Entity

Time filter

Source Type

San Jose, CA, United States

News Article
Site: http://www.nature.com/nature/current_issue/

All conditional Foxo1- and Myc-mutant mice were on a C57BL/6 genetic background and generated as described16, 18, 24, 25. For constitutive Cre-mediated recombination in ECs, Foxo1fl/fl or Rosa26-Foxo1CA mice were bred with Tie2-cre transgenic mice31. To avoid recombination in the female germline, only Tie2-cre-positive male mice were used for intercrossing. Embryos were collected from cre-negative females at the indicated time points and genotyping was performed from isolated yolk sacs. For inducible Cre-mediated recombination in ECs, floxed mice were bred with transgenic mice expressing the tamoxifen-inducible, Pdgfb promoter-driven creERT2 recombinase32. The degree of Cre-mediated recombination was assessed with the double-fluorescent Cre-reporter Rosa26-mT/mG33 allele, which was crossed into the respective mutant mice. For the analysis of angiogenesis in the postnatal mouse retina, Cre-mediated recombination was induced in newborn mice by intraperitoneal (i.p.) injections of 25 μl 4-hydroxy-tamoxifen (4-OHT; 2 mg ml−1; Sigma-Adrich) from postnatal day (P)1 to P4. Eyes were harvested at P5 or P21 for further analysis. In mosaic recombination experiments, 4-OHT (20 μl g−1 body weight of 0.02 mg ml−1) was injected i.p. at P3 and eyes were collected at P5. To induce Cre-mediated recombination in mouse embryos, 100 μl of 4-OHT (10 mg ml−1) was injected i.p. into pregnant females from embryonic day (E)8.5 to E10.5. Embryos were harvested at E11.5 for the analysis of angiogenesis in the embryonic hindbrain. The Rosa26-Foxo1CA, Rosa26-Myc and Rosa26-mT/mG alleles were kept heterozygous for the respective transgene in all experimental studies. Apart from the mosaic studies, control animals were littermate animals without cre expression. Male and female mice were used for the analysis, which were maintained under specific pathogen-free conditions. Experiments involving animals were conducted in accordance with institutional guidelines and laws, following protocols approved by local animal ethics committees and authorities (Regierungspraesidium Darmstadt). To analyse blood vessel growth in the postnatal retina, whole mouse eyes were fixed in 4% paraformaldehyde (PFA) on ice for 1 h. Eyes were washed in PBS before the retinas were dissected and partially cut into four leaflets. After blocking/permeabilization in 2% goat serum (Vector Laboratories), 1% BSA and 0.5% Triton X-100 (in PBS) for 1 h at room temperature, the retinas were incubated at 4 °C overnight in incubation buffer containing 1% goat serum, 0.5% BSA and 0.25% Triton X-100 (in PBS) and the primary antibody. Primary antibodies against the following proteins were used: cleaved caspase 3 (Cell Signaling Technology, #9664, 1:100), collagen IV (AbD Serotec, #2150-1470, 1:400), ERG 1/2/3 (Abcam, #ab92513, 1:200), FOXO1 (Cell Signaling Technology, #2880, 1:100), GFP (Invitrogen, #A21311, 1:100), ICAM2 (BD Biosciences, #553326, 1:200), MYC (Millipore, 06-340, 1:100), PECAM-1 (R&D Systems, AF3628, 1:400), phospho-histone H3 (Chemicon, #06-570, 1:100), TER119 (BD Biosciences, #553670, 1:100), and VE-cadherin (BD Biosciences, #555289, 1:25). After four washes with 0.1% Triton X-100 in PBS (PBST), retinas were incubated with Alexa-Fluor 488-, Alexa-Fluor 555- or Alexa-Fluor 647-conjugated secondary antibodies (Invitrogen, 1:400) for 2 h at room temperature. For staining ECs with isolectin B4 (IB4), retinas were washed with PBLEC buffer (1 mM CaCl , 1 mM MgCl , 1 mM MnCl and 1% Triton X-100 in PBS) and incubated with biotinylated IB4 (Griffonia simplicifolia, #B1205, Vector Laboratories, 1:100) diluted in PBLEC buffer. After washing, retinas were incubated in Alexa-Fluor-coupled streptavidin (Invitrogen, #S21374, 1:200) for 2 h at room temperature. For nuclear counterstain, retinas were incubated with 4′,6-diamidino-2-phenylindole (DAPI; Sigma Aldrich, #D9542, 1:1,000) for 15 min following washes with PBST and PBS. The labelling of proliferating cells with BrdU was performed in P5 pups. In brief, 50 mg kg−1 of BrdU (Invitrogen, #B23151) per pup was injected i.p. 3 h before they were killed. Retinas were fixed for 2 h in 4% PFA and then incubated for 1 h in 65 °C warm formamide, followed by an incubation of 30 min in 2 N HCl. Afterwards retinas were washed twice with 0.1 M Tris-HCl (pH 8) and then blocked in 1% BSA, 0.5% Tween 20 in PBS and incubated overnight at 4 °C with a mouse anti-BrdU antibody (BD Biosciences, #347580, 1:50). The detection was performed with Alexa-Fluor-488 anti-mouse secondary antibody (Invitrogen, A21202, 1:400). After the BrdU staining, retinas were processed for the IB4 staining as described earlier. The dissection of the embryonic hindbrain was performed as described34. After overnight fixation in 4% PFA, dissected hindbrains were incubated in a blocking solution containing 10% serum, 1% BSA and 0.5% Triton X-100 in PBS at 4 °C. After washes with PBS, hindbrains were incubated for 1 h in PBLEC buffer before the overnight incubation with Alexa-Fluor-conjugated IB4 (Invitrogen, #I21411, 1:100 in PBLEC) at 4 °C. Hindbrains were washed with PBS and stained with DAPI. Retinas and embryonic hindbrains were flat-mounted with Vectashield (Vector Laboratories) and examined by confocal laser microscopy (Leica TCS SP5 or SP8). Immunostainings were carried out in tissues from littermates and processed under the same conditions. HUVECs were seeded on glass-bottom culture dishes (Mattek) and cultured at 37 °C and 5% CO . To detect autophagy, cells were washed and fixed with 4% PFA for 20 min at room temperature. Permeabilization was performed in 1% BSA, 10% donkey serum and 0.5% Tween-20 in PBS. Cells were stained for anti-LC3A/B (Cell Signaling Technology, #12741, 1:400), Phalloidin-TRITC (Sigma Aldrich, #P1951, 1:500) and DAPI in incubation buffer (0.5% BSA, 5% donkey serum and 0.25% Tween-20 in PBS). After washes with PBST, samples were incubated with Alexa-Fluor-conjugated secondary antibodies (Invitrogen, 1:200). Cells were washed and mounted in VectaShield. As a positive control, HUVECs were treated with 50 μM chloroquine overnight before fixation. Stained tissue/cells were analysed at high resolution with a TCS SP8 confocal microscope (Leica). Volocity (Perkin Elmer), Fiji/ImageJ, Photoshop (Adobe) and Adobe Illustrator (Adobe) software were used for image acquisition and processing. For all of the images in which the levels of immunostaining were compared, settings for laser excitation and confocal scanner detection were kept constant between groups. All quantifications were done on high-resolution confocal images of thin z-sections of the sample using the Volocity (Perkin Elmer) software. In the retina, endothelial coverage, the number of endothelial branchpoints, and the average vessel branch diameter were quantified behind the angiogenic front in a region between an artery and a vein. In the embryonic hindbrain, randomly chosen fields were used to quantify the vascularization in the ventricular zone. All parameters were quantified in a minimum of four vascularized fields per sample. Endothelial coverage was determined by assessing the ratio of the IB4-positive area to the total area of the vascularized field (sized 200 μm × 200 μm), and expressed as a percentage of the area covered by IB4-positive ECs. Average vessel diameter was analysed by assessing the diameter of individual vessel branches in a vascularized field (sized 200 μm × 200 μm), which was used to calculate the mean diameter in each field. The diameter of individual vessel branches was averaged from three measurements taken at the proximal, middle and distal part of the vessel segment. The number of filopodial extensions was quantified at the angiogenic front. The total number of filopodia was normalized to a vessel length of 100 μm at the angiogenic front, which was defined and measured according to published protocols35. For quantifying vascular outgrowth in the mouse retina, the distance of vessel growth from the centre of the optic nerve to the periphery was measured in each leaflet of a dissected retina, which was used to calculate the mean value for each sample. The number of ERG/IB4- and BrdU/IB4-labelled cells was counted in at least four fields sized 200 μm × 200 μm per sample. Because of the lower incidence of pHH3-positive ECs, the number of pHH3/IB4- double-positive cells was quantified in larger fields (sized 580 μm × 580 μm). For the quantification of the mosaic control (Pdgfb-creERT2;Rosa26-Foxo1+/+;Rosa26-mTmGfl/+) and Foxo1iEC-CA (Pdgfb-creERT2;Rosa26-Foxo1CA/+;Rosa26-mTmGfl/+) retinas, the GFP/IB4 double-positive area per field was determined and divided by the total IB4-positive area. The percentage of the GFP/IB4 double-positive area per total IB4 area was measured in four fields (400 μm × 400 μm) per sample and used to calculate the mean value. For the quantification of nuclear FOXO1 expression in control and Foxo1iEC-CA mice, high-resolution confocal images were taken with a ×40 objective. The resulting images were analysed with the Bitplane Imaris software. Vessels were first segmented using the Surface module in Imaris. FOXO1 immunofluorescence was then used to set a threshold in the new vascular surface area, in which only CD31-positive nuclei were selected (Surface module). The sum intensity of the nuclear FOXO1 fluorescence was divided by the total vascular area to adjust for differences in vascular density on each image. An average of six images per sample was quantified in three animals per group. All of the images shown are representative of the vascular phenotype observed in samples from at least two distinct litters per group. Pooled HUVECs were purchased from Lonza and authenticated by marker expression (CD31/CD105 double-positive) and morphology. HUVECs were cultured in endothelial basal medium (EBM; Lonza) supplemented with hydrocortisone (1 μg ml−1), bovine brain extract (12 μg ml−1), gentamicin (50 μg ml−1), amphotericin B (50 ng ml−1), epidermal growth factor (10 ng ml−1) and 10% fetal bovine serum (FBS; Life Technologies). HUVECs were tested negative for mycoplasma and cultured until the fourth passage. The isolation of mouse lung ECs was performed as described36. In brief, adult mice were killed, lungs were removed and incubated with dispase. The homogenate was filtered through a cell strainer, collected by centrifugation, and washed with PBS containing 0.1% BSA (PBSB). The resulting cell suspension was incubated with rat anti-mouse VE-cadherin antibody- (BD Pharmingen, #555289) coated magnetic beads (Dynabeads, Invitrogen, #11035). Next, the beads were washed with PBSB and then resuspended in DMEM/F12 (Invitrogen) supplemented with 20% FCS, endothelial growth factor (Promocell, #C-30140), penicillin and streptomycin. The isolated cells were seeded on gelatin-coated culture dishes and re-purified with the VE-cadherin antibody during the first three passages. Sub-confluent HUVECs were infected with adenoviruses to overexpress constitutively active human FOXO1–Flag (FOXO1CA)37, human c-MYC–HA38 (Vector Biolabs) and GFP or LacZ as a control. HUVECs (70–80% confluent) were incubated in EBM containing 0.1% BSA for 4 h. Prior to infection, adenoviruses were incubated with an antennapedia-derived peptide (Eurogentec) to facilitate the infection. The mixture was then applied to the HUVECs cultured in EBM containing 0.1% BSA and incubated for 4 h. Thereafter, the cells were washed five times and cultured in EBM with 10% FCS and supplements. The adenoviral infection of murine ECs was performed with adenoviruses encoding for Cre or GFP (Vector Biolabs) as a control. To silence FOXO1, MYC or MXI1 gene expression, HUVECs were transfected with a pool of siRNA duplexes directed against human FOXO1, human c-MYC or human MXI1 (ON-TARGETplus SMARTpool, Dharmacon). A negative control pool of four siRNAs designed and microarray-tested for minimal targeting of human, mouse or rat genes was used as a control (ON-TARGETplus Non-targeting pool, Dharmacon). HUVECs were transfected with 50 nM of the indicated siRNAs using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s recommendations. Total RNA quality was verified using the Agilent Bioanalyser and the 6000 nano kit. RNA was labelled according to the Affymetrix Whole Transcript Sense Target Labelling protocol. Affymetrix GeneChip Human Gene 1.0 ST arrays were hybridized, processed and scanned using the appropriate Affymetrix protocols. Data were analysed using the Affymetrix expression console using the RMA algorithm, statistical analysis was done using DNAStar Arraystar 11. Heat maps were generated using GENE-E, publicly available from the Broad Institute (http://www.broadinstitute.org/cancer/software/GENE-E/). For gene set enrichment analysis (GSEA), gene set collections from the Molecular Signatures Database (MSigDB) 4.0 (http://www.broadinstitute.org/gsea/msigdb/) were used for the analysis of the endothelial FOXO1 and MYC transcriptomes. RNA was extracted from cells using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was performed on 2 μg of total RNA using the M-MLV reverse transcriptase (Invitrogen). qPCR was performed with TaqMan Gene Expression Master Mix (Applied Biosystems) and TaqMan probes (TaqMan Gene Expression Assays) available from Applied Biosystems. TaqMan Gene Expression Assays used were as follows: human ACTB Hs99999903_m1; CCNB2 Hs00270424_m1; CCND1 Hs00765553_m1; CCND2 Hs00153380_m1; CDK4 Hs00262861_m1; c-MYC Hs00153408_m1; ENO1 Hs00361415_m1; FASN Hs01005622_m1; FBXW7 Hs00217794_m1; FOXO1 Hs01054576_m1; LDHA Hs00855332_g1; LDHB Hs00929956_m1; MXI1 Hs00365651_m1; PKM2 Hs00987254_m1. Mouse probes were: Actb Mm 00607939_s1; Myc Mm00487804_m1. All qPCR reactions were run on a StepOnePlus real-time PCR instrument (Applied Biosystems) and data were calculated using the ∆∆C method. Western blot analyses were performed with precast gradient gels (Bio-Rad) using standard methods. Briefly, HUVECs were lysed in RIPA buffer (150 mM NaCl, 1.0% IGEPAL CA-630, 0.5% sodium deoxycholate, 0.1% SDS and 50 mM Tris, pH 8.0) supplemented with a protease inhibitor mix (Complete Mini Protease Inhibitor cocktail tablets, Roche) and phenylmethylsulfonyl fluoride. Proteins were separated by SDS–PAGE and blotted onto nitrocellulose membranes (Bio-Rad). Membranes were probed with specific primary antibodies and then with peroxidase-conjugated secondary antibodies. The following antibodies were used: AMPKα (Cell Signaling Technology, #2532, 1:1,000), caspase 3 (Cell Signaling Technology, #9662, 1:1,000), cleaved caspase 3 (Asp175) (Cell Signaling Technology, #9664, 1:1,000), cleaved PARP (Cell Signaling Technology, #5625, 1:1,000), c-MYC (Cell Signaling Technology, #9402, 1:1,000), FBXW7 (Abcam, #12292, 1:500), Flag M2 (Sigma, #F-3165, 1:1,000), FOXO1 (Cell Signaling Technology, #2880, 1:1,000), HA (Covance, clone 16B12, MMS-101P, 1:1,000), LC3A/B (Cell Signaling Technology, #12741, 1:1,000), MXI1 (Santa Cruz, SC-1042, 1:500), P-ACC (Cell Signaling Technology, #3661, 1:1,000), P-AMPKα (Thr 172) (Cell Signaling Technology, #2535, 1:1,000), PARP (Cell Signaling Technology, #9532, 1:1,000), Tubulin (Cell Signaling Technology, #2148, 1:1,000). The bands were visualized by chemiluminescence using an ECL detection kit (Clarity Western ECL Substrate, Bio-Rad) and a ChemiDoc MP Imaging System (Bio-Rad). The gel source data of the western blot analysis is illustrated in Supplementary Fig. 1. Quantification of band intensities by densitometry was carried out using the Image Lab software (Bio-Rad). Extracellular acidification (ECAR) and oxygen consumption (OCR) rates were measured using the Seahorse XFe96 analyser (Seahorse Bioscience) following the manufacturer’s protocols. Briefly, ECAR and OCR were measured 4 h after seeding HUVECs (40,000 cells per well) on fibronectin-coated XFe96 microplates. HUVECs were maintained in non-buffered assay medium in a non-CO incubator for 1 h before the assay. The Glycolysis stress test kit (Seahorse Bioscience) was used to monitor the extracellular acidification rate under various conditions. Three baseline recordings were made, followed by sequential injection of glucose (10 mM), the mitochondrial/ATP synthase inhibitor oligomycin (3 μM), and the glycolysis inhibitor 2-deoxy-d-glucose (2-DG; 100 mM). The Mito stress test kit was used to assay the mitochondrial respiration rate under basal conditions, in the presence of the ATP synthase inhibitor oligomycin (3 μM), the mitochondrial uncoupler carbonyl cyanide-4-(trifluoromethoxy)phenyl-hydrazone (FCCP; 1 μM), and the respiratory chain inhibitors antimycin A (1.5 μM) and rotenone (3 μM). To measure glycolysis in ECs, HUVECs were incubated for 2 h in growth medium containing 80 μCi mmol−1 [5-3H]-d-glucose (Perkin Elmer). Thereafter, supernatant was transferred into glass vials sealed with rubber stoppers. 3H O was captured in hanging wells containing a Whatman paper soaked with H O over a period of 48 h at 37 °C to reach saturation4. Radioactivity was determined by liquid scintillation counting and normalized to protein content. Lactate concentration in the HUVEC culture media was measured by using a Lactate Assay Kit (Biovision) following the instructions of the manufacturer. Glucose uptake was assessed by analysing the uptake of 2-DG with a Colorimetric Assay (BioVision). ATP was measured from lysates from HUVECs (1 × 106 per ml) with an ATP Bioluminescence Assay Kit CLS II (Roche) according to the instructions of the manufacturer. Intracellular ROS levels were determined using CM-H DCFDA dye (Life technologies). Dye was reconstituted in DMSO (10 mM) and diluted 1:1,000 in PBS containing CaCl and MagCl as working solution. Twenty-four hours after transduction, 1 × 106 cells were incubated in 1 ml working solution for 40 min at 37 °C in the dark. Subsequently the fluorescence of 10,000 living endothelial cells per sample was measured at the BD FACS LSR II flow cytometer. The assays were performed with adenoviruses, which did not co-express fluorescent reporter genes. Data were analysed using BD FACSDiva software (version 8.0.1). To detect senescence-associated β-galactosidase activity in HUVECs, a cellular senescence assay kit (#KAA002, Chemicon) was used according to the manufacturer’s instructions. Briefly, cells were fixed in 1 ml fixing solution at room temperature for 15 min. Two millilitres of freshly prepared SA-β-gal detection solution was added and cells were incubated overnight at 37 °C without CO and protected from light. Then the detection solution was removed and cells were washed and mounted in 70% glycerol in PBS. H O -treated HUVECs were used as a positive control. Statistical analysis was performed by unpaired, two-tailed Student’s t-test, or non-parametric one-way ANOVA followed by Bonferroni’s multiple comparison test unless mentioned otherwise. For all bar graphs, data are represented as mean ± s.d. P values < 0.05 were considered significant. All calculations were performed using GraphPad Prism software. No randomization or blinding was used and no animals were excluded from the analysis. Sample sizes were selected on the basis of published protocols34, 35 and previous experiments. Several independent experiments were performed to guarantee reproducibility and robustness of findings.


News Article
Site: http://www.nature.com/nature/current_issue/

No statistical methods were used to predetermine sample size. The investigators were not blinded to allocation during experiments and outcome assessment. DNA sequences of plasmids used in this study can be found in the Supplementary Information. sgRNA target sites are available in Supplementary Table 1, and oligonucleotides used in this study can be found in Supplementary Table 2. SpCas9 expression plasmids containing amino acid substitutions were generated by standard PCR and molecular cloning into JDS246 (ref. 4). sgRNA expression plasmids were constructed by ligating oligonucleotide duplexes into BsmBI cut BPK1520 (ref. 15). Unless otherwise indicated, all sgRNAs were designed to target sites containing a 5′ guanine nucleotide. U2OS cells (a gift from Toni Cathomen, Freiburg) and U2OS.EGFP cells (containing a single integrated copy of a reporter gene encoding an EGFP–PEST fusion)30 were cultured in advanced DMEM supplemented with 10% heat-inactivated fetal bovine serum, 2 mM GlutaMax, and penicillin and streptomycin at 37 °C with 5% CO . The growth media for U2OS.EGFP cells was additionally supplemented with 400 μg ml−1 Geneticin. All cell culture reagents were obtained from Life Technologies. Cell line identity was validated by STR profiling (ATCC) and deep-sequencing, and cells were tested bi-weekly for mycoplasma contamination. Unless otherwise noted, cells were co-transfected with 750 ng of Cas9 plasmid and 250 ng of sgRNA plasmid. For negative control experiments, Cas9 plasmids were co-transfected with a U6-null plasmid. Nucleofections were performed using the DN-100 program on a Lonza 4-D Nucleofector with the SE Cell Line Kit according to the manufacturer’s protocol (Lonza). For T7 endonuclease I assays, GUIDE-seq experiments, and targeted deep sequencing, genomic DNA was extracted ~72 h post-transfection using the Agencourt DNAdvance Genomic DNA Isolation Kit (Beckman Coulter Genomics). EGFP disruption experiments, in which cleavage and induction of indels by non-homologous end-joining (NHEJ)-mediated repair within a single integrated EGFP reporter gene leads to loss of cell fluorescence, were performed as previously described4, 30. Briefly, transfected cells were analysed ~52 h post-transfection for loss of EGFP expression using a Fortessa flow cytometer (BD Biosciences). Background EGFP loss was determined using negative control transfections gated at ~2.5% for all experiments (represented as a red dashed line in figures). P values for comparisons between SpCas9 variants were calculated using a one-sided t-test with equal variances and adjusted for multiple comparisons using the method of Benjamini and Hochberg (Supplementary Table 3). To quantify mutagenesis frequencies at desired genomic loci, T7 endonuclease I assays were performed as previously described30. Briefly, on- or off-target sites were amplified from ~100 ng of genomic DNA using Phusion Hot-Start Flex DNA Polymerase (New England Biolabs) using the primers listed in Supplementary Table 2. An Agencourt Ampure XP cleanup (Beckman Coulter Genomics) was performed before the denaturation and annealing of ~200 ng of the PCR product, followed by digestion with T7 endonuclease I (New England Biolabs). Purified digestion products were quantified using a QIAxcel capillary electrophoresis instrument (Qiagen) to approximate the mutagenesis frequencies induced by Cas9-sgRNA complexes. P values for comparisons between SpCas9 variants were calculated using a one-sided t-test with equal variances and adjusted for multiple comparisons using the method of Benjamini and Hochberg (Supplementary Table 3). GUIDE-seq relies on the integration of a short dsODN tag into DNA breaks to enable amplification and sequencing of adjacent genomic sequence, with the number of tag integrations at any given site providing a quantitative measure of cleavage efficiency8. GUIDE-seq experiments were performed and analysed essentially as previously described8. Briefly, U2OS cells were transfected with 750 ng of Cas9 and 250 ng sgRNA plasmids as described above, along with 100 pmol of a GUIDE-seq end-protected dsODN that contains an NdeI restriction site8. Restriction-fragment length polymorphism (RFLP) assays were used to estimate GUIDE-seq tag integration frequencies at the intended on-target sites as previously described15, using the primers listed in Supplementary Table 2. The overall on-target mutagenesis frequencies of GUIDE-seq tag-treated samples was determined by T7 endonuclease I assay as described above. Tag-specific amplification and library preparation8 were performed before high-throughput sequencing on an Illumina MiSeq instrument. GUIDE-seq data was analysed as previously described8 using open-source GUIDE-seq analysis software (http://www.jounglab.org/guideseq) and the summarized results can be found in Supplementary Table 4. Genomic sites were excluded from analysis on the basis of overlap with background genomic breakpoint regions detected in any of four oligo-only control samples, overlap with previously identified Cas9–sgRNA independent breakpoints in human U2OS cells8, or as neighbouring genomic window consolidation artefacts likely due to extensive end-resection around breakpoints (Supplementary Table 4). Potential RNA- or DNA-bulge sites12 (Extended Data Fig. 6) were identified by sequence alignment with Geneious version 8.1.6 (http://www.geneious.com)45. Sequencing data was corrected for U2OS cell-type specific SNPs with the site encoding the smallest edit distance to the intended sgRNA site used as the most likely off-target (Supplementary Table 4). Differences in number of GUIDE-seq identified off-target sites between this work and previous studies8, 15 are likely due to different experimental conditions (for example, different promoters, quantity of plasmids used for transfection) and/or to sampling effects at the limit of detection of these particular experiments (Supplementary Table 4), and most likely not due to depth of sequencing which was similar between experiments. Positional profiles generated from GUIDE-seq data (Extended Data Fig. 4) were made by weighting each nucleotide at each on/off-target site by the number of GUIDE-seq read counts. Sites containing gapped alignments relative to the human genome were not considered. Positional profiles for potential genomic off-target sites were restricted to sequences containing five or fewer mutations relative to the on-target site and to sequences containing NGG PAMs. Heat maps were generated with R 3.2.2 and the image function, with colours determined using the function colorRampPalette(c(“white”, “blue”))(2500). Off-target sites identified by GUIDE-seq were amplified using Phusion High-Fidelity DNA polymerase (New England Biolabs) using the primers listed in Supplementary Table 2 for the genomic amplicons listed in Supplementary Table 5. PCR products were generated for each on- and off-target site from ~100 ng of genomic DNA extracted from U2OS cells. Products were generated from triplicate transfections for each of three experimental conditions: (1) control (wild-type SpCas9 + pSL695, a control plasmid that contains a U6 promoter but does not encode a functional sgRNA), (2) wild-type SpCas9 + sgRNA, and (3) SpCas9-HF1 + sgRNA. PCR products were purified with Ampure XP magnetic beads (Agencourt), normalized in concentration, and pooled into nine samples (individual triplicate experiments for each of the three conditions listed above). Illumina Tru-seq compatible deep-sequencing libraries were prepared using ~500 ng of each pooled sample using a ‘with-bead’ HTP library preparation kit (KAPA BioSystems), and sequenced via 150-bp paired-end sequencing on an Illumina MiSeq instrument. High-throughput sequencing data was analysed essentially as previously described18. Breifly, paired reads were mapped to the human genome (reference sequence GRChr37) using the bwa mem algorithm with default parameters. High-quality reads (average quality score ≥30) were analysed for the presence of two or more bp indels that overlapped to the on- or off-target sites (Supplementary Table 5). One bp indel mutations were only included if they occurred directly adjacent to the predicted cleavage site. P values for comparisons between control, wild-type SpCas9 + sgRNA, and SpCas9-HF1 + sgRNA (Supplementary Table 5) were obtained on pooled triplicate data using a one-sided Fisher exact test in the R 3.2.2 software package. P values for each set of comparisons were adjusted for multiple comparisons using the method of Benjamini and Hochberg (function p.adjust(method = “BH”) in R). Scripts for GUIDE-seq analysis (v0.9) can be found at http://jounglab.org/guideseq. The scripts used for indel calling on deep sequencing data and GUIDE-seq profiles are available upon request.


News Article
Site: http://www.nature.com/nature/current_issue/

No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were blinded to allocation of mice for assessment of histopathology and readouts of inflammation. E. coli strains were routinely cultured aerobically at 37 °C in lysogeny broth (LB) and on LB agar plates. B. abortus was cultured in tryptic soy broth or on tryptic soy agar (TSA) plates,. Chlamydia muridarum strain Nigg II was purchased from ATCC (Manassas, VA). Bacteria were cultured in HeLa 229 cells in DMEM supplemented with 10% FBS. Elementary bodies (EBs) were purified by discontinuous density gradient centrifugations as described previously23 and stored at −80 °C. The HEK293 cell line was maintained in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% FBS at 37 °C in a 5% CO atmosphere. HEK293 cells (ATCC CRL-1573) were obtained from ATCC and were grown in a 48-well tissue culture plates in DMEM containing 10% FBS until ~40% of confluency was reached. HEK293 cells were transfected with a total of 250 ng of plasmid DNA per well, consisting of 25 ng of the reporter construct pNF-κB-luc, 25 ng of the normalization vector pTK-LacZ, and 200 ng of the different combinations of mammalian expression vectors carrying the indicated gene (empty control vector, pCMV-HA-VceC5, pCMV-HA-TRAF2DN (this study), hNOD1-3×Flag, hNOD2-3×Flag, pCMV-HA-hRip2, hNOD1DN-3×Flag, hNOD2DN-3×Flag or pCMV-HA-Rip2DN24 and pCMV-myc-CDC42DN25. The dominant-negative form of TRAF2, lacking an amino-terminal RING finger domain26, was PCR amplified from cDNA prepared from HEK293 cells and cloned into the mammalian expression vector pCMV-HA (BD Biosciences Clontech). Forty-eight hours after transfection, cells were lysed either without any treatment, or stimulated with C12-iE-DAP (1,000 ng ml−1, InvivoGen) and MDP (10 μg ml−1, InvivoGen). After five hours of treatment the cells were lysed and analysed for β-galactosidase and luciferase activity (Promega). FuGene HD (Roche) was used as a transfection reagent according to the manufacturer’s instructions. Cell lines were monitored for mycoplasma contamination. Bone-marrow-derived macrophages (BMDMs) were differentiated from bone marrow precursors from femur and tibiae of C57BL/6 mice obtained from The Jackson Laboratory (Bar Harbor, ME), Nod1+/−Nod2+/− (wild-type littermates) and Nod1−/−Nod2−/− (NOD1/NOD2-deficient) mice (generated at UC Davis) as described previously27. For BMDM experiments, 24-well microtitre plates were seeded with macrophages at a concentration of 5 × 105 cells per well in 0.5 ml of RPMI media (Invitrogen, Grand Island, NY) supplemented with 10% FBS and 10 mM l-glutamine (complete RPMI) and incubated for 48 h at 37 °C in 5% CO . BMDMs were stimulated with C12-iE-DAP (1,000 ng ml−1, InvivoGen), MDP (10 μg ml−1, InvivoGen), thapsigargin (1 μM and 10 μM, Sigma-Aldrich), dithiothreitol (DTT) (1 mM, Sigma-Aldrich), and LPS (10 ng ml−1, InvivoGen) with or without pre-treatment (30 min) of the cells with IRE1α kinase inhibitor KIRA6 (1 μM, Calbiochem), IRE1α endonuclease inhibitor STF-083010 (50 μM, Sigma-Aldrich), PERK inhibitor GSK2656157 (500 nM, Calbiochem) and tauroursodeoxycholate TUDCA (200 μM, Sigma-Aldrich) in the presence of 1 ng ml−1 of recombinant mouse IFNγ (BD Bioscience, San Jose, CA). After 24 h of stimulation, samples for ELISA and gene expression analysis were collected as described below. Preparation of the B. abortus wild-type strain 2308 and the ∆vceC mutant inoculum and BMDM infection was performed as previously described27. Approximately 5 × 107 bacteria in 0.5 ml of complete RPMI were added to each well containing 5 × 105 BMDMs. Microtitre plates were centrifuged at 210g for 5 min at room temperature in order to synchronize infection. Cells were incubated for 20 min at 37 °C in 5% CO , and free bacteria were removed by three washes with PBS, and the zero-time-point sample was taken as described below. After the PBS wash, complete RPMI plus 50 mg ml−1 gentamicin and 1 ng ml−1 of recombinant mouse IFNγ (BD Bioscience, San Jose, CA) was added to the cells, and incubated at 37 °C in 5% CO . For cytokine production assays, supernatant for each well was sampled at 24 h after infection. In order to determine bacterial survival, the medium was aspirated at the time point described above, and the BMDMs were lysed with 0.5 ml of 0.5% Tween 20, followed by rinsing each well with 0.5 ml of PBS. Viable bacteria were quantified by serial dilution in sterile PBS and plating on TSA. For gene expression assays, BMDMs were suspended in 0.5 ml of TRI-reagent (Molecular Research Center, Cincinnati) at the time points described above and kept at −80 °C until further use. At least three independent assays were performed with triplicate samples, and the standard error of the mean for each time point was calculated. All mouse experiments were approved by the Institutional Animal Care and Use Committees at the University of California, Davis, and were conducted in accordance with institutional guidelines. Sample sizes were determined based on experience with infection models and were calculated to use the minimum number of animals possible to generate reproducible results. C57BL/6 wild-type mice and Rip2−/− mice (The Jackson Laboratory), Nod1+/−Nod2+/− (wild-type littermates) and Nod1−/−Nod2−/− (NOD1/NOD2-deficient) mice (generated at UC Davis) were injected intraperitoneally (i.p.) with 100 μl of 2.5 mg per kg body weight of thapsigargin (Sigma-Aldrich) at 0 and 24 h, and 4 h after the second injection the mice were euthanized and serum and tissues collected for gene expression analysis and detection of cytokines. Where indicated, mice were treated i.p. at 12 h before the first thapsigargin dose and 12 h before the second thapsigargin dose with the ER stress inhibitor TUDCA (250 mg per kg body weight). Female and male C57BL/6, Nod1+/−Nod2+/−, Nod1−/−Nod2−/− mice, and Rip2−/− mice aged 6–8 weeks, were held in micro-isolator cages with sterile bedding and irradiated feed in a biosafety level 3 laboratory. Groups of five mice were inoculated i.p. with 0.2 ml of PBS containing 5 × 105 CFU of B. abortus 2308 or its isogenic mutant ∆vceC, as previously described28. At 3 days post-infection, mice were euthanized by CO asphyxiation and their serum and spleens were collected aseptically at necropsy. The spleens were homogenized in 2 ml of PBS, and serial dilutions of the homogenate were plated on TSA for enumeration of CFU. Spleen samples were also collected for gene expression analysis as described below. When necessary, mice were treated i.p. at day one and two post-infection with a daily dose of 250 mg per kg body weight of the ER stress inhibitor TUDCA (Sigma-Aldrich), or 10 mg per kg body weight of the IRE1α kinase inhibitor KIRA6 (Calbiochem) or vehicle control. For the placentitis mouse model, C57BL/6, Nod1+/−Nod2+/− and Nod1−/−Nod2−/− mice, aged 8–10 weeks, were held in micro-isolator cages with sterile bedding and irradiated feed in a biosafety level 3 laboratory. Female Nod1+/−Nod2+/− mice were mated with male C57BL/6 mice (control mice) and female Nod1−/−Nod2−/− mice were mated with male Nod1−/−Nod2−/− mice (NOD1/NOD2-deficient), and pregnancy was confirmed by presence of a vaginal plug. At 5 days of gestation, groups of pregnant mice were mock infected or infected i.p. with 1 × 105 CFU of Brucella abortus 2308 or its isogenic mutant ∆vceC (day 0). At 3, 7 and 13 days after infection mice were euthanized by CO asphyxiation and the spleen and placenta of dams were collected aseptically at necropsy. At day 13 after infection (corresponding to day 18 of gestation), viability of pups was evaluated based on the presence of fetal movement and heartbeat, and fetal size and skin colour. Fetuses were scored as viable if they exhibited movement and a heartbeat, visible blood vessels, bright pink skin, and were of normal size for their gestational period. Fetuses were scored as non-viable if fetal movement, heartbeat, and visible blood vessels were absent, skin was pale or opaque, and their size for gestational period or compared to littermates was small, or they showed evidence of fetal reabsorption. Percentage of viability was calculated as [(number viable pups per litter/total number pups per litter) × 100]. At each time point, the placenta samples were collected for bacteriology, gene expression analysis and blinded histopathological analysis (Extended Data Fig. 6d). When indicated, mice were treated i.p. at days 5, 7 and 9 post-infection with a daily dose of 250 mg per kg body weight of the ER stress inhibitor tauroursodeoxycholate TUDCA (Sigma-Aldrich) or vehicle control. RNA was isolated from BMDMs and mouse tissues using Tri-reagent (Molecular Research Center) according to the instructions of the manufacturer. Reverse transcription was performed on 1 μg of DNase-treated RNA with Taqman reverse transcription reagent (Applied Biosystems). For each real-time reaction, 4 μl of cDNA was used combined with primer pairs for mouse Actb, Il6, Hspa5 and Chop. Real time transcription-PCR was performed using Sybr green and an ABI 7900 RT–PCR machine (Applied Biosystems). The fold change in mRNA levels was determined using the comparative threshold cycle (C ) method. Target gene transcription was normalized to the levels of Actb mRNA. Cytokine levels in mouse serum and supernatants of infected BMDMs were measured using either a multiplex cytokine/chemokine assay (Bio-Plex 23-plex mouse cytokine assay; Bio-Rad), or via an enzyme-linked immunosorbent assay (IL-6 ELISA; eBioscience), according to the manufacturer’s instructions. Cytotoxicity was determined by using a LDH release assay in supernatant of BMDMs treated as described above. LDH release assay was performed using a CytoTox 96 Non-Radioactive Cytotoxicity Assay (Promega), following manufacturer’s protocol. The percentage of LDH release was calculated as follows: Percentage of LDH release = 100 × (absorbance reading of treated well − absorbance reading of untreated control)/(absorbance reading of maximum LDH release control − absorbance reading untreated control). The kit-provided lysis buffer was used to achieve complete cell lysis and the supernatant from lysis-buffer-treated cells was used to determine maximum LDH release control. HeLa 229 cells (ATCC CCL-2.1) were cultured in 96-well tissue culture plates at a concentration of 4 × 104 cells per well in Dulbecco’s Modified Eagle Medium (DMEM) (Life Technologies, Grand Island, NY) supplemented with 10% FBS. HeLa 229 cells were transfected with a total of 125 ng of pCMV-HA-Rip2DN or empty control vector per well. 24 h post-transfection HeLa 229 cells were treated with Dextran to enhance infection efficacy before they were infected with 1.7 × 105 Chlamydia bacteria per well. The plates were centrifuged at 2,000 r.p.m. for 60 min at 37 °C, then incubated for 30 min at 37 °C in 5% CO Supernatant was discarded and replaced with DMEM containing 1 μg ml−1 cyclohexine (Sigma Aldrich) and where indicated, 1 μM KIRA6, 10 μM thapsigargin or 10 μg ml−1 MDP, was added to cultures before incubation at 37 °C in 5% CO for 40 h. For gene expression assays, HeLa 229 cells were suspended in Tri-reagent (Molecular Research Center, Cincinnati) and RNA was isolated. Infection efficiency was confirmed in separate plates by staining Chlamydia-infected HeLa 229 cells with anti-Chlamydia MOMP antibody and counting bacteria under a fluorescent microscope. Four independent assays were performed and the standard error of the mean calculated. BMDMs stimulated where indicated with 10 μM thapsigargin for 24 h were lysed in lysis buffer (4% SDS, 100 mM Tris, 20% glycerol) and 10 μg of protein was analysed by western blot using antibodies raised against rabbit TRAF2 (C192, #4724, Cell Signaling), rabbit HSP90 (E289, #4875, Cell Signaling), mouse SGT1 (ab60728, Abcam) and rabbit α/β-tubulin (#2148, Cell Signaling). For tissue culture experiments, statistical differences were calculated using a paired Student’s t-test. To determine statistical significance in animal experiments, an unpaired Student’s t-test was used. To determine statistical significance of differences in total histopathology scores, a Mann–Whitney U-test was used. A two-tailed P value of <0.05 was considered to be significant.


News Article
Site: http://www.nature.com/nature/current_issue/

Sample size was not predetermined. For cell electron microscopy, samples were double-blind examined. Other experiments were not randomized or blinded. Box–whisker plots all show median, 25/75 quartiles by box boundaries and minimum/maximum values by errors, with the exception of Fig. 3 and Extended Data Fig. 7 which use Tukey-defined error bars. Human Rab5-6×His and GFP–Rab5-6×His were expressed and purified essentially as previously described in the Escherichia coli expression system6. Human Rabex-5 amino-acid residues 131–394 were PCR and restriction cloned into a pGST-parallel2 vector containing a TEV cleavable N-terminal glutathione-S-transferase (GST)29, 30. Expression and purification was performed essentially as described31. Briefly, E. coli-expressed proteins were transformed into BL21(DE3) cells and grown at 37 °C until absorbance at 600 nm (A ) of 0.8, whereupon the incubator was reduced to 18 °C. After 30 min, cultures were induced with 0.1 mM IPTG and grown overnight (16 h). Cell pellets were resuspended in standard buffer (20 mM Tris pH7.4, 150 mM NaCl, 0.5 mM TCEP) and flash frozen in liquid nitrogen. All subsequent steps performed at 4 °C or on ice. Cell pellets were resuspended in standard buffer supplemented with 1 mM MgCl for GTPases, and protease inhibitor cocktail (chymostatin 6 μg/ml, leupeptin 0.5 μg/ml, antipain-HCl 10 μg/ml, aprotinin 2 μg/ml, pepstatin 0.7 μg/ml, APMSF 10 μg/ml), homogenized and lysed by sonication. Histidine-tagged proteins were bound in batch to Ni-NTA resin in the presence of 20 mM imidazole, and eluted with 200 mM imidazole. GST-tagged proteins were purified on GS resin (GS-4B, GE Healthcare) by binding for 2 h followed by stringent washing, and cleavage from resin overnight. Imidazole-containing samples were immediately diluted after elution and tags cleaved during overnight dialysis. Following dialysis and tag cleavage, samples were concentrated and TEV or HRV 3C protease was removed by reverse purification through Ni-NTA or GS resin. Samples were then purified by size-exclusion chromatography on Superdex 200 columns in standard buffer. Human EEA1 was purified as a GST fusion in a pOEM series vector (Oxford Expression Technologies) modified to contain a HRV 3C-cleavable N-terminal GST and protease cleavage site or from a modified pFastbac1 vector (Thermo Fisher Scientific)23. Some samples were also purified as 6×His-MBP and 10×His fusions from a modified pOEM vector (rotary shadowing for N-to-C terminus alignment, and optical tweezer control, respectively; all other experiments performed with tags removed). Mutants were purified identically to wild-type EEA1. SF9 cells growing in ESF921 media (Expression Systems) were co-transfected with linearized viral genome and the expression plasmid and selected for high infectivity. P1 and P2 virus was generated according to the manufacturer’s protocol, and expression screens and time courses performed to optimize expression yield. Best viruses were used to infect 1–2 l SF9 cells at 106 cells/ml at 1% vol/vol and routinely harvested after 40–48 h at about 1.5 × 106 cells/ml, suspended in standard buffer and flash frozen in liquid nitrogen. Pellets were thawed on ice and lysed by Dounce homogenizer. Purification took place rapidly in standard buffer at 4 °C on GS resin in batch format. Bound protein was washed thoroughly and cleaved from resin by HRV 3C protease overnight. Proteins retaining 6×His-MBP tags were purified on amylose resin and eluted with 10 mM maltose. Protein retaining 10×His were eluted from Ni-NTA resin in standard buffer supplemented with 200 mM imidazole. All EEA1 and mutants were immediately further purified by Superose 6 size-exclusion chromatography where they eluted as a single peak. All experiments were performed with a preparation confirmed for Rab5 and PI(3)P binding. Concentrations were determined by UV280 and Bradford assay. All proteins were aliquoted and flash frozen in liquid nitrogen and stored at −80 °C. EEA1 variants extended and swapped were synthesized genes optimized for insect cell expression (Genscript). The extended mutant has regions of low coiled-coil prediction removed, resulting in an EEA1 construct 1,286 amino acids in length (versus 1,411 in wild-type EEA1) (see Extended Data Fig. 3). The swapped mutant has the C-terminal portion of the coiled-coil rearranged to follow the N-terminal Zn2+-finger domains, and the N-terminal portion of the coiled-coil therefore rearranged to the C-terminal region of EEA1. Variants were treated identically to wild-type EEA1 in purification. An autosampler equipped Viskotek TDAMax system was used to analyse the light-scattering from purified EEA1. Sample was loaded the autosampler and passed through a TSKGel G5000PW column (Tosoh Biosciences) and fractions were subjected to scattering data acquisition. Data obtained were averaged across the protein elution volume and molecular masses determined in OmniSEC software package. The following lipids were purchased and used directly: DOPC, DOPS, DOGS-NiNTA, RhoDPPE (Avanti), DiD (Invitrogen) and PI(3)P (Echelon Biosciences). Lipids were dissolved in chloroform, except PI(3)P in 1:2:0.8 CHCl :MeOH:H O. All were stored at −80 °C. Early endosome fusion assay was performed as previously described32. To assess the ability of EEA1 to bind competently in a GTP-dependent manner to Rab5, Rab5 was bound to GS resin and subsequently loaded with nucleotide (GDP, GTP-γS) as previously described6. Binding of EEA1 and all variants to immobilized Rab5 proceeded for1 h at room temperature, and the washed Rab5 resin was evaluated for EEA1 binding by western blot. Similarly, the binding of EEA1 to PI(3)P containing liposomes was evaluated as previously described by formation of liposomes composed of DOPC:DOPS or DOPC:DOPS:PI(3)P (85:15 or 80:15:5 respectively)33. Briefly, liposomes were formed from the hydration of lipids at 1 mM in standard buffer, and combined with EEA1 for 1 h before ultracentrifugation to separate supernatant and pellet for western blotting to evaluate EEA1 sedimentation. Rabbit anti-EEA1 antibody was made in our laboratory. Liposomes were formed by extrusion as previously described34. Liposome compositions for fluorescence microscopy tethering assays were DOPC:DOPS:DOGS-NiNTA, DOPC:DOPS:PI(3)P, DOPC:DOPS:biotin-DPPE, with RhoDPPE and DiD where applicable. Liposome compositions for bead-supported membranes were DOPC:DOPS:DOGS-NiNTA, DOPC:DOPS:PI(3)P. Solvent was evaporated under nitrogen and vacuum overnight. The resulting residue was suspended in standard buffer, rapidly vortexed, freeze-thawed five times by submersion in liquid N2 followed by water at 40 °C, and extruded by 11 passes through two polycarbonate membranes with a pore diameter of 100 nm (Avestin). Vesicles stored at 4 °C were used within 5 days. Silica beads (2 μm NIST-traceable size-standards for optical tweezers, or 10 μm standard microspheres for microscopy; Corpuscular) were thoroughly cleaned in pure ethanol and Hellmanex (1% sol., Hellma Analytics) before storage in water. Supported bilayers were formed as previously described with modifications35. Liposomes composed of DOPC:DOPS 85:15 (with 5% PI(3)P and DOGS-NiNTA where applicable) were added to a solution containing 250 mM NaCl for tethering assays (10 μm) and 100 mM for optical tweezers (2 μm), and 5 × 106 beads. Liposomes were added to final concentration of 100 μM and incubated for 30 min (final volume 100 μl). Samples were washed with 20 mM Tris pH7.4 three times by addition of 1 ml followed by gentle centrifugation (at 380g). Final wash was with standard buffer. Salt concentrations were optimized by examination of homogeneity at the transverse plane followed by examination of the excess membrane at the coverslip plane (see Extended Data Fig. 2a–d). We found that the membranes were extremely robust in conditions where the bilayer is fully formed, and could be readily pipetted and washed, consistent with previous reports36. Membrane-coated beads were used within 1 h of production and always stored before use on a rotary suspension mixer. Glass coverslips were cleaned in ethanol, Hellmanex and thoroughly rinsed in water. In these experiments, the following concentrations were used: 1 nM Rabex-5 (131–394), 100 nM Rab5-6×His, 120 nM EEA1. Experiments were performed in standard buffer with 5 mM MgCl and 1 μM nucleotide. Liposomes and proteins were pre-mixed in low-binding tubes at concentrations indicated, incubated for 5 min and imaged immediately upon addition to the coverslip. Images were acquired with a Nikon TiE equipped with a 60× plan-apochromat 1.2 numerical aperture W objective and Yokagawa CSU-X1 scan head. Images were acquired on an Andor DU-897 back-illuminated CCD. Acquired images were processed by the SQUASH package for Fiji37. A 200 μl observation chamber (μ-Slide 8 well, uncoated, #1.5, ibidi) was pre-blocked with BSA (1 mg/ml in standard buffer) for 1.5–2 h and washed thoroughly. Finally, 180 μl of standard buffer containing beads was added to the sample chamber. In these experiments, the following concentrations were used: 1 nM Rabex-5 (131–394), 100 nM GFP–Rab5-6×His, and the given EEA1 concentrations (between 30 and 400 nM). Nucleotide control experiments were performed at 190 nM EEA1. Experiments were performed in standard buffer with 2 mM MgCl and 1 mM nucleotide. Altogether Rab5, Rabex5, nucleotide, EEA1 and buffer were mixed in low-binding tubes at concentrations indicated, and were added to 240 μl final volume to assure mixing throughout the chamber volume. Images for co-localization analysis were acquired with a Nikon TiE equipped with a 60× plan-apochromat 1.2 numerical aperture W objective and Yokagawa CSU-X1 scan head. Images were acquired on an Andor DU-897 back-illuminated CCD. Acquired images were processed by the SQUASH package for Fiji37. Data obtained for distance measurements were acquired in the same way and processed in Fiji by determining line profiles eight pixels wide from the centre of the bead outwards over an observed vesicle. These profiles were fitted with a Gaussian distribution. The alignment of the microscope was confirmed by imaging of sub-diffraction beads, revealing no clear systematic shift and a maximum positional error of 21 nm determined in Motion Tracking16. Controls with sub-diffraction-sized multicolour particles (Methods) and distance measurements between Rab5 itself and its resident membrane were within the measurement error of the technique (approximately 15 nm)38. HeLa cells were stained using primary antibodies against EEA1 N terminus (610457, prepared in mouse, BD Biosciences) and EEA1 C terminus (2900, prepared in rabbit, Abcam). The secondary antibodies were anti-mouse Alexa568 antibody (A-11004, prepared in goat, Life Technologies) and anti-rabbit Alexa647 (A-21244, prepared in goat, Life Technologies). Coverslips were mounted in STORM buffer (100 mM Tris-HCl pH8.7, 10 mM NaCl, 10% glucose, 15% glycerol, 0.5 mg/ml glucose oxidase, 40 μg/ml catalase, 1% BME) and sealed with nail polish. Cells were imaged on a Zeiss Eclipse Ti microscope equipped with a 150 mW 561 nm laser and a 300 mW 647 laser. For imaging, lasers intensities were set to achieve 50 mW at the rear lens of the objective. Illumination was applied at a sub-TIRF angle through the objective to improve the signal to noise ratio. Videos of 24,000 frames (12,000 frames per channel) were acquired by groups of 6 consecutive frames using the NIS Elements software (Nikon). Images were aligned using 100 nm Tetraspeck beads (Thermo Fisher). This software was also used for peak detection and image reconstruction. The localization of the EEA1 termini could be distorted a maximum of approximately 20 nm owing to the size of the antibodies. The localization accuracy of the secondary antibody was ~25 nm. Measured distances were determined in Fiji and represent distances between respective centres-of-mass. Representative experiment is shown, n = 3. Bead-supported membranes were prepared as described. The concentrations used were as in the microscopy experiments: 1 nM Rabex-5 (131–394), 100 nM Rab5-6×His and EEA1 concentrations (between 30 and 400 nM). Most experiments were performed at 40 nM EEA1, with additional trials taking place at 4 and 400 nM. At lowest concentrations, single transient events became difficult to observe (<5% had interactions). At the highest concentrations, events were often non-transient or repeated. Samples were rotary-shadowed essentially as described39. Briefly, samples were diluted in a spraying buffer, consisting of 100 mM ammonium acetate and 30% glycerol. Diluted samples were sprayed via a capillary onto freshly cleaved mica chips. These mica chips were mounted in the high vacuum evaporator (MED 020, Baltec) and dried. Specimens were platinum coated (5–7.5 nm) and carbon was evaporated. Following deposition, the replica was floated off and examined at 71,000× magnification and imaged onto a CCD (Morgagni 268D, FEI; Morada G2, Olympus). Images obtained were processed in ImageJ by skeletonizing the particles. Lengths were determined directly from these data and represent an overestimation due to the granularity of the platinum shadowing (5–7.5 nm granules). The bouquet plots were generated by aligning the initial five segments of the molecules and the entire population set was plotted. To determine the curvature measure, we first took the skeletonized curves and smoothed them with a window of 8.2 nm. These curves were then segmented with 301 equally spaced points, and these smoothed curves were used for the curvature calculation. We first attempted to define curvature at one segment length (~0.75 nm) but this analysis was too noisy to obtain meaningful description of the curves. We therefore determined the curvature by taking the difference of the tangents and diving it by the arc length at a distance of ~15 nm (20 points). The variance of this measure was determined, and bootstrapping with resampling was used to determine errors over the whole population and for 1,000 iterations. Although proteins are not homogeneous polymers, the WLC model captures essential aspects of the physics underlying their shape fluctuations40, 41. Calculation of fits to all mean tangent-correlations and the equilibration analysis were performed using Easyworm source code in Matlab42. First, the original skeletonized curves were segmented with 301 equally spaced points. These data were then used to calculate the tangent-correlations and the kurtosis plots. We fitted the regime whereby the kurtosis measurement defined that the molecules were equilibrated18, 43, 44. This distance therefore varied (see Extended Data Fig. 6, kurtosis plots), but the estimation of persistence length was only weakly dependent on this distance. The fitting routines were then implemented up to the thermal equilibration distance with bootstrapping with resampling, which was run for the whole population and 1,000 times to obtain errors. These are given as mean ± standard deviation. For values and fit statistics, please refer to Supplementary Data Table. We did not apply the WLC model to the swapped mutant (Extended Data Fig. 4h) because of the lack of significant structural changes upon Rab5 binding (Fig. 2f and Extended Data Fig. 4f). The analytical fitting to the radial distribution functions was performed in Python18. The radial distribution function for a worm-like chain is the probability density for finding the end points of the polymer. The polymers are considered as embedded in a two-dimensional space in this scheme. This treatment adopts the continuum model of the polymer, thereby defining the statistical properties via free energy calculation. Fitting to analytical solution of the WLC yielded a mean effective persistence length of 270 ± 14 nm for EEA1 alone (mean ± error of fit), and two populations of effective persistence lengths (26 ± 2 nm (67%) and 300 ± 14 nm (33%)) for EEA1 in the presence of Rab5:GTP-γS. A custom-built high-resolution dual-trap optical tweezer microscope was used45, 46. A single stable solid-state laser (Spectra-Physics, 5 W) was split by polarization into two traps that could be independently manoeuvred. Forces were measured independently in both traps by back-focal plane interferometry. Absolute distances between the two traps were determined by template-based video microscopy analysis (43 ± 2 nm per pixel) and offset-corrected for each microsphere pair by repeatedly contacting the microspheres after each experiment. The template detection algorithm had subpixel accuracy, at an estimated uncertainty in absolute distance measurements to be not more than ± 20 nm. Bead displacement was calculated according to ΔF = −κΔy. Extended Data Fig. 7g demonstrates the sensitivity of the instrument via the Allan deviation47 for averaging times greater than 100 ms. All optical tweezer experiments were performed with 2 μm silica size-standard microspheres (Corpuscular), at a temperature of 26 ± 2 °C in a laminar flow chamber with buffers containing 35% glycerol to prevent sedimentation of the silica microspheres. Thermal calibration of the optical traps was performed with the power spectrum method using a dynamic viscosity of 3.1 mPas (ref. 48) (mean trap stiffness: trap 1, κ  = 0.035 ± 0.007 pN/nm; trap 2, κ  = 0.029 ± 0.007 pN/nm), leading to an overall trap stiffness of κ  = 0.0159 pN/nm (yellow response curve in Extended Data Fig. 7h). Data were acquired at 1 kHz and further processed using custom-written software in R. Spurious electronic noise at 50 Hz was filtered using a fifth-order Butterworth notch filter from 49 to 51 Hz. For probing the interactions of EEA1 with Rab5 without any assumptions on the shape of EEA1, a distance agnostic protocol with consecutive cycles of approaching, waiting (20 s) and retraction was used, approaching closer in each iteration (Fig. 3b). The stationary segments were then subjected to automatic change-point analysis to identify regions of the time series longer than 100 ms with significantly different mean and variance49. Events thus identified were classified as transient if the mean and variance went back to base levels within the stationary segment (see examples in force traces in Fig. 3c and Extended Data Fig. 7). Mean times of interactions were 3.4 ± 0.6 s for GTP-γS and 0.9 ± 0.2 s for GTP. A fluctuation analysis of the differential distance signal during these events gave an estimated tether misalignment of less than 30° in all interactions50. Only transient events were further processed. Silica beads alone as a negative control measured a mean contact distance of 22 nm (Fig. 3d, grey). To calculate the persistence length for individual captured molecules we determined the equilibrium extension, z , from the capture distance D (nm), the average measured force increase upon tethering ΔF (pN) and the known displacements from each trap Δx  = ΔF/κ and Δx  = ΔF/κ as z  = D − Δx  − Δx . With this distance, the persistence length was calculated according to51 Similarly, to estimate the magnitude of the entropic collapse force, this formula was applied to the equilibrium extensions of EEA1, as estimated by the end-to-end distances of the molecules from electron microscopy. Values determined were (median and bounds at (2.5%, 97.5%)) EEA1, 23 (14, 33) nm; extended, 73 (60, 88) nm; swapped, 26 (21, 30) nm; 10×His, 78 (35, 140) nm. Values reported are medians and 95% confidence intervals determined from bootstrapping. HeLa EEA1-KO lines were generated using CRISPR-Cas9 technology52 on HeLa-Kyoto cell lines obtained from the BAC recombineering facility at the Max Planck Institute of Molecular Cell Biology and Genetics. Cell lines were tested for mycoplasma and authenticated (Multiplexion, Heidelberg). pSpCas9(BB-2A–GFP (PX458) and pSpCas9(BB)-2A-Puro (PX459) were a gift from F. Zhang (Addgene plasmid 48138, 48139). A PX458 plasmid encoding a GFP–labelled Cas9 nuclease and the sgRNA sequence (from GECKO52 library 17446, GTGGTTAAACCATGTTAAGG, targeting first exon) was transfected into standard HeLa Kyoto cells with Lipofectamine 2000 following the manufacturer’s instructions. Cells were cultured in DMEM media supplemented with 10% FBS and 1% penicillin-streptomycin at 37 °C and 5% CO . After 3 days, the transfected cells were FACS sorted by their GFP fluorescence into 96-well plates to obtain single clones and visually inspected53. These clones were then screened by western blotting and in-del formation confirmed sequencing of genomic DNA (primer forward, AGCGGCCGTCGCCACCG; reverse, TAAGCGCCTGCCGGGCTG). Note the region is extremely GC-rich (75%, ± 250 nt from targeted indel region). Additionally, a mixed-clonal line was obtained by transfection of HeLa Kyoto with PX459 with the above sgRNA sequence. After 72 h from transfection, cells were exchanged into media supplemented with 0.5 μg/ml puromycin (concentration determined in separated experiment) and selected for 3 days. All imaging experiments were confirmed on this secondary line. Wild-type EEA1 and the extended and swapped variants (Extended Data Fig. 3) were cloned into customized mammalian expression plasmids under the CMV promoter resulting in untagged proteins. HeLa or HeLa EEA1-KO cells were seeded into 96-well plates and transfected (or mock transfected) after 48 h. Following 48 h after transfection, cells were exchanged into serum-free media containing 8.2 μg/ml LDL-Alexa 488 (prepared as previously described16) or 100 ng/ml EGF-Alexa 488 (E13345, Thermo Fisher) for 10 min at 37 °C, and washed in PBS then fixed in 4% paraformaldehyde. Fixed cells were stained with antibodies against EEA1 (laboratory-made rabbit) and Rab5 (610724, prepared in mouse, BD Biosciences) as previously described24. DAPI was used to stain the nuclei. Not all early endosomes harbour EEA1 (ref. 54) and other tethering factors could compensate for EEA1 (refs 24, 55). All imaging was performed on a Yokogawa CV7000 s automated spinning disc confocal using a 60× 1.2 numerical aperture objective. Fifteen images were acquired per well and each condition was duplicated at least twice per plate, resulting in 30 or more images per condition. Image analysis used home-made software, MotionTracking, as previously described56, 57. Images were first corrected for illumination, chromatic aberration and physical shift using multicolour beads. All cells, nuclei and cell objects in corrected images were then segmented and their size, content and complexity calculated. The intensity of EEA1 in wild-type HeLa cells was measured to determine a wild-type intensity distribution. In the rescue experiments, an intensity threshold for the transfections was set at about two times the mean of wild-type cells (Extended Data Fig. 8i). Experiments were repeated at different seeding densities with similar results. Given a cell density threshold between 10 and 100 per image, we obtained an average of more than 300 cells per condition after filtering for the transfection level of EEA1, and more than 15,000 endosomes per experiment. A two-tailed t-test was used for significance calculations. Cells in 3 cm diameter plastic dishes were processed for electron microscopy using a method58 to provide particularly heavy staining of cellular components. Briefly, cells were fixed by addition of 2.5% glutaraldehyde in PBS for 1 h at room temperature and then washed with PBS. The cells were then processed as described58 with sequential incubations in solutions containing potassium ferricyanide/osmium tetroxide, thiocarbohydrazide, osmium tetroxide, uranyl acetate and lead nitrate in aspartic acid before dehydration and flat embedding in resin. Sections were cut parallel to the substratum and analysed unstained in a JEOL 1011 transmission electron microscope (Tokyo, Japan). Images for quantitation were collected from coded samples (double blind) to avoid bias. Distance analysis used ImageJ. To correct for thickness of slices (60 nm), the following equation was used: where P (r) is the apparent 2D distance distribution, R is the 3D distance, H is the thickness of the slice and Z is the normalization constant. Uncorrected distance was measured at 119.8 ± 78.2 nm (mean ± s.d.), which resulted in 130.0 ± 76.8 nm corrected.


News Article
Site: http://www.nature.com/nature/current_issue/

Human ES cell line H9 (WA-09) and derivatives (SOX10::GFP; SYN::ChR2-EYFP; SYN::EYFP;PHOX2B:GFP;EF1::RFP Ednrb−/−) as well as two independent human iPS cell lines (healthy and familial dysautonomia, Sendai-based, OMSK (Cytotune)) were maintained on mouse embryonic fibroblasts (Global Stem) in knockout serum replacement (KSR; Life Technologies, 10828-028) containing human ES cell medium as described previously7. Cells were subjected to mycoplasma testing at monthly intervals and short tandem repeats (STR) profiled to confirm cell identity at the initiation of the study. Human ES cells were plated on matrigel (BD Biosciences, 354234)-coated dishes (105 cells cm−2) in ES cell medium containing 10 nM FGF2 (R&D Systems, 233-FB-001MG/CF). Differentiation was initiated in KSR medium (knockout DMEM plus 15% KSR (Life Technologies, 10828-028), l-glutamine (Life Technologies, 25030-081), NEAA (Life Technologies, 11140-050)) containing LDN193189 (100 nM, Stemgent) and SB431542 (10 μM, Tocris). The KSR medium was gradually replaced with increasing amounts of N2 medium from day 4 to day 10 as described previously7. For CNC induction, cells were treated with 3 μM CHIR99021 (Tocris Bioscience, 4423) in addition to LDN193189 and SB431542 from day 2 to day 11. ENC differentiation involves additional treatment with retinoic acid (1 μM) from day 6 to day 11. For deriving MNCs, LDN193189 is replaced with BMP4 (10 nM, R&D, 314-BP) and EDN3 (10 nM, American Peptide company, 88-5-10B) from day 6 to day 11 (ref. 3). The differentiated cells are sorted for CD49D at day 11. CNS precursor control cells were generated by treatment with LDN193189 and SB431542 from day 0 to day 11 as previously described7. Throughout the manuscript, day 0 is the day the medium is switched from human ES cell medium to LDN193189 and SB431542 containing medium. Days of differentiation in text and figures refer to the number of days since the pluripotent stage (day 0). For immunofluorescence, the cells were fixed with 4% paraformaldehyde (Affymetrix-USB, 19943) for 20 min, then blocked and permeabilized using 1% bovine serum albumin (BSA) (Thermo Scientific, 23209) and 0.3% Triton X-100 (Sigma, T8787). The cells were then incubated in primary antibody solutions overnight at 4 °C and stained with fluorophore-conjugated secondary antibodies at room temperature for 1 h. The stained cells were then incubated with DAPI (1 ng ml−1, Sigma, D9542-5MG) and washed several times before imaging. For flow cytometry analysis, the cells are dissociated with Accutase (Innovative Cell Technologies, AT104) and fixed and permeabilized using BD Cytofix/Cytoperm (BD Bioscience, 554722) solution, then washed, blocked and permeabilized using BD Perm/Wash buffer (BD Bioscience, 554723) according to manufacturer’s instructions. The cells are then stained with primary (overnight at 4 °C) and secondary (30 min at room temperature) antibodies and analysed using a flow Cytometer (Flowjo software). A list of primary antibodies and working dilutions is provided in Supplementary Table 4. The PHOX2A antibody was provided by J.-F. Brunet (rabbit, 1:800 dilution). Fertilized eggs (from Charles River Farms) were incubated at 37 °C for 50 h before injections. A total of 2 × 105 CD49D-sorted, RFP-labelled NC cells were injected into the intersomitic space of the vagal region of the embryos targeting a region between somite 2 and 6 (HH 14 embryo, 20–25 somite stage). The embryos were collected 36 h later for whole-mount epifluorescence and histological analyses. For RNA sequencing, total RNA was extracted using RNeasy RNA purification kit (Qiagen, 74106). For qRT–PCR assay, total RNA samples were reverse transcribed to cDNA using Superscript II Reverse Transcriptase (Life Technologies, 18064-014). qRT–PCR reactions were set up using QuantiTect SYBR Green PCR mix (Qiagen, 204148). Each data point represents three independent biological replicates. ENC cells from the 11-day induction protocol were aggregated into 3D spheroids (5 million cells per well) in Ultra Low Attachment 6-well culture plates (Fisher Scientific, 3471) and cultured in Neurobasal (NB) medium supplemented with l-glutamine (Gibco, 25030-164), N2 (Stem Cell Technologies, 07156) and B27 (Life Technologies, 17504044) containing CHIR99021 (3 μM, Tocris Bioscience, 4423) and FGF2 (10 nM, R&D Systems, 233-FB-001MG/CF). After 4 days of suspension culture, the spheroids are plated on poly-ornithine/laminin/fibronectin (PO/LM/FN)-coated dishes (prepared as described previously26) in neurobasal (NB) medium supplemented with l-glutamine (Gibco, 25030-164), N2 (Stem Cell Technologies, 07156) and B27 (Life Technologies, 17504044) containing GDNF (25 ng ml−1, Peprotech, 450-10) and ascorbic acid (100 μM, Sigma, A8960-5G). The ENC precursors migrate out of the plated spheroids and differentiate into neurons in 1–2 weeks. The cells were fixed for immunostaining or collected for gene expression analysis at days 25, 40 and 60 of differentiation. Mesoderm specification is carried out in STEMPRO-34 (Gibco, 10639-011) medium. The ES cells are subjected to activin A treatment (100 ng ml−1, R&D, 338-AC-010) for 24 h followed by BMP4 treatment (10 ng ml−1, R&D, 314-BP) for 4 days9. The cells are then differentiated into SMC progenitors by treatment with PDGF-BB (5 ng ml−1, Peprotech, 100-14B), TGFb3 (5 ng ml−1, R&D systems, 243-B3-200) and 10% FBS. The SMC progenitors are expandable in DMEM supplemented with 10% FBS. The SMC progenitors were plated on PO/LM/FN-coated culture dishes (prepared as described previously26) 3 days before addition of ENC-derived neurons. The neurons were dissociated (using accutase, Innovative Cell Technologies, AT104) at day 30 of differentiation and plated onto the SMC monolayer cultures. The culture is maintained in neurobasal (NB) medium supplemented with l-glutamine (Gibco, 25030-164), N2 (Stem Cell Technologies, 07156) and B27 (Life Technologies, 17504044) containing GDNF (25 ng ml−1, Peprotech, 450-10) and ascorbic acid (100 μM, Sigma, A8960-5G). Functional connectivity was assessed at 8–16 weeks of co-culture. SMC-only and SMC-ENC-derived neuron co-cultures were subjected to acetylcholine chloride (50 μM, Sigma, A6625), carbamoylcholine chloride (10 μM, Sigma,C4382) and KCl (55 mM, Fisher Scientific, BP366–500) treatment, 3 months after initiating the co-culture. Optogenetic stimulations were performed using a 450-nm pigtailed diode pumped solid state laser (OEM Laser, PSU-III LED, OEM Laser Systems, Inc.) achieving an illumination between 2 and 4 mW mm−2. The pulse width was 4 ms and stimulation frequencies ranged from 2 to 10 Hz. For the quantification of movement, images were assembled into a stack using Metamorph software and regions with high contrast were identified (labelled yellow in Supplementary Fig. 5). The movement of five representative high-contrast regions per field was automatically traced (Metamorph software). Data are presented in kinetograms as movement in pixels in x and y direction (distance) with respect to the previous frame. We used the previously described method for generation of tissue-engineered colon11. In brief, the donor colon tissue was collected and digested into organoid units using dispase (Life Technologies, 17105-041) and collagenase type 1 (Worthington, CLS-1). The organoid units were then mixed immediately (without any in vitro culture) with CD49D-purified human ES-cell-derived ENC precursors (day 15 of differentiation) and seeded onto biodegradable polyglycolic acid scaffolds (2-mm sheet thickness, 60 mg cm−3 bulk density; porosity >95%, Concordia Fibres) shaped into 2 mm long tubes with poly-l lactide (PLLA) (Durect Corporation). The seeded scaffolds were then placed onto and wrapped in the greater omentum of the adult (>2 months old) NSG mice. Just before the implantation, these mice were irradiated with 350 cGy. The seeded scaffolds were differentiated into colon-like structures inside the omentum for 4 additional weeks before they were surgically removed for tissue analysis. All mouse procedures were performed following NIH guidelines, and were approved by the local Institutional Animal Care and Use Committee (IACUC), the Institutional Biosafety Committee (IBC) as well as the Embryonic Stem Cell Research Committee (ESCRO). We used 3–6-week-old male NSG (NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ) mice or 2–3-week-old Ednrbs-l/s-l (SSL/LeJ) mice27 (n = 12, 6 male, 6 female) for these studies. Animal numbers were based on availability of homozygous hosts and on sufficient statistical power to detect large effects between treatment versus control (Ednrbs-l/s-l) as well as for demonstrating robustness of migration behaviour (NSG). Animals were randomly selected for the various treatment models (NSG and Ednrbs-l/s-l) but assuring for equal distribution of male/female ratio in each group (Ednrbs-l/s-l). All in vivo experiments were performed in a blinded manner. Animals were anaesthetized with isoflurane (1%) throughout the procedure, a small abdominal incision was made, abdominal wall musculature lifted and the caecum is exposed and exteriorized. Warm saline is used to keep the caecum moist. Then 20 μl of cell suspension (2–4 million RFP+ CD49D-purified human ES-cell-derived ENC precursors) in 70% Matrigel (BD Biosciences, 354234) in PBS or 20 μl of 70% Matrigel in PBS only (control-grafted animals) were slowly injected into the caecum (targeting the muscle layer) using a 27-gauge needle. Use of 70% matrigel as carrier for cell injection assured that the cells stayed in place after the injection and prevented backflow into the peritoneum. After injection that needle was withdrawn, and a Q-tip was placed over the injection site for 30 s to prevent bleeding. The caecum was returned to the abdominal cavity and the abdominal wall was closed using 4-0 vicryl and a taper needle in an interrupted suture pattern and the skin was closed using sterile wound clips. After wound closure animals were put on paper on top of their bedding and attended until conscious and preferably eating and drinking. The tissue was collected at different time points (ranging from two weeks to four months) after transplantation for histological analysis. Ednrbs-l/s-l mice were immunosuppressed by daily injections of cyclosporine (10 mg kg−1 i.p, Sigma, 30024). The collected colon samples were fixed in 4% paraformaldehyde at 4 °C overnight before imaging. Imaging is performed using Maestro fluorescence imaging system (Cambridge Research and Instrumentation). The tissue samples were incubated in 30% sucrose (Fisher Scientific, BP220-1) solutions at 4 °C for 2 days, and then embedded in OCT (Fisher Scientific, NC9638938) and cryosectioned. The sections were then blocked with 1% BSA (Thermo Scientific, 23209) and permeabilized with 0.3% Triton X-100 (Sigma, T8787). The sections are then stained with primary antibody solution at 4 °C overnight and fluorophore-conjugated secondary antibody solutions at room temperature for 30 min. The stained sectioned were then incubated with DAPI (1 ng ml−1, Sigma, D9542-5MG) and washed several times before they were mounted with Vectashield Mounting Medium (vector, H1200) and imaged using fluorescent (Olympus IX70) or confocal microscopes (Zeiss SP5). Mice are gavaged with 0.3 ml of dye solution containing 6% carmine (Sigma, C1022-5G), 0.5% methylcellulose (Sigma, 274429-5G) and 0.9 NaCl, using a #24 round-tip feeding needle. The needle was held inside the mouse oesophagus for a few seconds after gavage to prevent regurgitation. After 1 h, the stool colour was monitored for gavaged mice every 10 min. For each mouse, total gastrointestinal transit time is between the time of gavage and the time when red stool is observed. The double nickase CRISPR/Cas9 system28 was used to target the EDNRB locus in EF1–RFP H9 human ES cells. Two guide RNAs were designed (using the CRISPR design tool; http://crispr.mit.edu/) to target the coding sequence with PAM targets ~20 base pairs apart (qRNA #1 target specific sequence: 5′-AAGTCTGTGCGGACGCGCCCTGG-3′, RNA #2 target specific sequence: 5′-CCAGATCCGCGACAGGCCGCAGG-3′). The cells were transfected with guide RNA constructs and GFP-fused Cas9-D10A nickase. The GFP-expressing cells were FACS purified 24 h later and plated in low density (150 cells cm−2) on mouse embryonic fibroblasts. The colonies were picked 7 days later and passaged twice before genomic DNA isolation and screening. The targeted region of EDNRB gene was PCR amplified (forward primer: 5′-ACGCCTTCTGGAGCAGGTAG-3′, reverse primer: 5′-GTCAGGCGGGAAGCCTCTCT-3′) and cloned into Zero Blunt TOPO vector (Invitrogen, 450245). To ensure that both alleles (from each ES cell colony) are represented and sequenced, we picked 10 bacterial clones (for each ES cell clone) for plasmid purification and subsequent sequencing. The clones with bi-allelic nonsense mutations were expanded and differentiated for follow-up assays. The ENC cells are plated on PO/LM/FN coated (prepared as described previously26) 96-well or 48-well culture plates (30,000 cm−2). After 24 h, the culture lawn is scratched manually using a pipette tip. The cells are given an additional 24–48 h to migrate into the scratch area and fixed for imaging and quantification. The quantification is based on the percentage of the nuclei that are located in the scratch area after the migration period. The scratch area is defined using a reference well that was fixed immediately after scratching. Migration of cells was quantified using the open source data analysis software KNIME29 (http://knime.org) with the ‘quantification in ROI’ plug-in as described in detail elsewhere30. To quantify proliferation, FACS-purified ENC cells were assayed using CyQUANT NF cell proliferation Assay Kit (Life Technologies, C35006) according to manufacturer’s instructions. In brief, to generate a standard, cells were plated at various densities and stained using the fluorescent DNA binding dye reagent. Total fluorescence intensity was then measured using a plate reader (excitation at 485 nm and emission detection at 530 nm). After determining the linear range, the CD49D+ wild-type and Ednrb−/− ENC precursors were plated (6,000 cell cm−2) and assayed at 0, 24, 48 and 72 h. The cells were cultured in neurobasal (NB) medium supplemented with l-glutamine (Gibco, 25030-164), N2 (Stem Cell Technologies, 07156) and B27 (Life Technologies, 17504044) containing CHIR99021 (3 μM, Tocris Bioscience, 4423) and FGF2 (10 nM, R&D Systems, 233-FB-001MG/CF) during the assay. To monitor the viability of wild-type and Ednrb−/− ENC precursors, cells were assayed for lactate dehydrogenase (LDH) activity using CytoTox 96 cytotoxicity assay kit (Promega, G1780). In brief, the cells are plated in 96-well plates at 30,000 cm−2. The supernatant and the cell lysate is collected 24 h later and assayed for LDH activity using a plate reader (490 nm absorbance). Viability is calculated by dividing the LDH signal of the lysate by total LDH signal (from lysate plus supernatant). The cells were cultured in neurobasal (NB) medium supplemented with l-glutamine (Gibco, 25030-164), N2 (Stem Cell Technologies, 07156) and B27 (Life Technologies, 17504044) containing CHIR99021 (3 μM, Tocris Bioscience, 4423) and FGF2 (10 nM, R&D Systems, 233-FB-001MG/CF) during the assay. The chemical compound screening was performed using the Prestwick Chemical Library. The ENC cells were plated in 96-well plates (30,000 cm−2) and scratched manually 24 h before addition of the compounds. The cells were treated with two concentrations of the compounds (10 μM and 1 μM). The plates were fixed 24 h later for total plate imaging. The compounds were scored based on their ability to promote filling of the scratch in 24 h. The compounds that showed toxic effects (based on marked reduction in cell numbers assessed by DAPI staining) were scored 0, compounds with no effects were scored 1, compounds with moderate effects were scored 2, and compounds with strong effects (that resulted in complete filling of the scratch area) were scored 3 and identified as hit compounds. The hits were further validated to ensure reproducibility. The cells were treated with various concentrations of the selected hit compound (pepstatin A) for dose response analysis. The optimal dose (10 μM based on optimal response and viability) was used for follow-up experiments. For the pre-treatment experiments, cells were CD49D purified at day 11 and treated with pepstatin A from day 12 to day 15 followed by transplantation into the colon wall of NSG mice. The cells were cultured in neurobasal (NB) medium supplemented with l-glutamine (Gibco, 25030-164), N2 (Stem Cell Technologies, 07156) and B27 (Life Technologies, 17504044) containing CHIR99021 (3 μM, Tocris Bioscience, 4423) and FGF2 (10 nM, R&D Systems, 233-FB-001MG/CF) during the assay. To inhibit BACE2, the ENC precursors were treated with 1 μM β-secretase inhibitor IV (CAS 797035-11-1; Calbiochem). To knockdown BACE2, cells were dissociated using accutase (Innovative Cell Technologies, AT104) and reverse-transfected (using Lipofectamine RNAiMAX-Life Technologies, 13778-150) with an siRNA pool (SMARTpool: ON-TARGETplus BACE2 siRNA, Dharmacon, L-003802-00-0005) or four different individual siRNAs (Dharmacon, LQ-003802-00-0002, 2 nmol). The knockdown was confirmed by qRT–PCR measurement of BACE2 mRNA levels in cells transfected with the BACE2 siRNAs versus the control siRNA pool (ON-TARGETplus Non-targeting Pool, Dharmacon, D-001810-10-05). The transfected cells were scratched 24 h after plating and fixed 48 h later for migration quantification. The cells were cultured in neurobasal (NB) medium supplemented with l-glutamine (Gibco, 25030-164), N2 (Stem Cell Technologies, 07156) and B27 (Life Technologies, 17504044) containing CHIR99021 (3 μM, Tocris Bioscience, 4423) and FGF2 (10 nM, R&D Systems, 233-FB-001MG/CF) during the assay. Data are presented as mean ± s.e.m. and were derived from at least three independent experiments. Data on replicates (n) is given in figure legends. Statistical analysis was performed using the Student’s t-test (comparing two groups) or ANOVA with Dunnett test (comparing multiple groups against control). Distribution of the raw data approximated normal distribution (Kolmogorov–Smirnov normality test) for data with sufficient number of replicates to test for normality. Survival analysis was performed using a log-rank (Mantel–Cox) test. Z-scores for primary hits were calculated as Z = (x − μ)/σ, in which x is the migration score value and is 3 for all hit compounds; μ is the mean migration score value, and σ is the standard deviation for all compounds and DMSO controls (n = 224).

Discover hidden collaborations