scientific) and penicillin–streptomycin–glutamine (Gibco). Mouse KP1, KP2, and KP3 and human NJH29 SCLC cell lines were generated in the laboratory and have been described8, 32, 42. GFPneg and GFPhigh cell lines were isolated by FACS from individual mice. Human NCI-H82 and NCI-H889 cells were purchased from the American Type Culture Collection and authenticated by STR analysis. All cell lines tested negative for mycoplasma. Transfections and viral infections were performed as previously described39. For acute analysis of gene expression changes, RNA was isolated from GFPhigh cells FACS-sorted 48 h after transfection with MigR1-N1ICD or Rest-IRES-GFP or the empty vector control. Viral transductions of N1ICD or Rest were used to generate adherent non-NE cells from NE cells, a process taking about 1–2 weeks. The cells were then expanded and collected for immunoblot analyses. For isolation of Rest knockout clones, sgRNA-infected cells were selected with puromycin (2 μg ml−1) for 4 days and single cells were sorted into individual wells in 96-well plates by FACS. After 2 weeks, clones were picked and those with biallelic frameshift mutations resulting in premature truncation of the translated protein were verified by TOPO PCR cloning (Thermo Fisher Scientific) and Sanger sequencing. Tissue culture plates were coated overnight with 200 nM of purified Dll4 in PBS at 4 °C, then washed twice with PBS to remove any unbound ligand before seeding of cells. GFPhigh cell lines were maintained on Dll4-coated dishes. To assay for acute responses to the lost of Notch activation, cells were kept on Dll4-coated plates or seeded on plates without Dll4 and collected 72 h later for analyses. GFPneg cell lines were maintained on non-Dll4-coated dishes unless otherwise indicated. To test for Notch ligands expressed by NE SCLC cells, mCherry-labelled NE (KP1 and KP3) cells were co-cultured with GFPhigh cell lines at a 3:1 ratio with 10 μM DBZ or DMSO control without exogenous Dll4. This ratio was based on the average number of GFPneg and GFPhigh cells in TKO Hes1GFP/+ tumours (27.7% GFPhigh cells ≈ 3:1 ratio). Median GFP fluorescence intensity of mCherry-negative, GFPhigh cells was quantified by flow cytometry after 72 h. For Dll4 stimulation of human cell lines (suspension), plates were coated overnight with 400 nM Dll4 in PBS at 4 °C. Plates were washed twice with PBS, coated with 0.01% poly-d-lysine (Sigma-Aldrich) for an hour at 37 °C and then washed twice with PBS before seeding of cells. For GFPneg ex vivo assays, DBZ was added at a concentration of 10 μM and tarextumab at 100 μg ml−1. Cells were analysed after 2 weeks by flow cytometry for the generation of GFPhigh cells. Fifty thousand GFPneg, GFPhigh or bulk tumour cells (mixture of GFPneg and GFPhigh) were sorted from TKO Hes1GFP/+ tumours, resuspended in 100 μl of modified DMEM/F12 medium containing 50% Matrigel as previously described43 and then layered with 200 μl of medium. Overall survival was assayed 1 week later by incubating with AlamarBlue (Thermo Fisher Scientific) for 4 h. Supernatant was removed and fluorescence of the Matrigel layer was read by a fluorescence plate reader (excitation 560 nm, emission 590 nm). For immunostaining, the Matrigel layer was fixed overnight with 10% formalin in PBS then washed twice with PBS before being embedded in histogel and subjected to processing for paraffin embedding. For co-culture cell growth assays, NE mouse SCLC cells (KP1, KP2) were labelled with firefly luciferase and enhanced GFP by lentiviral infection. These cells were then mixed with GFPhigh cells at a 3:1 ratio (12,000 NE cells + 4,000 GFPhigh cells) in 96-well white bottom plates. Luciferase activity was assayed 72 h later by the Steady-Glo luciferase assay system (Promega) according to the manufacturer’s protocol. For conditioned medium assays, 0.5 × 106 GFPhigh cells were seeded overnight in 6-cm dishes. The medium was then changed and conditioned medium collected after 24 h. Twelve thousand NE cells per well of a 96-well plate were resuspended in conditioned medium and luciferase activity was assayed 72 h later. Conditioned medium from NE cells was used as the control, although in preliminary experiments we did not notice any difference in luciferase activity between NE-conditioned medium and regular medium. For co-culture EdU assays, unlabelled KP1 and KP2 were co-cultured with GFPhigh cells at a 3:1 ratio (150,000 NE cells + 50,000 GFPhigh cells) in 12-well plates for 72 h and then incubated with 10 μM EdU (Life Technologies) for 3 h. Both floating and adherent populations were collected and subject to EdU staining using a Click-iT Plus EdU Pacific Blue flow cytometry assay kit (Life Technologies). Twenty thousand NE or 4,000 GFPhigh cells were seeded per well of a 96-well plate in RPMI medium with 2% BGS. One microlitre of drug solution was added per well the next day at the appropriate concentration and cell viability was assayed 48 h later by the MTT assay (Roche). Twenty thousand NE cells were seeded per well of a 96-well plate in RPMI medium with 2% BGS in the presence of the recombinant proteins. Cell viability was assayed after 72 h by the AlamarBlue assay. The following recombinant proteins were used: Midkine (OriGene TP723299, 50 ng ml−1), Betacellulin (BioLegend 551302, 5 ng ml−1), Gdf15 (MyBioSource MBS205834, 25 ng ml−1), Bmp4 (BioLegend 595301, 50 ng ml−1), Ephrin A1 (BioLegend 755002, 50 ng ml−1), SCF (BioLegend 579702, 50 ng ml−1), and Fstl1 (R&D Systems 1738-FN-050, 200 ng ml−1). One and a half million NE cells or 0.5 × 106 GFPhigh cells were seeded per well of a 12-well plate in RPMI medium with 2% BGS. Supernatant was collected after 24 h, centrifuged at 1,500 r.p.m. for 10 min and assessed for the presence of midkine by an ELISA (LifeSpan Biosciences, LS-F5765) according to the manufacturer’s instructions. Data were analysed using http://www.elisaanalysis.com/. Tissues were fixed overnight with 10% formalin in PBS before processing for paraffin embedding. For IHC, paraffin sections were stained as previously described8. In brief, a citrate-based solution (Vector Laboratories) was used for antigen retrieval. DAB (Vector Laboratories) and haematoxylin were used for staining development and counterstaining, respectively. The primary antibodies used were Hes1 (CST 11988, 1:200), Notch2 (CST 5732, 1:200), GFP (Invitrogen A-11122, 1:400), cleaved caspase-3 (CST 9664, 1:200), Ki-67 (BD Biosciences 550609, 1:200), and Ascl1/Mash1 (BD Biosciences, 556604, 1:200). For staining of allograft and xenograft models treated with tarextumab, tissue sections were stained on a Ventana Discovery Ultra instrument (Roche) using Ventana reagents. Sections were treated with Cell Conditioning 1 before addition of antibodies. Antibodies were detected with UltraMap HRP kit and ChromoMAP DAB, then counterstained with haematoxylin. Antibodies used were the same as listed above except Ascl1 (eBioscience 1405794) and Ki67 (Abcam ab16667). For immunofluorescence, paraffin sections were deparaffinized, rehydrated, and unmasked by boiling in Trilogy (Cell Marque 920P-10) for 15 min, then blocked and stained with primary antibodies overnight, or subject to EdU staining (Life Technologies) before blocking and antibody staining. Nuclei were stained with DAPI (Sigma). The following primary antibodies were used: GFP (Rockland 600-101-215, 1:500), Uchl1 (Sigma HPA005993, 1:500), CGRP (Sigma C8198, 1:2,000), synaptophysin (Syp, Neuromics MO20000, 1:100), RFP/Tomato (Rockland 600-401-379, 1:500), phospho-histone H3 (EMD Millipore 06-570, 1:500), and cleaved caspase-3 (CST 9664, 1:100). Quantification of all immunostaining was performed blinded. Hes1pos cells in TKO lung or liver sections or in human tissue microarrays were scored on the basis of the frequency and intensity of Hes1 staining and assigned scores of 0 (no staining), 1 (staining in 1–20% of cells), 2 (staining in 20–60% of cells or strong intense staining in <20% of cells), or 3 (>60% staining). Human SCLC tissue microarrays were purchased from US Biomax (LC245, LC802a, LC818), containing a total of 172 cores from 139 patients. H scores were calculated as the summation of (1 + i)p where i is the intensity score and p is the percentage of the cells with that intensity. The frequency of Hes1pos cells in TKO sections after chemotherapy was quantified from IHC staining using the ImageJ plugin, ImmunoRatio44. The percentage of CC3pos cells in GFPneg or GFPhigh cells after acute chemotherapy of TKO Hes1GFP/+ mice was quantified from immunofluorescence images by ImageJ. For studies with human patient-derived xenograft and allograft tumour models performed at OncoMed Pharmaceuticals, slides were scanned using an Aperio AT scanner, then analysed using Definiens Tissue Studio image analysis software. Positively stained cells within tumours were identified and quantitated for staining intensity and frequency. For quantification in Extended Data Fig. 10f–m, some samples were excluded because the paraffin blocks did not have any tissue samples left to be cut (since the tumours were harvested at or close to minimum residual disease, the amount of tissue obtained was small). This exclusion due to unforeseen experimental limitations was not pre-established. The study was approved by the institutional review board of the East Paris University Hospitals Tumour Bio-bank, AP-HP, Tenon Hospital, Paris, France (AP-HP – GH-HUEP Tumorothèque Bio-bank platform). Seventy-three patients diagnosed with SCLC at Hôpital Tenon, Assistance Publique-Hôpitaux de Paris, France, from January 2010 to January 2013 were first identified. Tumour samples were obtained after getting written informed consent. We performed HES1 IHC for 68 of the patients from whom formaldehyde-fixed and paraffin-embedded tumour tissue was available. The tumour samples were first reviewed by at least two independent expert pathologists and the diagnosis of SCLC was histomorphologically confirmed by haematoxylin and eosin staining and IHC for chromogranin A, synaptophysin, NCAM and TTF1. Clinical and biological characteristics of the patients are provided in the Supplementary Methods. For survival analysis, the patients were separated into two groups on the basis of the absence (Hes1-negative) or presence (Hes1-positive) of HES1 immunostaining in their tumours. Human plasma samples from cancer-free normal donors were purchased from BioreclamationIVT. SCLC donor plasma was sourced from Conversant Biologics (Conversant Bio). The samples were collected, processed, and distributed in accordance with institutional review board approval following informed patient consent. Plasma samples were assayed by following the Luminex assay protocol with adaption of the Drop Array system (Curiox Biosystems, Luminex, Austin, Texas, USA). In brief, wells in the DropArray assay plate were blocked with 10 μl 1% BSA/PBS for 30 min at room temperature. Standards were prepared according to manufacturer’s instructions. Bead mix (5 μl) was added to all wells. Five-microlitre standards or diluted samples were then added to the plate; all standard and human plasma samples were tested in duplicate wells. The plate was shaken for 10 s at 1,000 r.p.m. then placed on a magnetic stand in a humidified chamber and shaken overnight at 4 °C. The plate was washed three times with a DropArray LT washing station MX96 (Curiox Biosystems). The detection antibody was added at 5 μl per well and the plate was incubated for 60 min. Five microlitres per well of the streptavidin-PE substrate was added to each well and incubated for 30 min with shaking. The plate was washed three times before reading by Luminex 200 instrument. Data were analysed using EMD Millipore’s Milliplex Analyst software. The standard curve readings were back-calculated and evaluated for accuracy (80–120%) and precision (percentage coefficient of variation of duplicates <30%). Cells were lysed in a modified RIPA buffer (1% NP40, 0.3% SDS, 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1% sodium deoxycholate, 30 mM NaF, 20 mM Na P O , 1 mM NaVO , 1 mM DTT, 60 mM β-glycerophosphate) supplemented with protease inhibitors aprotinin (10 μg ml−1), leupeptin (10 μg ml−1), and PMSF (1 mM). Protein concentration was measured with a Pierce BCA protein assay kit (Thermo Scientific). The antibodies used were Notch1 (Cell Signaling Technology (CST) 4380), cleaved Notch1 (CST 4147), Notch2 (CST 5732), Hes1 (CST 11988), GFP (Invitrogen A-11122), Rest (Abcam 21635), alpha-tubulin (Sigma T9026), and HSP90 (CST 4877). For analysis of primary tumour cells, cells were sorted from pooled tumours from individual TKO Hes1GFP/+ mice by FACS. DNA and RNA were isolated using a Qiagen Allprep DNA/RNA micro kit or an RNeasy mini kit according to the manufacturer’s protocol. qRT–PCR analysis was performed on an Applied Biosystems 7900HT Fast Real-Time PCR System using PerfeCTa SYBR Green FastMix (Quanta BioSciences 95073). Genes having C values that were high (>34) or undetermined (for example, Notch4) were removed from the graphical analyses. Data were normalized to Rplp0 as a housekeeping gene, unless otherwise stated. Primer sequences are available in Supplementary Methods. RNA from cells isolated by FACS from three TKO Hes1GFP/+ mice (independent of the samples used for qRT–PCR) was subjected to quality assessment and microarray analysis by the Stanford Protein and Nucleic Acid (PAN) facility as previously described8. The microarray was performed using a GeneChip Mouse Gene 2.0 ST Array (Affymetrix), and the Robust Multichip Average (RMA) Express 1.1.0 program was used for background adjustment and quantile RMA normalization of the 41,345 probe sets encoding mouse genome transcripts. Linear models for microarray data (Limma) was used to compare GFPneg and GFPhigh cells on RMA normalized signal intensities. The command prcomp in R was used for principal component analysis. Probe identifiers were annotated with gene symbols from the mouse gene 2.0 ST transcript cluster database (mogene20sttranscriptcluster.db). Of the 41,345 probe sets, 25,349 were annotated to genes, which were then used for gene set enrichment analysis45, 46. Default parameters were used except that we performed gene set permutation instead of phenotype permutation because there were fewer than seven samples per phenotype. Probes with an adjusted P value of 0.05 or less were considered as significantly differentially expressed. Seven thousand and ninety-six probes annotated to 5,437 genes (5,289 unique) were significant, and a heatmap for these genes was generated using the heatmap.2 function in R. Significantly differentially expressed genes were also analysed by Enrichr47, 48. To identify candidate transcription factors that might mediate the NE to non-NE switch, we used genes significantly downregulated in GFPhigh cells to search for enriched ENCODE and ChEA consensus transcription factors from the ChIP-X database. To identify a list of secreted factors, we first looked at genes that were classified in the ‘extracellular space’ gene signature and, by literature search, picked out the genes known to be secreted. We also input all significant genes into the ontology search tool in the BIOBASE Knowledge Library49, 50, and the output ontologies and gene descriptions were manually screened for secreted factors. We do not exclude the possibility that we might have missed some secreted factors that are not yet well curated in public databases. Candidates for testing in an NE cell growth assay were selected on the basis of expression fold changes and known biology. Single cells were sorted into individual wells in a 96-well PCR plate containing 5 μl of 2× reaction mix (CellsDirect One-Step qRT–PCR kit, Invitrogen) with two units of SUPERase In RNase Inhibitor (Thermo Fisher Scientific). Primers were designed and purchased from Fluidigm through the D3 assay design system. Primers were pooled, and reverse transcription and pre-amplification was performed at a final concentration of 50 nM for each primer pair using the following PCR protocol: 15 min at 50 °C, 2 min at 95 °C, 20 cycles of 15 s at 95 °C, and 4 min at 60 °C, 15 min at 4 °C. The complementary DNA (cDNA) products were treated with Exonuclease I (New England Biolabs) to remove unincorporated primers and then diluted fivefold for the final reaction. cDNA (2.25 μl), 2.5 μl 2× SsoFast EvaGreen Supermix with low ROX (Bio-Rad 172-5211) and 0.25 μl 20× DNA Binding Dye sample loading reagent (Fluidigm 100-3738) were mixed and loaded into a 48.48 or 96.96 Dynamic Array integrated fluidic circuit chip. Of each 100 μM primer pair, 0.25 μl was mixed with 2.5 μl 2× Assay Loading reagent (Fluidigm 85000736) and 2.25 μl TE buffer with low EDTA (Affymetrix 75793) and loaded into the integrated fluidic circuit. The chip was run on a Biomark machine according to the manufacturer’s protocol for EvaGreen probes. As established before the experiment, cells with high or undetectable C values (that is, low expression) for the housekeeping genes (Gapdh, Hsp90ab1, Actb) were excluded from the heatmaps. One nanogram of DNA was used for each multiplex PCR reaction to detect the unrecombined (floxed) and recombined (delta, Δ) Rb, p53, and p130 alleles. A Rb/p53/p130 (TKO) knockout cell line was a positive control for recombined alleles; DNA isolated from a mouse tail was a negative control. The reverse was true for the unrecombined alleles. Primer sequences are provided in the Supplementary Methods. Cells were fixed and ChIP was performed as previously described51. In brief, doxycycline-inducible cells were fixed after 48 h of doxycycline treatment. For N1ICD ChIP, KP1-pLIX-N1ICD cells were induced with 0.125 μg ml−1 of doxycycline and fixed with 2 mM disuccinimidyl glutarate (Thermo Scientific) in PBS for 30 min before formaldehyde fixation. For Rest ChIP, KP1-pLIX-Rest cells were induced with 0.5 μg ml−1 of doxycycline. The antibodies used were Notch1 (CST 3608), rabbit IgG (CST 2729), and Rest (Millipore 17-641). Primer sequences are provided in the Supplementary Methods. Sample sizes were chosen on the basis of our experience with similar experiments (a minimum of three to five mice for animal studies, or two to four biological replicates for in vitro/ex vivo assays, usually ensured statistical significance if the phenotypes were robust). Statistical significance was assayed by Student’s t-test with GraphPad Prism (two-tailed unpaired or paired t-test, depending on the experiment). *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; NS, not significant. Variance was examined by an F-test. Data are represented as mean ± s.d. unless otherwise stated. For analysis of patient survival data, we used a weighted log-rank test in the OASIS web-based tool52 with greater emphasis on late time-point differences (rho: 0; gamma: 1). Microarray data are available at the NCBI Gene Expression Omnibus under accession number GSE81170. Normalized values for significantly differentially expressed genes are provided in Supplementary Table 1; gene set enrichment analyses are in Supplementary Tables 2–4. HES1 immunostaining and survival data of patients with SCLC are provided in Supplementary Table 5. For immunoblot Source Data, see Supplementary Fig. 1. Source Data are provided for Figs 1b, d and Extended Data Figs 4c, 5j, 6c, 8s, 9c–d, f and 10c, f–m, o. All other data are available from the corresponding author upon reasonable request.

Loading BioLegend Inc. collaborators
Loading BioLegend Inc. collaborators